A comprehensive catalog of human KRAB-associated zinc finger genes: Insights into the evolutionary history of a large family of transcriptional repressors

PubMed Central

Huntley, Stuart; Baggott, Daniel M.; Hamilton, Aaron T.; Tran-Gyamfi, Mary; Yang, Shan; Kim, Joomyeong; Gordon, Laurie; Branscomb, Elbert; Stubbs, Lisa

2006-01-01

Krüppel-type zinc finger (ZNF) motifs are prevalent components of transcription factor proteins in all eukaryotes. KRAB-ZNF proteins, in which a potent repressor domain is attached to a tandem array of DNA-binding zinc-finger motifs, are specific to tetrapod vertebrates and represent the largest class of ZNF proteins in mammals. To define the full repertoire of human KRAB-ZNF proteins, we searched the genome sequence for key motifs and then constructed and manually curated gene models incorporating those sequences. The resulting gene catalog contains 423 KRAB-ZNF protein-coding loci, yielding alternative transcripts that altogether predict at least 742 structurally distinct proteins. Active rounds of segmental duplication, involving single genes or larger regions and including both tandem and distributed duplication events, have driven the expansion of this mammalian gene family. Comparisons between the human genes and ZNF loci mined from the draft mouse, dog, and chimpanzee genomes not only identified 103 KRAB-ZNF genes that are conserved in mammals but also highlighted a substantial level of lineage-specific change; at least 136 KRAB-ZNF coding genes are primate specific, including many recent duplicates. KRAB-ZNF genes are widely expressed and clustered genes are typically not coregulated, indicating that paralogs have evolved to fill roles in many different biological processes. To facilitate further study, we have developed a Web-based public resource with access to gene models, sequences, and other data, including visualization tools to provide genomic context and interaction with other public data sets. PMID:16606702

Tissue-Specific Profiling Reveals Transcriptome Alterations in Arabidopsis Mutants Lacking Morphological Phenotypes[C][W

PubMed Central

Simon, Marissa; Bruex, Angela; Kainkaryam, Raghunandan M.; Zheng, Xiaohua; Huang, Ling; Woolf, Peter J.; Schiefelbein, John

2013-01-01

Traditional genetic analysis relies on mutants with observable phenotypes. Mutants lacking visible abnormalities may nevertheless exhibit molecular differences useful for defining gene function. To examine this, we analyzed tissue-specific transcript profiles from Arabidopsis thaliana transcription factor gene mutants with known roles in root epidermis development, but lacking a single-gene mutant phenotype due to genetic redundancy. We discovered substantial transcriptional changes in each mutant, preferentially affecting root epidermal genes in a manner consistent with the known double mutant effects. Furthermore, comparing transcript profiles of single and double mutants, we observed remarkable variation in the sensitivity of target genes to the loss of one or both paralogous genes, including preferential effects on specific branches of the epidermal gene network, likely reflecting the pathways of paralog subfunctionalization during evolution. In addition, we analyzed the root epidermal transcriptome of the transparent testa glabra2 mutant to clarify its role in the network. These findings provide insight into the molecular basis of genetic redundancy and duplicate gene diversification at the level of a specific gene regulatory network, and they demonstrate the usefulness of tissue-specific transcript profiling to define gene function in mutants lacking informative visible changes in phenotype. PMID:24014549

Defining the Human Macula Transcriptome and Candidate Retinal Disease Genes UsingEyeSAGE

PubMed Central

Rickman, Catherine Bowes; Ebright, Jessica N.; Zavodni, Zachary J.; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P.; Wistow, Graeme; Boon, Kathy; Hauser, Michael A.

2009-01-01

Purpose To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Methods Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Results Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. Conclusions The EyeSAGE database, combining three different gene-profiling platforms including the authors’ multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions. PMID:16723438

Defining the human macula transcriptome and candidate retinal disease genes using EyeSAGE.

PubMed

Bowes Rickman, Catherine; Ebright, Jessica N; Zavodni, Zachary J; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P; Wistow, Graeme; Boon, Kathy; Hauser, Michael A

2006-06-01

To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. The EyeSAGE database, combining three different gene-profiling platforms including the authors' multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions.

Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sternberg, E.A.; Spizz, G.; Perry, W.M.

1988-07-01

Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

PubMed

Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

2005-05-18

To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

Epigenetic determinants of ovarian clear cell carcinoma biology

PubMed Central

Yamaguchi, Ken; Huang, Zhiqing; Matsumura, Noriomi; Mandai, Masaki; Okamoto, Takako; Baba, Tsukasa; Konishi, Ikuo; Berchuck, Andrew; Murphy, Susan K.

2015-01-01

Targeted approaches have revealed frequent epigenetic alterations in ovarian cancer, but the scope and relation of these changes to histologic subtype of disease is unclear. Genome-wide methylation and expression data for 14 clear cell carcinoma (CCC), 32 non-CCC, and 4 corresponding normal cell lines were generated to determine how methylation profiles differ between cells of different histological derivations of ovarian cancer. Consensus clustering showed that CCC is epigenetically distinct. Inverse relationships between expression and methylation in CCC were identified, suggesting functional regulation by methylation, and included 22 hypomethylated (UM) genes and 276 hypermethylated (HM) genes. Categorical and pathway analyses indicated that the CCC-specific UM genes were involved in response to stress and many contain hepatocyte nuclear factor (HNF) 1 binding sites, while the CCC-specific HM genes included members of the estrogen receptor alpha (ERalpha) network and genes involved in tumor development. We independently validated the methylation status of 17 of these pathway-specific genes, and confirmed increased expression of HNF1 network genes and repression of ERalpha pathway genes in CCC cell lines and primary cancer tissues relative to non-CCC specimens. Treatment of three CCC cell lines with the demethylating agent Decitabine significantly induced expression for all five genes analyzed. Coordinate changes in pathway expression were confirmed using two primary ovarian cancer datasets (p<0.0001 for both). Our results suggest that methylation regulates specific pathways and biological functions in CCC, with hypomethylation influencing the characteristic biology of the disease while hypermethylation contributes to the carcinogenic process. PMID:24382740

The landscape of genomic imprinting across diverse adult human tissues

PubMed Central

Baran, Yael; Subramaniam, Meena; Biton, Anne; Tukiainen, Taru; Tsang, Emily K.; Rivas, Manuel A.; Pirinen, Matti; Gutierrez-Arcelus, Maria; Smith, Kevin S.; Kukurba, Kim R.; Zhang, Rui; Eng, Celeste; Torgerson, Dara G.; Urbanek, Cydney; Li, Jin Billy; Rodriguez-Santana, Jose R.; Burchard, Esteban G.; Seibold, Max A.; MacArthur, Daniel G.; Montgomery, Stephen B.; Zaitlen, Noah A.; Lappalainen, Tuuli

2015-01-01

Genomic imprinting is an important regulatory mechanism that silences one of the parental copies of a gene. To systematically characterize this phenomenon, we analyze tissue specificity of imprinting from allelic expression data in 1582 primary tissue samples from 178 individuals from the Genotype-Tissue Expression (GTEx) project. We characterize imprinting in 42 genes, including both novel and previously identified genes. Tissue specificity of imprinting is widespread, and gender-specific effects are revealed in a small number of genes in muscle with stronger imprinting in males. IGF2 shows maternal expression in the brain instead of the canonical paternal expression elsewhere. Imprinting appears to have only a subtle impact on tissue-specific expression levels, with genes lacking a systematic expression difference between tissues with imprinted and biallelic expression. In summary, our systematic characterization of imprinting in adult tissues highlights variation in imprinting between genes, individuals, and tissues. PMID:25953952

A novel non prophage(-like) gene-intervening element within gerE that is reconstituted during sporulation in Bacillus cereus ATCC10987.

PubMed

Abe, Kimihiro; Shimizu, Shin-Ya; Tsuda, Shuhei; Sato, Tsutomu

2017-09-12

Gene rearrangement is a widely-shared phenomenon in spore forming bacteria, in which prophage(-like) elements interrupting sporulation-specific genes are excised from the host genome to reconstitute the intact gene. Here, we report a novel class of gene-intervening elements, named gin, inserted in the 225 bp gerE-coding region of the B. cereus ATCC10987 genome, which generates a sporulation-specific rearrangement. gin has no phage-related genes and possesses three site-specific recombinase genes; girA, girB, and girC. We demonstrated that the gerE rearrangement occurs at the middle stage of sporulation, in which site-specific DNA recombination took place within the 9 bp consensus sequence flanking the disrupted gerE segments. Deletion analysis of gin uncovered that GirC and an additional factor, GirX, are responsible for gerE reconstitution. Involvement of GirC and GirX in DNA recombination was confirmed by an in vitro recombination assay. These results broaden the definition of the sporulation-specific gene rearrangement phenomenon: gene-intervening elements are not limited to phage DNA but may include non-viral genetic elements that carry a developmentally-regulated site-specific recombination system.

Upregulating endogenous genes by an RNA-programmable artificial transactivator

PubMed Central

Fimiani, Cristina; Goina, Elisa; Mallamaci, Antonello

2015-01-01

To promote expression of endogenous genes ad libitum, we developed a novel, programmable transcription factor prototype. Kept together via an MS2 coat protein/RNA interface, it includes a fixed, polypeptidic transactivating domain and a variable RNA domain that recognizes the desired gene. Thanks to this device, we specifically upregulated five genes, in cell lines and primary cultures of murine pallial precursors. Gene upregulation was small, however sufficient to robustly inhibit neuronal differentiation. The transactivator interacted with target gene chromatin via its RNA cofactor. Its activity was restricted to cells in which the target gene is normally transcribed. Our device might be useful for specific applications. However for this purpose, it will require an improvement of its transactivation power as well as a better characterization of its target specificity and mechanism of action. PMID:26152305

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

PubMed

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

PubMed Central

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

Targeting gene therapy to cancer: a review.

PubMed

Dachs, G U; Dougherty, G J; Stratford, I J; Chaplin, D J

1997-01-01

In recent years the idea of using gene therapy as a modality in the treatment of diseases other than genetically inherited, monogenic disorders has taken root. This is particularly obvious in the field of oncology where currently more than 100 clinical trials have been approved worldwide. This report will summarize some of the exciting progress that has recently been made with respect to both targeting the delivery of potentially therapeutic genes to tumor sites and regulating their expression within the tumor microenvironment. In order to specifically target malignant cells while at the same time sparing normal tissue, cancer gene therapy will need to combine highly selective gene delivery with highly specific gene expression, specific gene product activity, and, possibly, specific drug activation. Although the efficient delivery of DNA to tumor sites remains a formidable task, progress has been made in recent years using both viral (retrovirus, adenovirus, adeno-associated virus) and nonviral (liposomes, gene gun, injection) methods. In this report emphasis will be placed on targeted rather than high-efficiency delivery, although those would need to be combined in the future for effective therapy. To date delivery has been targeted to tumor-specific and tissue-specific antigens, such as epithelial growth factor receptor, c-kit receptor, and folate receptor, and these will be described in some detail. To increase specificity and safety of gene therapy further, the expression of the therapeutic gene needs to be tightly controlled within the target tissue. Targeted gene expression has been analyzed using tissue-specific promoters (breast-, prostate-, and melanoma-specific promoters) and disease-specific promoters (carcinoembryonic antigen, HER-2/neu, Myc-Max response elements, DF3/MUC). Alternatively, expression could be regulated externally with the use of radiation-induced promoters or tetracycline-responsive elements. Another novel possibility that will be discussed is the regulation of therapeutic gene products by tumor-specific gene splicing. Gene expression could also be targeted at conditions specific to the tumor microenvironment, such as glucose deprivation and hypoxia. We have concentrated on hypoxia-targeted gene expression and this report will discuss our progress in detail. Chronic hypoxia occurs in tissue that is more than 100-200 microns away from a functional blood supply. In solid tumors hypoxia is widespread both because cancer cells are more prolific than the invading endothelial cells that make up the blood vessels and because the newly formed blood supply is disorganized. Measurements of oxygen partial pressure in patients' tumors showed a high percentage of severe hypoxia readings (less than 2.5 mmHg), readings not seen in normal tissue. This is a major problem in the treatment of cancer, because hypoxic cells are resistant to radiotherapy and often to chemotherapy. However, severe hypoxia is also a physiological condition specific to tumors, which makes it a potentially exploitable target. We have utilized hypoxia response elements (HRE) derived from the oxygen-regulated phosphoglycerate kinase gene to control gene expression in human tumor cells in vitro and in experimental tumors. The list of genes that have been considered for use in the treatment of cancer is extensive. It includes cytokines and costimulatory cell surface molecules intended to induce an effective systemic immune response against tumor antigens that would not otherwise develop. Other inventive strategies include the use of internally expressed antibodies to target oncogenic proteins (intrabodies) and the use of antisense technology (antisense oligonucleotides, antigenes, and ribozymes). This report will concentrate more on novel genes encoding prodrug activating enzymes, so-called suicide genes (Herpes simplex virus thymidine kinase, Escherichia coli nitroreductase, E. (ABSTRACT TRUNCATED)

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2014-01-07

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kolker, Eugene

Our project focused primarily on analysis of different types of data produced by global high-throughput technologies, data integration of gene annotation, and gene and protein expression information, as well as on getting a better functional annotation of Shewanella genes. Specifically, four of our numerous major activities and achievements include the development of: statistical models for identification and expression proteomics, superior to currently available approaches (including our own earlier ones); approaches to improve gene annotations on the whole-organism scale; standards for annotation, transcriptomics and proteomics approaches; and generalized approaches for data integration of gene annotation, gene and protein expression information.

Specificity of a Rust Resistance Suppressor on 7DL in the Spring Wheat Cultivar Canthatch.

PubMed

Talajoor, Mina; Jin, Yue; Wan, Anmin; Chen, Xianming; Bhavani, Sridhar; Tabe, Linda; Lagudah, Evans; Huang, Li

2015-04-01

The spring wheat 'Canthatch' has been shown to suppress stem rust resistance genes in the background due to the presence of a suppressor gene located on the long arm of chromosome 7D. However, it is unclear whether the suppressor also suppresses resistance genes against leaf rust and stripe rust. In this study, we investigated the specificity of the resistance suppression. To determine whether the suppression is genome origin specific, chromosome location specific, or rust species or race specific, we introduced 11 known rust resistance genes into the Canthatch background, including resistance to leaf, stripe, or stem rusts, originating from A, B, or D genomes and located on different chromosome homologous groups. F1 plants of each cross were tested with the corresponding rust race, and the infection types were scored and compared with the parents. Our results show that the Canthatch 7DL suppressor only suppressed stem rust resistance genes derived from either the A or B genome, and the pattern of the suppression is gene specific and independent of chromosomal location.

Characterization of rainbow trout (Oncorhynchus mykiss) spleen transcriptome and identification of immune-related genes

USDA-ARS?s Scientific Manuscript database

Resistance against specific diseases is affecting profitability in fish production systems including rainbow trout. Limited information is known about functions and mechanisms of the immune gene pathways in teleosts. Immunogenomics are powerful tools to determine immune-related genes/gene pathways a...

Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

PubMed Central

Sargent, R. Geoffrey; Kim, Soya

2011-01-01

Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

MCAT elements and the TEF-1 family of transcription factors in muscle development and disease.

PubMed

Yoshida, Tadashi

2008-01-01

MCAT elements are located in the promoter-enhancer regions of cardiac, smooth, and skeletal muscle-specific genes including cardiac troponin T, beta-myosin heavy chain, smooth muscle alpha-actin, and skeletal alpha-actin, and play a key role in the regulation of these genes during muscle development and disease. The binding factors of MCAT elements are members of the transcriptional enhancer factor-1 (TEF-1) family. However, it has not been fully understood how these transcription factors confer cell-specific expression in muscle, because their expression patterns are relatively broad. Results of recent studies revealed multiple mechanisms whereby TEF-1 family members control MCAT element-dependent muscle-specific gene expression, including posttranslational modifications of TEF-1 family members, the presence of muscle-selective TEF-1 cofactors, and cell-selective control of TEF-1 accessibility to MCAT elements. In addition, of particular interest, recent studies regarding MCAT element-dependent transcription of the myocardin gene and the smooth muscle alpha-actin gene in muscle provide evidence for the transcriptional diversity among distinct cell types and subtypes. This article summarizes the role of MCAT elements and the TEF-1 family of transcription factors in muscle development and disease, and reviews recent progress in our understanding of the transcriptional regulatory mechanisms involved in MCAT element-dependent muscle-specific gene expression.

The Diagnostic Performance of Stool DNA Testing for Colorectal Cancer: A Systematic Review and Meta-Analysis.

PubMed

Zhai, Rong-Lin; Xu, Fei; Zhang, Pei; Zhang, Wan-Li; Wang, Hui; Wang, Ji-Liang; Cai, Kai-Lin; Long, Yue-Ping; Lu, Xiao-Ming; Tao, Kai-Xiong; Wang, Guo-Bin

2016-02-01

This meta-analysis was designed to evaluate the diagnostic performance of stool DNA testing for colorectal cancer (CRC) and compare the performance between single-gene and multiple-gene tests.MEDLINE, Cochrane, EMBASE databases were searched using keywords colorectal cancers, stool/fecal, sensitivity, specificity, DNA, and screening. Sensitivity analysis, quality assessments, and performance bias were performed for the included studies.Fifty-three studies were included in the analysis with a total sample size of 7524 patients. The studies were heterogeneous with regard to the genes being analyzed for fecal genetic biomarkers of CRC, as well as the laboratory methods being used for each assay. The sensitivity of the different assays ranged from 2% to 100% and the specificity ranged from 81% to 100%. The meta-analysis found that the pooled sensitivities for single- and multigene assays were 48.0% and 77.8%, respectively, while the pooled specificities were 97.0% and 92.7%. Receiver operator curves and diagnostic odds ratios showed no significant difference between both tests with regard to sensitivity or specificity.This meta-analysis revealed that using assays that evaluated multiple genes compared with single-gene assays did not increase the sensitivity or specificity of stool DNA testing in detecting CRC.

Using the TIGR gene index databases for biological discovery.

PubMed

Lee, Yuandan; Quackenbush, John

2003-11-01

The TIGR Gene Index web pages provide access to analyses of ESTs and gene sequences for nearly 60 species, as well as a number of resources derived from these. Each species-specific database is presented using a common format with a homepage. A variety of methods exist that allow users to search each species-specific database. Methods implemented currently include nucleotide or protein sequence queries using WU-BLAST, text-based searches using various sequence identifiers, searches by gene, tissue and library name, and searches using functional classes through Gene Ontology assignments. This protocol provides guidance for using the Gene Index Databases to extract information.

Genetic Regulatory Networks in Embryogenesis and Evolution

NASA Technical Reports Server (NTRS)

1998-01-01

The article introduces a series of papers that were originally presented at a workshop titled Genetic Regulatory Network in Embryogenesis and Evaluation. Contents include the following: evolution of cleavage programs in relationship to axial specification and body plan evolution, changes in cell lineage specification elucidate evolutionary relations in spiralia, axial patterning in the leech: developmental mechanisms and evolutionary implications, hox genes in arthropod development and evolution, heterochronic genes in development and evolution, a common theme for LIM homeobox gene function across phylogeny, and mechanisms of specification in ascidian embryos.

Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

PubMed

Firnhaber, Christopher; Hammarlund, Marc

2013-11-01

Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

Impact of homeobox genes in gastrointestinal cancer.

PubMed

Joo, Moon Kyung; Park, Jong-Jae; Chun, Hoon Jai

2016-10-07

Homeobox genes, including HOX and non- HOX genes, have been identified to be expressed aberrantly in solid tumors. In gastrointestinal (GI) cancers, most studies have focused on the function of non- HOX genes including caudal-related homeobox transcription factor 1 (CDX1) and CDX2. CDX2 is a crucial factor in the development of pre-cancerous lesions such as Barrett's esophagus or intestinal metaplasia in the stomach, and its tumor suppressive role has been investigated in colorectal cancers. Recently, several HOX genes were reported to have specific roles in GI cancers; for example, HOXA13 in esophageal squamous cell cancer and HOXB7 in stomach and colorectal cancers. HOXD10 is upregulated in colorectal cancer while it is silenced epigenetically in gastric cancer. Thus, it is essential to examine the differential expression pattern of various homeobox genes in specific tumor types or cell lineages, and understand their underlying mechanisms. In this review, we summarize the available research on homeobox genes and present their potential value for the prediction of prognosis in GI cancers.

Pan-Genomic Approaches in Lactobacillus reuteri as a Porcine Probiotic: Investigation of Host Adaptation and Antipathogenic Activity.

PubMed

Lee, Jun-Yeong; Han, Geon Goo; Choi, Jaeyun; Jin, Gwi-Deuk; Kang, Sang-Kee; Chae, Byung Jo; Kim, Eun Bae; Choi, Yun-Jaie

2017-10-01

After the introduction of a ban on the use of antibiotic growth promoters (AGPs) for livestock, reuterin-producing Lactobacillus reuteri is getting attention as an alternative to AGPs. In this study, we investigated genetic features of L. reuteri associated with host specificity and antipathogenic effect. We isolated 104 L. reuteri strains from porcine feces, and 16 strains, composed of eight strains exhibiting the higher antipathogenic effect (group HS) and eight strains exhibiting the lower effect (group LS), were selected for genomic comparison. We generated draft genomes of the 16 isolates and investigated their pan-genome together with the 26 National Center for Biotechnology Information-registered genomes. L. reuteri genomes organized six clades with multi-locus sequence analysis, and the clade IV includes the 16 isolates. First, we identified six L. reuteri clade IV-specific genes including three hypothetical protein-coding genes. The three annotated genes encode transposases and cell surface proteins, indicating that these genes are the result of adaptation to the host gastrointestinal epithelia and that these host-specific traits were acquired by horizontal gene transfer. We also identified differences between groups HS and LS in the pdu-cbi-cob-hem gene cluster, which is essential for reuterin and cobalamin synthesis, and six genes specific to group HS are revealed. While the strains of group HS possessed all genes of this cluster, LS strains have lost many genes of the cluster. This study provides a deeper understanding of the relationship between probiotic properties and genomic features of L. reuteri.

Identification of Male Gametogenesis Expressed Genes from the Scallop Nodipecten subnodosus by Suppressive Subtraction Hybridization and Pyrosequencing

PubMed Central

Llera-Herrera, Raúl; García-Gasca, Alejandra; Abreu-Goodger, Cei; Huvet, Arnaud; Ibarra, Ana M.

2013-01-01

Despite the great advances in sequencing technologies, genomic and transcriptomic information for marine non-model species with ecological, evolutionary, and economical interest is still scarce. In this work we aimed to identify genes expressed during spermatogenesis in the functional hermaphrodite scallop Nodipecten subnodosus (Mollusca: Bivalvia: Pectinidae), with the purpose of obtaining a panel of genes that would allow for the study of differentially transcribed genes between diploid and triploid scallops in the context of meiotic arrest and reproductive sterility. Because our aim was to isolate genes involved in meiosis and other testis maturation-related processes, we generated suppressive subtractive hybridization libraries of testis vs. inactive gonad. We obtained 352 and 177 ESTs by clone sequencing, and using pyrosequencing (454-Roche) we maximized the identified ESTs to 34,276 reads. A total of 1,153 genes from the testis library had a blastx hit and GO annotation, including genes specific for meiosis, spermatogenesis, sex-differentiation, and transposable elements. Some of the identified meiosis genes function in chromosome pairing (scp2, scp3), recombination and DNA repair (dmc1, rad51, ccnb1ip1/hei10), and meiotic checkpoints (rad1, hormad1, dtl/cdt2). Gene expression analyses in different gametogenic stages in both sexual regions of the gonad of meiosis genes confirmed that the expression was specific or increased towards the maturing testis. Spermatogenesis genes included known testis-specific ones (kelch-10, shippo1, adad1), with some of these known to be associated to sterility. Sex differentiation genes included one of the most conserved genes at the bottom of the sex-determination cascade (dmrt1). Transcript from transposable elements, reverse transcriptase, and transposases in this library evidenced that transposition is an active process during spermatogenesis in N. subnodosus. In relation to the inactive library, we identified 833 transcripts with functional annotation related to activation of the transcription and translation machinery, as well as to germline control and maintenance. PMID:24066034

Methods for simultaneous control of lignin content and composition, and cellulose content in plants

DOEpatents

Chiang, Vincent Lee C.; Li, Laigeng

2005-02-15

The present invention relates to a method of concurrently introducing multiple genes into plants and trees is provided. The method includes simultaneous transformation of plants with multiple genes from the phenylpropanoid pathways including 4CL, CAld5H, AldOMT, SAD and CAD genes and combinations thereof to produce various lines of transgenic plants displaying altered agronomic traits. The agronomic traits of the plants are regulated by the orientation of the specific genes and the selected gene combinations, which are incorporated into the plant genome.

The landscape of genomic imprinting across diverse adult human tissues.

PubMed

Baran, Yael; Subramaniam, Meena; Biton, Anne; Tukiainen, Taru; Tsang, Emily K; Rivas, Manuel A; Pirinen, Matti; Gutierrez-Arcelus, Maria; Smith, Kevin S; Kukurba, Kim R; Zhang, Rui; Eng, Celeste; Torgerson, Dara G; Urbanek, Cydney; Li, Jin Billy; Rodriguez-Santana, Jose R; Burchard, Esteban G; Seibold, Max A; MacArthur, Daniel G; Montgomery, Stephen B; Zaitlen, Noah A; Lappalainen, Tuuli

2015-07-01

Genomic imprinting is an important regulatory mechanism that silences one of the parental copies of a gene. To systematically characterize this phenomenon, we analyze tissue specificity of imprinting from allelic expression data in 1582 primary tissue samples from 178 individuals from the Genotype-Tissue Expression (GTEx) project. We characterize imprinting in 42 genes, including both novel and previously identified genes. Tissue specificity of imprinting is widespread, and gender-specific effects are revealed in a small number of genes in muscle with stronger imprinting in males. IGF2 shows maternal expression in the brain instead of the canonical paternal expression elsewhere. Imprinting appears to have only a subtle impact on tissue-specific expression levels, with genes lacking a systematic expression difference between tissues with imprinted and biallelic expression. In summary, our systematic characterization of imprinting in adult tissues highlights variation in imprinting between genes, individuals, and tissues. © 2015 Baran et al.; Published by Cold Spring Harbor Laboratory Press.

The Caenorhabditis chemoreceptor gene families.

PubMed

Thomas, James H; Robertson, Hugh M

2008-10-06

Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

The Caenorhabditis chemoreceptor gene families

PubMed Central

Thomas, James H; Robertson, Hugh M

2008-01-01

Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space. PMID:18837995

Digital gene expression analysis of the zebra finch genome

PubMed Central

2010-01-01

Background In order to understand patterns of adaptation and molecular evolution it is important to quantify both variation in gene expression and nucleotide sequence divergence. Gene expression profiling in non-model organisms has recently been facilitated by the advent of massively parallel sequencing technology. Here we investigate tissue specific gene expression patterns in the zebra finch (Taeniopygia guttata) with special emphasis on the genes of the major histocompatibility complex (MHC). Results Almost 2 million 454-sequencing reads from cDNA of six different tissues were assembled and analysed. A total of 11,793 zebra finch transcripts were represented in this EST data, indicating a transcriptome coverage of about 65%. There was a positive correlation between the tissue specificity of gene expression and non-synonymous to synonymous nucleotide substitution ratio of genes, suggesting that genes with a specialised function are evolving at a higher rate (or with less constraint) than genes with a more general function. In line with this, there was also a negative correlation between overall expression levels and expression specificity of contigs. We found evidence for expression of 10 different genes related to the MHC. MHC genes showed relatively tissue specific expression levels and were in general primarily expressed in spleen. Several MHC genes, including MHC class I also showed expression in brain. Furthermore, for all genes with highest levels of expression in spleen there was an overrepresentation of several gene ontology terms related to immune function. Conclusions Our study highlights the usefulness of next-generation sequence data for quantifying gene expression in the genome as a whole as well as in specific candidate genes. Overall, the data show predicted patterns of gene expression profiles and molecular evolution in the zebra finch genome. Expression of MHC genes in particular, corresponds well with expression patterns in other vertebrates. PMID:20359325

Functional requirements driving the gene duplication in 12 Drosophila species.

PubMed

Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

2013-08-15

Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

Lifespan and Stress Resistance in Drosophila with Overexpressed DNA Repair Genes

PubMed Central

Shaposhnikov, Mikhail; Proshkina, Ekaterina; Shilova, Lyubov; Zhavoronkov, Alex; Moskalev, Alexey

2015-01-01

DNA repair declines with age and correlates with longevity in many animal species. In this study, we investigated the effects of GAL4-induced overexpression of genes implicated in DNA repair on lifespan and resistance to stress factors in Drosophila melanogaster. Stress factors included hyperthermia, oxidative stress, and starvation. Overexpression was either constitutive or conditional and either ubiquitous or tissue-specific (nervous system). Overexpressed genes included those involved in recognition of DNA damage (homologs of HUS1, CHK2), nucleotide and base excision repair (homologs of XPF, XPC and AP-endonuclease-1), and repair of double-stranded DNA breaks (homologs of BRCA2, XRCC3, KU80 and WRNexo). The overexpression of different DNA repair genes led to both positive and negative effects on lifespan and stress resistance. Effects were dependent on GAL4 driver, stage of induction, sex, and role of the gene in the DNA repair process. While the constitutive/neuron-specific and conditional/ubiquitous overexpression of DNA repair genes negatively impacted lifespan and stress resistance, the constitutive/ubiquitous and conditional/neuron-specific overexpression of Hus1, mnk, mei-9, mus210, and WRNexo had beneficial effects. This study demonstrates for the first time the effects of overexpression of these DNA repair genes on both lifespan and stress resistance in D. melanogaster. PMID:26477511

Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

PubMed

Zhang, Yi-Bing; Liu, Ting-Kai; Jiang, Jun; Shi, Jun; Liu, Ying; Li, Shun; Gui, Jian-Fang

2013-01-01

Gig2 (grass carp reovirus (GCRV)-induced gene 2) is first identified as a novel fish interferon (IFN)-stimulated gene (ISG). Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD) hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose) polymerases (PARPs), and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes

PubMed Central

Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis

2017-01-01

A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials. PMID:28594388

Controlling Nuclear Jaks and Stats for Specific Gene Activation by Ifn γ and Other Cytokines: A Possible Steroid-like Connection

PubMed Central

Johnson, Howard M.; Noon-Song, Ezra; Ahmed, Chulbul M.

2011-01-01

The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation. PMID:22924155

Controlling Nuclear Jaks and Stats for Specific Gene Activation by Ifn γ and Other Cytokines: A Possible Steroid-like Connection.

PubMed

Johnson, Howard M; Noon-Song, Ezra; Ahmed, Chulbul M

2011-09-03

The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation.

Gene-Based Genome-Wide Association Analysis in European and Asian Populations Identified Novel Genes for Rheumatoid Arthritis.

PubMed

Zhu, Hong; Xia, Wei; Mo, Xing-Bo; Lin, Xiang; Qiu, Ying-Hua; Yi, Neng-Jun; Zhang, Yong-Hong; Deng, Fei-Yan; Lei, Shu-Feng

2016-01-01

Rheumatoid arthritis (RA) is a complex autoimmune disease. Using a gene-based association research strategy, the present study aims to detect unknown susceptibility to RA and to address the ethnic differences in genetic susceptibility to RA between European and Asian populations. Gene-based association analyses were performed with KGG 2.5 by using publicly available large RA datasets (14,361 RA cases and 43,923 controls of European subjects, 4,873 RA cases and 17,642 controls of Asian Subjects). For the newly identified RA-associated genes, gene set enrichment analyses and protein-protein interactions analyses were carried out with DAVID and STRING version 10.0, respectively. Differential expression verification was conducted using 4 GEO datasets. The expression levels of three selected 'highly verified' genes were measured by ELISA among our in-house RA cases and controls. A total of 221 RA-associated genes were newly identified by gene-based association study, including 71'overlapped', 76 'European-specific' and 74 'Asian-specific' genes. Among them, 105 genes had significant differential expressions between RA patients and health controls at least in one dataset, especially for 20 genes including 11 'overlapped' (ABCF1, FLOT1, HLA-F, IER3, TUBB, ZKSCAN4, BTN3A3, HSP90AB1, CUTA, BRD2, HLA-DMA), 5 'European-specific' (PHTF1, RPS18, BAK1, TNFRSF14, SUOX) and 4 'Asian-specific' (RNASET2, HFE, BTN2A2, MAPK13) genes whose differential expressions were significant at least in three datasets. The protein expressions of two selected genes FLOT1 (P value = 1.70E-02) and HLA-DMA (P value = 4.70E-02) in plasma were significantly different in our in-house samples. Our study identified 221 novel RA-associated genes and especially highlighted the importance of 20 candidate genes on RA. The results addressed ethnic genetic background differences for RA susceptibility between European and Asian populations and detected a long list of overlapped or ethnic specific RA genes. The study not only greatly increases our understanding of genetic susceptibility to RA, but also provides important insights into the ethno-genetic homogeneity and heterogeneity of RA in both ethnicities.

Genome-wide localization and expression profiling establish Sp2 as a sequence-specific transcription factor regulating vitally important genes

PubMed Central

Terrados, Gloria; Finkernagel, Florian; Stielow, Bastian; Sadic, Dennis; Neubert, Juliane; Herdt, Olga; Krause, Michael; Scharfe, Maren; Jarek, Michael; Suske, Guntram

2012-01-01

The transcription factor Sp2 is essential for early mouse development and for proliferation of mouse embryonic fibroblasts in culture. Yet its mechanisms of action and its target genes are largely unknown. In this study, we have combined RNA interference, in vitro DNA binding, chromatin immunoprecipitation sequencing and global gene-expression profiling to investigate the role of Sp2 for cellular functions, to define target sites and to identify genes regulated by Sp2. We show that Sp2 is important for cellular proliferation that it binds to GC-boxes and occupies proximal promoters of genes essential for vital cellular processes including gene expression, replication, metabolism and signalling. Moreover, we identified important key target genes and cellular pathways that are directly regulated by Sp2. Most significantly, Sp2 binds and activates numerous sequence-specific transcription factor and co-activator genes, and represses the whole battery of cholesterol synthesis genes. Our results establish Sp2 as a sequence-specific regulator of vitally important genes. PMID:22684502

Hypoxia as a target for tissue specific gene therapy.

PubMed

Rhim, Taiyoun; Lee, Dong Yun; Lee, Minhyung

2013-12-10

Hypoxia is a hallmark of various ischemic diseases such as ischemic heart disease, ischemic limb, ischemic stroke, and solid tumors. Gene therapies for these diseases have been developed with various therapeutic genes including growth factors, anti-apoptotic genes, and toxins. However, non-specific expression of these therapeutic genes may induce dangerous side effects in the normal tissues. To avoid the side effects, gene expression should be tightly regulated in an oxygen concentration dependent manner. The hypoxia inducible promoters and enhancers have been evaluated as a transcriptional regulation tool for hypoxia inducible gene therapy. The hypoxia inducible UTRs were also used in gene therapy for spinal cord injury as a translational regulation strategy. In addition to transcriptional and translational regulations, post-translational regulation strategies have been developed using the HIF-1α ODD domain. Hypoxia inducible transcriptional, translational, and post-translational regulations are useful for tissue specific gene therapy of ischemic diseases. In this review, hypoxia inducible gene expression systems are discussed and their applications are introduced. Copyright © 2013 Elsevier B.V. All rights reserved.

A Sorghum bicolor expression atlas reveals dynamic genotype-specific expression profiles for vegetative tissues of grain, sweet and bioenergy sorghums

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shakoor, N; Nair, R; Crasta, O

2014-01-23

Background: Effective improvement in sorghum crop development necessitates a genomics-based approach to identify functional genes and QTLs. Sequenced in 2009, a comprehensive annotation of the sorghum genome and the development of functional genomics resources is key to enable the discovery and deployment of regulatory and metabolic genes and gene networks for crop improvement. Results: This study utilizes the first commercially available whole-transcriptome sorghum microarray (Sorgh-WTa520972F) to identify tissue and genotype-specific expression patterns for all identified Sorghum bicolor exons and UTRs. The genechip contains 1,026,373 probes covering 149,182 exons (27,577 genes) across the Sorghum bicolor nuclear, chloroplast, and mitochondrial genomes. Specificmore » probesets were also included for putative non-coding RNAs that may play a role in gene regulation (e. g., microRNAs), and confirmed functional small RNAs in related species (maize and sugarcane) were also included in our array design. We generated expression data for 78 samples with a combination of four different tissue types (shoot, root, leaf and stem), two dissected stem tissues (pith and rind) and six diverse genotypes, which included 6 public sorghum lines (R159, Atlas, Fremont, PI152611, AR2400 and PI455230) representing grain, sweet, forage, and high biomass ideotypes. Conclusions: Here we present a summary of the microarray dataset, including analysis of tissue-specific gene expression profiles and associated expression profiles of relevant metabolic pathways. With an aim to enable identification and functional characterization of genes in sorghum, this expression atlas presents a new and valuable resource to the research community.« less

Mapping the mouse Allelome reveals tissue-specific regulation of allelic expression

PubMed Central

Andergassen, Daniel; Dotter, Christoph P; Wenzel, Daniel; Sigl, Verena; Bammer, Philipp C; Muckenhuber, Markus; Mayer, Daniela; Kulinski, Tomasz M; Theussl, Hans-Christian; Penninger, Josef M; Bock, Christoph; Barlow, Denise P; Pauler, Florian M; Hudson, Quanah J

2017-01-01

To determine the dynamics of allelic-specific expression during mouse development, we analyzed RNA-seq data from 23 F1 tissues from different developmental stages, including 19 female tissues allowing X chromosome inactivation (XCI) escapers to also be detected. We demonstrate that allelic expression arising from genetic or epigenetic differences is highly tissue-specific. We find that tissue-specific strain-biased gene expression may be regulated by tissue-specific enhancers or by post-transcriptional differences in stability between the alleles. We also find that escape from X-inactivation is tissue-specific, with leg muscle showing an unexpectedly high rate of XCI escapers. By surveying a range of tissues during development, and performing extensive validation, we are able to provide a high confidence list of mouse imprinted genes including 18 novel genes. This shows that cluster size varies dynamically during development and can be substantially larger than previously thought, with the Igf2r cluster extending over 10 Mb in placenta. DOI: http://dx.doi.org/10.7554/eLife.25125.001 PMID:28806168

De novo Transcriptome Assembly of Common Wild Rice (Oryza rufipogon Griff.) and Discovery of Drought-Response Genes in Root Tissue Based on Transcriptomic Data.

PubMed

Tian, Xin-Jie; Long, Yan; Wang, Jiao; Zhang, Jing-Wen; Wang, Yan-Yan; Li, Wei-Min; Peng, Yu-Fa; Yuan, Qian-Hua; Pei, Xin-Wu

2015-01-01

The perennial O. rufipogon (common wild rice), which is considered to be the ancestor of Asian cultivated rice species, contains many useful genetic resources, including drought resistance genes. However, few studies have identified the drought resistance and tissue-specific genes in common wild rice. In this study, transcriptome sequencing libraries were constructed, including drought-treated roots (DR) and control leaves (CL) and roots (CR). Using Illumina sequencing technology, we generated 16.75 million bases of high-quality sequence data for common wild rice and conducted de novo assembly and annotation of genes without prior genome information. These reads were assembled into 119,332 unigenes with an average length of 715 bp. A total of 88,813 distinct sequences (74.42% of unigenes) significantly matched known genes in the NCBI NT database. Differentially expressed gene (DEG) analysis showed that 3617 genes were up-regulated and 4171 genes were down-regulated in the CR library compared with the CL library. Among the DEGs, 535 genes were expressed in roots but not in shoots. A similar comparison between the DR and CR libraries showed that 1393 genes were up-regulated and 315 genes were down-regulated in the DR library compared with the CR library. Finally, 37 genes that were specifically expressed in roots were screened after comparing the DEGs identified in the above-described analyses. This study provides a transcriptome sequence resource for common wild rice plants and establishes a digital gene expression profile of wild rice plants under drought conditions using the assembled transcriptome data as a reference. Several tissue-specific and drought-stress-related candidate genes were identified, representing a fully characterized transcriptome and providing a valuable resource for genetic and genomic studies in plants.

Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development

PubMed Central

Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C.; Zhang, Baohong

2016-01-01

TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development. PMID:26857372

Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development.

PubMed

Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C; Zhang, Baohong

2016-02-09

TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development.

Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi.

PubMed

Kaulich, Manuel; Lee, Yeon J; Lönn, Peter; Springer, Aaron D; Meade, Bryan R; Dowdy, Steven F

2015-04-20

Gene knockout strategies, RNAi and rescue experiments are all employed to study mammalian gene function. However, the disadvantages of these approaches include: loss of function adaptation, reduced viability and gene overexpression that rarely matches endogenous levels. Here, we developed an endogenous gene knockdown/rescue strategy that combines RNAi selectivity with a highly efficient CRISPR directed recombinant Adeno-Associated Virus (rAAV) mediated gene targeting approach to introduce allele-specific mutations plus an allele-selective siRNA Sensitive (siSN) site that allows for studying gene mutations while maintaining endogenous expression and regulation of the gene of interest. CRISPR/Cas9 plus rAAV targeted gene-replacement and introduction of allele-specific RNAi sensitivity mutations in the CDK2 and CDK1 genes resulted in a >85% site-specific recombination of Neo-resistant clones versus ∼8% for rAAV alone. RNAi knockdown of wild type (WT) Cdk2 with siWT in heterozygotic knockin cells resulted in the mutant Cdk2 phenotype cell cycle arrest, whereas allele specific knockdown of mutant CDK2 with siSN resulted in a wild type phenotype. Together, these observations demonstrate the ability of CRISPR plus rAAV to efficiently recombine a genomic locus and tag it with a selective siRNA sequence that allows for allele-selective phenotypic assays of the gene of interest while it remains expressed and regulated under endogenous control mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Distinct ontogenic and regional expressions of newly identified Cajal-Retzius cell-specific genes during neocorticogenesis.

PubMed

Yamazaki, Hiroshi; Sekiguchi, Mariko; Takamatsu, Masako; Tanabe, Yasuto; Nakanishi, Shigetada

2004-10-05

Cajal-Retzius (CR) cells are early-generated transient neurons and are important in the regulation of cortical neuronal migration and cortical laminar formation. Molecular entities characterizing the CR cell identity, however, remain largely elusive. We purified mouse cortical CR cells expressing GFP to homogeneity by fluorescence-activated cell sorting and examined a genome-wide expression profile of cortical CR cells at embryonic and postnatal periods. We identified 49 genes that exceeded hybridization signals by >10-fold in CR cells compared with non-CR cells at embryonic day 13.5, postnatal day 2, or both. Among these CR cell-specific genes, 25 genes, including the CR cell marker genes such as the reelin and calretinin genes, are selectively and highly expressed in both embryonic and postnatal CR cells. These genes, which encode generic properties of CR cell specificity, are eminently characterized as modulatory composites of voltage-dependent calcium channels and sets of functionally related cellular components involved in cell migration, adhesion, and neurite extension. Five genes are highly expressed in CR cells at the early embryonic period and are rapidly down-regulated thereafter. Furthermore, some of these genes have been shown to mark two distinctly different focal regions corresponding to the CR cell origins. At the late prenatal and postnatal periods, 19 genes are selectively up-regulated in CR cells. These genes include functional molecules implicated in synaptic transmission and modulation. CR cells thus strikingly change their cellular phenotypes during cortical development and play a pivotal role in both corticogenesis and cortical circuit maturation.

Multifunctionality and diversity of GDSL esterase/lipase gene family in rice (Oryza sativa L. japonica) genome: new insights from bioinformatics analysis

PubMed Central

2012-01-01

Background GDSL esterases/lipases are a newly discovered subclass of lipolytic enzymes that are very important and attractive research subjects because of their multifunctional properties, such as broad substrate specificity and regiospecificity. Compared with the current knowledge regarding these enzymes in bacteria, our understanding of the plant GDSL enzymes is very limited, although the GDSL gene family in plant species include numerous members in many fully sequenced plant genomes. Only two genes from a large rice GDSL esterase/lipase gene family were previously characterised, and the majority of the members remain unknown. In the present study, we describe the rice OsGELP (Oryza sativa GDSL esterase/lipase protein) gene family at the genomic and proteomic levels, and use this knowledge to provide insights into the multifunctionality of the rice OsGELP enzymes. Results In this study, an extensive bioinformatics analysis identified 114 genes in the rice OsGELP gene family. A complete overview of this family in rice is presented, including the chromosome locations, gene structures, phylogeny, and protein motifs. Among the OsGELPs and the plant GDSL esterase/lipase proteins of known functions, 41 motifs were found that represent the core secondary structure elements or appear specifically in different phylogenetic subclades. The specification and distribution of identified putative conserved clade-common and -specific peptide motifs, and their location on the predicted protein three dimensional structure may possibly signify their functional roles. Potentially important regions for substrate specificity are highlighted, in accordance with protein three-dimensional model and location of the phylogenetic specific conserved motifs. The differential expression of some representative genes were confirmed by quantitative real-time PCR. The phylogenetic analysis, together with protein motif architectures, and the expression profiling were analysed to predict the possible biological functions of the rice OsGELP genes. Conclusions Our current genomic analysis, for the first time, presents fundamental information on the organization of the rice OsGELP gene family. With combination of the genomic, phylogenetic, microarray expression, protein motif distribution, and protein structure analyses, we were able to create supported basis for the functional prediction of many members in the rice GDSL esterase/lipase family. The present study provides a platform for the selection of candidate genes for further detailed functional study. PMID:22793791

Identification of rhizome-specific genes by genome-wide differential expression analysis in Oryza longistaminata.

PubMed

Hu, Fengyi; Wang, Di; Zhao, Xiuqin; Zhang, Ting; Sun, Haixi; Zhu, Linghua; Zhang, Fan; Li, Lijuan; Li, Qiong; Tao, Dayun; Fu, Binying; Li, Zhikang

2011-01-24

Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their regulated pathways. Auxin/IAA appears to act as a negative regulator in rhizome development, while GA acts as the activator in rhizome development. Co-localization of the genes specifically expressed in rhizome tips and rhizome internodes with the QTLs for rhizome traits identified a large set of candidate genes for rhizome initiation and development in rice for further confirmation.

The Dynein Gene Family in Chlamydomonas Reinhardtii

PubMed Central

Porter, M. E.; Knott, J. A.; Myster, S. H.; Farlow, S. J.

1996-01-01

To correlate dynein heavy chain (Dhc) genes with flagellar mutations and gain insight into the function of specific dynein isoforms, we placed eight members of the Dhc gene family on the genetic map of Chlamydomonas. Using a PCR-based strategy, we cloned 11 Dhc genes from Chlamydomonas. Comparisons with other Dhc genes indicate that two clones correspond to genes encoding the alpha and beta heavy chains of the outer dynein arm. Alignment of the predicted amino acid sequences spanning the nucleotide binding site indicates that the remaining nine clones can be subdivided into three groups that are likely to include representatives of the inner-arm Dhc isoforms. Gene-specific probes reveal that each clone represents a single-copy gene that is expressed as a transcript of the appropriate size (>13 kb) sufficient to encode a high molecular weight Dhc polypeptide. The expression of all nine genes is upregulated in response to deflagellation, suggesting a role in axoneme assembly or motility. Restriction fragment length polymorphisms between divergent C. reinhardtii strains have been used to place each Dhc gene on the genetic map of Chlamydomonas. These studies lay the groundwork for correlating defects in different Dhc genes with specific flagellar mutations. PMID:8889521

Regulatory genes and their roles for improvement of antibiotic biosynthesis in Streptomyces.

PubMed

Lu, Fengjuan; Hou, Yanyan; Zhang, Heming; Chu, Yiwen; Xia, Haiyang; Tian, Yongqiang

2017-08-01

The numerous secondary metabolites in Streptomyces spp. are crucial for various applications. For example, cephamycin C is used as an antibiotic, and avermectin is used as an insecticide. Specifically, antibiotic yield is closely related to many factors, such as the external environment, nutrition (including nitrogen and carbon sources), biosynthetic efficiency and the regulatory mechanisms in producing strains. There are various types of regulatory genes that work in different ways, such as pleiotropic (or global) regulatory genes, cluster-situated regulators, which are also called pathway-specific regulatory genes, and many other regulators. The study of regulatory genes that influence antibiotic biosynthesis in Streptomyces spp. not only provides a theoretical basis for antibiotic biosynthesis in Streptomyces but also helps to increase the yield of antibiotics via molecular manipulation of these regulatory genes. Currently, more and more emphasis is being placed on the regulatory genes of antibiotic biosynthetic gene clusters in Streptomyces spp., and many studies on these genes have been performed to improve the yield of antibiotics in Streptomyces. This paper lists many antibiotic biosynthesis regulatory genes in Streptomyces spp. and focuses on frequently investigated regulatory genes that are involved in pathway-specific regulation and pleiotropic regulation and their applications in genetic engineering.

A Cell-surface Phylome for African Trypanosomes

PubMed Central

Jackson, Andrew P.; Allison, Harriet C.; Barry, J. David; Field, Mark C.; Hertz-Fowler, Christiane; Berriman, Matthew

2013-01-01

The cell surface of Trypanosoma brucei, like many protistan blood parasites, is crucial for mediating host-parasite interactions and is instrumental to the initiation, maintenance and severity of infection. Previous comparisons with the related trypanosomatid parasites T. cruzi and Leishmania major suggest that the cell-surface proteome of T. brucei is largely taxon-specific. Here we compare genes predicted to encode cell surface proteins of T. brucei with those from two related African trypanosomes, T. congolense and T. vivax. We created a cell surface phylome (CSP) by estimating phylogenies for 79 gene families with putative surface functions to understand the more recent evolution of African trypanosome surface architecture. Our findings demonstrate that the transferrin receptor genes essential for bloodstream survival in T. brucei are conserved in T. congolense but absent from T. vivax and include an expanded gene family of insect stage-specific surface glycoproteins that includes many currently uncharacterized genes. We also identify species-specific features and innovations and confirm that these include most expression site-associated genes (ESAGs) in T. brucei, which are absent from T. congolense and T. vivax. The CSP presents the first global picture of the origins and dynamics of cell surface architecture in African trypanosomes, representing the principal differences in genomic repertoire between African trypanosome species and provides a basis from which to explore the developmental and pathological differences in surface architectures. All data can be accessed at: http://www.genedb.org/Page/trypanosoma_surface_phylome. PMID:23556014

The large-scale investigation of gene expression in Leymus chinensis stigmas provides a valuable resource for understanding the mechanisms of poaceae self-incompatibility.

PubMed

Zhou, Qingyuan; Jia, Junting; Huang, Xing; Yan, Xueqing; Cheng, Liqin; Chen, Shuangyan; Li, Xiaoxia; Peng, Xianjun; Liu, Gongshe

2014-05-26

Many Poaceae species show a gametophytic self-incompatibility (GSI) system, which is controlled by at least two independent and multiallelic loci, S and Z. Until currently, the gene products for S and Z were unknown. Grass SI plant stigmas discriminate between pollen grains that land on its surface and support compatible pollen tube growth and penetration into the stigma, whereas recognizing incompatible pollen and thus inhibiting pollination behaviors. Leymus chinensis (Trin.) Tzvel. (sheepgrass) is a Poaceae SI species. A comprehensive analysis of sheepgrass stigma transcriptome may provide valuable information for understanding the mechanism of pollen-stigma interactions and grass SI. The transcript abundance profiles of mature stigmas, mature ovaries and leaves were examined using high-throughput next generation sequencing technology. A comparative transcriptomic analysis of these tissues identified 1,025 specifically or preferentially expressed genes in sheepgrass stigmas. These genes contained a significant proportion of genes predicted to function in cell-cell communication and signal transduction. We identified 111 putative transcription factors (TFs) genes and the most abundant groups were MYB, C2H2, C3H, FAR1, MADS. Comparative analysis of the sheepgrass, rice and Arabidopsis stigma-specific or preferential datasets showed broad similarities and some differences in the proportion of genes in the Gene Ontology (GO) functional categories. Potential SI candidate genes identified in other grasses were also detected in the sheepgrass stigma-specific or preferential dataset. Quantitative real-time PCR experiments validated the expression pattern of stigma preferential genes including homologous grass SI candidate genes. This study represents the first large-scale investigation of gene expression in the stigmas of an SI grass species. We uncovered many notable genes that are potentially involved in pollen-stigma interactions and SI mechanisms, including genes encoding receptor-like protein kinases (RLK), CBL (calcineurin B-like proteins) interacting protein kinases, calcium-dependent protein kinase, expansins, pectinesterase, peroxidases and various transcription factors. The availability of a pool of stigma-specific or preferential genes for L. chinensis offers an opportunity to elucidate the mechanisms of SI in Poaceae.

ATF4, A Novel Mediator of the Anabolic Actions of PTH on Bone

DTIC Science & Technology

2010-07-01

increased the expression of genes known to be associated with osteoblast differentiation including osteocalcin (Ocn), bone sialoprotein (Bsp...differentiation including osteocalcin (Ocn) (2.2-fold), bone sialoprotein (Bsp) (4.2-fold), alkaline phosphatase (Alp) (3.2-fold), a1(I) collagen (Col1... sialoprotein (BSP) gene transcription is mediated through a pituitary-specific transcription factor-1 (Pit-1) motif in the rat BSP gene promoter. Matrix Biol

Breast Cancer Gene Therapy: Development of Novel Non-Invasive Magnetic Resonance Assay to Optimize Efficacy

DTIC Science & Technology

2007-05-01

inhalation-mouse). HFB had been proposed as a veterinary anesthetic and has been used in many species including ponies, sheep, cats, dogs , rats and...anesthetic and has been used in many species including ponies, sheep, cats, dogs , rats and mice, but was abandoned due to its flammability [265...gene activity detection- specifically, using fluorinated substrates of β-galactosidase to reveal gene activity. Our prototype molecule PFONPG (p

Alteration of the gene expression profile of T-cell receptor αβ-modified T-cells with diffuse large B-cell lymphoma specificity.

PubMed

Zha, Xianfeng; Yin, Qingsong; Tan, Huo; Wang, Chunyan; Chen, Shaohua; Yang, Lijian; Li, Bo; Wu, Xiuli; Li, Yangqiu

2013-05-01

Antigen-specific, T-cell receptor (TCR)-modified cytotoxic T lymphocytes (CTLs) that target tumors are an attractive strategy for specific adoptive immunotherapy. Little is known about whether there are any alterations in the gene expression profile after TCR gene transduction in T cells. We constructed TCR gene-redirected CTLs with specificity for diffuse large B-cell lymphoma (DLBCL)-associated antigens to elucidate the gene expression profiles of TCR gene-redirected T-cells, and we further analyzed the gene expression profile pattern of these redirected T-cells by Affymetrix microarrays. The resulting data were analyzed using Bioconductor software, a two-fold cut-off expression change was applied together with anti-correlation of the profile ratios to render the microarray analysis set. The fold change of all genes was calculated by comparing the three TCR gene-modified T-cells and a negative control counterpart. The gene pathways were analyzed using Bioconductor and Kyoto Encyclopedia of Genes and Genomes. Identical genes whose fold change was greater than or equal to 2.0 in all three TCR gene-redirected T-cell groups in comparison with the negative control were identified as the differentially expressed genes. The differentially expressed genes were comprised of 33 up-regulated genes and 1 down-regulated gene including JUNB, FOS, TNF, INF-γ, DUSP2, IL-1B, CXCL1, CXCL2, CXCL9, CCL2, CCL4, and CCL8. These genes are mainly involved in the TCR signaling, mitogen-activated protein kinase signaling, and cytokine-cytokine receptor interaction pathways. In conclusion, we characterized the gene expression profile of DLBCL-specific TCR gene-redirected T-cells. The changes corresponded to an up-regulation in the differentiation and proliferation of the T-cells. These data may help to explain some of the characteristics of the redirected T-cells.

Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing.

PubMed

Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R

2015-11-09

Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.

Transcriptome profiling of the whitefly Bemisia tabaci reveals stage-specific gene expression signatures for thiamethoxam resistance

PubMed Central

Yang, N; Xie, W; Jones, CM; Bass, C; Jiao, X; Yang, X; Liu, B; Li, R; Zhang, Y

2013-01-01

Bemisia tabaci has developed high levels of resistance to many insecticides including the neonicotinoids and there is strong evidence that for some compounds resistance is stage-specific. To investigate the molecular basis of B. tabaci resistance to the neonicotinoid thiamethoxam we used a custom whitefly microarray to compare gene expression in the egg, nymph and adult stages of a thiamethoxam-resistant strain (TH-R) with a susceptible strain (TH-S). Gene ontology and bioinformatic analyses revealed that in all life stages many of the differentially expressed transcripts encoded enzymes involved in metabolic processes and/or metabolism of xenobiotics. Several of these are candidate resistance genes and include the cytochrome P450 CYP6CM1, which has been shown to confer resistance to several neonicotinoids previously, a P450 belonging to the Cytochrome P450s 4 family and a glutathione S-transferase (GST) belonging to the sigma class. Finally several ATP-binding cassette transporters of the ABCG subfamily were highly over-expressed in the adult stage of the TH-R strain and may play a role in resistance by active efflux. Here, we evaluated both common and stage-specific gene expression signatures and identified several candidate resistance genes that may underlie B. tabaci resistance to thiamethoxam. PMID:23889345

Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing

PubMed Central

Vannette, Rachel L.; Mohamed, Abbas; Johnson, Brian R.

2015-01-01

Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging. PMID:26549293

Host-Specific Response to HCV Infection in the Chimeric SCID-beige/Alb-uPA Mouse Model: Role of the Innate Antiviral Immune Response

PubMed Central

Thompson, Jill C; Smith, Maria W; Yeh, Matthew M; Proll, Sean; Zhu, Lin-Fu; Gao, T. J; Kneteman, Norman M; Tyrrell, D. Lorne; Katze, Michael G

2006-01-01

The severe combined immunodeficiency disorder (SCID)-beige/albumin (Alb)-urokinase plasminogen activator (uPA) mouse containing a human-mouse chimeric liver is currently the only small animal model capable of supporting hepatitis C virus (HCV) infection. This model was utilized to characterize the host transcriptional response to HCV infection. The purpose of these studies was to investigate the genetic component of the host response to HCV infection and also to distinguish virus-induced gene expression changes from adaptive HCV-specific immune-mediated effects. Gene expression profiles from HCV-infected mice were also compared to those from HCV-infected patients. Analyses of the gene expression data demonstrate that host factors regulate the response to HCV infection, including the nature of the innate antiviral immune response. They also indicate that HCV mediates gene expression changes, including regulation of lipid metabolism genes, which have the potential to be directly cytopathic, indicating that liver pathology may not be exclusively mediated by HCV-specific adaptive immune responses. This effect appears to be inversely related to the activation of the innate antiviral immune response. In summary, the nature of the initial interferon response to HCV infection may determine the extent of viral-mediated effects on host gene expression. PMID:16789836

Evidence-Based Annotation of Gene Function in Shewanella oneidensis MR-1 Using Genome-Wide Fitness Profiling across 121 Conditions

PubMed Central

Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.; Shao, Wenjun; Baumohl, Jason K.; Xu, Zhuchen; Nguyen, Michelle; Tamse, Raquel; Davis, Ronald W.; Arkin, Adam P.

2011-01-01

Most genes in bacteria are experimentally uncharacterized and cannot be annotated with a specific function. Given the great diversity of bacteria and the ease of genome sequencing, high-throughput approaches to identify gene function experimentally are needed. Here, we use pools of tagged transposon mutants in the metal-reducing bacterium Shewanella oneidensis MR-1 to probe the mutant fitness of 3,355 genes in 121 diverse conditions including different growth substrates, alternative electron acceptors, stresses, and motility. We find that 2,350 genes have a pattern of fitness that is significantly different from random and 1,230 of these genes (37% of our total assayed genes) have enough signal to show strong biological correlations. We find that genes in all functional categories have phenotypes, including hundreds of hypotheticals, and that potentially redundant genes (over 50% amino acid identity to another gene in the genome) are also likely to have distinct phenotypes. Using fitness patterns, we were able to propose specific molecular functions for 40 genes or operons that lacked specific annotations or had incomplete annotations. In one example, we demonstrate that the previously hypothetical gene SO_3749 encodes a functional acetylornithine deacetylase, thus filling a missing step in S. oneidensis metabolism. Additionally, we demonstrate that the orphan histidine kinase SO_2742 and orphan response regulator SO_2648 form a signal transduction pathway that activates expression of acetyl-CoA synthase and is required for S. oneidensis to grow on acetate as a carbon source. Lastly, we demonstrate that gene expression and mutant fitness are poorly correlated and that mutant fitness generates more confident predictions of gene function than does gene expression. The approach described here can be applied generally to create large-scale gene-phenotype maps for evidence-based annotation of gene function in prokaryotes. PMID:22125499

The use of cell microinjection for the in vivo analysis of viral transcriptional regulatory protein domains.

PubMed

Green, Maurice; Thorburn, Andrew; Kern, Robert; Loewenstein, Paul M

2007-01-01

Microinjection of mammalian cells provides a powerful method for analyzing in vivo functions of viral genes and viral gene products. By microinjection, a controlled amount (ranging from several to many thousands of copies) of a viral or cellular gene, a protein product of a gene, a polypeptide fragment encoding a specific protein domain, or an RNA molecule can be delivered into a target cell and the functional consequences analyzed. Microinjection can be used to deliver antibody targeted to a specific protein domain in order to analyze the requirement of the protein for specific cell functions such as cell cycle progression, transcription of specific genes, or intracellular transport. This chapter describes examples of the successful use of microinjection to probe adenovirus E1A regulatory mechanisms. Detailed methods are provided for manual and semiautomatic microinjection of mammalian cells as well as bioassay protocols for microinjected cells including immunofluorescence, colorimetic, in situ hybridization, and autoradiography.

PlantGI: a database for searching gene indices in agricultural plants developed at NIAB, Korea

PubMed Central

Kim, Chang Kug; Choi, Ji Weon; Park, DongSuk; Kang, Man Jung; Seol, Young-Joo; Hyun, Do Yoon; Hahn, Jang Ho

2008-01-01

The Plant Gene Index (PlantGI) database is developed as a web-based search system with search capabilities for keywords to provide information on gene indices specifically for agricultural plants. The database contains specific Gene Index information for ten agricultural species, namely, rice, Chinese cabbage, wheat, maize, soybean, barley, mushroom, Arabidopsis, hot pepper and tomato. PlantGI differs from other Gene Index databases in being specific to agricultural plant species and thus complements services from similar other developments. The database includes options for interactive mining of EST CONTIGS and assembled EST data for user specific keyword queries. The current version of PlantGI contains a total of 34,000 EST CONTIGS data for rice (8488 records), wheat (8560 records), maize (4570 records), soybean (3726 records), barley (3417 records), Chinese cabbage (3602 records), tomato (1236 records), hot pepper (998 records), mushroom (130 records) and Arabidopsis (8 records). Availability The database is available for free at http://www.niab.go.kr/nabic/. PMID:18685722

The evolution of the protein synthesis system. I - A model of a primitive protein synthesis system

NASA Technical Reports Server (NTRS)

Mizutani, H.; Ponnamperuma, C.

1977-01-01

A model is developed to describe the evolution of the protein synthesis system. The model is comprised of two independent autocatalytic systems, one including one gene (A-gene) and two activated amino acid polymerases (O and A-polymerases), and the other including the addition of another gene (N-gene) and a nucleotide polymerase. Simulation results have suggested that even a small enzymic activity and polymerase specificity could lead the system to the most accurate protein synthesis, as far as permitted by transitions to systems with higher accuracy.

STAT3 or USF2 Contributes to HIF Target Gene Specificity

PubMed Central

Pawlus, Matthew R.; Wang, Liyi; Murakami, Aya; Dai, Guanhai; Hu, Cheng-Jun

2013-01-01

The HIF1- and HIF2-mediated transcriptional responses play critical roles in solid tumor progression. Despite significant similarities, including their binding to promoters of both HIF1 and HIF2 target genes, HIF1 and HIF2 proteins activate unique subsets of target genes under hypoxia. The mechanism for HIF target gene specificity has remained unclear. Using siRNA or inhibitor, we previously reported that STAT3 or USF2 is specifically required for activation of endogenous HIF1 or HIF2 target genes. In this study, using reporter gene assays and chromatin immuno-precipitation, we find that STAT3 or USF2 exhibits specific binding to the promoters of HIF1 or HIF2 target genes respectively even when over-expressed. Functionally, HIF1α interacts with STAT3 to activate HIF1 target gene promoters in a HIF1α HLH/PAS and N-TAD dependent manner while HIF2α interacts with USF2 to activate HIF2 target gene promoters in a HIF2α N-TAD dependent manner. Physically, HIF1α HLH and PAS domains are required for its interaction with STAT3 while both N- and C-TADs of HIF2α are involved in physical interaction with USF2. Importantly, addition of functional USF2 binding sites into a HIF1 target gene promoter increases the basal activity of the promoter as well as its response to HIF2+USF2 activation while replacing HIF binding site with HBS from a HIF2 target gene does not change the specificity of the reporter gene. Importantly, RNA Pol II on HIF1 or HIF2 target genes is primarily associated with HIF1α or HIF2α in a STAT3 or USF2 dependent manner. Thus, we demonstrate here for the first time that HIF target gene specificity is achieved by HIF transcription partners that are required for HIF target gene activation, exhibit specific binding to the promoters of HIF1 or HIF2 target genes and selectively interact with HIF1α or HIF2α protein. PMID:23991099

Microarray profiling of diaphyseal bone of rats suffering from hypervitaminosis A.

PubMed

Lind, Thomas; Hu, Lijuan; Lind, P Monica; Sugars, Rachael; Andersson, Göran; Jacobson, Annica; Melhus, Håkan

2012-03-01

Vitamin A is the only known compound that produces spontaneous fractures in rats. In an effort to resolve the molecular mechanism behind this effect, we fed young male rats high doses of vitamin A and performed microarray analysis of diaphyseal bone with and without marrow after 1 week, i.e., just before the first fractures appeared. Of the differentially expressed genes in cortical bone, including marrow, 98% were upregulated. In contrast, hypervitaminotic cortical bone without marrow showed reduced expression of 37% of differentially expressed genes. Gene ontology (GO) analysis revealed that only samples containing bone marrow were associated with a GO term, which principally represented extracellular matrix. This is consistent with the histological findings of increased endosteal/marrow osteoblast number. Fourteen genes, including Cyp26b1, which is known to be upregulated by vitamin A, were selected and verified by real-time PCR. In addition, immunohistochemical staining of bone sections confirmed that the bone-specific molecule osteoadherin was upregulated. Further analysis of the major gene-expression changes revealed apparent augmented Wnt signaling in the sample containing bone marrow but reduced Wnt signaling in cortical bone. Moreover, induced expression of hypoxia-associated genes was found only in samples containing bone marrow. Together, these results highlight the importance of compartment-specific analysis of bone and corroborate previous observations of compartment-specific effects of vitamin A, with reduced activity in cortical bone but increased activity in the endosteal/marrow compartment. We specifically identify potential key osteoblast-, Wnt signaling-, and hypoxia-associated genes in the processes leading to spontaneous fractures.

Agrobacterium-mediated transformation of maize (Zea mays) with Cre-lox site specific recombination cassettes in BIBAC vectors.

PubMed

Vega, Juan M; Yu, Weichang; Han, Fangpu; Kato, Akio; Peters, Eric M; Zhang, Zhanyuan J; Birchler, James A

2008-04-01

The Cre/loxP site-specific recombination system has been applied in various plant species including maize (Zea mays) for marker gene removal, gene targeting, and functional genomics. A BIBAC vector system was adapted for maize transformation with a large fragment of genetic material including a herbicide resistance marker gene, a 30 kb yeast genomic fragment as a marker for fluorescence in situ hybridization (FISH), and a 35S-lox-cre recombination cassette. Seventy-five transgenic lines were generated from Agrobacterium-mediated transformation of a maize Hi II line with multiple B chromosomes. Eighty-four inserts have been localized among all 10 A chromosome pairs by FISH using the yeast DNA probe together with a karyotyping cocktail. No inserts were found on the B chromosomes; thus a bias against the B chromosomes by the Agrobacterium-mediated transformation was revealed. The expression of a cre gene was confirmed in 68 of the 75 transgenic lines by a reporter construct for cre/lox mediated recombination. The placement of the cre/lox site-specific recombination system in many locations in the maize genome will be valuable materials for gene targeting and chromosome engineering.

Nanoparticles for cancer gene therapy: Recent advances, challenges, and strategies.

PubMed

Wang, Kui; Kievit, Forrest M; Zhang, Miqin

2016-12-01

Compared to conventional treatments, gene therapy offers a variety of advantages for cancer treatment including high potency and specificity, low off-target toxicity, and delivery of multiple genes that concurrently target cancer tumorigenesis, recurrence, and drug resistance. In the past decades, gene therapy has undergone remarkable progress, and is now poised to become a first line therapy for cancer. Among various gene delivery systems, nanoparticles have attracted much attention because of their desirable characteristics including low toxicity profiles, well-controlled and high gene delivery efficiency, and multi-functionalities. This review provides an overview on gene therapeutics and gene delivery technologies, and highlight recent advances, challenges and insights into the design and the utility of nanoparticles in gene therapy for cancer treatment. Copyright © 2016. Published by Elsevier Ltd.

FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

Activity-dependent neuroprotective protein (ADNP): a case study for highly conserved chordata-specific genes shaping the brain and mutated in cancer.

PubMed

Gozes, Illana; Yeheskel, Adva; Pasmanik-Chor, Metsada

2015-01-01

The recent finding of activity-dependent neuroprotective protein (ADNP) as a protein decreased in serum of patients with Alzheimer's disease (AD) compared to controls, alongside with the discovery of ADNP mutations in autism and coupled with the original description of cancer mutations, ignited an interest for a comparative analysis of ADNP with other AD/autism/cancer-associated genes. We strive toward a better understanding of the molecular structure of key players in psychiatric/neurodegenerative diseases including autism, schizophrenia, and AD. This article includes data mining and bioinformatics analysis on the ADNP gene and protein, in addition to other related genes, with emphasis on recent literature. ADNP is discovered here as unique to chordata with specific autism mutations different from cancer-associated mutation. Furthermore, ADNP exhibits similarities to other cancer/autism-associated genes. We suggest that key genes, which shape and maintain our brain and are prone to mutations, are by in large unique to chordata. Furthermore, these brain-controlling genes, like ADNP, are linked to cell growth and differentiation, and under different stress conditions may mutate or exhibit expression changes leading to cancer propagation. Better understanding of these genes could lead to better therapeutics.

Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

PubMed

Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

2014-03-07

To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

Lineage-specific expansion of IFIT gene family: an insight into coevolution with IFN gene family.

PubMed

Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang

2013-01-01

In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system.

A Systems Biology Framework Identifies Molecular Underpinnings of Coronary Heart Disease

PubMed Central

Huan, Tianxiao; Zhang, Bin; Wang, Zhi; Joehanes, Roby; Zhu, Jun; Johnson, Andrew D.; Ying, Saixia; Munson, Peter J.; Raghavachari, Nalini; Wang, Richard; Liu, Poching; Courchesne, Paul; Hwang, Shih-Jen; Assimes, Themistocles L.; McPherson, Ruth; Samani, Nilesh J.; Schunkert, Heribert; Meng, Qingying; Suver, Christine; O'Donnell, Christopher J.; Derry, Jonathan; Yang, Xia; Levy, Daniel

2013-01-01

Objective Genetic approaches have identified numerous loci associated with coronary heart disease (CHD). The molecular mechanisms underlying CHD gene-disease associations, however, remain unclear. We hypothesized that genetic variants with both strong and subtle effects drive gene subnetworks that in turn affect CHD. Approach and Results We surveyed CHD-associated molecular interactions by constructing coexpression networks using whole blood gene expression profiles from 188 CHD cases and 188 age- and sex-matched controls. 24 coexpression modules were identified including one case-specific and one control-specific differential module (DM). The DMs were enriched for genes involved in B-cell activation, immune response, and ion transport. By integrating the DMs with altered gene expression associated SNPs (eSNPs) and with results of GWAS of CHD and its risk factors, the control-specific DM was implicated as CHD-causal based on its significant enrichment for both CHD and lipid eSNPs. This causal DM was further integrated with tissue-specific Bayesian networks and protein-protein interaction networks to identify regulatory key driver (KD) genes. Multi-tissue KDs (SPIB and TNFRSF13C) and tissue-specific KDs (e.g. EBF1) were identified. Conclusions Our network-driven integrative analysis not only identified CHD-related genes, but also defined network structure that sheds light on the molecular interactions of genes associated with CHD risk. PMID:23539213

Dehydrin gene expression provides an indicator of low temperature and drought stress: transcriptome-based analysis of barley (Hordeum vulgare L.).

PubMed

Tommasini, Livia; Svensson, Jan T; Rodriguez, Edmundo M; Wahid, Abdul; Malatrasi, Marina; Kato, Kenji; Wanamaker, Steve; Resnik, Josh; Close, Timothy J

2008-11-01

Low temperature and drought have major influences on plant growth and productivity. To identify barley genes involved in responses to these stresses and to specifically test the hypothesis that the dehydrin (Dhn) multigene family can serve as an indicator of the entire transcriptome response, we investigated the response of barley cv. Morex to: (1) gradual drought over 21 days and (2) low temperature including chilling, freeze-thaw cycles, and deacclimation over 33 days. We found 4,153 genes that responded to at least one component of these two stress regimes, about one fourth of all genes called "present" under any condition. About 44% (1,822 of 4,153) responded specifically to drought, whereas only 3.8% (158 of 4,153) were chilling specific and 2.8% (119 of 4,153) freeze-thaw specific, with 34.1% responsive to freeze-thaw and drought. The intersection between chilling and drought (31.9%) was somewhat smaller than the intersection between freeze-thaw and drought, implying an element of osmotic stress response to freeze-thaw. About 82.4% of the responsive genes were similar to Arabidopsis genes. The expression of 13 barley Dhn genes mirrored the global clustering of all transcripts, with specific combinations of Dhn genes providing an excellent indicator of each stress response. Data from these studies provide a robust reference data set for abiotic stress.

Mammalian-specific genomic functions: Newly acquired traits generated by genomic imprinting and LTR retrotransposon-derived genes in mammals

PubMed Central

KANEKO-ISHINO, Tomoko; ISHINO, Fumitoshi

2015-01-01

Mammals, including human beings, have evolved a unique viviparous reproductive system and a highly developed central nervous system. How did these unique characteristics emerge in mammalian evolution, and what kinds of changes did occur in the mammalian genomes as evolution proceeded? A key conceptual term in approaching these issues is “mammalian-specific genomic functions”, a concept covering both mammalian-specific epigenetics and genetics. Genomic imprinting and LTR retrotransposon-derived genes are reviewed as the representative, mammalian-specific genomic functions that are essential not only for the current mammalian developmental system, but also mammalian evolution itself. First, the essential roles of genomic imprinting in mammalian development, especially related to viviparous reproduction via placental function, as well as the emergence of genomic imprinting in mammalian evolution, are discussed. Second, we introduce the novel concept of “mammalian-specific traits generated by mammalian-specific genes from LTR retrotransposons”, based on the finding that LTR retrotransposons served as a critical driving force in the mammalian evolution via generating mammalian-specific genes. PMID:26666304

Mammalian-specific genomic functions: Newly acquired traits generated by genomic imprinting and LTR retrotransposon-derived genes in mammals.

PubMed

Kaneko-Ishino, Tomoko; Ishino, Fumitoshi

2015-01-01

Mammals, including human beings, have evolved a unique viviparous reproductive system and a highly developed central nervous system. How did these unique characteristics emerge in mammalian evolution, and what kinds of changes did occur in the mammalian genomes as evolution proceeded? A key conceptual term in approaching these issues is "mammalian-specific genomic functions", a concept covering both mammalian-specific epigenetics and genetics. Genomic imprinting and LTR retrotransposon-derived genes are reviewed as the representative, mammalian-specific genomic functions that are essential not only for the current mammalian developmental system, but also mammalian evolution itself. First, the essential roles of genomic imprinting in mammalian development, especially related to viviparous reproduction via placental function, as well as the emergence of genomic imprinting in mammalian evolution, are discussed. Second, we introduce the novel concept of "mammalian-specific traits generated by mammalian-specific genes from LTR retrotransposons", based on the finding that LTR retrotransposons served as a critical driving force in the mammalian evolution via generating mammalian-specific genes.

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

PubMed Central

Ding, Jian; Lin, Zhi-Qiang; Jiang, Jian-Ming; Seidman, Christine E.; Seidman, Jonathan G.; Pu, William T.; Wang, Da-Zhi

2016-01-01

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimalimmunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations. PMID:28060283

The insulin and islet amyloid polypeptide genes contain similar cell-specific promoter elements that bind identical beta-cell nuclear complexes.

PubMed Central

German, M S; Moss, L G; Wang, J; Rutter, W J

1992-01-01

The pancreatic beta cell makes several unique gene products, including insulin, islet amyloid polypeptide (IAPP), and beta-cell-specific glucokinase (beta GK). The functions of isolated portions of the insulin, IAPP, and beta GK promoters were studied by using transient expression and DNA binding assays. A short portion (-247 to -197 bp) of the rat insulin I gene, the FF minienhancer, contains three interacting transcriptional regulatory elements. The FF minienhancer binds at least two nuclear complexes with limited tissue distribution. Sequences similar to that of the FF minienhancer are present in the 5' flanking DNA of the human IAPP and rat beta GK genes and also the rat insulin II and mouse insulin I and II genes. Similar minienhancer constructs from the insulin and IAPP genes function as cell-specific transcriptional regulatory elements and compete for binding of the same nuclear factors, while the beta GK construct competes for protein binding but functions poorly as a minienhancer. These observations suggest that the patterns of expression of the beta-cell-specific genes result in part from sharing the same transcriptional regulators. Images PMID:1549125

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts.

PubMed

Ding, Jian; Lin, Zhi-Qiang; Jiang, Jian-Ming; Seidman, Christine E; Seidman, Jonathan G; Pu, William T; Wang, Da-Zhi

2016-12-17

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimal immunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations.

Identification of germline transcriptional regulatory elements in Aedes aegypti.

PubMed

Akbari, Omar S; Papathanos, Philippos A; Sandler, Jeremy E; Kennedy, Katie; Hay, Bruce A

2014-02-04

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UD(MEL), and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

Identification of germline transcriptional regulatory elements in Aedes aegypti

NASA Astrophysics Data System (ADS)

Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

2014-02-01

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

Evolutionary conservation of regulated longevity assurance mechanisms

PubMed Central

McElwee, Joshua J; Schuster, Eugene; Blanc, Eric; Piper, Matthew D; Thomas, James H; Patel, Dhaval S; Selman, Colin; Withers, Dominic J; Thornton, Janet M; Partridge, Linda; Gems, David

2007-01-01

Background To what extent are the determinants of aging in animal species universal? Insulin/insulin-like growth factor (IGF)-1 signaling (IIS) is an evolutionarily conserved (public) regulator of longevity; yet it remains unclear whether the genes and biochemical processes through which IIS acts on aging are public or private (that is, lineage specific). To address this, we have applied a novel, multi-level cross-species comparative analysis to compare gene expression changes accompanying increased longevity in mutant nematodes, fruitflies and mice with reduced IIS. Results Surprisingly, there is little evolutionary conservation at the level of individual, orthologous genes or paralogous genes under IIS regulation. However, a number of gene categories are significantly enriched for genes whose expression changes in long-lived animals of all three species. Down-regulated categories include protein biosynthesis-associated genes. Up-regulated categories include sugar catabolism, energy generation, glutathione-S-transferases (GSTs) and several other categories linked to cellular detoxification (that is, phase 1 and phase 2 metabolism of xenobiotic and endobiotic toxins). Protein biosynthesis and GST activity have recently been linked to aging and longevity assurance, respectively. Conclusion These processes represent candidate, regulated mechanisms of longevity-control that are conserved across animal species. The longevity assurance mechanisms via which IIS acts appear to be lineage-specific at the gene level (private), but conserved at the process level (or semi-public). In the case of GSTs, and cellular detoxification generally, this suggests that the mechanisms of aging against which longevity assurance mechanisms act are, to some extent, lineage specific. PMID:17612391

Identification of Wnt Pathway Target Genes Regulating the Division and Differentiation of Larval Seam Cells and Vulval Precursor Cells in Caenorhabditis elegans

PubMed Central

Gorrepati, Lakshmi; Krause, Michael W.; Chen, Weiping; Brodigan, Thomas M.; Correa-Mendez, Margarita; Eisenmann, David M.

2015-01-01

The evolutionarily conserved Wnt/β-catenin signaling pathway plays a fundamental role during metazoan development, regulating numerous processes including cell fate specification, cell migration, and stem cell renewal. Wnt ligand binding leads to stabilization of the transcriptional effector β-catenin and upregulation of target gene expression to mediate a cellular response. During larval development of the nematode Caenorhabditis elegans, Wnt/β-catenin pathways act in fate specification of two hypodermal cell types, the ventral vulval precursor cells (VPCs) and the lateral seam cells. Because little is known about targets of the Wnt signaling pathways acting during larval VPC and seam cell differentiation, we sought to identify genes regulated by Wnt signaling in these two hypodermal cell types. We conditionally activated Wnt signaling in larval animals and performed cell type–specific "mRNA tagging" to enrich for VPC and seam cell–specific mRNAs, and then used microarray analysis to examine gene expression compared to control animals. Two hundred thirty-nine genes activated in response to Wnt signaling were identified, and we characterized 50 genes further. The majority of these genes are expressed in seam and/or vulval lineages during normal development, and reduction of function for nine genes caused defects in the proper division, fate specification, fate execution, or differentiation of seam cells and vulval cells. Therefore, the combination of these techniques was successful at identifying potential cell type–specific Wnt pathway target genes from a small number of cells and at increasing our knowledge of the specification and behavior of these C. elegans larval hypodermal cells. PMID:26048561

Identification of Wnt Pathway Target Genes Regulating the Division and Differentiation of Larval Seam Cells and Vulval Precursor Cells in Caenorhabditis elegans.

PubMed

Gorrepati, Lakshmi; Krause, Michael W; Chen, Weiping; Brodigan, Thomas M; Correa-Mendez, Margarita; Eisenmann, David M

2015-06-05

The evolutionarily conserved Wnt/β-catenin signaling pathway plays a fundamental role during metazoan development, regulating numerous processes including cell fate specification, cell migration, and stem cell renewal. Wnt ligand binding leads to stabilization of the transcriptional effector β-catenin and upregulation of target gene expression to mediate a cellular response. During larval development of the nematode Caenorhabditis elegans, Wnt/β-catenin pathways act in fate specification of two hypodermal cell types, the ventral vulval precursor cells (VPCs) and the lateral seam cells. Because little is known about targets of the Wnt signaling pathways acting during larval VPC and seam cell differentiation, we sought to identify genes regulated by Wnt signaling in these two hypodermal cell types. We conditionally activated Wnt signaling in larval animals and performed cell type-specific "mRNA tagging" to enrich for VPC and seam cell-specific mRNAs, and then used microarray analysis to examine gene expression compared to control animals. Two hundred thirty-nine genes activated in response to Wnt signaling were identified, and we characterized 50 genes further. The majority of these genes are expressed in seam and/or vulval lineages during normal development, and reduction of function for nine genes caused defects in the proper division, fate specification, fate execution, or differentiation of seam cells and vulval cells. Therefore, the combination of these techniques was successful at identifying potential cell type-specific Wnt pathway target genes from a small number of cells and at increasing our knowledge of the specification and behavior of these C. elegans larval hypodermal cells. Copyright © 2015 Gorrepati et al.

Gene editing for skin diseases: designer nucleases as tools for gene therapy of skin fragility disorders.

PubMed

March, Oliver P; Reichelt, Julia; Koller, Ulrich

2018-04-01

What is the topic of this review? This review concerns current gene editing strategies for blistering skin diseases with respect to individual genetic constellations and distinct conditions. What advances does it highlight? Specificity and safety dominate the discussion of gene editing applications for gene therapy, where a number of tools are implemented. Recent developments in this rapidly progressing field pose further questions regarding which tool is best suited for each particular use. The current treatment of inherited blistering skin diseases, such as epidermolysis bullosa (EB), is largely restricted to wound care and pain management. More effective therapeutic strategies are urgently required, and targeting the genetic basis of these severe diseases is now within reach. Here, we describe current gene editing tools and their potential to correct gene function in monogenetic blistering skin diseases. We present the features of the most frequently used gene editing techniques, transcription activator-like effector nuclease (TALEN) and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9), determining their preferential application for specific genetic conditions, including the type of mutational inheritance, the targeting site within the gene or the possibility to target the mutation specifically. Both tools have traits beneficial in specific situations. Promising developments in the field engender gene editing as a potentially powerful therapeutic option for future clinical applications. © 2017 The Authors. Experimental Physiology © 2017 The Physiological Society.

Whole-Genome Positive Selection and Habitat-Driven Evolution in a Shallow and a Deep-Sea Urchin

PubMed Central

Oliver, Thomas A.; Garfield, David A.; Manier, Mollie K.; Haygood, Ralph; Wray, Gregory A.; Palumbi, Stephen R.

2010-01-01

Comparisons of genomic sequence between divergent species can provide insight into the action of natural selection across many distinct classes of proteins. Here, we examine the extent of positive selection as a function of tissue-specific and stage-specific gene expression in two closely-related sea urchins, the shallow-water Strongylocentrotus purpuratus and the deep-sea Allocentrotus fragilis, which have diverged greatly in their adult but not larval habitats. Genes that are expressed specifically in adult somatic tissue have significantly higher dN/dS ratios than the genome-wide average, whereas those in larvae are indistinguishable from the genome-wide average. Testis-specific genes have the highest dN/dS values, whereas ovary-specific have the lowest. Branch-site models involving the outgroup S. franciscanus indicate greater selection (ωFG) along the A. fragilis branch than along the S. purpuratus branch. The A. fragilis branch also shows a higher proportion of genes under positive selection, including those involved in skeletal development, endocytosis, and sulfur metabolism. Both lineages are approximately equal in enrichment for positive selection of genes involved in immunity, development, and cell–cell communication. The branch-site models further suggest that adult-specific genes have experienced greater positive selection than those expressed in larvae and that ovary-specific genes are more conserved (i.e., experienced greater negative selection) than those expressed specifically in adult somatic tissues and testis. Our results chart the patterns of protein change that have occurred after habitat divergence in these two species and show that the developmental or functional context in which a gene acts can play an important role in how divergent species adapt to new environments. PMID:20935062

Microarray analysis reveals overlapping and specific transcriptional responses to different plant hormones in rice

PubMed Central

Garg, Rohini; Tyagi, Akhilesh K.; Jain, Mukesh

2012-01-01

Hormones exert pleiotropic effects on plant growth and development throughout the life cycle. Many of these effects are mediated at molecular level via altering gene expression. In this study, we investigated the exogenous effect of plant hormones, including auxin, cytokinin, abscisic acid, ethylene, salicylic acid and jasmonic acid, on the transcription of rice genes at whole genome level using microarray. Our analysis identified a total of 4171 genes involved in several biological processes, whose expression was altered significantly in the presence of different hormones. Further, 28% of these genes exhibited overlapping transcriptional responses in the presence of any two hormones, indicating crosstalk among plant hormones. In addition, we identified genes showing only a particular hormone-specific response, which can be used as hormone-specific markers. The results of this study will facilitate further studies in hormone biology in rice. PMID:22827941

Intrinsic limits to gene regulation by global crosstalk

PubMed Central

Friedlander, Tamar; Prizak, Roshan; Guet, Călin C.; Barton, Nicholas H.; Tkačik, Gašper

2016-01-01

Gene regulation relies on the specificity of transcription factor (TF)–DNA interactions. Limited specificity may lead to crosstalk: a regulatory state in which a gene is either incorrectly activated due to noncognate TF–DNA interactions or remains erroneously inactive. As each TF can have numerous interactions with noncognate cis-regulatory elements, crosstalk is inherently a global problem, yet has previously not been studied as such. We construct a theoretical framework to analyse the effects of global crosstalk on gene regulation. We find that crosstalk presents a significant challenge for organisms with low-specificity TFs, such as metazoans. Crosstalk is not easily mitigated by known regulatory schemes acting at equilibrium, including variants of cooperativity and combinatorial regulation. Our results suggest that crosstalk imposes a previously unexplored global constraint on the functioning and evolution of regulatory networks, which is qualitatively distinct from the known constraints that act at the level of individual gene regulatory elements. PMID:27489144

Identification and profiling of Cyprinus carpio microRNAs during ovary differentiation by deep sequencing.

PubMed

Wang, Fang; Jia, Yongfang; Wang, Po; Yang, Qianwen; Du, QiYan; Chang, ZhongJie

2017-04-28

MicroRNAs (miRNAs) are endogenous small non-coding RNAs that regulate gene expression by targeting specific mRNAs. However, the possible role of miRNAs in the ovary differentiation and development of fish is not well understood. In this study, we examined the expression profiles and differential expression of miRNAs during three key stages of ovarian development and different developmental stages in common carp Cyprinus carpio. A total of 8765 miRNAs were identified, including 2155 conserved miRNAs highly conserved among various species, 145 miRNAs registered in miRBase for common carp, and 6505 novel miRNAs identified in common carp for the first time. Comparison of miRNA expression profiles among the five libraries identified 714 co-expressed and 2382 specific expressed miRNAs. Overall, 150, 628, and 431 specifically expressed miRNAs were identified in primordial gonad, juvenile ovary, and adult ovary, respectively. MiR-6758-3p, miR-3050-5p, and miR-2985-3p were highly expressed in primordial gonad, miR-3544-5p, miR-6877-3p, and miR-9086-5p were highly expressed in juvenile ovary, and miR-154-3p, miR-5307-5p, and miR-3958-3p were highly expressed in adult ovary. Predicted target genes of specific miRNAs in primordial gonad were involved in many reproductive biology signaling pathways, including transforming growth factor-β, Wnt, oocyte meiosis, mitogen-activated protein kinase, Notch, p53, and gonadotropin-releasing hormone pathways. Target-gene prediction revealed upward trends in miRNAs targeting male-bias genes, including dmrt1, atm, gsdf, and sox9, and downward trends in miRNAs targeting female-bias genes including foxl2, smad3, and smad4. Other sex-related genes such as sf1 were also predicted to be miRNA target genes. This comprehensive miRNA transcriptome analysis demonstrated differential expression profiles of miRNAs during ovary development in common carp. These results could facilitate future exploitation of the sex-regulatory roles and mechanisms of miRNAs, especially in primordial gonads, while the specifically expressed miRNAs represent candidates for studying the mechanisms of ovary determination in Yellow River carp.

A Comprehensive Analysis of Transcript-Supported De Novo Genes in Saccharomyces sensu stricto Yeasts

PubMed Central

Lu, Tzu-Chiao; Leu, Jun-Yi; Lin, Wen-Chang

2017-01-01

Abstract Novel genes arising from random DNA sequences (de novo genes) have been suggested to be widespread in the genomes of different organisms. However, our knowledge about the origin and evolution of de novo genes is still limited. To systematically understand the general features of de novo genes, we established a robust pipeline to analyze >20,000 transcript-supported coding sequences (CDSs) from the budding yeast Saccharomyces cerevisiae. Our analysis pipeline combined phylogeny, synteny, and sequence alignment information to identify possible orthologs across 20 Saccharomycetaceae yeasts and discovered 4,340 S. cerevisiae-specific de novo genes and 8,871 S. sensu stricto-specific de novo genes. We further combine information on CDS positions and transcript structures to show that >65% of de novo genes arose from transcript isoforms of ancient genes, especially in the upstream and internal regions of ancient genes. Fourteen identified de novo genes with high transcript levels were chosen to verify their protein expressions. Ten of them, including eight transcript isoform-associated CDSs, showed translation signals and five proteins exhibited specific cytosolic localizations. Our results suggest that de novo genes frequently arise in the S. sensu stricto complex and have the potential to be quickly integrated into ancient cellular network. PMID:28981695

[The role of integrons in dissemination of antibiotic resistance].

PubMed

Ploy, M C; Lambert, T; Gassama, A; Denis, F

2000-01-01

Bacteria can transfer genetic information to get protection against most antibiotics. The acquisition of resistance genes involves genetic mobile elements such as plasmids and transposons. Another genetic structures, named integrons, have been described and contain one or more gene cassettes located at a specific site. Integrons contain an intI gene encoding a site-specific recombinase belonging to the integrase family and a recombination site attI. A gene cassette includes an open reading frame and, at the 3'-end, a recombination site attC. Integration or excision of cassettes occurs by a site-specific recombination mechanism catalyzed by the integrase. However, insertion can rarely occur, at non-specific sites leading to a stable situation for the cassette. Cassettes are transcribed from a common promoter located in the 5'-conserved segment and expression of distal genes is reduced by the presence of upstream cassettes. Most gene cassettes encode antibiotic resistant determinants but antiseptic resistant genes have also been described. Integrons seem to have a major role in the spread of multidrug resistance in Gram-negative bacteria but integrons in Gram-positive bacteria have been recently described. Moreover, the finding of super-integrons with gene cassettes coding for other determinants (biochemical functions, virulence factors) in different Gram negative bacteria suggests that integrons are probably implied in bacterial genome evolution.

Comparative genome analysis of Pseudomonas genomes including Populus-associated isolates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jun, Se Ran; Wassenaar, Trudy; Nookaew, Intawat

The Pseudomonas genus contains a metabolically versatile group of organisms that are known to occupy numerous ecological niches including the rhizosphere and endosphere of many plants influencing phylogenetic diversity and heterogeneity. In this study, comparative genome analysis was performed on over one thousand Pseudomonas genomes, including 21 Pseudomonas strains isolated from the roots of native Populus deltoides. Based on average amino acid identity, genomic clusters were identified within the Pseudomonas genus, which showed agreements with clades by NCBI and cliques by IMG. The P. fluorescens group was organized into 20 distinct genomic clusters, representing enormous diversity and heterogeneity. The speciesmore » P. aeruginosa showed clear distinction in their genomic relatedness compared to other Pseudomonas species groups based on the pan and core genome analysis. The 19 isolates of our 21 Populus-associated isolates formed three distinct subgroups within the P. fluorescens major group, supported by pathway profiles analysis, while two isolates were more closely related to P. chlororaphis and P. putida. The specific genes to Populus-associated subgroups were identified where genes specific to subgroup 1 include several sensory systems such as proteins which act in two-component signal transduction, a TonB-dependent receptor, and a phosphorelay sensor; specific genes to subgroup 2 contain unique hypothetical genes; and genes specific to subgroup 3 organisms have a different hydrolase activity. IMPORTANCE The comparative genome analyses of the genus Pseudomonas that included Populus-associated isolates resulted in novel insights into high diversity of Pseudomonas. Consistent and robust genomic clusters with phylogenetic homogeneity were identified, which resolved species-clades that are not clearly defined by 16S rRNA gene sequence analysis alone. The genomic clusters may be reflective of distinct ecological niches to which the organisms have adapted, but this needs to be experimentally characterized with ecologically relevant phenotype properties. This study justifies the need to sequence multiple isolates, especially from P. fluorescens group in order to study functional capabilities from a pangenomic perspective. This information will prove useful when choosing Pseudomonas strains for use to promote growth and increase disease resistance in plants.« less

Comparative genome analysis of Pseudomonas genomes including Populus-associated isolates

DOE PAGES

Jun, Se Ran; Wassenaar, Trudy; Nookaew, Intawat; ...

2016-01-01

The Pseudomonas genus contains a metabolically versatile group of organisms that are known to occupy numerous ecological niches including the rhizosphere and endosphere of many plants influencing phylogenetic diversity and heterogeneity. In this study, comparative genome analysis was performed on over one thousand Pseudomonas genomes, including 21 Pseudomonas strains isolated from the roots of native Populus deltoides. Based on average amino acid identity, genomic clusters were identified within the Pseudomonas genus, which showed agreements with clades by NCBI and cliques by IMG. The P. fluorescens group was organized into 20 distinct genomic clusters, representing enormous diversity and heterogeneity. The speciesmore » P. aeruginosa showed clear distinction in their genomic relatedness compared to other Pseudomonas species groups based on the pan and core genome analysis. The 19 isolates of our 21 Populus-associated isolates formed three distinct subgroups within the P. fluorescens major group, supported by pathway profiles analysis, while two isolates were more closely related to P. chlororaphis and P. putida. The specific genes to Populus-associated subgroups were identified where genes specific to subgroup 1 include several sensory systems such as proteins which act in two-component signal transduction, a TonB-dependent receptor, and a phosphorelay sensor; specific genes to subgroup 2 contain unique hypothetical genes; and genes specific to subgroup 3 organisms have a different hydrolase activity. IMPORTANCE The comparative genome analyses of the genus Pseudomonas that included Populus-associated isolates resulted in novel insights into high diversity of Pseudomonas. Consistent and robust genomic clusters with phylogenetic homogeneity were identified, which resolved species-clades that are not clearly defined by 16S rRNA gene sequence analysis alone. The genomic clusters may be reflective of distinct ecological niches to which the organisms have adapted, but this needs to be experimentally characterized with ecologically relevant phenotype properties. This study justifies the need to sequence multiple isolates, especially from P. fluorescens group in order to study functional capabilities from a pangenomic perspective. This information will prove useful when choosing Pseudomonas strains for use to promote growth and increase disease resistance in plants.« less

Dnmts and Tet target memory-associated genes after appetitive olfactory training in honey bees

PubMed Central

Biergans, Stephanie D.; Giovanni Galizia, C.; Reinhard, Judith; Claudianos, Charles

2015-01-01

DNA methylation and demethylation are epigenetic mechanisms involved in memory formation. In honey bees DNA methyltransferase (Dnmt) function is necessary for long-term memory to be stimulus specific (i.e. to reduce generalization). So far, however, it remains elusive which genes are targeted and what the time-course of DNA methylation is during memory formation. Here, we analyse how DNA methylation affects memory retention, gene expression, and differential methylation in stimulus-specific olfactory long-term memory formation. Out of 30 memory-associated genes investigated here, 9 were upregulated following Dnmt inhibition in trained bees. These included Dnmt3 suggesting a negative feedback loop for DNA methylation. Within these genes also the DNA methylation pattern changed during the first 24 hours after training. Interestingly, this was accompanied by sequential activation of the DNA methylation machinery (i.e. Dnmts and Tet). In sum, memory formation involves a temporally complex epigenetic regulation of memory-associated genes that facilitates stimulus specific long-term memory in the honey bee. PMID:26531238

The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development

PubMed Central

Ortega-Molina, Ana; Boss, Isaac W.; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W.; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A.; Gascoyne, Randy D.; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M.; Wendel, Hans-Guido

2015-01-01

The lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL). However, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center (GC) involution, impedes B cell differentiation and class switch recombination (CSR). Integrative genomic analyses indicate that KMT2D affects H3K4 methylation and expression of a specific set of genes including those in the CD40, JAK-STAT, Toll-like receptor, and B cell receptor pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3, and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell activating pathways. PMID:26366710

Maternal Diets Trigger Sex-Specific Divergent Trajectories of Gene Expression and Epigenetic Systems in Mouse Placenta

PubMed Central

Gabory, Anne; Ferry, Laure; Fajardy, Isabelle; Jouneau, Luc; Gothié, Jean-David; Vigé, Alexandre; Fleur, Cécile; Mayeur, Sylvain; Gallou-Kabani, Catherine; Gross, Marie-Sylvie; Attig, Linda; Vambergue, Anne; Lesage, Jean; Reusens, Brigitte; Vieau, Didier; Remacle, Claude; Jais, Jean-Philippe; Junien, Claudine

2012-01-01

Males and females responses to gestational overnutrition set the stage for subsequent sex-specific differences in adult onset non communicable diseases. Placenta, as a widely recognized programming agent, contibutes to the underlying processes. According to our previous findings, a high-fat diet during gestation triggers sex-specific epigenetic alterations within CpG and throughout the genome, together with the deregulation of clusters of imprinted genes. We further investigated the impact of diet and sex on placental histology, transcriptomic and epigenetic signatures in mice. Both basal gene expression and response to maternal high-fat diet were sexually dimorphic in whole placentas. Numerous genes showed sexually dimorphic expression, but only 11 genes regardless of the diet. In line with the key role of genes belonging to the sex chromosomes, 3 of these genes were Y-specific and 3 were X-specific. Amongst all the genes that were differentially expressed under a high-fat diet, only 16 genes were consistently affected in both males and females. The differences were not only quantitative but remarkably qualitative. The biological functions and networks of genes dysregulated differed markedly between the sexes. Seven genes of the epigenetic machinery were dysregulated, due to effects of diet, sex or both, including the Y- and X-linked histone demethylase paralogues Kdm5c and Kdm5d, which could mark differently male and female epigenomes. The DNA methyltransferase cofactor Dnmt3l gene expression was affected, reminiscent of our previous observation of changes in global DNA methylation. Overall, this striking sexual dimorphism of programming trajectories impose a considerable revision of the current dietary interventions protocols. PMID:23144842

Identification of fever and vaccine-associated gene interaction networks using ontology-based literature mining

PubMed Central

2012-01-01

Background Fever is one of the most common adverse events of vaccines. The detailed mechanisms of fever and vaccine-associated gene interaction networks are not fully understood. In the present study, we employed a genome-wide, Centrality and Ontology-based Network Discovery using Literature data (CONDL) approach to analyse the genes and gene interaction networks associated with fever or vaccine-related fever responses. Results Over 170,000 fever-related articles from PubMed abstracts and titles were retrieved and analysed at the sentence level using natural language processing techniques to identify genes and vaccines (including 186 Vaccine Ontology terms) as well as their interactions. This resulted in a generic fever network consisting of 403 genes and 577 gene interactions. A vaccine-specific fever sub-network consisting of 29 genes and 28 gene interactions was extracted from articles that are related to both fever and vaccines. In addition, gene-vaccine interactions were identified. Vaccines (including 4 specific vaccine names) were found to directly interact with 26 genes. Gene set enrichment analysis was performed using the genes in the generated interaction networks. Moreover, the genes in these networks were prioritized using network centrality metrics. Making scientific discoveries and generating new hypotheses were possible by using network centrality and gene set enrichment analyses. For example, our study found that the genes in the generic fever network were more enriched in cell death and responses to wounding, and the vaccine sub-network had more gene enrichment in leukocyte activation and phosphorylation regulation. The most central genes in the vaccine-specific fever network are predicted to be highly relevant to vaccine-induced fever, whereas genes that are central only in the generic fever network are likely to be highly relevant to generic fever responses. Interestingly, no Toll-like receptors (TLRs) were found in the gene-vaccine interaction network. Since multiple TLRs were found in the generic fever network, it is reasonable to hypothesize that vaccine-TLR interactions may play an important role in inducing fever response, which deserves a further investigation. Conclusions This study demonstrated that ontology-based literature mining is a powerful method for analyzing gene interaction networks and generating new scientific hypotheses. PMID:23256563

5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells

PubMed Central

Malashchuk, Igor; Lajoie, Brian R.; Mardaryev, Andrei N.; Gdula, Michal R.; Sharov, Andrey A.; Kohwi-Shigematsu, Terumi; Fessing, Michael Y.

2017-01-01

Mammalian genomes contain several dozens of large (>0.5 Mbp) lineage-specific gene loci harbouring functionally related genes. However, spatial chromatin folding, organization of the enhancer-promoter networks and their relevance to Topologically Associating Domains (TADs) in these loci remain poorly understood. TADs are principle units of the genome folding and represents the DNA regions within which DNA interacts more frequently and less frequently across the TAD boundary. Here, we used Chromatin Conformation Capture Carbon Copy (5C) technology to characterize spatial chromatin interaction network in the 3.1 Mb Epidermal Differentiation Complex (EDC) locus harbouring 61 functionally related genes that show lineage-specific activation during terminal keratinocyte differentiation in the epidermis. 5C data validated by 3D-FISH demonstrate that the EDC locus is organized into several TADs showing distinct lineage-specific chromatin interaction networks based on their transcription activity and the gene-rich or gene-poor status. Correlation of the 5C results with genome-wide studies for enhancer-specific histone modifications (H3K4me1 and H3K27ac) revealed that the majority of spatial chromatin interactions that involves the gene-rich TADs at the EDC locus in keratinocytes include both intra- and inter-TAD interaction networks, connecting gene promoters and enhancers. Compared to thymocytes in which the EDC locus is mostly transcriptionally inactive, these interactions were found to be keratinocyte-specific. In keratinocytes, the promoter-enhancer anchoring regions in the gene-rich transcriptionally active TADs are enriched for the binding of chromatin architectural proteins CTCF, Rad21 and chromatin remodeler Brg1. In contrast to gene-rich TADs, gene-poor TADs show preferential spatial contacts with each other, do not contain active enhancers and show decreased binding of CTCF, Rad21 and Brg1 in keratinocytes. Thus, spatial interactions between gene promoters and enhancers at the multi-TAD EDC locus in skin epithelial cells are cell type-specific and involve extensive contacts within TADs as well as between different gene-rich TADs, forming the framework for lineage-specific transcription. PMID:28863138

Lineage-specific evolution of cnidarian Wnt ligands.

PubMed

Hensel, Katrin; Lotan, Tamar; Sanders, Steve M; Cartwright, Paulyn; Frank, Uri

2014-09-01

We have studied the evolution of Wnt genes in cnidarians and the expression pattern of all Wnt ligands in the hydrozoan Hydractinia echinata. Current views favor a scenario in which 12 Wnt sub-families were jointly inherited by cnidarians and bilaterians from their last common ancestor. Our phylogenetic analyses clustered all medusozoan genes in distinct, well-supported clades, but many orthologous relationships between medusozoan Wnts and anthozoan and bilaterian Wnt genes were poorly supported. Only seven anthozoan genes, Wnt2, Wnt4, Wnt5, Wnt6, Wnt 10, Wnt11, and Wnt16 were recovered with strong support with bilaterian genes and of those, only the Wnt2, Wnt5, Wnt11, and Wnt16 clades also included medusozoan genes. Although medusozoan Wnt8 genes clustered with anthozoan and bilaterian genes, this was not well supported. In situ hybridization studies revealed poor conservation of expression patterns of putative Wnt orthologs within Cnidaria. In polyps, only Wnt1, Wnt3, and Wnt7 were expressed at the same position in the studied cnidarian models Hydra, Hydractinia, and Nematostella. Different expression patterns are consistent with divergent functions. Our data do not fully support previous assertions regarding Wnt gene homology, and suggest a more complex history of Wnt family genes than previously suggested. This includes high rates of sequence divergence and lineage-specific duplications of Wnt genes within medusozoans, followed by functional divergence over evolutionary time scales. © 2014 Wiley Periodicals, Inc.

Colloquium paper: uniquely human evolution of sialic acid genetics and biology.

PubMed

Varki, Ajit

2010-05-11

Darwinian evolution of humans from our common ancestors with nonhuman primates involved many gene-environment interactions at the population level, and the resulting human-specific genetic changes must contribute to the "Human Condition." Recent data indicate that the biology of sialic acids (which directly involves less than 60 genes) shows more than 10 uniquely human genetic changes in comparison with our closest evolutionary relatives. Known outcomes are tissue-specific changes in abundant cell-surface glycans, changes in specificity and/or expression of multiple proteins that recognize these glycans, and novel pathogen regimes. Specific events include Alu-mediated inactivation of the CMAH gene, resulting in loss of synthesis of the Sia N-glycolylneuraminic acid (Neu5Gc) and increase in expression of the precursor N-acetylneuraminic acid (Neu5Ac); increased expression of alpha2-6-linked Sias (likely because of changed expression of ST6GALI); and multiple changes in SIGLEC genes encoding Sia-recognizing Ig-like lectins (Siglecs). The last includes binding specificity changes (in Siglecs -5, -7, -9, -11, and -12); expression pattern changes (in Siglecs -1, -5, -6, and -11); gene conversion (SIGLEC11); and deletion or pseudogenization (SIGLEC13, SIGLEC14, and SIGLEC16). A nongenetic outcome of the CMAH mutation is human metabolic incorporation of foreign dietary Neu5Gc, in the face of circulating anti-Neu5Gc antibodies, generating a novel "xeno-auto-antigen" situation. Taken together, these data suggest that both the genes associated with Sia biology and the related impacts of the environment comprise a relative "hot spot" of genetic and physiological changes in human evolution, with implications for uniquely human features both in health and disease.

Gene-gene-environment interactions between drugs, transporters, receptors, and metabolizing enzymes: Statins, SLCO1B1, and CYP3A4 as an example.

PubMed

Sadee, Wolfgang

2013-09-01

Pharmacogenetic biomarker tests include mostly specific single gene-drug pairs, capable of accounting for a portion of interindividual variability in drug response and toxicity. However, multiple genes are likely to contribute, either acting independently or epistatically, with the CYP2C9-VKORC1-warfarin test panel, an example of a clinically used gene-gene-dug interaction. I discuss here further instances of gene-gene-drug interactions, including a proposed dynamic effect on statin therapy by genetic variants in both a transporter (SLCO1B1) and a metabolizing enzyme (CYP3A4) in liver cells, the main target site where statins block cholesterol synthesis. These examples set a conceptual framework for developing diagnostic panels involving multiple gene-drug combinations. Copyright © 2013 Wiley Periodicals, Inc.

Diploid/Polyploid Syntenic Shuttle Mapping and Haplotype-Specific Chromosome Walking Toward a Rust Resistance Gene (Bru1) in Highly Polyploid Sugarcane (2n ∼ 12x ∼ 115)

PubMed Central

Le Cunff, Loïc; Garsmeur, Olivier; Raboin, Louis Marie; Pauquet, Jérome; Telismart, Hugues; Selvi, Athiappan; Grivet, Laurent; Philippe, Romain; Begum, Dilara; Deu, Monique; Costet, Laurent; Wing, Rod; Glaszmann, Jean Christophe; D'Hont, Angélique

2008-01-01

The genome of modern sugarcane cultivars is highly polyploid (∼12x), aneuploid, of interspecific origin, and contains 10 Gb of DNA. Its size and complexity represent a major challenge for the isolation of agronomically important genes. Here we report on the first attempt to isolate a gene from sugarcane by map-based cloning, targeting a durable major rust resistance gene (Bru1). We describe the genomic strategies that we have developed to overcome constraints associated with high polyploidy in the successive steps of map-based cloning approaches, including diploid/polyploid syntenic shuttle mapping with two model diploid species (sorghum and rice) and haplotype-specific chromosome walking. Their applications allowed us (i) to develop a high-resolution map including markers at 0.28 and 0.14 cM on both sides and 13 markers cosegregating with Bru1 and (ii) to develop a physical map of the target haplotype that still includes two gaps at this stage due to the discovery of an insertion specific to this haplotype. These approaches will pave the way for the development of future map-based cloning approaches for sugarcane and other complex polyploid species. PMID:18757946

Understanding how long‐acting β2‐adrenoceptor agonists enhance the clinical efficacy of inhaled corticosteroids in asthma – an update

PubMed Central

Giembycz, Mark A

2016-01-01

In moderate‐to‐severe asthma, adding an inhaled long‐acting β2‐adenoceptor agonist (LABA) to an inhaled corticosteroid (ICS) provides better disease control than simply increasing the dose of ICS. Acting on the glucocorticoid receptor (GR, gene NR3C1), ICSs promote anti‐inflammatory/anti‐asthma gene expression. In vitro, LABAs synergistically enhance the maximal expression of many glucocorticoid‐induced genes. Other genes, including dual‐specificity phosphatase 1(DUSP1) in human airways smooth muscle (ASM) and epithelial cells, are up‐regulated additively by both drug classes. Synergy may also occur for LABA‐induced genes, as illustrated by the bronchoprotective gene, regulator of G‐protein signalling 2 (RGS2) in ASM. Such effects cannot be produced by either drug alone and may explain the therapeutic efficacy of ICS/LABA combination therapies. While the molecular basis of synergy remains unclear, mechanistic interpretations must accommodate gene‐specific regulation. We explore the concept that each glucocorticoid‐induced gene is an independent signal transducer optimally activated by a specific, ligand‐directed, GR conformation. In addition to explaining partial agonism, this realization provides opportunities to identify novel GR ligands that exhibit gene expression bias. Translating this into improved therapeutic ratios requires consideration of GR density in target tissues and further understanding of gene function. Similarly, the ability of a LABA to interact with a glucocorticoid may be suboptimal due to low β2‐adrenoceptor density or biased β2‐adrenoceptor signalling. Strategies to overcome these limitations include adding‐on a phosphodiesterase inhibitor and using agonists of other Gs‐coupled receptors. In all cases, the rational design of ICS/LABA, and derivative, combination therapies requires functional knowledge of induced (and repressed) genes for therapeutic benefit to be maximized. PMID:27646470

Identification of rhizome-specific genes by genome-wide differential expression Analysis in Oryza longistaminata

PubMed Central

2011-01-01

Background Rhizomatousness is a key component of perenniality of many grasses that contribute to competitiveness and invasiveness of many noxious grass weeds, but can potentially be used to develop perennial cereal crops for sustainable farmers in hilly areas of tropical Asia. Oryza longistaminata, a perennial wild rice with strong rhizomes, has been used as the model species for genetic and molecular dissection of rhizome development and in breeding efforts to transfer rhizome-related traits into annual rice species. In this study, an effort was taken to get insights into the genes and molecular mechanisms underlying the rhizomatous trait in O. longistaminata by comparative analysis of the genome-wide tissue-specific gene expression patterns of five different tissues of O. longistaminata using the Affymetrix GeneChip Rice Genome Array. Results A total of 2,566 tissue-specific genes were identified in five different tissues of O. longistaminata, including 58 and 61 unique genes that were specifically expressed in the rhizome tips (RT) and internodes (RI), respectively. In addition, 162 genes were up-regulated and 261 genes were down-regulated in RT compared to the shoot tips. Six distinct cis-regulatory elements (CGACG, GCCGCC, GAGAC, AACGG, CATGCA, and TAAAG) were found to be significantly more abundant in the promoter regions of genes differentially expressed in RT than in the promoter regions of genes uniformly expressed in all other tissues. Many of the RT and/or RI specifically or differentially expressed genes were located in the QTL regions associated with rhizome expression, rhizome abundance and rhizome growth-related traits in O. longistaminata and thus are good candidate genes for these QTLs. Conclusion The initiation and development of the rhizomatous trait in O. longistaminata are controlled by very complex gene networks involving several plant hormones and regulatory genes, different members of gene families showing tissue specificity and their regulated pathways. Auxin/IAA appears to act as a negative regulator in rhizome development, while GA acts as the activator in rhizome development. Co-localization of the genes specifically expressed in rhizome tips and rhizome internodes with the QTLs for rhizome traits identified a large set of candidate genes for rhizome initiation and development in rice for further confirmation. PMID:21261937

Deciphering Genome Content and Evolutionary Relationships of Isolates from the Fungus Magnaporthe oryzae Attacking Different Host Plants

PubMed Central

Chiapello, Hélène; Mallet, Ludovic; Guérin, Cyprien; Aguileta, Gabriela; Amselem, Joëlle; Kroj, Thomas; Ortega-Abboud, Enrique; Lebrun, Marc-Henri; Henrissat, Bernard; Gendrault, Annie; Rodolphe, François; Tharreau, Didier; Fournier, Elisabeth

2015-01-01

Deciphering the genetic bases of pathogen adaptation to its host is a key question in ecology and evolution. To understand how the fungus Magnaporthe oryzae adapts to different plants, we sequenced eight M. oryzae isolates differing in host specificity (rice, foxtail millet, wheat, and goosegrass), and one Magnaporthe grisea isolate specific of crabgrass. Analysis of Magnaporthe genomes revealed small variation in genome sizes (39–43 Mb) and gene content (12,283–14,781 genes) between isolates. The whole set of Magnaporthe genes comprised 14,966 shared families, 63% of which included genes present in all the nine M. oryzae genomes. The evolutionary relationships among Magnaporthe isolates were inferred using 6,878 single-copy orthologs. The resulting genealogy was mostly bifurcating among the different host-specific lineages, but was reticulate inside the rice lineage. We detected traces of introgression from a nonrice genome in the rice reference 70-15 genome. Among M. oryzae isolates and host-specific lineages, the genome composition in terms of frequencies of genes putatively involved in pathogenicity (effectors, secondary metabolism, cazome) was conserved. However, 529 shared families were found only in nonrice lineages, whereas the rice lineage possessed 86 specific families absent from the nonrice genomes. Our results confirmed that the host specificity of M. oryzae isolates was associated with a divergence between lineages without major gene flow and that, despite the strong conservation of gene families between lineages, adaptation to different hosts, especially to rice, was associated with the presence of a small number of specific gene families. All information was gathered in a public database (http://genome.jouy.inra.fr/gemo). PMID:26454013

New frontier in regenerative medicine: site-specific gene correction in patient-specific induced pluripotent stem cells.

PubMed

Garate, Zita; Davis, Brian R; Quintana-Bustamante, Oscar; Segovia, Jose C

2013-06-01

Advances in cell and gene therapy are opening up new avenues for regenerative medicine. Because of their acquired pluripotency, human induced pluripotent stem cells (hiPSCs) are a promising source of autologous cells for regenerative medicine. They show unlimited self-renewal while retaining the ability, in principle, to differentiate into any cell type of the human body. Since Yamanaka and colleagues first reported the generation of hiPSCs in 2007, significant efforts have been made to understand the reprogramming process and to generate hiPSCs with potential for clinical use. On the other hand, the development of gene-editing platforms to increase homologous recombination efficiency, namely DNA nucleases (zinc finger nucleases, TAL effector nucleases, and meganucleases), is making the application of locus-specific gene therapy in human cells an achievable goal. The generation of patient-specific hiPSC, together with gene correction by homologous recombination, will potentially allow for their clinical application in the near future. In fact, reports have shown targeted gene correction through DNA-Nucleases in patient-specific hiPSCs. Various technologies have been described to reprogram patient cells and to correct these patient hiPSCs. However, no approach has been clearly more efficient and safer than the others. In addition, there are still significant challenges for the clinical application of these technologies, such as inefficient differentiation protocols, genetic instability resulting from the reprogramming process and hiPSC culture itself, the efficacy and specificity of the engineered DNA nucleases, and the overall homologous recombination efficiency. To summarize advances in the generation of gene corrected patient-specific hiPSCs, this review focuses on the available technological platforms, including their strengths and limitations regarding future therapeutic use of gene-corrected hiPSCs.

Papain-like cysteine proteases in Carica papaya: lineage-specific gene duplication and expansion.

PubMed

Liu, Juan; Sharma, Anupma; Niewiara, Marie Jamille; Singh, Ratnesh; Ming, Ray; Yu, Qingyi

2018-01-06

Papain-like cysteine proteases (PLCPs), a large group of cysteine proteases structurally related to papain, play important roles in plant development, senescence, and defense responses. Papain, the first cysteine protease whose structure was determined by X-ray crystallography, plays a crucial role in protecting papaya from herbivorous insects. Except the four major PLCPs purified and characterized in papaya latex, the rest of the PLCPs in papaya genome are largely unknown. We identified 33 PLCP genes in papaya genome. Phylogenetic analysis clearly separated plant PLCP genes into nine subfamilies. PLCP genes are not equally distributed among the nine subfamilies and the number of PLCPs in each subfamily does not increase or decrease proportionally among the seven selected plant species. Papaya showed clear lineage-specific gene expansion in the subfamily III. Interestingly, all four major PLCPs purified from papaya latex, including papain, chymopapain, glycyl endopeptidase and caricain, were grouped into the lineage-specific expansion branch in the subfamily III. Mapping PLCP genes on chromosomes of five plant species revealed that lineage-specific expansions of PLCP genes were mostly derived from tandem duplications. We estimated divergence time of papaya PLCP genes of subfamily III. The major duplication events leading to lineage-specific expansion of papaya PLCP genes in subfamily III were estimated at 48 MYA, 34 MYA, and 16 MYA. The gene expression patterns of the papaya PLCP genes in different tissues were assessed by transcriptome sequencing and qRT-PCR. Most of the papaya PLCP genes of subfamily III expressed at high levels in leaf and green fruit tissues. Tandem duplications played the dominant role in affecting copy number of PLCPs in plants. Significant variations in size of the PLCP subfamilies among species may reflect genetic adaptation of plant species to different environments. The lineage-specific expansion of papaya PLCPs of subfamily III might have been promoted by the continuous reciprocal selective effects of herbivore attack and plant defense.

Expression profiles of urbilaterian genes uniquely shared between honey bee and vertebrates

PubMed Central

Matsui, Toshiaki; Yamamoto, Toshiyuki; Wyder, Stefan; Zdobnov, Evgeny M; Kadowaki, Tatsuhiko

2009-01-01

Background Large-scale comparison of metazoan genomes has revealed that a significant fraction of genes of the last common ancestor of Bilateria (Urbilateria) is lost in each animal lineage. This event could be one of the underlying mechanisms involved in generating metazoan diversity. However, the present functions of these ancient genes have not been addressed extensively. To understand the functions and evolutionary mechanisms of such ancient Urbilaterian genes, we carried out comprehensive expression profile analysis of genes shared between vertebrates and honey bees but not with the other sequenced ecdysozoan genomes (honey bee-vertebrate specific, HVS genes) as a model. Results We identified 30 honey bee and 55 mouse HVS genes. Many HVS genes exhibited tissue-selective expression patterns; intriguingly, the expression of 60% of honey bee HVS genes was found to be brain enriched, and 24% of mouse HVS genes were highly expressed in either or both the brain and testis. Moreover, a minimum of 38% of mouse HVS genes demonstrated neuron-enriched expression patterns, and 62% of them exhibited expression in selective brain areas, particularly the forebrain and cerebellum. Furthermore, gene ontology (GO) analysis of HVS genes predicted that 35% of genes are associated with DNA transcription and RNA processing. Conclusion These results suggest that HVS genes include genes that are biased towards expression in the brain and gonads. They also demonstrate that at least some of Urbilaterian genes retained in the specific animal lineage may be selectively maintained to support the species-specific phenotypes. PMID:19138430

Expression profiles of urbilaterian genes uniquely shared between honey bee and vertebrates.

PubMed

Matsui, Toshiaki; Yamamoto, Toshiyuki; Wyder, Stefan; Zdobnov, Evgeny M; Kadowaki, Tatsuhiko

2009-01-12

Large-scale comparison of metazoan genomes has revealed that a significant fraction of genes of the last common ancestor of Bilateria (Urbilateria) is lost in each animal lineage. This event could be one of the underlying mechanisms involved in generating metazoan diversity. However, the present functions of these ancient genes have not been addressed extensively. To understand the functions and evolutionary mechanisms of such ancient Urbilaterian genes, we carried out comprehensive expression profile analysis of genes shared between vertebrates and honey bees but not with the other sequenced ecdysozoan genomes (honey bee-vertebrate specific, HVS genes) as a model. We identified 30 honey bee and 55 mouse HVS genes. Many HVS genes exhibited tissue-selective expression patterns; intriguingly, the expression of 60% of honey bee HVS genes was found to be brain enriched, and 24% of mouse HVS genes were highly expressed in either or both the brain and testis. Moreover, a minimum of 38% of mouse HVS genes demonstrated neuron-enriched expression patterns, and 62% of them exhibited expression in selective brain areas, particularly the forebrain and cerebellum. Furthermore, gene ontology (GO) analysis of HVS genes predicted that 35% of genes are associated with DNA transcription and RNA processing. These results suggest that HVS genes include genes that are biased towards expression in the brain and gonads. They also demonstrate that at least some of Urbilaterian genes retained in the specific animal lineage may be selectively maintained to support the species-specific phenotypes.

Molecular dissection of prethymic progenitor entry into the T lymphocyte developmental pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fung, Elizabeth-sharon

2008-01-01

Notch signaling activates T lineage differentiation from hemopoietic progenitors, but relatively few regulators that initiate this program have been identified, e.g., GATA3 and T cell factor-I (TCF-1) (gene name Tcli). To identify additional regulators of T cell specification, a cDNA libnlrY from mouse Pro-T cells was screened for genes that are specifically up-regulated in intrathymic T cell precursors as compared with myeloid progenitors. Over 90 genes of interest were identified, and 35 of 44 tested were confirmed to be more highly expressed in T lineage precursors relative to precursors of B and/or myeloid lineage. To a remarkable extent, however, expressionmore » of these T lineage-enriched genes, including zinc finger transcription factor, helicase, and signaling adaptor genes, was also shared by stem cells (Lin{sup -}Sca-1{sup +}Kit{sup +}CD27{sup -}) and multipotent progenitors (Lin{sup -}Sca-l{sup +}Kit{sup +}CD27{sup +}), although down-regulated in other lineages. Thus, a major fraction of these early T lineage genes are a regulatory legacy from stem cells. The few genes sharply up-regulated between multipotent progenitors and Pro-T cell stages included those encoding transcription factors Bclllb, TCF-I (Tcli), and HEBalt, Notch target Deltexl, Deltex3L, Fkbp5, Eval, and Tmem13l. Like GATA3 and Deltexl, Bclllb, Fkbp5, and Eval were dependent on Notch/Delta signaling for induction in fetal liver precursors, but only BcIlI band HEBalt were up-regulated between the first two stages of intrathymic T cell development (double negative I and double negative 2) corresponding to T lineage specification. Bclllb was uniquely T lineage restricted and induced by NotchlDelta signaling specifically upon entry into the T lineage differentiation pathway.« less

Quantitative Proteomic and Microarray Analysis of the Archaeon Methanosarcina Acetivorans Grown with Acetate Versus Methanol*

PubMed Central

Li, Lingyun; Li, Qingbo; Rohlin, Lars; Kim, UnMi; Salmon, Kirsty; Rejtar, Tomas; Gunsalus, Robert P.; Karger, Barry L.; Ferry, James G.

2008-01-01

Summary Methanosarcina acetivorans strain C2A is an acetate- and methanol-utilizing methane-producing organism for which the genome, the largest yet sequenced among the Archaea, reveals extensive physiological diversity. LC linear ion trap-FTICR mass spectrometry was employed to analyze acetate- vs. methanol-grown cells metabolically labeled with 14N vs. 15N, respectively, to obtain quantitative protein abundance ratios. DNA microarray analyses of acetate- vs. methanol-grown cells was also performed to determine gene expression ratios. The combined approaches were highly complementary, extending the physiological understanding of growth and methanogenesis. Of the 1081 proteins detected, 255 were ≥ 3-fold differentially abundant. DNA microarray analysis revealed 410 genes that were ≥ 2.5-fold differentially expressed of 1972 genes with detected expression. The ratios of differentially abundant proteins were in good agreement with expression ratios of the encoding genes. Taken together, the results suggest several novel roles for electron transport components specific to acetate-grown cells, including two flavodoxins each specific for growth on acetate or methanol. Protein abundance ratios indicated that duplicate CO dehydrogenase/acetyl-CoA complexes function in the conversion of acetate to methane. Surprisingly, the protein abundance and gene expression ratios indicated a general stress response in acetate- vs. methanol-grown cells that included enzymes specific for polyphosphate accumulation and oxidative stress. The microarray analysis identified transcripts of several genes encoding regulatory proteins with identity to the PhoU, MarR, GlnK, and TetR families commonly found in the Bacteria domain. An analysis of neighboring genes suggested roles in controlling phosphate metabolism (PhoU), ammonia assimilation (GlnK), and molybdopterin cofactor biosynthesis (TetR). Finally, the proteomic and microarray results suggested roles for two-component regulatory systems specific for each growth substrate. PMID:17269732

Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.

PubMed

Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu

2017-08-01

Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.

Massive expression of germ cell-specific genes is a hallmark of cancer and a potential target for novel treatment development.

PubMed

Bruggeman, Jan Willem; Koster, Jan; Lodder, Paul; Repping, Sjoerd; Hamer, Geert

2018-06-15

Cancer cells have been found to frequently express genes that are normally restricted to the testis, often referred to as cancer/testis (CT) antigens or genes. Because germ cell-specific antigens are not recognized as "self" by the innate immune system, CT-genes have previously been suggested as ideal candidate targets for cancer therapy. The use of CT-genes in cancer therapy has thus far been unsuccessful, most likely because their identification has relied on gene expression in whole testis, including the testicular somatic cells, precluding the detection of true germ cell-specific genes. By comparing the transcriptomes of micro-dissected germ cell subtypes, representing the main developmental stages of human spermatogenesis, with the publicly accessible transcriptomes of 2617 samples from 49 different healthy somatic tissues and 9232 samples from 33 tumor types, we here discover hundreds of true germ cell-specific cancer expressed genes. Strikingly, we found these germ cell cancer genes (GC-genes) to be widely expressed in all analyzed tumors. Many GC-genes appeared to be involved in processes that are likely to actively promote tumor viability, proliferation and metastasis. Targeting these true GC-genes thus has the potential to inhibit tumor growth with infertility being the only possible side effect. Moreover, we identified a subset of GC-genes that are not expressed in spermatogonial stem cells. Targeting of this GC-gene subset is predicted to only lead to temporary infertility, as untargeted spermatogonial stem cells can recover spermatogenesis after treatment. Our GC-gene dataset enables improved understanding of tumor biology and provides multiple novel targets for cancer treatment.

Transcriptional Profiling of Caulobacter crescentus during Growth on Complex and Minimal Media

PubMed Central

Hottes, Alison K.; Meewan, Maliwan; Yang, Desiree; Arana, Naomi; Romero, Pedro; McAdams, Harley H.; Stephens, Craig

2004-01-01

Microarray analysis was used to examine gene expression in the freshwater oligotrophic bacterium Caulobacter crescentus during growth on three standard laboratory media, including peptone-yeast extract medium (PYE) and minimal salts medium with glucose or xylose as the carbon source. Nearly 400 genes (approximately 10% of the genome) varied significantly in expression between at least two of these media. The differentially expressed genes included many encoding transport systems, most notably diverse TonB-dependent outer membrane channels of unknown substrate specificity. Amino acid degradation pathways constituted the largest class of genes induced in PYE. In contrast, many of the genes upregulated in minimal media encoded enzymes for synthesis of amino acids, including incorporation of ammonia and sulfate into glutamate and cysteine. Glucose availability induced expression of genes encoding enzymes of the Entner-Doudoroff pathway, which was demonstrated here through mutational analysis to be essential in C. crescentus for growth on glucose. Xylose induced expression of genes encoding several hydrolytic exoenzymes as well as an operon that may encode a novel pathway for xylose catabolism. A conserved DNA motif upstream of many xylose-induced genes was identified and shown to confer xylose-specific expression. Xylose is an abundant component of xylan in plant cell walls, and the microarray data suggest that in addition to serving as a carbon source for growth of C. crescentus, this pentose may be interpreted as a signal to produce enzymes associated with plant polymer degradation. PMID:14973021

Shared liver-like transcriptional characteristics in liver metastases and corresponding primary colorectal tumors.

PubMed

Cheng, Jun; Song, Xuekun; Ao, Lu; Chen, Rou; Chi, Meirong; Guo, You; Zhang, Jiahui; Li, Hongdong; Zhao, Wenyuan; Guo, Zheng; Wang, Xianlong

2018-01-01

Background & Aims : Primary tumors of colorectal carcinoma (CRC) with liver metastasis might gain some liver-specific characteristics to adapt the liver micro-environment. This study aims to reveal potential liver-like transcriptional characteristics associated with the liver metastasis in primary colorectal carcinoma. Methods: Among the genes up-regulated in normal liver tissues versus normal colorectal tissues, we identified "liver-specific" genes whose expression levels ranked among the bottom 10% ("unexpressed") of all measured genes in both normal colorectal tissues and primary colorectal tumors without metastasis. These liver-specific genes were investigated for their expressions in both the primary tumors and the corresponding liver metastases of seven primary CRC patients with liver metastasis using microdissected samples. Results: Among the 3958 genes detected to be up-regulated in normal liver tissues versus normal colorectal tissues, we identified 12 liver-specific genes and found two of them, ANGPTL3 and CFHR5 , were unexpressed in microdissected primary colorectal tumors without metastasis but expressed in both microdissected liver metastases and corresponding primary colorectal tumors (Fisher's exact test, P < 0.05). Genes co-expressed with ANGPTL3 and CFHR5 were significantly enriched in metabolism pathways characterizing liver tissues, including "starch and sucrose metabolism" and "drug metabolism-cytochrome P450". Conclusions: For primary CRC with liver metastasis, both the liver metastases and corresponding primary colorectal tumors may express some liver-specific genes which may help the tumor cells adapt the liver micro-environment.

A Modified ABCDE Model of Flowering in Orchids Based on Gene Expression Profiling Studies of the Moth Orchid Phalaenopsis aphrodite

PubMed Central

Lee, Ann-Ying; Chen, Chun-Yi; Chang, Yao-Chien Alex; Chao, Ya-Ting; Shih, Ming-Che

2013-01-01

Previously we developed genomic resources for orchids, including transcriptomic analyses using next-generation sequencing techniques and construction of a web-based orchid genomic database. Here, we report a modified molecular model of flower development in the Orchidaceae based on functional analysis of gene expression profiles in Phalaenopsis aphrodite (a moth orchid) that revealed novel roles for the transcription factors involved in floral organ pattern formation. Phalaenopsis orchid floral organ-specific genes were identified by microarray analysis. Several critical transcription factors including AP3, PI, AP1 and AGL6, displayed distinct spatial distribution patterns. Phylogenetic analysis of orchid MADS box genes was conducted to infer the evolutionary relationship among floral organ-specific genes. The results suggest that gene duplication MADS box genes in orchid may have resulted in their gaining novel functions during evolution. Based on these analyses, a modified model of orchid flowering was proposed. Comparison of the expression profiles of flowers of a peloric mutant and wild-type Phalaenopsis orchid further identified genes associated with lip morphology and peloric effects. Large scale investigation of gene expression profiles revealed that homeotic genes from the ABCDE model of flower development classes A and B in the Phalaenopsis orchid have novel functions due to evolutionary diversification, and display differential expression patterns. PMID:24265826

Genomic determinants of sporulation in Bacilli and Clostridia: towards the minimal set of sporulation-specific genes

PubMed Central

Galperin, Michael Y; Mekhedov, Sergei L; Puigbo, Pere; Smirnov, Sergey; Wolf, Yuri I; Rigden, Daniel J

2012-01-01

Three classes of low-G+C Gram-positive bacteria (Firmicutes), Bacilli, Clostridia and Negativicutes, include numerous members that are capable of producing heat-resistant endospores. Spore-forming firmicutes include many environmentally important organisms, such as insect pathogens and cellulose-degrading industrial strains, as well as human pathogens responsible for such diseases as anthrax, botulism, gas gangrene and tetanus. In the best-studied model organism Bacillus subtilis, sporulation involves over 500 genes, many of which are conserved among other bacilli and clostridia. This work aimed to define the genomic requirements for sporulation through an analysis of the presence of sporulation genes in various firmicutes, including those with smaller genomes than B. subtilis. Cultivable spore-formers were found to have genomes larger than 2300 kb and encompass over 2150 protein-coding genes of which 60 are orthologues of genes that are apparently essential for sporulation in B. subtilis. Clostridial spore-formers lack, among others, spoIIB, sda, spoVID and safA genes and have non-orthologous displacements of spoIIQ and spoIVFA, suggesting substantial differences between bacilli and clostridia in the engulfment and spore coat formation steps. Many B. subtilis sporulation genes, particularly those encoding small acid-soluble spore proteins and spore coat proteins, were found only in the family Bacillaceae, or even in a subset of Bacillus spp. Phylogenetic profiles of sporulation genes, compiled in this work, confirm the presence of a common sporulation gene core, but also illuminate the diversity of the sporulation processes within various lineages. These profiles should help further experimental studies of uncharacterized widespread sporulation genes, which would ultimately allow delineation of the minimal set(s) of sporulation-specific genes in Bacilli and Clostridia. PMID:22882546

Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.

PubMed

Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin

2016-10-15

Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve  = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Sex-specific patterns and deregulation of endocrine pathways in the gene expression profiles of Bangladeshi adults exposed to arsenic contaminated drinking water

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muñoz, Alexandra; Chervona, Yana; Hall, Megan

Arsenic contamination of drinking water occurs globally and is associated with numerous diseases including skin, lung and bladder cancers, and cardiovascular disease. Recent research indicates that arsenic may be an endocrine disruptor. This study was conducted to evaluate the nature of gene expression changes among males and females exposed to arsenic contaminated water in Bangladesh at high and low doses. Twenty-nine (55% male) Bangladeshi adults with water arsenic exposure ranging from 50 to 1000 μg/L were selected from the Folic Acid Creatinine Trial. RNA was extracted from peripheral blood mononuclear cells for gene expression profiling using Affymetrix 1.0 ST arrays.more » Differentially expressed genes were assessed between high and low exposure groups for males and females separately and findings were validated using quantitative real-time PCR. There were 534 and 645 differentially expressed genes (p < 0.05) in the peripheral blood mononuclear cells of males and females, respectively, when high and low water arsenic exposure groups were compared. Only 43 genes overlapped between the two sexes, with 29 changing in opposite directions. Despite the difference in gene sets both males and females exhibited common biological changes including deregulation of 17β-hydroxysteroid dehydrogenase enzymes, deregulation of genes downstream of Sp1 (specificity protein 1) transcription factor, and prediction of estrogen receptor alpha as a key hub in cardiovascular networks. Arsenic-exposed adults exhibit sex-specific gene expression profiles that implicate involvement of the endocrine system. Due to arsenic's possible role as an endocrine disruptor, exposure thresholds for arsenic may require different parameters for males and females. - Highlights: • Males and females exhibit unique gene expression changes in response to arsenic. • Only 23 genes are common among the differentially expressed genes for the sexes. • Male and female gene lists exhibit common biological implications. • Both sexes exhibit deregulation of cardiovascular and endocrine pathways.« less

Transcriptional regulation of podocyte specification and differentiation.

PubMed

Quaggin, Susan E

2002-05-15

Glomerular visceral epithelial cells (podocytes) are highly specialized cells found in the vertebrate and invertebrate kidney and make up a major portion of the filtration barrier between blood and urinary spaces. During development, specification and differentiation of the podocyte lineage must be tightly orchestrated to produce highly specialized characteristics such as foot processes and slit diaphragms. Furthermore, podocytes are poised to direct incoming endothelial and mesangial cells during glomerular development. They express a number of growth factors that likely play a major role in these processes. Recent findings from transgenic and knockout mouse models and the identification of genes responsible for human podocyte disease have provided insight into transcriptional regulation of some of these processes. These transcription factors include Pax2, WT1 (the Wilms tumor suppressor gene), Pod1 (capsulin, epicardin), Kreisler (maf-1), lmx1b, and mf2. Furthermore, regulatory regions from a podocyte-restricted gene, NPHS1 (nephrin) that are required to direct podocyte-specific expression have been identified from both human and murine genes and provide a tool to further dissect the transcriptional regulation of podocyte-specific gene expression. This article reviews the present state of knowledge regarding transcriptional regulation of podocyte specification and differentiation. Copyright 2002 Wiley-Liss, Inc.

Design and verification of a pangenome microarray oligonucleotide probe set for Dehalococcoides spp.

PubMed

Hug, Laura A; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R; Edwards, Elizabeth A

2011-08-01

Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This "pangenome" probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with <99% average nucleotide identity. An in silico analysis of the expected probe hybridization against the recently released Dehalococcoides strain GT genome and additional KB-1 metagenome sequence data indicated that the pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined.

Genome-wide association identifies SLC2A9 and NLN gene regions as associated with entropion in domestic sheep

USDA-ARS?s Scientific Manuscript database

Background: Entropion is an inward rolling of the eyelid allowing contact between the eyelashes and cornea that may lead to blindness if not corrected. Although many mammalian species, including humans and dogs, are afflicted by congenital entropion, no specific genes or gene regions related to deve...

Involvement of astrocyte metabolic coupling in Tourette syndrome pathogenesis.

PubMed

de Leeuw, Christiaan; Goudriaan, Andrea; Smit, August B; Yu, Dongmei; Mathews, Carol A; Scharf, Jeremiah M; Verheijen, Mark H G; Posthuma, Danielle

2015-11-01

Tourette syndrome is a heritable neurodevelopmental disorder whose pathophysiology remains unknown. Recent genome-wide association studies suggest that it is a polygenic disorder influenced by many genes of small effect. We tested whether these genes cluster in cellular function by applying gene-set analysis using expert curated sets of brain-expressed genes in the current largest available Tourette syndrome genome-wide association data set, involving 1285 cases and 4964 controls. The gene sets included specific synaptic, astrocytic, oligodendrocyte and microglial functions. We report association of Tourette syndrome with a set of genes involved in astrocyte function, specifically in astrocyte carbohydrate metabolism. This association is driven primarily by a subset of 33 genes involved in glycolysis and glutamate metabolism through which astrocytes support synaptic function. Our results indicate for the first time that the process of astrocyte-neuron metabolic coupling may be an important contributor to Tourette syndrome pathogenesis.

Involvement of astrocyte metabolic coupling in Tourette syndrome pathogenesis

PubMed Central

de Leeuw, Christiaan; Goudriaan, Andrea; Smit, August B; Yu, Dongmei; Mathews, Carol A; Scharf, Jeremiah M; Scharf, J M; Pauls, D L; Yu, D; Illmann, C; Osiecki, L; Neale, B M; Mathews, C A; Reus, V I; Lowe, T L; Freimer, N B; Cox, N J; Davis, L K; Rouleau, G A; Chouinard, S; Dion, Y; Girard, S; Cath, D C; Posthuma, D; Smit, J H; Heutink, P; King, R A; Fernandez, T; Leckman, J F; Sandor, P; Barr, C L; McMahon, W; Lyon, G; Leppert, M; Morgan, J; Weiss, R; Grados, M A; Singer, H; Jankovic, J; Tischfield, J A; Heiman, G A; Verheijen, Mark H G; Posthuma, Danielle

2015-01-01

Tourette syndrome is a heritable neurodevelopmental disorder whose pathophysiology remains unknown. Recent genome-wide association studies suggest that it is a polygenic disorder influenced by many genes of small effect. We tested whether these genes cluster in cellular function by applying gene-set analysis using expert curated sets of brain-expressed genes in the current largest available Tourette syndrome genome-wide association data set, involving 1285 cases and 4964 controls. The gene sets included specific synaptic, astrocytic, oligodendrocyte and microglial functions. We report association of Tourette syndrome with a set of genes involved in astrocyte function, specifically in astrocyte carbohydrate metabolism. This association is driven primarily by a subset of 33 genes involved in glycolysis and glutamate metabolism through which astrocytes support synaptic function. Our results indicate for the first time that the process of astrocyte-neuron metabolic coupling may be an important contributor to Tourette syndrome pathogenesis. PMID:25735483

The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

PubMed

Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

2012-06-01

Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

Complex Roads from Genotype to Phenotype in Dilated Cardiomyopathy: Scientific update from the Working Group of Myocardial Function of the European Society of Cardiology

PubMed

Bondue, Antoine; Arbustini, Eloisa; Bianco, Anna M; Ciccarelli, Michele; Dawson, Dana; De Rosa, Matteo; Hamdani, Nazha; Hilfiker-Kleiner, Denise; Meder, Benjamin; Leite Moreira, Adelino; Thum, Thomas; Gabriele Tocchetti, Carlo; Varricchi, Gilda; Van der Velden, Jolanda; Walsh, Roddy; Heymans, Stephane

2018-05-23

Dilated cardiomyopathy (DCM) frequently affects relatively young, economically and socially active adults, and is an important cause of heart failure and transplantation. DCM is a complex disease and its pathological architecture encounters many genetic determinants interacting with environmental factors. The old perspective that every pathogenic gene mutation would lead to a diseased heart, is now being replaced by the novel observation that the phenotype depends not only on the penetrance -malignancy of the mutated gene- but also on epigenetics, age, toxic factors, pregnancy and a diversity of acquired diseases. This review discusses how gene mutations will result in mutation-specific molecular alterations in the heart including increased mitochondrial oxidation (sarcomeric gene e.g. TTN), decreased calcium sensitivity (sarcomeric genes), fibrosis (e.g. LMNA and TTN) or inflammation. Therefore, getting a complete picture of the DCM patient will include genomic data, molecular assessment by preference from cardiac samples, stratification according to co-morbidities, and phenotypic description. Those data will help to better guide the heart failure and anti-arrhythmic treatment, predict response to therapy, develop novel siRNA-based gene silencing for malignant gene mutations, or intervene with mutation-specific altered gene pathways in the heart.

Detection of histone modifications in plant leaves.

PubMed

Jaskiewicz, Michal; Peterhansel, Christoph; Conrath, Uwe

2011-09-23

Chromatin structure is important for the regulation of gene expression in eukaryotes. In this process, chromatin remodeling, DNA methylation, and covalent modifications on the amino-terminal tails of histones H3 and H4 play essential roles(1-2). H3 and H4 histone modifications include methylation of lysine and arginine, acetylation of lysine, and phosphorylation of serine residues(1-2). These modifications are associated either with gene activation, repression, or a primed state of gene that supports more rapid and robust activation of expression after perception of appropriate signals (microbe-associated molecular patterns, light, hormones, etc.)(3-7). Here, we present a method for the reliable and sensitive detection of specific chromatin modifications on selected plant genes. The technique is based on the crosslinking of (modified) histones and DNA with formaldehyde(8,9), extraction and sonication of chromatin, chromatin immunoprecipitation (ChIP) with modification-specific antibodies(9,10), de-crosslinking of histone-DNA complexes, and gene-specific real-time quantitative PCR. The approach has proven useful for detecting specific histone modifications associated with C(4;) photosynthesis in maize(5,11) and systemic immunity in Arabidopsis(3).

Genome-wide characterization of GRAS family genes in Medicago truncatula reveals their evolutionary dynamics and functional diversification

PubMed Central

Zhang, Hailing; Cao, Yingping; Shang, Chen; Li, Jikai; Wang, Jianli; Wu, Zhenying; Ma, Lichao; Qi, Tianxiong; Fu, Chunxiang; Hu, Baozhong

2017-01-01

The GRAS gene family is a large plant-specific family of transcription factors that are involved in diverse processes during plant development. Medicago truncatula is an ideal model plant for genetic research in legumes, and specifically for studying nodulation, which is crucial for nitrogen fixation. In this study, 59 MtGRAS genes were identified and classified into eight distinct subgroups based on phylogenetic relationships. Motifs located in the C-termini were conserved across the subgroups, while motifs in the N-termini were subfamily specific. Gene duplication was the main evolutionary force for MtGRAS expansion, especially proliferation of the LISCL subgroup. Seventeen duplicated genes showed strong effects of purifying selection and diverse expression patterns, highlighting their functional importance and diversification after duplication. Thirty MtGRAS genes, including NSP1 and NSP2, were preferentially expressed in nodules, indicating possible roles in the process of nodulation. A transcriptome study, combined with gene expression analysis under different stress conditions, suggested potential functions of MtGRAS genes in various biological pathways and stress responses. Taken together, these comprehensive analyses provide basic information for understanding the potential functions of GRAS genes, and will facilitate further discovery of MtGRAS gene functions. PMID:28945786

Uhrf1 is indispensable for normal limb growth by regulating chondrocyte differentiation through specific gene expression.

PubMed

Yamashita, Michiko; Inoue, Kazuki; Saeki, Noritaka; Ideta-Otsuka, Maky; Yanagihara, Yuta; Sawada, Yuichiro; Sakakibara, Iori; Lee, Jiwon; Ichikawa, Koichi; Kamei, Yoshiaki; Iimura, Tadahiro; Igarashi, Katsuhide; Takada, Yasutsugu; Imai, Yuuki

2018-01-08

Transcriptional regulation can be tightly orchestrated by epigenetic regulators. Among these, ubiquitin-like with PHD and RING finger domains 1 (Uhrf1) is reported to have diverse epigenetic functions, including regulation of DNA methylation. However, the physiological functions of Uhrf1 in skeletal tissues remain unclear. Here, we show that limb mesenchymal cell-specific Uhrf1 conditional knockout mice ( Uhrf1 Δ Limb/ Δ Limb ) exhibit remarkably shortened long bones that have morphological deformities due to dysregulated chondrocyte differentiation and proliferation. RNA-seq performed on primary cultured chondrocytes obtained from Uhrf1 Δ Limb/ Δ Limb mice showed abnormal chondrocyte differentiation. In addition, integrative analyses using RNA-seq and MBD-seq revealed that Uhrf1 deficiency decreased genome-wide DNA methylation and increased gene expression through reduced DNA methylation in the promoter regions of 28 genes, including Hspb1 , which is reported to be an IL1-related gene and to affect chondrocyte differentiation. Hspb1 knockdown in cKO chondrocytes can normalize abnormal expression of genes involved in chondrocyte differentiation, such as Mmp13 These results indicate that Uhrf1 governs cell type-specific transcriptional regulation by controlling the genome-wide DNA methylation status and regulating consequent cell differentiation and skeletal maturation. © 2018. Published by The Company of Biologists Ltd.

Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants.

PubMed

Luo, Ming; Gilbert, Brian; Ayliffe, Michael

2016-07-01

Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described.

A dermal HOX transcriptional program regulates site-specific epidermal fate

PubMed Central

Rinn, John L.; Wang, Jordon K.; Allen, Nancy; Brugmann, Samantha A.; Mikels, Amanda J.; Liu, Helen; Ridky, Todd W.; Stadler, H. Scott; Nusse, Roel; Helms, Jill A.; Chang, Howard Y.

2008-01-01

Reciprocal epithelial–mesenchymal interactions shape site-specific development of skin. Here we show that site-specific HOX expression in fibroblasts is cell-autonomous and epigenetically maintained. The distal-specific gene HOXA13 is continually required to maintain the distal-specific transcriptional program in adult fibroblasts, including expression of WNT5A, a morphogen required for distal development. The ability of distal fibroblasts to induce epidermal keratin 9, a distal-specific gene, is abrogated by depletion of HOXA13, but rescued by addition of WNT5A. Thus, maintenance of appropriate HOX transcriptional program in adult fibroblasts may serve as a source of positional memory to differentially pattern the epithelia during homeostasis and regeneration. PMID:18245445

A dermal HOX transcriptional program regulates site-specific epidermal fate.

PubMed

Rinn, John L; Wang, Jordon K; Allen, Nancy; Brugmann, Samantha A; Mikels, Amanda J; Liu, Helen; Ridky, Todd W; Stadler, H Scott; Nusse, Roel; Helms, Jill A; Chang, Howard Y

2008-02-01

Reciprocal epithelial-mesenchymal interactions shape site-specific development of skin. Here we show that site-specific HOX expression in fibroblasts is cell-autonomous and epigenetically maintained. The distal-specific gene HOXA13 is continually required to maintain the distal-specific transcriptional program in adult fibroblasts, including expression of WNT5A, a morphogen required for distal development. The ability of distal fibroblasts to induce epidermal keratin 9, a distal-specific gene, is abrogated by depletion of HOXA13, but rescued by addition of WNT5A. Thus, maintenance of appropriate HOX transcriptional program in adult fibroblasts may serve as a source of positional memory to differentially pattern the epithelia during homeostasis and regeneration.

Gene delivery systems by the combination of lipid bubbles and ultrasound.

PubMed

Negishi, Yoichi; Endo-Takahashi, Yoko; Maruyama, Kazuo

2016-11-28

Gene therapy is promising for the treatment of many diseases including cancers and genetic diseases. From the viewpoint of safety, ultrasound (US)-mediated gene delivery with nano/ microbubbles was recently developed as a novel non-viral vector system. US-mediated gene delivery using nano/microbubbles are able to produce transient changes in the permeability of the cell membrane after US-induced cavitation while reducing cellular damage and enables the tissue-specific or the site-specific intracellular delivery of gene both in vitro and in vivo. We have recently developed novel lipid nanobubbles (Lipid Bubbles). These nanobubbles can also be used to enhance the efficacy of the US-mediated genes (plasmid DNA, siRNA, and miRNA etc.) delivery. In this review, we describe US-mediated delivery systems combined with nano/microbubbles and discuss their feasibility as non-viral vector systems.

Two fatty acyl reductases involved in moth pheromone biosynthesis

PubMed Central

Antony, Binu; Ding, Bao-Jian; Moto, Ken’Ichi; Aldosari, Saleh A.; Aldawood, Abdulrahman S.

2016-01-01

Fatty acyl reductases (FARs) constitute an evolutionarily conserved gene family found in all kingdoms of life. Members of the FAR gene family play diverse roles, including seed oil synthesis, insect pheromone biosynthesis, and mammalian wax biosynthesis. In insects, FAR genes dedicated to sex pheromone biosynthesis (pheromone-gland-specific fatty acyl reductase, pgFAR) form a unique clade that exhibits substantial modifications in gene structure and possesses unique specificity and selectivity for fatty acyl substrates. Highly selective and semi-selective ‘single pgFARs’ produce single and multicomponent pheromone signals in bombycid, pyralid, yponomeutid and noctuid moths. An intriguing question is how a ‘single reductase’ can direct the synthesis of several fatty alcohols of various chain lengths and isomeric forms. Here, we report two active pgFARs in the pheromone gland of Spodoptera, namely a semi-selective, C14:acyl-specific pgFAR and a highly selective, C16:acyl-specific pgFAR, and demonstrate that these pgFARs play a pivotal role in the formation of species-specific signals, a finding that is strongly supported by functional gene expression data. The study envisages a new area of research for disclosing evolutionary changes associated with C14- and C16-specific FARs in moth pheromone biosynthesis. PMID:27427355

Deafness genes in Israel: implications for diagnostics in the clinic.

PubMed

Brownstein, Zippora; Avraham, Karen B

2009-08-01

The identification of the molecular basis of deafness in the last decade has made a remarkable impact on genetic counseling and diagnostics for the hearing impaired population. Since the discovery of the most prevalent form of deafness associated with mutations in the GJB2 (connexin 26) gene, many other genes have been found worldwide, with a subset of these, including unique mutations, in Israel. Here, we review the current status of deafness genes in Israel and report one known mutation in a syndromic form of deafness, Usher syndrome, described in the Jewish Israeli population for the first time. In the future, the identification of specific mutations may be relevant for specific types of treatment.

IDP-ASE: haplotyping and quantifying allele-specific expression at the gene and gene isoform level by hybrid sequencing

PubMed Central

Deonovic, Benjamin; Wang, Yunhao; Weirather, Jason; Wang, Xiu-Jie; Au, Kin Fai

2017-01-01

Abstract Allele-specific expression (ASE) is a fundamental problem in studying gene regulation and diploid transcriptome profiles, with two key challenges: (i) haplotyping and (ii) estimation of ASE at the gene isoform level. Existing ASE analysis methods are limited by a dependence on haplotyping from laborious experiments or extra genome/family trio data. In addition, there is a lack of methods for gene isoform level ASE analysis. We developed a tool, IDP-ASE, for full ASE analysis. By innovative integration of Third Generation Sequencing (TGS) long reads with Second Generation Sequencing (SGS) short reads, the accuracy of haplotyping and ASE quantification at the gene and gene isoform level was greatly improved as demonstrated by the gold standard data GM12878 data and semi-simulation data. In addition to methodology development, applications of IDP-ASE to human embryonic stem cells and breast cancer cells indicate that the imbalance of ASE and non-uniformity of gene isoform ASE is widespread, including tumorigenesis relevant genes and pluripotency markers. These results show that gene isoform expression and allele-specific expression cooperate to provide high diversity and complexity of gene regulation and expression, highlighting the importance of studying ASE at the gene isoform level. Our study provides a robust bioinformatics solution to understand ASE using RNA sequencing data only. PMID:27899656

The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation.

PubMed

Zhang, Hui; Zhang, Jinshan; Wei, Pengliang; Zhang, Botao; Gou, Feng; Feng, Zhengyan; Mao, Yanfei; Yang, Lan; Zhang, Heng; Xu, Nanfei; Zhu, Jian-Kang

2014-08-01

The CRISPR/Cas9 system has been demonstrated to efficiently induce targeted gene editing in a variety of organisms including plants. Recent work showed that CRISPR/Cas9-induced gene mutations in Arabidopsis were mostly somatic mutations in the early generation, although some mutations could be stably inherited in later generations. However, it remains unclear whether this system will work similarly in crops such as rice. In this study, we tested in two rice subspecies 11 target genes for their amenability to CRISPR/Cas9-induced editing and determined the patterns, specificity and heritability of the gene modifications. Analysis of the genotypes and frequency of edited genes in the first generation of transformed plants (T0) showed that the CRISPR/Cas9 system was highly efficient in rice, with target genes edited in nearly half of the transformed embryogenic cells before their first cell division. Homozygotes of edited target genes were readily found in T0 plants. The gene mutations were passed to the next generation (T1) following classic Mendelian law, without any detectable new mutation or reversion. Even with extensive searches including whole genome resequencing, we could not find any evidence of large-scale off-targeting in rice for any of the many targets tested in this study. By specifically sequencing the putative off-target sites of a large number of T0 plants, low-frequency mutations were found in only one off-target site where the sequence had 1-bp difference from the intended target. Overall, the data in this study point to the CRISPR/Cas9 system being a powerful tool in crop genome engineering. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming

2012-11-15

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catecholmore » enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.« less

Sexual dimorphic floral development in dioecious plants revealed by transcriptome, phytohormone, and DNA methylation analysis in Populus tomentosa.

PubMed

Song, Yuepeng; Ma, Kaifeng; Ci, Dong; Chen, Qingqing; Tian, Jiaxing; Zhang, Deqiang

2013-12-01

Dioecious plants have evolved sex-specific floral development mechanisms. However, the precise gene expression patterns in dioecious plant flower development remain unclear. Here, we used andromonoecious poplar, an exceptional model system, to eliminate the confounding effects of genetic background of dioecious plants. Comparative transcriptome and physiological analysis allowed us to characterize sex-specific development of female and male flowers. Transcriptome analysis identified genes significantly differentially expressed between the sexes, including genes related to floral development, phytohormone synthesis and metabolism, and DNA methylation. Correlation analysis revealed a significant correlation between phytohormone signaling and gene expression, identifying specific phytohormone-responsive genes and their cis-regulatory elements. Two genes related to DNA methylation, METHYLTRANSFERASE1 (MET1) and DECREASED DNA METHYLATION 1 (DDM1), which are located in the sex determination region of Chromosome XIX, have differential expression between female and male flowers. A time-course analysis revealed that MET1 and DDM1 expression may produce different DNA methylation levels in female and male flowers. Understanding the interactions of phytohormone signaling, DNA methylation and target gene expression should lead to a better understanding of sexual differences in floral development. Thus, this study identifies a set of candidate genes for further studies of poplar sexual dimorphism and relates sex-specific floral development to physiological and epigenetic changes.

Biomphalaria glabrata transcriptome: cDNA microarray profiling identifies resistant- and susceptible-specific gene expression in haemocytes from snail strains exposed to Schistosoma mansoni

PubMed Central

Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S

2008-01-01

Background Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. Results We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1α and EF-2. Conclusion Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination. PMID:19114004

Biomphalaria glabrata transcriptome: cDNA microarray profiling identifies resistant- and susceptible-specific gene expression in haemocytes from snail strains exposed to Schistosoma mansoni.

PubMed

Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S

2008-12-29

Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1alpha and EF-2. Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination.

Exome chip meta-analysis identifies novel loci and East Asian-specific coding variants that contribute to lipid levels and coronary artery disease.

PubMed

Lu, Xiangfeng; Peloso, Gina M; Liu, Dajiang J; Wu, Ying; Zhang, He; Zhou, Wei; Li, Jun; Tang, Clara Sze-Man; Dorajoo, Rajkumar; Li, Huaixing; Long, Jirong; Guo, Xiuqing; Xu, Ming; Spracklen, Cassandra N; Chen, Yang; Liu, Xuezhen; Zhang, Yan; Khor, Chiea Chuen; Liu, Jianjun; Sun, Liang; Wang, Laiyuan; Gao, Yu-Tang; Hu, Yao; Yu, Kuai; Wang, Yiqin; Cheung, Chloe Yu Yan; Wang, Feijie; Huang, Jianfeng; Fan, Qiao; Cai, Qiuyin; Chen, Shufeng; Shi, Jinxiu; Yang, Xueli; Zhao, Wanting; Sheu, Wayne H-H; Cherny, Stacey Shawn; He, Meian; Feranil, Alan B; Adair, Linda S; Gordon-Larsen, Penny; Du, Shufa; Varma, Rohit; Chen, Yii-Der Ida; Shu, Xiao-Ou; Lam, Karen Siu Ling; Wong, Tien Yin; Ganesh, Santhi K; Mo, Zengnan; Hveem, Kristian; Fritsche, Lars G; Nielsen, Jonas Bille; Tse, Hung-Fat; Huo, Yong; Cheng, Ching-Yu; Chen, Y Eugene; Zheng, Wei; Tai, E Shyong; Gao, Wei; Lin, Xu; Huang, Wei; Abecasis, Goncalo; Kathiresan, Sekar; Mohlke, Karen L; Wu, Tangchun; Sham, Pak Chung; Gu, Dongfeng; Willer, Cristen J

2017-12-01

Most genome-wide association studies have been of European individuals, even though most genetic variation in humans is seen only in non-European samples. To search for novel loci associated with blood lipid levels and clarify the mechanism of action at previously identified lipid loci, we used an exome array to examine protein-coding genetic variants in 47,532 East Asian individuals. We identified 255 variants at 41 loci that reached chip-wide significance, including 3 novel loci and 14 East Asian-specific coding variant associations. After a meta-analysis including >300,000 European samples, we identified an additional nine novel loci. Sixteen genes were identified by protein-altering variants in both East Asians and Europeans, and thus are likely to be functional genes. Our data demonstrate that most of the low-frequency or rare coding variants associated with lipids are population specific, and that examining genomic data across diverse ancestries may facilitate the identification of functional genes at associated loci.

APC alterations are frequently involved in the pathogenesis of acinar cell carcinoma of the pancreas, mainly through gene loss and promoter hypermethylation.

PubMed

Furlan, Daniela; Sahnane, Nora; Bernasconi, Barbara; Frattini, Milo; Tibiletti, Maria Grazia; Molinari, Francesca; Marando, Alessandro; Zhang, Lizhi; Vanoli, Alessandro; Casnedi, Selenia; Adsay, Volkan; Notohara, Kenji; Albarello, Luca; Asioli, Sofia; Sessa, Fausto; Capella, Carlo; La Rosa, Stefano

2014-05-01

Genetic and epigenetic alterations involved in the pathogenesis of pancreatic acinar cell carcinomas (ACCs) are poorly characterized, including the frequency and role of gene-specific hypermethylation, chromosome aberrations, and copy number alterations (CNAs). A subset of ACCs is known to show alterations in the APC/β-catenin pathway which includes mutations of APC gene. However, it is not known whether, in addition to mutation, loss of APC gene function can occur through alternative genetic and epigenetic mechanisms such as gene loss or promoter methylation. We investigated the global methylation profile of 34 tumor suppressor genes, CNAs of 52 chromosomal regions, and APC gene alterations (mutation, methylation, and loss) together with APC mRNA level in 45 ACCs and related peritumoral pancreatic tissues using methylation-specific multiplex ligation probe amplification (MS-MLPA), fluorescence in situ hybridization (FISH), mutation analysis, and reverse transcription-droplet digital PCR. ACCs did not show an extensive global gene hypermethylation profile. RASSF1 and APC were the only two genes frequently methylated. APC mutations were found in only 7 % of cases, while APC loss and methylation were more frequently observed (48 and 56 % of ACCs, respectively). APC mRNA low levels were found in 58 % of cases and correlated with CNAs. In conclusion, ACCs do not show extensive global gene hypermethylation. APC alterations are frequently involved in the pathogenesis of ACCs mainly through gene loss and promoter hypermethylation, along with reduction of APC mRNA levels.

Expression of Pax gene family members in the anthozoan cnidarian, Nematostella vectensis.

PubMed

Matus, David Q; Pang, Kevin; Daly, Meg; Martindale, Mark Q

2007-01-01

Pax genes are a family of homeodomain transcription factors that have been isolated from protostomes (e.g., eight in Drosophilia) and deuterostomes (e.g., nine in vertebrates) as well as outside the Bilateria, from sponges, a placozoan, and several classes of cnidarians. The genome of an anthozoan cnidarian, the starlet sea anemone, Nematostella vectensis, has been surveyed by both degenerate polymerase chain reaction and in silico for the presence of Pax genes. N. vectensis possesses seven Pax genes, which are orthologous to cnidarian Pax genes (A,B,C, and D) previously identified in another anthozoan, a coral, Acropora millepora. Phylogenetic analyses including data from nonchordate deuterostomes indicates that there were five Pax gene classes in the protostome-deuterostome ancestor, but only three in the cnidarian-bilaterian ancestor, with PaxD class genes lost in medusozoan cnidarians. Pax genes play diverse roles in bilaterians, including eye formation (e.g., Pax6), segmentation (e.g., Pax3/7 class genes), and neural patterning (e.g., Pox-neuro, Pax2/5/8). We show the first expression data for members of all four Pax classes in a single species of cnidarian. N. vectensis Pax genes are expressed in both a cell-type and region-specific manner during embryogenesis, and likely play a role in patterning specific components of the cnidarian ectodermal nerve net. The results of these patterns are discussed with respect to Pax gene evolution in the Bilateria.

Genetic and Molecular Characterization of the Caenorhabditis Elegans Spermatogenesis-Defective Gene Spe-17

PubMed Central

L'Hernault, S. W.; Benian, G. M.; Emmons, R. B.

1993-01-01

Two self-sterile mutations that define the spermatogenesis-defective gene spe-17 have been analyzed. These mutations affect unc-22 and fail to complement each other for both Unc-22 and spermatogenesis defects. Both of these mutations are deficiencies (hcDf1 and hDf13) that affect more than one transcription unit. Genomic DNA adjacent to and including the region deleted by the smaller deficiency (hcDf1) has been sequenced and four mRNAs (including unc-22) have been localized to this sequenced region. The three non unc-22 mRNAs are shown to be sex-specific: a 1.2-kb mRNA that can be detected in sperm-free hermaphrodites and 1.2- and 0.56-kb mRNAs found in males. hDf13 deletes at least 55 kb of chromosome IV, including all of unc-22, both male-specific mRNAs and at least part of the female-specific mRNA. hcDf1, which is approximately 15.6 kb, deletes only the 5' end of unc-22 and the gene that encodes the 0.56-kb male-specific mRNA. The common defect that apparently accounts for the defective sperm in hcDf1 and hDf13 homozygotes is deletion of the spe-17 gene, which encodes the 0.56-kb mRNA. Strains carrying two copies of either deletion are self-fertile when they are transgenic for any of four extrachromosomal array that include spe-17. We have sequenced two spe-17 cDNAs, and the deduced 142 amino acid protein sequence is highly charged and rich in serine and threonine, but shows no significant homology to any previously determined protein sequence. PMID:8349108

TRAM (Transcriptome Mapper): database-driven creation and analysis of transcriptome maps from multiple sources

PubMed Central

2011-01-01

Background Several tools have been developed to perform global gene expression profile data analysis, to search for specific chromosomal regions whose features meet defined criteria as well as to study neighbouring gene expression. However, most of these tools are tailored for a specific use in a particular context (e.g. they are species-specific, or limited to a particular data format) and they typically accept only gene lists as input. Results TRAM (Transcriptome Mapper) is a new general tool that allows the simple generation and analysis of quantitative transcriptome maps, starting from any source listing gene expression values for a given gene set (e.g. expression microarrays), implemented as a relational database. It includes a parser able to assign univocal and updated gene symbols to gene identifiers from different data sources. Moreover, TRAM is able to perform intra-sample and inter-sample data normalization, including an original variant of quantile normalization (scaled quantile), useful to normalize data from platforms with highly different numbers of investigated genes. When in 'Map' mode, the software generates a quantitative representation of the transcriptome of a sample (or of a pool of samples) and identifies if segments of defined lengths are over/under-expressed compared to the desired threshold. When in 'Cluster' mode, the software searches for a set of over/under-expressed consecutive genes. Statistical significance for all results is calculated with respect to genes localized on the same chromosome or to all genome genes. Transcriptome maps, showing differential expression between two sample groups, relative to two different biological conditions, may be easily generated. We present the results of a biological model test, based on a meta-analysis comparison between a sample pool of human CD34+ hematopoietic progenitor cells and a sample pool of megakaryocytic cells. Biologically relevant chromosomal segments and gene clusters with differential expression during the differentiation toward megakaryocyte were identified. Conclusions TRAM is designed to create, and statistically analyze, quantitative transcriptome maps, based on gene expression data from multiple sources. The release includes FileMaker Pro database management runtime application and it is freely available at http://apollo11.isto.unibo.it/software/, along with preconfigured implementations for mapping of human, mouse and zebrafish transcriptomes. PMID:21333005

Digital transcriptome analysis of putative sex-determination genes in papaya (Carica papaya).

PubMed

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Y(h)) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Y(h) chromosome, implying a loss of many genes on the Y(h) chromosome. Nevertheless, candidate Y(h) chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya.

Digital Transcriptome Analysis of Putative Sex-Determination Genes in Papaya (Carica papaya)

PubMed Central

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Yh) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Yh chromosome, implying a loss of many genes on the Yh chromosome. Nevertheless, candidate Yh chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya. PMID:22815863

Bacterial discrimination by Dictyostelid amoebae reveals the complexity of ancient interspecies interactions

PubMed Central

Nasser, Waleed; Santhanam, Balaji; Miranda, Edward Roshan; Parikh, Anup; Juneja, Kavina; Rot, Gregor; Dinh, Chris; Chen, Rui; Zupan, Blaz; Shaulsky, Gad; Kuspa, Adam

2014-01-01

Background Amoebae and bacteria interact within predator/prey and host/pathogen relationships, but the general response of amoeba to bacteria is not well understood. The amoeba Dictyostelium discoideum feeds on, and is colonized by diverse bacterial species including Gram-positive [Gram(+)] and Gram-negative [Gram(−)] bacteria, two major groups of bacteria that differ in structure and macromolecular composition. Results Transcriptional profiling of D. discoideum revealed sets of genes whose expression is enriched in amoebae interacting with different species of bacteria, including sets that appear specific to amoebae interacting with Gram(+), or with Gram(−) bacteria. In a genetic screen utilizing the growth of mutant amoebae on a variety of bacteria as a phenotypic readout, we identified amoebal genes that are only required for growth on Gram(+) bacteria, including one that encodes the cell surface protein gp130, as well as several genes that are only required for growth on Gram(−) bacteria including one that encodes a putative lysozyme, AlyL. These genes are required for parts of the transcriptional response of wild-type amoebae, and this allowed their classification into potential response pathways. Conclusions We have defined genes that are critical for amoebal survival during feeding on Gram(+), or Gram(−), bacteria which we propose form part of a regulatory network that allows D. discoideum to elicit specific cellular responses to different species of bacteria in order to optimize survival. PMID:23664307

PAGER 2.0: an update to the pathway, annotated-list and gene-signature electronic repository for Human Network Biology

PubMed Central

Yue, Zongliang; Zheng, Qi; Neylon, Michael T; Yoo, Minjae; Shin, Jimin; Zhao, Zhiying; Tan, Aik Choon

2018-01-01

Abstract Integrative Gene-set, Network and Pathway Analysis (GNPA) is a powerful data analysis approach developed to help interpret high-throughput omics data. In PAGER 1.0, we demonstrated that researchers can gain unbiased and reproducible biological insights with the introduction of PAGs (Pathways, Annotated-lists and Gene-signatures) as the basic data representation elements. In PAGER 2.0, we improve the utility of integrative GNPA by significantly expanding the coverage of PAGs and PAG-to-PAG relationships in the database, defining a new metric to quantify PAG data qualities, and developing new software features to simplify online integrative GNPA. Specifically, we included 84 282 PAGs spanning 24 different data sources that cover human diseases, published gene-expression signatures, drug–gene, miRNA–gene interactions, pathways and tissue-specific gene expressions. We introduced a new normalized Cohesion Coefficient (nCoCo) score to assess the biological relevance of genes inside a PAG, and RP-score to rank genes and assign gene-specific weights inside a PAG. The companion web interface contains numerous features to help users query and navigate the database content. The database content can be freely downloaded and is compatible with third-party Gene Set Enrichment Analysis tools. We expect PAGER 2.0 to become a major resource in integrative GNPA. PAGER 2.0 is available at http://discovery.informatics.uab.edu/PAGER/. PMID:29126216

Gene expression and metabolism preceding soft scald, a chilling injury of 'Honeycrisp' apple fruit.

PubMed

Leisso, Rachel S; Gapper, Nigel E; Mattheis, James P; Sullivan, Nathanael L; Watkins, Christopher B; Giovannoni, James J; Schaffer, Robert J; Johnston, Jason W; Hanrahan, Ines; Hertog, Maarten L A T M; Nicolaï, Bart M; Rudell, David R

2016-10-12

'Honeycrisp' is an apple cultivar that is susceptible to soft scald, a chilling injury expressed as necrotic patches on the peel. Improved understanding of metabolism associated with the disorder would improve our understanding of soft scald and contribute to developing more effective management strategies for apple storage. It was expected that specific gene expression and specific metabolite levels in the peel would be linked with soft scald risk at harvest and/or specific time points during cold storage. Fruit from nine 'Honeycrisp' apple orchards that would eventually develop different incidences of soft scald between 4 and 8 weeks of cold air storage were used to contrast and determine differential transcriptomic and metabolomic changes during storage. Untargeted metabolic profiling revealed changes in a number of distinct pathways preceding and concurrent with soft scald symptom development, including elevated γ-aminobutryic acid (GABA), 1-hexanol, acylated steryl glycosides, and free p-coumaryl acyl esters. At harvest, levels of sesquiterpenoid and triterpenoid acyl esters were relatively higher in peel of fruit that did not later develop the disorder. RNA-seq driven gene expression profiling highlighted possible involvement of genes and associated metabolic processes with soft scald development. These included elevated expression of genes involved in lipid peroxidation and phenolic metabolism in fruit with soft scald, and isoprenoid/brassinosteroid metabolism in fruit that did not develop soft scald. Expression of other stress-related genes in fruit that developed soft scald included chlorophyll catabolism, cell wall loosening, and lipid transport while superoxide dismutases were up-regulated in fruit that did not develop the disorder. This study delineates the sequential transcriptomic and metabolomic changes preceding soft scald symptom development. Changes were differential depending on susceptibility of fruit to the disorder and could be attributed to key stress related and mediating pathways.

Mutations within the HBc gene of the hepatitis B virus: a study on Iranian patients.

PubMed

Zare-Bidaki, Mohammad; Ayoobi, Fatemeh; Hassanshahi, Gholamhossein; Arababadi, Mohammad Kazemi; Mirzaei, Tayebeh; Darehdori, Ahmad Shebanizade; Kennedy, Derek

2014-01-01

Hepatitis B virus (HBV) is a serious risk factor for several severe liver diseases such as cirrhosis and hepatocellular carcinoma. HBV, like other viruses, uses several mechanisms to escape from specific immune responses including the use of mutations in the genome which lead to epitope variations. There are several immune responses, including T helper cells, cytotoxic T lymphocytes, and B cells, against the core antigen of HBV (HBcAg) that can lead to HBV eradication. Therefore, mutations within the HBc gene can lead to escape from immune responses by HBV and, hence, understanding the prevalence of HBc mutations among a specific population can be helpful for future treatment and vaccination. This review addresses the recent information regarding the prevalence of mutations within the HBc gene among Iranian HBV infected patients. The data presented here was collected gene sequences reported from Iran to the NCBI nucleotide Gen Bank. Results showed that the prevalence of HBc gene mutations is frequent in Iranian HBV infected patients. Based on our searches it seems that escape from immune responses is a plausible reason for the high prevalence of HBc gene mutations among Iranian HBV infected patients.

Learning contextual gene set interaction networks of cancer with condition specificity

PubMed Central

2013-01-01

Background Identifying similarities and differences in the molecular constitutions of various types of cancer is one of the key challenges in cancer research. The appearances of a cancer depend on complex molecular interactions, including gene regulatory networks and gene-environment interactions. This complexity makes it challenging to decipher the molecular origin of the cancer. In recent years, many studies reported methods to uncover heterogeneous depictions of complex cancers, which are often categorized into different subtypes. The challenge is to identify diverse molecular contexts within a cancer, to relate them to different subtypes, and to learn underlying molecular interactions specific to molecular contexts so that we can recommend context-specific treatment to patients. Results In this study, we describe a novel method to discern molecular interactions specific to certain molecular contexts. Unlike conventional approaches to build modular networks of individual genes, our focus is to identify cancer-generic and subtype-specific interactions between contextual gene sets, of which each gene set share coherent transcriptional patterns across a subset of samples, termed contextual gene set. We then apply a novel formulation for quantitating the effect of the samples from each subtype on the calculated strength of interactions observed. Two cancer data sets were analyzed to support the validity of condition-specificity of identified interactions. When compared to an existing approach, the proposed method was much more sensitive in identifying condition-specific interactions even in heterogeneous data set. The results also revealed that network components specific to different types of cancer are related to different biological functions than cancer-generic network components. We found not only the results that are consistent with previous studies, but also new hypotheses on the biological mechanisms specific to certain cancer types that warrant further investigations. Conclusions The analysis on the contextual gene sets and characterization of networks of interaction composed of these sets discovered distinct functional differences underlying various types of cancer. The results show that our method successfully reveals many subtype-specific regions in the identified maps of biological contexts, which well represent biological functions that can be connected to specific subtypes. PMID:23418942

Variants in the dopamine-4-receptor gene promoter are not associated with sensation seeking in skiers.

PubMed

Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L

2014-01-01

Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.

Chamber Specific Gene Expression Landscape of the Zebrafish Heart

PubMed Central

Singh, Angom Ramcharan; Sivadas, Ambily; Sabharwal, Ankit; Vellarikal, Shamsudheen Karuthedath; Jayarajan, Rijith; Verma, Ankit; Kapoor, Shruti; Joshi, Adita; Scaria, Vinod; Sivasubbu, Sridhar

2016-01-01

The organization of structure and function of cardiac chambers in vertebrates is defined by chamber-specific distinct gene expression. This peculiarity and uniqueness of the genetic signatures demonstrates functional resolution attributed to the different chambers of the heart. Altered expression of the cardiac chamber genes can lead to individual chamber related dysfunctions and disease patho-physiologies. Information on transcriptional repertoire of cardiac compartments is important to understand the spectrum of chamber specific anomalies. We have carried out a genome wide transcriptome profiling study of the three cardiac chambers in the zebrafish heart using RNA sequencing. We have captured the gene expression patterns of 13,396 protein coding genes in the three cardiac chambers—atrium, ventricle and bulbus arteriosus. Of these, 7,260 known protein coding genes are highly expressed (≥10 FPKM) in the zebrafish heart. Thus, this study represents nearly an all-inclusive information on the zebrafish cardiac transcriptome. In this study, a total of 96 differentially expressed genes across the three cardiac chambers in zebrafish were identified. The atrium, ventricle and bulbus arteriosus displayed 20, 32 and 44 uniquely expressing genes respectively. We validated the expression of predicted chamber-restricted genes using independent semi-quantitative and qualitative experimental techniques. In addition, we identified 23 putative novel protein coding genes that are specifically restricted to the ventricle and not in the atrium or bulbus arteriosus. In our knowledge, these 23 novel genes have either not been investigated in detail or are sparsely studied. The transcriptome identified in this study includes 68 differentially expressing zebrafish cardiac chamber genes that have a human ortholog. We also carried out spatiotemporal gene expression profiling of the 96 differentially expressed genes throughout the three cardiac chambers in 11 developmental stages and 6 tissue types of zebrafish. We hypothesize that clustering the differentially expressed genes with both known and unknown functions will deliver detailed insights on fundamental gene networks that are important for the development and specification of the cardiac chambers. It is also postulated that this transcriptome atlas will help utilize zebrafish in a better way as a model for studying cardiac development and to explore functional role of gene networks in cardiac disease pathogenesis. PMID:26815362

Genome-editing Technologies for Gene and Cell Therapy.

PubMed

Maeder, Morgan L; Gersbach, Charles A

2016-03-01

Gene therapy has historically been defined as the addition of new genes to human cells. However, the recent advent of genome-editing technologies has enabled a new paradigm in which the sequence of the human genome can be precisely manipulated to achieve a therapeutic effect. This includes the correction of mutations that cause disease, the addition of therapeutic genes to specific sites in the genome, and the removal of deleterious genes or genome sequences. This review presents the mechanisms of different genome-editing strategies and describes each of the common nuclease-based platforms, including zinc finger nucleases, transcription activator-like effector nucleases (TALENs), meganucleases, and the CRISPR/Cas9 system. We then summarize the progress made in applying genome editing to various areas of gene and cell therapy, including antiviral strategies, immunotherapies, and the treatment of monogenic hereditary disorders. The current challenges and future prospects for genome editing as a transformative technology for gene and cell therapy are also discussed.

Genome-editing Technologies for Gene and Cell Therapy

PubMed Central

Maeder, Morgan L; Gersbach, Charles A

2016-01-01

Gene therapy has historically been defined as the addition of new genes to human cells. However, the recent advent of genome-editing technologies has enabled a new paradigm in which the sequence of the human genome can be precisely manipulated to achieve a therapeutic effect. This includes the correction of mutations that cause disease, the addition of therapeutic genes to specific sites in the genome, and the removal of deleterious genes or genome sequences. This review presents the mechanisms of different genome-editing strategies and describes each of the common nuclease-based platforms, including zinc finger nucleases, transcription activator-like effector nucleases (TALENs), meganucleases, and the CRISPR/Cas9 system. We then summarize the progress made in applying genome editing to various areas of gene and cell therapy, including antiviral strategies, immunotherapies, and the treatment of monogenic hereditary disorders. The current challenges and future prospects for genome editing as a transformative technology for gene and cell therapy are also discussed. PMID:26755333

Virus-Plus-Susceptibility Gene Interaction Determines Crohn’s Disease Gene Atg16L1 Phenotypes in Intestine

PubMed Central

Cadwell, Ken; Patel, Khushbu K.; Maloney, Nicole S.; Liu, Ta-Chiang; Ng, Aylwin C.Y.; Storer, Chad E.; Head, Richard D.; Xavier, Ramnik; Stappenbeck, Thaddeus S.; Virgin, Herbert W.

2010-01-01

SUMMARY It is unclear why disease occurs in only a small proportion of persons carrying common risk alleles of disease susceptibility genes. Here we demonstrate that an interaction between a specific virus infection and a mutation in the Crohn’s disease susceptibility gene Atg16L1 induces intestinal pathologies in mice. This virus-plus-susceptibility gene interaction generated abnormalities in granule packaging and unique patterns of gene expression in Paneth cells. Further, the response to injury induced by the toxic substance dextran sodium sulfate was fundamentally altered to include pathologies resembling aspects of Crohn’s disease. These pathologies triggered by virus-plus-susceptibility gene interaction were dependent on TNFα and IFNγ and were prevented by treatment with broad spectrum antibiotics. Thus, we provide a specific example of how a virus-plus-susceptibility gene interaction can, in combination with additional environmental factors and commensal bacteria, determine the phenotype of hosts carrying common risk alleles for inflammatory disease. PMID:20602997

Functional and topological characteristics of mammalian regulatory domains

PubMed Central

Symmons, Orsolya; Uslu, Veli Vural; Tsujimura, Taro; Ruf, Sandra; Nassari, Sonya; Schwarzer, Wibke; Ettwiller, Laurence; Spitz, François

2014-01-01

Long-range regulatory interactions play an important role in shaping gene-expression programs. However, the genomic features that organize these activities are still poorly characterized. We conducted a large operational analysis to chart the distribution of gene regulatory activities along the mouse genome, using hundreds of insertions of a regulatory sensor. We found that enhancers distribute their activities along broad regions and not in a gene-centric manner, defining large regulatory domains. Remarkably, these domains correlate strongly with the recently described TADs, which partition the genome into distinct self-interacting blocks. Different features, including specific repeats and CTCF-binding sites, correlate with the transition zones separating regulatory domains, and may help to further organize promiscuously distributed regulatory influences within large domains. These findings support a model of genomic organization where TADs confine regulatory activities to specific but large regulatory domains, contributing to the establishment of specific gene expression profiles. PMID:24398455

Salient Features of Endonuclease Platforms for Therapeutic Genome Editing.

PubMed

Certo, Michael T; Morgan, Richard A

2016-03-01

Emerging gene-editing technologies are nearing a revolutionary phase in genetic medicine: precisely modifying or repairing causal genetic defects. This may include any number of DNA sequence manipulations, such as knocking out a deleterious gene, introducing a particular mutation, or directly repairing a defective sequence by site-specific recombination. All of these edits can currently be achieved via programmable rare-cutting endonucleases to create targeted DNA breaks that can engage and exploit endogenous DNA repair pathways to impart site-specific genetic changes. Over the past decade, several distinct technologies for introducing site-specific DNA breaks have been developed, yet the different biological origins of these gene-editing technologies bring along inherent differences in parameters that impact clinical implementation. This review aims to provide an accessible overview of the various endonuclease-based gene-editing platforms, highlighting the strengths and weakness of each with respect to therapeutic applications.

Salient Features of Endonuclease Platforms for Therapeutic Genome Editing

PubMed Central

Certo, Michael T; Morgan, Richard A

2016-01-01

Emerging gene-editing technologies are nearing a revolutionary phase in genetic medicine: precisely modifying or repairing causal genetic defects. This may include any number of DNA sequence manipulations, such as knocking out a deleterious gene, introducing a particular mutation, or directly repairing a defective sequence by site-specific recombination. All of these edits can currently be achieved via programmable rare-cutting endonucleases to create targeted DNA breaks that can engage and exploit endogenous DNA repair pathways to impart site-specific genetic changes. Over the past decade, several distinct technologies for introducing site-specific DNA breaks have been developed, yet the different biological origins of these gene-editing technologies bring along inherent differences in parameters that impact clinical implementation. This review aims to provide an accessible overview of the various endonuclease-based gene-editing platforms, highlighting the strengths and weakness of each with respect to therapeutic applications. PMID:26796671

Cellular and molecular mechanisms of HIV-1 integration targeting.

PubMed

Engelman, Alan N; Singh, Parmit K

2018-07-01

Integration is central to HIV-1 replication and helps mold the reservoir of cells that persists in AIDS patients. HIV-1 interacts with specific cellular factors to target integration to interior regions of transcriptionally active genes within gene-dense regions of chromatin. The viral capsid interacts with several proteins that are additionally implicated in virus nuclear import, including cleavage and polyadenylation specificity factor 6, to suppress integration into heterochromatin. The viral integrase protein interacts with transcriptional co-activator lens epithelium-derived growth factor p75 to principally position integration within gene bodies. The integrase additionally senses target DNA distortion and nucleotide sequence to help fine-tune the specific phosphodiester bonds that are cleaved at integration sites. Research into virus-host interactions that underlie HIV-1 integration targeting has aided the development of a novel class of integrase inhibitors and may help to improve the safety of viral-based gene therapy vectors.

Convergent losses of decay mechanisms and rapid turnover of symbiosis genes in mycorrhizal mutualists

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kohler, Annegret; Kuo, Alan; Nagy, Laszlo G.

To elucidate the genetic bases of mycorrhizal lifestyle evolution, we sequenced new fungal genomes, including 13 ectomycorrhizal (ECM), orchid (ORM) and ericoid (ERM) species, and five saprotrophs, which we analyzed along with other fungal genomes. Ectomycorrhizal fungi have a reduced complement of genes encoding plant cell wall-degrading enzymes (PCWDEs), as compared to their ancestral wood decayers. Nevertheless, they have retained a unique array of PCWDEs, thus suggesting that they possess diverse abilities to decompose lignocellulose. Similar functional categories of nonorthologous genes are induced in symbiosis. Of induced genes, 7-38% are orphan genes, including genes that encode secreted effector-like proteins. Convergentmore » evolution of the mycorrhizal habit in fungi occurred via the repeated evolution of a 'symbiosis toolkit', with reduced numbers of PCWDEs and lineage-specific suites of mycorrhiza-induced genes.« less

Convergent losses of decay mechanisms and rapid turnover of symbiosis genes in mycorrhizal mutualists

DOE PAGES

Kohler, Annegret; Kuo, Alan; Nagy, Laszlo G.; ...

2015-02-23

To elucidate the genetic bases of mycorrhizal lifestyle evolution, we sequenced new fungal genomes, including 13 ectomycorrhizal (ECM), orchid (ORM) and ericoid (ERM) species, and five saprotrophs, which we analyzed along with other fungal genomes. Ectomycorrhizal fungi have a reduced complement of genes encoding plant cell wall-degrading enzymes (PCWDEs), as compared to their ancestral wood decayers. Nevertheless, they have retained a unique array of PCWDEs, thus suggesting that they possess diverse abilities to decompose lignocellulose. Similar functional categories of nonorthologous genes are induced in symbiosis. Of induced genes, 7-38% are orphan genes, including genes that encode secreted effector-like proteins. Convergentmore » evolution of the mycorrhizal habit in fungi occurred via the repeated evolution of a 'symbiosis toolkit', with reduced numbers of PCWDEs and lineage-specific suites of mycorrhiza-induced genes.« less

The evolution of heart gene delivery vectors.

PubMed

Wasala, Nalinda B; Shin, Jin-Hong; Duan, Dongsheng

2011-10-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. Copyright © 2011 John Wiley & Sons, Ltd.

The evolution of heart gene delivery vectors

PubMed Central

Wasala, Nalinda B.; Shin, Jin-Hong; Duan, Dongsheng

2012-01-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. PMID:21837689

Specification, testing, and interpretation of gene-by-measured-environment interaction models in the presence of gene-environment correlation

PubMed Central

Rathouz, Paul J.; Van Hulle, Carol A.; Lee Rodgers, Joseph; Waldman, Irwin D.; Lahey, Benjamin B.

2009-01-01

Purcell (2002) proposed a bivariate biometric model for testing and quantifying the interaction between latent genetic influences and measured environments in the presence of gene-environment correlation. Purcell’s model extends the Cholesky model to include gene-environment interaction. We examine a number of closely-related alternative models that do not involve gene-environment interaction but which may fit the data as well Purcell’s model. Because failure to consider these alternatives could lead to spurious detection of gene-environment interaction, we propose alternative models for testing gene-environment interaction in the presence of gene-environment correlation, including one based on the correlated factors model. In addition, we note mathematical errors in the calculation of effect size via variance components in Purcell’s model. We propose a statistical method for deriving and interpreting variance decompositions that are true to the fitted model. PMID:18293078

Genome Editing in the Cricket, Gryllus bimaculatus.

PubMed

Watanabe, Takahito; Noji, Sumihare; Mito, Taro

2017-01-01

Hemimetabolous, or incompletely metamorphosing, insects are phylogenetically basal and include many beneficial and deleterious species. The cricket, Gryllus bimaculatus, is an emerging model for hemimetabolous insects, based on the success of RNA interference (RNAi)-based gene-functional analyses and transgenic technology. Taking advantage of genome editing technologies in this species would greatly promote functional genomics studies. Genome editing has proven to be an effective method for site-specific genome manipulation in various species. Here, we describe a protocol for genome editing including gene knockout and gene knockin in G. bimaculatus for functional genomics studies.

Genetic analysis of the response to eleven Colletotrichum lindemuthianum races in a RIL population of common bean (Phaseolus vulgaris L.)

PubMed Central

2014-01-01

Background Bean anthracnose is caused by the fungus Colletotrichum lindemuthianum (Sacc. & Magnus) Lams.- Scrib. Resistance to C. lindemuthianum in common bean (Phaseolus vulgaris L.) generally follows a qualitative mode of inheritance. The pathogen shows extensive pathogenic variation and up to 20 anthracnose resistance loci (named Co-), conferring resistance to specific races, have been described. Anthracnose resistance has generally been investigated by analyzing a limited number of isolates or races in segregating populations. In this work, we analyzed the response against eleven C. lindemuthianum races in a recombinant inbred line (RIL) common bean population derived from the cross Xana × Cornell 49242 in which a saturated linkage map was previously developed. Results A systematic genetic analysis was carried out to dissect the complex resistance segregations observed, which included contingency analyses, subpopulations and genetic mapping. Twenty two resistance genes were identified, some with a complementary mode of action. The Cornell 49242 genotype carries a complex cluster of resistance genes at the end of linkage group (LG) Pv11 corresponding to the previously described anthracnose resistance cluster Co-2. In this position, specific resistance genes to races 3, 6, 7, 19, 38, 39, 65, 357, 449 and 453 were identified, with one of them showing a complementary mode of action. In addition, Cornell 49242 had an independent gene on LG Pv09 showing a complementary mode of action for resistance to race 453. Resistance genes in genotype Xana were located on three regions involving LGs Pv01, Pv02 and Pv04. All resistance genes identified in Xana showed a complementary mode of action, except for two controlling resistance to races 65 and 73 located on LG Pv01, in the position of the previously described anthracnose resistance cluster Co-1. Conclusions Results shown herein reveal a complex and specific interaction between bean and fungus genotypes leading to anthracnose resistance. Organization of specific resistance genes in clusters including resistance genes with different modes of action (dominant and complementary genes) was also confirmed. Finally, new locations for anthracnose resistance genes were identified in LG Pv09. PMID:24779442

Examination of the genetic basis for sexual dimorphism in the Aedes aegypti (dengue vector mosquito) pupal brain

PubMed Central

2014-01-01

Background Most animal species exhibit sexually dimorphic behaviors, many of which are linked to reproduction. A number of these behaviors, including blood feeding in female mosquitoes, contribute to the global spread of vector-borne illnesses. However, knowledge concerning the genetic basis of sexually dimorphic traits is limited in any organism, including mosquitoes, especially with respect to differences in the developing nervous system. Methods Custom microarrays were used to examine global differences in female vs. male gene expression in the developing pupal head of the dengue vector mosquito, Aedes aegypti. The spatial expression patterns of a subset of differentially expressed transcripts were examined in the developing female vs. male pupal brain through in situ hybridization experiments. Small interfering RNA (siRNA)-mediated knockdown studies were used to assess the putative role of Doublesex, a terminal component of the sex determination pathway, in the regulation of sex-specific gene expression observed in the developing pupal brain. Results Transcripts (2,527), many of which were linked to proteolysis, the proteasome, metabolism, catabolic, and biosynthetic processes, ion transport, cell growth, and proliferation, were found to be differentially expressed in A. aegypti female vs. male pupal heads. Analysis of the spatial expression patterns for a subset of dimorphically expressed genes in the pupal brain validated the data set and also facilitated the identification of brain regions with dimorphic gene expression. In many cases, dimorphic gene expression localized to the optic lobe. Sex-specific differences in gene expression were also detected in the antennal lobe and mushroom body. siRNA-mediated gene targeting experiments demonstrated that Doublesex, a transcription factor with consensus binding sites located adjacent to many dimorphically expressed transcripts that function in neural development, is required for regulation of sex-specific gene expression in the developing A. aegypti brain. Conclusions These studies revealed sex-specific gene expression profiles in the developing A. aegypti pupal head and identified Doublesex as a key regulator of sexually dimorphic gene expression during mosquito neural development. PMID:25729562

Transcriptional Profiling of Ectoderm Specification to Keratinocyte Fate in Human Embryonic Stem Cells

PubMed Central

Tadeu, Ana Mafalda Baptista; Lin, Samantha; Hou, Lin; Chung, Lisa; Zhong, Mei; Zhao, Hongyu; Horsley, Valerie

2015-01-01

In recent years, several studies have shed light into the processes that regulate epidermal specification and homeostasis. We previously showed that a broad-spectrum γ–secretase inhibitor DAPT promoted early keratinocyte specification in human embryonic stem cells triggered to undergo ectoderm specification. Here, we show that DAPT accelerates human embryonic stem cell differentiation and induces expression of the ectoderm protein AP2. Furthermore, we utilize RNA sequencing to identify several candidate regulators of ectoderm specification including those involved in epithelial and epidermal development in human embryonic stem cells. Genes associated with transcriptional regulation and growth factor activity are significantly enriched upon DAPT treatment during specification of human embryonic stem cells to the ectoderm lineage. The human ectoderm cell signature identified in this study contains several genes expressed in ectodermal and epithelial tissues. Importantly, these genes are also associated with skin disorders and ectodermal defects, providing a platform for understanding the biology of human epidermal keratinocyte development under diseased and homeostatic conditions. PMID:25849374

Variable promoter methylation contributes to differential expression of key genes in human placenta-derived venous and arterial endothelial cells.

PubMed

Joo, Jihoon E; Hiden, Ursula; Lassance, Luciana; Gordon, Lavinia; Martino, David J; Desoye, Gernot; Saffery, Richard

2013-07-15

The endothelial compartment, comprising arterial, venous and lymphatic cell types, is established prenatally in association with rapid phenotypic and functional changes. The molecular mechanisms underpinning this process in utero have yet to be fully elucidated. The aim of this study was to investigate the potential for DNA methylation to act as a driver of the specific gene expression profiles of arterial and venous endothelial cells. Placenta-derived venous and arterial endothelial cells were collected at birth prior to culturing. DNA methylation was measured at >450,000 CpG sites in parallel with expression measurements taken from 25,000 annotated genes. A consistent set of genomic loci was found to show coordinate differential methylation between the arterial and venous cell types. This included many loci previously not investigated in relation to endothelial function. An inverse relationship was observed between gene expression and promoter methylation levels for a limited subset of genes implicated in endothelial function, including NOS3, encoding endothelial Nitric Oxide Synthase. Endothelial cells derived from the placental vasculature at birth contain widespread methylation of key regulatory genes. These are candidates involved in the specification of different endothelial cell types and represent potential target genes for environmentally mediated epigenetic disruption in utero in association with cardiovascular disease risk later in life.

Signaling events in pathogen-induced macrophage foam cell formation.

PubMed

Shaik-Dasthagirisaheb, Yazdani B; Mekasha, Samrawit; He, Xianbao; Gibson, Frank C; Ingalls, Robin R

2016-08-01

Macrophage foam cell formation is a key event in atherosclerosis. Several triggers induce low-density lipoprotein (LDL) uptake by macrophages to create foam cells, including infections with Porphyromonas gingivalis and Chlamydia pneumoniae, two pathogens that have been linked to atherosclerosis. While gene regulation during foam cell formation has been examined, comparative investigations to identify shared and specific pathogen-elicited molecular events relevant to foam cell formation are not well documented. We infected mouse bone marrow-derived macrophages with P. gingivalis or C. pneumoniae in the presence of LDL to induce foam cell formation, and examined gene expression using an atherosclerosis pathway targeted plate array. We found over 30 genes were significantly induced in response to both pathogens, including PPAR family members that are broadly important in atherosclerosis and matrix remodeling genes that may play a role in plaque development and stability. Six genes mainly involved in lipid transport were significantly downregulated. The response overall was remarkably similar and few genes were regulated in a pathogen-specific manner. Despite very divergent lifestyles, P. gingivalis and C. pneumoniae activate similar gene expression profiles during foam cell formation that may ultimately serve as targets for modulating infection-elicited foam cell burden, and progression of atherosclerosis. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

oPOSSUM: integrated tools for analysis of regulatory motif over-representation

PubMed Central

Ho Sui, Shannan J.; Fulton, Debra L.; Arenillas, David J.; Kwon, Andrew T.; Wasserman, Wyeth W.

2007-01-01

The identification of over-represented transcription factor binding sites from sets of co-expressed genes provides insights into the mechanisms of regulation for diverse biological contexts. oPOSSUM, an internet-based system for such studies of regulation, has been improved and expanded in this new release. New features include a worm-specific version for investigating binding sites conserved between Caenorhabditis elegans and C. briggsae, as well as a yeast-specific version for the analysis of co-expressed sets of Saccharomyces cerevisiae genes. The human and mouse applications feature improvements in ortholog mapping, sequence alignments and the delineation of multiple alternative promoters. oPOSSUM2, introduced for the analysis of over-represented combinations of motifs in human and mouse genes, has been integrated with the original oPOSSUM system. Analysis using user-defined background gene sets is now supported. The transcription factor binding site models have been updated to include new profiles from the JASPAR database. oPOSSUM is available at http://www.cisreg.ca/oPOSSUM/ PMID:17576675

A convex optimization approach for identification of human tissue-specific interactomes.

PubMed

Mohammadi, Shahin; Grama, Ananth

2016-06-15

Analysis of organism-specific interactomes has yielded novel insights into cellular function and coordination, understanding of pathology, and identification of markers and drug targets. Genes, however, can exhibit varying levels of cell type specificity in their expression, and their coordinated expression manifests in tissue-specific function and pathology. Tissue-specific/tissue-selective interaction mechanisms have significant applications in drug discovery, as they are more likely to reveal drug targets. Furthermore, tissue-specific transcription factors (tsTFs) are significantly implicated in human disease, including cancers. Finally, disease genes and protein complexes have the tendency to be differentially expressed in tissues in which defects cause pathology. These observations motivate the construction of refined tissue-specific interactomes from organism-specific interactomes. We present a novel technique for constructing human tissue-specific interactomes. Using a variety of validation tests (Edge Set Enrichment Analysis, Gene Ontology Enrichment, Disease-Gene Subnetwork Compactness), we show that our proposed approach significantly outperforms state-of-the-art techniques. Finally, using case studies of Alzheimer's and Parkinson's diseases, we show that tissue-specific interactomes derived from our study can be used to construct pathways implicated in pathology and demonstrate the use of these pathways in identifying novel targets. http://www.cs.purdue.edu/homes/mohammas/projects/ActPro.html mohammadi@purdue.edu. © The Author 2016. Published by Oxford University Press.

The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups.

PubMed

Curtis, Christina; Shah, Sohrab P; Chin, Suet-Feung; Turashvili, Gulisa; Rueda, Oscar M; Dunning, Mark J; Speed, Doug; Lynch, Andy G; Samarajiwa, Shamith; Yuan, Yinyin; Gräf, Stefan; Ha, Gavin; Haffari, Gholamreza; Bashashati, Ali; Russell, Roslin; McKinney, Steven; Langerød, Anita; Green, Andrew; Provenzano, Elena; Wishart, Gordon; Pinder, Sarah; Watson, Peter; Markowetz, Florian; Murphy, Leigh; Ellis, Ian; Purushotham, Arnie; Børresen-Dale, Anne-Lise; Brenton, James D; Tavaré, Simon; Caldas, Carlos; Aparicio, Samuel

2012-04-18

The elucidation of breast cancer subgroups and their molecular drivers requires integrated views of the genome and transcriptome from representative numbers of patients. We present an integrated analysis of copy number and gene expression in a discovery and validation set of 997 and 995 primary breast tumours, respectively, with long-term clinical follow-up. Inherited variants (copy number variants and single nucleotide polymorphisms) and acquired somatic copy number aberrations (CNAs) were associated with expression in ~40% of genes, with the landscape dominated by cis- and trans-acting CNAs. By delineating expression outlier genes driven in cis by CNAs, we identified putative cancer genes, including deletions in PPP2R2A, MTAP and MAP2K4. Unsupervised analysis of paired DNA–RNA profiles revealed novel subgroups with distinct clinical outcomes, which reproduced in the validation cohort. These include a high-risk, oestrogen-receptor-positive 11q13/14 cis-acting subgroup and a favourable prognosis subgroup devoid of CNAs. Trans-acting aberration hotspots were found to modulate subgroup-specific gene networks, including a TCR deletion-mediated adaptive immune response in the ‘CNA-devoid’ subgroup and a basal-specific chromosome 5 deletion-associated mitotic network. Our results provide a novel molecular stratification of the breast cancer population, derived from the impact of somatic CNAs on the transcriptome.

A systems-wide comparison of red rice (Oryza longistaminata) tissues identifies rhizome specific genes and proteins that are targets for cultivated rice improvement

PubMed Central

2014-01-01

Background The rhizome, the original stem of land plants, enables species to invade new territory and is a critical component of perenniality, especially in grasses. Red rice (Oryza longistaminata) is a perennial wild rice species with many valuable traits that could be used to improve cultivated rice cultivars, including rhizomatousness, disease resistance and drought tolerance. Despite these features, little is known about the molecular mechanisms that contribute to rhizome growth, development and function in this plant. Results We used an integrated approach to compare the transcriptome, proteome and metabolome of the rhizome to other tissues of red rice. 116 Gb of transcriptome sequence was obtained from various tissues and used to identify rhizome-specific and preferentially expressed genes, including transcription factors and hormone metabolism and stress response-related genes. Proteomics and metabolomics approaches identified 41 proteins and more than 100 primary metabolites and plant hormones with rhizome preferential accumulation. Of particular interest was the identification of a large number of gene transcripts from Magnaportha oryzae, the fungus that causes rice blast disease in cultivated rice, even though the red rice plants showed no sign of disease. Conclusions A significant set of genes, proteins and metabolites appear to be specifically or preferentially expressed in the rhizome of O. longistaminata. The presence of M. oryzae gene transcripts at a high level in apparently healthy plants suggests that red rice is resistant to this pathogen, and may be able to provide genes to cultivated rice that will enable resistance to rice blast disease. PMID:24521476

Knock down of Whitefly Gut Gene Expression and Mortality by Orally Delivered Gut Gene-Specific dsRNAs.

PubMed

Vyas, Meenal; Raza, Amir; Ali, Muhammad Yousaf; Ashraf, Muhammad Aleem; Mansoor, Shahid; Shahid, Ahmad Ali; Brown, Judith K

2017-01-01

Control of the whitefly Bemisia tabaci (Genn.) agricultural pest and plant virus vector relies on the use of chemical insecticides. RNA-interference (RNAi) is a homology-dependent innate immune response in eukaryotes, including insects, which results in degradation of the corresponding transcript following its recognition by a double-stranded RNA (dsRNA) that shares 100% sequence homology. In this study, six whitefly 'gut' genes were selected from an in silico-annotated transcriptome library constructed from the whitefly alimentary canal or 'gut' of the B biotype of B. tabaci, and tested for knock down efficacy, post-ingestion of dsRNAs that share 100% sequence homology to each respective gene target. Candidate genes were: Acetylcholine receptor subunit α, Alpha glucosidase 1, Aquaporin 1, Heat shock protein 70, Trehalase1, and Trehalose transporter1. The efficacy of RNAi knock down was further tested in a gene-specific functional bioassay, and mortality was recorded in 24 hr intervals, six days, post-treatment. Based on qPCR analysis, all six genes tested showed significantly reduced gene expression. Moderate-to-high whitefly mortality was associated with the down-regulation of osmoregulation, sugar metabolism and sugar transport-associated genes, demonstrating that whitefly survivability was linked with RNAi results. Silenced Acetylcholine receptor subunit α and Heat shock protein 70 genes showed an initial low whitefly mortality, however, following insecticide or high temperature treatments, respectively, significantly increased knockdown efficacy and death was observed, indicating enhanced post-knockdown sensitivity perhaps related to systemic silencing. The oral delivery of gut-specific dsRNAs, when combined with qPCR analysis of gene expression and a corresponding gene-specific bioassay that relates knockdown and mortality, offers a viable approach for functional genomics analysis and the discovery of prospective dsRNA biopesticide targets. The approach can be applied to functional genomics analyses to facilitate, species-specific dsRNA-mediated control of other non-model hemipterans.

Primary Airway Epithelial Cell Gene Editing Using CRISPR-Cas9.

PubMed

Everman, Jamie L; Rios, Cydney; Seibold, Max A

2018-01-01

The adaptation of the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated endonuclease 9 (CRISPR-Cas9) machinery from prokaryotic organisms has resulted in a gene editing system that is highly versatile, easily constructed, and can be leveraged to generate human cells knocked out (KO) for a specific gene. While standard transfection techniques can be used for the introduction of CRISPR-Cas9 expression cassettes to many cell types, delivery by this method is not efficient in many primary cell types, including primary human airway epithelial cells (AECs). More efficient delivery in AECs can be achieved through lentiviral-mediated transduction, allowing the CRISPR-Cas9 system to be integrated into the genome of the cell, resulting in stable expression of the nuclease machinery and increasing editing rates. In parallel, advancements have been made in the culture, expansion, selection, and differentiation of AECs, which allow the robust generation of a bulk edited AEC population from transduced cells. Applying these methods, we detail here our latest protocol to generate mucociliary epithelial cultures knocked out for a specific gene from donor-isolated primary human basal airway epithelial cells. This protocol includes methods to: (1) design and generate lentivirus which targets a specific gene for KO with CRISPR-Cas9 machinery, (2) efficiently transduce AECs, (3) culture and select for a bulk edited AEC population, (4) molecularly screen AECs for Cas9 cutting and specific sequence edits, and (5) further expand and differentiate edited cells to a mucociliary airway epithelial culture. The AEC knockouts generated using this protocol provide an excellent primary cell model system with which to characterize the function of genes involved in airway dysfunction and disease.

Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling.

PubMed

Liston, Adrian; Hardy, Kristine; Pittelkow, Yvonne; Wilson, Susan R; Makaroff, Lydia E; Fahrer, Aude M; Goodnow, Christopher C

2007-01-01

T cells in the thymus undergo opposing positive and negative selection processes so that the only T cells entering circulation are those bearing a T cell receptor (TCR) with a low affinity for self. The mechanism differentiating negative from positive selection is poorly understood, despite the fact that inherited defects in negative selection underlie organ-specific autoimmune disease in AIRE-deficient people and the non-obese diabetic (NOD) mouse strain Here we use homogeneous populations of T cells undergoing either positive or negative selection in vivo together with genome-wide transcription profiling on microarrays to identify the gene expression differences underlying negative selection to an Aire-dependent organ-specific antigen, including the upregulation of a genomic cluster in the cytogenetic band 2F. Analysis of defective negative selection in the autoimmune-prone NOD strain demonstrates a global impairment in the induction of the negative selection response gene set, but little difference in positive selection response genes. Combining expression differences with genetic linkage data, we identify differentially expressed candidate genes, including Bim, Bnip3, Smox, Pdrg1, Id1, Pdcd1, Ly6c, Pdia3, Trim30 and Trim12. The data provide a molecular map of the negative selection response in vivo and, by analysis of deviations from this pathway in the autoimmune susceptible NOD strain, suggest that susceptibility arises from small expression differences in genes acting at multiple points in the pathway between the TCR and cell death.

Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling

PubMed Central

Liston, Adrian; Hardy, Kristine; Pittelkow, Yvonne; Wilson, Susan R; Makaroff, Lydia E; Fahrer, Aude M; Goodnow, Christopher C

2007-01-01

Background T cells in the thymus undergo opposing positive and negative selection processes so that the only T cells entering circulation are those bearing a T cell receptor (TCR) with a low affinity for self. The mechanism differentiating negative from positive selection is poorly understood, despite the fact that inherited defects in negative selection underlie organ-specific autoimmune disease in AIRE-deficient people and the non-obese diabetic (NOD) mouse strain Results Here we use homogeneous populations of T cells undergoing either positive or negative selection in vivo together with genome-wide transcription profiling on microarrays to identify the gene expression differences underlying negative selection to an Aire-dependent organ-specific antigen, including the upregulation of a genomic cluster in the cytogenetic band 2F. Analysis of defective negative selection in the autoimmune-prone NOD strain demonstrates a global impairment in the induction of the negative selection response gene set, but little difference in positive selection response genes. Combining expression differences with genetic linkage data, we identify differentially expressed candidate genes, including Bim, Bnip3, Smox, Pdrg1, Id1, Pdcd1, Ly6c, Pdia3, Trim30 and Trim12. Conclusion The data provide a molecular map of the negative selection response in vivo and, by analysis of deviations from this pathway in the autoimmune susceptible NOD strain, suggest that susceptibility arises from small expression differences in genes acting at multiple points in the pathway between the TCR and cell death. PMID:17239257

Divergent branches of mitochondrial signaling regulate specific genes and the viability of specialized cell types of differentiated yeast colonies.

PubMed

Podholová, Kristýna; Plocek, Vítězslav; Rešetárová, Stanislava; Kučerová, Helena; Hlaváček, Otakar; Váchová, Libuše; Palková, Zdena

2016-03-29

Mitochondrial retrograde signaling mediates communication from altered mitochondria to the nucleus and is involved in many normal and pathophysiological changes, including cell metabolic reprogramming linked to cancer development and progression in mammals. The major mitochondrial retrograde pathway described in yeast includes three activators, Rtg1p, Rtg2p and Rtg3p, and repressors, Mks1p and Bmh1p/Bmh2p. Using differentiated yeast colonies, we show that Mks1p-Rtg pathway regulation is complex and includes three branches that divergently regulate the properties and fate of three specifically localized cell subpopulations via signals from differently altered mitochondria. The newly identified RTG pathway-regulated genes ATO1/ATO2 are expressed in colonial upper (U) cells, the cells with active TORC1 that metabolically resemble tumor cells, while CIT2 is a typical target induced in one subpopulation of starving lower (L) cells. The viability of the second L cell subpopulation is strictly dependent on RTG signaling. Additional co-activators of Rtg1p-Rtg3p specific to particular gene targets of each branch are required to regulate cell differentiation.

Functional Study of Genes Essential for Autogamy and Nuclear Reorganization in Paramecium▿§

PubMed Central

Nowak, Jacek K.; Gromadka, Robert; Juszczuk, Marek; Jerka-Dziadosz, Maria; Maliszewska, Kamila; Mucchielli, Marie-Hélène; Gout, Jean-François; Arnaiz, Olivier; Agier, Nicolas; Tang, Thomas; Aggerbeck, Lawrence P.; Cohen, Jean; Delacroix, Hervé; Sperling, Linda; Herbert, Christopher J.; Zagulski, Marek; Bétermier, Mireille

2011-01-01

Like all ciliates, Paramecium tetraurelia is a unicellular eukaryote that harbors two kinds of nuclei within its cytoplasm. At each sexual cycle, a new somatic macronucleus (MAC) develops from the germ line micronucleus (MIC) through a sequence of complex events, which includes meiosis, karyogamy, and assembly of the MAC genome from MIC sequences. The latter process involves developmentally programmed genome rearrangements controlled by noncoding RNAs and a specialized RNA interference machinery. We describe our first attempts to identify genes and biological processes that contribute to the progression of the sexual cycle. Given the high percentage of unknown genes annotated in the P. tetraurelia genome, we applied a global strategy to monitor gene expression profiles during autogamy, a self-fertilization process. We focused this pilot study on the genes carried by the largest somatic chromosome and designed dedicated DNA arrays covering 484 genes from this chromosome (1.2% of all genes annotated in the genome). Transcriptome analysis revealed four major patterns of gene expression, including two successive waves of gene induction. Functional analysis of 15 upregulated genes revealed four that are essential for vegetative growth, one of which is involved in the maintenance of MAC integrity and another in cell division or membrane trafficking. Two additional genes, encoding a MIC-specific protein and a putative RNA helicase localizing to the old and then to the new MAC, are specifically required during sexual processes. Our work provides a proof of principle that genes essential for meiosis and nuclear reorganization can be uncovered following genome-wide transcriptome analysis. PMID:21257794

Multiple Cross Displacement Amplification Coupled With Nanoparticles-Based Lateral Flow Biosensor for Detection of Staphylococcus aureus and Identification of Methicillin-Resistant S. aureus.

PubMed

Wang, Yi; Yan, Weiqiang; Fu, Shanshan; Hu, Shoukui; Wang, Yan; Xu, Jianguo; Ye, Changyun

2018-01-01

Staphylococcus aureus ( S. aureus ), including methicillin-resistant S. aureus (MRSA), is one of the most important human pathogens, which is responsible for bacteremia, soft-tissue infections, and food poisoning. Hence, multiple cross displacement amplification (MCDA) is employed to detect all S. aureus strains, and differentiates MRSA from methicillin-sensitive S. aureus . Multiplex MCDA (m-MCDA), which targets the nuc gene ( S. aureus -specific gene) and mecA gene (encoding penicillin-binding protein-2'), could detect S. aureus strains and identify MRSA within 85 min. Detection of the m-MCDA products is achieved using disposable lateral flow biosensors. A total of 58 strains, including various species of Gram-positive and Gram-negative strains, are used for evaluating and optimizing m-MCDA assays. The optimal amplification condition is found to be 63°C for 40 min, with detection limits at 100 fg DNA/reaction for nuc and mecA genes in the pure cultures, and 10 CFU/tube for nuc and mecA genes in the blood samples. The analytical specificity of m-MCDA assay is of 100%, and no cross-reactions to non- S. aureus strains are produced according to the specificity testing. Particularly, two additional components, including AUDG enzyme and dUTP, are added into the m-MCDA amplification mixtures, which are used for eliminating the unwanted results arising from carryover contamination. Thus, the m-MCDA technique appears to be a simple, rapid, sensitive, and reliable assay to detect all S. aureus strains, and identify MRSA infection for appropriate antibiotic therapy.

Mutation databases for inherited renal disease: are they complete, accurate, clinically relevant, and freely available?

PubMed

Savige, Judy; Dagher, Hayat; Povey, Sue

2014-07-01

This study examined whether gene-specific DNA variant databases for inherited diseases of the kidney fulfilled the Human Variome Project recommendations of being complete, accurate, clinically relevant and freely available. A recent review identified 60 inherited renal diseases caused by mutations in 132 genes. The disease name, MIM number, gene name, together with "mutation" or "database," were used to identify web-based databases. Fifty-nine diseases (98%) due to mutations in 128 genes had a variant database. Altogether there were 349 databases (a median of 3 per gene, range 0-6), but no gene had two databases with the same number of variants, and 165 (50%) databases included fewer than 10 variants. About half the databases (180, 54%) had been updated in the previous year. Few (77, 23%) were curated by "experts" but these included nine of the 11 with the most variants. Even fewer databases (41, 12%) included clinical features apart from the name of the associated disease. Most (223, 67%) could be accessed without charge, including those for 50 genes (40%) with the maximum number of variants. Future efforts should focus on encouraging experts to collaborate on a single database for each gene affected in inherited renal disease, including both unpublished variants, and clinical phenotypes. © 2014 WILEY PERIODICALS, INC.

Landscape of Conditional eQTL in Dorsolateral Prefrontal Cortex and Co-localization with Schizophrenia GWAS.

PubMed

Dobbyn, Amanda; Huckins, Laura M; Boocock, James; Sloofman, Laura G; Glicksberg, Benjamin S; Giambartolomei, Claudia; Hoffman, Gabriel E; Perumal, Thanneer M; Girdhar, Kiran; Jiang, Yan; Raj, Towfique; Ruderfer, Douglas M; Kramer, Robin S; Pinto, Dalila; Akbarian, Schahram; Roussos, Panos; Domenici, Enrico; Devlin, Bernie; Sklar, Pamela; Stahl, Eli A; Sieberts, Solveig K

2018-06-07

Causal genes and variants within genome-wide association study (GWAS) loci can be identified by integrating GWAS statistics with expression quantitative trait loci (eQTL) and determining which variants underlie both GWAS and eQTL signals. Most analyses, however, consider only the marginal eQTL signal, rather than dissect this signal into multiple conditionally independent signals for each gene. Here we show that analyzing conditional eQTL signatures, which could be important under specific cellular or temporal contexts, leads to improved fine mapping of GWAS associations. Using genotypes and gene expression levels from post-mortem human brain samples (n = 467) reported by the CommonMind Consortium (CMC), we find that conditional eQTL are widespread; 63% of genes with primary eQTL also have conditional eQTL. In addition, genomic features associated with conditional eQTL are consistent with context-specific (e.g., tissue-, cell type-, or developmental time point-specific) regulation of gene expression. Integrating the 2014 Psychiatric Genomics Consortium schizophrenia (SCZ) GWAS and CMC primary and conditional eQTL data reveals 40 loci with strong evidence for co-localization (posterior probability > 0.8), including six loci with co-localization of conditional eQTL. Our co-localization analyses support previously reported genes, identify novel genes associated with schizophrenia risk, and provide specific hypotheses for their functional follow-up. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Natural selection in avian protein-coding genes expressed in brain.

PubMed

Axelsson, Erik; Hultin-Rosenberg, Lina; Brandström, Mikael; Zwahlén, Martin; Clayton, David F; Ellegren, Hans

2008-06-01

The evolution of birds from theropod dinosaurs took place approximately 150 million years ago, and was associated with a number of specific adaptations that are still evident among extant birds, including feathers, song and extravagant secondary sexual characteristics. Knowledge about the molecular evolutionary background to such adaptations is lacking. Here, we analyse the evolution of > 5000 protein-coding gene sequences expressed in zebra finch brain by comparison to orthologous sequences in chicken. Mean d(N)/d(S) is 0.085 and genes with their maximal expression in the eye and central nervous system have the lowest mean d(N)/d(S) value, while those expressed in digestive and reproductive tissues exhibit the highest. We find that fast-evolving genes (those which have higher than expected rate of nonsynonymous substitution, indicative of adaptive evolution) are enriched for biological functions such as fertilization, muscle contraction, defence response, response to stress, wounding and endogenous stimulus, and cell death. After alignment to mammalian orthologues, we identify a catalogue of 228 genes that show a significantly higher rate of protein evolution in the two bird lineages than in mammals. These accelerated bird genes, representing candidates for avian-specific adaptations, include genes implicated in vocal learning and other cognitive processes. Moreover, colouration genes evolve faster in birds than in mammals, which may have been driven by sexual selection for extravagant plumage characteristics.

Abolishment of N-glycan mannosylphosphorylation in glyco-engineered Saccharomyces cerevisiae by double disruption of MNN4 and MNN14 genes.

PubMed

Kim, Yeong Hun; Kang, Ji-Yeon; Gil, Jin Young; Kim, Sang-Yoon; Shin, Keun Koo; Kang, Hyun Ah; Kim, Jeong-Yoon; Kwon, Ohsuk; Oh, Doo-Byoung

2017-04-01

Mannosylphosphorylated glycans are found only in fungi, including yeast, and the elimination of mannosylphosphates from glycans is a prerequisite for yeast glyco-engineering to produce human-compatible glycoproteins. In Saccharomyces cerevisiae, MNN4 and MNN6 genes are known to play roles in mannosylphosphorylation, but disruption of these genes does not completely remove the mannosylphosphates in N-glycans. This study was performed to find unknown key gene(s) involved in N-glycan mannosylphosphorylation in S. cerevisiae. For this purpose, each of one MNN4 and five MNN6 homologous genes were deleted from the och1Δmnn1Δmnn4Δmnn6Δ strain, which lacks yeast-specific hyper-mannosylation and the immunogenic α(1,3)-mannose structure. N-glycan profile analysis of cell wall mannoproteins and a secretory recombinant protein produced in mutants showed that the MNN14 gene, an MNN4 paralog with unknown function, is essential for N-glycan mannosylphosphorylation. Double disruption of MNN4 and MNN14 genes was enough to eliminate N-glycan mannosylphosphorylation. Our results suggest that the S. cerevisiae och1Δmnn1Δmnn4Δmnn14Δ strain, in which all yeast-specific N-glycan structures including mannosylphosphorylation are abolished, may have promise as a useful platform for glyco-engineering to produce therapeutic glycoproteins with human-compatible N-glycans.

Tbx2/3 is an essential mediator within the Brachyury gene network during Ciona notochord development

PubMed Central

José-Edwards, Diana S.; Oda-Ishii, Izumi; Nibu, Yutaka; Di Gregorio, Anna

2013-01-01

T-box genes are potent regulators of mesoderm development in many metazoans. In chordate embryos, the T-box transcription factor Brachyury (Bra) is required for specification and differentiation of the notochord. In some chordates, including the ascidian Ciona, members of the Tbx2 subfamily of T-box genes are also expressed in this tissue; however, their regulatory relationships with Bra and their contributions to the development of the notochord remain uncharacterized. We determined that the notochord expression of Ciona Tbx2/3 (Ci-Tbx2/3) requires Ci-Bra, and identified a Ci-Tbx2/3 notochord CRM that necessitates multiple Ci-Bra binding sites for its activity. Expression of mutant forms of Ci-Tbx2/3 in the developing notochord revealed a role for this transcription factor primarily in convergent extension. Through microarray screens, we uncovered numerous Ci-Tbx2/3 targets, some of which overlap with known Ci-Bra-downstream notochord genes. Among the Ci-Tbx2/3 notochord targets are evolutionarily conserved genes, including caspases, lineage-specific genes, such as Noto4, and newly identified genes, such as MLKL. This work sheds light on a large section of the notochord regulatory circuitry controlled by T-box factors, and reveals new components of the complement of genes required for the proper formation of this structure. PMID:23674602

Tbx2/3 is an essential mediator within the Brachyury gene network during Ciona notochord development.

PubMed

José-Edwards, Diana S; Oda-Ishii, Izumi; Nibu, Yutaka; Di Gregorio, Anna

2013-06-01

T-box genes are potent regulators of mesoderm development in many metazoans. In chordate embryos, the T-box transcription factor Brachyury (Bra) is required for specification and differentiation of the notochord. In some chordates, including the ascidian Ciona, members of the Tbx2 subfamily of T-box genes are also expressed in this tissue; however, their regulatory relationships with Bra and their contributions to the development of the notochord remain uncharacterized. We determined that the notochord expression of Ciona Tbx2/3 (Ci-Tbx2/3) requires Ci-Bra, and identified a Ci-Tbx2/3 notochord CRM that necessitates multiple Ci-Bra binding sites for its activity. Expression of mutant forms of Ci-Tbx2/3 in the developing notochord revealed a role for this transcription factor primarily in convergent extension. Through microarray screens, we uncovered numerous Ci-Tbx2/3 targets, some of which overlap with known Ci-Bra-downstream notochord genes. Among the Ci-Tbx2/3 notochord targets are evolutionarily conserved genes, including caspases, lineage-specific genes, such as Noto4, and newly identified genes, such as MLKL. This work sheds light on a large section of the notochord regulatory circuitry controlled by T-box factors, and reveals new components of the complement of genes required for the proper formation of this structure.

The Wright stuff: reimagining path analysis reveals novel components of the sex determination hierarchy in Drosophila melanogaster.

PubMed

Fear, Justin M; Arbeitman, Michelle N; Salomon, Matthew P; Dalton, Justin E; Tower, John; Nuzhdin, Sergey V; McIntyre, Lauren M

2015-09-04

The Drosophila sex determination hierarchy is a classic example of a transcriptional regulatory hierarchy, with sex-specific isoforms regulating morphology and behavior. We use a structural equation modeling approach, leveraging natural genetic variation from two studies on Drosophila female head tissues--DSPR collection (596 F1-hybrids from crosses between DSPR sub-populations) and CEGS population (75 F1-hybrids from crosses between DGRP/Winters lines to a reference strain w1118)--to expand understanding of the sex hierarchy gene regulatory network (GRN). This approach is completely generalizable to any natural population, including humans. We expanded the sex hierarchy GRN adding novel links among genes, including a link from fruitless (fru) to Sex-lethal (Sxl) identified in both populations. This link is further supported by the presence of fru binding sites in the Sxl locus. 754 candidate genes were added to the pathway, including the splicing factors male-specific lethal 2 and Rm62 as downstream targets of Sxl which are well-supported links in males. Independent studies of doublesex and transformer mutants support many additions, including evidence for a link between the sex hierarchy and metabolism, via Insulin-like receptor. The genes added in the CEGS population were enriched for genes with sex-biased splicing and components of the spliceosome. A common goal of molecular biologists is to expand understanding about regulatory interactions among genes. Using natural alleles we can not only identify novel relationships, but using supervised approaches can order genes into a regulatory hierarchy. Combining these results with independent large effect mutation studies, allows clear candidates for detailed molecular follow-up to emerge.

Evolution and diversification of the CYC/TB1 gene family in Asteraceae--a comparative study in Gerbera (Mutisieae) and sunflower (Heliantheae).

PubMed

Tähtiharju, Sari; Rijpkema, Anneke S; Vetterli, Adrien; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula

2012-04-01

Plant-specific TCP domain transcription factors have been shown to regulate morphological novelties during plant evolution, including the complex architecture of the Asteraceae inflorescence that involves different types of flowers. We conducted comparative analysis of the CYCLOIDEA/TEOSINTE BRANCHED1 (CYC/TB1) gene family in Gerbera hybrida (gerbera) and Helianthus annuus (sunflower), two species that represent distant tribes within Asteraceae. Our data confirm that the CYC/TB1 gene family has expanded in Asteraceae, a condition that appears to be connected with the increased developmental complexity and evolutionary success of this large plant family. Phylogenetic analysis of the CYC/TB1 gene family revealed both shared and lineage-specific duplications in gerbera and sunflower, corresponding to the three gene lineages previously identified as specific to core eudicots: CYC1, CYC2, and CYC3. Expression analyses of early stages of flower primordia development indicated that especially within the CYC2 clade, with the greatest number of secondary gene duplications, gene expression patterns are conserved between the species and associated with flower and inflorescence development. All sunflower and gerbera CYC2 clade genes showed differential expression between developing flower types, being upregulated in marginal ray (and trans) flowers. One gene in gerbera (GhCYC3) and two in sunflower (HaCYC2d and HaCYC2c) were indicated to be strong candidates as regulators of ray flower identity, a function that is specific for Asteraceae. Our data further showed that other CYC2 clade genes are likely to have more specialized functions at the level of single flowers, including the late functions in floral reproductive organs that may be more conserved across plant families. The expression patterns of CYC1 and CYC3 clade genes showed more differences between the two species but still pointed to possible conserved functions during vegetative plant development. Pairwise protein-protein interaction assays gave the first molecular evidence that CYC/TB1-like proteins function in complexes. Compared with sunflower, the gerbera proteins showed higher capacity for dimerization, between as well as within CYC clades. Our data from two distant species within the Asteraceae suggest that the expansion and the apparent conservation of especially the CYC2 clade CYC/TB1-like genes are associated with the evolution of the increased complexity of the Asteraceae inflorescence architecture.

Genome analysis of Listeria ivanovii strain G770 that caused a deadly aortic prosthesis infection

PubMed Central

Beye, M.; Gouriet, F.; Michelle, C.; Casalta, J.-P.; Habib, G.; Raoult, D.; Fournier, P.-E.

2016-01-01

We sequenced the genome of Listeria ivanovii strain G770, which caused a deadly infection of the thoracic aortic prosthesis of a 78-year-old man. The 2.9 Mb genome exhibited 21 specific genes among L. ivanovii strains, including five genes encoding a type I restriction modification system and one glycopeptide resistance gene. PMID:26933501

A genome-wide SNP scan accelerates trait-regulatory genomic loci identification in chickpea

PubMed Central

Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C.L.L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

We identified 44844 high-quality SNPs by sequencing 92 diverse chickpea accessions belonging to a seed and pod trait-specific association panel using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays. A GWAS (genome-wide association study) in an association panel of 211, including the 92 sequenced accessions, identified 22 major genomic loci showing significant association (explaining 23–47% phenotypic variation) with pod and seed number/plant and 100-seed weight. Eighteen trait-regulatory major genomic loci underlying 13 robust QTLs were validated and mapped on an intra-specific genetic linkage map by QTL mapping. A combinatorial approach of GWAS, QTL mapping and gene haplotype-specific LD mapping and transcript profiling uncovered one superior haplotype and favourable natural allelic variants in the upstream regulatory region of a CesA-type cellulose synthase (Ca_Kabuli_CesA3) gene regulating high pod and seed number/plant (explaining 47% phenotypic variation) in chickpea. The up-regulation of this superior gene haplotype correlated with increased transcript expression of Ca_Kabuli_CesA3 gene in the pollen and pod of high pod/seed number accession, resulting in higher cellulose accumulation for normal pollen and pollen tube growth. A rapid combinatorial genome-wide SNP genotyping-based approach has potential to dissect complex quantitative agronomic traits and delineate trait-regulatory genomic loci (candidate genes) for genetic enhancement in crop plants, including chickpea. PMID:26058368

Isolation and partial characterization of a root-specific promoter for stacking multiple traits into cassava (Manihot esculenta CRANTZ).

PubMed

Gbadegesin, M A; Beeching, J R

2011-06-07

Cassava can be cultivated on impoverished soils with minimum inputs, and its storage roots are a staple food for millions in Africa. However, these roots are low in bioavailable nutrients and in protein content, contain cyanogenic glycosides, and suffer from a very short post-harvest shelf-life, and the plant is susceptible to viral and bacterial diseases prevalent in Africa. The demand for improvement of cassava with respect to these traits comes from both farmers and national agricultural institutions. Genetic improvement of cassava cultivars by molecular biology techniques requires the availability of appropriate genes, a system to introduce these genes into cassava, and the use of suitable gene promoters. Cassava root-specific promoter for auxin-repressed protein was isolated using the gene walking approach, starting with a cDNA sequence. In silico analysis of promoter sequences revealed putative cis-acting regulatory elements, including root-specific elements, which may be required for gene expression in vascular tissues. Research on the activities of this promoter is continuing, with the development of plant expression cassettes for transformation into major African elite lines and farmers' preferred cassava cultivars to enable testing of tissue-specific expression patterns in the field.

Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

PubMed Central

Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

2004-01-01

Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

PubMed

Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

2009-01-01

A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

NASA Astrophysics Data System (ADS)

Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

2015-09-01

In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

HuMiChip: Development of a Functional Gene Array for the Study of Human Microbiomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tu, Q.; Deng, Ye; Lin, Lu

Microbiomes play very important roles in terms of nutrition, health and disease by interacting with their hosts. Based on sequence data currently available in public domains, we have developed a functional gene array to monitor both organismal and functional gene profiles of normal microbiota in human and mouse hosts, and such an array is called human and mouse microbiota array, HMM-Chip. First, seed sequences were identified from KEGG databases, and used to construct a seed database (seedDB) containing 136 gene families in 19 metabolic pathways closely related to human and mouse microbiomes. Second, a mother database (motherDB) was constructed withmore » 81 genomes of bacterial strains with 54 from gut and 27 from oral environments, and 16 metagenomes, and used for selection of genes and probe design. Gene prediction was performed by Glimmer3 for bacterial genomes, and by the Metagene program for metagenomes. In total, 228,240 and 801,599 genes were identified for bacterial genomes and metagenomes, respectively. Then the motherDB was searched against the seedDB using the HMMer program, and gene sequences in the motherDB that were highly homologous with seed sequences in the seedDB were used for probe design by the CommOligo software. Different degrees of specific probes, including gene-specific, inclusive and exclusive group-specific probes were selected. All candidate probes were checked against the motherDB and NCBI databases for specificity. Finally, 7,763 probes covering 91.2percent (12,601 out of 13,814) HMMer confirmed sequences from 75 bacterial genomes and 16 metagenomes were selected. This developed HMM-Chip is able to detect the diversity and abundance of functional genes, the gene expression of microbial communities, and potentially, the interactions of microorganisms and their hosts.« less

Alcohol-related Genes Show an Enrichment of Associations with a Persistent Externalizing Factor

PubMed Central

Ashenhurst, James R.; Harden, K. Paige; Corbin, William R.; Fromme, Kim

2016-01-01

Research using twins has found that much of the variability in externalizing phenotypes – including alcohol and drug use, impulsive personality traits, risky sex and property crime – is explained by genetic factors. Nevertheless, identification of specific genes and variants associated with these traits has proven to be difficult, likely because individual differences in externalizing are explained by many genes of small individual effect. Moreover, twin research indicates that heritable variance in externalizing behaviors is mostly shared across the externalizing spectrum rather than specific to any behavior. We use a longitudinal, “deep phenotyping” approach to model a general externalizing factor reflecting persistent engagement in a variety of socially problematic behaviors measured at eleven assessment occasions spanning early adulthood (ages 18 to 28). In an ancestrally homogenous sample of non-Hispanic Whites (N = 337), we then tested for enrichment of associations between the persistent externalizing factor and a set of 3,281 polymorphisms within 104 genes that were previously identified as associated with alcohol-use behaviors. Next we tested for enrichment among domain-specific factors (e.g., property crime) composed of residual variance not accounted for by the common factor. Significance was determined relative to bootstrapped empirical thresholds derived from permutations of phenotypic data. Results indicated significant enrichment of genetic associations for persistent externalizing, but not for domain-specific factors. Consistent with twin research findings, these results suggest that genetic variants are broadly associated with externalizing behaviors rather than unique to specific behaviors. General Scientific Summary This study shows that variation in 104 genes is associated with socially problematic “externalizing” behavior, including substance misuse, property crime, risky sex, and aspects of impulsive personality. Importantly, this association was with the common variation across these behaviors rather than with the variation unique to any given behavior. The manuscript demonstrates a potentially advantageous technique for relating sets of hypothesized genes to complex traits or behaviors. PMID:27505405

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

PubMed Central

David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

2017-01-01

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

Identifying gene networks underlying the neurobiology of ethanol and alcoholism.

PubMed

Wolen, Aaron R; Miles, Michael F

2012-01-01

For complex disorders such as alcoholism, identifying the genes linked to these diseases and their specific roles is difficult. Traditional genetic approaches, such as genetic association studies (including genome-wide association studies) and analyses of quantitative trait loci (QTLs) in both humans and laboratory animals already have helped identify some candidate genes. However, because of technical obstacles, such as the small impact of any individual gene, these approaches only have limited effectiveness in identifying specific genes that contribute to complex diseases. The emerging field of systems biology, which allows for analyses of entire gene networks, may help researchers better elucidate the genetic basis of alcoholism, both in humans and in animal models. Such networks can be identified using approaches such as high-throughput molecular profiling (e.g., through microarray-based gene expression analyses) or strategies referred to as genetical genomics, such as the mapping of expression QTLs (eQTLs). Characterization of gene networks can shed light on the biological pathways underlying complex traits and provide the functional context for identifying those genes that contribute to disease development.

Biotype-specific tcpA genes in Vibrio cholerae.

PubMed

Iredell, J R; Manning, P A

1994-08-01

The tcpA gene, encoding the structural subunit of the toxin-coregulated pilus, has been isolated from a variety of clinical isolates of Vibrio cholerae, and the nucleotide sequence determined. Strict biotype-specific conservation within both the coding and putative regulatory regions was observed, with important differences between the El Tor and classical biotypes. V. cholerae O139 Bengal strains appear to have El Tor-type tcpA genes. Environmental O1 and non-O1 isolates have sequences that bind an El Tor-specific tcpA DNA probe and that are weakly and variably amplified by tcpA-specific polymerase chain reaction primers, under conditions of reduced stringency. The data presented allow the selection of primer pairs to help distinguish between clinical and environmental isolates, and to distinguish El Tor (and Bengal) biotypes from classical biotypes of V. cholerae. While the role of TcpA in cholera vaccine preparations remains unclear, the data strongly suggest that TcpA-containing vaccines directed at O1 strains need include only the two forms of TcpA, and that such vaccines directed at (O139) Bengal strains should include the TcpA of El Tor biotype.

Selection and validation of reliable housekeeping genes to evaluate Piscirickettsia salmonis gene expression.

PubMed

Flores-Herrera, Patricio; Arredondo-Zelada, Oscar; Marshall, Sergio H; Gómez, Fernando A

2018-06-01

Piscirickettsia salmonis is a highly aggressive facultative intracellular bacterium that challenges the sustainability of Chilean salmon production. Due to the limited knowledge of its biology, there is a need to identify key molecular markers that could help define the pathogenic potential of this bacterium. We think a model system should be implemented that efficiently evaluates the expression of putative bacterial markers by using validated, stable, and highly specific housekeeping genes to properly select target genes, which could lead to identifying those responsible for infection and disease induction in naturally infected fish. Here, we selected a set of validated reference or housekeeping genes for RT-qPCR expression analyses of P. salmonis under different growth and stress conditions, including an in vitro infection kinetic. After a thorough screening, we selected sdhA as the most reliable housekeeping gene able to represent stable and highly specific host reference genes for RT-qPCR-driven P. salmonis analysis. Copyright © 2018. Published by Elsevier B.V.

HnRNP-like proteins as post-transcriptional regulators.

PubMed

Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

2014-10-01

Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Highly specific gene silencing in a monocot species by artificial microRNAs derived from chimeric miRNA precursors

DOE PAGES

Carbonell, Alberto; Fahlgren, Noah; Mitchell, Skyler; ...

2015-05-20

Artificial microRNAs (amiRNAs) are used for selective gene silencing in plants. However, current methods to produce amiRNA constructs for silencing transcripts in monocot species are not suitable for simple, cost-effective and large-scale synthesis. Here, a series of expression vectors based on Oryza sativa MIR390 (OsMIR390) precursor was developed for high-throughput cloning and high expression of amiRNAs in monocots. Four different amiRNA sequences designed to target specifically endogenous genes and expressed from OsMIR390-based vectors were validated in transgenic Brachypodium distachyon plants. Surprisingly, amiRNAs accumulated to higher levels and were processed more accurately when expressed from chimeric OsMIR390-based precursors that include distalmore » stem-loop sequences from Arabidopsis thaliana MIR390a (AtMIR390a). In all cases, transgenic plants displayed the predicted phenotypes induced by target gene repression, and accumulated high levels of amiRNAs and low levels of the corresponding target transcripts. Genome-wide transcriptome profiling combined with 5-RLM-RACE analysis in transgenic plants confirmed that amiRNAs were highly specific. Finally, significance Statement A series of amiRNA vectors based on Oryza sativa MIR390 (OsMIR390) precursor were developed for simple, cost-effective and large-scale synthesis of amiRNA constructs to silence genes in monocots. Unexpectedly, amiRNAs produced from chimeric OsMIR390-based precursors including Arabidopsis thaliana MIR390a distal stem-loop sequences accumulated elevated levels of highly effective and specific amiRNAs in transgenic Brachypodium distachyon plants.« less

[Research progress in neuropsychopharmacology updated for the post-genomic era].

PubMed

Nakanishi, Toru

2009-11-01

Neuropsychopharmacological research in the post genomic (genomic sequence) era has been developing rapidly through the use of novel techniques including DNA chips. We have applied these techniques to investigate the anti-tumor effect of NSAIDs, isolate novel genes specifically expressed in rheumatoid arthritis, and analyze gene expression profiles in mesenchymal stem cells. Recently, we have developed a novel system of quantitative PCR for detection of BDNF mRNA isoforms. By using this system, we identified the exon-specific mode of expression in acute and chronic pain. In addition, we have made gene expression profiles of KO mice of beta2 subunits in acetylcholine receptors.

Evolution of Chemical Diversity in Echinocandin Lipopeptide Antifungal Metabolites

PubMed Central

Yue, Qun; Chen, Li; Zhang, Xiaoling; Li, Kuan; Sun, Jingzu; Liu, Xingzhong

2015-01-01

The echinocandins are a class of antifungal drugs that includes caspofungin, micafungin, and anidulafungin. Gene clusters encoding most of the structural complexity of the echinocandins provided a framework for hypotheses about the evolutionary history and chemical logic of echinocandin biosynthesis. Gene orthologs among echinocandin-producing fungi were identified. Pathway genes, including the nonribosomal peptide synthetases (NRPSs), were analyzed phylogenetically to address the hypothesis that these pathways represent descent from a common ancestor. The clusters share cooperative gene contents and linkages among the different strains. Individual pathway genes analyzed in the context of similar genes formed unique echinocandin-exclusive phylogenetic lineages. The echinocandin NRPSs, along with the NRPS from the inp gene cluster in Aspergillus nidulans and its orthologs, comprise a novel lineage among fungal NRPSs. NRPS adenylation domains from different species exhibited a one-to-one correspondence between modules and amino acid specificity that is consistent with models of tandem duplication and subfunctionalization. Pathway gene trees and Ascomycota phylogenies are congruent and consistent with the hypothesis that the echinocandin gene clusters have a common origin. The disjunct Eurotiomycete-Leotiomycete distribution appears to be consistent with a scenario of vertical descent accompanied by incomplete lineage sorting and loss of the clusters from most lineages of the Ascomycota. We present evidence for a single evolutionary origin of the echinocandin family of gene clusters and a progression of structural diversification in two fungal classes that diverged approximately 290 to 390 million years ago. Lineage-specific gene cluster evolution driven by selection of new chemotypes contributed to diversification of the molecular functionalities. PMID:26024901

Repressor-mediated tissue-specific gene expression in plants

DOEpatents

Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

2009-02-17

Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

Rapid Evolution of Ovarian-Biased Genes in the Yellow Fever Mosquito (Aedes aegypti).

PubMed

Whittle, Carrie A; Extavour, Cassandra G

2017-08-01

Males and females exhibit highly dimorphic phenotypes, particularly in their gonads, which is believed to be driven largely by differential gene expression. Typically, the protein sequences of genes upregulated in males, or male-biased genes, evolve rapidly as compared to female-biased and unbiased genes. To date, the specific study of gonad-biased genes remains uncommon in metazoans. Here, we identified and studied a total of 2927, 2013, and 4449 coding sequences (CDS) with ovary-biased, testis-biased, and unbiased expression, respectively, in the yellow fever mosquito Aedes aegypti The results showed that ovary-biased and unbiased CDS had higher nonsynonymous to synonymous substitution rates (dN/dS) and lower optimal codon usage (those codons that promote efficient translation) than testis-biased genes. Further, we observed higher dN/dS in ovary-biased genes than in testis-biased genes, even for genes coexpressed in nonsexual (embryo) tissues. Ovary-specific genes evolved exceptionally fast, as compared to testis- or embryo-specific genes, and exhibited higher frequency of positive selection. Genes with ovary expression were preferentially involved in olfactory binding and reception. We hypothesize that at least two potential mechanisms could explain rapid evolution of ovary-biased genes in this mosquito: (1) the evolutionary rate of ovary-biased genes may be accelerated by sexual selection (including female-female competition or male-mate choice) affecting olfactory genes during female swarming by males, and/or by adaptive evolution of olfactory signaling within the female reproductive system ( e.g. , sperm-ovary signaling); and/or (2) testis-biased genes may exhibit decelerated evolutionary rates due to the formation of mating plugs in the female after copulation, which limits male-male sperm competition. Copyright © 2017 by the Genetics Society of America.

Evolutionary origin and functional divergence of totipotent cell homeobox genes in eutherian mammals.

PubMed

Maeso, Ignacio; Dunwell, Thomas L; Wyatt, Chris D R; Marlétaz, Ferdinand; Vető, Borbála; Bernal, Juan A; Quah, Shan; Irimia, Manuel; Holland, Peter W H

2016-06-13

A central goal of evolutionary biology is to link genomic change to phenotypic evolution. The origin of new transcription factors is a special case of genomic evolution since it brings opportunities for novel regulatory interactions and potentially the emergence of new biological properties. We demonstrate that a group of four homeobox gene families (Argfx, Leutx, Dprx, Tprx), plus a gene newly described here (Pargfx), arose by tandem gene duplication from the retinal-expressed Crx gene, followed by asymmetric sequence evolution. We show these genes arose as part of repeated gene gain and loss events on a dynamic chromosomal region in the stem lineage of placental mammals, on the forerunner of human chromosome 19. The human orthologues of these genes are expressed specifically in early embryo totipotent cells, peaking from 8-cell to morula, prior to cell fate restrictions; cow orthologues have similar expression. To examine biological roles, we used ectopic gene expression in cultured human cells followed by high-throughput RNA-seq and uncovered extensive transcriptional remodelling driven by three of the genes. Comparison to transcriptional profiles of early human embryos suggest roles in activating and repressing a set of developmentally-important genes that spike at 8-cell to morula, rather than a general role in genome activation. We conclude that a dynamic chromosome region spawned a set of evolutionarily new homeobox genes, the ETCHbox genes, specifically in eutherian mammals. After these genes diverged from the parental Crx gene, we argue they were recruited for roles in the preimplantation embryo including activation of genes at the 8-cell stage and repression after morula. We propose these new homeobox gene roles permitted fine-tuning of cell fate decisions necessary for specification and function of embryonic and extra-embryonic tissues utilised in mammalian development and pregnancy.

Comparative analysis of alfalfa (Medicago sativa L.) leaf transcriptomes reveals genotype-specific salt tolerance mechanisms.

PubMed

Lei, Yunting; Xu, Yuxing; Hettenhausen, Christian; Lu, Chengkai; Shen, Guojing; Zhang, Cuiping; Li, Jing; Song, Juan; Lin, Honghui; Wu, Jianqiang

2018-02-15

Soil salinity is an important factor affecting growth, development, and productivity of almost all land plants, including the forage crop alfalfa (Medicago sativa). However, little is known about how alfalfa responds and adapts to salt stress, particularly among different salt-tolerant cultivars. Among seven alfalfa cultivars, we found that Zhongmu-1 (ZM) is relatively salt-tolerant and Xingjiang Daye (XJ) is salt-sensitive. Compared to XJ, ZM showed slower growth under low-salt conditions, but exhibited stronger tolerance to salt stress. RNA-seq analysis revealed 2237 and 1125 differentially expressed genes (DEGs) between ZM and XJ in the presence and absence of salt stress, among which many genes are involved in stress-related pathways. After salt treatment, compared with the controls, the number of DEGs in XJ (19373) was about four times of that in ZM (4833). We also detected specific differential gene expression patterns: In response to salt stress, compared with XJ, ZM maintained relatively more stable expression levels of genes related to the ROS and Ca 2+ pathways, phytohormone biosynthesis, and Na + /K + transport. Notably, several salt resistance-associated genes always showed greater levels of expression in ZM than in XJ, including a transcription factor. Consistent with the suppression of plant growth resulting from salt stress, the expression of numerous photosynthesis- and growth hormone-related genes decreased more dramatically in XJ than in ZM. By contrast, the expression levels of photosynthetic genes were lower in ZM under low-salt conditions. Compared with XJ, ZM is a salt-tolerant alfalfa cultivar possessing specific regulatory mechanisms conferring exceptional salt tolerance, likely by maintaining high transcript levels of abiotic and biotic stress resistance-related genes. Our results suggest that maintaining this specific physiological status and/or plant adaptation to salt stress most likely arises by inhibition of plant growth in ZM through plant hormone interactions. This study identifies new candidate genes that may regulate alfalfa tolerance to salt stress and increases the understanding of the genetic basis for salt tolerance.

Elephant Transcriptome Provides Insights into the Evolution of Eutherian Placentation

PubMed Central

Hou, Zhuo-Cheng; Sterner, Kirstin N.; Romero, Roberto; Than, Nandor Gabor; Gonzalez, Juan M.; Weckle, Amy; Xing, Jun; Benirschke, Kurt; Goodman, Morris; Wildman, Derek E.

2012-01-01

The chorioallantoic placenta connects mother and fetus in eutherian pregnancies. In order to understand the evolution of the placenta and provide further understanding of placenta biology, we sequenced the transcriptome of a term placenta of an African elephant (Loxodonta africana) and compared these data with RNA sequence and microarray data from other eutherian placentas including human, mouse, and cow. We characterized the composition of 55,910 expressed sequence tag (i.e., cDNA) contigs using our custom annotation pipeline. A Markov algorithm was used to cluster orthologs of human, mouse, cow, and elephant placenta transcripts. We found 2,963 genes are commonly expressed in the placentas of these eutherian mammals. Gene ontology categories previously suggested to be important for placenta function (e.g., estrogen receptor signaling pathway, cell motion and migration, and adherens junctions) were significantly enriched in these eutherian placenta–expressed genes. Genes duplicated in different lineages and also specifically expressed in the placenta contribute to the great diversity observed in mammalian placenta anatomy. We identified 1,365 human lineage–specific, 1,235 mouse lineage–specific, 436 cow lineage–specific, and 904 elephant-specific placenta-expressed (PE) genes. The most enriched clusters of human-specific PE genes are signal/glycoprotein and immunoglobulin, and humans possess a deeply invasive human hemochorial placenta that comes into direct contact with maternal immune cells. Inference of phylogenetically conserved and derived transcripts demonstrates the power of comparative transcriptomics to trace placenta evolution and variation across mammals and identified candidate genes that may be important in the normal function of the human placenta, and their dysfunction may be related to human pregnancy complications. PMID:22546564

Expansion of TALE homeobox genes and the evolution of spiralian development.

PubMed

Morino, Yoshiaki; Hashimoto, Naoki; Wada, Hiroshi

2017-12-01

Spiralians, including molluscs, annelids and platyhelminths, share a unique development process that includes the typical geometry of early cleavage and early segregation of cell fate in blastomeres along the animal-vegetal axis. However, the molecular mechanisms underlying this early cell fate segregation are largely unknown. Here, we report spiralian-specific expansion of the three-amino-acid loop extension (TALE) class of homeobox genes. During early development, some of these TALE genes are expressed in staggered domains along the animal-vegetal axis in the limpet Nipponacmea fuscoviridis and the polychaete Spirobranchus kraussii. Inhibition or overexpression of these genes alters the developmental fate of blastomeres, as predicted by the gene expression patterns. These results suggest that the expansion of novel TALE genes plays a critical role in the establishment of a novel cell fate segregation mechanism in spiralians.

Untangling the Contributions of Sex-Specific Gene Regulation and X-Chromosome Dosage to Sex-Biased Gene Expression in Caenorhabditis elegans

PubMed Central

Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc

2016-01-01

Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611

Bioluminescent bioreporter integrated circuit devices and methods for detecting ammonia

DOEpatents

Simpson, Michael L [Knoxville, TN; Paulus, Michael J [Knoxville, TN; Sayler, Gary S [Blaine, TN; Applegate, Bruce M [West Lafayette, IN; Ripp, Steven A [Knoxville, TN

2007-04-24

Monolithic bioelectronic devices for the detection of ammonia includes a microorganism that metabolizes ammonia and which harbors a lux gene fused with a heterologous promoter gene stably incorporated into the chromosome of the microorganism and an Optical Application Specific Integrated Circuit (OASIC). The microorganism is generally a bacterium.

DLGP: A database for lineage-conserved and lineage-specific gene pairs in animal and plant genomes.

PubMed

Wang, Dapeng

2016-01-15

The conservation of gene organization in the genome with lineage-specificity is an invaluable resource to decipher their potential functionality with diverse selective constraints, especially in higher animals and plants. Gene pairs appear to be the minimal structure for such kind of gene clusters that tend to reside in their preferred locations, representing the distinctive genomic characteristics in single species or a given lineage. Despite gene families having been investigated in a widespread manner, the definition of gene pair families in various taxa still lacks adequate attention. To address this issue, we report DLGP (http://lcgbase.big.ac.cn/DLGP/) that stores the pre-calculated lineage-based gene pairs in currently available 134 animal and plant genomes and inspect them under the same analytical framework, bringing out a set of innovational features. First, the taxonomy or lineage has been classified into four levels such as Kingdom, Phylum, Class and Order. It adopts all-to-all comparison strategy to identify the possible conserved gene pairs in all species for each gene pair in certain species and reckon those that are conserved in over a significant proportion of species in a given lineage (e.g. Primates, Diptera or Poales) as the lineage-conserved gene pairs. Furthermore, it predicts the lineage-specific gene pairs by retaining the above-mentioned lineage-conserved gene pairs that are not conserved in any other lineages. Second, it carries out pairwise comparison for the gene pairs between two compared species and creates the table including all the conserved gene pairs and the image elucidating the conservation degree of gene pairs in chromosomal level. Third, it supplies gene order browser to extend gene pairs to gene clusters, allowing users to view the evolution dynamics in the gene context in an intuitive manner. This database will be able to facilitate the particular comparison between animals and plants, between vertebrates and arthropods, and between monocots and eudicots, accounting for the significant contribution of gene pairs to speciation and diversification in specific lineages. Copyright © 2015 Elsevier Inc. All rights reserved.

Overlapping Yet Response-Specific Transcriptome Alterations Characterize the Nature of Tobacco-Pseudomonas syringae Interactions.

PubMed

Bozsó, Zoltán; Ott, Péter G; Kámán-Tóth, Evelin; Bognár, Gábor F; Pogány, Miklós; Szatmári, Ágnes

2016-01-01

In this study transcriptomic alterations of bacterially induced pattern triggered immunity (PTI) were compared with other types of tobacco-Pseudomonas interactions. In addition, using pharmacological agents we blocked some signal transduction pathways (Ca(2+) influx, kinases, phospholipases, proteasomic protein degradation) to find out how they contribute to gene expression during PTI. PTI is the first defense response of plant cells to microbes, elicited by their widely conserved molecular patterns. Tobacco is an important model of Solanaceae to study resistance responses, including defense mechanisms against bacteria. In spite of these facts the transcription regulation of tobacco genes during different types of plant bacterial interactions is not well-described. In this paper we compared the tobacco transcriptomic alterations in microarray experiments induced by (i) PTI inducer Pseudomonas syringae pv. syringae type III secretion mutant (hrcC) at earlier (6 h post inoculation) and later (48 hpi) stages of defense, (ii) wild type P. syringae (6 hpi) that causes effector triggered immunity (ETI) and cell death (HR), and (iii) disease-causing P. syringae pv. tabaci (6 hpi). Among the different treatments the highest overlap was between the PTI and ETI at 6 hpi, however, there were groups of genes with specifically altered activity for either type of defenses. Instead of quantitative effects of the virulent P. tabaci on PTI-related genes it influenced transcription qualitatively and blocked the expression changes of a special set of genes including ones involved in signal transduction and transcription regulation. P. tabaci specifically activated or repressed other groups of genes seemingly not related to either PTI or ETI. Kinase and phospholipase A inhibitors had highest impacts on the PTI response and effects of these signal inhibitors on transcription greatly overlapped. Remarkable interactions of phospholipase C-related pathways with the proteasomal system were also observable. Genes specifically affected by virulent P. tabaci belonged to various previously identified signaling routes, suggesting that compatible pathogens may modulate diverse signaling pathways of PTI to overcome plant defense.

Comparative Genomics of Plant-Associated Pseudomonas spp.: Insights into Diversity and Inheritance of Traits Involved in Multitrophic Interactions

PubMed Central

Loper, Joyce E.; Hassan, Karl A.; Mavrodi, Dmitri V.; Davis, Edward W.; Lim, Chee Kent; Shaffer, Brenda T.; Elbourne, Liam D. H.; Stockwell, Virginia O.; Hartney, Sierra L.; Breakwell, Katy; Henkels, Marcella D.; Tetu, Sasha G.; Rangel, Lorena I.; Kidarsa, Teresa A.; Wilson, Neil L.; van de Mortel, Judith E.; Song, Chunxu; Blumhagen, Rachel; Radune, Diana; Hostetler, Jessica B.; Brinkac, Lauren M.; Durkin, A. Scott; Kluepfel, Daniel A.; Wechter, W. Patrick; Anderson, Anne J.; Kim, Young Cheol; Pierson, Leland S.; Pierson, Elizabeth A.; Lindow, Steven E.; Kobayashi, Donald Y.; Raaijmakers, Jos M.; Weller, David M.; Thomashow, Linda S.; Allen, Andrew E.; Paulsen, Ian T.

2012-01-01

We provide here a comparative genome analysis of ten strains within the Pseudomonas fluorescens group including seven new genomic sequences. These strains exhibit a diverse spectrum of traits involved in biological control and other multitrophic interactions with plants, microbes, and insects. Multilocus sequence analysis placed the strains in three sub-clades, which was reinforced by high levels of synteny, size of core genomes, and relatedness of orthologous genes between strains within a sub-clade. The heterogeneity of the P. fluorescens group was reflected in the large size of its pan-genome, which makes up approximately 54% of the pan-genome of the genus as a whole, and a core genome representing only 45–52% of the genome of any individual strain. We discovered genes for traits that were not known previously in the strains, including genes for the biosynthesis of the siderophores achromobactin and pseudomonine and the antibiotic 2-hexyl-5-propyl-alkylresorcinol; novel bacteriocins; type II, III, and VI secretion systems; and insect toxins. Certain gene clusters, such as those for two type III secretion systems, are present only in specific sub-clades, suggesting vertical inheritance. Almost all of the genes associated with multitrophic interactions map to genomic regions present in only a subset of the strains or unique to a specific strain. To explore the evolutionary origin of these genes, we mapped their distributions relative to the locations of mobile genetic elements and repetitive extragenic palindromic (REP) elements in each genome. The mobile genetic elements and many strain-specific genes fall into regions devoid of REP elements (i.e., REP deserts) and regions displaying atypical tri-nucleotide composition, possibly indicating relatively recent acquisition of these loci. Collectively, the results of this study highlight the enormous heterogeneity of the P. fluorescens group and the importance of the variable genome in tailoring individual strains to their specific lifestyles and functional repertoire. PMID:22792073

Ogura-CMS in Chinese cabbage (Brassica rapa ssp. pekinensis) causes delayed expression of many nuclear genes.

PubMed

Dong, Xiangshu; Kim, Wan Kyu; Lim, Yong-Pyo; Kim, Yeon-Ki; Hur, Yoonkang

2013-02-01

We investigated the mechanism regulating cytoplasmic male sterility (CMS) in Brassica rapa ssp. pekinensis using floral bud transcriptome analyses of Ogura-CMS Chinese cabbage and its maintainer line in B. rapa 300-K oligomeric probe (Br300K) microarrays. Ogura-CMS Chinese cabbage produced few and infertile pollen grains on indehiscent anthers. Compared to the maintainer line, CMS plants had shorter filaments and plant growth, and delayed flowering and pollen development. In microarray analysis, 4646 genes showed different expression, depending on floral bud size, between Ogura-CMS and its maintainer line. We found 108 and 62 genes specifically expressed in Ogura-CMS and its maintainer line, respectively. Ogura-CMS line-specific genes included stress-related, redox-related, and B. rapa novel genes. In the maintainer line, genes related to pollen coat and germination were specifically expressed in floral buds longer than 3mm, suggesting insufficient expression of these genes in Ogura-CMS is directly related to dysfunctional pollen. In addition, many nuclear genes associated with auxin response, ATP synthesis, pollen development and stress response had delayed expression in Ogura-CMS plants compared to the maintainer line, which is consistent with the delay in growth and development of Ogura-CMS plants. Delayed expression may reduce pollen grain production and/or cause sterility, implying that mitochondrial, retrograde signaling delays nuclear gene expression. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

NetDecoder: a network biology platform that decodes context-specific biological networks and gene activities.

PubMed

da Rocha, Edroaldo Lummertz; Ung, Choong Yong; McGehee, Cordelia D; Correia, Cristina; Li, Hu

2016-06-02

The sequential chain of interactions altering the binary state of a biomolecule represents the 'information flow' within a cellular network that determines phenotypic properties. Given the lack of computational tools to dissect context-dependent networks and gene activities, we developed NetDecoder, a network biology platform that models context-dependent information flows using pairwise phenotypic comparative analyses of protein-protein interactions. Using breast cancer, dyslipidemia and Alzheimer's disease as case studies, we demonstrate NetDecoder dissects subnetworks to identify key players significantly impacting cell behaviour specific to a given disease context. We further show genes residing in disease-specific subnetworks are enriched in disease-related signalling pathways and information flow profiles, which drive the resulting disease phenotypes. We also devise a novel scoring scheme to quantify key genes-network routers, which influence many genes, key targets, which are influenced by many genes, and high impact genes, which experience a significant change in regulation. We show the robustness of our results against parameter changes. Our network biology platform includes freely available source code (http://www.NetDecoder.org) for researchers to explore genome-wide context-dependent information flow profiles and key genes, given a set of genes of particular interest and transcriptome data. More importantly, NetDecoder will enable researchers to uncover context-dependent drug targets. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genome-wide identification and expression analysis of SBP-like transcription factor genes in Moso Bamboo (Phyllostachys edulis).

PubMed

Pan, Feng; Wang, Yue; Liu, Huanglong; Wu, Min; Chu, Wenyuan; Chen, Danmei; Xiang, Yan

2017-06-27

The SQUAMOSA promoter binding protein-like (SPL) proteins are plant-specific transcription factors (TFs) that function in a variety of developmental processes including growth, flower development, and signal transduction. SPL proteins are encoded by a gene family, and these genes have been characterized in two model grass species, Zea mays and Oryza sativa. The SPL gene family has not been well studied in moso bamboo (Phyllostachys edulis), a woody grass species. We identified 32 putative PeSPL genes in the P. edulis genome. Phylogenetic analysis arranged the PeSPL protein sequences in eight groups. Similarly, phylogenetic analysis of the SBP-like and SBP proteins from rice and maize clustered them into eight groups analogous to those from P. edulis. Furthermore, the deduced PeSPL proteins in each group contained very similar conserved sequence motifs. Our analyses indicate that the PeSPL genes experienced a large-scale duplication event ~15 million years ago (MYA), and that divergence between the PeSPL and OsSPL genes occurred 34 MYA. The stress-response expression profiles and tissue-specificity of the putative PeSPL gene promoter regions showed that SPL genes in moso bamboo have potential biological functions in stress resistance as well as in growth and development. We therefore examined PeSPL gene expression in response to different plant hormone and drought (polyethylene glycol-6000; PEG) treatments to mimic biotic and abiotic stresses. Expression of three (PeSPL10, -12, -17), six (PeSPL1, -10, -12, -17, -20, -31), and nine (PeSPL5, -8, -9, -14, -15, -19, -20, -31, -32) genes remained relatively stable after treating with salicylic acid (SA), gibberellic acid (GA), and PEG, respectively, while the expression patterns of other genes changed. In addition, analysis of tissue-specific expression of the moso bamboo SPL genes during development showed differences in their spatiotemporal expression patterns, and many were expressed at high levels in flowers and leaves. The PeSPL genes play important roles in plant growth and development, including responses to stresses, and most of the genes are expressed in different tissues. Our study provides a comprehensive understanding of the PeSPL gene family and may enable future studies on the function and evolution of SPL genes in moso bamboo.

Advancing Translational Research Through the NHLBI Gene Therapy Resource Program (GTRP)

PubMed Central

Benson, Janet; Cornetta, Kenneth; Diggins, Margaret; Johnston, Julie C.; Sepelak, Susan; Wang, Gensheng; Wilson, James M.; Wright, J. Fraser; Skarlatos, Sonia I.

2013-01-01

Abstract Translational research is a lengthy, complex, and necessary endeavor in order to bring basic science discoveries to clinical fruition. The NIH offers several programs to support translational research including an important resource established specifically for gene therapy researchers—the National Heart, Lung, and Blood Institute (NHLBI) Gene Therapy Resource Program (GTRP). This paper reviews the core components of the GTRP and describes how the GTRP provides researchers with resources that are critical to advancing investigational gene therapy products into clinical testing. PMID:23692378

Genomic determinants of sporulation in Bacilli and Clostridia: towards the minimal set of sporulation-specific genes.

PubMed

Galperin, Michael Y; Mekhedov, Sergei L; Puigbo, Pere; Smirnov, Sergey; Wolf, Yuri I; Rigden, Daniel J

2012-11-01

Three classes of low-G+C Gram-positive bacteria (Firmicutes), Bacilli, Clostridia and Negativicutes, include numerous members that are capable of producing heat-resistant endospores. Spore-forming firmicutes include many environmentally important organisms, such as insect pathogens and cellulose-degrading industrial strains, as well as human pathogens responsible for such diseases as anthrax, botulism, gas gangrene and tetanus. In the best-studied model organism Bacillus subtilis, sporulation involves over 500 genes, many of which are conserved among other bacilli and clostridia. This work aimed to define the genomic requirements for sporulation through an analysis of the presence of sporulation genes in various firmicutes, including those with smaller genomes than B. subtilis. Cultivable spore-formers were found to have genomes larger than 2300 kb and encompass over 2150 protein-coding genes of which 60 are orthologues of genes that are apparently essential for sporulation in B. subtilis. Clostridial spore-formers lack, among others, spoIIB, sda, spoVID and safA genes and have non-orthologous displacements of spoIIQ and spoIVFA, suggesting substantial differences between bacilli and clostridia in the engulfment and spore coat formation steps. Many B. subtilis sporulation genes, particularly those encoding small acid-soluble spore proteins and spore coat proteins, were found only in the family Bacillaceae, or even in a subset of Bacillus spp. Phylogenetic profiles of sporulation genes, compiled in this work, confirm the presence of a common sporulation gene core, but also illuminate the diversity of the sporulation processes within various lineages. These profiles should help further experimental studies of uncharacterized widespread sporulation genes, which would ultimately allow delineation of the minimal set(s) of sporulation-specific genes in Bacilli and Clostridia. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

Fungal Infection Induces Sex-Specific Transcriptional Changes and Alters Sexual Dimorphism in the Dioecious Plant Silene latifolia

PubMed Central

Zemp, Niklaus; Tavares, Raquel; Widmer, Alex

2015-01-01

Sexual dimorphism, including differences in morphology, behavior and physiology between females and males, is widespread in animals and plants and is shaped by gene expression differences between the sexes. Such expression differences may also underlie sex-specific responses of hosts to pathogen infections, most notably when pathogens induce partial sex reversal in infected hosts. The genetic changes associated with sex-specific responses to pathogen infections on the one hand, and sexual dimorphism on the other hand, remain poorly understood. The dioecious White Campion (Silene latifolia) displays sexual dimorphism in floral traits and infection with the smut fungus Micobrotryum lychnidis-dioicae induces a partial sex reversal in females. We find strong sex-specific responses to pathogen infection and reduced sexual dimorphism in infected S. latifolia. This provides a direct link between pathogen-mediated changes in sex-biased gene expression and altered sexual dimorphism in the host. Expression changes following infection affected mainly genes with male-biased expression in healthy plants. In females, these genes were up-regulated, leading to a masculinization of the transcriptome. In contrast, infection in males was associated with down-regulation of these genes, leading to a demasculinization of the transcriptome. To a lesser extent, genes with female-biased expression in healthy plants were also affected in opposite directions in the two sexes. These genes were overall down-regulated in females and up-regulated in males, causing, respectively, a defeminization in infected females and a feminization of the transcriptome in infected males. Our results reveal strong sex-specific responses to pathogen infection in a dioecious plant and provide a link between pathogen-induced changes in sex-biased gene expression and sexual dimorphism. PMID:26448481

Fungal Infection Induces Sex-Specific Transcriptional Changes and Alters Sexual Dimorphism in the Dioecious Plant Silene latifolia.

PubMed

Zemp, Niklaus; Tavares, Raquel; Widmer, Alex

2015-10-01

Sexual dimorphism, including differences in morphology, behavior and physiology between females and males, is widespread in animals and plants and is shaped by gene expression differences between the sexes. Such expression differences may also underlie sex-specific responses of hosts to pathogen infections, most notably when pathogens induce partial sex reversal in infected hosts. The genetic changes associated with sex-specific responses to pathogen infections on the one hand, and sexual dimorphism on the other hand, remain poorly understood. The dioecious White Campion (Silene latifolia) displays sexual dimorphism in floral traits and infection with the smut fungus Micobrotryum lychnidis-dioicae induces a partial sex reversal in females. We find strong sex-specific responses to pathogen infection and reduced sexual dimorphism in infected S. latifolia. This provides a direct link between pathogen-mediated changes in sex-biased gene expression and altered sexual dimorphism in the host. Expression changes following infection affected mainly genes with male-biased expression in healthy plants. In females, these genes were up-regulated, leading to a masculinization of the transcriptome. In contrast, infection in males was associated with down-regulation of these genes, leading to a demasculinization of the transcriptome. To a lesser extent, genes with female-biased expression in healthy plants were also affected in opposite directions in the two sexes. These genes were overall down-regulated in females and up-regulated in males, causing, respectively, a defeminization in infected females and a feminization of the transcriptome in infected males. Our results reveal strong sex-specific responses to pathogen infection in a dioecious plant and provide a link between pathogen-induced changes in sex-biased gene expression and sexual dimorphism.

The rat alpha-tropomyosin gene generates a minimum of six different mRNAs coding for striated, smooth, and nonmuscle isoforms by alternative splicing.

PubMed Central

Wieczorek, D F; Smith, C W; Nadal-Ginard, B

1988-01-01

Tropomyosin (TM), a ubiquitous protein, is a component of the contractile apparatus of all cells. In nonmuscle cells, it is found in stress fibers, while in sarcomeric and nonsarcomeric muscle, it is a component of the thin filament. Several different TM isoforms specific for nonmuscle cells and different types of muscle cell have been described. As for other contractile proteins, it was assumed that smooth, striated, and nonmuscle isoforms were each encoded by different sets of genes. Through the use of S1 nuclease mapping, RNA blots, and 5' extension analyses, we showed that the rat alpha-TM gene, whose expression was until now considered to be restricted to muscle cells, generates many different tissue-specific isoforms. The promoter of the gene appears to be very similar to other housekeeping promoters in both its pattern of utilization, being active in most cell types, and its lack of any canonical sequence elements. The rat alpha-TM gene is split into at least 13 exons, 7 of which are alternatively spliced in a tissue-specific manner. This gene arrangement, which also includes two different 3' ends, generates a minimum of six different mRNAs each with the capacity to code for a different protein. These distinct TM isoforms are expressed specifically in nonmuscle and smooth and striated (cardiac and skeletal) muscle cells. The tissue-specific expression and developmental regulation of these isoforms is, therefore, produced by alternative mRNA processing. Moreover, structural and sequence comparisons among TM genes from different phyla suggest that alternative splicing is evolutionarily a very old event that played an important role in gene evolution and might have appeared concomitantly with or even before constitutive splicing. Images PMID:3352602

Comprehensive transcriptional map of primate brain development

PubMed Central

Bakken, Trygve E.; Miller, Jeremy A.; Ding, Song-Lin; Sunkin, Susan M.; Smith, Kimberly A.; Ng, Lydia; Szafer, Aaron; Dalley, Rachel A.; Royall, Joshua J.; Lemon, Tracy; Shapouri, Sheila; Aiona, Kaylynn; Arnold, James; Bennett, Jeffrey L.; Bertagnolli, Darren; Bickley, Kristopher; Boe, Andrew; Brouner, Krissy; Butler, Stephanie; Byrnes, Emi; Caldejon, Shiella; Carey, Anita; Cate, Shelby; Chapin, Mike; Chen, Jefferey; Dee, Nick; Desta, Tsega; Dolbeare, Tim A.; Dotson, Nadia; Ebbert, Amanda; Fulfs, Erich; Gee, Garrett; Gilbert, Terri L.; Goldy, Jeff; Gourley, Lindsey; Gregor, Ben; Gu, Guangyu; Hall, Jon; Haradon, Zeb; Haynor, David R.; Hejazinia, Nika; Hoerder-Suabedissen, Anna; Howard, Robert; Jochim, Jay; Kinnunen, Marty; Kriedberg, Ali; Kuan, Chihchau L.; Lau, Christopher; Lee, Chang-Kyu; Lee, Felix; Luong, Lon; Mastan, Naveed; May, Ryan; Melchor, Jose; Mosqueda, Nerick; Mott, Erika; Ngo, Kiet; Nyhus, Julie; Oldre, Aaron; Olson, Eric; Parente, Jody; Parker, Patrick D.; Parry, Sheana; Pendergraft, Julie; Potekhina, Lydia; Reding, Melissa; Riley, Zackery L.; Roberts, Tyson; Rogers, Brandon; Roll, Kate; Rosen, David; Sandman, David; Sarreal, Melaine; Shapovalova, Nadiya; Shi, Shu; Sjoquist, Nathan; Sodt, Andy J.; Townsend, Robbie; Velasquez, Lissette; Wagley, Udi; Wakeman, Wayne B.; White, Cassandra; Bennett, Crissa; Wu, Jennifer; Young, Rob; Youngstrom, Brian L.; Wohnoutka, Paul; Gibbs, Richard A.; Rogers, Jeffrey; Hohmann, John G.; Hawrylycz, Michael J.; Hevner, Robert F.; Molnár, Zoltán; Phillips, John W.; Dang, Chinh; Jones, Allan R.; Amaral, David G.; Bernard, Amy; Lein, Ed S.

2017-01-01

The transcriptional underpinnings of brain development remain poorly understood, particularly in humans and closely related non-human primates. We describe a high resolution transcriptional atlas of rhesus monkey brain development that combines dense temporal sampling of prenatal and postnatal periods with fine anatomical parcellation of cortical and subcortical regions associated with human neuropsychiatric disease. Gene expression changes more rapidly before birth, both in progenitor cells and maturing neurons, and cortical layers and areas acquire adult-like molecular profiles surprisingly late postnatally. Disparate cell populations exhibit distinct developmental timing but also unexpected synchrony of processes underlying neural circuit construction including cell projection and adhesion. Candidate risk genes for neurodevelopmental disorders including primary microcephaly, autism spectrum disorder, intellectual disability, and schizophrenia show disease-specific spatiotemporal enrichment within developing neocortex. Human developmental expression trajectories are more similar to monkey than rodent, and approximately 9% of genes show human-specific regulation with evidence for prolonged maturation or neoteny. PMID:27409810

Beyond genome-wide association studies: genetic heterogeneity and individual predisposition to cancer

PubMed Central

Galvan, Antonella; Ioannidis, John P.A.; Dragani, Tommaso A.

2010-01-01

Genome-wide association studies (GWAS) using population-based designs have identified many genetic loci associated with risk of a range of complex diseases including cancer; however, each locus exerts a very small effect and most heritability remains unexplained. Family-based pedigree studies have also suggested tentative loci linked to increased cancer risk, often characterized by pedigree-specificity. However, a comparison between the results of population-and those of family-based studies shows little concordance. Explanations for this unidentified genetic ‘dark matter’ of cancer include phenotype ascertainment issues, limited power, gene-gene and gene-environment interactions, population heterogeneity, parent-of-origin-specific effects, rare and unexplored variants. Many of these reasons converge towards the concept of genetic heterogeneity that might implicate hundreds of genetic variants in regulating cancer risk. Dissecting the dark matter is a challenging task. Further insights can be gained from both population association and pedigree studies. PMID:20106545

Adaptable gene-specific dye bias correction for two-channel DNA microarrays.

PubMed

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank C P

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available.

Adaptable gene-specific dye bias correction for two-channel DNA microarrays

PubMed Central

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank CP

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available. PMID:19401678

Genetic Factors of Autoimmune Thyroid Diseases in Japanese

PubMed Central

Ban, Yoshiyuki

2012-01-01

Autoimmune thyroid diseases (AITDs), including Graves' disease (GD) and Hashimoto's thyroiditis (HT), are caused by immune response to self-thyroid antigens and affect approximately 2–5% of the general population. Genetic susceptibility in combination with external factors, such as smoking, viral/bacterial infection, and chemicals, is believed to initiate the autoimmune response against thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITDs. Various techniques have been employed to identify genes contributing to the etiology of AITDs, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions) that are linked to AITDs, and, in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to GD and HT and some are common to both diseases, indicating that there is a shared genetic susceptibility to GD and HT. Known AITD-susceptibility genes are classified into three groups: HLA genes, non-HLA immune-regulatory genes (e.g., CTLA-4, PTPN22, and CD40), and thyroid-specific genes (e.g., TSHR and Tg). In this paper, we will summarize the latest findings on AITD susceptibility genes in Japanese. PMID:22242199

The 4-Celled Tetrabaena socialis Nuclear Genome Reveals the Essential Components for Genetic Control of Cell Number at the Origin of Multicellularity in the Volvocine Lineage.

PubMed

Featherston, Jonathan; Arakaki, Yoko; Hanschen, Erik R; Ferris, Patrick J; Michod, Richard E; Olson, Bradley J S C; Nozaki, Hisayoshi; Durand, Pierre M

2018-04-01

Multicellularity is the premier example of a major evolutionary transition in individuality and was a foundational event in the evolution of macroscopic biodiversity. The volvocine chlorophyte lineage is well suited for studying this process. Extant members span unicellular, simple colonial, and obligate multicellular taxa with germ-soma differentiation. Here, we report the nuclear genome sequence of one of the most morphologically simple organisms in this lineage-the 4-celled colonial Tetrabaena socialis and compare this to the three other complete volvocine nuclear genomes. Using conservative estimates of gene family expansions a minimal set of expanded gene families was identified that associate with the origin of multicellularity. These families are rich in genes related to developmental processes. A subset of these families is lineage specific, which suggests that at a genomic level the evolution of multicellularity also includes lineage-specific molecular developments. Multiple points of evidence associate modifications to the ubiquitin proteasomal pathway (UPP) with the beginning of coloniality. Genes undergoing positive or accelerating selection in the multicellular volvocines were found to be enriched in components of the UPP and gene families gained at the origin of multicellularity include components of the UPP. A defining feature of colonial/multicellular life cycles is the genetic control of cell number. The genomic data presented here, which includes diversification of cell cycle genes and modifications to the UPP, align the genetic components with the evolution of this trait.

Sampling Daphnia's expressed genes: preservation, expansion and invention of crustacean genes with reference to insect genomes

PubMed Central

Colbourne, John K; Eads, Brian D; Shaw, Joseph; Bohuski, Elizabeth; Bauer, Darren J; Andrews, Justen

2007-01-01

Background Functional and comparative studies of insect genomes have shed light on the complement of genes, which in part, account for shared morphologies, developmental programs and life-histories. Contrasting the gene inventories of insects to those of the nematodes provides insight into the genomic changes responsible for their diversification. However, nematodes have weak relationships to insects, as each belongs to separate animal phyla. A better outgroup to distinguish lineage specific novelties would include other members of Arthropoda. For example, crustaceans are close allies to the insects (together forming Pancrustacea) and their fascinating aquatic lifestyle provides an important comparison for understanding the genetic basis of adaptations to life on land versus life in water. Results This study reports on the first characterization of cDNA libraries and sequences for the model crustacean Daphnia pulex. We analyzed 1,546 ESTs of which 1,414 represent approximately 787 nuclear genes, by measuring their sequence similarities with insect and nematode proteomes. The provisional annotation of genes is supported by expression data from microarray studies described in companion papers. Loci expected to be shared between crustaceans and insects because of their mutual biological features are identified, including genes for reproduction, regulation and cellular processes. We identify genes that are likely derived within Pancrustacea or lost within the nematodes. Moreover, lineage specific gene family expansions are identified, which suggest certain biological demands associated with their ecological setting. In particular, up to seven distinct ferritin loci are found in Daphnia compared to three in most insects. Finally, a substantial fraction of the sampled gene transcripts shares no sequence similarity with those from other arthropods. Genes functioning during development and reproduction are comparatively well conserved between crustaceans and insects. By contrast, genes that were responsive to environmental conditions (metal stress) and not sex-biased included the greatest proportion of genes with no matches to insect proteomes. Conclusion This study along with associated microarray experiments are the initial steps in a coordinated effort by the Daphnia Genomics Consortium to build the necessary genomic platform needed to discover genes that account for the phenotypic diversity within the genus and to gain new insights into crustacean biology. This effort will soon include the first crustacean genome sequence. PMID:17612412

Integrating Membrane Transport with Male Gametophyte Development and Function through Transcriptomics.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bock KW; D Honys; JM. Ward

Male fertility depends on the proper development of the male gametophyte, successful pollen germination, tube growth and delivery of the sperm cells to the ovule. Previous studies have shown that nutrients like boron, and ion gradients or currents of Ca2+, H+, and K+ are critical for pollen tube growth. However, the molecular identities of transporters mediating these fluxes are mostly unknown. As a first step to integrate transport with pollen development and function, a genome-wide analysis of transporter genes expressed in the male gametophyte at four developmental stages was conducted. About 1269 genes encoding classified transporters were collected from themore » Arabidopsis thaliana genome. Of 757 transporter genes expressed in pollen, 16% or 124 genes, including AHA6, CNGC18, TIP1.3 and CHX08, are specifically or preferentially expressed relative to sporophytic tissues. Some genes are highly expressed in microspores and bicellular pollen (COPT3, STP2, OPT9); while others are activated only in tricellular or mature pollen (STP11, LHT7). Analyses of entire gene families showed that a subset of genes, including those expressed in sporophytic tissues, were developmentally-regulated during pollen maturation. Early and late expression patterns revealed by transcriptome analysis are supported by promoter::GUS analyses of CHX genes and by other methods. Recent genetic studies based on a few transporters, including plasma membrane H+ pump AHA3, Ca2+ pump ACA9, and K+ channel SPIK, further support the expression patterns and the inferred functions revealed by our analyses. Thus, revealing the distinct expression patterns of specific transporters and unknown polytopic proteins during microgametogenesis provides new insights for strategic mutant analyses necessary to integrate the roles of transporters and potential receptors with male gametophyte development.« less

Integrating membrane transport with male gametophyte development and function through transcriptomics.

PubMed

Bock, Kevin W; Honys, David; Ward, John M; Padmanaban, Senthilkumar; Nawrocki, Eric P; Hirschi, Kendal D; Twell, David; Sze, Heven

2006-04-01

Male fertility depends on the proper development of the male gametophyte, successful pollen germination, tube growth, and delivery of the sperm cells to the ovule. Previous studies have shown that nutrients like boron, and ion gradients or currents of Ca2+, H+, and K+ are critical for pollen tube growth. However, the molecular identities of transporters mediating these fluxes are mostly unknown. As a first step to integrate transport with pollen development and function, a genome-wide analysis of transporter genes expressed in the male gametophyte at four developmental stages was conducted. Approximately 1,269 genes encoding classified transporters were collected from the Arabidopsis (Arabidopsis thaliana) genome. Of 757 transporter genes expressed in pollen, 16% or 124 genes, including AHA6, CNGC18, TIP1.3, and CHX08, are specifically or preferentially expressed relative to sporophytic tissues. Some genes are highly expressed in microspores and bicellular pollen (COPT3, STP2, OPT9), while others are activated only in tricellular or mature pollen (STP11, LHT7). Analyses of entire gene families showed that a subset of genes, including those expressed in sporophytic tissues, was developmentally regulated during pollen maturation. Early and late expression patterns revealed by transcriptome analysis are supported by promoter::beta-glucuronidase analyses of CHX genes and by other methods. Recent genetic studies based on a few transporters, including plasma membrane H+ pump AHA3, Ca2+ pump ACA9, and K+ channel SPIK, further support the expression patterns and the inferred functions revealed by our analyses. Thus, revealing the distinct expression patterns of specific transporters and unknown polytopic proteins during microgametogenesis provides new insights for strategic mutant analyses necessary to integrate the roles of transporters and potential receptors with male gametophyte development.

Advances in targeted genome editing.

PubMed

Perez-Pinera, Pablo; Ousterout, David G; Gersbach, Charles A

2012-08-01

New technologies have recently emerged that enable targeted editing of genomes in diverse systems. This includes precise manipulation of gene sequences in their natural chromosomal context and addition of transgenes to specific genomic loci. This progress has been facilitated by advances in engineering targeted nucleases with programmable, site-specific DNA-binding domains, including zinc finger proteins and transcription activator-like effectors (TALEs). Recent improvements have enhanced nuclease performance, accelerated nuclease assembly, and lowered the cost of genome editing. These advances are driving new approaches to many areas of biotechnology, including biopharmaceutical production, agriculture, creation of transgenic organisms and cell lines, and studies of genome structure, regulation, and function. Genome editing is also being investigated in preclinical and clinical gene therapies for many diseases. Copyright © 2012 Elsevier Ltd. All rights reserved.

Behavior-specific changes in transcriptional modules lead to distinct and predictable neurogenomic states

PubMed Central

Chandrasekaran, Sriram; Ament, Seth A.; Eddy, James A.; Rodriguez-Zas, Sandra L.; Schatz, Bruce R.; Price, Nathan D.; Robinson, Gene E.

2011-01-01

Using brain transcriptomic profiles from 853 individual honey bees exhibiting 48 distinct behavioral phenotypes in naturalistic contexts, we report that behavior-specific neurogenomic states can be inferred from the coordinated action of transcription factors (TFs) and their predicted target genes. Unsupervised hierarchical clustering of these transcriptomic profiles showed three clusters that correspond to three ecologically important behavioral categories: aggression, maturation, and foraging. To explore the genetic influences potentially regulating these behavior-specific neurogenomic states, we reconstructed a brain transcriptional regulatory network (TRN) model. This brain TRN quantitatively predicts with high accuracy gene expression changes of more than 2,000 genes involved in behavior, even for behavioral phenotypes on which it was not trained, suggesting that there is a core set of TFs that regulates behavior-specific gene expression in the bee brain, and other TFs more specific to particular categories. TFs playing key roles in the TRN include well-known regulators of neural and behavioral plasticity, e.g., Creb, as well as TFs better known in other biological contexts, e.g., NF-κB (immunity). Our results reveal three insights concerning the relationship between genes and behavior. First, distinct behaviors are subserved by distinct neurogenomic states in the brain. Second, the neurogenomic states underlying different behaviors rely upon both shared and distinct transcriptional modules. Third, despite the complexity of the brain, simple linear relationships between TFs and their putative target genes are a surprisingly prominent feature of the networks underlying behavior. PMID:21960440

Epigenetic Mechanisms of Folate Nutrition in Breast Cancer

DTIC Science & Technology

2011-04-01

relationships between folate , one carbon metabolism, DNA methylation and gene expression within the context of breast cancer. Our hypothesis is that the...lentivirus plasmids containing miRNA against DHFR and AHCY. 2. Test effects of folate deficiency on global and gene specific DNA methylation and gene...including mammary tumors. The B vitamin folate is required for the synthesis of purines, thymidine, and S-adenosylmethionine (SAM), the methyl donor for DNA

Design and testing of regulatory cassettes for optimal activity in skeletal and cardiac muscles.

PubMed

Himeda, Charis L; Chen, Xiaolan; Hauschka, Stephen D

2011-01-01

Gene therapy for muscular dystrophies requires efficient gene delivery to the striated musculature and specific, high-level expression of the therapeutic gene in a physiologically diverse array of muscles. This can be achieved by the use of recombinant adeno-associated virus vectors in conjunction with muscle-specific regulatory cassettes. We have constructed several generations of regulatory cassettes based on the enhancer and promoter of the muscle creatine kinase gene, some of which include heterologous enhancers and individual elements from other muscle genes. Since the relative importance of many control elements varies among different anatomical muscles, we are aiming to tailor these cassettes for high-level expression in cardiac muscle, and in fast and slow skeletal muscles. With the achievement of efficient intravascular gene delivery to isolated limbs, selected muscle groups, and heart in large animal models, the design of cassettes optimized for activity in different muscle types is now a practical goal. In this protocol, we outline the key steps involved in the design of regulatory cassettes for optimal activity in skeletal and cardiac muscle, and testing in mature muscle fiber cultures. The basic principles described here can also be applied to engineering tissue-specific regulatory cassettes for other cell types.

Impact of the Location of CpG Methylation within the GSTP1 Gene on Its Specificity as a DNA Marker for Hepatocellular Carcinoma

PubMed Central

Jain, Surbhi; Boldbaatar, Batbold; Hamilton, James P.; Lin, Selena Y.; Chang, Ting-Tsung; Chen, Shun-Hua; Song, Wei; Meltzer, Stephen J.; Block, Timothy M.; Su, Ying-Hsiu

2012-01-01

Hypermethylation of the glutathione S-transferase π 1 (GSTP1) gene promoter region has been reported to be a potential biomarker to distinguish hepatocellular carcinoma (HCC) from other liver diseases. However, reports regarding how specific a marker it is have ranged from 100% to 0%. We hypothesized that, to a large extent, the variation of specificity depends on the location of the CpG sites analyzed. To test this hypothesis, we compared the methylation status of the GSTP1 promoter region of the DNA isolated from HCC, cirrhosis, hepatitis, and normal liver tissues by bisulfite–PCR sequencing. We found that the 5′ region of the position −48 nt from the transcription start site of the GSTP1 gene is selectively methylated in HCC, whereas the 3′ region is methylated in all liver tissues examined, including normal liver and the HCC tissue. Interestingly, when DNA derived from fetal liver and 11 nonhepatic normal tissue was also examined by bisulfite-PCR sequencing, we found that methylation of the 3′ region of the promoter appeared to be liver-specific. A methylation-specific PCR assay targeting the 5′ region of the promoter was developed and used to quantify the methylated GSTP1 gene in various diseased liver tissues including HCC. When we used an assay targeting the 3′ region, we found that the methylation of the 5′-end of the GSTP1 promoter was significantly more specific than that of the 3′-end (97.1% vs. 60%, p<0.0001 by Fisher's exact test) for distinguishing HCC (n = 120) from hepatitis (n = 35) and cirrhosis (n = 35). Encouragingly, 33.8% of the AFP-negative HCC contained the methylated GSTP1 gene. This study clearly demonstrates the importance of the location of CpG site methylation for HCC specificity and how liver-specific DNA methylation should be considered when an epigenetic DNA marker is studied for detection of HCC. PMID:22536438

A Penalized Robust Method for Identifying Gene-Environment Interactions

PubMed Central

Shi, Xingjie; Liu, Jin; Huang, Jian; Zhou, Yong; Xie, Yang; Ma, Shuangge

2015-01-01

In high-throughput studies, an important objective is to identify gene-environment interactions associated with disease outcomes and phenotypes. Many commonly adopted methods assume specific parametric or semiparametric models, which may be subject to model mis-specification. In addition, they usually use significance level as the criterion for selecting important interactions. In this study, we adopt the rank-based estimation, which is much less sensitive to model specification than some of the existing methods and includes several commonly encountered data and models as special cases. Penalization is adopted for the identification of gene-environment interactions. It achieves simultaneous estimation and identification and does not rely on significance level. For computation feasibility, a smoothed rank estimation is further proposed. Simulation shows that under certain scenarios, for example with contaminated or heavy-tailed data, the proposed method can significantly outperform the existing alternatives with more accurate identification. We analyze a lung cancer prognosis study with gene expression measurements under the AFT (accelerated failure time) model. The proposed method identifies interactions different from those using the alternatives. Some of the identified genes have important implications. PMID:24616063

''The control of lignin synthesis''

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carlson, John E.

2005-04-07

In this project we tested the hypothesis that regulation of the synthesis of lignin in secondary xylem cells in conifer trees involves the transport of glucosylated lignin monomers to the wall of xylem cells, followed by de-glucosylation in the cell wall by monolignol-specific glucosidase enzymes, which activates the monomers for lignin polymerization. The information we gathered is relevant to the fundamental understanding of how trees make wood, and to the applied goal of more environmentally friendly pulp and paper production. We characterized the complete genomic structure of the Coniferin-specific Beta-glucosidase (CBG) gene family in the conifers loblolly pine (Pinus taeda)more » and lodgepole pine (Pinus contorta), and partial genomic sequences were obtained in several other tree species. Both pine species contain multiple CBG genes which raises the possibility of differential regulation, perhaps related to the multiple roles of lignin in development and defense. Subsequent projects will need to include detailed gene expression studies of each gene family member during tree growth and development, and testing the role of each monolignol-specific glucosidase gene in controlling lignin content.« less

Animal models for prenatal gene therapy: rodent models for prenatal gene therapy.

PubMed

Roybal, Jessica L; Endo, Masayuki; Buckley, Suzanne M K; Herbert, Bronwen R; Waddington, Simon N; Flake, Alan W

2012-01-01

Fetal gene transfer has been studied in various animal models, including rabbits, guinea pigs, cats, dogs, and nonhuman primate; however, the most common model is the rodent, particularly the mouse. There are numerous advantages to mouse models, including a short gestation time of around 20 days, large litter size usually of more than six pups, ease of colony maintenance due to the small physical size, and the relatively low expense of doing so. Moreover, the mouse genome is well defined, there are many transgenic models particularly of human monogenetic disorders, and mouse-specific biological reagents are readily available. One criticism has been that it is difficult to perform procedures on the fetal mouse with suitable accuracy. Over the past decade, accumulation of technical expertise and development of technology such as high-frequency ultrasound have permitted accurate vector delivery to organs and tissues. Here, we describe our experiences of gene transfer to the fetal mouse with and without ultrasound guidance from mid to late gestation. Depending upon the vector type, the route of delivery and the age of the fetus, specific or widespread gene transfer can be achieved, making fetal mice excellent models for exploratory biodistribution studies.

Evolving targeted therapies for right ventricular failure.

PubMed

Di Salvo, Thomas G

2015-01-01

Although right and left ventricular embryological origins, morphology and cardiodynamics differ, the notion of selectively targeted right ventricular therapies remains controversial. This review focuses on both the currently evolving pharmacologic agents targeting right ventricular failure (metabolic modulators, phosphodiesterase type V inhibitors) and future therapeutic approaches including epigenetic modulation by miRNAs, chromatin binding complexes, long non-coding RNAs, genomic editing, adoptive gene transfer and gene therapy, cell regeneration via cell transplantation and cell reprogramming and cardiac tissue engineering. Strategies for adult right ventricular regeneration will require a more holistic approach than strategies for adult left ventricular failure. Instances of right ventricular failure requiring global reconstitution of right ventricular myocardium, attractive approaches include: i) myocardial patches seeded with cardiac fibroblasts reprogrammed into cardiomyocytes in vivo by small molecules, miRNAs or other epigenetic modifiers; and ii) administration of miRNAs, lncRNAs or small molecules by non-viral vector delivery systems targeted to fibroblasts (e.g., episomes) to stimulate in vivo reprogramming of fibroblasts into cardiomyocytes. For selected heritable genetic myocardial diseases, genomic editing affords exciting opportunities for allele-specific silencing by site-specific directed silencing, mutagenesis or gene excision. Genomic editing by adoptive gene transfer affords similarly exciting opportunities for restoration of myocardial gene expression.

Variants in the Dopamine-4-Receptor Gene Promoter Are Not Associated with Sensation Seeking in Skiers

PubMed Central

Thomson, Cynthia J.; Rajala, Amelia K.; Carlson, Scott R.; Rupert, Jim L.

2014-01-01

Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (−1106T/C, −906T/C, −809G/A, −291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population. PMID:24691022

Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.).

PubMed

Okada, Kazuma; Moriya, Shigeki; Haji, Takashi; Abe, Kazuyuki

2013-06-01

Using 11 consensus primer pairs designed from S-linked F-box genes of apple and Japanese pear, 10 new F-box genes (MdFBX21 to 30) were isolated from the apple cultivar 'Spartan' (S(9)S(10)). MdFBX21 to 23 and MdFBX24 to 30 were completely linked to the S(9) -RNase and S(10-)RNase, respectively, and showed pollen-specific expression and S-haplotype-specific polymorphisms. Therefore, these 10 F-box genes are good candidates for the pollen determinant of self-incompatibility in apple. Phylogenetic analysis and comparison of deduced amino acid sequences of MdFBX21 to 30 with those of 25 S-linked F-box genes previously isolated from apple showed that a deduced amino acid identity of greater than 88.0 % can be used as the tentative criterion to classify F-box genes into one type. Using this criterion, 31 of 35 F-box genes of apple were classified into 11 types (SFBB1-11). All types included F-box genes derived from S(3-) and S(9-)haplotypes, and seven types included F-box genes derived from S(3-), S(9-), and S(10-)haplotypes. Moreover, comparison of nucleotide sequences of S-RNases and multiple F-box genes among S(3-), S(9-), and S(10-)haplotypes suggested that F-box genes within each type showed high nucleotide identity regardless of the identity of the S-RNase. The large number of F-box genes as candidates for the pollen determinant and the high degree of conservation within each type are consistent with the collaborative non-self-recognition model reported for Petunia. These findings support that the collaborative non-self-recognition system also exists in apple.

Expression of mouse Tla region class I genes in tissues enriched for gamma delta cells.

PubMed

Eghtesady, P; Brorson, K A; Cheroutre, H; Tigelaar, R E; Hood, L; Kronenberg, M

1992-01-01

The Tla region of the BALB/c mouse major histocompatibility complex contains at least 20 class I genes. The function of the products of these genes is unknown, but recent evidence demonstrates that some Tla region gene products could be involved in presentation of antigens to gamma delta T cells. We have generated a set of polymerase chain reaction (PCR) oligonucleotide primers and hybridization probes that permit us to specifically amplify and detect expression of 11 of the 20 BALB/c Tla region genes. cDNA prepared from 12 adult and fetal tissues and from seven cell lines was analyzed. In some cases, northern blot analysis or staining with monoclonal antibodies specific for the Tla-encoded thymus leukemia (TL) antigen were used to confirm the expression pattern of several of the genes as determined by PCR. Some Tla region genes, such as T24d and the members of the T10d/T22d gene pair, are expressed in a wide variety of tissues in a manner similar to the class I transplantation antigens. The members of the TL antigen encoding gene pair, T3d/T18d, are expressed in only a limited number of organs, including several sites enriched for gamma delta T cells. Other Tla region genes, including T1d, T2d, T16d, and T17d, are transcriptionally silent and transcripts from the T8d/T20d gene pair do not undergo proper splicing. In general, sites that contain gamma delta T lymphocytes have Tla region transcripts. The newly identified pattern of expression of the genes analyzed in sites containing gamma delta T cells further extends the list of potential candidates for antigen presentation to gamma delta T cells.

Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine

PubMed Central

Haralambieva, Iana H.; Ovsyannikova, Inna G.; Umlauf, Benjamin J.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2014-01-01

Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans. PMID:21939710

Metatranscriptomic Study of Common and Host-Specific Patterns of Gene Expression between Pines and Their Symbiotic Ectomycorrhizal Fungi in the Genus Suillus

PubMed Central

Liao, Hui-Ling; Chen, Yuan; Vilgalys, Rytas

2016-01-01

Ectomycorrhizal fungi (EMF) represent one of the major guilds of symbiotic fungi associated with roots of forest trees, where they function to improve plant nutrition and fitness in exchange for plant carbon. Many groups of EMF exhibit preference or specificity for different plant host genera; a good example is the genus Suillus, which grows in association with the conifer family Pinaceae. We investigated genetics of EMF host-specificity by cross-inoculating basidiospores of five species of Suillus onto ten species of Pinus, and screened them for their ability to form ectomycorrhizae. Several Suillus spp. including S. granulatus, S. spraguei, and S. americanus readily formed ectomycorrhizae (compatible reaction) with white pine hosts (subgenus Strobus), but were incompatible with other pine hosts (subgenus Pinus). Metatranscriptomic analysis of inoculated roots reveals that plant and fungus each express unique gene sets during incompatible vs. compatible pairings. The Suillus-Pinus metatranscriptomes utilize highly conserved gene regulatory pathways, including fungal G-protein signaling, secretory pathways, leucine-rich repeat and pathogen resistance proteins that are similar to those associated with host-pathogen interactions in other plant-fungal systems. Metatranscriptomic study of the combined Suillus-Pinus transcriptome has provided new insight into mechanisms of adaptation and coevolution of forest trees with their microbial community, and revealed that genetic regulation of ectomycorrhizal symbiosis utilizes universal gene regulatory pathways used by other types of fungal-plant interactions including pathogenic fungal-host interactions. PMID:27736883

A transcriptional dynamic network during Arabidopsis thaliana pollen development.

PubMed

Wang, Jigang; Qiu, Xiaojie; Li, Yuhua; Deng, Youping; Shi, Tieliu

2011-01-01

To understand transcriptional regulatory networks (TRNs), especially the coordinated dynamic regulation between transcription factors (TFs) and their corresponding target genes during development, computational approaches would represent significant advances in the genome-wide expression analysis. The major challenges for the experiments include monitoring the time-specific TFs' activities and identifying the dynamic regulatory relationships between TFs and their target genes, both of which are currently not yet available at the large scale. However, various methods have been proposed to computationally estimate those activities and regulations. During the past decade, significant progresses have been made towards understanding pollen development at each development stage under the molecular level, yet the regulatory mechanisms that control the dynamic pollen development processes remain largely unknown. Here, we adopt Networks Component Analysis (NCA) to identify TF activities over time course, and infer their regulatory relationships based on the coexpression of TFs and their target genes during pollen development. We carried out meta-analysis by integrating several sets of gene expression data related to Arabidopsis thaliana pollen development (stages range from UNM, BCP, TCP, HP to 0.5 hr pollen tube and 4 hr pollen tube). We constructed a regulatory network, including 19 TFs, 101 target genes and 319 regulatory interactions. The computationally estimated TF activities were well correlated to their coordinated genes' expressions during the development process. We clustered the expression of their target genes in the context of regulatory influences, and inferred new regulatory relationships between those TFs and their target genes, such as transcription factor WRKY34, which was identified that specifically expressed in pollen, and regulated several new target genes. Our finding facilitates the interpretation of the expression patterns with more biological relevancy, since the clusters corresponding to the activity of specific TF or the combination of TFs suggest the coordinated regulation of TFs to their target genes. Through integrating different resources, we constructed a dynamic regulatory network of Arabidopsis thaliana during pollen development with gene coexpression and NCA. The network illustrated the relationships between the TFs' activities and their target genes' expression, as well as the interactions between TFs, which provide new insight into the molecular mechanisms that control the pollen development.

Hyphae-specific genes HGC1, ALS3, HWP1, and ECE1 and relevant signaling pathways in Candida albicans.

PubMed

Fan, Yan; He, Hong; Dong, Yan; Pan, Hengbiao

2013-12-01

Fungal virulence mechanisms include adhesion to epithelia, morphogenesis, production of secretory hydrolytic enzymes, and phenotype switching, all of which contribute to the process of pathogenesis. A striking feature of the biology of Candida albicans is its ability to grow in yeast, pseudohyphal, and hyphal forms. The hyphal form plays an important role in causing disease, by invading epithelial cells and causing tissue damage. In this review, we illustrate some of the main hyphae-specific genes, namely HGC1, UME6, ALS3, HWP1, and ECE1, and their relevant and reversed signal transduction pathways in reactions stimulated by environmental factors, including pH, CO2, and serum.

Design and interpretation of microRNA-reporter gene activity.

PubMed

Carroll, Adam P; Tooney, Paul A; Cairns, Murray J

2013-06-15

MicroRNAs (miRNAs) are small noncoding RNA molecules that act as sequence specificity guides to direct post-transcriptional gene silencing. In doing so, miRNAs regulate many critical developmental processes, including cellular proliferation, differentiation, migration, and apoptosis, as well as more specialized biological functions such as dendritic spine development and synaptogenesis. Interactions between miRNAs and their miRNA recognition elements occur via partial complementarity, rendering tremendous redundancy in targeting such that miRNAs are predicted to regulate 60% of the genome, with each miRNA estimated to regulate more than 200 genes. Because these predictions are prone to false positives and false negatives, there is an ever present need to provide material support to these assertions to firmly establish the biological function of specific miRNAs in both normal and pathophysiological contexts. Using schizophrenia-associated miR-181b as an example, we present detailed guidelines and novel insights for the rapid establishment of a streamlined miRNA-reporter gene assay and explore various design concepts for miRNA-reporter gene applications, including bidirectional miRNA modulation. In exemplifying this approach, we report seven novel miR-181b target sites for five schizophrenia candidate genes (DISC1, BDNF, ENKUR, GRIA1, and GRIK1) and dissect a number of vital concepts regarding future developments for miRNA-reporter gene assays and the interpretation of their results. Copyright © 2013 Elsevier Inc. All rights reserved.

Efficient disruption of Zebrafish genes using a Gal4-containing gene trap

PubMed Central

2013-01-01

Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702

Mammalian X homolog acts as sex chromosome in lacertid lizards

PubMed Central

Rovatsos, M; Vukić, J; Kratochvíl, L

2016-01-01

Among amniotes, squamate reptiles are especially variable in their mechanisms of sex determination; however, based largely on cytogenetic data, some lineages possess highly evolutionary stable sex chromosomes. The still very limited knowledge of the genetic content of squamate sex chromosomes precludes a reliable reconstruction of the evolutionary history of sex determination in this group and consequently in all amniotes. Female heterogamety with a degenerated W chromosome typifies the lizards of the family Lacertidae, the widely distributed Old World clade including several hundreds of species. From the liver transcriptome of the lacertid Takydromus sexlineatus female, we selected candidates for Z-specific genes as the loci lacking single-nucleotide polymorphisms. We validated the candidate genes through the comparison of the copy numbers in the female and male genomes of T. sexlineatus and another lacertid species, Lacerta agilis, by quantitative PCR that also proved to be a reliable technique for the molecular sexing of the studied species. We suggest that this novel approach is effective for the detection of Z-specific and X-specific genes in lineages with degenerated W, respectively Y chromosomes. The analyzed gene content of the Z chromosome revealed that lacertid sex chromosomes are not homologous with those of other reptiles including birds, but instead the genes have orthologs in the X-conserved region shared by viviparous mammals. It is possible that this part of the vertebrate genome was independently co-opted for the function of sex chromosomes in viviparous mammals and lacertids because of its content of genes involved in gonad differentiation. PMID:26980341

Comparative Genome Analysis of Trichophyton rubrum and Related Dermatophytes Reveals Candidate Genes Involved in Infection

PubMed Central

Martinez, Diego A.; Oliver, Brian G.; Gräser, Yvonne; Goldberg, Jonathan M.; Li, Wenjun; Martinez-Rossi, Nilce M.; Monod, Michel; Shelest, Ekaterina; Barton, Richard C.; Birch, Elizabeth; Brakhage, Axel A.; Chen, Zehua; Gurr, Sarah J.; Heiman, David; Heitman, Joseph; Kosti, Idit; Rossi, Antonio; Saif, Sakina; Samalova, Marketa; Saunders, Charles W.; Shea, Terrance; Summerbell, Richard C.; Xu, Jun; Young, Sarah; Zeng, Qiandong; Birren, Bruce W.; Cuomo, Christina A.; White, Theodore C.

2012-01-01

ABSTRACT The major cause of athlete’s foot is Trichophyton rubrum, a dermatophyte or fungal pathogen of human skin. To facilitate molecular analyses of the dermatophytes, we sequenced T. rubrum and four related species, Trichophyton tonsurans, Trichophyton equinum, Microsporum canis, and Microsporum gypseum. These species differ in host range, mating, and disease progression. The dermatophyte genomes are highly colinear yet contain gene family expansions not found in other human-associated fungi. Dermatophyte genomes are enriched for gene families containing the LysM domain, which binds chitin and potentially related carbohydrates. These LysM domains differ in sequence from those in other species in regions of the peptide that could affect substrate binding. The dermatophytes also encode novel sets of fungus-specific kinases with unknown specificity, including nonfunctional pseudokinases, which may inhibit phosphorylation by competing for kinase sites within substrates, acting as allosteric effectors, or acting as scaffolds for signaling. The dermatophytes are also enriched for a large number of enzymes that synthesize secondary metabolites, including dermatophyte-specific genes that could synthesize novel compounds. Finally, dermatophytes are enriched in several classes of proteases that are necessary for fungal growth and nutrient acquisition on keratinized tissues. Despite differences in mating ability, genes involved in mating and meiosis are conserved across species, suggesting the possibility of cryptic mating in species where it has not been previously detected. These genome analyses identify gene families that are important to our understanding of how dermatophytes cause chronic infections, how they interact with epithelial cells, and how they respond to the host immune response. PMID:22951933

The Evolution of Two-Component Systems in Bacteria Reveals Different Strategies for Niche Adaptation

PubMed Central

Arkin, Adam

2006-01-01

Two-component systems including histidine protein kinases represent the primary signal transduction paradigm in prokaryotic organisms. To understand how these systems adapt to allow organisms to detect niche-specific signals, we analyzed the phylogenetic distribution of nearly 5,000 histidine protein kinases from 207 sequenced prokaryotic genomes. We found that many genomes carry a large repertoire of recently evolved signaling genes, which may reflect selective pressure to adapt to new environmental conditions. Both lineage-specific gene family expansion and horizontal gene transfer play major roles in the introduction of new histidine kinases into genomes; however, there are differences in how these two evolutionary forces act. Genes imported via horizontal transfer are more likely to retain their original functionality as inferred from a similar complement of signaling domains, while gene family expansion accompanied by domain shuffling appears to be a major source of novel genetic diversity. Family expansion is the dominant source of new histidine kinase genes in the genomes most enriched in signaling proteins, and detailed analysis reveals that divergence in domain structure and changes in expression patterns are hallmarks of recent expansions. Finally, while these two modes of gene acquisition are widespread across bacterial taxa, there are clear species-specific preferences for which mode is used. PMID:17083272

Evolution and functional divergence of NLRP genes in mammalian reproductive systems

PubMed Central

2009-01-01

Background NLRPs (Nucleotide-binding oligomerization domain, Leucine rich Repeat and Pyrin domain containing Proteins) are members of NLR (Nod-like receptors) protein family. Recent researches have shown that NLRP genes play important roles in both mammalian innate immune system and reproductive system. Several of NLRP genes were shown to be specifically expressed in the oocyte in mammals. The aim of the present work was to study how these genes evolved and diverged after their duplication, as well as whether natural selection played a role during their evolution. Results By using in silico methods, we have evaluated the evolution and functional divergence of NLRP genes, in particular of mouse reproduction-related Nlrp genes. We found that (1) major NLRP genes have been duplicated before the divergence of mammals, with certain lineage-specific duplications in primates (NLRP7 and 11) and in rodents (Nlrp1, 4 and 9 duplicates); (2) tandem duplication events gave rise to a mammalian reproduction-related NLRP cluster including NLRP2, 4, 5, 7, 8, 9, 11, 13 and 14 genes; (3) the function of mammalian oocyte-specific NLRP genes (NLRP4, 5, 9 and 14) might have diverged during gene evolution; (4) recent segmental duplications concerning Nlrp4 copies and vomeronasal 1 receptor encoding genes (V1r) have been undertaken in the mouse; and (5) duplicates of Nlrp4 and 9 in the mouse might have been subjected to adaptive evolution. Conclusion In conclusion, this study brings us novel information on the evolution of mammalian reproduction-related NLRPs. On the one hand, NLRP genes duplicated and functionally diversified in mammalian reproductive systems (such as NLRP4, 5, 9 and 14). On the other hand, during evolution, different lineages adapted to develop their own NLRP genes, particularly in reproductive function (such as the specific expansion of Nlrp4 and Nlrp9 in the mouse). PMID:19682372

A genome-wide analysis of the flax (Linum usitatissimum L.) dirigent protein family: from gene identification and evolution to differential regulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Corbin, Cyrielle; Drouet, Samantha; Markulin, Lucija

Identification of DIR encoding genes in flax genome. Analysis of phylogeny, gene/protein structures and evolution. Identification of new conserved motifs linked to biochemical functions. Investigation of spatio-temporal gene expression and response to stress. Dirigent proteins (DIRs) were discovered during 8-8' lignan biosynthesis studies, through identification of stereoselective coupling to afford either (+)- or (-)-pinoresinols from E-coniferyl alcohol. DIRs are also involved or potentially involved in terpenoid, allyl/propenyl phenol lignan, pterocarpan and lignin biosynthesis. DIRs have very large multigene families in different vascular plants including flax, with most still of unknown function. DIR studies typically focus on a small subset ofmore » genes and identification of biochemical/physiological functions. Herein, a genome-wide analysis and characterization of the predicted flax DIR 44-membered multigene family was performed, this species being a rich natural grain source of 8-8' linked secoisolariciresinol-derived lignan oligomers. All predicted DIR sequences, including their promoters, were analyzed together with their public gene expression datasets. Expression patterns of selected DIRs were examined using qPCR, as well as through clustering analysis of DIR gene expression. These analyses further implicated roles for specific DIRs in (-)-pinoresinol formation in seed-coats, as well as (+)-pinoresinol in vegetative organs and/or specific responses to stress. Phylogeny and gene expression analysis segregated flax DIRs into six distinct clusters with new cluster-specific motifs identified. We propose that these findings can serve as a foundation to further systematically determine functions of DIRs, i.e. other than those already known in lignan biosynthesis in flax and other species. Given the differential expression profiles and inducibility of the flax DIR family, we provisionally propose that some DIR genes of unknown function could be involved in different aspects of secondary cell wall biosynthesis and plant defense.« less

A genome-wide analysis of the flax (Linum usitatissimum L.) dirigent protein family: from gene identification and evolution to differential regulation.

PubMed

Corbin, Cyrielle; Drouet, Samantha; Markulin, Lucija; Auguin, Daniel; Lainé, Éric; Davin, Laurence B; Cort, John R; Lewis, Norman G; Hano, Christophe

2018-05-01

Identification of DIR encoding genes in flax genome. Analysis of phylogeny, gene/protein structures and evolution. Identification of new conserved motifs linked to biochemical functions. Investigation of spatio-temporal gene expression and response to stress. Dirigent proteins (DIRs) were discovered during 8-8' lignan biosynthesis studies, through identification of stereoselective coupling to afford either (+)- or (-)-pinoresinols from E-coniferyl alcohol. DIRs are also involved or potentially involved in terpenoid, allyl/propenyl phenol lignan, pterocarpan and lignin biosynthesis. DIRs have very large multigene families in different vascular plants including flax, with most still of unknown function. DIR studies typically focus on a small subset of genes and identification of biochemical/physiological functions. Herein, a genome-wide analysis and characterization of the predicted flax DIR 44-membered multigene family was performed, this species being a rich natural grain source of 8-8' linked secoisolariciresinol-derived lignan oligomers. All predicted DIR sequences, including their promoters, were analyzed together with their public gene expression datasets. Expression patterns of selected DIRs were examined using qPCR, as well as through clustering analysis of DIR gene expression. These analyses further implicated roles for specific DIRs in (-)-pinoresinol formation in seed-coats, as well as (+)-pinoresinol in vegetative organs and/or specific responses to stress. Phylogeny and gene expression analysis segregated flax DIRs into six distinct clusters with new cluster-specific motifs identified. We propose that these findings can serve as a foundation to further systematically determine functions of DIRs, i.e. other than those already known in lignan biosynthesis in flax and other species. Given the differential expression profiles and inducibility of the flax DIR family, we provisionally propose that some DIR genes of unknown function could be involved in different aspects of secondary cell wall biosynthesis and plant defense.

Genome-Wide Analysis of the NAC Gene Family in Physic Nut (Jatropha curcas L.)

PubMed Central

Wu, Zhenying; Xu, Xueqin; Xiong, Wangdan; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Wu, Guojiang; Jiang, Huawu

2015-01-01

The NAC proteins (NAM, ATAF1/2 and CUC2) are plant-specific transcriptional regulators that have a conserved NAM domain in the N-terminus. They are involved in various biological processes, including both biotic and abiotic stress responses. In the present study, a total of 100 NAC genes (JcNAC) were identified in physic nut (Jatropha curcas L.). Based on phylogenetic analysis and gene structures, 83 JcNAC genes were classified as members of, or proposed to be diverged from, 39 previously predicted orthologous groups (OGs) of NAC sequences. Physic nut has a single intron-containing NAC gene subfamily that has been lost in many plants. The JcNAC genes are non-randomly distributed across the 11 linkage groups of the physic nut genome, and appear to be preferentially retained duplicates that arose from both ancient and recent duplication events. Digital gene expression analysis indicates that some of the JcNAC genes have tissue-specific expression profiles (e.g. in leaves, roots, stem cortex or seeds), and 29 genes differentially respond to abiotic stresses (drought, salinity, phosphorus deficiency and nitrogen deficiency). Our results will be helpful for further functional analysis of the NAC genes in physic nut. PMID:26125188

Genome-Wide Analysis of the NAC Gene Family in Physic Nut (Jatropha curcas L.).

PubMed

Wu, Zhenying; Xu, Xueqin; Xiong, Wangdan; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Wu, Guojiang; Jiang, Huawu

2015-01-01

The NAC proteins (NAM, ATAF1/2 and CUC2) are plant-specific transcriptional regulators that have a conserved NAM domain in the N-terminus. They are involved in various biological processes, including both biotic and abiotic stress responses. In the present study, a total of 100 NAC genes (JcNAC) were identified in physic nut (Jatropha curcas L.). Based on phylogenetic analysis and gene structures, 83 JcNAC genes were classified as members of, or proposed to be diverged from, 39 previously predicted orthologous groups (OGs) of NAC sequences. Physic nut has a single intron-containing NAC gene subfamily that has been lost in many plants. The JcNAC genes are non-randomly distributed across the 11 linkage groups of the physic nut genome, and appear to be preferentially retained duplicates that arose from both ancient and recent duplication events. Digital gene expression analysis indicates that some of the JcNAC genes have tissue-specific expression profiles (e.g. in leaves, roots, stem cortex or seeds), and 29 genes differentially respond to abiotic stresses (drought, salinity, phosphorus deficiency and nitrogen deficiency). Our results will be helpful for further functional analysis of the NAC genes in physic nut.

Gene transfer and gene mapping in mammalian cells in culture.

PubMed

Shows, T B; Sakaguchi, A Y

1980-01-01

The ability to transfer mammalian genes parasexually has opened new possibilities for gene mapping and fine structure mapping and offers great potential for contributing to several aspects of mammalian biology, including gene expression and genetic engineering. The DNA transferred has ranged from whole genomes to single genes and smaller segments of DNA. The transfer of whole genomes by cell fusion forms cell hybrids, which has promoted the extensive mapping of human and mouse genes. Transfer, by cell fusion, of rearranged chromosomes has contributed significantly to determining close linkage and the assignment of genes to specific chromosomal regions. Transfer of single chromosomes has been achieved utilizing microcells fused to recipient cells. Metaphase chromosomes have been isolated and used to transfer single-to-multigenic DNA segments. DNA-mediated gene transfer, simulating bacterial transformation, has achieved transfer of single-copy genes. By utilizing DNA cleaved with restriction endonucleases, gene transfer is being empolyed as a bioassay for the purification of genes. Gene mapping and the fate of transferred genes can be examined now at the molecular level using sequence-specific probles. Recently, single genes have been cloned into eucaryotic and procaryotic vectors for transfer into mammalian cells. Moreover, recombinant libraries in which entire mammalian genomes are represented collectively are a rich new source of transferable genes. Methodology for transferring mammalian genetic information and applications for mapping mammalian genes is presented and prospects for the future discussed.

New genes in the evolution of the neural crest differentiation program

PubMed Central

2007-01-01

Background Development of the vertebrate head depends on the multipotency and migratory behavior of neural crest derivatives. This cell population is considered a vertebrate innovation and, accordingly, chordate ancestors lacked neural crest counterparts. The identification of neural crest specification genes expressed in the neural plate of basal chordates, in addition to the discovery of pigmented migratory cells in ascidians, has challenged this hypothesis. These new findings revive the debate on what is new and what is ancient in the genetic program that controls neural crest formation. Results To determine the origin of neural crest genes, we analyzed Phenotype Ontology annotations to select genes that control the development of this tissue. Using a sequential blast pipeline, we phylogenetically classified these genes, as well as those associated with other tissues, in order to define tissue-specific profiles of gene emergence. Of neural crest genes, 9% are vertebrate innovations. Our comparative analyses show that, among different tissues, the neural crest exhibits a particularly high rate of gene emergence during vertebrate evolution. A remarkable proportion of the new neural crest genes encode soluble ligands that control neural crest precursor specification into each cell lineage, including pigmented, neural, glial, and skeletal derivatives. Conclusion We propose that the evolution of the neural crest is linked not only to the recruitment of ancestral regulatory genes but also to the emergence of signaling peptides that control the increasingly complex lineage diversification of this plastic cell population. PMID:17352807

CHRFAM7A: a human-specific α7-nicotinic acetylcholine receptor gene shows differential responsiveness of human intestinal epithelial cells to LPS

PubMed Central

Dang, Xitong; Eliceiri, Brian P.; Baird, Andrew; Costantini, Todd W.

2015-01-01

The human genome contains a unique, distinct, and human-specific α7-nicotinic acetylcholine receptor (α7nAChR) gene [CHRNA7 (gene-encoding α7-nicotinic acetylcholine receptor)] called CHRFAM7A (gene-encoding dup-α7-nicotinic acetylcholine receptor) on a locus of chromosome 15 associated with mental illness, including schizophrenia. Located 5′ upstream from the “wild-type” CHRNA7 gene that is found in other vertebrates, we demonstrate CHRFAM7A expression in a broad range of epithelial cells and sequenced the CHRFAM7A transcript found in normal human fetal small intestine epithelial (FHs) cells to prove its identity. We then compared its expression to CHRNA7 in 11 gut epithelial cell lines, showed that there is a differential response to LPS when compared to CHRNA7, and characterized the CHRFAM7A promoter. We report that both CHRFAM7A and CHRNA7 gene expression are widely distributed in human epithelial cell lines but that the levels of CHRFAM7A gene expression vary up to 5000-fold between different gut epithelial cells. A 3-hour treatment of epithelial cells with 100 ng/ml LPS increased CHRFAM7A gene expression by almost 1000-fold but had little effect on CHRNA7 gene expression. Mapping the regulatory elements responsible for CHRFAM7A gene expression identifies a 1 kb sequence in the UTR of the CHRFAM7A gene that is modulated by LPS. Taken together, these data establish the presence, identity, and differential regulation of the human-specific CHRFAM7A gene in human gut epithelial cells. In light of the fact that CHRFAM7A expression is reported to modulate ligand binding to, and alter the activity of, the wild-type α7nAChR ligand-gated pentameric ion channel, the findings point to the existence of a species-specific α7nAChR response that might regulate gut epithelial function in a human-specific fashion.—Dang, X., Eliceiri, B. P., Baird, A., Costantini, T. W. CHRFAM7A: a human-specific α7-nicotinic acetylcholine receptor gene shows differential responsiveness of human intestinal epithelial cells to LPS. PMID:25681457

The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups

PubMed Central

Curtis, Christina; Shah, Sohrab P.; Chin, Suet-Feung; Turashvili, Gulisa; Rueda, Oscar M.; Dunning, Mark J.; Speed, Doug; Lynch, Andy G.; Samarajiwa, Shamith; Yuan, Yinyin; Gräf, Stefan; Ha, Gavin; Haffari, Gholamreza; Bashashati, Ali; Russell, Roslin; McKinney, Steven; Langerød, Anita; Green, Andrew; Provenzano, Elena; Wishart, Gordon; Pinder, Sarah; Watson, Peter; Markowetz, Florian; Murphy, Leigh; Ellis, Ian; Purushotham, Arnie; Børresen-Dale, Anne-Lise; Brenton, James D.; Tavaré, Simon; Caldas, Carlos; Aparicio, Samuel

2012-01-01

The elucidation of breast cancer subgroups and their molecular drivers requires integrated views of the genome and transcriptome from representative numbers of patients. We present an integrated analysis of copy number and gene expression in a discovery and validation set of 997 and 995 primary breast tumours, respectively, with long-term clinical follow-up. Inherited variants (copy number variants and single nucleotide polymorphisms) and acquired somatic copy number aberrations (CNAs) were associated with expression in ~40% of genes, with the landscape dominated by cis- and trans-acting CNAs. By delineating expression outlier genes driven in cis by CNAs, we identified putative cancer genes, including deletions in PPP2R2A, MTAP and MAP2K4. Unsupervised analysis of paired DNA–RNA profiles revealed novel subgroups with distinct clinical outcomes, which reproduced in the validation cohort. These include a high-risk, oestrogen-receptor-positive 11q13/14 cis-acting subgroup and a favourable prognosis subgroup devoid of CNAs. Trans-acting aberration hotspots were found to modulate subgroup-specific gene networks, including a TCR deletion-mediated adaptive immune response in the ‘CNA-devoid’ subgroup and a basal-specific chromosome 5 deletion-associated mitotic network. Our results provide a novel molecular stratification of the breast cancer population, derived from the impact of somatic CNAs on the transcriptome. PMID:22522925

Catechin supplemented in a FOS diet induces weight loss by altering cecal microbiota and gene expression of colonic epithelial cells.

PubMed

Luo, Jianming; Han, Lulu; Liu, Liu; Gao, Lijuan; Xue, Bin; Wang, Yong; Ou, Shiyi; Miller, Michael; Peng, Xichun

2018-05-23

Our previous study showed that catechin controlled rats' body weights and changed gut microbiota composition when supplemented into a high-fructo-oligosaccharide (FOS) diet. This experiment is devised to further confirm the relationship between specific bacteria in the colon and body weight gain, and to investigate how specific bacteria impact body weight by changing the expression of colonic epithelial cells. Forty obese rats were divided into four groups: three catechin-supplemented groups with a high-FOS diet (100, 400, and 700 mg kg-1 d-1 catechin, orally administered) and one group with a high-FOS diet only. Food consumption and body weights were recorded each week. After one month of treatment, rats' cecal content and colonic epithelial cells were individually collected and analyzed with MiSeq and gene expression profiling techniques, respectively. Results identified some specific bacteria at the genus level-including the increased Parabacteroides sp., Prevotella sp., Robinsoniella sp., [Ruminococcus], Phascolarctobacterium sp. and an unknown genus of YS2, and the decreased Lachnospira sp., Oscillospira sp., Ruminococcus sp., an unknown genus of Peptococcaceae and an unknown genus of Clostridiales in rats' cecum-and eight genes-including one downregulated Pla2g2a and seven upregulated genes: Apoa1, Apoa4, Aabr07073400.1, Fabp4, Pik3r5, Dgat2 and Ptgs2 of colonic epithelial cells-that were due to the consumption of catechin. Consequently, various biological functions in connection with energy metabolism in colonic epithelial cells were altered, including fat digestion and absorption and the regulation of lipolysis in adipocytes. In conclusion, catechin induces host weight loss by altering gut microbiota and gene expression and function in colonic epithelial cells.

Deciphering the Resistome of the Widespread Pseudomonas aeruginosa Sequence Type 175 International High-Risk Clone through Whole-Genome Sequencing

PubMed Central

López-Causapé, Carla; Ocampo-Sosa, Alain A.; Sommer, Lea M.; Domínguez, María Ángeles; Zamorano, Laura; Juan, Carlos; Tubau, Fe; Rodríguez, Cristina; Moyà, Bartolomé; Martínez-Martínez, Luis; Plesiat, Patrick

2016-01-01

Whole-genome sequencing (WGS) was used for the characterization of the frequently extensively drug resistant (XDR) Pseudomonas aeruginosa sequence type 175 (ST175) high-risk clone. A total of 18 ST175 isolates recovered from 8 different Spanish hospitals were analyzed; 4 isolates from 4 different French hospitals were included for comparison. The typical resistance profile of ST175 included penicillins, cephalosporins, monobactams, carbapenems, aminoglycosides, and fluoroquinolones. In the phylogenetic analysis, the four French isolates clustered together with two isolates from one of the Spanish regions. Sequence variation was analyzed for 146 chromosomal genes related to antimicrobial resistance, and horizontally acquired genes were explored using online databases. The resistome of ST175 was determined mainly by mutational events; resistance traits common to all or nearly all of the strains included specific ampR mutations leading to ampC overexpression, specific mutations in oprD conferring carbapenem resistance, or a mexZ mutation leading to MexXY overexpression. All isolates additionally harbored an aadB gene conferring gentamicin and tobramycin resistance. Several other resistance traits were specific to certain geographic areas, such as a streptomycin resistance gene, aadA13, detected in all four isolates from France and in the two isolates from the Cantabria region and a glpT mutation conferring fosfomycin resistance, detected in all but these six isolates. Finally, several unique resistance mutations were detected in single isolates; particularly interesting were those in genes encoding penicillin-binding proteins (PBP1A, PBP3, and PBP4). Thus, these results provide information valuable for understanding the genetic basis of resistance and the dynamics of the dissemination and evolution of high-risk clones. PMID:27736752

Deciphering the Resistome of the Widespread Pseudomonas aeruginosa Sequence Type 175 International High-Risk Clone through Whole-Genome Sequencing.

PubMed

Cabot, Gabriel; López-Causapé, Carla; Ocampo-Sosa, Alain A; Sommer, Lea M; Domínguez, María Ángeles; Zamorano, Laura; Juan, Carlos; Tubau, Fe; Rodríguez, Cristina; Moyà, Bartolomé; Peña, Carmen; Martínez-Martínez, Luis; Plesiat, Patrick; Oliver, Antonio

2016-12-01

Whole-genome sequencing (WGS) was used for the characterization of the frequently extensively drug resistant (XDR) Pseudomonas aeruginosa sequence type 175 (ST175) high-risk clone. A total of 18 ST175 isolates recovered from 8 different Spanish hospitals were analyzed; 4 isolates from 4 different French hospitals were included for comparison. The typical resistance profile of ST175 included penicillins, cephalosporins, monobactams, carbapenems, aminoglycosides, and fluoroquinolones. In the phylogenetic analysis, the four French isolates clustered together with two isolates from one of the Spanish regions. Sequence variation was analyzed for 146 chromosomal genes related to antimicrobial resistance, and horizontally acquired genes were explored using online databases. The resistome of ST175 was determined mainly by mutational events; resistance traits common to all or nearly all of the strains included specific ampR mutations leading to ampC overexpression, specific mutations in oprD conferring carbapenem resistance, or a mexZ mutation leading to MexXY overexpression. All isolates additionally harbored an aadB gene conferring gentamicin and tobramycin resistance. Several other resistance traits were specific to certain geographic areas, such as a streptomycin resistance gene, aadA13, detected in all four isolates from France and in the two isolates from the Cantabria region and a glpT mutation conferring fosfomycin resistance, detected in all but these six isolates. Finally, several unique resistance mutations were detected in single isolates; particularly interesting were those in genes encoding penicillin-binding proteins (PBP1A, PBP3, and PBP4). Thus, these results provide information valuable for understanding the genetic basis of resistance and the dynamics of the dissemination and evolution of high-risk clones. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Genome organization and characteristics of soybean microRNAs

PubMed Central

2012-01-01

Background microRNAs (miRNAs) are key regulators of gene expression and play important roles in many aspects of plant biology. The role(s) of miRNAs in nitrogen-fixing root nodules of leguminous plants such as soybean is not well understood. We examined a library of small RNAs from Bradyrhizobium japonicum-inoculated soybean roots and identified novel miRNAs. In order to enhance our understanding of miRNA evolution, diversification and function, we classified all known soybean miRNAs based on their phylogenetic conservation (conserved, legume- and soybean-specific miRNAs) and examined their genome organization, family characteristics and target diversity. We predicted targets of these miRNAs and experimentally validated several of them. We also examined organ-specific expression of selected miRNAs and their targets. Results We identified 120 previously unknown miRNA genes from soybean including 5 novel miRNA families. In the soybean genome, genes encoding miRNAs are primarily intergenic and a small percentage were intragenic or less than 1000 bp from a protein-coding gene, suggesting potential co-regulation between the miRNA and its parent gene. Difference in number and orientation of tandemly duplicated miRNA genes between orthologous genomic loci indicated continuous evolution and diversification. Conserved miRNA families are often larger in size and produce less diverse mature miRNAs than legume- and soybean-specific families. In addition, the majority of conserved and legume-specific miRNA families produce 21 nt long mature miRNAs with distinct nucleotide distribution and regulate a more conserved set of target mRNAs compared to soybean-specific families. A set of nodule-specific target mRNAs and their cognate regulatory miRNAs had inverse expression between root and nodule tissues suggesting that spatial restriction of target gene transcripts by miRNAs might govern nodule-specific gene expression in soybean. Conclusions Genome organization of soybean miRNAs suggests that they are actively evolving. Distinct family characteristics of soybean miRNAs suggest continuous diversification of function. Inverse organ-specific expression between selected miRNAs and their targets in the roots and nodules, suggested a potential role for these miRNAs in regulating nodule development. PMID:22559273

Species-specific serine-threonine protein kinase Pkb2 of Bifidobacterium longum subsp. longum: Genetic environment and substrate specificity.

PubMed

Nezametdinova, V Z; Mavletova, D A; Alekseeva, M G; Chekalina, M S; Zakharevich, N V; Danilenko, V N

2018-06-01

The objective of this study was to determine for phosphorylated substrates of the species-specific serine-threonine protein kinase (STPK) Pkb2 from Bifidobacterium longum subsp. longum GT15. Two approaches were employed: analyses of phosphorylated membrane vesicles protein spectra following kinase reactions and analyses of the genes surrounding pkb2. A bioinformatics analysis of the genes surrounding pkb2 found a species-specific gene cluster PFNA in the genomes of 34 different bifidobacterial species. The identified cluster consisted of 5-8 genes depending on the species. The first five genes are characteristic for all considered species. These are the following genes encoding serine-threonine protein kinase (pkb2), fibronectin type III domain-containing protein (fn3), AAA-ATPase (aaa-atp), hypothetical protein with DUF58 domain (duf58) and transglutaminase (tgm). The sixth (protein phosphatase, prpC), seventh (hypothetical protein, BLGT_RS02790), and eighth (FHA domain-containing protein, fha) genes are included in this cluster, but they are not found in all species. The operon organization of the PFNA gene cluster was confirmed with transcriptional analysis. AAA-ATPase, which is encoded by a gene of the PFNA gene cluster, was found to be a substrate of the STPK Pkb2. Fourteen AAA-ATPase sites (seven serine, six threonine, and one tyrosine) phosphorylated by STPK Pkb2 were revealed. Analysis of the spectra of phosphorylated membrane vesicles proteins allowed us to identify eleven proteins that were considered as possible Pkb2 substrates. They belong to several functional classes: proteins involved in transcription and translation; proteins of the F1-domain of the FoF1-ATPase; ABC-transporters; molecular chaperone GroEL; and glutamine synthase, GlnA1. All identified proteins were considered moonlighting proteins. Three out of 11 proteins (glutamine synthetase GlnA1 and FoF1-ATPase alpha and beta subunits) were selected for further in vitro phosphorylation assays and were shown to be phosphorylated by Pkb2. Four phosphorylated substrates of the species-specific STPK Pkb2 from B. longum subsp. longum GT15 were identified for the first time. They included the moonlighting protein glutamine synthase GlnA, FoF1-ATPase alpha and beta subunits, and the chaperone MoxR family of AAA-ATPase. The ability of bifidobacterial STPK to phosphorylate the substrate on serine, threonine, and tyrosine residues was shown for the first time. Copyright © 2018 Elsevier Ltd. All rights reserved.

A polymorphic region in the human transcription factor AP-2beta gene is associated with specific personality traits.

PubMed

Damberg, M; Garpenstrand, H; Alfredsson, J; Ekblom, J; Forslund, K; Rylander, G; Oreland, L

2000-03-01

Transcription factor AP-2beta is implicated in playing an important role during embryonic development of different parts of the brain, eg, midbrain, hindbrain, spinal cord, dorsal and cranial root ganglia.1,2 The gene encoding AP-2beta contains a polymorphic region which includes a tetranucleotide repeat of [CAAA] four or five times, located in intron 2 between nucleotides 12593 and 12612.3 Since the midbrain contains structures important for variables such as mood and personality, we have investigated if the AP-2beta genotype is associated with personality traits estimated by the Karolinska Scales of Personality (KSP). Identification of transcription factor genes as candidate genes in psychiatric disorders is a novel approach to further elucidate the genetic factors that, together with environmental factors, are involved in the expression of specific psychiatric phenotypes. The AP-2beta genotype and KSP scores were determined for 137 Caucasian volunteers (73 females and 64 males). The personality traits muscular tension, guilt, somatic anxiety, psychastenia and indirect aggression were significantly associated with the specific AP-2beta genotype, albeit with significant difference between genders. Based on this result the human AP-2beta gene seems to be an important candidate gene for personality disorders. Moreover, the present results suggest that the structure of the intron 2 region of the AP-2beta gene is one factor that contributes to development of the constitutional component of specific personality traits.

Involvement of specific calmodulin isoforms in salicylic acid-independent activation of plant disease resistance responses.

PubMed

Heo, W D; Lee, S H; Kim, M C; Kim, J C; Chung, W S; Chun, H J; Lee, K J; Park, C Y; Park, H C; Choi, J Y; Cho, M J

1999-01-19

The Ca2+ signal is essential for the activation of plant defense responses, but downstream components of the signaling pathway are still poorly defined. Here we demonstrate that specific calmodulin (CaM) isoforms are activated by infection or pathogen-derived elicitors and participate in Ca2+-mediated induction of plant disease resistance responses. Soybean CaM (SCaM)-4 and SCaM-5 genes, which encode for divergent CaM isoforms, were induced within 30 min by a fungal elicitor or pathogen, whereas other SCaM genes encoding highly conserved CaM isoforms did not show such response. This pathogen-triggered induction of these genes specifically depended on the increase of intracellular Ca2+ level. Constitutive expression of SCaM-4 and SCaM-5 in transgenic tobacco plants triggered spontaneous induction of lesions and induces an array of systemic acquired resistance (SAR)-associated genes. Surprisingly, these transgenic plants have normal levels of endogenous salicylic acid (SA). Furthermore, coexpression of nahG gene did not block the induction of SAR-associated genes in these transgenic plants, indicating that SA is not involved in the SAR gene induction mediated by SCaM-4 or SCaM-5. The transgenic plants exhibit enhanced resistance to a wide spectrum of virulent and avirulent pathogens, including bacteria, fungi, and virus. These results suggest that specific CaM isoforms are components of a SA-independent signal transduction chain leading to disease resistance.

High Mobility Group N Proteins Modulate the Fidelity of the Cellular Transcriptional Profile in a Tissue- and Variant-specific Manner*

PubMed Central

Kugler, Jamie E.; Horsch, Marion; Huang, Di; Furusawa, Takashi; Rochman, Mark; Garrett, Lillian; Becker, Lore; Bohla, Alexander; Hölter, Sabine M.; Prehn, Cornelia; Rathkolb, Birgit; Racz, Ildikó; Aguilar-Pimentel, Juan Antonio; Adler, Thure; Adamski, Jerzy; Beckers, Johannes; Busch, Dirk H.; Eickelberg, Oliver; Klopstock, Thomas; Ollert, Markus; Stöger, Tobias; Wolf, Eckhard; Wurst, Wolfgang; Yildirim, Ali Önder; Zimmer, Andreas; Gailus-Durner, Valérie; Fuchs, Helmut; Hrabě de Angelis, Martin; Garfinkel, Benny; Orly, Joseph; Ovcharenko, Ivan; Bustin, Michael

2013-01-01

The nuclei of most vertebrate cells contain members of the high mobility group N (HMGN) protein family, which bind specifically to nucleosome core particles and affect chromatin structure and function, including transcription. Here, we study the biological role of this protein family by systematic analysis of phenotypes and tissue transcription profiles in mice lacking functional HMGN variants. Phenotypic analysis of Hmgn1tm1/tm1, Hmgn3tm1/tm1, and Hmgn5tm1/tm1 mice and their wild type littermates with a battery of standardized tests uncovered variant-specific abnormalities. Gene expression analysis of four different tissues in each of the Hmgntm1/tm1 lines reveals very little overlap between genes affected by specific variants in different tissues. Pathway analysis reveals that loss of an HMGN variant subtly affects expression of numerous genes in specific biological processes. We conclude that within the biological framework of an entire organism, HMGNs modulate the fidelity of the cellular transcriptional profile in a tissue- and HMGN variant-specific manner. PMID:23620591

Technical variables in high-throughput miRNA expression profiling: much work remains to be done.

PubMed

Nelson, Peter T; Wang, Wang-Xia; Wilfred, Bernard R; Tang, Guiliang

2008-11-01

MicroRNA (miRNA) gene expression profiling has provided important insights into plant and animal biology. However, there has not been ample published work about pitfalls associated with technical parameters in miRNA gene expression profiling. One source of pertinent information about technical variables in gene expression profiling is the separate and more well-established literature regarding mRNA expression profiling. However, many aspects of miRNA biochemistry are unique. For example, the cellular processing and compartmentation of miRNAs, the differential stability of specific miRNAs, and aspects of global miRNA expression regulation require specific consideration. Additional possible sources of systematic bias in miRNA expression studies include the differential impact of pre-analytical variables, substrate specificity of nucleic acid processing enzymes used in labeling and amplification, and issues regarding new miRNA discovery and annotation. We conclude that greater focus on technical parameters is required to bolster the validity, reliability, and cultural credibility of miRNA gene expression profiling studies.

Joint-specific DNA methylation and transcriptome signatures in rheumatoid arthritis identify distinct pathogenic processes

PubMed Central

Ai, Rizi; Hammaker, Deepa; Boyle, David L.; Morgan, Rachel; Walsh, Alice M.; Fan, Shicai; Firestein, Gary S.; Wang, Wei

2016-01-01

Stratifying patients on the basis of molecular signatures could facilitate development of therapeutics that target pathways specific to a particular disease or tissue location. Previous studies suggest that pathogenesis of rheumatoid arthritis (RA) is similar in all affected joints. Here we show that distinct DNA methylation and transcriptome signatures not only discriminate RA fibroblast-like synoviocytes (FLS) from osteoarthritis FLS, but also distinguish RA FLS isolated from knees and hips. Using genome-wide methods, we show differences between RA knee and hip FLS in the methylation of genes encoding biological pathways, such as IL-6 signalling via JAK-STAT pathway. Furthermore, differentially expressed genes are identified between knee and hip FLS using RNA-sequencing. Double-evidenced genes that are both differentially methylated and expressed include multiple HOX genes. Joint-specific DNA signatures suggest that RA disease mechanisms might vary from joint to joint, thus potentially explaining some of the diversity of drug responses in RA patients. PMID:27282753

Gene therapy for prostate cancer: where are we now?

PubMed

Steiner, M S; Gingrich, J R

2000-10-01

The ability to recombine specifically and alter DNA sequences followed by techniques to transfer these sequences or even whole genes into normal and diseased cells has revolutionized medical research and ushered the clinicians of today into the age of gene therapy. We provide urologists a review of relevant background information, outline current treatment strategies and clinical trials, and delineate current challenges facing the field of gene therapy for advanced prostate cancer. We comprehensively reviewed the literature, including PubMed and recent abstract proceedings from national meetings, relevant to gene therapy and advanced prostate cancer. We selected for review literature representative of the principal scientific background for current gene therapy strategies and National Institutes of Health Recombinant DNA Advisory Committee approved clinical trials. Current prostate cancer gene therapy strategies include correcting aberrant gene expression, exploiting programmed cell death pathways, targeting critical cell biological functions, introducing toxic or cell lytic suicide genes, enhancing the immune system antitumor response and combining treatment with conventional cytotoxic chemotherapy or radiation therapy. Many challenges lie ahead for gene therapy, including improving DNA transfer efficiency to cells locally and at distant sites, enhancing levels of gene expression and overcoming immune responses that limit the time that genes are expressed. Nevertheless, despite these current challenges it is almost certain that gene therapy will be part of the urological armamentarium against prostate cancer in this century.

The genetics of fat distribution.

PubMed

Schleinitz, Dorit; Böttcher, Yvonne; Blüher, Matthias; Kovacs, Peter

2014-07-01

Fat stored in visceral depots makes obese individuals more prone to complications than subcutaneous fat. There is good evidence that body fat distribution (FD) is controlled by genetic factors. WHR, a surrogate measure of FD, shows significant heritability of up to ∼60%, even after adjusting for BMI. Genetic variants have been linked to various forms of altered FD such as lipodystrophies; however, the polygenic background of visceral obesity has only been sparsely investigated in the past. Recent genome-wide association studies (GWAS) for measures of FD revealed numerous loci harbouring genes potentially regulating FD. In addition, genes with fat depot-specific expression patterns (in particular subcutaneous vs visceral adipose tissue) provide plausible candidate genes involved in the regulation of FD. Many of these genes are differentially expressed in various fat compartments and correlate with obesity-related traits, thus further supporting their role as potential mediators of metabolic alterations associated with a distinct FD. Finally, developmental genes may at a very early stage determine specific FD in later life. Indeed, genes such as TBX15 not only manifest differential expression in various fat depots, but also correlate with obesity and related traits. Moreover, recent GWAS identified several polymorphisms in developmental genes (including TBX15, HOXC13, RSPO3 and CPEB4) strongly associated with FD. More accurate methods, including cardiometabolic imaging, for assessment of FD are needed to promote our understanding in this field, where the main focus is now to unravel the yet unknown biological function of these novel 'fat distribution genes'.

Systems Level Analysis of Systemic Sclerosis Shows a Network of Immune and Profibrotic Pathways Connected with Genetic Polymorphisms

PubMed Central

Mahoney, J. Matthew; Taroni, Jaclyn; Martyanov, Viktor; Wood, Tammara A.; Greene, Casey S.; Pioli, Patricia A.; Hinchcliff, Monique E.; Whitfield, Michael L.

2015-01-01

Systemic sclerosis (SSc) is a rare systemic autoimmune disease characterized by skin and organ fibrosis. The pathogenesis of SSc and its progression are poorly understood. The SSc intrinsic gene expression subsets (inflammatory, fibroproliferative, normal-like, and limited) are observed in multiple clinical cohorts of patients with SSc. Analysis of longitudinal skin biopsies suggests that a patient's subset assignment is stable over 6–12 months. Genetically, SSc is multi-factorial with many genetic risk loci for SSc generally and for specific clinical manifestations. Here we identify the genes consistently associated with the intrinsic subsets across three independent cohorts, show the relationship between these genes using a gene-gene interaction network, and place the genetic risk loci in the context of the intrinsic subsets. To identify gene expression modules common to three independent datasets from three different clinical centers, we developed a consensus clustering procedure based on mutual information of partitions, an information theory concept, and performed a meta-analysis of these genome-wide gene expression datasets. We created a gene-gene interaction network of the conserved molecular features across the intrinsic subsets and analyzed their connections with SSc-associated genetic polymorphisms. The network is composed of distinct, but interconnected, components related to interferon activation, M2 macrophages, adaptive immunity, extracellular matrix remodeling, and cell proliferation. The network shows extensive connections between the inflammatory- and fibroproliferative-specific genes. The network also shows connections between these subset-specific genes and 30 SSc-associated polymorphic genes including STAT4, BLK, IRF7, NOTCH4, PLAUR, CSK, IRAK1, and several human leukocyte antigen (HLA) genes. Our analyses suggest that the gene expression changes underlying the SSc subsets may be long-lived, but mechanistically interconnected and related to a patients underlying genetic risk. PMID:25569146

Evolutionary hierarchy of vertebrate-like heterotrimeric G protein families.

PubMed

Krishnan, Arunkumar; Mustafa, Arshi; Almén, Markus Sällman; Fredriksson, Robert; Williams, Michael J; Schiöth, Helgi B

2015-10-01

Heterotrimeric G proteins perform a crucial role as molecular switches controlling various cellular responses mediated by G protein-coupled receptor (GPCR) signaling pathway. Recent data have shown that the vertebrate-like G protein families are found across metazoans and their closest unicellular relatives. However, an overall evolutionary hierarchy of vertebrate-like G proteins, including gene family annotations and in particular mapping individual gene gain/loss events across diverse holozoan lineages is still incomplete. Here, with more expanded invertebrate taxon sampling, we have reconstructed phylogenetic trees for each of the G protein classes/families and provide a robust classification and hierarchy of vertebrate-like heterotrimeric G proteins. Our results further extend the evidence that the common ancestor (CA) of holozoans had at least five ancestral Gα genes corresponding to all major vertebrate Gα classes and contain a total of eight genes including two Gβ and one Gγ. Our results also indicate that the GNAI/O-like gene likely duplicated in the last CA of metazoans to give rise to GNAI- and GNAO-like genes, which are conserved across invertebrates. Moreover, homologs of GNB1-4 paralogon- and GNB5 family-like genes are found in most metazoans and that the unicellular holozoans encode two ancestral Gβ genes. Similarly, most bilaterian invertebrates encode two Gγ genes which include a representative of the GNG gene cluster and a putative homolog of GNG13. Interestingly, our results also revealed key evolutionary events such as the Drosophila melanogaster eye specific Gβ subunit that is found conserved in most arthropods and several previously unidentified species specific expansions within Gαi/o, Gαs, Gαq, Gα12/13 classes and the GNB1-4 paralogon. Also, we provide an overall proposed evolutionary scenario on the expansions of all G protein families in vertebrate tetraploidizations. Our robust classification/hierarchy is essential to further understand the differential roles of GPCR/G protein mediated intracellular signaling system across various metazoan lineages. Copyright © 2015 Elsevier Inc. All rights reserved.

Co-expression network with protein-protein interaction and transcription regulation in malaria parasite Plasmodium falciparum.

PubMed

Yu, Fu-Dong; Yang, Shao-You; Li, Yuan-Yuan; Hu, Wei

2013-04-10

Malaria continues to be one of the most severe global infectious diseases, as a major threat to human health and economic development. Network-based biological analysis is a promising approach to uncover key genes and biological processes from a network viewpoint, which could not be recognized from individual gene-based signatures. We integrated gene co-expression profile with protein-protein interaction and transcriptional regulation information to construct a comprehensive gene co-expression network of Plasmodium falciparum. Based on this network, we identified 10 core modules by using ICE (Iterative Clique Enumeration) algorithm, which were essential for malaria parasite development in intraerythrocytic developmental cycle (IDC) stages. In each module, all genes were highly correlated probably due to co-regulation or formation of a protein complex. Some of these genes were recognized to be differentially coexpressed among three close-by IDC stages. The gene of prpf8 (PFD0265w) encoding pre-mRNA processing splicing factor 8 product was identified as DCGs (differentially co-expressed genes) among IDC stages, although this gene function was seldom reported in previous researches. Integrating the species-specific gene prediction and differential co-expression gene detection, we found some modules could perform species-specific functions according to some of genes in these modules were species-specific genes, like the module 10. Furthermore, in order to reveal the underlying mechanisms of the erythrocyte invasion by P. falciparum, Steiner Tree algorithm was employed to identify the invasion subnetwork from our gene co-expression network. The subnetwork-based analysis indicated that some important Plasmodium parasite specific genes could corporate with each other and be co-regulated during the parasite invasion process, which including a head-to-head gene pair of PfRH2a (PF13_0198) and PfRH2b (MAL13P1.176). This study based on gene co-expression network could shed new insights on the mechanisms of pathogenesis, even virulence and P. falciparum development. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

[Mapping of seedlessness gene in grapes using SCAR markers].

PubMed

Yang, Ke-Qiang; Wang, Yue-Jin; Zhang, Jin-Jin; Wang, Xi-Ping; W A N, Yi-Zhen; Zhang, Jian-Xia

2005-03-01

Nine primers (including UBC-269 and GSLP1) were designed and synthesized based on DNA sequences of UBC-269(484) and GSLP1(569). The template DNA from Red Globe (seeded paternal parent) and Flame Seedless (seedless maternal parent) were screened using these primers. For Flame Seedless,GSLP1 yielded specific marker GSLP1(569); No. 39970524-5 primer yielded specific marker 39970524-5-564; and No. 6 primer yielded specific marker 39970524-6-1538 and 39970524-6-1200. GSLP1, No. 39970524-5, and No. 39970524-6 primers were used specifically to screen template DNA from the experimental plant materials. The results showed that the specific markers GSLP1(569), 39970524-5-564,39970524-6-1538 and 39970524-6-1200 were cosegregating with the major seedlessness gene. All these specific loci were also present in Thompson Seedless which was the initial donor of the seedlessness gene. It suggests that these SCAR markers are linked to a major grape seedlessness gene S. Markers order and map distance were estimated using the software 'QTXb17'. This showed that GSLP1(569), 39970524-5-564,39970524-6-1538 and 39970524-6-1200 were tightly linked to gene S. When P = 0.01,confidence limits for map distance ranged from 0.2 to 9.9; standard errors of map distance were from 0.6 to 1.9; LOD for linkage were from 32.7 to 46.4. These markers and the gene S were found to be in the same group. The markers were located on either side of gene S, covering 12.3 cM of the grape genome. The genetic distances between gene S and 39970524-5-564, GSLP1(569), 39970524-6-1538 and 39970524-6-1200 were 0.6 cM, 1.2 cM, 4.9 cM and 11.1 cM respectively.

Systems Biophysics of Gene Expression

PubMed Central

Vilar, Jose M.G.; Saiz, Leonor

2013-01-01

Gene expression is a process central to any form of life. It involves multiple temporal and functional scales that extend from specific protein-DNA interactions to the coordinated regulation of multiple genes in response to intracellular and extracellular changes. This diversity in scales poses fundamental challenges to the use of traditional approaches to fully understand even the simplest gene expression systems. Recent advances in computational systems biophysics have provided promising avenues to reliably integrate the molecular detail of biophysical process into the system behavior. Here, we review recent advances in the description of gene regulation as a system of biophysical processes that extend from specific protein-DNA interactions to the combinatorial assembly of nucleoprotein complexes. There is now basic mechanistic understanding on how promoters controlled by multiple, local and distal, DNA binding sites for transcription factors can actively control transcriptional noise, cell-to-cell variability, and other properties of gene regulation, including precision and flexibility of the transcriptional responses. PMID:23790365

Evolution of substrate specificity in a retained enzyme driven by gene loss

PubMed Central

Juárez-Vázquez, Ana Lilia; Edirisinghe, Janaka N; Verduzco-Castro, Ernesto A; Michalska, Karolina; Wu, Chenggang; Noda-García, Lianet; Babnigg, Gyorgy; Endres, Michael; Medina-Ruíz, Sofía; Santoyo-Flores, Julián; Carrillo-Tripp, Mauricio; Ton-That, Hung; Joachimiak, Andrzej; Henry, Christopher S; Barona-Gómez, Francisco

2017-01-01

The connection between gene loss and the functional adaptation of retained proteins is still poorly understood. We apply phylogenomics and metabolic modeling to detect bacterial species that are evolving by gene loss, with the finding that Actinomycetaceae genomes from human cavities are undergoing sizable reductions, including loss of L-histidine and L-tryptophan biosynthesis. We observe that the dual-substrate phosphoribosyl isomerase A or priA gene, at which these pathways converge, appears to coevolve with the occurrence of trp and his genes. Characterization of a dozen PriA homologs shows that these enzymes adapt from bifunctionality in the largest genomes, to a monofunctional, yet not necessarily specialized, inefficient form in genomes undergoing reduction. These functional changes are accomplished via mutations, which result from relaxation of purifying selection, in residues structurally mapped after sequence and X-ray structural analyses. Our results show how gene loss can drive the evolution of substrate specificity from retained enzymes. DOI: http://dx.doi.org/10.7554/eLife.22679.001 PMID:28362260

Evolution of Substrate Specificity in A Retained Enzyme Driven by Gene Loss

DOE PAGES

Juarez-Vazquez, Ana L.; Edirisinghe, Janaka N.; Verduzco-Castro, Ernesto A.; ...

2017-03-31

The connection between gene loss and the functional adaptation of retained proteins is still poorly understood. Here, we apply phylogenomics and metabolic modeling to detect bacterial species that are evolving by gene loss, with the finding that Actinomycetaceae genomes from human cavities are undergoing sizable reductions, including loss of L-histidine and L-tryptophan biosynthesis. We also observe that the dual-substrate phosphoribosyl isomerase A or priA gene, at which these pathways converge, appears to coevolve with the occurrence of trp and his genes. Characterization of a dozen PriA homologs shows that these enzymes adapt from bifunctionality in the largest genomes, to amore » monofunctional, yet not necessarily specialized, inefficient form in genomes undergoing reduction. These functional changes are accomplished via mutations, which result from relaxation of purifying selection, in residues structurally mapped after sequence and X-ray structural analyses. These results show how gene loss can drive the evolution of substrate specificity from retained enzymes.« less

Eye-Specific Gene Expression following Embryonic Ethanol Exposure in Zebrafish: Roles for Heat Shock Factor 1

PubMed Central

Kashyap, Bhavani; Pegorsch, Laurel; Frey, Ruth A.; Sun, Chi; Shelden, Eric A.; Stenkamp, Deborah L.

2014-01-01

The mechanisms through which ethanol exposure results in developmental defects remain unclear. We used the zebrafish model to elucidate eye-specific mechanisms that underlie ethanol-mediated microphthalmia (reduced eye size), through time-series microarray analysis of gene expression within eyes of embryos exposed to 1.5% ethanol. 62 genes were differentially expressed (DE) in ethanol-treated as compared to control eyes sampled during retinal neurogenesis (24-48 hours post-fertilization). The EDGE (extraction of differential gene expression) algorithm identified >3000 genes DE over developmental time in ethanol-exposed eyes as compared to controls. The DE lists included several genes indicating a mis-regulated cellular stress response due to ethanol exposure. Combined treatment with sub-threshold levels of ethanol and a morpholino targeting heat shock factor 1 mRNA resulted in microphthalmia, suggesting convergent molecular pathways. Thermal preconditioning partially prevented ethanol-mediated microphthalmia while maintaining Hsf-1 expression. These data suggest roles for reduced Hsf-1 in mediating microphthalmic effects of embryonic ethanol exposure. PMID:24355176

Evolution of Substrate Specificity in A Retained Enzyme Driven by Gene Loss

DOE Office of Scientific and Technical Information (OSTI.GOV)

Juarez-Vazquez, Ana L.; Edirisinghe, Janaka N.; Verduzco-Castro, Ernesto A.

The connection between gene loss and the functional adaptation of retained proteins is still poorly understood. Here, we apply phylogenomics and metabolic modeling to detect bacterial species that are evolving by gene loss, with the finding that Actinomycetaceae genomes from human cavities are undergoing sizable reductions, including loss of L-histidine and L-tryptophan biosynthesis. We also observe that the dual-substrate phosphoribosyl isomerase A or priA gene, at which these pathways converge, appears to coevolve with the occurrence of trp and his genes. Characterization of a dozen PriA homologs shows that these enzymes adapt from bifunctionality in the largest genomes, to amore » monofunctional, yet not necessarily specialized, inefficient form in genomes undergoing reduction. These functional changes are accomplished via mutations, which result from relaxation of purifying selection, in residues structurally mapped after sequence and X-ray structural analyses. These results show how gene loss can drive the evolution of substrate specificity from retained enzymes.« less

Sex chromosome differentiation and the W- and Z-specific loci in Xenopus laevis.

PubMed

Mawaribuchi, Shuuji; Takahashi, Shuji; Wada, Mikako; Uno, Yoshinobu; Matsuda, Yoichi; Kondo, Mariko; Fukui, Akimasa; Takamatsu, Nobuhiko; Taira, Masanori; Ito, Michihiko

2017-06-15

Genetic sex-determining systems in vertebrates include two basic types of heterogamety; XX (female)/XY (male) and ZZ (male)/ZW (female) types. The African clawed frog Xenopus laevis has a ZZ/ZW-type sex-determining system. In this species, we previously identified a W-specific sex (female)-determining gene dmw, and specified W and Z chromosomes, which could be morphologically indistinguishable (homomorphic). In addition to dmw, we most recently discovered two genes, named scanw and ccdc69w, and one gene, named capn5z in the W- and Z-specific regions, respectively. In this study, we revealed the detail structures of the W/Z-specific loci and genes. Sequence analysis indicated that there is almost no sequence similarity between 278kb W-specific and 83kb Z-specific sequences on chromosome 2Lq32-33, where both the transposable elements are abundant. Synteny and phylogenic analyses indicated that all the W/Z-specific genes might have emerged independently. Expression analysis demonstrated that scanw and ccdc69w or capn5z are expressed in early differentiating ZW gonads or testes, thereby suggesting possible roles in female or male development, respectively. Importantly, the sex-determining gene (SDG) dmw might have been generated after allotetraploidization, thereby indicating the construction of the new sex-determining system by dmw after species hybridization. Furthermore, by direct genotyping, we confirmed that diploid WW embryos developed into normal female frogs, which indicate that the Z-specific region is not essential for female development. Overall, these findings indicate that sex chromosome differentiation has started, although no heteromorphic sex chromosomes are evident yet, in X. laevis. Homologous recombination suppression might have promoted the accumulation of mutations and transposable elements, and enlarged the W/Z-specific regions, thereby resulting in differentiation of the W/Z chromosomes. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of miniature inverted-repeat transposable elements (MITEs) and biogenesis of their siRNAs in the Solanaceae: New functional implications for MITEs

USDA-ARS?s Scientific Manuscript database

Small RNAs regulate the genome by guiding transcriptional and post-transcriptional silencing machinery to specific target sequences, including genes and transposable elements (TEs). Although miniature inverted-repeat transposable elements (MITEs) are closely associated with euchromatic genes, the br...

Using Immediate-Early Genes to Map Hippocampal Subregional Functions

ERIC Educational Resources Information Center

Kubik, Stepan; Miyashita, Teiko; Guzowski, John F.

2007-01-01

Different functions have been suggested for the hippocampus and its subdivisions along both transversal and longitudinal axes. Expression of immediate-early genes (IEGs) has been used to map specific functions onto neuronal activity in different areas of the brain including the hippocampus (IEG imaging). Here we review IEG studies on hippocampal…

Rapid genetic typing of diarrheagenic Escherichia coli using a two-tube modified molecular beacon based multiplex real-time PCR assay and its clinical application

PubMed Central

2014-01-01

Background Diarrheagenic Escherichia coli (DEC), including Enterotoxigenic E.coli (ETEC), Enteroaggregative E.coli (EAEC), Enteropathogenic E.coli (EPEC), Enterohemolysin E.coli (EHEC) and Enteroinvasive E.coli (EIEC) causes diarrhea or hemolytic uremic syndromes among infants and travelers around the world. A rapid, reliable and repeatable method is urgent for identifying DEC so as to provide the reference for responding to diarrheal disease outbreak and the treatment of the diarrheal patients associated with DEC. Methods In this study, specific primers and modified molecular beacon probes of nine specific virulence genes, whose 5′end were added with homo tail sequence, were designed; and a two-tube modified molecular beacon based multiplex real–time PCR (rtPCR) assay for the identification of five Escherichia coli pathotypes, including ETEC, EAEC, EPEC, EHEC and EIEC was developed and optimized. Totally 102 bacterial strains, including 52 reference bacterial strains and 50 clinical strains were detected to confirm whether the target genes selected were specific. Then detection limits of the assay were tested. Lastly, the assay was applied to the detection of 11860 clinical samples to evaluate the specificity and sensitivity of the developed assay compared with the conventional PCR. Results The target genes were 100% specific as assessed on 102 bacterial strains since no cross-reactions were observed. The detection limits ranged from 88 CFU/mL (EHEC) to 880 CFU/mL (EPEC). Compared with the conventional PCR, the specificity and sensitivity of the multiplex rtPCR was 100% and over 99%, respectively. The coefficient of variation (CV) for each target gene ranged from 0.45% to 1.53%. 171 positive clinical samples were mostly identified as ETEC (n = 111, 64.9%) and EPEC (n = 38, 22.2%), which were the dominating pathotypes of DEC strains. Conclusion The developed multiplex rtPCR assay for the identification of DEC was high sensitive and specific and could be applied to the rapid identification of DEC in clinical and public health laboratories. PMID:25023669

Expansion by whole genome duplication and evolution of the sox gene family in teleost fish

PubMed Central

Naville, Magali; Volff, Jean-Nicolas

2017-01-01

It is now recognized that several rounds of whole genome duplication (WGD) have occurred during the evolution of vertebrates, but the link between WGDs and phenotypic diversification remains unsolved. We have investigated in this study the impact of the teleost-specific WGD on the evolution of the sox gene family in teleostean fishes. The sox gene family, which encodes for transcription factors, has essential role in morphology, physiology and behavior of vertebrates and teleosts, the current largest group of vertebrates. We have first redrawn the evolution of all sox genes identified in eleven teleost genomes using a comparative genomic approach including phylogenetic and synteny analyses. We noticed, compared to tetrapods, an important expansion of the sox family: 58% (11/19) of sox genes are duplicated in teleost genomes. Furthermore, all duplicated sox genes, except sox17 paralogs, are derived from the teleost-specific WGD. Then, focusing on five sox genes, analyzing the evolution of coding and non-coding sequences, as well as the expression patterns in fish embryos and adult tissues, we demonstrated that these paralogs followed lineage-specific evolutionary trajectories in teleost genomes. This work, based on whole genome data from multiple teleostean species, supports the contribution of WGDs to the expansion of gene families, as well as to the emergence of genomic differences between lineages that might promote genetic and phenotypic diversity in teleosts. PMID:28738066

The genome of Aiptasia, a sea anemone model for coral symbiosis

PubMed Central

Baumgarten, Sebastian; Simakov, Oleg; Esherick, Lisl Y.; Liew, Yi Jin; Lehnert, Erik M.; Michell, Craig T.; Li, Yong; Hambleton, Elizabeth A.; Guse, Annika; Oates, Matt E.; Gough, Julian; Weis, Virginia M.; Aranda, Manuel; Pringle, John R.; Voolstra, Christian R.

2015-01-01

The most diverse marine ecosystems, coral reefs, depend upon a functional symbiosis between a cnidarian animal host (the coral) and intracellular photosynthetic dinoflagellate algae. The molecular and cellular mechanisms underlying this endosymbiosis are not well understood, in part because of the difficulties of experimental work with corals. The small sea anemone Aiptasia provides a tractable laboratory model for investigating these mechanisms. Here we report on the assembly and analysis of the Aiptasia genome, which will provide a foundation for future studies and has revealed several features that may be key to understanding the evolution and function of the endosymbiosis. These features include genomic rearrangements and taxonomically restricted genes that may be functionally related to the symbiosis, aspects of host dependence on alga-derived nutrients, a novel and expanded cnidarian-specific family of putative pattern-recognition receptors that might be involved in the animal–algal interactions, and extensive lineage-specific horizontal gene transfer. Extensive integration of genes of prokaryotic origin, including genes for antimicrobial peptides, presumably reflects an intimate association of the animal–algal pair also with its prokaryotic microbiome. PMID:26324906

The Chromatin Remodeler BPTF Activates a Stemness Gene-Expression Program Essential for the Maintenance of Adult Hematopoietic Stem Cells.

PubMed

Xu, Bowen; Cai, Ling; Butler, Jason M; Chen, Dongliang; Lu, Xiongdong; Allison, David F; Lu, Rui; Rafii, Shahin; Parker, Joel S; Zheng, Deyou; Wang, Gang Greg

2018-03-13

Self-renewal and differentiation of adult stem cells are tightly regulated partly through configuration of chromatin structure by chromatin remodelers. Using knockout mice, we here demonstrate that bromodomain PHD finger transcription factor (BPTF), a component of the nucleosome remodeling factor (NURF) chromatin-remodeling complex, is essential for maintaining the population size of hematopoietic stem/progenitor cells (HSPCs), including long-term hematopoietic stem cells (HSCs). Bptf-deficient HSCs are defective in reconstituted hematopoiesis, and hematopoietic-specific knockout of Bptf caused profound defects including bone marrow failure and anemia. Genome-wide transcriptome profiling revealed that BPTF loss caused downregulation of HSC-specific gene-expression programs, which contain several master transcription factors (Meis1, Pbx1, Mn1, and Lmo2) required for HSC maintenance and self-renewal. Furthermore, we show that BPTF potentiates the chromatin accessibility of key HSC "stemness" genes. These results demonstrate an essential requirement of the chromatin remodeler BPTF and NURF for activation of "stemness" gene-expression programs and proper function of adult HSCs. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome.

PubMed

Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu

2006-01-01

Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker programs, for the highly efficient and specific screening of both guide and orphan snoRNA genes in mammalian genomes. By using these programs, we have systematically scanned four human-mammal whole-genome alignment (WGA) sequences and identified 54 novel candidates including 26 orphan candidates as well as 266 known snoRNA genes. Eighteen novel snoRNAs were further experimentally confirmed with four snoRNAs exhibiting a tissue-specific or restricted expression pattern. The results of this study provide the most comprehensive listing of two families of snoRNA genes in the human genome till date.

Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

PubMed

Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

2009-11-01

DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

GARNET--gene set analysis with exploration of annotation relations.

PubMed

Rho, Kyoohyoung; Kim, Bumjin; Jang, Youngjun; Lee, Sanghyun; Bae, Taejeong; Seo, Jihae; Seo, Chaehwa; Lee, Jihyun; Kang, Hyunjung; Yu, Ungsik; Kim, Sunghoon; Lee, Sanghyuk; Kim, Wan Kyu

2011-02-15

Gene set analysis is a powerful method of deducing biological meaning for an a priori defined set of genes. Numerous tools have been developed to test statistical enrichment or depletion in specific pathways or gene ontology (GO) terms. Major difficulties towards biological interpretation are integrating diverse types of annotation categories and exploring the relationships between annotation terms of similar information. GARNET (Gene Annotation Relationship NEtwork Tools) is an integrative platform for gene set analysis with many novel features. It includes tools for retrieval of genes from annotation database, statistical analysis & visualization of annotation relationships, and managing gene sets. In an effort to allow access to a full spectrum of amassed biological knowledge, we have integrated a variety of annotation data that include the GO, domain, disease, drug, chromosomal location, and custom-defined annotations. Diverse types of molecular networks (pathways, transcription and microRNA regulations, protein-protein interaction) are also included. The pair-wise relationship between annotation gene sets was calculated using kappa statistics. GARNET consists of three modules--gene set manager, gene set analysis and gene set retrieval, which are tightly integrated to provide virtually automatic analysis for gene sets. A dedicated viewer for annotation network has been developed to facilitate exploration of the related annotations. GARNET (gene annotation relationship network tools) is an integrative platform for diverse types of gene set analysis, where complex relationships among gene annotations can be easily explored with an intuitive network visualization tool (http://garnet.isysbio.org/ or http://ercsb.ewha.ac.kr/garnet/).

Identification and characterization of mouse otic sensory lineage genes

PubMed Central

Hartman, Byron H.; Durruthy-Durruthy, Robert; Laske, Roman D.; Losorelli, Steven; Heller, Stefan

2015-01-01

Vertebrate embryogenesis gives rise to all cell types of an organism through the development of many unique lineages derived from the three primordial germ layers. The otic sensory lineage arises from the otic vesicle, a structure formed through invagination of placodal non-neural ectoderm. This developmental lineage possesses unique differentiation potential, giving rise to otic sensory cell populations including hair cells, supporting cells, and ganglion neurons of the auditory and vestibular organs. Here we present a systematic approach to identify transcriptional features that distinguish the otic sensory lineage (from early otic progenitors to otic sensory populations) from other major lineages of vertebrate development. We used a microarray approach to analyze otic sensory lineage populations including microdissected otic vesicles (embryonic day 10.5) as well as isolated neonatal cochlear hair cells and supporting cells at postnatal day 3. Non-otic tissue samples including periotic tissues and whole embryos with otic regions removed were used as reference populations to evaluate otic specificity. Otic populations shared transcriptome-wide correlations in expression profiles that distinguish members of this lineage from non-otic populations. We further analyzed the microarray data using comparative and dimension reduction methods to identify individual genes that are specifically expressed in the otic sensory lineage. This analysis identified and ranked top otic sensory lineage-specific transcripts including Fbxo2, Col9a2, and Oc90, and additional novel otic lineage markers. To validate these results we performed expression analysis on select genes using immunohistochemistry and in situ hybridization. Fbxo2 showed the most striking pattern of specificity to the otic sensory lineage, including robust expression in the early otic vesicle and sustained expression in prosensory progenitors and auditory and vestibular hair cells and supporting cells. PMID:25852475

Genetic heterogeneity of the dnaK gene locus including transcription terminator region (TTR) in Campylobacter lari.

PubMed

Shitara, M; Tsuboi, Y; Sekizuka, T; Tazumi, A; Moorei, J E; Millar, B C; Taneike, I; Matsuda, M

2008-01-01

Nucleotide sequences of approximately 3.1 kbp consisting of the full-length open reading frame (ORF) for grpE, a non-coding (NC) region and a putative ORF for the full-length dnaK gene (1860 bp) were identified from a urease-positive thermophilic Campylobacter (UPTC) CF89-12 isolate. Then, following the construction of a new degenerate polymerase chain reaction (PCR) primer pair for amplification of the dnaK structural gene, including the transcription terminator region of C. lari isolates, the dnaK region was amplified successfully, TA-cloned and sequenced in nine C. lari isolates. The dnaK gene sequences commenced with an ATG and terminated with a TAA in all 10 isolates, including CF89-12. In addition, the putative ORFs for the dnaK gene locus from seven UPTC isolates consisted of 1860 bases, and the four urease-negative (UN) C. lari isolates included C. lari RM2100 reference strain 1866. Interestingly, different probable ribosome binding sites and hypothetically intrinsic p-independent terminator structures were identified between the seven UPTC and four UN C. lari isolates, respectively. Moreover, it is interesting to note that 20 out of a total of 28 polymorphic sites occurred among amino acid sequences of the dnaK ORF from 11 C. lari isolates, identified to be alternatively UPTC-specific or UN C. lari-specific. In the neighbour-joining tree based on the nucleotide sequence information of the dnaK gene, C. lari forms two major distinct clusters consisting of UPTC and UN C. lari isolates, respectively, with UN C. lari being more closely related to other thermophilic campylobacters than to UPTC.

Molecular decay of enamel matrix protein genes in turtles and other edentulous amniotes

PubMed Central

2013-01-01

Background Secondary edentulism (toothlessness) has evolved on multiple occasions in amniotes including several mammalian lineages (pangolins, anteaters, baleen whales), birds, and turtles. All edentulous amniote clades have evolved from ancestors with enamel-capped teeth. Previous studies have documented the molecular decay of tooth-specific genes in edentulous mammals, all of which lost their teeth in the Cenozoic, and birds, which lost their teeth in the Cretaceous. By contrast with mammals and birds, tooth loss in turtles occurred in the Jurassic (201.6-145.5 Ma), providing an extended time window for tooth gene degradation in this clade. The release of the painted turtle and Chinese softshell turtle genomes provides an opportunity to recover the decayed remains of tooth-specific genes in Testudines. Results We queried available genomes of Testudines (Chrysemys picta [painted turtle], Pelodiscus sinensis [Chinese softshell turtle]), Aves (Anas platyrhynchos [duck], Gallus gallus [chicken], Meleagris gallopavo [turkey], Melopsittacus undulatus [budgerigar], Taeniopygia guttata [zebra finch]), and enamelless mammals (Orycteropus afer [aardvark], Choloepus hoffmanni [Hoffmann’s two-toed sloth], Dasypus novemcinctus [nine-banded armadillo]) for remnants of three enamel matrix protein (EMP) genes with putative enamel-specific functions. Remnants of the AMBN and ENAM genes were recovered in Chrysemys and retain their original synteny. Remnants of AMEL were recovered in both testudines, although there are no shared frameshifts. We also show that there are inactivated copies of AMBN, AMEL and ENAM in representatives of divergent avian lineages including Galloanserae, Passeriformes, and Psittaciformes, and that there are shared frameshift mutations in all three genes that predate the basal split in Neognathae. Among enamelless mammals, all three EMP genes exhibit inactivating mutations in Orycteropus and Choloepus. Conclusions Our results highlight the power of combining fossil and genomic evidence to decipher macroevolutionary transitions and characterize the functional range of different loci involved in tooth development. The fossil record and phylogenetics combine to predict the occurrence of molecular fossils of tooth-specific genes in the genomes of edentulous amniotes, and in every case these molecular fossils have been discovered. The widespread occurrence of EMP pseudogenes in turtles, birds, and edentulous/enamelless mammals also provides compelling evidence that in amniotes, the only unique, non-redundant function of these genes is in enamel formation. PMID:23342979

Pharmacogenetics of cystic fibrosis treatment.

PubMed

Carter, Suzanne C; McKone, Edward F

2016-08-01

Cystic fibrosis (CF) is genetic autosomal recessive disease caused by reduced or absent function of CFTR protein. Treatments for patients with CF have primarily focused on the downstream end-organ consequences of defective CFTR. Since the discovery of the CFTR gene that causes CF in 1989 there have been tremendous advances in our understanding of the genetics and pathophysiology of CF. This has recently led to the development of new CFTR mutation-specific targeted therapies for select patients with CF. This review will discuss the characteristics of the CFTR gene, the CFTR mutations that cause CF and the new mutation specific pharmacological treatments including gene therapy that are contributing to the dawning of a new era in cystic fibrosis care.

Integrated multi-cohort transcriptional meta-analysis of neurodegenerative diseases.

PubMed

Li, Matthew D; Burns, Terry C; Morgan, Alexander A; Khatri, Purvesh

2014-09-04

Neurodegenerative diseases share common pathologic features including neuroinflammation, mitochondrial dysfunction and protein aggregation, suggesting common underlying mechanisms of neurodegeneration. We undertook a meta-analysis of public gene expression data for neurodegenerative diseases to identify a common transcriptional signature of neurodegeneration. Using 1,270 post-mortem central nervous system tissue samples from 13 patient cohorts covering four neurodegenerative diseases, we identified 243 differentially expressed genes, which were similarly dysregulated in 15 additional patient cohorts of 205 samples including seven neurodegenerative diseases. This gene signature correlated with histologic disease severity. Metallothioneins featured prominently among differentially expressed genes, and functional pathway analysis identified specific convergent themes of dysregulation. MetaCore network analyses revealed various novel candidate hub genes (e.g. STAU2). Genes associated with M1-polarized macrophages and reactive astrocytes were strongly enriched in the meta-analysis data. Evaluation of genes enriched in neurons revealed 70 down-regulated genes, over half not previously associated with neurodegeneration. Comparison with aging brain data (3 patient cohorts, 221 samples) revealed 53 of these to be unique to neurodegenerative disease, many of which are strong candidates to be important in neuropathogenesis (e.g. NDN, NAP1L2). ENCODE ChIP-seq analysis predicted common upstream transcriptional regulators not associated with normal aging (REST, RBBP5, SIN3A, SP2, YY1, ZNF143, IKZF1). Finally, we removed genes common to neurodegeneration from disease-specific gene signatures, revealing uniquely robust immune response and JAK-STAT signaling in amyotrophic lateral sclerosis. Our results implicate pervasive bioenergetic deficits, M1-type microglial activation and gliosis as unifying themes of neurodegeneration, and identify numerous novel genes associated with neurodegenerative processes.

Phenotypic and Molecular Antibiotic Resistance Determination of Airborne Coagulase Negative Staphylococcus spp. Strains from Healthcare Facilities in Southern Poland.

PubMed

Lenart-Boroń, Anna; Wolny-Koładka, Katarzyna; Stec, Joanna; Kasprowic, Andrzej

2016-10-01

This study assessed the antimicrobial resistance of airborne Staphylococcus spp. strains isolated from healthcare facilities in southern Poland. A total of 55 isolates, belonging to 10 coagulase-negative staphylococci (CoNS) species, isolated from 10 healthcare facilities (including hospitals and outpatient units) were included in the analysis. The most frequently identified species were Staphylococcus saprophyticus and Staphylococcus warneri, which belong to normal human skin flora, but can also be the cause of common and even severe nosocomial infections. Disk diffusion tests showed that the bacterial strains were most frequently resistant to erythromycin and tetracycline and only 18% of strains were susceptible to all tested antimicrobials. Polymerase chain reaction amplification of specific gene regions was used to determine the presence of the Macrolide-Lincosamide-Streptogramin resistance mechanisms in CoNS. The molecular analysis, conducted using specific primer pairs, identified the msrA1 gene, encoding active efflux pumps in bacterial cells, as the most frequent resistance gene. As many as seven antibiotic resistance genes were found in one isolate, whereas the most common number of resistance genes per isolate was five (n = 17). It may be concluded that drug resistance was widely spread among the tested strains, but the resulting antimicrobial resistance profile indicates that in the case of infection, the use of antibiotics from the basic antibiogram group will be effective in therapy. However, before administering treatment, determination of the specific antimicrobial resistance should be conducted, particularly in the case of hospitalized patients.

Parent of origin effects on age at colorectal cancer diagnosis.

PubMed

Lindor, Noralane M; Rabe, Kari G; Petersen, Gloria M; Chen, Helen; Bapat, Bharati; Hopper, John; Young, Joanne; Jenkins, Mark; Potter, John; Newcomb, Polly; Templeton, Allyson; Lemarchand, Loic; Grove, John; Burgio, Michael R; Haile, Robert; Green, Jane; Woods, Michael O; Seminara, Daniela; Limburg, Paul J; Thibodeau, Stephen N

2010-07-15

Genomic imprinting refers to a parent-of-origin specific effect on gene expression. At least 1% of genes in the human genome are modulated in this manner. We sought evidence for genomic imprinting in colorectal cancer by studying the ages at diagnosis in the offspring of 2,061 parent-child pairs in which both parent and child were affected by nonsyndromic colorectal cancer. Families were ascertained through the colon Cancer Family Registry [http://epi.grants.cancer.gov/CFR/] from both population-based and clinic-based sources. We found that the affected offspring of affected fathers were on average younger than offspring of affected mothers (55.8 vs. 53.7 years; p = 0.0003), but when divided into sons and daughters, this difference was driven entirely by younger age at diagnosis in daughters of affected fathers compared to sons (52.3 years vs. 55.1 years; p = 0.0004). A younger age at diagnosis in affected daughters of affected fathers was also observable in various subsets including families that met Amsterdam II Criteria, families that did not meet Amsterdam Criteria, and in families with documented normal DNA mismatch repair in tumors. Imprinting effects are not expected to be affected by the sex of the offspring. Possible explanations for these unexpected findings include: (i) an imprinted gene on the pseudoautosomal regions of the X chromosome; (ii) an imprinted autosomal gene that affects a sex-specific pathway; or (iii) an X-linked gene unmasked because of colonic tissue-specific preferential inactivation of the maternal X chromosome.

Stepwise Evolution of Coral Biomineralization Revealed with Genome-Wide Proteomics and Transcriptomics

PubMed Central

Sawada, Hitoshi; Satoh, Noriyuki

2016-01-01

Despite the importance of stony corals in many research fields related to global issues, such as marine ecology, climate change, paleoclimatogy, and metazoan evolution, very little is known about the evolutionary origin of coral skeleton formation. In order to investigate the evolution of coral biomineralization, we have identified skeletal organic matrix proteins (SOMPs) in the skeletal proteome of the scleractinian coral, Acropora digitifera, for which large genomic and transcriptomic datasets are available. Scrupulous gene annotation was conducted based on comparisons of functional domain structures among metazoans. We found that SOMPs include not only coral-specific proteins, but also protein families that are widely conserved among cnidarians and other metazoans. We also identified several conserved transmembrane proteins in the skeletal proteome. Gene expression analysis revealed that expression of these conserved genes continues throughout development. Therefore, these genes are involved not only skeleton formation, but also in basic cellular functions, such as cell-cell interaction and signaling. On the other hand, genes encoding coral-specific proteins, including extracellular matrix domain-containing proteins, galaxins, and acidic proteins, were prominently expressed in post-settlement stages, indicating their role in skeleton formation. Taken together, the process of coral skeleton formation is hypothesized as: 1) formation of initial extracellular matrix between epithelial cells and substrate, employing pre-existing transmembrane proteins; 2) additional extracellular matrix formation using novel proteins that have emerged by domain shuffling and rapid molecular evolution and; 3) calcification controlled by coral-specific SOMPs. PMID:27253604

Fusion genes in solid tumors: an emerging target for cancer diagnosis and treatment.

PubMed

Parker, Brittany C; Zhang, Wei

2013-11-01

Studies over the past decades have uncovered fusion genes, a class of oncogenes that provide immense diagnostic and therapeutic advantages because of their tumor-specific expression. Originally associated with hemotologic cancers, fusion genes have recently been discovered in a wide array of solid tumors, including sarcomas, carcinomas, and tumors of the central nervous system. Fusion genes are attractive as both therapeutic targets and diagnostic tools due to their inherent expression in tumor tissue alone. Therefore, the discovery and elucidation of fusion genes in various cancer types may provide more effective therapies in the future for cancer patients.

Gene analysis of PROP1 in dwarfism with combined pituitary hormone deficiency.

PubMed

Takamura, N; Fofanova, O V; Kinoshita, E; Yamashita, S

1999-06-01

The prophet of Pit-1 gene (PROP1), a novel pituitary-specific homeodomain factor, has been proved to be one of the causative genes for combined pituitary hormone deficiency (CPHD). Recently, PROP1 mutations have been identified in CPHD families, including our Russian cohort. The 2-bp deletion, 296delGA (A301G302del), is the most common mutational hot spot. Furthermore, in our cohort, PROP1 mutations are more common in comparison with human POU1F1 gene mutations. Here we review the gene analysis of PROP1 in patients with CPHD.

Transcriptome analysis of functional differentiation between haploid and diploid cells of Emiliania huxleyi, a globally significant photosynthetic calcifying cell.

PubMed

von Dassow, Peter; Ogata, Hiroyuki; Probert, Ian; Wincker, Patrick; Da Silva, Corinne; Audic, Stéphane; Claverie, Jean-Michel; de Vargas, Colomban

2009-01-01

Eukaryotes are classified as either haplontic, diplontic, or haplo-diplontic, depending on which ploidy levels undergo mitotic cell division in the life cycle. Emiliania huxleyi is one of the most abundant phytoplankton species in the ocean, playing an important role in global carbon fluxes, and represents haptophytes, an enigmatic group of unicellular organisms that diverged early in eukaryotic evolution. This species is haplo-diplontic. Little is known about the haploid cells, but they have been hypothesized to allow persistence of the species between the yearly blooms of diploid cells. We sequenced over 38,000 expressed sequence tags from haploid and diploid E. huxleyi normalized cDNA libraries to identify genes involved in important processes specific to each life phase (2N calcification or 1N motility), and to better understand the haploid phase of this prominent haplo-diplontic organism. The haploid and diploid transcriptomes showed a dramatic differentiation, with approximately 20% greater transcriptome richness in diploid cells than in haploid cells and only

Transcriptome analysis of functional differentiation between haploid and diploid cells of Emiliania huxleyi, a globally significant photosynthetic calcifying cell

PubMed Central

2009-01-01

Background Eukaryotes are classified as either haplontic, diplontic, or haplo-diplontic, depending on which ploidy levels undergo mitotic cell division in the life cycle. Emiliania huxleyi is one of the most abundant phytoplankton species in the ocean, playing an important role in global carbon fluxes, and represents haptophytes, an enigmatic group of unicellular organisms that diverged early in eukaryotic evolution. This species is haplo-diplontic. Little is known about the haploid cells, but they have been hypothesized to allow persistence of the species between the yearly blooms of diploid cells. We sequenced over 38,000 expressed sequence tags from haploid and diploid E. huxleyi normalized cDNA libraries to identify genes involved in important processes specific to each life phase (2N calcification or 1N motility), and to better understand the haploid phase of this prominent haplo-diplontic organism. Results The haploid and diploid transcriptomes showed a dramatic differentiation, with approximately 20% greater transcriptome richness in diploid cells than in haploid cells and only ≤ 50% of transcripts estimated to be common between the two phases. The major functional category of transcripts differentiating haploids included signal transduction and motility genes. Diploid-specific transcripts included Ca2+, H+, and HCO3- pumps. Potential factors differentiating the transcriptomes included haploid-specific Myb transcription factor homologs and an unusual diploid-specific histone H4 homolog. Conclusions This study permitted the identification of genes likely involved in diploid-specific biomineralization, haploid-specific motility, and transcriptional control. Greater transcriptome richness in diploid cells suggests they may be more versatile for exploiting a diversity of rich environments whereas haploid cells are intrinsically more streamlined. PMID:19832986

Cell- and Tissue-Specific Transcriptome Analyses of Medicago truncatula Root Nodules

PubMed Central

Limpens, Erik; Moling, Sjef; Hooiveld, Guido; Pereira, Patrícia A.; Bisseling, Ton; Becker, Jörg D.; Küster, Helge

2013-01-01

Legumes have the unique ability to host nitrogen-fixing Rhizobium bacteria as symbiosomes inside root nodule cells. To get insight into this key process, which forms the heart of the endosymbiosis, we isolated specific cells/tissues at different stages of symbiosome formation from nodules of the model legume Medicago truncatula using laser-capture microdissection. Next, we determined their associated expression profiles using Affymetrix Medicago GeneChips. Cells were collected from the nodule infection zone divided into a distal (where symbiosome formation and division occur) and proximal region (where symbiosomes are mainly differentiating), as well as infected cells from the fixation zone containing mature nitrogen fixing symbiosomes. As non-infected cells/tissue we included nodule meristem cells and uninfected cells from the fixation zone. Here, we present a comprehensive gene expression map of an indeterminate Medicago nodule and selected genes that show specific enriched expression in the different cells or tissues. Validation of the obtained expression profiles, by comparison to published gene expression profiles and experimental verification, indicates that the data can be used as digital “in situ”. This digital “in situ” offers a genome-wide insight into genes specifically associated with subsequent stages of symbiosome and nodule cell development, and can serve to guide future functional studies. PMID:23734198

Hormone-dependent control of developmental timing through regulation of chromatin accessibility

PubMed Central

Uyehara, Christopher M.; Nystrom, Spencer L.; Niederhuber, Matthew J.; Leatham-Jensen, Mary; Ma, Yiqin; Buttitta, Laura A.

2017-01-01

Specification of tissue identity during development requires precise coordination of gene expression in both space and time. Spatially, master regulatory transcription factors are required to control tissue-specific gene expression programs. However, the mechanisms controlling how tissue-specific gene expression changes over time are less well understood. Here, we show that hormone-induced transcription factors control temporal gene expression by regulating the accessibility of DNA regulatory elements. Using the Drosophila wing, we demonstrate that temporal changes in gene expression are accompanied by genome-wide changes in chromatin accessibility at temporal-specific enhancers. We also uncover a temporal cascade of transcription factors following a pulse of the steroid hormone ecdysone such that different times in wing development can be defined by distinct combinations of hormone-induced transcription factors. Finally, we show that the ecdysone-induced transcription factor E93 controls temporal identity by directly regulating chromatin accessibility across the genome. Notably, we found that E93 controls enhancer activity through three different modalities, including promoting accessibility of late-acting enhancers and decreasing accessibility of early-acting enhancers. Together, this work supports a model in which an extrinsic signal triggers an intrinsic transcription factor cascade that drives development forward in time through regulation of chromatin accessibility. PMID:28536147

A Large-Scale Genetic Screen in Arabidopsis to Identify Genes Involved in Pollen Exine Production1[C][W][OA

PubMed Central

Dobritsa, Anna A.; Geanconteri, Aliza; Shrestha, Jay; Carlson, Ann; Kooyers, Nicholas; Coerper, Daniel; Urbanczyk-Wochniak, Ewa; Bench, Bennie J.; Sumner, Lloyd W.; Swanson, Robert; Preuss, Daphne

2011-01-01

Exine, the outer plant pollen wall, has elaborate species-specific patterns, provides a protective barrier for male gametophytes, and serves as a mediator of strong and species-specific pollen-stigma adhesion. Exine is made of sporopollenin, a material remarkable for its strength, elasticity, and chemical durability. The chemical nature of sporopollenin, as well as the developmental mechanisms that govern its assembly into diverse patterns in different species, are poorly understood. Here, we describe a simple yet effective genetic screen in Arabidopsis (Arabidopsis thaliana) that was undertaken to advance our understanding of sporopollenin synthesis and exine assembly. This screen led to the recovery of mutants with a variety of defects in exine structure, including multiple mutants with novel phenotypes. Fifty-six mutants were selected for further characterization and are reported here. In 14 cases, we have mapped defects to specific genes, including four with previously demonstrated or suggested roles in exine development (MALE STERILITY2, CYP703A2, ANTHER-SPECIFIC PROTEIN6, TETRAKETIDE α-PYRONE REDUCTASE/DIHYDROFLAVONOL-4-REDUCTASE-LIKE1), and a number of genes that have not been implicated in exine production prior to this screen (among them, fatty acid ω-hydroxylase CYP704B1, putative glycosyl transferases At1g27600 and At1g33430, 4-coumarate-coenzyme A ligase 4CL3, polygalacturonase QUARTET3, novel gene At5g58100, and nucleotide-sugar transporter At5g65000). Our study illustrates that morphological screens of pollen can be extremely fruitful in identifying previously unknown exine genes and lays the foundation for biochemical, developmental, and evolutionary studies of exine production. PMID:21849515

Germline variants in the CYP19A1 gene are related to specific adverse events in aromatase inhibitor users: a substudy of Dutch patients in the TEAM trial.

PubMed

Fontein, Duveken B Y; Houtsma, Daniel; Nortier, Johan W R; Baak-Pablo, Renee F; Kranenbarg, Elma Meershoek-Klein; van der Straaten, Tahar R J H M; Putter, Hein; Seynaeve, Caroline; Gelderblom, Hans; van de Velde, Cornelis J H; Guchelaar, Henk-Jan

2014-04-01

Musculoskeletal adverse events (MSAEs) and vasomotor symptoms (VMSs) are known side-effects of aromatase inhibitors, and may be related to genetic variations of the aromatase gene (CYP19A1). We investigated the relationship between these specific AEs and single nucleotide polymorphisms (SNPs) in the CYP19A1 gene in postmenopausal, hormone receptor-positive early breast cancer (BC) patients treated with adjuvant exemestane for 5 years. Dutch patients who were randomized to receive 5 years of exemestane in the Tamoxifen Exemestane Adjuvant Multinational (TEAM) trial were included. A tagging-SNP approach was performed, covering 80 % of variations of the CYP19A1 gene with 30 SNPs. Logistic regression analyses were used to assess the risk of reporting VMSs or MSAEs in relation to genotypes within selected SNPs. Of 737 included patients, 281 patients reported at least one MSAE (n = 210) or VMS (n = 163). Homozygous AA genotype of rs934635 was associated with a significantly higher odds of MSAEs (multivariate odds ratio (OR) 4.66, p = 0.008) and VMSs (multivariate OR 2.78, p = 0.044). Regarding both rs1694189 and rs7176005, the homozygous variant genotypes (TT) were associated with a higher odds of VMSs, but not MSAEs (OR 1.758, p = 0.025 and OR 6.361, p = 0.021, respectively). Our exploratory analysis demonstrated that some CYP19A1 gene variations may be associated with MSAEs and/or VMSs. Specifically, patients with the homozygous variant rs934635 genotype reported more MSAEs and VMSs. Although further confirmatory studies are warranted, genomic profiling can help identify patients at an increased risk of reporting these specific AEs, potentiating further personalized BC treatment.

Gene Delivery in Neuro-Oncology.

PubMed

Dixit, Karan; Kumthekar, Priya

2017-09-02

Glioblastoma multiforme (GBM) is the most common primary malignant brain tumor in adults with a dismal prognosis despite aggressive multimodal management thus novel treatments are urgently needed. Gene therapy is a versatile treatment strategy being investigated in multiple cancers including GBM. In gene therapy, a variety of vectors or "carriers" are used to deliver genes designed for different anti-tumoral effects. Gene delivery vehicles and approaches to treatment will be addressed in this review. The most commonly studied vectors are viral based, however, driven by advances in biomedical engineering, mesenchymal and neural stem cells, as well as multiple different types of nanoparticles have been developed to improve tumor tropism and also increase gene transfer into tumor cells. Different genes have been studied including suicide genes, which convert non-toxic prodrug into cytotoxic drug; immunomodulatory genes, which stimulate the immune system; and tumor suppressor genes which repair the defect that allow cells to divide unchecked. Gene therapy may be a promising treatment strategy in neuro-oncology as it is versatile and flexible due to the ability to tailor vectors and genes for specific therapeutic activity. Pre-clinical studies and clinical trials have demonstrated feasibility and safety of gene therapy; however, further studies are required to determine efficacy.

Hypervariable and highly divergent intron-exon organizations in the chordate Oikopleura dioica.

PubMed

Edvardsen, Rolf B; Lerat, Emmanuelle; Maeland, Anne Dorthea; Flåt, Mette; Tewari, Rita; Jensen, Marit F; Lehrach, Hans; Reinhardt, Richard; Seo, Hee-Chan; Chourrout, Daniel

2004-10-01

Oikopleura dioica is a pelagic tunicate with a very small genome and a very short life cycle. In order to investigate the intron-exon organizations in Oikopleura, we have isolated and characterized ribosomal protein EF-1alpha, Hox, and alpha-tubulin genes. Their intron positions have been compared with those of the same genes from various invertebrates and vertebrates, including four species with entirely sequenced genomes. Oikopleura genes, like Caenorhabditis genes, have introns at a large number of nonconserved positions, which must originate from late insertions or intron sliding of ancient insertions. Both species exhibit hypervariable intron-exon organization within their alpha-tubulin gene family. This is due to localization of most nonconserved intron positions in single members of this gene family. The hypervariability and divergence of intron positions in Oikopleura and Caenorhabditis may be related to the predominance of short introns, the processing of which is not very dependent upon the exonic environment compared to large introns. Also, both species have an undermethylated genome, and the control of methylation-induced point mutations imposes a control on exon size, at least in vertebrate genes. That introns placed at such variable positions in Oikopleura or C. elegans may serve a specific purpose is not easy to infer from our current knowledge and hypotheses on intron functions. We propose that new introns are retained in species with very short life cycles, because illegitimate exchanges including gene conversion are repressed. We also speculate that introns placed at gene-specific positions may contribute to suppressing these exchanges and thereby favor their own persistence.

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

PubMed

David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

2017-01-04

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genome-Wide Identification and Transcriptome-Based Expression Profiling of the Sox Gene Family in the Nile Tilapia (Oreochromis niloticus)

PubMed Central

Wei, Ling; Yang, Chao; Tao, Wenjing; Wang, Deshou

2016-01-01

The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG) box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus), and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts. PMID:26907269

Genome-Wide Identification and Transcriptome-Based Expression Profiling of the Sox Gene Family in the Nile Tilapia (Oreochromis niloticus).

PubMed

Wei, Ling; Yang, Chao; Tao, Wenjing; Wang, Deshou

2016-02-23

The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG) box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus), and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.

Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

PubMed Central

Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

2018-01-01

Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

A high parasite density environment induces transcriptional changes and cell death in Plasmodium falciparum blood stages.

PubMed

Chou, Evelyn S; Abidi, Sabia Z; Teye, Marian; Leliwa-Sytek, Aleksandra; Rask, Thomas S; Cobbold, Simon A; Tonkin-Hill, Gerry Q; Subramaniam, Krishanthi S; Sexton, Anna E; Creek, Darren J; Daily, Johanna P; Duffy, Michael F; Day, Karen P

2018-03-01

Transient regulation of Plasmodium numbers below the density that induces fever has been observed in chronic malaria infections in humans. This species transcending control cannot be explained by immunity alone. Using an in vitro system we have observed density dependent regulation of malaria population size as a mechanism to possibly explain these in vivo observations. Specifically, Plasmodium falciparum blood stages from a high but not low-density environment exhibited unique phenotypic changes during the late trophozoite (LT) and schizont stages of the intraerythrocytic cycle. These included in order of appearance: failure of schizonts to mature and merozoites to replicate, apoptotic-like morphological changes including shrinking, loss of mitochondrial membrane potential, and blebbing with eventual release of aberrant parasites from infected erythrocytes. This unique death phenotype was triggered in a stage-specific manner by sensing of a high-density culture environment. Conditions of glucose starvation, nutrient depletion, and high lactate could not induce the phenotype. A high-density culture environment induced rapid global changes in the parasite transcriptome including differential expression of genes involved in cell remodeling, clonal antigenic variation, metabolism, and cell death pathways including an apoptosis-associated metacaspase gene. This transcriptional profile was also characterized by concomitant expression of asexual and sexual stage-specific genes. The data show strong evidence to support our hypothesis that density sensing exists in P. falciparum. They indicate that an apoptotic-like mechanism may play a role in P. falciparum density regulation, which, as in yeast, has features quite distinguishable from mammalian apoptosis. Gene expression data are available in the GEO databases under the accession number GSE91188. © 2017 Federation of European Biochemical Societies.

The aquaglyceroporin AQP9 contributes to the sex-specific effects of in utero arsenic exposure on placental gene expression.

PubMed

Winterbottom, Emily F; Koestler, Devin C; Fei, Dennis Liang; Wika, Eric; Capobianco, Anthony J; Marsit, Carmen J; Karagas, Margaret R; Robbins, David J

2017-06-14

Sex-specific factors play a major role in human health and disease, including responses to environmental stresses such as toxicant exposure. Increasing evidence suggests that such sex differences also exist during fetal development. In a previous report using the resources of the New Hampshire Birth Cohort Study (NHBCS), we found that low-to-moderate in utero exposure to arsenic, a highly toxic and widespread pollutant, was associated with altered expression of several key developmental genes in the fetal portion of the placenta. These associations were sex-dependent, suggesting that in utero arsenic exposure differentially impacts male and female fetuses. In the present study, we investigated the molecular basis for these sex-specific responses to arsenic. Using NanoString technology, we further analyzed the fetal placenta samples from the NHBCS for the expression of genes encoding arsenic transporters and metabolic enzymes. Multivariable linear regression analysis was used to examine their relationship with arsenic exposure and with key developmental genes, after stratification by fetal sex. We found that maternal arsenic exposure was strongly associated with expression of the AQP9 gene, encoding an aquaglyceroporin transporter, in female but not male fetal placenta. Moreover, AQP9 expression associated with that of a subset of female-specific arsenic-responsive genes. Our results suggest that AQP9 is upregulated in response to arsenic exposure in female, but not male, fetal placenta. Based on these results and prior studies, increased AQP9 expression may lead to increased arsenic transport in the female fetal placenta, which in turn may alter the expression patterns of key developmental genes that we have previously shown to be associated with arsenic exposure. Thus, this study suggests that AQP9 may play a role in the sex-specific effects of in utero arsenic exposure.

The ubiquilin gene family: evolutionary patterns and functional insights

PubMed Central

2014-01-01

Background Ubiquilins are proteins that function as ubiquitin receptors in eukaryotes. Mutations in two ubiquilin-encoding genes have been linked to the genesis of neurodegenerative diseases. However, ubiquilin functions are still poorly understood. Results In this study, evolutionary and functional data are combined to determine the origin and diversification of the ubiquilin gene family and to characterize novel potential roles of ubiquilins in mammalian species, including humans. The analysis of more than six hundred sequences allowed characterizing ubiquilin diversity in all the main eukaryotic groups. Many organisms (e. g. fungi, many animals) have single ubiquilin genes, but duplications in animal, plant, alveolate and excavate species are described. Seven different ubiquilins have been detected in vertebrates. Two of them, here called UBQLN5 and UBQLN6, had not been hitherto described. Significantly, marsupial and eutherian mammals have the most complex ubiquilin gene families, composed of up to 6 genes. This exceptional mammalian-specific expansion is the result of the recent emergence of four new genes, three of them (UBQLN3, UBQLN5 and UBQLNL) with precise testis-specific expression patterns that indicate roles in the postmeiotic stages of spermatogenesis. A gene with related features has independently arisen in species of the Drosophila genus. Positive selection acting on some mammalian ubiquilins has been detected. Conclusions The ubiquilin gene family is highly conserved in eukaryotes. The infrequent lineage-specific amplifications observed may be linked to the emergence of novel functions in particular tissues. PMID:24674348

Adrenal-kidney-gonad complex measurements may not predict gonad-specific changes in gene expression patterns during temperature-dependent sex determination in the red-eared slider turtle (Trachemys scripta elegans).

PubMed

Ramsey, Mary; Crews, David

2007-08-01

Many turtles, including the red-eared slider turtle (Trachemys scripta elegans) have temperature-dependent sex determination in which gonadal sex is determined by temperature during the middle third of incubation. The gonad develops as part of a heterogenous tissue complex that comprises the developing adrenal, kidney, and gonad (AKG complex). Owing to the difficulty in excising the gonad from the adjacent tissues, the AKG complex is often used as tissue source in assays examining gene expression in the developing gonad. However, the gonad is a relatively small component of the AKG, and gene expression in the adrenal-kidney (AK) compartment may interfere with the detection of gonad-specific changes in gene expression, particularly during early key phases of gonadal development and sex determination. In this study, we examine transcript levels as measured by quantitative real-time polymerase chain reaction for five genes important in slider turtle sex determination and differentiation (AR, ERalpha, ERbeta, aromatase, and Sf1) in AKG, AK, and isolated gonad tissues. In all cases, gonad-specific gene expression patterns were attenuated in AKG versus gonad tissue. All five genes were expressed in the AK in addition to the gonad at all stages/temperatures. Inclusion of the AK compartment masked important changes in gonadal gene expression. In addition, AK and gonad expression patterns are not additive, and gonadal gene expression cannot be predicted from intact AKG measurements. (c) 2007 Wiley-Liss, Inc.

Themes and Variations: Regulation of RpoN-Dependent Flagellar Genes across Diverse Bacterial Species

PubMed Central

Tsang, Jennifer; Hoover, Timothy R.

2014-01-01

Flagellar biogenesis in bacteria is a complex process in which the transcription of dozens of structural and regulatory genes is coordinated with the assembly of the flagellum. Although the overall process of flagellar biogenesis is conserved among bacteria, the mechanisms used to regulate flagellar gene expression vary greatly among different bacterial species. Many bacteria use the alternative sigma factor σ 54 (also known as RpoN) to transcribe specific sets of flagellar genes. These bacteria include members of the Epsilonproteobacteria (e.g., Helicobacter pylori and Campylobacter jejuni), Gammaproteobacteria (e.g., Vibrio and Pseudomonas species), and Alphaproteobacteria (e.g., Caulobacter crescentus). This review characterizes the flagellar transcriptional hierarchies in these bacteria and examines what is known about how flagellar gene regulation is linked with other processes including growth phase, quorum sensing, and host colonization. PMID:24672734

Quantitative Dynamics of Chromatin Remodeling during Germ Cell Specification from Mouse Embryonic Stem Cells.

PubMed

Kurimoto, Kazuki; Yabuta, Yukihiro; Hayashi, Katsuhiko; Ohta, Hiroshi; Kiyonari, Hiroshi; Mitani, Tadahiro; Moritoki, Yoshinobu; Kohri, Kenjiro; Kimura, Hiroshi; Yamamoto, Takuya; Katou, Yuki; Shirahige, Katsuhiko; Saitou, Mitinori

2015-05-07

Germ cell specification is accompanied by epigenetic remodeling, the scale and specificity of which are unclear. Here, we quantitatively delineate chromatin dynamics during induction of mouse embryonic stem cells (ESCs) to epiblast-like cells (EpiLCs) and from there into primordial germ cell-like cells (PGCLCs), revealing large-scale reorganization of chromatin signatures including H3K27me3 and H3K9me2 patterns. EpiLCs contain abundant bivalent gene promoters characterized by low H3K27me3, indicating a state primed for differentiation. PGCLCs initially lose H3K4me3 from many bivalent genes but subsequently regain this mark with concomitant upregulation of H3K27me3, particularly at developmental regulatory genes. PGCLCs progressively lose H3K9me2, including at lamina-associated perinuclear heterochromatin, resulting in changes in nuclear architecture. T recruits H3K27ac to activate BLIMP1 and early mesodermal programs during PGCLC specification, which is followed by BLIMP1-mediated repression of a broad range of targets, possibly through recruitment and spreading of H3K27me3. These findings provide a foundation for reconstructing regulatory networks of the germline epigenome. Copyright © 2015 Elsevier Inc. All rights reserved.

The Complete Mitochondrial Genome of the Land Snail Cornu aspersum (Helicidae: Mollusca): Intra-Specific Divergence of Protein-Coding Genes and Phylogenetic Considerations within Euthyneura

PubMed Central

Gaitán-Espitia, Juan Diego; Nespolo, Roberto F.; Opazo, Juan C.

2013-01-01

The complete sequences of three mitochondrial genomes from the land snail Cornu aspersum were determined. The mitogenome has a length of 14050 bp, and it encodes 13 protein-coding genes, 22 transfer RNA genes and two ribosomal RNA genes. It also includes nine small intergene spacers, and a large AT-rich intergenic spacer. The intra-specific divergence analysis revealed that COX1 has the lower genetic differentiation, while the most divergent genes were NADH1, NADH3 and NADH4. With the exception of Euhadra herklotsi, the structural comparisons showed the same gene order within the family Helicidae, and nearly identical gene organization to that found in order Pulmonata. Phylogenetic reconstruction recovered Basommatophora as polyphyletic group, whereas Eupulmonata and Pulmonata as paraphyletic groups. Bayesian and Maximum Likelihood analyses showed that C. aspersum is a close relative of Cepaea nemoralis, and with the other Helicidae species form a sister group of Albinaria caerulea, supporting the monophyly of the Stylommatophora clade. PMID:23826260

Statistical algorithms improve accuracy of gene fusion detection

PubMed Central

Hsieh, Gillian; Bierman, Rob; Szabo, Linda; Lee, Alex Gia; Freeman, Donald E.; Watson, Nathaniel; Sweet-Cordero, E. Alejandro

2017-01-01

Abstract Gene fusions are known to play critical roles in tumor pathogenesis. Yet, sensitive and specific algorithms to detect gene fusions in cancer do not currently exist. In this paper, we present a new statistical algorithm, MACHETE (Mismatched Alignment CHimEra Tracking Engine), which achieves highly sensitive and specific detection of gene fusions from RNA-Seq data, including the highest Positive Predictive Value (PPV) compared to the current state-of-the-art, as assessed in simulated data. We show that the best performing published algorithms either find large numbers of fusions in negative control data or suffer from low sensitivity detecting known driving fusions in gold standard settings, such as EWSR1-FLI1. As proof of principle that MACHETE discovers novel gene fusions with high accuracy in vivo, we mined public data to discover and subsequently PCR validate novel gene fusions missed by other algorithms in the ovarian cancer cell line OVCAR3. These results highlight the gains in accuracy achieved by introducing statistical models into fusion detection, and pave the way for unbiased discovery of potentially driving and druggable gene fusions in primary tumors. PMID:28541529

Gene Drive for Mosquito Control: Where Did It Come from and Where Are We Headed?

PubMed Central

Macias, Vanessa M.; Ohm, Johanna R.; Rasgon, Jason L.

2017-01-01

Mosquito-borne pathogens place an enormous burden on human health. The existing toolkit is insufficient to support ongoing vector-control efforts towards meeting disease elimination and eradication goals. The perspective that genetic approaches can potentially add a significant set of tools toward mosquito control is not new, but the recent improvements in site-specific gene editing with CRISPR/Cas9 systems have enhanced our ability to both study mosquito biology using reverse genetics and produce genetics-based tools. Cas9-mediated gene-editing is an efficient and adaptable platform for gene drive strategies, which have advantages over innundative release strategies for introgressing desirable suppression and pathogen-blocking genotypes into wild mosquito populations; until recently, an effective gene drive has been largely out of reach. Many considerations will inform the effective use of new genetic tools, including gene drives. Here we review the lengthy history of genetic advances in mosquito biology and discuss both the impact of efficient site-specific gene editing on vector biology and the resulting potential to deploy new genetic tools for the abatement of mosquito-borne disease. PMID:28869513

New Genes and Functional Innovation in Mammals

PubMed Central

Luis Villanueva-Cañas, José; Ruiz-Orera, Jorge; Agea, M. Isabel; Gallo, Maria; Andreu, David

2017-01-01

Abstract The birth of genes that encode new protein sequences is a major source of evolutionary innovation. However, we still understand relatively little about how these genes come into being and which functions they are selected for. To address these questions, we have obtained a large collection of mammalian-specific gene families that lack homologues in other eukaryotic groups. We have combined gene annotations and de novo transcript assemblies from 30 different mammalian species, obtaining ∼6,000 gene families. In general, the proteins in mammalian-specific gene families tend to be short and depleted in aromatic and negatively charged residues. Proteins which arose early in mammalian evolution include milk and skin polypeptides, immune response components, and proteins involved in reproduction. In contrast, the functions of proteins which have a more recent origin remain largely unknown, despite the fact that these proteins also have extensive proteomics support. We identify several previously described cases of genes originated de novo from noncoding genomic regions, supporting the idea that this mechanism frequently underlies the evolution of new protein-coding genes in mammals. Finally, we show that most young mammalian genes are preferentially expressed in testis, suggesting that sexual selection plays an important role in the emergence of new functional genes. PMID:28854603

The Arabidopsis mediator complex subunits MED16, MED14, and MED2 regulate mediator and RNA polymerase II recruitment to CBF-responsive cold-regulated genes.

PubMed

Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather

2014-01-01

The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.

Solid Lipid Nanoparticles as Efficient Drug and Gene Delivery Systems: Recent Breakthroughs

PubMed Central

Ezzati Nazhad Dolatabadi, Jafar; Valizadeh, Hadi; Hamishehkar, Hamed

2015-01-01

In recent years, nanomaterials have been widely applied as advanced drug and gene delivery nanosystems. Among them, solid lipid nanoparticles (SLNs) have attracted great attention as colloidal drug delivery systems for incorporating hydrophilic or lipophilic drugs and various macromolecules as well as proteins and nucleic acids. Therefore, SLNs offer great promise for controlled and site specific drug and gene delivery. This article includes general information about SLN structures and properties, production procedures, characterization. In addition, recent progress on development of drug and gene delivery systems using SLNs was reviewed. PMID:26236652

CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.

PubMed

Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun

2014-09-05

Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.

Identifying Novel Helix–Loop–Helix Genes in Caenorhabditis elegans through a Classroom Demonstration of Functional Genomics

PubMed Central

Griffin, Vernetta; McMiller, Tracee; Jones, Erika; Johnson, Casonya M.

2003-01-01

A 14-week, undergraduate-level Genetics and Population Biology course at Morgan State University was modified to include a demonstration of functional genomics in the research laboratory. Students performed a rudimentary sequence analysis of the Caenorhabditis elegans genome and further characterized three sequences that were predicted to encode helix–loop–helix proteins. Students then used reverse transcription–polymerase chain reaction to determine which of the three genes is normally expressed in C. elegans. At the end of this laboratory activity, students were 1) to demonstrate a rudimentary knowledge of bioinformatics, including the ability to differentiate between “having” a gene and “expressing” a gene, and 2) to understand basic approaches to functional genomics, including one specific technique for assaying for gene expression. It was also anticipated that students would increase their skills at effectively communicating their research activities through written and/or oral presentation. This article describes the laboratory activity and the assessment of the effectiveness of the activity. PMID:12822036

Biological Gene Delivery Vehicles: Beyond Viral Vectors

PubMed Central

Seow, Yiqi; Wood, Matthew J

2009-01-01

Gene therapy covers a broad spectrum of applications, from gene replacement and knockdown for genetic or acquired diseases such as cancer, to vaccination, each with different requirements for gene delivery. Viral vectors and synthetic liposomes have emerged as the vehicles of choice for many applications today, but both have limitations and risks, including complexity of production, limited packaging capacity, and unfavorable immunological features, which restrict gene therapy applications and hold back the potential for preventive gene therapy. While continuing to improve these vectors, it is important to investigate other options, particularly nonviral biological agents which include bacteria, bacteriophage, virus-like particles (VLPs), erythrocyte ghosts, and exosomes. Exploiting the natural properties of these biological entities for specific gene delivery applications will expand the repertoire of gene therapy vectors available for clinical use. Here, we review the prospects for nonviral biological delivery vehicles as gene therapy agents with focus on their unique evolved biological properties and respective limitations and potential applications. The potential of these nonviral biological entities to act as clinical gene therapy delivery vehicles has already been shown in clinical trials using bacteria-mediated gene transfer and with sufficient development, these entities will complement the established delivery techniques for gene therapy applications. PMID:19277019

Biological gene delivery vehicles: beyond viral vectors.

PubMed

Seow, Yiqi; Wood, Matthew J

2009-05-01

Gene therapy covers a broad spectrum of applications, from gene replacement and knockdown for genetic or acquired diseases such as cancer, to vaccination, each with different requirements for gene delivery. Viral vectors and synthetic liposomes have emerged as the vehicles of choice for many applications today, but both have limitations and risks, including complexity of production, limited packaging capacity, and unfavorable immunological features, which restrict gene therapy applications and hold back the potential for preventive gene therapy. While continuing to improve these vectors, it is important to investigate other options, particularly nonviral biological agents which include bacteria, bacteriophage, virus-like particles (VLPs), erythrocyte ghosts, and exosomes. Exploiting the natural properties of these biological entities for specific gene delivery applications will expand the repertoire of gene therapy vectors available for clinical use. Here, we review the prospects for nonviral biological delivery vehicles as gene therapy agents with focus on their unique evolved biological properties and respective limitations and potential applications. The potential of these nonviral biological entities to act as clinical gene therapy delivery vehicles has already been shown in clinical trials using bacteria-mediated gene transfer and with sufficient development, these entities will complement the established delivery techniques for gene therapy applications.

Genome-wide identification, characterization and classification of ionotropic glutamate receptor genes (iGluRs) in the malaria vector Anopheles sinensis (Diptera: Culicidae).

PubMed

Wang, Ting-Ting; Si, Feng-Ling; He, Zheng-Bo; Chen, Bin

2018-01-15

Ionotropic glutamate receptors (iGluRs) are conserved ligand-gated ion channel receptors, and ionotropic receptors (IRs) were revealed as a new family of iGluRs. Their subdivision was unsettled, and their characteristics are little known. Anopheles sinensis is a major malaria vector in eastern Asia, and its genome was recently well sequenced and annotated. We identified iGluR genes in the An. sinensis genome, analyzed their characteristics including gene structure, genome distribution, domains and specific sites by bioinformatic methods, and deduced phylogenetic relationships of all iGluRs in An. sinensis, Anopheles gambiae and Drosophila melanogaster. Based on the characteristics and phylogenetics, we generated the classification of iGluRs, and comparatively analyzed the intron number and selective pressure of three iGluRs subdivisions, iGluR group, Antenna IR and Divergent IR subfamily. A total of 56 iGluR genes were identified and named in the whole-genome of An. sinensis. These genes were located on 18 scaffolds, and 31 of them (29 being IRs) are distributed into 10 clusters that are suggested to form mainly from recent gene duplication. These iGluRs can be divided into four groups: NMDA, non-NMDA, Antenna IR and Divergent IR based on feature comparison and phylogenetic analysis. IR8a and IR25a were suggested to be monophyletic, named as Putative in the study, and moved from the Antenna subfamily in the IR family to the non-NMDA group as a sister of traditional non-NMDA. The generated iGluRs of genes (including NMDA and regenerated non-NMDA) are relatively conserved, and have a more complicated gene structure, smaller ω values and some specific functional sites. The iGluR genes in An. sinensis, An. gambiae and D. melanogaster have amino-terminal domain (ATD), ligand binding domain (LBD) and Lig_Chan domains, except for IR8a that only has the LBD and Lig_Chan domains. However, the new concept IR family of genes (including regenerated Antenna IR, and Divergent IR), especially for Divergent IR are more variable, have a simpler gene structure (intron loss phenomenon) and larger ω values, and lack specific functional sites. These IR genes have no other domains except for Antenna IRs that only have the Lig_Chan domain. This study provides a comprehensive information framework for iGluR genes in An. sinensis, and generated the classification of iGluRs by feature and bioinformatics analyses. The work lays the foundation for further functional study of these genes.

DNA hypermethylation profiles in squamous cell carcinoma of the vulva.

PubMed

Stephen, Josena K; Chen, Kang Mei; Raitanen, Misa; Grénman, Seija; Worsham, Maria J

2009-01-01

Gene silencing through promoter hypermethylation is a growing concept in the development of human cancers. In this study, we examined the contribution of aberrant methylation of promoter regions in methylation-prone tumor suppressors to the pathogenesis of vulvar cancer. Thirteen cell lines from 12 patients with squamous cell carcinoma of the vulva were evaluated for aberrant methylation status and gene copy number alterations, concomitantly, using the methylation-specific multiplex ligation-dependent probe amplification assay. Of the 22 tumor suppressor genes examined, aberrant methylation was observed for 9 genes: tumor protein p73 (TP73), fragile histidine triad (FHIT), von Hippel-Lindau (VHL), adenomatosis polyposis coli (APC), estrogen receptor 1 (ESR1), cyclin-dependent kinase inhibitor 2B (CDKN2B), death-associated protein kinase 1 (DAPK1), glutathione S-transferase pi (GSTP1), and immunoglobin superfamily, member 4 (IGSF4). The most frequently methylated genes included TP73 in 9 of 13 cell lines, and IGSF4, DAPK1, and FHIT in 3 of 13 cell lines. Methylation-specific polymerase chain reaction was performed for TP73 and FHIT to confirm aberrant methylation by methylation-specific multiplex ligation-dependent probe amplification. In the context of gene copy number and methylation status, both copies of the TP73 gene were hypermethylated. Loss or decreased mRNA expression of TP73 and IGSF4 by reverse transcription polymerase chain reaction confirmed aberrant methylation. Frequent genetic alterations of loss and gain of gene copy number included gain of GSTP1 and multiple endocrine neoplasia type 1 (MEN1), and loss of malignant fibrous histiocytoma amplified sequence 1 (MFHAS1) and IGSF4 in over 50% of the squamous cell carcinoma of the vulva cell lines. These findings underscore the contribution of both genetic and epigenetic events to the underlying pathogenesis of squamous cell carcinoma of the vulva.

Integrated transcriptome catalogue and organ-specific profiling of gene expression in fertile garlic (Allium sativum L.).

PubMed

Kamenetsky, Rina; Faigenboim, Adi; Shemesh Mayer, Einat; Ben Michael, Tomer; Gershberg, Chen; Kimhi, Sagie; Esquira, Itzhak; Rohkin Shalom, Sarit; Eshel, Dani; Rabinowitch, Haim D; Sherman, Amir

2015-01-22

Garlic is cultivated and consumed worldwide as a popular condiment and green vegetable with medicinal and neutraceutical properties. Garlic cultivars do not produce seeds, and therefore, this plant has not been the subject of either classical breeding or genetic studies. However, recent achievements in fertility restoration in a number of genotypes have led to flowering and seed production, thus enabling genetic studies and breeding in garlic. A transcriptome catalogue of fertile garlic was produced from multiplexed gene libraries, using RNA collected from various plant organs, including inflorescences and flowers. Over 32 million 250-bp paired-end reads were assembled into an extensive transcriptome of 240,000 contigs. An abundant transcriptome assembled separately from 102,000 highly expressed contigs was annotated and analyzed for gene ontology and metabolic pathways. Organ-specific analysis showed significant variation of gene expression between plant organs, with the highest number of specific reads in inflorescences and flowers. Analysis of the enriched biological processes and molecular functions revealed characteristic patterns for stress response, flower development and photosynthetic activity. Orthologues of key flowering genes were differentially expressed, not only in reproductive tissues, but also in leaves and bulbs, suggesting their role in flower-signal transduction and the bulbing process. More than 100 variants and isoforms of enzymes involved in organosulfur metabolism were differentially expressed and had organ-specific patterns. In addition to plant genes, viral RNA of at least four garlic viruses was detected, mostly in the roots and cloves, whereas only 1-4% of the reads were found in the foliage leaves. The de novo transcriptome of fertile garlic represents a new resource for research and breeding of this important crop, as well as for the development of effective molecular markers for useful traits, including fertility and seed production, resistance to pests and neutraceutical characteristics.

Structure of the Elastin-Contractile Units in the Thoracic Aorta and How Genes That Cause Thoracic Aortic Aneurysms and Dissections Disrupt This Structure.

PubMed

Karimi, Ashkan; Milewicz, Dianna M

2016-01-01

The medial layer of the aorta confers elasticity and strength to the aortic wall and is composed of alternating layers of smooth muscle cells (SMCs) and elastic fibres. The SMC elastin-contractile unit is a structural unit that links the elastin fibres to the SMCs and is characterized by the following: (1) layers of elastin fibres that are surrounded by microfibrils; (2) microfibrils that bind to the integrin receptors in focal adhesions on the cell surface of the SMCs; and (3) SMC contractile filaments that are linked to the focal adhesions on the inner side of the membrane. The genes that are altered to cause thoracic aortic aneurysms and aortic dissections encode proteins involved in the structure or function of the SMC elastin-contractile unit. Included in this gene list are the genes encoding protein that are structural components of elastin fibres and microfibrils, FBN1, MFAP5, ELN, and FBLN4. Also included are genes that encode structural proteins in the SMC contractile unit, including ACTA2, which encodes SMC-specific α-actin and MYH11, which encodes SMC-specific myosin heavy chain, along with MYLK and PRKG1, which encode kinases that control SMC contraction. Finally, mutations in the gene encoding the protein linking integrin receptors to the contractile filaments, FLNA, also predispose to thoracic aortic disease. Thus, these data suggest that functional SMC elastin-contractile units are important for maintaining the structural integrity of the aorta. Copyright © 2016 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

Identification of the meiotic toolkit in diatoms and exploration of meiosis-specific SPO11 and RAD51 homologs in the sexual species Pseudo-nitzschia multistriata and Seminavis robusta

DOE PAGES

Patil, Shrikant; Moeys, Sara; von Dassow, Peter; ...

2015-11-14

Sexual reproduction is an obligate phase in the life cycle of most eukaryotes. Meiosis varies among organisms, which is reflected by the variability of the gene set associated to the process. Diatoms are unicellular organisms that belong to the stramenopile clade and have unique life cycles that can include a sexual phase. The exploration of five diatom genomes and one diatom transcriptome led to the identification of 42 genes potentially involved in meiosis. While these include the majority of known meiosis-related genes, several meiosis-specific genes, including DMC1, could not be identified. Furthermore, phylogenetic analyses supported gene identification and revealed ancestralmore » loss and recent expansion in the RAD51 family in diatoms. The two sexual species Pseudo-nitzschia multistriata and Seminavis robusta were used to explore the expression of meiosis-related genes: RAD21, SPO11-2, RAD51-A, RAD51-B and RAD51-C were upregulated during meiosis, whereas other paralogs in these families showed no differential expression patterns, suggesting that they may play a role during vegetative divisions. An almost identical toolkit is shared among Pseudo-nitzschia multiseries and Fragilariopsis cylindrus, as well as two species for which sex has not been observed, Phaeodactylum tricornutum and Thalassiosira pseudonana, suggesting that these two may retain a facultative sexual phase. Lastly, our results reveal the conserved meiotic toolkit in six diatom species and indicate that Stramenopiles share major modifications of canonical meiosis processes ancestral to eukaryotes, with important divergences in each Kingdom.« less

Identification of the meiotic toolkit in diatoms and exploration of meiosis-specific SPO11 and RAD51 homologs in the sexual species Pseudo-nitzschia multistriata and Seminavis robusta

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patil, Shrikant; Moeys, Sara; von Dassow, Peter

Sexual reproduction is an obligate phase in the life cycle of most eukaryotes. Meiosis varies among organisms, which is reflected by the variability of the gene set associated to the process. Diatoms are unicellular organisms that belong to the stramenopile clade and have unique life cycles that can include a sexual phase. The exploration of five diatom genomes and one diatom transcriptome led to the identification of 42 genes potentially involved in meiosis. While these include the majority of known meiosis-related genes, several meiosis-specific genes, including DMC1, could not be identified. Furthermore, phylogenetic analyses supported gene identification and revealed ancestralmore » loss and recent expansion in the RAD51 family in diatoms. The two sexual species Pseudo-nitzschia multistriata and Seminavis robusta were used to explore the expression of meiosis-related genes: RAD21, SPO11-2, RAD51-A, RAD51-B and RAD51-C were upregulated during meiosis, whereas other paralogs in these families showed no differential expression patterns, suggesting that they may play a role during vegetative divisions. An almost identical toolkit is shared among Pseudo-nitzschia multiseries and Fragilariopsis cylindrus, as well as two species for which sex has not been observed, Phaeodactylum tricornutum and Thalassiosira pseudonana, suggesting that these two may retain a facultative sexual phase. Lastly, our results reveal the conserved meiotic toolkit in six diatom species and indicate that Stramenopiles share major modifications of canonical meiosis processes ancestral to eukaryotes, with important divergences in each Kingdom.« less

Rigorous tests of gene-environment interactions in a lab study of the oxytocin receptor gene (OXTR), alcohol exposure, and aggression.

PubMed

LoParo, Devon; Johansson, Ada; Walum, Hasse; Westberg, Lars; Santtila, Pekka; Waldman, Irwin

2016-07-01

Naturalistic studies of gene-environment interactions (G X E) have been plagued by several limitations, including difficulty isolating specific environmental risk factors from other correlated aspects of the environment, gene-environment correlation (rGE ), and the use of a single genetic variant to represent the influence of a gene. We present results from 235 Finnish young men in two lab studies of aggression and alcohol challenge that attempt to redress these limitations of the extant G X E literature. Specifically, we use a latent variable modeling approach in an attempt to more fully account for genetic variation across the oxytocin receptor gene (OXTR) and to robustly test its main effects on aggression and its interaction with alcohol exposure. We also modeled aggression as a latent variable comprising various indices, including the average and maximum levels of aggression, the earliest trial on which aggression was expressed, and the proportion of trials on which the minimum and maximum levels of aggression were expressed. The best fitting model for the genetic variation across OXTR included six factors derived from an exploratory factor analysis, roughly corresponding to six haplotype blocks. Aggression levels were higher on trials in which participants were administered alcohol, won, or were provoked. There was a significant main effect of OXTR on aggression across studies after controlling for covariates. The interaction of OXTR and alcohol was also significant across studies, such that OXTR had stronger effects on aggression in the alcohol administration condition. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Identification of the meiotic toolkit in diatoms and exploration of meiosis-specific SPO11 and RAD51 homologs in the sexual species Pseudo-nitzschia multistriata and Seminavis robusta.

PubMed

Patil, Shrikant; Moeys, Sara; von Dassow, Peter; Huysman, Marie J J; Mapleson, Daniel; De Veylder, Lieven; Sanges, Remo; Vyverman, Wim; Montresor, Marina; Ferrante, Maria Immacolata

2015-11-14

Sexual reproduction is an obligate phase in the life cycle of most eukaryotes. Meiosis varies among organisms, which is reflected by the variability of the gene set associated to the process. Diatoms are unicellular organisms that belong to the stramenopile clade and have unique life cycles that can include a sexual phase. The exploration of five diatom genomes and one diatom transcriptome led to the identification of 42 genes potentially involved in meiosis. While these include the majority of known meiosis-related genes, several meiosis-specific genes, including DMC1, could not be identified. Furthermore, phylogenetic analyses supported gene identification and revealed ancestral loss and recent expansion in the RAD51 family in diatoms. The two sexual species Pseudo-nitzschia multistriata and Seminavis robusta were used to explore the expression of meiosis-related genes: RAD21, SPO11-2, RAD51-A, RAD51-B and RAD51-C were upregulated during meiosis, whereas other paralogs in these families showed no differential expression patterns, suggesting that they may play a role during vegetative divisions. An almost identical toolkit is shared among Pseudo-nitzschia multiseries and Fragilariopsis cylindrus, as well as two species for which sex has not been observed, Phaeodactylum tricornutum and Thalassiosira pseudonana, suggesting that these two may retain a facultative sexual phase. Our results reveal the conserved meiotic toolkit in six diatom species and indicate that Stramenopiles share major modifications of canonical meiosis processes ancestral to eukaryotes, with important divergences in each Kingdom.

Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

PubMed

Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

2017-10-27

Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.

A Comprehensive, Ethnically Diverse Library of Sickle Cell Disease-Specific Induced Pluripotent Stem Cells.

PubMed

Park, Seonmi; Gianotti-Sommer, Andreia; Molina-Estevez, Francisco Javier; Vanuytsel, Kim; Skvir, Nick; Leung, Amy; Rozelle, Sarah S; Shaikho, Elmutaz Mohammed; Weir, Isabelle; Jiang, Zhihua; Luo, Hong-Yuan; Chui, David H K; Figueiredo, Maria Stella; Alsultan, Abdulraham; Al-Ali, Amein; Sebastiani, Paola; Steinberg, Martin H; Mostoslavsky, Gustavo; Murphy, George J

2017-04-11

Sickle cell anemia affects millions of people worldwide and is an emerging global health burden. As part of a large NIH-funded NextGen Consortium, we generated a diverse, comprehensive, and fully characterized library of sickle-cell-disease-specific induced pluripotent stem cells (iPSCs) from patients of different ethnicities, β-globin gene (HBB) haplotypes, and fetal hemoglobin (HbF) levels. iPSCs stand to revolutionize the way we study human development, model disease, and perhaps eventually, treat patients. Here, we describe this unique resource for the study of sickle cell disease, including novel haplotype-specific polymorphisms that affect disease severity, as well as for the development of patient-specific therapeutics for this phenotypically diverse disorder. As a complement to this library, and as proof of principle for future cell- and gene-based therapies, we also designed and employed CRISPR/Cas gene editing tools to correct the sickle hemoglobin (HbS) mutation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Kuwait and Dubai.

PubMed

Ahmad, Suhail; Mokaddas, Eiman; Fares, Esther

2002-11-01

Mutations conferring resistance to rifampin in rifampin-resistant clinical Mycobacterium tuberculosis isolates occur mostly in the 81 bp rifampin-resistance-determining region (RRDR) of the rpoB gene. In this study, 29 rifampin-resistant and 12 -susceptible clinical M. tuberculosis isolates were tested for characterization of mutations in the rpoB gene by line probe (INNO-LiPA Rif. TB) assay and the results were confirmed and extended by DNA sequencing of the PCR amplified target DNA. The line probe assay identified all 12 susceptible strains as rifampin-sensitive and the DNA sequence of RRDR in the amplified rpoB gene from two isolates matched perfectly with the wild-type sequence. The line probe assay identified 28 resistant isolates as rifampin-resistant with specific detection of mutation in 22 isolates including one isolate that exhibited hetro-resistance containing both the wild-type pattern as well as a specific mutation within RRDR while one of the rifampin-resistant strain was identified as rifampin-susceptible. DNA sequencing confirmed these results and, in addition, led to the specific detection of mutations in 5 rifampin-resistant isolates in which specific base changes within RRDR could not be determined by the line probe assay. These analyses identified 8 different mutations within RRDR of the rpoB gene including one novel mutation (S522W) that has not been reported so far. The genotyping performed on the isolates carrying similar mutations showed that majority of these isolates were unique as they exhibited varying DNA banding patterns. Correlating the ethnic origin of the infected TB patients with the occurrence of specific mutations at three main codon positions (516, 526 and 531) in the rpoB gene showed that most patients (11 of 15) from South Asian region contained mutations at codon 526 while majority of isolates from patients (6 of 11) of Middle Eastern origin contained mutations at codon 531.

What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira

PubMed Central

Fouts, Derrick E.; Matthias, Michael A.; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E.; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L.; Haake, David A.; Haft, Daniel H.; Hartskeerl, Rudy; Ko, Albert I.; Levett, Paul N.; Matsunaga, James; Mechaly, Ariel E.; Monk, Jonathan M.; Nascimento, Ana L. T.; Nelson, Karen E.; Palsson, Bernhard; Peacock, Sharon J.; Picardeau, Mathieu; Ricaldi, Jessica N.; Thaipandungpanit, Janjira; Wunder, Elsio A.; Yang, X. Frank; Zhang, Jun-Jie; Vinetz, Joseph M.

2016-01-01

Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade’s refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic) vs. non-infectious Leptospira, this work provides new insights into the evolution of a genus of bacterial pathogens. This work will be a comprehensive roadmap for understanding leptospirosis pathogenesis. More generally, it provides new insights into mechanisms by which bacterial pathogens adapt to mammalian hosts. PMID:26890609

What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira.

PubMed

Fouts, Derrick E; Matthias, Michael A; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L; Haake, David A; Haft, Daniel H; Hartskeerl, Rudy; Ko, Albert I; Levett, Paul N; Matsunaga, James; Mechaly, Ariel E; Monk, Jonathan M; Nascimento, Ana L T; Nelson, Karen E; Palsson, Bernhard; Peacock, Sharon J; Picardeau, Mathieu; Ricaldi, Jessica N; Thaipandungpanit, Janjira; Wunder, Elsio A; Yang, X Frank; Zhang, Jun-Jie; Vinetz, Joseph M

2016-02-01

Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic) vs. non-infectious Leptospira, this work provides new insights into the evolution of a genus of bacterial pathogens. This work will be a comprehensive roadmap for understanding leptospirosis pathogenesis. More generally, it provides new insights into mechanisms by which bacterial pathogens adapt to mammalian hosts.

Promoter analysis reveals globally differential regulation of human long non-coding RNA and protein-coding genes

DOE PAGES

Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; ...

2014-10-02

Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptionalmore » regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.« less

Promoter analysis reveals globally differential regulation of human long non-coding RNA and protein-coding genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui

Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptionalmore » regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.« less

Comparative Analysis of AhR-Mediated TCDD-Elicited Gene Expression in Human Liver Adult Stem Cells

PubMed Central

Kim, Suntae; Dere, Edward; Burgoon, Lyle D.; Chang, Chia-Cheng; Zacharewski, Timothy R.

2009-01-01

Time course and dose-response studies were conducted in HL1-1 cells, a human liver cell line with stem cell–like characteristics, to assess the differential gene expression elicited by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) compared with other established models. Cells were treated with 0.001, 0.01, 0.1, 1, 10, or 100nM TCDD or dimethyl sulfoxide vehicle control for 12 h for the dose-response study, or with 10nM TCDD or vehicle for 1, 2, 4, 8, 12, 24, or 48 h for the time course study. Elicited changes were monitored using a human cDNA microarray with 6995 represented genes. Empirical Bayes analysis identified 144 genes differentially expressed at one or more time points following treatment. Most genes exhibited dose-dependent responses including CYP1A1, CYP1B1, ALDH1A3, and SLC7A5 genes. Comparative analysis of HL1-1 differential gene expression to human HepG2 data identified 74 genes with comparable temporal expression profiles including 12 putative primary responses. HL1-1–specific changes were related to lipid metabolism and immune responses, consistent with effects elicited in vivo. Furthermore, comparative analysis of HL1-1 cells with mouse Hepa1c1c7 hepatoma cell lines and C57BL/6 hepatic tissue identified 18 and 32 commonly regulated orthologous genes, respectively, with functions associated with signal transduction, transcriptional regulation, metabolism and transport. Although some common pathways are affected, the results suggest that TCDD elicits species- and model-specific gene expression profiles. PMID:19684285

Comparison of CpG island methylator phenotype (CIMP) frequency in colon cancer using different probe- and gene-specific scoring alternatives on recommended multi-gene panels.

PubMed

Berg, Marianne; Hagland, Hanne R; Søreide, Kjetil

2014-01-01

In colorectal cancer a distinct subgroup of tumours demonstrate the CpG island methylator phenotype (CIMP). However, a consensus of how to score CIMP is not reached, and variation in definition may influence the reported CIMP prevalence in tumours. Thus, we sought to compare currently suggested definitions and cut-offs for methylation markers and how they influence CIMP classification in colon cancer. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA), with subsequent fragment analysis, was used to investigate methylation of tumour samples. In total, 31 CpG sites, located in 8 different genes (RUNX3, MLH1, NEUROG1, CDKN2A, IGF2, CRABP1, SOCS1 and CACNA1G) were investigated in 64 distinct colon cancers and 2 colon cancer cell lines. The Ogino gene panel includes all 8 genes, in addition to the Weisenberger panel of which only 5 of the 8 genes included were investigated. In total, 18 alternative combinations of scoring of CIMP positivity on probe-, gene-, and panel-level were analysed and compared. For 47 samples (71%), the CIMP status was constant and independent of criteria used for scoring; 34 samples were constantly scored as CIMP negative, and 13 (20%) consistently scored as CIMP positive. Only four of 31 probes (13%) investigated showed no difference in the numbers of positive samples using the different cut-offs. Within the panels a trend was observed that increasing the gene-level stringency resulted in a larger difference in CIMP positive samples than increasing the probe-level stringency. A significant difference between positive samples using 'the most stringent' as compared to 'the least stringent' criteria (20% vs 46%, respectively; p<0.005) was demonstrated. A statistical significant variation in the frequency of CIMP depending on the cut-offs and genes included in a panel was found, with twice as many positives samples by least compared to most stringent definition used.

[Fibroblast growth factors and their effects in pancreas organogenesis].

PubMed

Gnatenko, D A; Kopantzev, E P; Sverdlov, E D

2017-05-01

Fibroblast growth factors (FGF) - growth factors that regulate many important biological processes, including proliferation and differentiation of embryonic cells during organogenesis. In this review, we will summarize current information about the involvement of FGFs in the pancreas organogenesis. Pancreas organogenesis is a complex process, which involves constant signaling from mesenchymal tissue. This orchestrates the activation of various regulator genes at specific stages, determining the specification of progenitor cells. Alterations in FGF/FGFR signaling pathway during this process lead to incorrect activation of the master genes, which leads to different pathologies during pancreas development. Understanding the full picture about role of FGF factors in pancreas development will make it possible to more accurately understand their role in other pathologies of this organ, including carcinogenesis.

Genome-wide strategies identify downstream target genes of chick connective tissue-associated transcription factors.

PubMed

Orgeur, Mickael; Martens, Marvin; Leonte, Georgeta; Nassari, Sonya; Bonnin, Marie-Ange; Börno, Stefan T; Timmermann, Bernd; Hecht, Jochen; Duprez, Delphine; Stricker, Sigmar

2018-03-29

Connective tissues support organs and play crucial roles in development, homeostasis and fibrosis, yet our understanding of their formation is still limited. To gain insight into the molecular mechanisms of connective tissue specification, we selected five zinc-finger transcription factors - OSR1, OSR2, EGR1, KLF2 and KLF4 - based on their expression patterns and/or known involvement in connective tissue subtype differentiation. RNA-seq and ChIP-seq profiling of chick limb micromass cultures revealed a set of common genes regulated by all five transcription factors, which we describe as a connective tissue core expression set. This common core was enriched with genes associated with axon guidance and myofibroblast signature, including fibrosis-related genes. In addition, each transcription factor regulated a specific set of signalling molecules and extracellular matrix components. This suggests a concept whereby local molecular niches can be created by the expression of specific transcription factors impinging on the specification of local microenvironments. The regulatory network established here identifies common and distinct molecular signatures of limb connective tissue subtypes, provides novel insight into the signalling pathways governing connective tissue specification, and serves as a resource for connective tissue development. © 2018. Published by The Company of Biologists Ltd.

Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

PubMed

Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

2016-12-20

Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

Characterization of temperature and light effects on the defense response phenotypes associated with the maize Rp1-D21 gene

USDA-ARS?s Scientific Manuscript database

Rp1 is a complex locus of maize controlling race-specific resistance to the common rust fungus, Puccinia sorghi. The resistance response includes the “Hypersensitive response” (HR) – a rapid localized cell death at the point of pathogen penetration - and the induction of pathogenesis associated gene...

Comprehensive characterization and RNA-Seq profiling of the HD-Zip transcription factor family in soybean (Glycine max) during dehydration and salt stress

USDA-ARS?s Scientific Manuscript database

The homeodomain leucine zipper (HD-Zip) transcription factor family is one of the largest plant specific superfamilies, and includes genes with roles in modulation of plant growth and response to environmental stresses. Many HD-Zip genes are well characterized in Arabidopsis (Arabidopsis thaliana), ...

Characterization of wood decay enzymes by MALDI-MS for post-translational modification and gene identification.

Treesearch

Theodorus H. de Koker; Philip J. Kersten

2002-01-01

The recent sequencing of the Phanerochaete chrysosporium genome presents many opportunities, including the possibility of rapidly correlating specific wood decay proteins of the fungus with the corresponding gene sequences. Here we compare mass fragments of trypsin digests, determined by MALDI-MS (Matrix Assisted Laser Desorption Ionization-Mass Spectrometry), with...

Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development.

PubMed

Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M

2014-04-16

The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.

Accuracy of screening women at familial risk of breast cancer without a known gene mutation: Individual patient data meta-analysis.

PubMed

Phi, Xuan-Anh; Houssami, Nehmat; Hooning, Maartje J; Riedl, Christopher C; Leach, Martin O; Sardanelli, Francesco; Warner, Ellen; Trop, Isabelle; Saadatmand, Sepideh; Tilanus-Linthorst, Madeleine M A; Helbich, Thomas H; van den Heuvel, Edwin R; de Koning, Harry J; Obdeijn, Inge-Marie; de Bock, Geertruida H

2017-11-01

Women with a strong family history of breast cancer (BC) and without a known gene mutation have an increased risk of developing BC. We aimed to investigate the accuracy of screening using annual mammography with or without magnetic resonance imaging (MRI) for these women outside the general population screening program. An individual patient data (IPD) meta-analysis was conducted using IPD from six prospective screening trials that had included women at increased risk for BC: only women with a strong familial risk for BC and without a known gene mutation were included in this analysis. A generalised linear mixed model was applied to estimate and compare screening accuracy (sensitivity, specificity and predictive values) for annual mammography with or without MRI. There were 2226 women (median age: 41 years, interquartile range 35-47) with 7478 woman-years of follow-up, with a BC rate of 12 (95% confidence interval 9.3-14) in 1000 woman-years. Mammography screening had a sensitivity of 55% (standard error of mean [SE] 7.0) and a specificity of 94% (SE 1.3). Screening with MRI alone had a sensitivity of 89% (SE 4.6) and a specificity of 83% (SE 2.8). Adding MRI to mammography increased sensitivity to 98% (SE 1.8, P < 0.01 compared to mammography alone) but lowered specificity to 79% (SE 2.7, P < 0.01 compared with mammography alone). In this population of women with strong familial BC risk but without a known gene mutation, in whom BC incidence was high both before and after age 50, adding MRI to mammography substantially increased screening sensitivity but also decreased its specificity. Copyright © 2017 Elsevier Ltd. All rights reserved.

SEA: a super-enhancer archive.

PubMed

Wei, Yanjun; Zhang, Shumei; Shang, Shipeng; Zhang, Bin; Li, Song; Wang, Xinyu; Wang, Fang; Su, Jianzhong; Wu, Qiong; Liu, Hongbo; Zhang, Yan

2016-01-04

Super-enhancers are large clusters of transcriptional enhancers regarded as having essential roles in driving the expression of genes that control cell identity during development and tumorigenesis. The construction of a genome-wide super-enhancer database is urgently needed to better understand super-enhancer-directed gene expression regulation for a given biology process. Here, we present a specifically designed web-accessible database, Super-Enhancer Archive (SEA, http://sea.edbc.org). SEA focuses on integrating super-enhancers in multiple species and annotating their potential roles in the regulation of cell identity gene expression. The current release of SEA incorporates 83 996 super-enhancers computationally or experimentally identified in 134 cell types/tissues/diseases, including human (75 439, three of which were experimentally identified), mouse (5879, five of which were experimentally identified), Drosophila melanogaster (1774) and Caenorhabditis elegans (904). To facilitate data extraction, SEA supports multiple search options, including species, genome location, gene name, cell type/tissue and super-enhancer name. The response provides detailed (epi)genetic information, incorporating cell type specificity, nearby genes, transcriptional factor binding sites, CRISPR/Cas9 target sites, evolutionary conservation, SNPs, H3K27ac, DNA methylation, gene expression and TF ChIP-seq data. Moreover, analytical tools and a genome browser were developed for users to explore super-enhancers and their roles in defining cell identity and disease processes in depth. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Brassica oleracea gene expressed in a variety-specific manner may encode a novel plant transmembrane receptor.

PubMed

Palmer, J E; Dikeman, D A; Fujinuma, T; Kim, B; Jones, J I; Denda, M; Martínez-Zapater, J M; Cruz-Alvarez, M

2001-04-01

The species Brassica oleracea includes several agricultural varieties characterized by the proliferation of different types of meristems. Using a combination of subtractive hybridization and PCR (polymerase chain reaction) techniques we have identified several genes which are expressed in the reproductive meristems of the cauliflower curd (B. oleracea var. botrytis) but not in the vegetative meristems of Brussels sprouts (B. oleracea var. gemmifera) axillary buds. One of the cloned genes, termed CCE1 (CAULIFLOWER CURD EXPRESSION 1) shows specific expression in the botrytis variety. Preferential expression takes place in this variety in the meristems of the curd and in the stem throughout the vegetative and reproductive stages of plant growth. CCE1 transcripts are not detected in any of the organs of other B. oleracea varieties analyzed. Based on the nucleotide sequence of a cDNA encompassing the complete coding region, we predict that this gene encodes a transmembrane protein, with three transmembrane domains. The deduced amino acid sequence includes motifs conserved in G-protein-coupled receptors (GPCRs) from yeast and animal species. Our results suggest that the cloned gene encodes a protein belonging to a new, so far unidentified, family of transmembrane receptors in plants. The expression pattern of the gene suggests that the receptor may be involved in the control of meristem development/arrest that takes place in cauliflower.

Identification and Validation of Selected Universal Stress Protein Domain Containing Drought-Responsive Genes in Pigeonpea (Cajanus cajan L.)

PubMed Central

Sinha, Pallavi; Pazhamala, Lekha T.; Singh, Vikas K.; Saxena, Rachit K.; Krishnamurthy, L.; Azam, Sarwar; Khan, Aamir W.; Varshney, Rajeev K.

2016-01-01

Pigeonpea is a resilient crop, which is relatively more drought tolerant than many other legume crops. To understand the molecular mechanisms of this unique feature of pigeonpea, 51 genes were selected using the Hidden Markov Models (HMM) those codes for proteins having close similarity to universal stress protein domain. Validation of these genes was conducted on three pigeonpea genotypes (ICPL 151, ICPL 8755, and ICPL 227) having different levels of drought tolerance. Gene expression analysis using qRT-PCR revealed 6, 8, and 18 genes to be ≥2-fold differentially expressed in ICPL 151, ICPL 8755, and ICPL 227, respectively. A total of 10 differentially expressed genes showed ≥2-fold up-regulation in the more drought tolerant genotype, which encoded four different classes of proteins. These include plant U-box protein (four genes), universal stress protein A-like protein (four genes), cation/H(+) antiporter protein (one gene) and an uncharacterized protein (one gene). Genes C.cajan_29830 and C.cajan_33874 belonging to uspA, were found significantly expressed in all the three genotypes with ≥2-fold expression variations. Expression profiling of these two genes on the four other legume crops revealed their specific role in pigeonpea. Therefore, these genes seem to be promising candidates for conferring drought tolerance specifically to pigeonpea. PMID:26779199

A Novel Family in Medicago truncatula Consisting of More Than 300 Nodule-Specific Genes Coding for Small, Secreted Polypeptides with Conserved Cysteine Motifs1[w

PubMed Central

Mergaert, Peter; Nikovics, Krisztina; Kelemen, Zsolt; Maunoury, Nicolas; Vaubert, Danièle; Kondorosi, Adam; Kondorosi, Eva

2003-01-01

Transcriptome analysis of Medicago truncatula nodules has led to the discovery of a gene family named NCR (nodule-specific cysteine rich) with more than 300 members. The encoded polypeptides were short (60–90 amino acids), carried a conserved signal peptide, and, except for a conserved cysteine motif, displayed otherwise extensive sequence divergence. Family members were found in pea (Pisum sativum), broad bean (Vicia faba), white clover (Trifolium repens), and Galega orientalis but not in other plants, including other legumes, suggesting that the family might be specific for galegoid legumes forming indeterminate nodules. Gene expression of all family members was restricted to nodules except for two, also expressed in mycorrhizal roots. NCR genes exhibited distinct temporal and spatial expression patterns in nodules and, thus, were coupled to different stages of development. The signal peptide targeted the polypeptides in the secretory pathway, as shown by green fluorescent protein fusions expressed in onion (Allium cepa) epidermal cells. Coregulation of certain NCR genes with genes coding for a potentially secreted calmodulin-like protein and for a signal peptide peptidase suggests a concerted action in nodule development. Potential functions of the NCR polypeptides in cell-to-cell signaling and creation of a defense system are discussed. PMID:12746522

Chromosomal location and gene paucity of the male specific region on papaya Y chromosome.

PubMed

Yu, Qingyi; Hou, Shaobin; Hobza, Roman; Feltus, F Alex; Wang, Xiue; Jin, Weiwei; Skelton, Rachel L; Blas, Andrea; Lemke, Cornelia; Saw, Jimmy H; Moore, Paul H; Alam, Maqsudul; Jiang, Jiming; Paterson, Andrew H; Vyskot, Boris; Ming, Ray

2007-08-01

Sex chromosomes in flowering plants evolved recently and many of them remain homomorphic, including those in papaya. We investigated the chromosomal location of papaya's small male specific region of the hermaphrodite Y (Yh) chromosome (MSY) and its genomic features. We conducted chromosome fluorescence in situ hybridization mapping of Yh-specific bacterial artificial chromosomes (BACs) and placed the MSY near the centromere of the papaya Y chromosome. Then we sequenced five MSY BACs to examine the genomic features of this specialized region, which resulted in the largest collection of contiguous genomic DNA sequences of a Y chromosome in flowering plants. Extreme gene paucity was observed in the papaya MSY with no functional gene identified in 715 kb MSY sequences. A high density of retroelements and local sequence duplications were detected in the MSY that is suppressed for recombination. Location of the papaya MSY near the centromere might have provided recombination suppression and fostered paucity of genes in the male specific region of the Y chromosome. Our findings provide critical information for deciphering the sex chromosomes in papaya and reference information for comparative studies of other sex chromosomes in animals and plants.

Gene-specific changes in alpha-tubulin transcript accumulation in developing cotton fibers.

PubMed

Whittaker, D J; Triplett, B A

1999-09-01

The fibers of cotton (Gossypium hirsutum) are single-cell trichomes that undergo rapid and synchronous elongation. Cortical microtubules provide spatial information necessary for the alignment of cellulose microfibrils that confine and regulate cell elongation. We used gene-specific probes to investigate alpha-tubulin transcript levels in elongating cotton fibers. Two discrete patterns of transcript accumulation were observed. Whereas transcripts of alpha-tubulin genes GhTua2/3 and GhTua4 increased in abundance from 10 to 20 d post anthesis (DPA), GhTua1 and GhTua5 transcripts were abundant only through to 14 DPA, and dropped significantly at 16 DPA with the onset of secondary wall synthesis. This is the first report, to our knowledge, of gene-specific changes in tubulin transcript levels during the development of a terminally differentiated plant cell. The decrease in abundance of GhTua1 and GhTua5 transcripts was correlated with pronounced changes in cell wall structure, suggesting that alpha-tubulin isoforms may be functionally distinct in elongating fiber cells. Although total alpha-tubulin transcript levels were much higher in fiber than several other tissues, including the hypocotyl and pollen, none of the alpha-tubulins was specific to fiber cells.

Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

PubMed

Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

2013-12-05

The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

Transcriptome Analysis of Neisseria gonorrhoeae during Natural Infection Reveals Differential Expression of Antibiotic Resistance Determinants between Men and Women.

PubMed

Nudel, Kathleen; McClure, Ryan; Moreau, Matthew; Briars, Emma; Abrams, A Jeanine; Tjaden, Brian; Su, Xiao-Hong; Trees, David; Rice, Peter A; Massari, Paola; Genco, Caroline A

2018-08-29

Neisseria gonorrhoeae is a bacterial pathogen responsible for the sexually transmitted infection gonorrhea. Emergence of antimicrobial resistance (AMR) of N. gonorrhoeae worldwide has resulted in limited therapeutic choices for this infection. Men who seek treatment often have symptomatic urethritis; in contrast, gonococcal cervicitis in women is usually minimally symptomatic, but may progress to pelvic inflammatory disease. Previously, we reported the first analysis of gonococcal transcriptome expression determined in secretions from women with cervical infection. Here, we defined gonococcal global transcriptional responses in urethral specimens from men with symptomatic urethritis and compared these with transcriptional responses in specimens obtained from women with cervical infections and in vitro -grown N. gonorrhoeae isolates. This is the first comprehensive comparison of gonococcal gene expression in infected men and women. RNA sequencing analysis revealed that 9.4% of gonococcal genes showed increased expression exclusively in men and included genes involved in host immune cell interactions, while 4.3% showed increased expression exclusively in women and included phage-associated genes. Infected men and women displayed comparable antibiotic-resistant genotypes and in vitro phenotypes, but a 4-fold higher expression of the Mtr efflux pump-related genes was observed in men. These results suggest that expression of AMR genes is programed genotypically and also driven by sex-specific environments. Collectively, our results indicate that distinct N. gonorrhoeae gene expression signatures are detected during genital infection in men and women. We propose that therapeutic strategies could target sex-specific differences in expression of antibiotic resistance genes. IMPORTANCE Recent emergence of antimicrobial resistance of Neisseria gonorrhoeae worldwide has resulted in limited therapeutic choices for treatment of infections caused by this organism. We performed global transcriptomic analysis of N. gonorrhoeae in subjects with gonorrhea who attended a Nanjing, China, sexually transmitted infection (STI) clinic, where antimicrobial resistance of N. gonorrhoeae is high and increasing. We found that N. gonorrhoeae transcriptional responses to infection differed in genital specimens taken from men and women, particularly antibiotic resistance gene expression, which was increased in men. These sex-specific findings may provide a new approach to guide therapeutic interventions and preventive measures that are also sex specific while providing additional insight to address antimicrobial resistance of N. gonorrhoeae . Copyright © 2018 Nudel et al.

Expression profiling of tomato pre-abscission pedicels provides insights into abscission zone properties including competence to respond to abscission signals

PubMed Central

2013-01-01

Background Detachment of plant organs occurs in abscission zones (AZs). During plant growth, the AZ forms, but does not develop further until the cells perceive abscission-promoting signals and initiate detachment. Upon signal perception, abscission initiates immediately; if there is no signal, abscission is not induced and the organ remains attached to the plant. However, little attention has been paid to the genes that maintain competence to respond to the abscission signal in the pre-abscission AZ. Recently, we found that the tomato (Solanum lycopersicum) transcription factors BLIND (Bl), GOBLET (GOB), Lateral suppressor (Ls) and a tomato WUSCHEL homologue (LeWUS) are expressed specifically in pre-abscission tissue, the anthesis pedicel AZs. To advance our understanding of abscission, here we profiled genome-wide gene expression in tomato flower pedicels at the pre-abscission stage. Results We examined the transcriptomes of three tomato flower pedicel regions, the AZ and flanking proximal- (Prox) and distal- (Dis) regions, and identified 89 genes that were preferentially expressed in the AZ compared to both Prox and Dis. These genes included several transcription factors that regulate apical or axillary shoot meristem activity. Also, genes associated with auxin activity were regulated in a Prox-Dis region-specific manner, suggesting that a gradient of auxin exists in the pedicel. A MADS-box gene affecting floral transition was preferentially expressed in the Prox region and other MADS-box genes for floral organ identification were preferentially expressed in Dis, implying that the morphologically similar Prox and Dis regions have distinct identities. We also analyzed the expression of known regulators; in anthesis pedicels, Bl, GOB, Ls and LeWUS were expressed in the vascular cells of the AZ region. However, after an abscission signal, Bl was up-regulated, but GOB, Ls and LeWUS were down-regulated, suggesting that Bl may be a positive regulator of abscission, but the others may be negative regulators. Conclusions This study reveals region-specific gene expression in tomato flower pedicels at anthesis and identifies factors that may determine the physiological properties of the pre-abscission pedicel. The region-specific transcriptional regulators and genes for auxin activity identified here may prevent flower abscission in the absence of signal or establish competence to respond to the abscission signal. PMID:23497084

Modular adeno-associated virus (rAAV) vectors used for cellular virus-directed enzyme prodrug therapy

PubMed Central

Hagen, Sven; Baumann, Tobias; Wagner, Hanna J.; Morath, Volker; Kaufmann, Beate; Fischer, Adrian; Bergmann, Stefan; Schindler, Patrick; Arndt, Katja M.; Müller, Kristian M.

2014-01-01

The pre-clinical and clinical development of viral vehicles for gene transfer increased in recent years, and a recombinant adeno-associated virus (rAAV) drug took center stage upon approval in the European Union. However, lack of standardization, inefficient purification methods and complicated retargeting limit general usability. We address these obstacles by fusing rAAV-2 capsids with two modular targeting molecules (DARPin or Affibody) specific for a cancer cell-surface marker (EGFR) while simultaneously including an affinity tag (His-tag) in a surface-exposed loop. Equipping these particles with genes coding for prodrug converting enzymes (thymidine kinase or cytosine deaminase) we demonstrate tumor marker specific transduction and prodrug-dependent apoptosis of cancer cells. Coding terminal and loop modifications in one gene enabled specific and scalable purification. Our genetic parts for viral production adhere to a standardized cloning strategy facilitating rapid prototyping of virus directed enzyme prodrug therapy (VDEPT). PMID:24457557

Dosage Compensation of the Sex Chromosomes

PubMed Central

Disteche, Christine M.

2013-01-01

Differentiated sex chromosomes evolved because of suppressed recombination once sex became genetically controlled. In XX/XY and ZZ/ZW systems, the heterogametic sex became partially aneuploid after degeneration of the Y or W. Often, aneuploidy causes abnormal levels of gene expression throughout the entire genome. Dosage compensation mechanisms evolved to restore balanced expression of the genome. These mechanisms include upregulation of the heterogametic chromosome as well as repression in the homogametic sex. Remarkably, strategies for dosage compensation differ between species. In organisms where more is known about molecular mechanisms of dosage compensation, specific protein complexes containing noncoding RNAs are targeted to the X chromosome. In addition, the dosage-regulated chromosome often occupies a specific nuclear compartment. Some genes escape dosage compensation, potentially resulting in sex-specific differences in gene expression. This review focuses on dosage compensation in mammals, with comparisons to fruit flies, nematodes, and birds. PMID:22974302

AbMiner: a bioinformatic resource on available monoclonal antibodies and corresponding gene identifiers for genomic, proteomic, and immunologic studies.

PubMed

Major, Sylvia M; Nishizuka, Satoshi; Morita, Daisaku; Rowland, Rick; Sunshine, Margot; Shankavaram, Uma; Washburn, Frank; Asin, Daniel; Kouros-Mehr, Hosein; Kane, David; Weinstein, John N

2006-04-06

Monoclonal antibodies are used extensively throughout the biomedical sciences for detection of antigens, either in vitro or in vivo. We, for example, have used them for quantitation of proteins on "reverse-phase" protein lysate arrays. For those studies, we quality-controlled > 600 available monoclonal antibodies and also needed to develop precise information on the genes that encode their antigens. Translation among the various protein and gene identifier types proved non-trivial because of one-to-many and many-to-one relationships. To organize the antibody, protein, and gene information, we initially developed a relational database in Filemaker for our own use. When it became apparent that the information would be useful to many other researchers faced with the need to choose or characterize antibodies, we developed it further as AbMiner, a fully relational web-based database under MySQL, programmed in Java. AbMiner is a user-friendly, web-based relational database of information on > 600 commercially available antibodies that we validated by Western blot for protein microarray studies. It includes many types of information on the antibody, the immunogen, the vendor, the antigen, and the antigen's gene. Multiple gene and protein identifier types provide links to corresponding entries in a variety of other public databases, including resources for phosphorylation-specific antibodies. AbMiner also includes our quality-control data against a pool of 60 diverse cancer cell types (the NCI-60) and also protein expression levels for the NCI-60 cells measured using our high-density "reverse-phase" protein lysate microarrays for a selection of the listed antibodies. Some other available database resources give information on antibody specificity for one or a couple of cell types. In contrast, the data in AbMiner indicate specificity with respect to the antigens in a pool of 60 diverse cell types from nine different tissues of origin. AbMiner is a relational database that provides extensive information from our own laboratory and other sources on more than 600 available antibodies and the genes that encode the antibodies' antigens. The data will be made freely available at http://discover.nci.nih.gov/abminer.

A gene regulatory network armature for T-lymphocyte specification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fung, Elizabeth-sharon

Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through whichmore » T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.« less

A Resource for Discovering Specific and Universal Biomarkers for Distributed Stem Cells

PubMed Central

Noh, Minsoo; Smith, Janet L.; Huh, Yang Hoon; Sherley, James L.

2011-01-01

Specific and universal biomarkers for distributed stem cells (DSCs) have been elusive. A major barrier to discovery of such ideal DSC biomarkers is difficulty in obtaining DSCs in sufficient quantity and purity. To solve this problem, we used cell lines genetically engineered for conditional asymmetric self-renewal, the defining DSC property. In gene microarray analyses, we identified 85 genes whose expression is tightly asymmetric self-renewal associated (ASRA). The ASRA gene signature prescribed DSCs to undergo asymmetric self-renewal to a greater extent than committed progenitor cells, embryonic stem cells, or induced pluripotent stem cells. This delineation has several significant implications. These include: 1) providing experimental evidence that DSCs in vivo undergo asymmetric self-renewal as individual cells; 2) providing an explanation why earlier attempts to define a common gene expression signature for DSCs were unsuccessful; and 3) predicting that some ASRA proteins may be ideal biomarkers for DSCs. Indeed, two ASRA proteins, CXCR6 and BTG2, and two other related self-renewal pattern associated (SRPA) proteins identified in this gene resource, LGR5 and H2A.Z, display unique asymmetric patterns of expression that have a high potential for universal and specific DSC identification. PMID:21818293

EHMT2 directs DNA methylation for efficient gene silencing in mouse embryos

PubMed Central

Auclair, Ghislain; Borgel, Julie; Sanz, Lionel A.; Vallet, Judith; Guibert, Sylvain; Dumas, Michael; Cavelier, Patricia; Girardot, Michael; Forné, Thierry; Feil, Robert; Weber, Michael

2016-01-01

The extent to which histone modifying enzymes contribute to DNA methylation in mammals remains unclear. Previous studies suggested a link between the lysine methyltransferase EHMT2 (also known as G9A and KMT1C) and DNA methylation in the mouse. Here, we used a model of knockout mice to explore the role of EHMT2 in DNA methylation during mouse embryogenesis. The Ehmt2 gene is expressed in epiblast cells but is dispensable for global DNA methylation in embryogenesis. In contrast, EHMT2 regulates DNA methylation at specific sequences that include CpG-rich promoters of germline-specific genes. These loci are bound by EHMT2 in embryonic cells, are marked by H3K9 dimethylation, and have strongly reduced DNA methylation in Ehmt2−/− embryos. EHMT2 also plays a role in the maintenance of germline-derived DNA methylation at one imprinted locus, the Slc38a4 gene. Finally, we show that DNA methylation is instrumental for EHMT2-mediated gene silencing in embryogenesis. Our findings identify EHMT2 as a critical factor that facilitates repressive DNA methylation at specific genomic loci during mammalian development. PMID:26576615

Isolation, amplification and characterization of foodborne pathogen disease bacteria gene for rapid kit test development

NASA Astrophysics Data System (ADS)

Nurjayadi, M.; Santoso, I.; Kartika, I. R.; Kurniadewi, F.; Saamia, V.; Sofihan, W.; Nurkhasanah, D.

2017-07-01

There is a lot of public concern over food safety. Food-safety cases recently, including many food poisoning cases in both the developed and developing countries, considered to be the national security threats which involved police investigation. Quick and accurate detection methods are needed to handle the food poisoning cases with a big number of sufferers at the same time. Therefore, the research is aimed to develop a specific, sensitive, and rapid result molecular detection tool for foodborne pathogen bacteria. We, thus, propose genomic level approach with Polymerase Chain Reaction. The research has successfully produced a specific primer to perform amplification to fim-C S. typhi, E. coli, and pef Salmonella typhimurium genes. The electrophoresis result shows that amplification products are 95 base pairs, 121 base pairs, and 139 base pairs; and all three genes are in accordance with the size of the in silico to third genes bacteria. In conclusion, the research has been successfully designed a specific detection tool to three foodborne pathogen bacteria genes. Further stages test and the uses of Real-time PCR in the detection are still in the trial process for better detection method.

A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

PubMed

Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

2017-01-11

A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Adenovirus Vectors Target Several Cell Subtypes of Mammalian Inner Ear In Vivo

PubMed Central

Li, Wenyan; Shen, Jun

2016-01-01

Mammalian inner ear harbors diverse cell types that are essential for hearing and balance. Adenovirus is one of the major vectors to deliver genes into the inner ear for functional studies and hair cell regeneration. To identify adenovirus vectors that target specific cell subtypes in the inner ear, we studied three adenovirus vectors, carrying a reporter gene encoding green fluorescent protein (GFP) from two vendors or with a genome editing gene Cre recombinase (Cre), by injection into postnatal days 0 (P0) and 4 (P4) mouse cochlea through scala media by cochleostomy in vivo. We found three adenovirus vectors transduced mouse inner ear cells with different specificities and expression levels, depending on the type of adenoviral vectors and the age of mice. The most frequently targeted region was the cochlear sensory epithelium, including auditory hair cells and supporting cells. Adenovirus with GFP transduced utricular supporting cells as well. This study shows that adenovirus vectors are capable of efficiently and specifically transducing different cell types in the mammalian inner ear and provides useful tools to study inner ear gene function and to evaluate gene therapy to treat hearing loss and vestibular dysfunction. PMID:28116172

Anorexia Nervosa

MedlinePlus

... happen because of a combination of a person’s biology and life events. This combination includes having specific genes, a person’s biology, body image and self-esteem, social experiences, family ...

S locus-linked F-box genes expressed in anthers of Hordeum bulbosum.

PubMed

Kakeda, Katsuyuki

2009-09-01

Diploid Hordeum bulbosum (a wild relative of cultivated barley) exhibits a two-locus self-incompatibility (SI) system gametophytically controlled by the unlinked multiallelic loci S and Z. This unique SI system is observed in the grasses (Poaceae) including the tribe Triticeae. This paper describes the identification and characterization of two F-box genes cosegregating with the S locus in H. bulbosum, named Hordeum S locus-linked F-box 1 (HSLF1) and HSLF2, which were derived from an S (3) haplotype-specific clone (HAS175) obtained by previous AMF (AFLP-based mRNA fingerprinting) analysis. Sequence analysis showed that both genes encode similar F-box proteins with a C-terminal leucine-rich repeat (LRR) domain, which are distinct from S locus (or S haplotype-specific) F-box protein (SLF/SFB), a class of F-box proteins identified as the pollen S determinant in S-RNase-based gametophytic SI systems. A number of homologous F-box genes with an LRR domain were found in the rice genome, although the functions of the gene family are unknown. One allele of the HSLF1 gene (HSLF1-S (3)) was expressed specifically in mature anthers, whereas no expression was detected from the other two alleles examined. Although the degree of sequence polymorphism among the three HSLF1 alleles was low, a frameshift mutation was found in one of the unexpressed alleles. The HSLF2 gene showed a low level of expression with no tissue specificity as well as little sequence polymorphism among the three alleles. The multiplicity of S locus-linked F-box genes is discussed in comparison with those found in the S-RNase-based SI system.

Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

NASA Technical Reports Server (NTRS)

Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

1995-01-01

In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

CTCF-Mediated and Pax6-Associated Gene Expression in Corneal Epithelial Cell-Specific Differentiation

PubMed Central

Tsui, Shanli; Wang, Jie; Wang, Ling; Dai, Wei; Lu, Luo

2016-01-01

Background The purpose of the study is to elicit the epigenetic mechanism involving CCCTC binding factor (CTCF)-mediated chromatin remodeling that regulates PAX6 gene interaction with differentiation-associated genes to control corneal epithelial differentiation. Methods Cell cycle progression and specific keratin expressions were measured to monitor changes of differentiation-induced primary human limbal stem/progenitor (HLS/P), human corneal epithelial (HCE) and human telomerase-immortalized corneal epithelial (HTCE) cells. PAX6-interactive and differentiation-associated genes in chromatin remodeling mediated by the epigenetic factor CTCF were detected by circular chromosome conformation capture (4C) and ChIP (Chromatin immunoprecipitation)-on-chip approaches, and verified by FISH (Fluorescent in situ hybridization). Furthermore, CTCF activities were altered by CTCF-shRNA to study the effect of CTCF on mediating interaction of Pax6 and differentiation-associated genes in corneal epithelial cell fate. Results Our results demonstrated that differentiation-induced human corneal epithelial cells expressed typical corneal epithelial characteristics including morphological changes, increased keratin12 expression and G0/G1 accumulations. Expressions of CTCF and PAX6 were suppressed and elevated following the process of differentiation, respectively. During corneal epithelial cell differentiation, differentiation-induced RCN1 and ADAM17 were found interacting with PAX6 in the process of CTCF-mediated chromatin remodeling detected by 4C and verified by ChIP-on-chip and FISH. Diminished CTCF mRNA with CTCF-shRNA in HTCE cells weakened the interaction of PAX6 gene in controlling RCN1/ADAM17 and enhanced early onset of the genes in cell differentiation. Conclusion Our results explain how epigenetic factor CTCF-mediated chromatin remodeling regulates interactions between eye-specific PAX6 and those genes that are induced/associated with cell differentiation to modulate corneal epithelial cell-specific differentiation. PMID:27583466

Adeno-associated virus inverted terminal repeats stimulate gene editing.

PubMed

Hirsch, M L

2015-02-01

Advancements in genome editing have relied on technologies to specifically damage DNA which, in turn, stimulates DNA repair including homologous recombination (HR). As off-target concerns complicate the therapeutic translation of site-specific DNA endonucleases, an alternative strategy to stimulate gene editing based on fragile DNA was investigated. To do this, an episomal gene-editing reporter was generated by a disruptive insertion of the adeno-associated virus (AAV) inverted terminal repeat (ITR) into the egfp gene. Compared with a non-structured DNA control sequence, the ITR induced DNA damage as evidenced by increased gamma-H2AX and Mre11 foci formation. As local DNA damage stimulates HR, ITR-mediated gene editing was investigated using DNA oligonucleotides as repair substrates. The AAV ITR stimulated gene editing >1000-fold in a replication-independent manner and was not biased by the polarity of the repair oligonucleotide. Analysis of additional human DNA sequences demonstrated stimulation of gene editing to varying degrees. In particular, inverted yet not direct, Alu repeats induced gene editing, suggesting a role for DNA structure in the repair event. Collectively, the results demonstrate that inverted DNA repeats stimulate gene editing via double-strand break repair in an episomal context and allude to efficient gene editing of the human chromosome using fragile DNA sequences.

Site-specific selfish genes as tools for the control and genetic engineering of natural populations.

PubMed

Burt, Austin

2003-05-07

Site-specific selfish genes exploit host functions to copy themselves into a defined target DNA sequence, and include homing endonuclease genes, group II introns and some LINE-like transposable elements. If such genes can be engineered to target new host sequences, then they can be used to manipulate natural populations, even if the number of individuals released is a small fraction of the entire population. For example, a genetic load sufficient to eradicate a population can be imposed in fewer than 20 generations, if the target is an essential host gene, the knockout is recessive and the selfish gene has an appropriate promoter. There will be selection for resistance, but several strategies are available for reducing the likelihood of it evolving. These genes may also be used to genetically engineer natural populations, by means of population-wide gene knockouts, gene replacements and genetic transformations. By targeting sex-linked loci just prior to meiosis one may skew the population sex ratio, and by changing the promoter one may limit the spread of the gene to neighbouring populations. The proposed constructs are evolutionarily stable in the face of the mutations most likely to arise during their spread, and strategies are also available for reversing the manipulations.

The Transcriptome of the Reference Potato Genome Solanum tuberosum Group Phureja Clone DM1-3 516R44

PubMed Central

Massa, Alicia N.; Childs, Kevin L.; Lin, Haining; Bryan, Glenn J.; Giuliano, Giovanni; Buell, C. Robin

2011-01-01

Advances in molecular breeding in potato have been limited by its complex biological system, which includes vegetative propagation, autotetraploidy, and extreme heterozygosity. The availability of the potato genome and accompanying gene complement with corresponding gene structure, location, and functional annotation are powerful resources for understanding this complex plant and advancing molecular breeding efforts. Here, we report a reference for the potato transcriptome using 32 tissues and growth conditions from the doubled monoploid Solanum tuberosum Group Phureja clone DM1-3 516R44 for which a genome sequence is available. Analysis of greater than 550 million RNA-Seq reads permitted the detection and quantification of expression levels of over 22,000 genes. Hierarchical clustering and principal component analyses captured the biological variability that accounts for gene expression differences among tissues suggesting tissue-specific gene expression, and genes with tissue or condition restricted expression. Using gene co-expression network analysis, we identified 18 gene modules that represent tissue-specific transcriptional networks of major potato organs and developmental stages. This information provides a powerful resource for potato research as well as studies on other members of the Solanaceae family. PMID:22046362

Genomic Pangea: coordinate gene regulation and cell-specific chromosomal topologies.

PubMed

Laster, Kyle; Kosak, Steven T

2010-06-01

The eukaryotic nucleus is functionally organized. Gene loci, for example, often reveal altered localization patterns according to their developmental regulation. Whole chromosomes also demonstrate non-random nuclear positions, correlated with inherent characteristics such as gene density or size. Given that hundreds to thousands of genes are coordinately regulated in any given cell type, interest has grown in whether chromosomes may be specifically localized according to gene regulation. A synthesis of the evidence for preferential chromosomal organization suggests that, beyond basic characteristics, chromosomes can assume positions functionally related to gene expression. Moreover, analysis of total chromosome organization during cellular differentiation indicates that unique chromosome topologies, albeit probabilistic, in effect define a cell lineage. Future work with new techniques, including the advanced forms of the chromosome conformation capture (3C), and the development of next-generation whole-genome imaging approaches, will help to refine our view of chromosomal organization. We suggest that genomic organization during cellular differentiation should be viewed as a dynamic process, with gene expression patterns leading to chromosome associations that feed back on themselves, leading to the self-organization of the genome according to coordinate gene regulation. Copyright 2010 Elsevier Ltd. All rights reserved.

Biotechnological application of functional genomics towards plant-parasitic nematode control.

PubMed

Li, Jiarui; Todd, Timothy C; Lee, Junghoon; Trick, Harold N

2011-12-01

Plant-parasitic nematodes are primary biotic factors limiting the crop production. Current nematode control strategies include nematicides, crop rotation and resistant cultivars, but each has serious limitations. RNA interference (RNAi) represents a major breakthrough in the application of functional genomics for plant-parasitic nematode control. RNAi-induced suppression of numerous genes essential for nematode development, reproduction or parasitism has been demonstrated, highlighting the considerable potential for using this strategy to control damaging pest populations. In an effort to find more suitable and effective gene targets for silencing, researchers are employing functional genomics methodologies, including genome sequencing and transcriptome profiling. Microarrays have been used for studying the interactions between nematodes and plant roots and to measure both plants and nematodes transcripts. Furthermore, laser capture microdissection has been applied for the precise dissection of nematode feeding sites (syncytia) to allow the study of gene expression specifically in syncytia. In the near future, small RNA sequencing techniques will provide more direct information for elucidating small RNA regulatory mechanisms in plants and specific gene silencing using artificial microRNAs should further improve the potential of targeted gene silencing as a strategy for nematode management. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Neurotransmitter-based strategies for the treatment of cognitive dysfunction in Down syndrome.

PubMed

Das, Devsmita; Phillips, Cristy; Hsieh, Wayne; Sumanth, Krithika; Dang, Van; Salehi, Ahmad

2014-10-03

Down syndrome (DS) is a multisystem disorder affecting the cardiovascular, respiratory, gastrointestinal, neurological, hematopoietic, and musculoskeletal systems and is characterized by significant cognitive disability and a possible common pathogenic mechanism with Alzheimer's disease. During the last decade, numerous studies have supported the notion that the triplication of specific genes on human chromosome 21 plays a significant role in cognitive dysfunction in DS. Here we reviewed studies in trisomic mouse models and humans, including children and adults with DS. In order to identify groups of genes that contribute to cognitive disability in DS, multiple mouse models of DS with segmental trisomy have been generated. Over-expression of these particular genes in DS can lead to dysfunction of several neurotransmitter systems. Therapeutic strategies for DS have either focused on normalizing the expression of triplicated genes with important roles in DS or restoring the function of these systems. Indeed, our extensive review of studies on the pathogenesis of DS suggests that one plausible strategy for the treatment of cognitive dysfunction is to target the cholinergic, serotonergic, GABA-ergic, glutamatergic, and norepinephrinergic system. However, a fundamental strategy for treatment of cognitive dysfunction in DS would include reducing to normal levels the expression of specific triplicated genes in affected systems before the onset of neurodegeneration. Published by Elsevier Inc.

Adoptive immunotherapy for hematological malignancies using T cells gene-modified to express tumor antigen-specific receptors.

PubMed

Fujiwara, Hiroshi

2014-12-15

Accumulating clinical evidence suggests that adoptive T-cell immunotherapy could be a promising option for control of cancer; evident examples include the graft-vs-leukemia effect mediated by donor lymphocyte infusion (DLI) and therapeutic infusion of ex vivo-expanded tumor-infiltrating lymphocytes (TIL) for melanoma. Currently, along with advances in synthetic immunology, gene-modified T cells retargeted to defined tumor antigens have been introduced as "cellular drugs". As the functional properties of the adoptive immune response mediated by T lymphocytes are decisively regulated by their T-cell receptors (TCRs), transfer of genes encoding target antigen-specific receptors should enable polyclonal T cells to be uniformly redirected toward cancer cells. Clinically, anticancer adoptive immunotherapy using genetically engineered T cells has an impressive track record. Notable examples include the dramatic benefit of chimeric antigen receptor (CAR) gene-modified T cells redirected towards CD19 in patients with B-cell malignancy, and the encouraging results obtained with TCR gene-modified T cells redirected towards NY-ESO-1, a cancer-testis antigen, in patients with advanced melanoma and synovial cell sarcoma. This article overviews the current status of this treatment option, and discusses challenging issues that still restrain the full effectiveness of this strategy, especially in the context of hematological malignancy.

Non-coding cancer driver candidates identified with a sample- and position-specific model of the somatic mutation rate

PubMed Central

Juul, Malene; Bertl, Johanna; Guo, Qianyun; Nielsen, Morten Muhlig; Świtnicki, Michał; Hornshøj, Henrik; Madsen, Tobias; Hobolth, Asger; Pedersen, Jakob Skou

2017-01-01

Non-coding mutations may drive cancer development. Statistical detection of non-coding driver regions is challenged by a varying mutation rate and uncertainty of functional impact. Here, we develop a statistically founded non-coding driver-detection method, ncdDetect, which includes sample-specific mutational signatures, long-range mutation rate variation, and position-specific impact measures. Using ncdDetect, we screened non-coding regulatory regions of protein-coding genes across a pan-cancer set of whole-genomes (n = 505), which top-ranked known drivers and identified new candidates. For individual candidates, presence of non-coding mutations associates with altered expression or decreased patient survival across an independent pan-cancer sample set (n = 5454). This includes an antigen-presenting gene (CD1A), where 5’UTR mutations correlate significantly with decreased survival in melanoma. Additionally, mutations in a base-excision-repair gene (SMUG1) correlate with a C-to-T mutational-signature. Overall, we find that a rich model of mutational heterogeneity facilitates non-coding driver identification and integrative analysis points to candidates of potential clinical relevance. DOI: http://dx.doi.org/10.7554/eLife.21778.001 PMID:28362259

Germline Mutations and Polymorphisms in the Origins of Cancers in Women

PubMed Central

Hirshfield, Kim M.; Rebbeck, Timothy R.; Levine, Arnold J.

2010-01-01

Several female malignancies including breast, ovarian, and endometrial cancers can be characterized based on known somatic and germline mutations. Initiation and propagation of tumors reflect underlying genomic alterations such as mutations, polymorphisms, and copy number variations found in genes of multiple cellular pathways. The contributions of any single genetic variation or mutation in a population depend on its frequency and penetrance as well as tissue-specific functionality. Genome wide association studies, fluorescence in situ hybridization, comparative genomic hybridization, and candidate gene studies have enumerated genetic contributors to cancers in women. These include p53, BRCA1, BRCA2, STK11, PTEN, CHEK2, ATM, BRIP1, PALB2, FGFR2, TGFB1, MDM2, MDM4 as well as several other chromosomal loci. Based on the heterogeneity within a specific tumor type, a combination of genomic alterations defines the cancer subtype, biologic behavior, and in some cases, response to therapeutics. Consideration of tumor heterogeneity is therefore important in the critical analysis of gene associations in cancer. PMID:20111735

Global Transcriptome Analysis of Primary Cerebrocortical Cells: Identification of Genes Regulated by Triiodothyronine in Specific Cell Types.

PubMed

Gil-Ibañez, Pilar; García-García, Francisco; Dopazo, Joaquín; Bernal, Juan; Morte, Beatriz

2017-01-01

Thyroid hormones, thyroxine, and triiodothyronine (T3) are crucial for cerebral cortex development acting through regulation of gene expression. To define the transcriptional program under T3 regulation, we have performed RNA-Seq of T3-treated and untreated primary mouse cerebrocortical cells. The expression of 1145 genes or 7.7% of expressed genes was changed upon T3 addition, of which 371 responded to T3 in the presence of cycloheximide indicating direct transcriptional regulation. The results were compared with available transcriptomic datasets of defined cellular types. In this way, we could identify targets of T3 within genes enriched in astrocytes and neurons, in specific layers including the subplate, and in specific neurons such as prepronociceptin, cholecystokinin, or cortistatin neurons. The subplate and the prepronociceptin neurons appear as potentially major targets of T3 action. T3 upregulates mostly genes related to cell membrane events, such as G-protein signaling, neurotransmission, and ion transport and downregulates genes involved in nuclear events associated with the M phase of cell cycle, such as chromosome organization and segregation. Remarkably, the transcriptomic changes induced by T3 sustain the transition from fetal to adult patterns of gene expression. The results allow defining in molecular terms the elusive role of thyroid hormones on neocortical development. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Behavioral science and the study of gene-nutrition and gene-physical activity interactions in obesity research.

PubMed

Faith, Myles S

2008-12-01

This report summarizes emerging opportunities for behavioral science to help advance the field of gene-environment and gene-behavior interactions, based on presentations at The National Cancer Institute (NCI) Workshop, "Gene-Nutrition and Gene-Physical Activity Interactions in the Etiology of Obesity." Three opportunities are highlighted: (i) designing potent behavioral "challenges" in experiments, (ii) determining viable behavioral phenotypes for genetics studies, and (iii) identifying specific measures of the environment or environmental exposures. Additional points are underscored, including the need to incorporate novel findings from neuroimaging studies regarding motivation and drive for eating and physical activity. Advances in behavioral science theory and methods can play an important role in advancing understanding of gene-brain-behavior relationships in obesity onset.

Disorders of Human Hemoglobin

NASA Astrophysics Data System (ADS)

Bank, Arthur; Mears, J. Gregory; Ramirez, Francesco

1980-02-01

Studies of the human hemoglobin system have provided new insights into the regulation of expression of a group of linked human genes, the γ -δ -β globin gene complex in man. In particular, the thalassemia syndromes and related disorders of man are inherited anemias that provide mutations for the study of the regulation of globin gene expression. New methods, including restriction enzyme analysis and cloning of cellular DNA, have made it feasible to define more precisely the structure and organization of the globin genes in cellular DNA. Deletions of specific globin gene fragments have already been found in certain of these disorders and have been applied in prenatal diagnosis.

Genome engineering in human cells.

PubMed

Song, Minjung; Kim, Young-Hoon; Kim, Jin-Soo; Kim, Hyongbum

2014-01-01

Genome editing in human cells is of great value in research, medicine, and biotechnology. Programmable nucleases including zinc-finger nucleases, transcription activator-like effector nucleases, and RNA-guided engineered nucleases recognize a specific target sequence and make a double-strand break at that site, which can result in gene disruption, gene insertion, gene correction, or chromosomal rearrangements. The target sequence complexities of these programmable nucleases are higher than 3.2 mega base pairs, the size of the haploid human genome. Here, we briefly introduce the structure of the human genome and the characteristics of each programmable nuclease, and review their applications in human cells including pluripotent stem cells. In addition, we discuss various delivery methods for nucleases, programmable nickases, and enrichment of gene-edited human cells, all of which facilitate efficient and precise genome editing in human cells.

Gene-for-gene disease resistance: bridging insect pest and pathogen defense.

PubMed

Kaloshian, Isgouhi

2004-12-01

Active plant defense, also known as gene-for-gene resistance, is triggered when a plant resistance (R) gene recognizes the intrusion of a specific insect pest or pathogen. Activation of plant defense includes an array of physiological and transcriptional reprogramming. During the past decade, a large number of plant R genes that confer resistance to diverse group of pathogens have been cloned from a number of plant species. Based on predicted protein structures, these genes are classified into a small number of groups, indicating that structurally related R genes recognize phylogenetically distinct pathogens. An extreme example is the tomato Mi-1 gene, which confers resistance to potato aphid (Macrosiphum euphorbiae), whitefly (Bemisia tabaci), and root-knot nematodes (Meloidogyne spp.). While Mi-1 remains the only cloned insect R gene, there is evidence that gene-for-gene type of plant defense against piercing-sucking insects exists in a number of plant species.

Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data.

PubMed

Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S

2016-01-01

Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers.

Gene therapy in liver diseases: state-of-the-art and future perspectives.

PubMed

Domvri, Kalliopi; Zarogoulidis, Paul; Porpodis, Konstantinos; Koffa, Maria; Lambropoulou, Maria; Kakolyris, Stylianos; Kolios, George; Zarogoulidis, Konstantinos; Chatzaki, Ekaterini

2012-12-01

Gene therapy is a fundamentally novel therapeutic approach that involves introducing genetic material into target cells in order to fight or prevent disease. A number of different strategies of gene therapy are tested at experimental and clinical levels, including: a) replacing a mutated gene that causes disease with a healthy copy of the gene, b) inactivating a mutated gene that its improper function causes pathogenesis, c) introducing a new gene coding a therapeutic compound to fight a disease, d) introducing to the target organ an enzyme converting an inactive pro-drug to its cytotoxic metabolite. In gene therapy, the transcriptional machinery of the patient is used to produce the active factor that exerts the intended therapeutic effect, ideally in a permanent, tissue-specific and manageable way. The liver is a major target for gene therapy, presenting inherited metabolic defects of single-gene etiology, but also severe multifactorial pathologies with limited therapeutic options such as hepatocellular carcinoma. The initial promising results from gene therapy strategies in liver diseases were followed by skepticism on the actual clinical value due to specificity, efficacy, toxicity and immune limitations, but are recently re-evaluated due to progress in vector technology and monitoring techniques. The significant amount of experimental data along with the available information from clinical trials are systematically reviewed here and presented per pathological entity. Finally, future perspectives of gene therapy protocols in hepatology are summarized.

Morphometric Analysis of Recognized Genes for Autism Spectrum Disorders and Obesity in Relationship to the Distribution of Protein-Coding Genes on Human Chromosomes.

PubMed

McGuire, Austen B; Rafi, Syed K; Manzardo, Ann M; Butler, Merlin G

2016-05-05

Mammalian chromosomes are comprised of complex chromatin architecture with the specific assembly and configuration of each chromosome influencing gene expression and function in yet undefined ways by varying degrees of heterochromatinization that result in Giemsa (G) negative euchromatic (light) bands and G-positive heterochromatic (dark) bands. We carried out morphometric measurements of high-resolution chromosome ideograms for the first time to characterize the total euchromatic and heterochromatic chromosome band length, distribution and localization of 20,145 known protein-coding genes, 790 recognized autism spectrum disorder (ASD) genes and 365 obesity genes. The individual lengths of G-negative euchromatin and G-positive heterochromatin chromosome bands were measured in millimeters and recorded from scaled and stacked digital images of 850-band high-resolution ideograms supplied by the International Society of Chromosome Nomenclature (ISCN) 2013. Our overall measurements followed established banding patterns based on chromosome size. G-negative euchromatic band regions contained 60% of protein-coding genes while the remaining 40% were distributed across the four heterochromatic dark band sub-types. ASD genes were disproportionately overrepresented in the darker heterochromatic sub-bands, while the obesity gene distribution pattern did not significantly differ from protein-coding genes. Our study supports recent trends implicating genes located in heterochromatin regions playing a role in biological processes including neurodevelopment and function, specifically genes associated with ASD.

Biosensors engineered from conditionally stable ligand-binding domains

DOEpatents

Church, George M.; Feng, Justin; Mandell, Daniel J.; Baker, David; Fields, Stanley; Jester, Benjamin Ward; Tinberg, Christine Elaine

2017-09-19

Disclosed is a biosensor engineered to conditionally respond to the presence of specific small molecules, the biosensors including conditionally stable ligand-binding domains (LBDs) which respond to the presence of specific small molecules, wherein readout of binding is provided by reporter genes or transcription factors (TFs) fused to the LBDs.

Genetic variation: effect on prostate cancer

PubMed Central

Sissung, Tristan M.; Price, Douglas K.; Del Re, Marzia; Ley, Ariel M.; Giovannetti, Elisa; Danesi, Romano

2014-01-01

Summary The crucial role of androgens in the development of prostate cancer is well established. The aim of this review is to examine the role of constitutional (germline) and tumor-specific (somatic) polymorphisms within important regulatory genes of prostate cancer. These include genes encoding enzymes of the androgen biosynthetic pathway, the androgen receptor gene, genes that encode proteins of the signal transduction pathways that may have a role in disease progression and survival, and genes involved in prostate cancer angiogenesis. Characterization of deregulated pathways critical to cancer cell growth have lead to the development of new treatments, including the CYP17 inhibitor abiraterone and clinical trials using novel drugs that are ongoing or recently completed [1]. The pharmacogenetics of the drugs used to treat prostate cancer will also be addressed. This review will define how germline polymorphisms are known affect a multitude of pathways, and therefore phenotypes, in prostate cancer etiology, progression, and treatment. PMID:25199985

Asynchronous Replication and Autosome-Pair Non-Equivalence in Human Embryonic Stem Cells

PubMed Central

Dutta, Devkanya; Ensminger, Alexander W.; Zucker, Jacob P.; Chess, Andrew

2009-01-01

A number of mammalian genes exhibit the unusual properties of random monoallelic expression and random asynchronous replication. Such exceptional genes include genes subject to X inactivation and autosomal genes including odorant receptors, immunoglobulins, interleukins, pheromone receptors, and p120 catenin. In differentiated cells, random asynchronous replication of interspersed autosomal genes is coordinated at the whole chromosome level, indicative of chromosome-pair non-equivalence. Here we have investigated the replication pattern of the random asynchronously replicating genes in undifferentiated human embryonic stem cells, using fluorescence in situ hybridization based assay. We show that allele-specific replication of X-linked genes and random monoallelic autosomal genes occur in human embryonic stem cells. The direction of replication is coordinated at the whole chromosome level and can cross the centromere, indicating the existence of autosome-pair non-equivalence in human embryonic stem cells. These results suggest that epigenetic mechanism(s) that randomly distinguish between two parental alleles are emerging in the cells of the inner cell mass, the source of human embryonic stem cells. PMID:19325893

Nuclear Glycolytic Enzyme Enolase of Toxoplasma gondii Functions as a Transcriptional Regulator

PubMed Central

Mouveaux, Thomas; Oria, Gabrielle; Werkmeister, Elisabeth; Slomianny, Christian; Fox, Barbara A.; Bzik, David J.; Tomavo, Stanislas

2014-01-01

Apicomplexan parasites including Toxoplasma gondii have complex life cycles within different hosts and their infectivity relies on their capacity to regulate gene expression. However, little is known about the nuclear factors that regulate gene expression in these pathogens. Here, we report that T. gondii enolase TgENO2 is targeted to the nucleus of actively replicating parasites, where it specifically binds to nuclear chromatin in vivo. Using a ChIP-Seq technique, we provide evidence for TgENO2 enrichment at the 5′ untranslated gene regions containing the putative promoters of 241 nuclear genes. Ectopic expression of HA-tagged TgENO1 or TgENO2 led to changes in transcript levels of numerous gene targets. Targeted disruption of TgENO1 gene results in a decrease in brain cyst burden of chronically infected mice and in changes in transcript levels of several nuclear genes. Complementation of this knockout mutant with ectopic TgENO1-HA fully restored normal transcript levels. Our findings reveal that enolase functions extend beyond glycolytic activity and include a direct role in coordinating gene regulation in T. gondii. PMID:25153525

A powerful score-based test statistic for detecting gene-gene co-association.

PubMed

Xu, Jing; Yuan, Zhongshang; Ji, Jiadong; Zhang, Xiaoshuai; Li, Hongkai; Wu, Xuesen; Xue, Fuzhong; Liu, Yanxun

2016-01-29

The genetic variants identified by Genome-wide association study (GWAS) can only account for a small proportion of the total heritability for complex disease. The existence of gene-gene joint effects which contains the main effects and their co-association is one of the possible explanations for the "missing heritability" problems. Gene-gene co-association refers to the extent to which the joint effects of two genes differ from the main effects, not only due to the traditional interaction under nearly independent condition but the correlation between genes. Generally, genes tend to work collaboratively within specific pathway or network contributing to the disease and the specific disease-associated locus will often be highly correlated (e.g. single nucleotide polymorphisms (SNPs) in linkage disequilibrium). Therefore, we proposed a novel score-based statistic (SBS) as a gene-based method for detecting gene-gene co-association. Various simulations illustrate that, under different sample sizes, marginal effects of causal SNPs and co-association levels, the proposed SBS has the better performance than other existed methods including single SNP-based and principle component analysis (PCA)-based logistic regression model, the statistics based on canonical correlations (CCU), kernel canonical correlation analysis (KCCU), partial least squares path modeling (PLSPM) and delta-square (δ (2)) statistic. The real data analysis of rheumatoid arthritis (RA) further confirmed its advantages in practice. SBS is a powerful and efficient gene-based method for detecting gene-gene co-association.

Transcriptional regulation of development in heterocyst-forming cyanobacteria.

PubMed

Flores, Enrique; Picossi, Silvia; Valladares, Ana; Herrero, Antonia

2018-04-30

Filamentous, heterocyst-forming cyanobacteria are among the simplest multicellular systems in Nature. In the absence of combined nitrogen, the filaments consist of vegetative cells that fix CO 2 through oxygenic photosynthesis and micro-oxic heterocysts specialized for the fixation of N 2 in a proportion of about 10 to 1. The development of a heterocyst-containing filament involves differentiation of vegetative cells into heterocysts in a process that requires a distinct gene expression program. Two transcription factors are strictly required, NtcA and HetR. The CRP-family protein NtcA directly activates the expression of multiple genes during heterocyst differentiation - in some cases assisted by coactivators including HetR - and in mature heterocysts, whereas HetR is needed to build high NtcA levels in differentiating heterocysts and directly activates some particular genes. A few other regulators of gene expression participate at specific differentiation steps, and a specific transcription factor, CnfR, activates nif gene expression under the micro-oxic conditions of the heterocyst. Copyright © 2018 Elsevier B.V. All rights reserved.

Genomic organization, complete sequence, and chromosomal location of the gene for human eotaxin (SCYA11), an eosinophil-specific CC chemokine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia-Zepeda, E.A.; Sarafi, M.N.; Luster, A.D.

1997-05-01

Eotaxin is a CC chemokine that is a specific chemoattractant for eosinophils and is implicated in the pathogenesis of eosinophilic inflammatory diseases, such as asthma. We describe the genomic organization, complete sequence, including 1354 bp 5{prime} of the RNA initiation site, and chromosomal localization of the human eotaxin gene. Fluorescence in situ hybridization analysis localized eotaxin to human chromosome 17, in the region q21.1-q21.2, and the human gene name SCYA11 was assigned. We also present the 5{prime} flanking sequence of the mouse eotaxin gene and have identified several regulatory elements that are conserved between the murine and the human promoters.more » In particular, the presence of elements such as NF-{Kappa}B, interferon-{gamma} response element, and glucocorticoid response element may explain the observed regulation of the eotaxin gene by cytokines and glucocorticoids. 17 refs., 4 figs., 1 tab.« less

Brothers in Arms

PubMed Central

Bhindi, Ravinay; Fahmy, Roger G.; Lowe, Harry C.; Chesterman, Colin N.; Dass, Crispin R.; Cairns, Murray J.; Saravolac, Edward G.; Sun, Lun-Quan; Khachigian, Levon M.

2007-01-01

The past decade has seen the rapid evolution of small-molecule gene-silencing strategies, driven largely by enhanced understanding of gene function in the pathogenesis of disease. Over this time, many genes have been targeted by specifically engineered agents from different classes of nucleic acid-based drugs in experimental models of disease to probe, dissect, and characterize further the complex processes that underpin molecular signaling. Arising from this, a number of molecules have been examined in the setting of clinical trials, and several have recently made the successful transition from the bench to the clinic, heralding an exciting era of gene-specific treatments. This is particularly important because clear inadequacies in present therapies account for significant morbidity, mortality, and cost. The broad umbrella of gene-silencing therapeutics encompasses a range of agents that include DNA enzymes, short interfering RNA, antisense oligonucleotides, decoys, ribozymes, and aptamers. This review tracks current movements in these technologies, focusing mainly on DNA enzymes and short interfering RNA, because these are poised to play an integral role in antigene therapies in the future. PMID:17717148

Identifying transcription factor functions and targets by phenotypic activation

PubMed Central

Chua, Gordon; Morris, Quaid D.; Sopko, Richelle; Robinson, Mark D.; Ryan, Owen; Chan, Esther T.; Frey, Brendan J.; Andrews, Brenda J.; Boone, Charles; Hughes, Timothy R.

2006-01-01

Mapping transcriptional regulatory networks is difficult because many transcription factors (TFs) are activated only under specific conditions. We describe a generic strategy for identifying genes and pathways induced by individual TFs that does not require knowledge of their normal activation cues. Microarray analysis of 55 yeast TFs that caused a growth phenotype when overexpressed showed that the majority caused increased transcript levels of genes in specific physiological categories, suggesting a mechanism for growth inhibition. Induced genes typically included established targets and genes with consensus promoter motifs, if known, indicating that these data are useful for identifying potential new target genes and binding sites. We identified the sequence 5′-TCACGCAA as a binding sequence for Hms1p, a TF that positively regulates pseudohyphal growth and previously had no known motif. The general strategy outlined here presents a straightforward approach to discovery of TF activities and mapping targets that could be adapted to any organism with transgenic technology. PMID:16880382

Evolution of substrate specificity in a retained enzyme driven by gene loss

DOE PAGES

Juárez-Vázquez, Ana Lilia; Edirisinghe, Janaka N.; Verduzco-Castro, Ernesto A.; ...

2017-03-31

The connection between gene loss and the functional adaptation of retained proteins is still poorly understood. We apply phylogenomics and metabolic modeling to detect bacterial species that are evolving by gene loss, with the finding that Actinomycetaceae genomes from human cavities are undergoing sizable reductions, including loss of L-histidine and L-tryptophan biosynthesis. We observe that the dual-substrate phosphoribosyl isomerase A or priA gene, at which these pathways converge, appears to coevolve with the occurrence oftrpandhisgenes. Characterization of a dozen PriA homologs shows that these enzymes adapt from bifunctionality in the largest genomes, to a monofunctional, yet not necessarily specialized, inefficientmore » form in genomes undergoing reduction. These functional changes are accomplished via mutations, which result from relaxation of purifying selection, in residues structurally mapped after sequence and X-ray structural analyses. Finally, our results show how gene loss can drive the evolution of substrate specificity from retained enzymes.« less

Evolution of substrate specificity in a retained enzyme driven by gene loss

DOE Office of Scientific and Technical Information (OSTI.GOV)

Juárez-Vázquez, Ana Lilia; Edirisinghe, Janaka N.; Verduzco-Castro, Ernesto A.

The connection between gene loss and the functional adaptation of retained proteins is still poorly understood. We apply phylogenomics and metabolic modeling to detect bacterial species that are evolving by gene loss, with the finding that Actinomycetaceae genomes from human cavities are undergoing sizable reductions, including loss of L-histidine and L-tryptophan biosynthesis. We observe that the dual-substrate phosphoribosyl isomerase A or priA gene, at which these pathways converge, appears to coevolve with the occurrence oftrpandhisgenes. Characterization of a dozen PriA homologs shows that these enzymes adapt from bifunctionality in the largest genomes, to a monofunctional, yet not necessarily specialized, inefficientmore » form in genomes undergoing reduction. These functional changes are accomplished via mutations, which result from relaxation of purifying selection, in residues structurally mapped after sequence and X-ray structural analyses. Finally, our results show how gene loss can drive the evolution of substrate specificity from retained enzymes.« less

Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

PubMed

Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2013-05-01

In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain

PubMed Central

Khadake, Jyoti; Heggestad, Arnold D.; Ma, Xiaojie; Johnstone, Karen A.; Resnick, James L.; Yang, Thomas P.

2013-01-01

The Angelman/Prader-Willi syndrome (AS/PWS) domain contains at least 8 imprinted genes regulated by a bipartite imprinting center (IC) associated with the SNRPN gene. One component of the IC, the PWS-IC, governs the paternal epigenotype and expression of paternal genes. The mechanisms by which imprinting and expression of paternal genes within the AS/PWS domain – such as MKRN3 and NDN – are regulated by the PWS-IC are unclear. The syntenic region in the mouse is organized and imprinted similarly to the human domain with the murine PWS-IC defined by a 6 kb interval within the Snrpn locus that includes the promoter. To identify regulatory elements that may mediate PWS-IC function, we mapped the location and allele-specificity of DNase I hypersensitive (DH) sites within the PWS-IC in brain cells, then identified transcription factor binding sites within a subset of these DH sites. Six major paternal-specific DH sites were detected in the Snrpn gene, five of which map within the 6 kb PWS-IC. We postulate these five DH sites represent functional components of the murine PWS-IC. Analysis of transcription factor binding within multiple DH sites detected nuclear respiratory factors (NRF's) and YY1 specifically on the paternal allele. NRF's and YY1 were also detected in the paternal promoter region of the murine Mrkn3 and Ndn genes. These results suggest that NRF's and YY1 may facilitate PWS-IC function and coordinately regulate expression of paternal genes. The presence of NRF's also suggests a link between transcriptional regulation within the AS/PWS domain and regulation of respiration. 3C analyses indicated Mkrn3 lies in close proximity to the PWS-IC on the paternal chromosome, evidence that the PWS-IC functions by allele-specific interaction with its distal target genes. This could occur by allele-specific co-localization of the PWS-IC and its target genes to transcription factories containing NRF's and YY1. PMID:23390487

Disturbed Placental Imprinting in Preeclampsia Leads to Altered Expression of DLX5, a Human-Specific Early Trophoblast Marker

PubMed Central

Zadora, Julianna; Singh, Manvendra; Herse, Florian; Przybyl, Lukasz; Haase, Nadine; Golic, Michaela; Yung, Hong Wa; Huppertz, Berthold; Cartwright, Judith E.; Whitley, Guy; Johnsen, Guro M.; Levi, Giovanni; Isbruch, Annette; Schulz, Herbert; Luft, Friedrich C.; Müller, Dominik N.; Staff, Anne Cathrine

2017-01-01

Background: Preeclampsia is a complex and common human-specific pregnancy syndrome associated with placental pathology. The human specificity provides both intellectual and methodological challenges, lacking a robust model system. Given the role of imprinted genes in human placentation and the vulnerability of imprinted genes to loss of imprinting changes, there has been extensive speculation, but no robust evidence, that imprinted genes are involved in preeclampsia. Our study aims to investigate whether disturbed imprinting contributes to preeclampsia. Methods: We first aimed to confirm that preeclampsia is a disease of the placenta by generating and analyzing genome-wide molecular data on well-characterized patient material. We performed high-throughput transcriptome analyses of multiple placenta samples from healthy controls and patients with preeclampsia. Next, we identified differentially expressed genes in preeclamptic placentas and intersected them with the list of human imprinted genes. We used bioinformatics/statistical analyses to confirm association between imprinting and preeclampsia and to predict biological processes affected in preeclampsia. Validation included epigenetic and cellular assays. In terms of human specificity, we established an in vitro invasion-differentiation trophoblast model. Our comparative phylogenetic analysis involved single-cell transcriptome data of human, macaque, and mouse preimplantation embryogenesis. Results: We found disturbed placental imprinting in preeclampsia and revealed potential candidates, including GATA3 and DLX5, with poorly explored imprinted status and no prior association with preeclampsia. As a result of loss of imprinting, DLX5 was upregulated in 69% of preeclamptic placentas. Levels of DLX5 correlated with classic preeclampsia markers. DLX5 is expressed in human but not in murine trophoblast. The DLX5high phenotype resulted in reduced proliferation, increased metabolism, and endoplasmic reticulum stress-response activation in trophoblasts in vitro. The transcriptional profile of such cells mimics the transcriptome of preeclamptic placentas. Pan-mammalian comparative analysis identified DLX5 as part of the human-specific regulatory network of trophoblast differentiation. Conclusions: Our analysis provides evidence of a true association among disturbed imprinting, gene expression, and preeclampsia. As a result of disturbed imprinting, the upregulated DLX5 affects trophoblast proliferation. Our in vitro model might fill a vital niche in preeclampsia research. Human-specific regulatory circuitry of DLX5 might help explain certain aspects of preeclampsia. PMID:28904069

Disturbed Placental Imprinting in Preeclampsia Leads to Altered Expression of DLX5, a Human-Specific Early Trophoblast Marker.

PubMed

Zadora, Julianna; Singh, Manvendra; Herse, Florian; Przybyl, Lukasz; Haase, Nadine; Golic, Michaela; Yung, Hong Wa; Huppertz, Berthold; Cartwright, Judith E; Whitley, Guy; Johnsen, Guro M; Levi, Giovanni; Isbruch, Annette; Schulz, Herbert; Luft, Friedrich C; Müller, Dominik N; Staff, Anne Cathrine; Hurst, Laurence D; Dechend, Ralf; Izsvák, Zsuzsanna

2017-11-07

Preeclampsia is a complex and common human-specific pregnancy syndrome associated with placental pathology. The human specificity provides both intellectual and methodological challenges, lacking a robust model system. Given the role of imprinted genes in human placentation and the vulnerability of imprinted genes to loss of imprinting changes, there has been extensive speculation, but no robust evidence, that imprinted genes are involved in preeclampsia. Our study aims to investigate whether disturbed imprinting contributes to preeclampsia. We first aimed to confirm that preeclampsia is a disease of the placenta by generating and analyzing genome-wide molecular data on well-characterized patient material. We performed high-throughput transcriptome analyses of multiple placenta samples from healthy controls and patients with preeclampsia. Next, we identified differentially expressed genes in preeclamptic placentas and intersected them with the list of human imprinted genes. We used bioinformatics/statistical analyses to confirm association between imprinting and preeclampsia and to predict biological processes affected in preeclampsia. Validation included epigenetic and cellular assays. In terms of human specificity, we established an in vitro invasion-differentiation trophoblast model. Our comparative phylogenetic analysis involved single-cell transcriptome data of human, macaque, and mouse preimplantation embryogenesis. We found disturbed placental imprinting in preeclampsia and revealed potential candidates, including GATA3 and DLX5 , with poorly explored imprinted status and no prior association with preeclampsia. As a result of loss of imprinting, DLX5 was upregulated in 69% of preeclamptic placentas. Levels of DLX5 correlated with classic preeclampsia markers. DLX5 is expressed in human but not in murine trophoblast. The DLX5 high phenotype resulted in reduced proliferation, increased metabolism, and endoplasmic reticulum stress-response activation in trophoblasts in vitro. The transcriptional profile of such cells mimics the transcriptome of preeclamptic placentas. Pan-mammalian comparative analysis identified DLX5 as part of the human-specific regulatory network of trophoblast differentiation. Our analysis provides evidence of a true association among disturbed imprinting, gene expression, and preeclampsia. As a result of disturbed imprinting, the upregulated DLX5 affects trophoblast proliferation. Our in vitro model might fill a vital niche in preeclampsia research. Human-specific regulatory circuitry of DLX5 might help explain certain aspects of preeclampsia. © 2017 The Authors.

Convergent roles of de novo mutations and common variants in schizophrenia in tissue-specific and spatiotemporal co-expression network.

PubMed

Jia, Peilin; Chen, Xiangning; Fanous, Ayman H; Zhao, Zhongming

2018-05-24

Genetic components susceptible to complex disease such as schizophrenia include a wide spectrum of variants, including common variants (CVs) and de novo mutations (DNMs). Although CVs and DNMs differ by origin, it remains elusive whether and how they interact at the gene, pathway, and network levels that leads to the disease. In this work, we characterized the genes harboring schizophrenia-associated CVs (CVgenes) and the genes harboring DNMs (DNMgenes) using measures from network, tissue-specific expression profile, and spatiotemporal brain expression profile. We developed an algorithm to link the DNMgenes and CVgenes in spatiotemporal brain co-expression networks. DNMgenes tended to have central roles in the human protein-protein interaction (PPI) network, evidenced in their high degree and high betweenness values. DNMgenes and CVgenes connected with each other significantly more often than with other genes in the networks. However, only CVgenes remained significantly connected after adjusting for their degree. In our gene co-expression PPI network, we found DNMgenes and CVgenes connected in a tissue-specific fashion, and such a pattern was similar to that in GTEx brain but not in other GTEx tissues. Importantly, DNMgene-CVgene subnetworks were enriched with pathways of chromatin remodeling, MHC protein complex binding, and neurotransmitter activities. In summary, our results unveiled that both DNMgenes and CVgenes contributed to a core set of biologically important pathways and networks, and their interactions may attribute to the risk for schizophrenia. Our results also suggested a stronger biological effect of DNMgenes than CVgenes in schizophrenia.

Genes misregulated in C. elegans deficient in Dicer, RDE-4, or RDE-1 are enriched for innate immunity genes.

PubMed

Welker, Noah C; Habig, Jeffrey W; Bass, Brenda L

2007-07-01

We describe the first microarray analysis of a whole animal containing a mutation in the Dicer gene. We used adult Caenorhabditis elegans and, to distinguish among different roles of Dicer, we also performed microarray analyses of animals with mutations in rde-4 and rde-1, which are involved in silencing by siRNA, but not miRNA. Surprisingly, we find that the X chromosome is greatly enriched for genes regulated by Dicer. Comparison of all three microarray data sets indicates the majority of Dicer-regulated genes are not dependent on RDE-4 or RDE-1, including the X-linked genes. However, all three data sets are enriched in genes important for innate immunity and, specifically, show increased expression of innate immunity genes.

Genes misregulated in C. elegans deficient in Dicer, RDE-4, or RDE-1 are enriched for innate immunity genes

PubMed Central

Welker, Noah C.; Habig, Jeffrey W.; Bass, Brenda L.

2007-01-01

We describe the first microarray analysis of a whole animal containing a mutation in the Dicer gene. We used adult Caenorhabditis elegans and, to distinguish among different roles of Dicer, we also performed microarray analyses of animals with mutations in rde-4 and rde-1, which are involved in silencing by siRNA, but not miRNA. Surprisingly, we find that the X chromosome is greatly enriched for genes regulated by Dicer. Comparison of all three microarray data sets indicates the majority of Dicer-regulated genes are not dependent on RDE-4 or RDE-1, including the X-linked genes. However, all three data sets are enriched in genes important for innate immunity and, specifically, show increased expression of innate immunity genes. PMID:17526642

[Regulation of heat shock gene expression in response to stress].

PubMed

Garbuz, D G

2017-01-01

Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS protein mRNAs ensure their preferential translation in stress.

Expressing foreign genes in the pistil: a comparison of S-RNase constructs in different Nicotiana backgrounds.

PubMed

Murfett, J; McClure, B A

1998-06-01

Transgenic plant experiments have great potential for extending our understanding of the role of specific genes in controlling pollination. Often, the intent of such experiments is to over-express a gene and test for effects on pollination. We have examined the efficiency of six different S-RNase constructs in Nicotiana species and hybrids. Each construct contained the coding region, intron, and downstream sequences from the Nicotiana alata S(A2)-RNase gene. Among the six expression constructs, two utilized the cauliflower mosaic virus (CaMV) 35S promoter with duplicated enhancer, and four utilized promoters from genes expressed primarily in pistils. The latter included promoters from the tomato Chi2;1 and 9612 genes, a promoter from the N. alata S(A2)-RNase gene, and a promoter from the Brassica SLG-13 gene. Some or all of the constructs were tested in N. tabacum, N. plumbaginifolia, N. plumbaginifolia x SI N. alata S(C10)S(c10) hybrids, N. langsdorffii, and N. langsdorffii x SC N. alata hybrids. Stylar specific RNase activities and S(A2)-RNase transcript levels were determined in transformed plants. Constructs including the tomato Chi2;1 gene promoter or the Brassica SLG-13 promoter provided the highest levels of S(A2)-RNase expression. Transgene expression patterns were tightly regulated, the highest level of expression was observed in post-anthesis styles. Expression levels of the S(A2)-RNase transgenes was dependent on the genetic background of the host. Higher levels of S(A2)-RNase expression were observed in N. plumbaginifolia x SC N. alata hybrids than in N. plumbaginifolia.

Comparative analysis of programmed cell death pathways in filamentous fungi.

PubMed

Fedorova, Natalie D; Badger, Jonathan H; Robson, Geoff D; Wortman, Jennifer R; Nierman, William C

2005-12-08

Fungi can undergo autophagic- or apoptotic-type programmed cell death (PCD) on exposure to antifungal agents, developmental signals, and stress factors. Filamentous fungi can also exhibit a form of cell death called heterokaryon incompatibility (HI) triggered by fusion between two genetically incompatible individuals. With the availability of recently sequenced genomes of Aspergillus fumigatus and several related species, we were able to define putative components of fungi-specific death pathways and the ancestral core apoptotic machinery shared by all fungi and metazoa. Phylogenetic profiling of HI-associated proteins from four Aspergilli and seven other fungal species revealed lineage-specific protein families, orphan genes, and core genes conserved across all fungi and metazoa. The Aspergilli-specific domain architectures include NACHT family NTPases, which may function as key integrators of stress and nutrient availability signals. They are often found fused to putative effector domains such as Pfs, SesB/LipA, and a newly identified domain, HET-s/LopB. Many putative HI inducers and mediators are specific to filamentous fungi and not found in unicellular yeasts. In addition to their role in HI, several of them appear to be involved in regulation of cell cycle, development and sexual differentiation. Finally, the Aspergilli possess many putative downstream components of the mammalian apoptotic machinery including several proteins not found in the model yeast, Saccharomyces cerevisiae. Our analysis identified more than 100 putative PCD associated genes in the Aspergilli, which may help expand the range of currently available treatments for aspergillosis and other invasive fungal diseases. The list includes species-specific protein families as well as conserved core components of the ancestral PCD machinery shared by fungi and metazoa.

The transcriptional activator ZNF143 is essential for normal development in zebrafish

PubMed Central

2012-01-01

Background ZNF143 is a sequence-specific DNA-binding protein that stimulates transcription of both small RNA genes by RNA polymerase II or III, or protein-coding genes by RNA polymerase II, using separable activating domains. We describe phenotypic effects following knockdown of this protein in developing Danio rerio (zebrafish) embryos by injection of morpholino antisense oligonucleotides that target znf143 mRNA. Results The loss of function phenotype is pleiotropic and includes a broad array of abnormalities including defects in heart, blood, ear and midbrain hindbrain boundary. Defects are rescued by coinjection of synthetic mRNA encoding full-length ZNF143 protein, but not by protein lacking the amino-terminal activation domains. Accordingly, expression of several marker genes is affected following knockdown, including GATA-binding protein 1 (gata1), cardiac myosin light chain 2 (cmlc2) and paired box gene 2a (pax2a). The zebrafish pax2a gene proximal promoter contains two binding sites for ZNF143, and reporter gene transcription driven by this promoter in transfected cells is activated by this protein. Conclusions Normal development of zebrafish embryos requires ZNF143. Furthermore, the pax2a gene is probably one example of many protein-coding gene targets of ZNF143 during zebrafish development. PMID:22268977

The transcriptional activator ZNF143 is essential for normal development in zebrafish.

PubMed

Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

2012-01-23

ZNF143 is a sequence-specific DNA-binding protein that stimulates transcription of both small RNA genes by RNA polymerase II or III, or protein-coding genes by RNA polymerase II, using separable activating domains. We describe phenotypic effects following knockdown of this protein in developing Danio rerio (zebrafish) embryos by injection of morpholino antisense oligonucleotides that target znf143 mRNA. The loss of function phenotype is pleiotropic and includes a broad array of abnormalities including defects in heart, blood, ear and midbrain hindbrain boundary. Defects are rescued by coinjection of synthetic mRNA encoding full-length ZNF143 protein, but not by protein lacking the amino-terminal activation domains. Accordingly, expression of several marker genes is affected following knockdown, including GATA-binding protein 1 (gata1), cardiac myosin light chain 2 (cmlc2) and paired box gene 2a (pax2a). The zebrafish pax2a gene proximal promoter contains two binding sites for ZNF143, and reporter gene transcription driven by this promoter in transfected cells is activated by this protein. Normal development of zebrafish embryos requires ZNF143. Furthermore, the pax2a gene is probably one example of many protein-coding gene targets of ZNF143 during zebrafish development.

MIrExpress: A Database for Gene Coexpression Correlation in Immune Cells Based on Mutual Information and Pearson Correlation

PubMed Central

Wang, Luman; Mo, Qiaochu; Wang, Jianxin

2015-01-01

Most current gene coexpression databases support the analysis for linear correlation of gene pairs, but not nonlinear correlation of them, which hinders precisely evaluating the gene-gene coexpression strengths. Here, we report a new database, MIrExpress, which takes advantage of the information theory, as well as the Pearson linear correlation method, to measure the linear correlation, nonlinear correlation, and their hybrid of cell-specific gene coexpressions in immune cells. For a given gene pair or probe set pair input by web users, both mutual information (MI) and Pearson correlation coefficient (r) are calculated, and several corresponding values are reported to reflect their coexpression correlation nature, including MI and r values, their respective rank orderings, their rank comparison, and their hybrid correlation value. Furthermore, for a given gene, the top 10 most relevant genes to it are displayed with the MI, r, or their hybrid perspective, respectively. Currently, the database totally includes 16 human cell groups, involving 20,283 human genes. The expression data and the calculated correlation results from the database are interactively accessible on the web page and can be implemented for other related applications and researches. PMID:26881263

MIrExpress: A Database for Gene Coexpression Correlation in Immune Cells Based on Mutual Information and Pearson Correlation.

PubMed

Wang, Luman; Mo, Qiaochu; Wang, Jianxin

2015-01-01

Most current gene coexpression databases support the analysis for linear correlation of gene pairs, but not nonlinear correlation of them, which hinders precisely evaluating the gene-gene coexpression strengths. Here, we report a new database, MIrExpress, which takes advantage of the information theory, as well as the Pearson linear correlation method, to measure the linear correlation, nonlinear correlation, and their hybrid of cell-specific gene coexpressions in immune cells. For a given gene pair or probe set pair input by web users, both mutual information (MI) and Pearson correlation coefficient (r) are calculated, and several corresponding values are reported to reflect their coexpression correlation nature, including MI and r values, their respective rank orderings, their rank comparison, and their hybrid correlation value. Furthermore, for a given gene, the top 10 most relevant genes to it are displayed with the MI, r, or their hybrid perspective, respectively. Currently, the database totally includes 16 human cell groups, involving 20,283 human genes. The expression data and the calculated correlation results from the database are interactively accessible on the web page and can be implemented for other related applications and researches.

Cancer diagnosis marker extraction for soft tissue sarcomas based on gene expression profiling data by using projective adaptive resonance theory (PART) filtering method

PubMed Central

Takahashi, Hiro; Nemoto, Takeshi; Yoshida, Teruhiko; Honda, Hiroyuki; Hasegawa, Tadashi

2006-01-01

Background Recent advances in genome technologies have provided an excellent opportunity to determine the complete biological characteristics of neoplastic tissues, resulting in improved diagnosis and selection of treatment. To accomplish this objective, it is important to establish a sophisticated algorithm that can deal with large quantities of data such as gene expression profiles obtained by DNA microarray analysis. Results Previously, we developed the projective adaptive resonance theory (PART) filtering method as a gene filtering method. This is one of the clustering methods that can select specific genes for each subtype. In this study, we applied the PART filtering method to analyze microarray data that were obtained from soft tissue sarcoma (STS) patients for the extraction of subtype-specific genes. The performance of the filtering method was evaluated by comparison with other widely used methods, such as signal-to-noise, significance analysis of microarrays, and nearest shrunken centroids. In addition, various combinations of filtering and modeling methods were used to extract essential subtype-specific genes. The combination of the PART filtering method and boosting – the PART-BFCS method – showed the highest accuracy. Seven genes among the 15 genes that are frequently selected by this method – MIF, CYFIP2, HSPCB, TIMP3, LDHA, ABR, and RGS3 – are known prognostic marker genes for other tumors. These genes are candidate marker genes for the diagnosis of STS. Correlation analysis was performed to extract marker genes that were not selected by PART-BFCS. Sixteen genes among those extracted are also known prognostic marker genes for other tumors, and they could be candidate marker genes for the diagnosis of STS. Conclusion The procedure that consisted of two steps, such as the PART-BFCS and the correlation analysis, was proposed. The results suggest that novel diagnostic and therapeutic targets for STS can be extracted by a procedure that includes the PART filtering method. PMID:16948864

Signaling through protein kinases and transcriptional regulators in Candida albicans.

PubMed

Dhillon, Navneet K; Sharma, Sadhna; Khuller, G K

2003-01-01

The human fungal pathogen Candida albicans switches from a budding yeast form to a polarized hyphal form in response to various external signals. This morphogenetic switching has been implicated in the development of pathogenicity. Several signaling pathways that regulate morphogenesis have been identified, including various transcription factors that either activate or repress hypha-specific genes. Two well-characterized pathways include the MAP kinase cascade and cAMP-dependent protein kinase pathway that regulate the transcription factors Cph1p and Efg1p, respectively. cAMP also appears to interplay with other second messengers: Ca2+, inositol tri-phosphates in regulating yeast-hyphal transition. Other, less-characterized pathways include two component histidine kinases, cyclin-dependent kinase pathway, and condition specific pathways such as pH and embedded growth conditions. Nrg1 and Rfg1 function as transcriptional repressors of hyphal genes via recruitment of Tup1 co-repressor complex. Different upstream signals converge into a common downstream output during hyphal switch. The levels of expression of several genes have been shown to be associated with hyphal morphogenesis rather than with a specific hypha-inducing condition. Hyphal development is also linked to the expression of a range of other virulence factors. This review explains the relative contribution of multiple pathways that could be used by Candida albican cells to sense subtle differences in the growth conditions of its native host environment.

Pediatric Crohn disease patients exhibit specific ileal transcriptome and microbiome signature.

PubMed

Haberman, Yael; Tickle, Timothy L; Dexheimer, Phillip J; Kim, Mi-Ok; Tang, Dora; Karns, Rebekah; Baldassano, Robert N; Noe, Joshua D; Rosh, Joel; Markowitz, James; Heyman, Melvin B; Griffiths, Anne M; Crandall, Wallace V; Mack, David R; Baker, Susan S; Huttenhower, Curtis; Keljo, David J; Hyams, Jeffrey S; Kugathasan, Subra; Walters, Thomas D; Aronow, Bruce; Xavier, Ramnik J; Gevers, Dirk; Denson, Lee A

2014-08-01

Interactions between the host and gut microbial community likely contribute to Crohn disease (CD) pathogenesis; however, direct evidence for these interactions at the onset of disease is lacking. Here, we characterized the global pattern of ileal gene expression and the ileal microbial community in 359 treatment-naive pediatric patients with CD, patients with ulcerative colitis (UC), and control individuals. We identified core gene expression profiles and microbial communities in the affected CD ilea that are preserved in the unaffected ilea of patients with colon-only CD but not present in those with UC or control individuals; therefore, this signature is specific to CD and independent of clinical inflammation. An abnormal increase of antimicrobial dual oxidase (DUOX2) expression was detected in association with an expansion of Proteobacteria in both UC and CD, while expression of lipoprotein APOA1 gene was downregulated and associated with CD-specific alterations in Firmicutes. The increased DUOX2 and decreased APOA1 gene expression signature favored oxidative stress and Th1 polarization and was maximally altered in patients with more severe mucosal injury. A regression model that included APOA1 gene expression and microbial abundance more accurately predicted month 6 steroid-free remission than a model using clinical factors alone. These CD-specific host and microbe profiles identify the ileum as the primary inductive site for all forms of CD and may direct prognostic and therapeutic approaches.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

Complexities of gene expression patterns in natural populations of an extremophile fish (Poecilia mexicana, Poeciliidae)

PubMed Central

Passow, Courtney N.; Brown, Anthony P.; Arias-Rodriguez, Lenin; Yee, Muh-Ching; Sockell, Alexandra; Schartl, Manfred; Warren, Wesley C.; Bustamante, Carlos; Kelley, Joanna L.; Tobler, Michael

2017-01-01

Variation in gene expression can provide insights into organismal responses to environmental stress and physiological mechanisms mediating adaptation to habitats with contrasting environmental conditions. We performed an RNA-sequencing experiment to quantify gene expression patterns in fish adapted to habitats with different combinations of environmental stressors, including the presence of toxic hydrogen sulphide (H2S) and the absence of light in caves. We specifically asked how gene expression varies among populations living in different habitats, whether population differences were consistent among organs, and whether there is evidence for shared expression responses in populations exposed to the same stressors. We analysed organ-specific transcriptome-wide data from four ecotypes of Poecilia mexicana (nonsulphidic surface, sulphidic surface, nonsulphidic cave and sulphidic cave). The majority of variation in gene expression was correlated with organ type, and the presence of specific environmental stressors elicited unique expression differences among organs. Shared patterns of gene expression between populations exposed to the same environmental stressors increased with levels of organismal organization (from transcript to gene to physiological pathway). In addition, shared patterns of gene expression were more common between populations from sulphidic than populations from cave habitats, potentially indicating that physiochemical stressors with clear biochemical consequences can constrain the diversity of adaptive solutions that mitigate their adverse effects. Overall, our analyses provided insights into transcriptional variation in a unique system, in which adaptation to H2S and darkness coincide. Functional annotations of differentially expressed genes provide a springboard for investigating physiological mechanisms putatively underlying adaptation to extreme environments. PMID:28598519

Beyond the genome: The ethics of DNA testing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fackelmann, K.A.

1994-11-05

This article looks at the implications of identification of specific genes in the human genome. Ethical questions concerning inherited conditions include privacy, paternity, judgement, society versus individual.

An atypical 7q11.23 deletion in a normal IQ Williams–Beuren syndrome patient

PubMed Central

Ferrero, Giovanni Battista; Howald, Cédric; Micale, Lucia; Biamino, Elisa; Augello, Bartolomeo; Fusco, Carmela; Turturo, Maria Giuseppina; Forzano, Serena; Reymond, Alexandre; Merla, Giuseppe

2010-01-01

Williams–Beuren syndrome (WBS; OMIM no. 194050) is a multisystemic neurodevelopmental disorder caused by a hemizygous deletion of 1.55 Mb on chromosome 7q11.23 spanning 28 genes. Haploinsufficiency of the ELN gene was shown to be responsible for supravalvular aortic stenosis and generalized arteriopathy, whereas LIMK1, CLIP2, GTF2IRD1 and GTF2I genes were suggested to be linked to the specific cognitive profile and craniofacial features. These insights for genotype–phenotype correlations came from the molecular and clinical analysis of patients with atypical deletions and mice models. Here we report a patient showing mild WBS physical phenotype and normal IQ, who carries a shorter 1 Mb atypical deletion. This rearrangement does not include the GTF2IRD1 and GTF2I genes and only partially the BAZ1B gene. Our results are consistent with the hypothesis that hemizygosity of the GTF2IRD1 and GTF2I genes might be involved in the facial dysmorphisms and in the specific motor and cognitive deficits observed in WBS patients. PMID:19568270

Towards in vivo amplification: Overcoming hurdles in the use of hematopoietic stem cells in transplantation and gene therapy

PubMed Central

Nagree, Murtaza S; López-Vásquez, Lucía; Medin, Jeffrey A

2015-01-01

With the advent of safer and more efficient gene transfer methods, gene therapy has become a viable solution for many inherited and acquired disorders. Hematopoietic stem cells (HSCs) are a prime cell compartment for gene therapy aimed at correcting blood-based disorders, as well as those amenable to metabolic outcomes that can effect cross-correction. While some resounding clinical successes have recently been demonstrated, ample room remains to increase the therapeutic output from HSC-directed gene therapy. In vivo amplification of therapeutic cells is one avenue to achieve enhanced gene product delivery. To date, attempts have been made to provide HSCs with resistance to cytotoxic drugs, to include drug-inducible growth modules specific to HSCs, and to increase the engraftment potential of transduced HSCs. This review aims to summarize amplification strategies that have been developed and tested and to discuss their advantages along with barriers faced towards their clinical adaptation. In addition, next-generation strategies to circumvent current limitations of specific amplification schemas are discussed. PMID:26730268

PEDF Is Associated with the Termination of Chondrocyte Phenotype and Catabolism of Cartilage Tissue.

PubMed

Klinger, P; Lukassen, S; Ferrazzi, F; Ekici, A B; Hotfiel, T; Swoboda, B; Aigner, T; Gelse, K

2017-01-01

Objective. To investigate the expression and target genes of pigment epithelium-derived factor (PEDF) in cartilage and chondrocytes, respectively. Methods. We analyzed the expression pattern of PEDF in different human cartilaginous tissues including articular cartilage, osteophytic cartilage, and fetal epiphyseal and growth plate cartilage, by immunohistochemistry and quantitative real-time (qRT) PCR. Transcriptome analysis after stimulation of human articular chondrocytes with rhPEDF was performed by RNA sequencing (RNA-Seq) and confirmed by qRT-PCR. Results. Immunohistochemically, PEDF could be detected in transient cartilaginous tissue that is prone to undergo endochondral ossification, including epiphyseal cartilage, growth plate cartilage, and osteophytic cartilage. In contrast, PEDF was hardly detected in healthy articular cartilage and in the superficial zone of epiphyses, regions that are characterized by a permanent stable chondrocyte phenotype. RNA-Seq analysis and qRT-PCR demonstrated that rhPEDF significantly induced the expression of a number of matrix-degrading factors including SAA1, MMP1, MMP3, and MMP13. Simultaneously, a number of cartilage-specific genes including COL2A1, COL9A2, COMP, and LECT were among the most significantly downregulated genes. Conclusions. PEDF represents a marker for transient cartilage during all neonatal and postnatal developmental stages and promotes the termination of cartilage tissue by upregulation of matrix-degrading factors and downregulation of cartilage-specific genes. These data provide the basis for novel strategies to stabilize the phenotype of articular cartilage and prevent its degradation.

Developmental expression of "germline"- and "sex determination"-related genes in the ctenophore Mnemiopsis leidyi.

PubMed

Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q

2016-01-01

An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also report on splice variants for two Mnemiopsis Dmrt genes that impact the presence and composition of the DM DNA binding domain for these transcription factors. Our results are consistent with a potential role for vasa, piwi and nanos genes in the specification or maintenance of somatic stem cell populations during development in Mnemiopsis. These results are similar to previous results in the tentaculate ctenophore Pleurobrachia, with the exception that these genes were also expressed in gonads and developing gametes of adult Pleurobrachia. These differences suggest that the Mnemiopsis germline is either specified later in development than hypothesized, the germline undergoes extensive migration, or the germline does not express these classic molecular markers. Our results highlight the utility of comparing expression of orthologous genes across multiple species. We provide the first description of Dmrt expression in a ctenophore, which indicates that Dmrt genes are expressed in distinct structures and regions during development but not in future gametogenic regions, the only sex-specific structure for this hermaphroditic species.

Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

PubMed

Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

2016-04-15

The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

Androgen receptor repeat length polymorphism associated with male-to-female transsexualism.

PubMed

Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J; Baird, Paul N; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R

2009-01-01

There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor beta (ERbeta), and aromatase (CYP19) genes. Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERbeta gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p=.04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERbeta genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. This study provides evidence that male gender identity might be partly mediated through the androgen receptor.

Androgen Receptor Repeat Length Polymorphism Associated with Male-to-Female Transsexualism

PubMed Central

Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J.; Baird, Paul N.; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R.

2012-01-01

Background There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor β (ERβ), and aromatase (CYP19) genes. Methods Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERβ gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. Results A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p = .04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERβ genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. Conclusions This study provides evidence that male gender identity might be partly mediated through the androgen receptor. PMID:18962445

Using Signature Genes as Tools To Assess Environmental Viral Ecology and Diversity

PubMed Central

Adriaenssens, Evelien M.

2014-01-01

Viruses (including bacteriophages) are the most abundant biological entities on the planet. As such, they are thought to have a major impact on all aspects of microbial community structure and function. Despite this critical role in ecosystem processes, the study of virus/phage diversity has lagged far behind parallel studies of the bacterial and eukaryotic kingdoms, largely due to the absence of any universal phylogenetic marker. Here we review the development and use of signature genes to investigate viral diversity, as a viable strategy for data sets of specific virus groups. Genes that have been used include those encoding structural proteins, such as portal protein, major capsid protein, and tail sheath protein, auxiliary metabolism genes, such as psbA, psbB, and phoH, and several polymerase genes. These marker genes have been used in combination with PCR-based fingerprinting and/or sequencing strategies to investigate spatial, temporal, and seasonal variations and diversity in a wide range of habitats. PMID:24837394

Genomic Signature of Kin Selection in an Ant with Obligately Sterile Workers

PubMed Central

Warner, Michael R.; Mikheyev, Alexander S.

2017-01-01

Abstract Kin selection is thought to drive the evolution of cooperation and conflict, but the specific genes and genome-wide patterns shaped by kin selection are unknown. We identified thousands of genes associated with the sterile ant worker caste, the archetype of an altruistic phenotype shaped by kin selection, and then used population and comparative genomic approaches to study patterns of molecular evolution at these genes. Consistent with population genetic theoretical predictions, worker-upregulated genes experienced reduced selection compared with genes upregulated in reproductive castes. Worker-upregulated genes included more taxonomically restricted genes, indicating that the worker caste has recruited more novel genes, yet these genes also experienced reduced selection. Our study identifies a putative genomic signature of kin selection and helps to integrate emerging sociogenomic data with longstanding social evolution theory. PMID:28419349

Photobiological hydrogen production with switchable photosystem-II designer algae

DOEpatents

Lee, James Weifu

2014-02-18

A process for enhanced photobiological H.sub.2 production using transgenic alga. The process includes inducing exogenous genes in a transgenic alga by manipulating selected environmental factors. In one embodiment inducing production of an exogenous gene uncouples H.sub.2 production from existing mechanisms that would downregulate H.sub.2 production in the absence of the exogenous gene. In other embodiments inducing an exogenous gene triggers a cascade of metabolic changes that increase H.sub.2 production. In some embodiments the transgenic alga are rendered non-regenerative by inducing exogenous transgenes for proton channel polypeptides that are targeted to specific algal membranes.

Neurotactin functions in concert with other identified CAMs in growth cone guidance in Drosophila.

PubMed

Speicher, S; García-Alonso, L; Carmena, A; Martín-Bermudo, M D; de la Escalera, S; Jiménez, F

1998-02-01

We have isolated and characterized mutations in Drosophila neurotactin, a gene that encodes a cell adhesion protein widely expressed during neural development. Analysis of both loss and gain of gene function conditions during embryonic and postembryonic development revealed specific requirements for neurotactin during axon outgrowth, fasciculation, and guidance. Furthermore, embryos of some double mutant combinations of neurotactin and other genes encoding adhesion/signaling molecules, including neuroglian, derailed, and kekkon1, displayed phenotypic synergy. This result provides evidence for functional cooperativity in vivo between the adhesion and signaling pathways controlled by neurotactin and the other three genes.

Cross-Species Transcriptome Profiling Identifies New Alveolar Epithelial Type I Cell–Specific Genes

PubMed Central

Sunohara, Mitsuhiro; Pouldar, Tiffany M.; Wang, Hongjun; Liu, Yixin; Rieger, Megan E.; Tran, Evelyn; Flodby, Per; Siegmund, Kimberly D.; Crandall, Edward D.; Laird-Offringa, Ite A.

2017-01-01

Diseases involving the distal lung alveolar epithelium include chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis, and lung adenocarcinoma. Accurate labeling of specific cell types is critical for determining the contribution of each to the pathogenesis of these diseases. The distal lung alveolar epithelium is composed of two cell types, alveolar epithelial type 1 (AT1) and type 2 (AT2) cells. Although cell type–specific markers, most prominently surfactant protein C, have allowed detailed lineage tracing studies of AT2 cell differentiation and the cells’ roles in disease, studies of AT1 cells have been hampered by a lack of genes with expression unique to AT1 cells. In this study, we performed genome-wide expression profiling of multiple rat organs together with purified rat AT2, AT1, and in vitro differentiated AT1-like cells, resulting in the identification of 54 candidate AT1 cell markers. Cross-referencing with genes up-regulated in human in vitro differentiated AT1-like cells narrowed the potential list to 18 candidate genes. Testing the top four candidate genes at RNA and protein levels revealed GRAM domain 2 (GRAMD2), a protein of unknown function, as highly specific to AT1 cells. RNA sequencing (RNAseq) confirmed that GRAMD2 is transcriptionally silent in human AT2 cells. Immunofluorescence verified that GRAMD2 expression is restricted to the plasma membrane of AT1 cells and is not expressed in bronchial epithelial cells, whereas reverse transcription–polymerase chain reaction confirmed that it is not expressed in endothelial cells. Using GRAMD2 as a new AT1 cell–specific gene will enhance AT1 cell isolation, the investigation of alveolar epithelial cell differentiation potential, and the contribution of AT1 cells to distal lung diseases. PMID:27749084

Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

PubMed

Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

1994-12-20

The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

New Genes and Functional Innovation in Mammals.

PubMed

Luis Villanueva-Cañas, José; Ruiz-Orera, Jorge; Agea, M Isabel; Gallo, Maria; Andreu, David; Albà, M Mar

2017-07-01

The birth of genes that encode new protein sequences is a major source of evolutionary innovation. However, we still understand relatively little about how these genes come into being and which functions they are selected for. To address these questions, we have obtained a large collection of mammalian-specific gene families that lack homologues in other eukaryotic groups. We have combined gene annotations and de novo transcript assemblies from 30 different mammalian species, obtaining ∼6,000 gene families. In general, the proteins in mammalian-specific gene families tend to be short and depleted in aromatic and negatively charged residues. Proteins which arose early in mammalian evolution include milk and skin polypeptides, immune response components, and proteins involved in reproduction. In contrast, the functions of proteins which have a more recent origin remain largely unknown, despite the fact that these proteins also have extensive proteomics support. We identify several previously described cases of genes originated de novo from noncoding genomic regions, supporting the idea that this mechanism frequently underlies the evolution of new protein-coding genes in mammals. Finally, we show that most young mammalian genes are preferentially expressed in testis, suggesting that sexual selection plays an important role in the emergence of new functional genes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Candidate genes for idiopathic epilepsy in four dog breeds.

PubMed

Ekenstedt, Kari J; Patterson, Edward E; Minor, Katie M; Mickelson, James R

2011-04-25

Idiopathic epilepsy (IE) is a naturally occurring and significant seizure disorder affecting all dog breeds. Because dog breeds are genetically isolated populations, it is possible that IE is attributable to common founders and is genetically homogenous within breeds. In humans, a number of mutations, the majority of which are genes encoding ion channels, neurotransmitters, or their regulatory subunits, have been discovered to cause rare, specific types of IE. It was hypothesized that there are simple genetic bases for IE in some purebred dog breeds, specifically in Vizslas, English Springer Spaniels (ESS), Greater Swiss Mountain Dogs (GSMD), and Beagles, and that the gene(s) responsible may, in some cases, be the same as those already discovered in humans. Candidate genes known to be involved in human epilepsy, along with selected additional genes in the same gene families that are involved in murine epilepsy or are expressed in neural tissue, were examined in populations of affected and unaffected dogs. Microsatellite markers in close proximity to each candidate gene were genotyped and subjected to two-point linkage in Vizslas, and association analysis in ESS, GSMD and Beagles. Most of these candidate genes were not significantly associated with IE in these four dog breeds, while a few genes remained inconclusive. Other genes not included in this study may still be causing monogenic IE in these breeds or, like many cases of human IE, the disease in dogs may be likewise polygenic.

The Arabidopsis Mediator Complex Subunits MED16, MED14, and MED2 Regulate Mediator and RNA Polymerase II Recruitment to CBF-Responsive Cold-Regulated Genes[C][W][OPEN

PubMed Central

Hemsley, Piers A.; Hurst, Charlotte H.; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R.; De Cothi, Elizabeth A.; Steele, John F.; Knight, Heather

2014-01-01

The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation–induced freezing tolerance. In addition, these three subunits are required for low temperature–induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770

Genome-Wide Association Identifies SLC2A9 and NLN Gene Regions as Associated with Entropion in Domestic Sheep

PubMed Central

Mousel, Michelle R.; Reynolds, James O.; White, Stephen N.

2015-01-01

Entropion is an inward rolling of the eyelid allowing contact between the eyelashes and cornea that may lead to blindness if not corrected. Although many mammalian species, including humans and dogs, are afflicted by congenital entropion, no specific genes or gene regions related to development of entropion have been reported in any mammalian species to date. Entropion in domestic sheep is known to have a genetic component therefore, we used domestic sheep as a model system to identify genomic regions containing genes associated with entropion. A genome-wide association was conducted with congenital entropion in 998 Columbia, Polypay, and Rambouillet sheep genotyped with 50,000 SNP markers. Prevalence of entropion was 6.01%, with all breeds represented. Logistic regression was performed in PLINK with additive allelic, recessive, dominant, and genotypic inheritance models. Two genome-wide significant (empirical P<0.05) SNP were identified, specifically markers in SLC2A9 (empirical P = 0.007; genotypic model) and near NLN (empirical P = 0.026; dominance model). Six additional genome-wide suggestive SNP (nominal P<1x10-5) were identified including markers in or near PIK3CB (P = 2.22x10-6; additive model), KCNB1 (P = 2.93x10-6; dominance model), ZC3H12C (P = 3.25x10-6; genotypic model), JPH1 (P = 4.68x20-6; genotypic model), and MYO3B (P = 5.74x10-6; recessive model). This is the first report of specific gene regions associated with congenital entropion in any mammalian species, to our knowledge. Further, none of these genes have previously been associated with any eyelid traits. These results represent the first genome-wide analysis of gene regions associated with entropion and provide target regions for the development of sheep genetic markers for marker-assisted selection. PMID:26098909

Genome-Wide Association Identifies SLC2A9 and NLN Gene Regions as Associated with Entropion in Domestic Sheep.

PubMed

Mousel, Michelle R; Reynolds, James O; White, Stephen N

2015-01-01

Entropion is an inward rolling of the eyelid allowing contact between the eyelashes and cornea that may lead to blindness if not corrected. Although many mammalian species, including humans and dogs, are afflicted by congenital entropion, no specific genes or gene regions related to development of entropion have been reported in any mammalian species to date. Entropion in domestic sheep is known to have a genetic component therefore, we used domestic sheep as a model system to identify genomic regions containing genes associated with entropion. A genome-wide association was conducted with congenital entropion in 998 Columbia, Polypay, and Rambouillet sheep genotyped with 50,000 SNP markers. Prevalence of entropion was 6.01%, with all breeds represented. Logistic regression was performed in PLINK with additive allelic, recessive, dominant, and genotypic inheritance models. Two genome-wide significant (empirical P<0.05) SNP were identified, specifically markers in SLC2A9 (empirical P = 0.007; genotypic model) and near NLN (empirical P = 0.026; dominance model). Six additional genome-wide suggestive SNP (nominal P<1x10(-5)) were identified including markers in or near PIK3CB (P = 2.22x10(-6); additive model), KCNB1 (P = 2.93x10(-6); dominance model), ZC3H12C (P = 3.25x10(-6); genotypic model), JPH1 (P = 4.68x20(-6); genotypic model), and MYO3B (P = 5.74x10(-6); recessive model). This is the first report of specific gene regions associated with congenital entropion in any mammalian species, to our knowledge. Further, none of these genes have previously been associated with any eyelid traits. These results represent the first genome-wide analysis of gene regions associated with entropion and provide target regions for the development of sheep genetic markers for marker-assisted selection.

Seasonal and Regional Differences in Gene Expression in the Brain of a Hibernating Mammal

PubMed Central

Schwartz, Christine; Hampton, Marshall; Andrews, Matthew T.

2013-01-01

Mammalian hibernation presents a unique opportunity to study naturally occurring neuroprotection. Hibernating ground squirrels undergo rapid and extreme physiological changes in body temperature, oxygen consumption, and heart rate without suffering neurological damage from ischemia and reperfusion injury. Different brain regions show markedly different activity during the torpor/arousal cycle: the cerebral cortex shows activity only during the periodic returns to normothermia, while the hypothalamus is active over the entire temperature range. Therefore, region-specific neuroprotective strategies must exist to permit this compartmentalized spectrum of activity. In this study, we use the Illumina HiSeq platform to compare the transcriptomes of these two brain regions at four collection points across the hibernation season: April Active, October Active, Torpor, and IBA. In the cerebral cortex, 1,085 genes were found to be differentially expressed across collection points, while 1,063 genes were differentially expressed in the hypothalamus. Comparison of these transcripts indicates that the cerebral cortex and hypothalamus implement very different strategies during hibernation, showing less than 20% of these differentially expressed genes in common. The cerebral cortex transcriptome shows evidence of remodeling and plasticity during hibernation, including transcripts for the presynaptic cytomatrix proteins bassoon and piccolo, and extracellular matrix components, including laminins and collagens. Conversely, the hypothalamic transcriptome displays upregulation of transcripts involved in damage response signaling and protein turnover during hibernation, including the DNA damage repair gene RAD50 and ubiquitin E3 ligases UBR1 and UBR5. Additionally, the hypothalamus transcriptome also provides evidence of potential mechanisms underlying the hibernation phenotype, including feeding and satiety signaling, seasonal timing mechanisms, and fuel utilization. This study provides insight into potential neuroprotective strategies and hibernation control mechanisms, and also specifically shows that the hibernator brain exhibits both seasonal and regional differences in mRNA expression. PMID:23526982

ROKU: a novel method for identification of tissue-specific genes.

PubMed

Kadota, Koji; Ye, Jiazhen; Nakai, Yuji; Terada, Tohru; Shimizu, Kentaro

2006-06-12

One of the important goals of microarray research is the identification of genes whose expression is considerably higher or lower in some tissues than in others. We would like to have ways of identifying such tissue-specific genes. We describe a method, ROKU, which selects tissue-specific patterns from gene expression data for many tissues and thousands of genes. ROKU ranks genes according to their overall tissue specificity using Shannon entropy and detects tissues specific to each gene if any exist using an outlier detection method. We evaluated the capacity for the detection of various specific expression patterns using synthetic and real data. We observed that ROKU was superior to a conventional entropy-based method in its ability to rank genes according to overall tissue specificity and to detect genes whose expression pattern are specific only to objective tissues. ROKU is useful for the detection of various tissue-specific expression patterns. The framework is also directly applicable to the selection of diagnostic markers for molecular classification of multiple classes.

Microarray-based gene expression profiling in patients with cryopyrin-associated periodic syndromes defines a disease-related signature and IL-1-responsive transcripts.

PubMed

Balow, James E; Ryan, John G; Chae, Jae Jin; Booty, Matthew G; Bulua, Ariel; Stone, Deborah; Sun, Hong-Wei; Greene, James; Barham, Beverly; Goldbach-Mansky, Raphaela; Kastner, Daniel L; Aksentijevich, Ivona

2013-06-01

To analyse gene expression patterns and to define a specific gene expression signature in patients with the severe end of the spectrum of cryopyrin-associated periodic syndromes (CAPS). The molecular consequences of interleukin 1 inhibition were examined by comparing gene expression patterns in 16 CAPS patients before and after treatment with anakinra. We collected peripheral blood mononuclear cells from 22 CAPS patients with active disease and from 14 healthy children. Transcripts that passed stringent filtering criteria (p values≤false discovery rate 1%) were considered as differentially expressed genes (DEG). A set of DEG was validated by quantitative reverse transcription PCR and functional studies with primary cells from CAPS patients and healthy controls. We used 17 CAPS and 66 non-CAPS patient samples to create a set of gene expression models that differentiates CAPS patients from controls and from patients with other autoinflammatory conditions. Many DEG include transcripts related to the regulation of innate and adaptive immune responses, oxidative stress, cell death, cell adhesion and motility. A set of gene expression-based models comprising the CAPS-specific gene expression signature correctly classified all 17 samples from an independent dataset. This classifier also correctly identified 15 of 16 post-anakinra CAPS samples despite the fact that these CAPS patients were in clinical remission. We identified a gene expression signature that clearly distinguished CAPS patients from controls. A number of DEG were in common with other systemic inflammatory diseases such as systemic onset juvenile idiopathic arthritis. The CAPS-specific gene expression classifiers also suggest incomplete suppression of inflammation at low doses of anakinra.

Microarray-based gene expression profiling in patients with cryopyrin-associated periodic syndromes defines a disease-related signature and IL-1-responsive transcripts

PubMed Central

Balow, James E; Ryan, John G; Chae, Jae Jin; Booty, Matthew G; Bulua, Ariel; Stone, Deborah; Sun, Hong-Wei; Greene, James; Barham, Beverly; Goldbach-Mansky, Raphaela; Kastner, Daniel L; Aksentijevich, Ivona

2014-01-01

Objective To analyse gene expression patterns and to define a specific gene expression signature in patients with the severe end of the spectrum of cryopyrin-associated periodic syndromes (CAPS). The molecular consequences of interleukin 1 inhibition were examined by comparing gene expression patterns in 16 CAPS patients before and after treatment with anakinra. Methods We collected peripheral blood mononuclear cells from 22 CAPS patients with active disease and from 14 healthy children. Transcripts that passed stringent filtering criteria (p values ≤ false discovery rate 1%) were considered as differentially expressed genes (DEG). A set of DEG was validated by quantitative reverse transcription PCR and functional studies with primary cells from CAPS patients and healthy controls. We used 17 CAPS and 66 non-CAPS patient samples to create a set of gene expression models that differentiates CAPS patients from controls and from patients with other autoinflammatory conditions. Results Many DEG include transcripts related to the regulation of innate and adaptive immune responses, oxidative stress, cell death, cell adhesion and motility. A set of gene expression-based models comprising the CAPS-specific gene expression signature correctly classified all 17 samples from an independent dataset. This classifier also correctly identified 15 of 16 postanakinra CAPS samples despite the fact that these CAPS patients were in clinical remission. Conclusions We identified a gene expression signature that clearly distinguished CAPS patients from controls. A number of DEG were in common with other systemic inflammatory diseases such as systemic onset juvenile idiopathic arthritis. The CAPS-specific gene expression classifiers also suggest incomplete suppression of inflammation at low doses of anakinra. PMID:23223423

Exploring the Transcriptome of Ciliated Cells Using In Silico Dissection of Human Tissues

PubMed Central

Ivliev, Alexander E.; 't Hoen, Peter A. C.; van Roon-Mom, Willeke M. C.; Peters, Dorien J. M.; Sergeeva, Marina G.

2012-01-01

Cilia are cell organelles that play important roles in cell motility, sensory and developmental functions and are involved in a range of human diseases, known as ciliopathies. Here, we search for novel human genes related to cilia using a strategy that exploits the previously reported tendency of cell type-specific genes to be coexpressed in the transcriptome of complex tissues. Gene coexpression networks were constructed using the noise-resistant WGCNA algorithm in 12 publicly available microarray datasets from human tissues rich in motile cilia: airways, fallopian tubes and brain. A cilia-related coexpression module was detected in 10 out of the 12 datasets. A consensus analysis of this module's gene composition recapitulated 297 known and predicted 74 novel cilia-related genes. 82% of the novel candidates were supported by tissue-specificity expression data from GEO and/or proteomic data from the Human Protein Atlas. The novel findings included a set of genes (DCDC2, DYX1C1, KIAA0319) related to a neurological disease dyslexia suggesting their potential involvement in ciliary functions. Furthermore, we searched for differences in gene composition of the ciliary module between the tissues. A multidrug-and-toxin extrusion transporter MATE2 (SLC47A2) was found as a brain-specific central gene in the ciliary module. We confirm the localization of MATE2 in cilia by immunofluorescence staining using MDCK cells as a model. While MATE2 has previously gained attention as a pharmacologically relevant transporter, its potential relation to cilia is suggested for the first time. Taken together, our large-scale analysis of gene coexpression networks identifies novel genes related to human cell cilia. PMID:22558177

The genome- and transcriptome-wide analysis of innate immunity in the brown planthopper, Nilaparvata lugens

PubMed Central

2013-01-01

Background The brown planthopper (Nilaparvata lugens) is one of the most serious rice plant pests in Asia. N. lugens causes extensive rice damage by sucking rice phloem sap, which results in stunted plant growth and the transmission of plant viruses. Despite the importance of this insect pest, little is known about the immunological mechanisms occurring in this hemimetabolous insect species. Results In this study, we performed a genome- and transcriptome-wide analysis aiming at the immune-related genes. The transcriptome datasets include the N. lugens intestine, the developmental stage, wing formation, and sex-specific expression information that provided useful gene expression sequence data for the genome-wide analysis. As a result, we identified a large number of genes encoding N. lugens pattern recognition proteins, modulation proteins in the prophenoloxidase (proPO) activating cascade, immune effectors, and the signal transduction molecules involved in the immune pathways, including the Toll, Immune deficiency (Imd) and Janus kinase signal transducers and activators of transcription (JAK-STAT) pathways. The genome scale analysis revealed detailed information of the gene structure, distribution and transcription orientations in scaffolds. A comparison of the genome-available hemimetabolous and metabolous insect species indicate the differences in the immune-related gene constitution. We investigated the gene expression profiles with regards to how they responded to bacterial infections and tissue, as well as development and sex expression specificity. Conclusions The genome- and transcriptome-wide analysis of immune-related genes including pattern recognition and modulation molecules, immune effectors, and the signal transduction molecules involved in the immune pathways is an important step in determining the overall architecture and functional network of the immune components in N. lugens. Our findings provide the comprehensive gene sequence resource and expression profiles of the immune-related genes of N. lugens, which could facilitate the understanding of the innate immune mechanisms in the hemimetabolous insect species. These data give insight into clarifying the potential functional roles of the immune-related genes involved in the biological processes of development, reproduction, and virus transmission in N. lugens. PMID:23497397

Homez, a homeobox leucine zipper gene specific to the vertebrate lineage.

PubMed

Bayarsaihan, Dashzeveg; Enkhmandakh, Badam; Makeyev, Aleksandr; Greally, John M; Leckman, James F; Ruddle, Frank H

2003-09-02

This work describes a vertebrate homeobox gene, designated Homez (homeodomain leucine zipper-encoding gene), that encodes a protein with an unusual structural organization. There are several regions within Homez, including three atypical homeodomains, two leucine zipper-like motifs, and an acidic domain. The gene is ubiquitously expressed in human and murine tissues, although the expression pattern is more restricted during mouse development. Genomic analysis revealed that human and mouse genes are located at 14q11.2 and 14C, respectively, and are composed of two exons. The zebrafish and pufferfish homologs share high similarity to mammalian sequences, particularly within the homeodomain sequences. Based on homology of homeodomains and on the similarity in overall protein structure, we delineate Homez and members of ZHX family of zinc finger homeodomain factors as a subset within the superfamily of homeobox-containing proteins. The type and composition of homeodomains in the Homez subfamily are vertebrate-specific. Phylogenetic analysis indicates that Homez lineage was separated from related genes >400 million years ago before separation of ray- and lobe-finned fishes. We apply a duplication-degeneration-complementation model to explain how this family of genes has evolved.

Ewing sarcoma: a chronicle of molecular pathogenesis.

PubMed

Kim, Sang Kyum; Park, Yong-Koo

2016-09-01

Sarcomas have traditionally been classified according to their chromosomal alterations regardless of whether they accompany simple or complex genetic changes. Ewing sarcoma, a classic small round cell bone tumor, is a well-known mesenchymal malignancy that results from simple sarcoma-specific genetic alterations. The genetic alterations are translocations between genes of the TET/FET family (TLS/FUS, EWSR1, and TAF15) and genes of the E26 transformation-specific (ETS) family. In this review, we intend to summarize a chronicle of molecular findings of Ewing sarcoma including recent advances and explain resultant molecular pathogenesis. Copyright © 2016 Elsevier Inc. All rights reserved.

Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera.

PubMed

Mao, Wenfu; Schuler, Mary A; Berenbaum, May R

2013-05-28

As a managed pollinator, the honey bee Apis mellifera is critical to the American agricultural enterprise. Recent colony losses have thus raised concerns; possible explanations for bee decline include nutritional deficiencies and exposures to pesticides and pathogens. We determined that constituents found in honey, including p-coumaric acid, pinocembrin, and pinobanksin 5-methyl ether, specifically induce detoxification genes. These inducers are primarily found not in nectar but in pollen in the case of p-coumaric acid (a monomer of sporopollenin, the principal constituent of pollen cell walls) and propolis, a resinous material gathered and processed by bees to line wax cells. RNA-seq analysis (massively parallel RNA sequencing) revealed that p-coumaric acid specifically up-regulates all classes of detoxification genes as well as select antimicrobial peptide genes. This up-regulation has functional significance in that that adding p-coumaric acid to a diet of sucrose increases midgut metabolism of coumaphos, a widely used in-hive acaricide, by ∼60%. As a major component of pollen grains, p-coumaric acid is ubiquitous in the natural diet of honey bees and may function as a nutraceutical regulating immune and detoxification processes. The widespread apicultural use of honey substitutes, including high-fructose corn syrup, may thus compromise the ability of honey bees to cope with pesticides and pathogens and contribute to colony losses.

Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera

PubMed Central

Mao, Wenfu; Schuler, Mary A.; Berenbaum, May R.

2013-01-01

As a managed pollinator, the honey bee Apis mellifera is critical to the American agricultural enterprise. Recent colony losses have thus raised concerns; possible explanations for bee decline include nutritional deficiencies and exposures to pesticides and pathogens. We determined that constituents found in honey, including p-coumaric acid, pinocembrin, and pinobanksin 5-methyl ether, specifically induce detoxification genes. These inducers are primarily found not in nectar but in pollen in the case of p-coumaric acid (a monomer of sporopollenin, the principal constituent of pollen cell walls) and propolis, a resinous material gathered and processed by bees to line wax cells. RNA-seq analysis (massively parallel RNA sequencing) revealed that p-coumaric acid specifically up-regulates all classes of detoxification genes as well as select antimicrobial peptide genes. This up-regulation has functional significance in that that adding p-coumaric acid to a diet of sucrose increases midgut metabolism of coumaphos, a widely used in-hive acaricide, by ∼60%. As a major component of pollen grains, p-coumaric acid is ubiquitous in the natural diet of honey bees and may function as a nutraceutical regulating immune and detoxification processes. The widespread apicultural use of honey substitutes, including high-fructose corn syrup, may thus compromise the ability of honey bees to cope with pesticides and pathogens and contribute to colony losses. PMID:23630255

Pseudomonas aeruginosa AES-1 exhibits increased virulence gene expression during chronic infection of cystic fibrosis lung.

PubMed

Naughton, Sharna; Parker, Dane; Seemann, Torsten; Thomas, Torsten; Turnbull, Lynne; Rose, Barbara; Bye, Peter; Cordwell, Stuart; Whitchurch, Cynthia; Manos, Jim

2011-01-01

Pseudomonas aeruginosa, the leading cause of morbidity and mortality in people with cystic fibrosis (CF), adapts for survival in the CF lung through both mutation and gene expression changes. Frequent clonal strains such as the Australian Epidemic Strain-1 (AES-1), have increased ability to establish infection in the CF lung and to superimpose and replace infrequent clonal strains. Little is known about the factors underpinning these properties. Analysis has been hampered by lack of expression array templates containing CF-strain specific genes. We sequenced the genome of an acute infection AES-1 isolate from a CF infant (AES-1R) and constructed a non-redundant micro-array (PANarray) comprising AES-1R and seven other sequenced P. aeruginosa genomes. The unclosed AES-1R genome comprised 6.254Mbp and contained 6957 putative genes, including 338 not found in the other seven genomes. The PANarray contained 12,543 gene probe spots; comprising 12,147 P. aeruginosa gene probes, 326 quality-control probes and 70 probes for non-P. aeruginosa genes, including phage and plant genes. We grew AES-1R and its isogenic pair AES-1M, taken from the same patient 10.5 years later and not eradicated in the intervening period, in our validated artificial sputum medium (ASMDM) and used the PANarray to compare gene expression of both in duplicate. 675 genes were differentially expressed between the isogenic pairs, including upregulation of alginate, biofilm, persistence genes and virulence-related genes such as dihydroorotase, uridylate kinase and cardiolipin synthase, in AES-1M. Non-PAO1 genes upregulated in AES-1M included pathogenesis-related (PAGI-5) genes present in strains PACS2 and PA7, and numerous phage genes. Elucidation of these genes' roles could lead to targeted treatment strategies for chronically infected CF patients.

Pseudomonas aeruginosa AES-1 Exhibits Increased Virulence Gene Expression during Chronic Infection of Cystic Fibrosis Lung

PubMed Central

Naughton, Sharna; Parker, Dane; Seemann, Torsten; Thomas, Torsten; Turnbull, Lynne; Rose, Barbara; Bye, Peter; Cordwell, Stuart; Whitchurch, Cynthia; Manos, Jim

2011-01-01

Pseudomonas aeruginosa, the leading cause of morbidity and mortality in people with cystic fibrosis (CF), adapts for survival in the CF lung through both mutation and gene expression changes. Frequent clonal strains such as the Australian Epidemic Strain-1 (AES-1), have increased ability to establish infection in the CF lung and to superimpose and replace infrequent clonal strains. Little is known about the factors underpinning these properties. Analysis has been hampered by lack of expression array templates containing CF-strain specific genes. We sequenced the genome of an acute infection AES-1 isolate from a CF infant (AES-1R) and constructed a non-redundant micro-array (PANarray) comprising AES-1R and seven other sequenced P. aeruginosa genomes. The unclosed AES-1R genome comprised 6.254Mbp and contained 6957 putative genes, including 338 not found in the other seven genomes. The PANarray contained 12,543 gene probe spots; comprising 12,147 P. aeruginosa gene probes, 326 quality-control probes and 70 probes for non-P. aeruginosa genes, including phage and plant genes. We grew AES-1R and its isogenic pair AES-1M, taken from the same patient 10.5 years later and not eradicated in the intervening period, in our validated artificial sputum medium (ASMDM) and used the PANarray to compare gene expression of both in duplicate. 675 genes were differentially expressed between the isogenic pairs, including upregulation of alginate, biofilm, persistence genes and virulence-related genes such as dihydroorotase, uridylate kinase and cardiolipin synthase, in AES-1M. Non-PAO1 genes upregulated in AES-1M included pathogenesis-related (PAGI-5) genes present in strains PACS2 and PA7, and numerous phage genes. Elucidation of these genes' roles could lead to targeted treatment strategies for chronically infected CF patients. PMID:21935417

Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

PubMed Central

Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

2013-01-01

The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

DroSpeGe: rapid access database for new Drosophila species genomes.

PubMed

Gilbert, Donald G

2007-01-01

The Drosophila species comparative genome database DroSpeGe (http://insects.eugenes.org/DroSpeGe/) provides genome researchers with rapid, usable access to 12 new and old Drosophila genomes, since its inception in 2004. Scientists can use, with minimal computing expertise, the wealth of new genome information for developing new insights into insect evolution. New genome assemblies provided by several sequencing centers have been annotated with known model organism gene homologies and gene predictions to provided basic comparative data. TeraGrid supplies the shared cyberinfrastructure for the primary computations. This genome database includes homologies to Drosophila melanogaster and eight other eukaryote model genomes, and gene predictions from several groups. BLAST searches of the newest assemblies are integrated with genome maps. GBrowse maps provide detailed views of cross-species aligned genomes. BioMart provides for data mining of annotations and sequences. Common chromosome maps identify major synteny among species. Potential gain and loss of genes is suggested by Gene Ontology groupings for genes of the new species. Summaries of essential genome statistics include sizes, genes found and predicted, homology among genomes, phylogenetic trees of species and comparisons of several gene predictions for sensitivity and specificity in finding new and known genes.

Tissue-specific models of spinal muscular atrophy confirm a critical role of SMN in motor neurons from embryonic to adult stages.

PubMed

Laird, Angela S; Mackovski, Nikolce; Rinkwitz, Silke; Becker, Thomas S; Giacomotto, Jean

2016-05-01

Spinal muscular atrophy (SMA) is an autosomal recessive disease linked to survival motor neuron (SMN) protein deficiency. While SMN protein is expressed ubiquitously, its deficiency triggers tissue-specific hallmarks, including motor neuron death and muscle atrophy, leading to impaired motor functions and premature death. Here, using stable miR-mediated knockdown technology in zebrafish, we developed the first vertebrate system allowing transgenic spatio-temporal control of the smn1 gene. Using this new model it is now possible to investigate normal and pathogenic SMN function(s) in specific cell types, independently or in synergy with other cell populations. We took advantage of this new system to first test the effect of motor neuron or muscle-specific smn1 silencing. Anti-smn1 miRNA expression in motor neurons, but not in muscles, reproduced SMA hallmarks, including abnormal motor neuron development, poor motor function and premature death. Interestingly, smn1 knockdown in motor neurons also induced severe late-onset phenotypes including scoliosis-like body deformities, weight loss, muscle atrophy and, seen for the first time in zebrafish, reduction in the number of motor neurons, indicating motor neuron degeneration. Taken together, we have developed a new transgenic system allowing spatio-temporal control of smn1 expression in zebrafish, and using this model, we have demonstrated that smn1 silencing in motor neurons alone is sufficient to reproduce SMA hallmarks in zebrafish. It is noteworthy that this research is going beyond SMA as this versatile gene-silencing transgenic system can be used to knockdown any genes of interest, filling the gap in the zebrafish genetic toolbox and opening new avenues to study gene functions in this organism. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Differential expression of members of the annexin multigene family in Arabidopsis

NASA Technical Reports Server (NTRS)

Clark, G. B.; Sessions, A.; Eastburn, D. J.; Roux, S. J.

2001-01-01

Although in most plant species no more than two annexin genes have been reported to date, seven annexin homologs have been identified in Arabidopsis, Annexin Arabidopsis 1-7 (AnnAt1--AnnAt7). This establishes that annexins can be a diverse, multigene protein family in a single plant species. Here we compare and analyze these seven annexin gene sequences and present the in situ RNA localization patterns of two of these genes, AnnAt1 and AnnAt2, during different stages of Arabidopsis development. Sequence analysis of AnnAt1--AnnAt7 reveals that they contain the characteristic four structural repeats including the more highly conserved 17-amino acid endonexin fold region found in vertebrate annexins. Alignment comparisons show that there are differences within the repeat regions that may have functional importance. To assess the relative level of expression in various tissues, reverse transcription-PCR was carried out using gene-specific primers for each of the Arabidopsis annexin genes. In addition, northern blot analysis using gene-specific probes indicates differences in AnnAt1 and AnnAt2 expression levels in different tissues. AnnAt1 is expressed in all tissues examined and is most abundant in stems, whereas AnnAt2 is expressed mainly in root tissue and to a lesser extent in stems and flowers. In situ RNA localization demonstrates that these two annexin genes display developmentally regulated tissue-specific and cell-specific expression patterns. These patterns are both distinct and overlapping. The developmental expression patterns for both annexins provide further support for the hypothesis that annexins are involved in the Golgi-mediated secretion of polysaccharides.

De Novo Assembly of the Manila Clam Ruditapes philippinarum Transcriptome Provides New Insights into Expression Bias, Mitochondrial Doubly Uniparental Inheritance and Sex Determination

PubMed Central

Ghiselli, Fabrizio; Milani, Liliana; Chang, Peter L.; Hedgecock, Dennis; Davis, Jonathan P.; Nuzhdin, Sergey V.; Passamonti, Marco

2012-01-01

Males and females share the same genome, thus, phenotypic divergence requires differential gene expression and sex-specific regulation. Accordingly, the analysis of expression patterns is pivotal to the understanding of sex determination mechanisms. Many bivalves are stable gonochoric species, but the mechanism of gonad sexualization and the genes involved are still unknown. Moreover, during the period of sexual rest, a gonad is not present and sex cannot be determined. A mechanism associated with germ line differentiation in some bivalves, including the Manila clam Ruditapes philippinarum, is the doubly uniparental inheritance (DUI) of mitochondria, a variation of strict maternal inheritance. Two mitochondrial lineages are present, one transmitted through eggs and the other through sperm, as well as a mother-dependent sex bias of the progeny. We produced a de novo annotation of 17,186 transcripts from R. philippinarum and compared the transcriptomes of males and females and identified 1,575 genes with strong sex-specific expression and 166 sex-specific single nucleotide polymorphisms, obtaining preliminary information about genes that could be involved in sex determination. Then we compared the transcriptomes between a family producing predominantly females and a family producing predominantly males to identify candidate genes involved in regulation of sex-specific aspects of DUI system, finding a relationship between sex bias and differential expression of several ubiquitination genes. In mammalian embryos, sperm mitochondria are degraded by ubiquitination. A modification of this mechanism is hypothesized to be responsible for the retention of sperm mitochondria in male embryos of DUI species. Ubiquitination can additionally regulate gene expression, playing a role in sex determination of several animals. These data enable us to develop a model that incorporates both the DUI literature and our new findings. PMID:21976711

Use of human antigen presenting cell gene array profiling to examine the effect of human T-cell leukemia virus type 1 Tax on primary human dendritic cells.

PubMed

Ahuja, Jaya; Kampani, Karan; Datta, Suman; Wigdahl, Brian; Flaig, Katherine E; Jain, Pooja

2006-02-01

Human T-cell leukemia virus type 1 (HTLV-1) is etiologically linked to adult T-cell leukemia and a progressive demyelinating disorder termed HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). One of the most striking features of the immune response in HAM/TSP centers on the expansion of HTLV-1-specific CD8(+) cytotoxic T lymphocyte (CTL) compartment in the peripheral blood and cerebrospinal fluid. More than 90% of the HTLV-1-specific CTLs are directed against the viral Tax (11-19) peptide implying that Tax is available for immune recognition by antigen presenting cells, such as dendritic cells (DCs). DCs obtained from HAM/TSP patients have been shown to be infected with HTLV-1 and exhibit rapid maturation. Therefore, we hypothesized that presentation of Tax peptides by activated DCs to naIve CD8(+) T cells may play an important role in the induction of a Tax-specific CTL response and neurologic dysfunction. In this study, a pathway-specific antigen presenting cell gene array was used to study transcriptional changes induced by exposure of monocyte-derived DCs to extracellular HTLV-1 Tax protein. Approximately 100 genes were differentially expressed including genes encoding toll-like receptors, cell surface receptors, proteins involved in antigen uptake and presentation and adhesion molecules. The differential regulation of chemokines and cytokines characteristic of functional DC activation was also observed by the gene array analyses. Furthermore, the expression pattern of signal transduction genes was also significantly altered. These results have suggested that Tax-mediated DC gene regulation might play a critical role in cellular activation and the mechanisms resulting in HTLV-1-induced disease.

Sex determines which section of the SLC6A4 gene is linked to obsessive-compulsive symptoms in normal Chinese college students.

PubMed

Lei, Xuemei; Chen, Chuansheng; He, Qinghua; Chen, Chunhui; Moyzis, Robert K; Xue, Gui; Chen, Xiongying; Cao, Zhongyu; Li, Jin; Li, He; Zhu, Bi; Chun Hsu, Anna Shan; Li, Sufang; Li, Jun; Dong, Qi

2012-09-01

Previous case-control and family-based association studies have implicated the SLC6A4 gene in obsessive-compulsive disorder (OCD). Little research, however, has examined this gene's role in obsessive-compulsive symptoms (OCS) in community samples. The present study genotyped seven tag SNPs and two common functional tandem repeat polymorphisms (5-HTTLPR and STin2), which together cover the whole SLC6A4 gene, and investigated their associations with OCS in normal Chinese college students (N = 572). The results revealed a significant gender main effect and gender-specific genetic effects of the SLC6A4 gene on OCS. Males scored significantly higher on total OCS and its three dimensions than did females (ps < .01). The 5-HTTLPR in the promoter region showed a female-specific genetic effect, with the l/l and l/s genotypes linked to higher OCS scores than the s/s genotype (ps < .05). In contrast, a conserved haplotype polymorphism (rs1042173| rs4325622| rs3794808| rs140701| rs4583306| rs2020942) covering from intron 3 to the 3' UTR of the SLC6A4 gene showed male-specific genetic effects, with the CGAAGG/CGAAGG genotype associated with lower OCS scores than the other genotypes (ps < .05). These effects remained significant after controlling for OCS-related factors including participants' depressive and anxiety symptoms as well as stressful life events, and correction for multiple tests. These results are discussed in terms of their implications for our understanding of the sex-specific role of the different sections of the SLC6A4 gene in OCD. Published by Elsevier Ltd.

Genetic and molecular risk factors within the newly identified primate-specific exon of the SAP97/DLG1 gene in the 3q29 schizophrenia-associated locus.

PubMed

Uezato, Akihito; Yamamoto, Naoki; Jitoku, Daisuke; Haramo, Emiko; Hiraaki, Eri; Iwayama, Yoshimi; Toyota, Tomoko; Umino, Masakazu; Umino, Asami; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Hashimoto, Tasuku; Kanahara, Nobuhisa; Kurumaji, Akeo; Yoshikawa, Takeo; Nishikawa, Toru

2017-12-01

The synapse-associated protein 97/discs, large homolog 1 of Drosophila (DLG1) gene encodes synaptic scaffold PDZ proteins interacting with ionotropic glutamate receptors including the N-methyl-D-aspartate type glutamate receptor (NMDAR) that is presumed to be hypoactive in brains of patients with schizophrenia. The DLG1 gene resides in the chromosomal position 3q29, the microdeletion of which confers a 40-fold increase in the risk for schizophrenia. In the present study, we performed genetic association analyses for DLG1 gene using a Japanese cohort with 1808 schizophrenia patients and 2170 controls. We detected an association which remained significant after multiple comparison testing between schizophrenia and the single nucleotide polymorphism (SNP) rs3915512 that is located within the newly identified primate-specific exon (exon 3b) of the DLG1 gene and constitutes the exonic splicing enhancer sequence. When stratified by onset age, although it did not survive multiple comparisons, the association was observed in non-early onset schizophrenia, whose onset-age selectivity is consistent with our recent postmortem study demonstrating a decrease in the expression of the DLG1 variant in early-onset schizophrenia. Although the present study did not demonstrate the previously reported association of the SNP rs9843659 by itself, a meta-analysis revealed a significant association between DLG1 gene and schizophrenia. These findings provide a valuable clue for molecular mechanisms on how genetic variations in the primate-specific exon of the gene in the schizophrenia-associated 3q29 locus affect its regulation in the glutamate system and lead to the disease onset around a specific stage of brain development. © 2017 Wiley Periodicals, Inc.

CRISPR/Cas9-mediated gene targeting in Arabidopsis using sequential transformation.

PubMed

Miki, Daisuke; Zhang, Wenxin; Zeng, Wenjie; Feng, Zhengyan; Zhu, Jian-Kang

2018-05-17

Homologous recombination-based gene targeting is a powerful tool for precise genome modification and has been widely used in organisms ranging from yeast to higher organisms such as Drosophila and mouse. However, gene targeting in higher plants, including the most widely used model plant Arabidopsis thaliana, remains challenging. Here we report a sequential transformation method for gene targeting in Arabidopsis. We find that parental lines expressing the bacterial endonuclease Cas9 from the egg cell- and early embryo-specific DD45 gene promoter can improve the frequency of single-guide RNA-targeted gene knock-ins and sequence replacements via homologous recombination at several endogenous sites in the Arabidopsis genome. These heritable gene targeting can be identified by regular PCR. Our approach enables routine and fine manipulation of the Arabidopsis genome.

Transcriptome analysis of Petunia axillaris flowers reveals genes involved in morphological differentiation and metabolite transport

PubMed Central

Amano, Ikuko; Kitajima, Sakihito; Suzuki, Hideyuki; Koeduka, Takao

2018-01-01

The biosynthesis of plant secondary metabolites is associated with morphological and metabolic differentiation. As a consequence, gene expression profiles can change drastically, and primary and secondary metabolites, including intermediate and end-products, move dynamically within and between cells. However, little is known about the molecular mechanisms underlying differentiation and transport mechanisms. In this study, we performed a transcriptome analysis of Petunia axillaris subsp. parodii, which produces various volatiles in its corolla limbs and emits metabolites to attract pollinators. RNA-sequencing from leaves, buds, and limbs identified 53,243 unigenes. Analysis of differentially expressed genes, combined with gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses, showed that many biological processes were highly enriched in limbs. These included catabolic processes and signaling pathways of hormones, such as gibberellins, and metabolic pathways, including phenylpropanoids and fatty acids. Moreover, we identified five transporter genes that showed high expression in limbs, and we performed spatiotemporal expression analyses and homology searches to infer their putative functions. Our systematic analysis provides comprehensive transcriptomic information regarding morphological differentiation and metabolite transport in the Petunia flower and lays the foundation for establishing the specific mechanisms that control secondary metabolite biosynthesis in plants. PMID:29902274

Global Fitness Profiling Identifies Arsenic and Cadmium Tolerance Mechanisms in Fission Yeast.

PubMed

Guo, Lan; Ganguly, Abantika; Sun, Lingling; Suo, Fang; Du, Li-Lin; Russell, Paul

2016-10-13

Heavy metals and metalloids such as cadmium [Cd(II)] and arsenic [As(III)] are widespread environmental toxicants responsible for multiple adverse health effects in humans. However, the molecular mechanisms underlying metal-induced cytotoxicity and carcinogenesis, as well as the detoxification and tolerance pathways, are incompletely understood. Here, we use global fitness profiling by barcode sequencing to quantitatively survey the Schizosaccharomyces pombe haploid deletome for genes that confer tolerance of cadmium or arsenic. We identified 106 genes required for cadmium resistance and 110 genes required for arsenic resistance, with a highly significant overlap of 36 genes. A subset of these 36 genes account for almost all proteins required for incorporating sulfur into the cysteine-rich glutathione and phytochelatin peptides that chelate cadmium and arsenic. A requirement for Mms19 is explained by its role in directing iron-sulfur cluster assembly into sulfite reductase as opposed to promoting DNA repair, as DNA damage response genes were not enriched among those required for cadmium or arsenic tolerance. Ubiquinone, siroheme, and pyridoxal 5'-phosphate biosynthesis were also identified as critical for Cd/As tolerance. Arsenic-specific pathways included prefoldin-mediated assembly of unfolded proteins and protein targeting to the peroxisome, whereas cadmium-specific pathways included plasma membrane and vacuolar transporters, as well as Spt-Ada-Gcn5-acetyltransferase (SAGA) transcriptional coactivator that controls expression of key genes required for cadmium tolerance. Notable differences are apparent with corresponding screens in the budding yeast Saccharomyces cerevisiae, underscoring the utility of analyzing toxic metal defense mechanisms in both organisms. Copyright © 2016 Guo et al.

Microarray analysis identifies candidate genes for key roles in coral development

PubMed Central

Grasso, Lauretta C; Maindonald, John; Rudd, Stephen; Hayward, David C; Saint, Robert; Miller, David J; Ball, Eldon E

2008-01-01

Background Anthozoan cnidarians are amongst the simplest animals at the tissue level of organization, but are surprisingly complex and vertebrate-like in terms of gene repertoire. As major components of tropical reef ecosystems, the stony corals are anthozoans of particular ecological significance. To better understand the molecular bases of both cnidarian development in general and coral-specific processes such as skeletogenesis and symbiont acquisition, microarray analysis was carried out through the period of early development – when skeletogenesis is initiated, and symbionts are first acquired. Results Of 5081 unique peptide coding genes, 1084 were differentially expressed (P ≤ 0.05) in comparisons between four different stages of coral development, spanning key developmental transitions. Genes of likely relevance to the processes of settlement, metamorphosis, calcification and interaction with symbionts were characterised further and their spatial expression patterns investigated using whole-mount in situ hybridization. Conclusion This study is the first large-scale investigation of developmental gene expression for any cnidarian, and has provided candidate genes for key roles in many aspects of coral biology, including calcification, metamorphosis and symbiont uptake. One surprising finding is that some of these genes have clear counterparts in higher animals but are not present in the closely-related sea anemone Nematostella. Secondly, coral-specific processes (i.e. traits which distinguish corals from their close relatives) may be analogous to similar processes in distantly related organisms. This first large-scale application of microarray analysis demonstrates the potential of this approach for investigating many aspects of coral biology, including the effects of stress and disease. PMID:19014561

Genome-wide prediction and analysis of human tissue-selective genes using microarray expression data

PubMed Central

2013-01-01

Background Understanding how genes are expressed specifically in particular tissues is a fundamental question in developmental biology. Many tissue-specific genes are involved in the pathogenesis of complex human diseases. However, experimental identification of tissue-specific genes is time consuming and difficult. The accurate predictions of tissue-specific gene targets could provide useful information for biomarker development and drug target identification. Results In this study, we have developed a machine learning approach for predicting the human tissue-specific genes using microarray expression data. The lists of known tissue-specific genes for different tissues were collected from UniProt database, and the expression data retrieved from the previously compiled dataset according to the lists were used for input vector encoding. Random Forests (RFs) and Support Vector Machines (SVMs) were used to construct accurate classifiers. The RF classifiers were found to outperform SVM models for tissue-specific gene prediction. The results suggest that the candidate genes for brain or liver specific expression can provide valuable information for further experimental studies. Our approach was also applied for identifying tissue-selective gene targets for different types of tissues. Conclusions A machine learning approach has been developed for accurately identifying the candidate genes for tissue specific/selective expression. The approach provides an efficient way to select some interesting genes for developing new biomedical markers and improve our knowledge of tissue-specific expression. PMID:23369200

Comparative Analysis of Genome Sequences Covering the Seven Cronobacter Species

PubMed Central

Cummings, Craig A.; Shih, Rita; Degoricija, Lovorka; Rico, Alain; Brzoska, Pius; Hamby, Stephen E.; Masood, Naqash; Hariri, Sumyya; Sonbol, Hana; Chuzhanova, Nadia; McClelland, Michael; Furtado, Manohar R.; Forsythe, Stephen J.

2012-01-01

Background Species of Cronobacter are widespread in the environment and are occasional food-borne pathogens associated with serious neonatal diseases, including bacteraemia, meningitis, and necrotising enterocolitis. The genus is composed of seven species: C. sakazakii, C. malonaticus, C. turicensis, C. dublinensis, C. muytjensii, C. universalis, and C. condimenti. Clinical cases are associated with three species, C. malonaticus, C. turicensis and, in particular, with C. sakazakii multilocus sequence type 4. Thus, it is plausible that virulence determinants have evolved in certain lineages. Methodology/Principal Findings We generated high quality sequence drafts for eleven Cronobacter genomes representing the seven Cronobacter species, including an ST4 strain of C. sakazakii. Comparative analysis of these genomes together with the two publicly available genomes revealed Cronobacter has over 6,000 genes in one or more strains and over 2,000 genes shared by all Cronobacter. Considerable variation in the presence of traits such as type six secretion systems, metal resistance (tellurite, copper and silver), and adhesins were found. C. sakazakii is unique in the Cronobacter genus in encoding genes enabling the utilization of exogenous sialic acid which may have clinical significance. The C. sakazakii ST4 strain 701 contained additional genes as compared to other C. sakazakii but none of them were known specific virulence-related genes. Conclusions/Significance Genome comparison revealed that pair-wise DNA sequence identity varies between 89 and 97% in the seven Cronobacter species, and also suggested various degrees of divergence. Sets of universal core genes and accessory genes unique to each strain were identified. These gene sequences can be used for designing genus/species specific detection assays. Genes encoding adhesins, T6SS, and metal resistance genes as well as prophages are found in only subsets of genomes and have contributed considerably to the variation of genomic content. Differences in gene content likely contribute to differences in the clinical and environmental distribution of species and sequence types. PMID:23166675

Distinct gene-specific mechanisms of arrhythmia revealed by cardiac gene transfer of two long QT disease genes, HERG and KCNE1.

PubMed

Hoppe, U C; Marbán, E; Johns, D C

2001-04-24

The long QT syndrome (LQTS) is a heritable disorder that predisposes to sudden cardiac death. LQTS is caused by mutations in ion channel genes including HERG and KCNE1, but the precise mechanisms remain unclear. To clarify this situation we injected adenoviral vectors expressing wild-type or LQT mutants of HERG and KCNE1 into guinea pig myocardium. End points at 48-72 h included electrophysiology in isolated myocytes and electrocardiography in vivo. HERG increased the rapid component, I(Kr), of the delayed rectifier current, thereby accelerating repolarization, increasing refractoriness, and diminishing beat-to-beat action potential variability. Conversely, HERG-G628S suppressed I(Kr) without significantly delaying repolarization. Nevertheless, HERG-G628S abbreviated refractoriness and increased beat-to-beat variability, leading to early afterdepolarizations (EADs). KCNE1 increased the slow component of the delayed rectifier, I(Ks), without clear phenotypic sequelae. In contrast, KCNE1-D76N suppressed I(Ks) and markedly slowed repolarization, leading to frequent EADs and electrocardiographic QT prolongation. Thus, the two genes predispose to sudden death by distinct mechanisms: the KCNE1 mutant flagrantly undermines cardiac repolarization, and HERG-G628S subtly facilitates the genesis and propagation of premature beats. Our ability to produce electrocardiographic long QT in vivo with a clinical KCNE1 mutation demonstrates the utility of somatic gene transfer in creating genotype-specific disease models.

The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development.

PubMed

Ortega-Molina, Ana; Boss, Isaac W; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A; Gascoyne, Randy D; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M; Wendel, Hans-Guido

2015-10-01

The gene encoding the lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma and diffuse large B cell lymphoma; however, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center involution and impedes B cell differentiation and class switch recombination. Integrative genomic analyses indicate that KMT2D affects methylation of lysine 4 on histone H3 (H3K4) and expression of a set of genes, including those in the CD40, JAK-STAT, Toll-like receptor and B cell receptor signaling pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3 and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell-activating pathways.

Recombinant structures expand and contract inter and intragenic diversification at the KIR locus

PubMed Central

2013-01-01

Background The human KIR genes are arranged in at least six major gene-content haplotypes, all of which are combinations of four centromeric and two telomeric motifs. Several less frequent or minor haplotypes also exist, including insertions, deletions, and hybridization of KIR genes derived from the major haplotypes. These haplotype structures and their concomitant linkage disequilibrium among KIR genes suggest that more meaningful correlative data from studies of KIR genetics and complex disease may be achieved by measuring haplotypes of the KIR region in total. Results Towards that end, we developed a KIR haplotyping method that reports unambiguous combinations of KIR gene-content haplotypes, including both phase and copy number for each KIR. A total of 37 different gene content haplotypes were detected from 4,512 individuals and new sequence data was derived from haplotypes where the detailed structure was not previously available. Conclusions These new structures suggest a number of specific recombinant events during the course of KIR evolution, and add to an expanding diversity of potential new KIR haplotypes derived from gene duplication, deletion, and hybridization. PMID:23394822

Fip1 regulates mRNA alternative polyadenylation to promote stem cell self-renewal

PubMed Central

Lackford, Brad; Yao, Chengguo; Charles, Georgette M; Weng, Lingjie; Zheng, Xiaofeng; Choi, Eun-A; Xie, Xiaohui; Wan, Ji; Xing, Yi; Freudenberg, Johannes M; Yang, Pengyi; Jothi, Raja; Hu, Guang; Shi, Yongsheng

2014-01-01

mRNA alternative polyadenylation (APA) plays a critical role in post-transcriptional gene control and is highly regulated during development and disease. However, the regulatory mechanisms and functional consequences of APA remain poorly understood. Here, we show that an mRNA 3′ processing factor, Fip1, is essential for embryonic stem cell (ESC) self-renewal and somatic cell reprogramming. Fip1 promotes stem cell maintenance, in part, by activating the ESC-specific APA profiles to ensure the optimal expression of a specific set of genes, including critical self-renewal factors. Fip1 expression and the Fip1-dependent APA program change during ESC differentiation and are restored to an ESC-like state during somatic reprogramming. Mechanistically, we provide evidence that the specificity of Fip1-mediated APA regulation depends on multiple factors, including Fip1-RNA interactions and the distance between APA sites. Together, our data highlight the role for post-transcriptional control in stem cell self-renewal, provide mechanistic insight on APA regulation in development, and establish an important function for APA in cell fate specification. PMID:24596251

Altered Pathway Analyzer: A gene expression dataset analysis tool for identification and prioritization of differentially regulated and network rewired pathways

PubMed Central

Kaushik, Abhinav; Ali, Shakir; Gupta, Dinesh

2017-01-01

Gene connection rewiring is an essential feature of gene network dynamics. Apart from its normal functional role, it may also lead to dysregulated functional states by disturbing pathway homeostasis. Very few computational tools measure rewiring within gene co-expression and its corresponding regulatory networks in order to identify and prioritize altered pathways which may or may not be differentially regulated. We have developed Altered Pathway Analyzer (APA), a microarray dataset analysis tool for identification and prioritization of altered pathways, including those which are differentially regulated by TFs, by quantifying rewired sub-network topology. Moreover, APA also helps in re-prioritization of APA shortlisted altered pathways enriched with context-specific genes. We performed APA analysis of simulated datasets and p53 status NCI-60 cell line microarray data to demonstrate potential of APA for identification of several case-specific altered pathways. APA analysis reveals several altered pathways not detected by other tools evaluated by us. APA analysis of unrelated prostate cancer datasets identifies sample-specific as well as conserved altered biological processes, mainly associated with lipid metabolism, cellular differentiation and proliferation. APA is designed as a cross platform tool which may be transparently customized to perform pathway analysis in different gene expression datasets. APA is freely available at http://bioinfo.icgeb.res.in/APA. PMID:28084397