Sample records for specific genomic sequences

  1. GSP: A web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  2. Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-08-15

    Identification of transgenic sequences in an unknown genetically modified (GM) papaya (Carica papaya L.) by whole genome sequence analysis was demonstrated. Whole genome sequence data were generated for a GM-positive fresh papaya fruit commodity detected in monitoring using real-time polymerase chain reaction (PCR). The sequences obtained were mapped against an open database for papaya genome sequence. Transgenic construct- and event-specific sequences were identified as a GM papaya developed to resist infection from a Papaya ringspot virus. Based on the transgenic sequences, a specific real-time PCR detection method for GM papaya applicable to various food commodities was developed. Whole genome sequence analysis enabled identifying unknown transgenic construct- and event-specific sequences in GM papaya and development of a reliable method for detecting them in papaya food commodities. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Visualization of genome signatures of eukaryote genomes by batch-learning self-organizing map with a special emphasis on Drosophila genomes.

    PubMed

    Abe, Takashi; Hamano, Yuta; Ikemura, Toshimichi

    2014-01-01

    A strategy of evolutionary studies that can compare vast numbers of genome sequences is becoming increasingly important with the remarkable progress of high-throughput DNA sequencing methods. We previously established a sequence alignment-free clustering method "BLSOM" for di-, tri-, and tetranucleotide compositions in genome sequences, which can characterize sequence characteristics (genome signatures) of a wide range of species. In the present study, we generated BLSOMs for tetra- and pentanucleotide compositions in approximately one million sequence fragments derived from 101 eukaryotes, for which almost complete genome sequences were available. BLSOM recognized phylotype-specific characteristics (e.g., key combinations of oligonucleotide frequencies) in the genome sequences, permitting phylotype-specific clustering of the sequences without any information regarding the species. In our detailed examination of 12 Drosophila species, the correlation between their phylogenetic classification and the classification on the BLSOMs was observed to visualize oligonucleotides diagnostic for species-specific clustering.

  4. Gene calling and bacterial genome annotation with BG7.

    PubMed

    Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo

    2015-01-01

    New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).

  5. A novel bioinformatics method for efficient knowledge discovery by BLSOM from big genomic sequence data.

    PubMed

    Bai, Yu; Iwasaki, Yuki; Kanaya, Shigehiko; Zhao, Yue; Ikemura, Toshimichi

    2014-01-01

    With remarkable increase of genomic sequence data of a wide range of species, novel tools are needed for comprehensive analyses of the big sequence data. Self-Organizing Map (SOM) is an effective tool for clustering and visualizing high-dimensional data such as oligonucleotide composition on one map. By modifying the conventional SOM, we have previously developed Batch-Learning SOM (BLSOM), which allows classification of sequence fragments according to species, solely depending on the oligonucleotide composition. In the present study, we introduce the oligonucleotide BLSOM used for characterization of vertebrate genome sequences. We first analyzed pentanucleotide compositions in 100 kb sequences derived from a wide range of vertebrate genomes and then the compositions in the human and mouse genomes in order to investigate an efficient method for detecting differences between the closely related genomes. BLSOM can recognize the species-specific key combination of oligonucleotide frequencies in each genome, which is called a "genome signature," and the specific regions specifically enriched in transcription-factor-binding sequences. Because the classification and visualization power is very high, BLSOM is an efficient powerful tool for extracting a wide range of information from massive amounts of genomic sequences (i.e., big sequence data).

  6. BiQ Analyzer HT: locus-specific analysis of DNA methylation by high-throughput bisulfite sequencing

    PubMed Central

    Lutsik, Pavlo; Feuerbach, Lars; Arand, Julia; Lengauer, Thomas; Walter, Jörn; Bock, Christoph

    2011-01-01

    Bisulfite sequencing is a widely used method for measuring DNA methylation in eukaryotic genomes. The assay provides single-base pair resolution and, given sufficient sequencing depth, its quantitative accuracy is excellent. High-throughput sequencing of bisulfite-converted DNA can be applied either genome wide or targeted to a defined set of genomic loci (e.g. using locus-specific PCR primers or DNA capture probes). Here, we describe BiQ Analyzer HT (http://biq-analyzer-ht.bioinf.mpi-inf.mpg.de/), a user-friendly software tool that supports locus-specific analysis and visualization of high-throughput bisulfite sequencing data. The software facilitates the shift from time-consuming clonal bisulfite sequencing to the more quantitative and cost-efficient use of high-throughput sequencing for studying locus-specific DNA methylation patterns. In addition, it is useful for locus-specific visualization of genome-wide bisulfite sequencing data. PMID:21565797

  7. Development of a real-time PCR for detection of Staphylococcus pseudintermedius using a novel automated comparison of whole-genome sequences.

    PubMed

    Verstappen, Koen M; Huijbregts, Loes; Spaninks, Mirlin; Wagenaar, Jaap A; Fluit, Ad C; Duim, Birgitta

    2017-01-01

    Staphylococcus pseudintermedius is an opportunistic pathogen in dogs and cats and occasionally causes infections in humans. S. pseudintermedius is often resistant to multiple classes of antimicrobials. It requires a reliable detection so that it is not misidentified as S. aureus. Phenotypic and currently-used molecular-based diagnostic assays lack specificity or are labour-intensive using multiplex PCR or nucleic acid sequencing. The aim of this study was to identify a specific target for real-time PCR by comparing whole genome sequences of S. pseudintermedius and non-pseudintermedius.Genome sequences were downloaded from public repositories and supplemented by isolates that were sequenced in this study. A Perl-script was written that analysed 300-nt fragments from a reference genome sequence of S. pseudintermedius and checked if this sequence was present in other S. pseudintermedius genomes (n = 74) and non-pseudintermedius genomes (n = 138). Six sequences specific for S. pseudintermedius were identified (sequence length between 300-500 nt). One sequence, which was located in the spsJ gene, was used to develop primers and a probe. The real-time PCR showed 100% specificity when testing for S. pseudintermedius isolates (n = 54), and eight other staphylococcal species (n = 43). In conclusion, a novel approach by comparing whole genome sequences identified a sequence that is specific for S. pseudintermedius and provided a real-time PCR target for rapid and reliable detection of S. pseudintermedius.

  8. Consequences of Normalizing Transcriptomic and Genomic Libraries of Plant Genomes Using a Duplex-Specific Nuclease and Tetramethylammonium Chloride

    PubMed Central

    Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard

    2013-01-01

    Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce. PMID:23409088

  9. Consequences of normalizing transcriptomic and genomic libraries of plant genomes using a duplex-specific nuclease and tetramethylammonium chloride.

    PubMed

    Matvienko, Marta; Kozik, Alexander; Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard

    2013-01-01

    Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce.

  10. Project 1: Microbial Genomes: A Genomic Approach to Understanding the Evolution of Virulence. Project 2: From Genomes to Life: Drosophilia Development in Space and Time

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robert DeSalle

    2004-09-10

    This project seeks to use the genomes of two close relatives, A. actinomycetemcomitans and H. aphrophilus, to understand the evolutionary changes that take place in a genome to make it more or less virulent. Our primary specific aim of this project was to sequence, annotate, and analyze the genomes of Actinobacillus actinomycetemcomitans (CU1000, serotype f) and Haemophilus aphrophilus. With these genome sequences we have then compared the whole genome sequences to each other and to the current Aa (HK1651 www.genome.ou.edu) genome project sequence along with other fully sequenced Pasteurellaceae to determine inter and intra species differences that may account formore » the differences and similarities in disease. We also propose to create and curate a comprehensive database where sequence information and analysis for the Pasteurellaceae (family that includes the genera Actinobacillus and Haemophilus) are readily accessible. And finally we have proposed to develop phylogenetic techniques that can be used to efficiently and accurately examine the evolution of genomes. Below we report on progress we have made on these major specific aims. Progress on the specific aims is reported below under two major headings--experimental approaches and bioinformatics and systematic biology approaches.« less

  11. Sequence-specific epigenetic effects of the maternal somatic genome on developmental rearrangements of the zygotic genome in Paramecium primaurelia.

    PubMed Central

    Meyer, E; Butler, A; Dubrana, K; Duharcourt, S; Caron, F

    1997-01-01

    In ciliates, the germ line genome is extensively rearranged during the development of the somatic macronucleus from a mitotic product of the zygotic nucleus. Germ line chromosomes are fragmented in specific regions, and a large number of internal sequence elements are eliminated. It was previously shown that transformation of the vegetative macronucleus of Paramecium primaurelia with a plasmid containing a subtelomeric surface antigen gene can affect the processing of the homologous germ line genomic region during development of a new macronucleus in sexual progeny of transformed clones. The gene and telomere-proximal flanking sequences are deleted from the new macronuclear genome, although the germ line genome remains wild type. Here we show that plasmids containing nonoverlapping segments of the same genomic region are able to induce similar terminal deletions; the locations of deletion end points depend on the particular sequence used. Transformation of the maternal macronucleus with a sequence internal to a macronuclear chromosome also causes the occurrence of internal deletions between short direct repeats composed of alternating thymines and adenines. The epigenetic influence of maternal macronuclear sequences on developmental rearrangements of the zygotic genome thus appears to be both sequence specific and general, suggesting that this trans-nucleus effect is mediated by pairing of homologous sequences. PMID:9199294

  12. Sequences Associated with Centromere Competency in the Human Genome

    PubMed Central

    Hayden, Karen E.; Strome, Erin D.; Merrett, Stephanie L.; Lee, Hye-Ran; Rudd, M. Katharine

    2013-01-01

    Centromeres, the sites of spindle attachment during mitosis and meiosis, are located in specific positions in the human genome, normally coincident with diverse subsets of alpha satellite DNA. While there is strong evidence supporting the association of some subfamilies of alpha satellite with centromere function, the basis for establishing whether a given alpha satellite sequence is or is not designated a functional centromere is unknown, and attempts to understand the role of particular sequence features in establishing centromere identity have been limited by the near identity and repetitive nature of satellite sequences. Utilizing a broadly applicable experimental approach to test sequence competency for centromere specification, we have carried out a genomic and epigenetic functional analysis of endogenous human centromere sequences available in the current human genome assembly. The data support a model in which functionally competent sequences confer an opportunity for centromere specification, integrating genomic and epigenetic signals and promoting the concept of context-dependent centromere inheritance. PMID:23230266

  13. FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes

    PubMed Central

    Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena

    2017-01-01

    Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes. PMID:29608678

  14. Chromosome arm-specific BAC end sequences permit comparative analysis of homoeologous chromosomes and genomes of polyploid wheat

    PubMed Central

    2012-01-01

    Background Bread wheat, one of the world’s staple food crops, has the largest, highly repetitive and polyploid genome among the cereal crops. The wheat genome holds the key to crop genetic improvement against challenges such as climate change, environmental degradation, and water scarcity. To unravel the complex wheat genome, the International Wheat Genome Sequencing Consortium (IWGSC) is pursuing a chromosome- and chromosome arm-based approach to physical mapping and sequencing. Here we report on the use of a BAC library made from flow-sorted telosomic chromosome 3A short arm (t3AS) for marker development and analysis of sequence composition and comparative evolution of homoeologous genomes of hexaploid wheat. Results The end-sequencing of 9,984 random BACs from a chromosome arm 3AS-specific library (TaaCsp3AShA) generated 11,014,359 bp of high quality sequence from 17,591 BAC-ends with an average length of 626 bp. The sequence represents 3.2% of t3AS with an average DNA sequence read every 19 kb. Overall, 79% of the sequence consisted of repetitive elements, 1.38% as coding regions (estimated 2,850 genes) and another 19% of unknown origin. Comparative sequence analysis suggested that 70-77% of the genes present in both 3A and 3B were syntenic with model species. Among the transposable elements, gypsy/sabrina (12.4%) was the most abundant repeat and was significantly more frequent in 3A compared to homoeologous chromosome 3B. Twenty novel repetitive sequences were also identified using de novo repeat identification. BESs were screened to identify simple sequence repeats (SSR) and transposable element junctions. A total of 1,057 SSRs were identified with a density of one per 10.4 kb, and 7,928 junctions between transposable elements (TE) and other sequences were identified with a density of one per 1.39 kb. With the objective of enhancing the marker density of chromosome 3AS, oligonucleotide primers were successfully designed from 758 SSRs and 695 Insertion Site Based Polymorphisms (ISBPs). Of the 96 ISBP primer pairs tested, 28 (29%) were 3A-specific and compared to 17 (18%) for 96 SSRs. Conclusion This work reports on the use of wheat chromosome arm 3AS-specific BAC library for the targeted generation of sequence data from a particular region of the huge genome of wheat. A large quantity of sequences were generated from the A genome of hexaploid wheat for comparative genome analysis with homoeologous B and D genomes and other model grass genomes. Hundreds of molecular markers were developed from the 3AS arm-specific sequences; these and other sequences will be useful in gene discovery and physical mapping. PMID:22559868

  15. Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

    PubMed Central

    Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2016-01-01

    Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

  16. Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

    USDA-ARS?s Scientific Manuscript database

    Background: BAC-based physical maps provide for sequencing across an entire genome or selected sub-genome regions of biological interest. Using the minimum tiling path as a guide, it is possible to select specific BAC clones from prioritized genome sections such as a genetically defined QTL interv...

  17. GSP: a web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

  18. Variability among the Most Rapidly Evolving Plastid Genomic Regions is Lineage-Specific: Implications of Pairwise Genome Comparisons in Pyrus (Rosaceae) and Other Angiosperms for Marker Choice

    PubMed Central

    Ter-Voskanyan, Hasmik; Allgaier, Martin; Borsch, Thomas

    2014-01-01

    Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae)—a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC–trnV, trnR–atpA, ndhF–rpl32, psbM–trnD, and trnQ–rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters). Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid), Olea (asterids) and Cymbidium (monocots) showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF–rpl32 and trnK–rps16) were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations. Sequencing whole plastid genomes to find markers for evolutionary analyses is therefore particularly useful when overall genetic distances are low. PMID:25405773

  19. An efficient approach to BAC based assembly of complex genomes.

    PubMed

    Visendi, Paul; Berkman, Paul J; Hayashi, Satomi; Golicz, Agnieszka A; Bayer, Philipp E; Ruperao, Pradeep; Hurgobin, Bhavna; Montenegro, Juan; Chan, Chon-Kit Kenneth; Staňková, Helena; Batley, Jacqueline; Šimková, Hana; Doležel, Jaroslav; Edwards, David

    2016-01-01

    There has been an exponential growth in the number of genome sequencing projects since the introduction of next generation DNA sequencing technologies. Genome projects have increasingly involved assembly of whole genome data which produces inferior assemblies compared to traditional Sanger sequencing of genomic fragments cloned into bacterial artificial chromosomes (BACs). While whole genome shotgun sequencing using next generation sequencing (NGS) is relatively fast and inexpensive, this method is extremely challenging for highly complex genomes, where polyploidy or high repeat content confounds accurate assembly, or where a highly accurate 'gold' reference is required. Several attempts have been made to improve genome sequencing approaches by incorporating NGS methods, to variable success. We present the application of a novel BAC sequencing approach which combines indexed pools of BACs, Illumina paired read sequencing, a sequence assembler specifically designed for complex BAC assembly, and a custom bioinformatics pipeline. We demonstrate this method by sequencing and assembling BAC cloned fragments from bread wheat and sugarcane genomes. We demonstrate that our assembly approach is accurate, robust, cost effective and scalable, with applications for complete genome sequencing in large and complex genomes.

  20. Massively parallel whole genome amplification for single-cell sequencing using droplet microfluidics.

    PubMed

    Hosokawa, Masahito; Nishikawa, Yohei; Kogawa, Masato; Takeyama, Haruko

    2017-07-12

    Massively parallel single-cell genome sequencing is required to further understand genetic diversities in complex biological systems. Whole genome amplification (WGA) is the first step for single-cell sequencing, but its throughput and accuracy are insufficient in conventional reaction platforms. Here, we introduce single droplet multiple displacement amplification (sd-MDA), a method that enables massively parallel amplification of single cell genomes while maintaining sequence accuracy and specificity. Tens of thousands of single cells are compartmentalized in millions of picoliter droplets and then subjected to lysis and WGA by passive droplet fusion in microfluidic channels. Because single cells are isolated in compartments, their genomes are amplified to saturation without contamination. This enables the high-throughput acquisition of contamination-free and cell specific sequence reads from single cells (21,000 single-cells/h), resulting in enhancement of the sequence data quality compared to conventional methods. This method allowed WGA of both single bacterial cells and human cancer cells. The obtained sequencing coverage rivals those of conventional techniques with superior sequence quality. In addition, we also demonstrate de novo assembly of uncultured soil bacteria and obtain draft genomes from single cell sequencing. This sd-MDA is promising for flexible and scalable use in single-cell sequencing.

  1. SuperPhy: predictive genomics for the bacterial pathogen Escherichia coli.

    PubMed

    Whiteside, Matthew D; Laing, Chad R; Manji, Akiff; Kruczkiewicz, Peter; Taboada, Eduardo N; Gannon, Victor P J

    2016-04-12

    Predictive genomics is the translation of raw genome sequence data into a phenotypic assessment of the organism. For bacterial pathogens, these phenotypes can range from environmental survivability, to the severity of human disease. Significant progress has been made in the development of generic tools for genomic analyses that are broadly applicable to all microorganisms; however, a fundamental missing component is the ability to analyze genomic data in the context of organism-specific phenotypic knowledge, which has been accumulated from decades of research and can provide a meaningful interpretation of genome sequence data. In this study, we present SuperPhy, an online predictive genomics platform ( http://lfz.corefacility.ca/superphy/ ) for Escherichia coli. The platform integrates the analytical tools and genome sequence data for all publicly available E. coli genomes and facilitates the upload of new genome sequences from users under public or private settings. SuperPhy provides real-time analyses of thousands of genome sequences with results that are understandable and useful to a wide community, including those in the fields of clinical medicine, epidemiology, ecology, and evolution. SuperPhy includes identification of: 1) virulence and antimicrobial resistance determinants 2) statistical associations between genotypes, biomarkers, geospatial distribution, host, source, and phylogenetic clade; 3) the identification of biomarkers for groups of genomes on the based presence/absence of specific genomic regions and single-nucleotide polymorphisms and 4) in silico Shiga-toxin subtype. SuperPhy is a predictive genomics platform that attempts to provide an essential link between the vast amounts of genome information currently being generated and phenotypic knowledge in an organism-specific context.

  2. Mapping the pericentric heterochromatin by comparative genomic hybridization analysis and chromosome deletions in Drosophila melanogaster

    PubMed Central

    He, Bing; Caudy, Amy; Parsons, Lance; Rosebrock, Adam; Pane, Attilio; Raj, Sandeep; Wieschaus, Eric

    2012-01-01

    Heterochromatin represents a significant portion of eukaryotic genomes and has essential structural and regulatory functions. Its molecular organization is largely unknown due to difficulties in sequencing through and assembling repetitive sequences enriched in the heterochromatin. Here we developed a novel strategy using chromosomal rearrangements and embryonic phenotypes to position unmapped Drosophila melanogaster heterochromatic sequence to specific chromosomal regions. By excluding sequences that can be mapped to the assembled euchromatic arms, we identified sequences that are specific to heterochromatin and used them to design heterochromatin specific probes (“H-probes”) for microarray. By comparative genomic hybridization (CGH) analyses of embryos deficient for each chromosome or chromosome arm, we were able to map most of our H-probes to specific chromosome arms. We also positioned sequences mapped to the second and X chromosomes to finer intervals by analyzing smaller deletions with breakpoints in heterochromatin. Using this approach, we were able to map >40% (13.9 Mb) of the previously unmapped heterochromatin sequences assembled by the whole-genome sequencing effort on arm U and arm Uextra to specific locations. We also identified and mapped 110 kb of novel heterochromatic sequences. Subsequent analyses revealed that sequences located within different heterochromatic regions have distinct properties, such as sequence composition, degree of repetitiveness, and level of underreplication in polytenized tissues. Surprisingly, although heterochromatin is generally considered to be transcriptionally silent, we detected region-specific temporal patterns of transcription in heterochromatin during oogenesis and early embryonic development. Our study provides a useful approach to elucidate the molecular organization and function of heterochromatin and reveals region-specific variation of heterochromatin. PMID:22745230

  3. Lineage-specific genomics: Frequent birth and death in the human genome: The human genome contains many lineage-specific elements created by both sequence and functional turnover.

    PubMed

    Young, Robert S

    2016-07-01

    Frequent evolutionary birth and death events have created a large quantity of biologically important, lineage-specific DNA within mammalian genomes. The birth and death of DNA sequences is so frequent that the total number of these insertions and deletions in the human population remains unknown, although there are differences between these groups, e.g. transposable elements contribute predominantly to sequence insertion. Functional turnover - where the activity of a locus is specific to one lineage, but the underlying DNA remains conserved - can also drive birth and death. However, this does not appear to be a major driver of divergent transcriptional regulation. Both sequence and functional turnover have contributed to the birth and death of thousands of functional promoters in the human and mouse genomes. These findings reveal the pervasive nature of evolutionary birth and death and suggest that lineage-specific regions may play an important but previously underappreciated role in human biology and disease. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.

  4. Development and application of a PCR assay to detect chicken and turkey parvoviruses in commercial poultry flocks in the United States.

    USDA-ARS?s Scientific Manuscript database

    Comparative sequence analysis of six independent chicken and turkey parvovirus nonstructural (NS) genes revealed specific genomic regions with 100% nucleotide sequence identity. A PCR assay with primers targeting these conserved genome sequences proved to be highly specific and sensitive to detect p...

  5. CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites

    PubMed Central

    Naito, Yuki; Hino, Kimihiro; Bono, Hidemasa; Ui-Tei, Kumiko

    2015-01-01

    Summary: CRISPRdirect is a simple and functional web server for selecting rational CRISPR/Cas targets from an input sequence. The CRISPR/Cas system is a promising technique for genome engineering which allows target-specific cleavage of genomic DNA guided by Cas9 nuclease in complex with a guide RNA (gRNA), that complementarily binds to a ∼20 nt targeted sequence. The target sequence requirements are twofold. First, the 5′-NGG protospacer adjacent motif (PAM) sequence must be located adjacent to the target sequence. Second, the target sequence should be specific within the entire genome in order to avoid off-target editing. CRISPRdirect enables users to easily select rational target sequences with minimized off-target sites by performing exhaustive searches against genomic sequences. The server currently incorporates the genomic sequences of human, mouse, rat, marmoset, pig, chicken, frog, zebrafish, Ciona, fruit fly, silkworm, Caenorhabditis elegans, Arabidopsis, rice, Sorghum and budding yeast. Availability: Freely available at http://crispr.dbcls.jp/. Contact: y-naito@dbcls.rois.ac.jp Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25414360

  6. High depth, whole-genome sequencing of cholera isolates from Haiti and the Dominican Republic.

    PubMed

    Sealfon, Rachel; Gire, Stephen; Ellis, Crystal; Calderwood, Stephen; Qadri, Firdausi; Hensley, Lisa; Kellis, Manolis; Ryan, Edward T; LaRocque, Regina C; Harris, Jason B; Sabeti, Pardis C

    2012-09-11

    Whole-genome sequencing is an important tool for understanding microbial evolution and identifying the emergence of functionally important variants over the course of epidemics. In October 2010, a severe cholera epidemic began in Haiti, with additional cases identified in the neighboring Dominican Republic. We used whole-genome approaches to sequence four Vibrio cholerae isolates from Haiti and the Dominican Republic and three additional V. cholerae isolates to a high depth of coverage (>2000x); four of the seven isolates were previously sequenced. Using these sequence data, we examined the effect of depth of coverage and sequencing platform on genome assembly and identification of sequence variants. We found that 50x coverage is sufficient to construct a whole-genome assembly and to accurately call most variants from 100 base pair paired-end sequencing reads. Phylogenetic analysis between the newly sequenced and thirty-three previously sequenced V. cholerae isolates indicates that the Haitian and Dominican Republic isolates are closest to strains from South Asia. The Haitian and Dominican Republic isolates form a tight cluster, with only four variants unique to individual isolates. These variants are located in the CTX region, the SXT region, and the core genome. Of the 126 mutations identified that separate the Haiti-Dominican Republic cluster from the V. cholerae reference strain (N16961), 73 are non-synonymous changes, and a number of these changes cluster in specific genes and pathways. Sequence variant analyses of V. cholerae isolates, including multiple isolates from the Haitian outbreak, identify coverage-specific and technology-specific effects on variant detection, and provide insight into genomic change and functional evolution during an epidemic.

  7. IDENTIFICATION OF AVIAN-SPECIFIC FECAL METAGENOMIC SEQUENCES USING GENOME FRAGMENT ENRICHMENTS

    EPA Science Inventory

    Sequence analysis of microbial genomes has provided biologists the opportunity to compare genetic differences between closely related microorganisms. While random sequencing has also been used to study natural microbial communities, metagenomic comparisons via sequencing analysis...

  8. The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

    PubMed

    Murray, Vincent; Chen, Jon K; Tanaka, Mark M

    2016-07-01

    The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

  9. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  10. A ddRAD-based genetic map and its integration with the genome assembly of Japanese eel (Anguilla japonica) provides insights into genome evolution after the teleost-specific genome duplication

    PubMed Central

    2014-01-01

    Background Recent advancements in next-generation sequencing technology have enabled cost-effective sequencing of whole or partial genomes, permitting the discovery and characterization of molecular polymorphisms. Double-digest restriction-site associated DNA sequencing (ddRAD-seq) is a powerful and inexpensive approach to developing numerous single nucleotide polymorphism (SNP) markers and constructing a high-density genetic map. To enrich genomic resources for Japanese eel (Anguilla japonica), we constructed a ddRAD-based genetic map using an Ion Torrent Personal Genome Machine and anchored scaffolds of the current genome assembly to 19 linkage groups of the Japanese eel. Furthermore, we compared the Japanese eel genome with genomes of model fishes to infer the history of genome evolution after the teleost-specific genome duplication. Results We generated the ddRAD-based linkage map of the Japanese eel, where the maps for female and male spanned 1748.8 cM and 1294.5 cM, respectively, and were arranged into 19 linkage groups. A total of 2,672 SNP markers and 115 Simple Sequence Repeat markers provide anchor points to 1,252 scaffolds covering 151 Mb (13%) of the current genome assembly of the Japanese eel. Comparisons among the Japanese eel, medaka, zebrafish and spotted gar genomes showed highly conserved synteny among teleosts and revealed part of the eight major chromosomal rearrangement events that occurred soon after the teleost-specific genome duplication. Conclusions The ddRAD-seq approach combined with the Ion Torrent Personal Genome Machine sequencing allowed us to conduct efficient and flexible SNP genotyping. The integration of the genetic map and the assembled sequence provides a valuable resource for fine mapping and positional cloning of quantitative trait loci associated with economically important traits and for investigating comparative genomics of the Japanese eel. PMID:24669946

  11. A ddRAD-based genetic map and its integration with the genome assembly of Japanese eel (Anguilla japonica) provides insights into genome evolution after the teleost-specific genome duplication.

    PubMed

    Kai, Wataru; Nomura, Kazuharu; Fujiwara, Atushi; Nakamura, Yoji; Yasuike, Motoshige; Ojima, Nobuhiko; Masaoka, Tetsuji; Ozaki, Akiyuki; Kazeto, Yukinori; Gen, Koichiro; Nagao, Jiro; Tanaka, Hideki; Kobayashi, Takanori; Ototake, Mitsuru

    2014-03-26

    Recent advancements in next-generation sequencing technology have enabled cost-effective sequencing of whole or partial genomes, permitting the discovery and characterization of molecular polymorphisms. Double-digest restriction-site associated DNA sequencing (ddRAD-seq) is a powerful and inexpensive approach to developing numerous single nucleotide polymorphism (SNP) markers and constructing a high-density genetic map. To enrich genomic resources for Japanese eel (Anguilla japonica), we constructed a ddRAD-based genetic map using an Ion Torrent Personal Genome Machine and anchored scaffolds of the current genome assembly to 19 linkage groups of the Japanese eel. Furthermore, we compared the Japanese eel genome with genomes of model fishes to infer the history of genome evolution after the teleost-specific genome duplication. We generated the ddRAD-based linkage map of the Japanese eel, where the maps for female and male spanned 1748.8 cM and 1294.5 cM, respectively, and were arranged into 19 linkage groups. A total of 2,672 SNP markers and 115 Simple Sequence Repeat markers provide anchor points to 1,252 scaffolds covering 151 Mb (13%) of the current genome assembly of the Japanese eel. Comparisons among the Japanese eel, medaka, zebrafish and spotted gar genomes showed highly conserved synteny among teleosts and revealed part of the eight major chromosomal rearrangement events that occurred soon after the teleost-specific genome duplication. The ddRAD-seq approach combined with the Ion Torrent Personal Genome Machine sequencing allowed us to conduct efficient and flexible SNP genotyping. The integration of the genetic map and the assembled sequence provides a valuable resource for fine mapping and positional cloning of quantitative trait loci associated with economically important traits and for investigating comparative genomics of the Japanese eel.

  12. RetroTector online, a rational tool for analysis of retroviral elements in small and medium size vertebrate genomic sequences

    PubMed Central

    Sperber, Göran; Lövgren, Anders; Eriksson, Nils-Einar; Benachenhou, Farid; Blomberg, Jonas

    2009-01-01

    Background The rapid accumulation of genomic information in databases necessitates rapid and specific algorithms for extracting biologically meaningful information. More or less complete retroviral sequences, also called proviral or endogenous retroviral sequences; ERVs, constitutes at least 5% of vertebrate genomes. After infecting the host, these retroviruses have integrated in germ line cells, and have then been carried in genomes for at least several 100 million years. A better understanding of structure and function of these sequences can have profound biological and medical consequences. Methods RetroTector© (ReTe) is a platform-independent Java program for identification and characterization of proviral sequences in vertebrate genomes. The full ReTe requires a local installation with a MySQL database. Although not overly complicated, the installation may take some time. A "light" version of ReTe, (RetroTector online; ROL) which does not require specific installation procedures is provided, via the World Wide Web. Results ROL was implemented under the Batchelor web interface (A Lövgren et al). It allows both GenBank accession number, file and FASTA cut-and-paste admission of sequences (5 to 10 000 kilobases). Up to ten submissions can be done simultaneously, allowing batch analysis of <= 100 Megabases. Jobs are shown in an IP-number specific list. Results are text files, and can be viewed with the program, RetroTectorViewer.jar (at the same site), which has the full graphical capabilities of the basic ReTe program. A detailed analysis of any retroviral sequences found in the submitted sequence is graphically presented, exportable in standard formats. With the current server, a complete analysis of a 1 Megabase sequence is complete in 10 minutes. It is possible to mask nonretroviral repetitive sequences in the submitted sequence, using host genome specific "brooms", which increase specificity. Discussion Proviral sequences can be hard to recognize, especially if the integration occurred many million years ago. Precise delineation of LTR, gag, pro, pol and env can be difficult, requiring manual work. ROL is a way of simplifying these tasks. Conclusion ROL provides 1. annotation and presentation of known retroviral sequences, 2. detection of proviral chains in unknown genomic sequences, with up to 100 Mbase per submission. PMID:19534753

  13. RetroTector online, a rational tool for analysis of retroviral elements in small and medium size vertebrate genomic sequences.

    PubMed

    Sperber, Göran; Lövgren, Anders; Eriksson, Nils-Einar; Benachenhou, Farid; Blomberg, Jonas

    2009-06-16

    The rapid accumulation of genomic information in databases necessitates rapid and specific algorithms for extracting biologically meaningful information. More or less complete retroviral sequences, also called proviral or endogenous retroviral sequences; ERVs, constitutes at least 5% of vertebrate genomes. After infecting the host, these retroviruses have integrated in germ line cells, and have then been carried in genomes for at least several 100 million years. A better understanding of structure and function of these sequences can have profound biological and medical consequences. RetroTector (ReTe) is a platform-independent Java program for identification and characterization of proviral sequences in vertebrate genomes. The full ReTe requires a local installation with a MySQL database. Although not overly complicated, the installation may take some time. A "light" version of ReTe, (RetroTector online; ROL) which does not require specific installation procedures is provided, via the World Wide Web. ROL http://www.fysiologi.neuro.uu.se/jbgs/ was implemented under the Batchelor web interface (A Lövgren et al). It allows both GenBank accession number, file and FASTA cut-and-paste admission of sequences (5 to 10,000 kilobases). Up to ten submissions can be done simultaneously, allowing batch analysis of

  14. MIPS: a database for genomes and protein sequences

    PubMed Central

    Mewes, H. W.; Frishman, D.; Güldener, U.; Mannhaupt, G.; Mayer, K.; Mokrejs, M.; Morgenstern, B.; Münsterkötter, M.; Rudd, S.; Weil, B.

    2002-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF, Neuherberg, Germany) continues to provide genome-related information in a systematic way. MIPS supports both national and European sequencing and functional analysis projects, develops and maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences, and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the databases for the comprehensive set of genomes (PEDANT genomes), the database of annotated human EST clusters (HIB), the database of complete cDNAs from the DHGP (German Human Genome Project), as well as the project specific databases for the GABI (Genome Analysis in Plants) and HNB (Helmholtz–Netzwerk Bioinformatik) networks. The Arabidospsis thaliana database (MATDB), the database of mitochondrial proteins (MITOP) and our contribution to the PIR International Protein Sequence Database have been described elsewhere [Schoof et al. (2002) Nucleic Acids Res., 30, 91–93; Scharfe et al. (2000) Nucleic Acids Res., 28, 155–158; Barker et al. (2001) Nucleic Acids Res., 29, 29–32]. All databases described, the protein analysis tools provided and the detailed descriptions of our projects can be accessed through the MIPS World Wide Web server (http://mips.gsf.de). PMID:11752246

  15. MIPS: a database for genomes and protein sequences.

    PubMed

    Mewes, H W; Frishman, D; Güldener, U; Mannhaupt, G; Mayer, K; Mokrejs, M; Morgenstern, B; Münsterkötter, M; Rudd, S; Weil, B

    2002-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF, Neuherberg, Germany) continues to provide genome-related information in a systematic way. MIPS supports both national and European sequencing and functional analysis projects, develops and maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences, and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the databases for the comprehensive set of genomes (PEDANT genomes), the database of annotated human EST clusters (HIB), the database of complete cDNAs from the DHGP (German Human Genome Project), as well as the project specific databases for the GABI (Genome Analysis in Plants) and HNB (Helmholtz-Netzwerk Bioinformatik) networks. The Arabidospsis thaliana database (MATDB), the database of mitochondrial proteins (MITOP) and our contribution to the PIR International Protein Sequence Database have been described elsewhere [Schoof et al. (2002) Nucleic Acids Res., 30, 91-93; Scharfe et al. (2000) Nucleic Acids Res., 28, 155-158; Barker et al. (2001) Nucleic Acids Res., 29, 29-32]. All databases described, the protein analysis tools provided and the detailed descriptions of our projects can be accessed through the MIPS World Wide Web server (http://mips.gsf.de).

  16. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses

    PubMed Central

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A.; Janke, Axel

    2015-01-01

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. PMID:26019166

  17. Bivalve-specific gene expansion in the pearl oyster genome: implications of adaptation to a sessile lifestyle.

    PubMed

    Takeuchi, Takeshi; Koyanagi, Ryo; Gyoja, Fuki; Kanda, Miyuki; Hisata, Kanako; Fujie, Manabu; Goto, Hiroki; Yamasaki, Shinichi; Nagai, Kiyohito; Morino, Yoshiaki; Miyamoto, Hiroshi; Endo, Kazuyoshi; Endo, Hirotoshi; Nagasawa, Hiromichi; Kinoshita, Shigeharu; Asakawa, Shuichi; Watabe, Shugo; Satoh, Noriyuki; Kawashima, Takeshi

    2016-01-01

    Bivalve molluscs have flourished in marine environments, and many species constitute important aquatic resources. Recently, whole genome sequences from two bivalves, the pearl oyster, Pinctada fucata, and the Pacific oyster, Crassostrea gigas, have been decoded, making it possible to compare genomic sequences among molluscs, and to explore general and lineage-specific genetic features and trends in bivalves. In order to improve the quality of sequence data for these purposes, we have updated the entire P. fucata genome assembly. We present a new genome assembly of the pearl oyster, Pinctada fucata (version 2.0). To update the assembly, we conducted additional sequencing, obtaining accumulated sequence data amounting to 193× the P. fucata genome. Sequence redundancy in contigs that was caused by heterozygosity was removed in silico, which significantly improved subsequent scaffolding. Gene model version 2.0 was generated with the aid of manual gene annotations supplied by the P. fucata research community. Comparison of mollusc and other bilaterian genomes shows that gene arrangements of Hox, ParaHox, and Wnt clusters in the P. fucata genome are similar to those of other molluscs. Like the Pacific oyster, P. fucata possesses many genes involved in environmental responses and in immune defense. Phylogenetic analyses of heat shock protein70 and C1q domain-containing protein families indicate that extensive expansion of genes occurred independently in each lineage. Several gene duplication events prior to the split between the pearl oyster and the Pacific oyster are also evident. In addition, a number of tandem duplications of genes that encode shell matrix proteins are also well characterized in the P. fucata genome. Both the Pinctada and Crassostrea lineages have expanded specific gene families in a lineage-specific manner. Frequent duplication of genes responsible for shell formation in the P. fucata genome explains the diversity of mollusc shell structures. These duplications reveal dynamic genome evolution to forge the complex physiology that enables bivalves to employ a sessile lifestyle in the intertidal zone.

  18. New families of site-specific repetitive DNA sequences that comprise constitutive heterochromatin of the Syrian hamster (Mesocricetus auratus, Cricetinae, Rodentia).

    PubMed

    Yamada, Kazuhiko; Kamimura, Eikichi; Kondo, Mariko; Tsuchiya, Kimiyuki; Nishida-Umehara, Chizuko; Matsuda, Yoichi

    2006-02-01

    We molecularly cloned new families of site-specific repetitive DNA sequences from BglII- and EcoRI-digested genomic DNA of the Syrian hamster (Mesocricetus auratus, Cricetrinae, Rodentia) and characterized them by chromosome in situ hybridization and filter hybridization. They were classified into six different types of repetitive DNA sequence families according to chromosomal distribution and genome organization. The hybridization patterns of the sequences were consistent with the distribution of C-positive bands and/or Hoechst-stained heterochromatin. The centromeric major satellite DNA and sex chromosome-specific and telomeric region-specific repetitive sequences were conserved in the same genus (Mesocricetus) but divergent in different genera. The chromosome-2-specific sequence was conserved in two genera, Mesocricetus and Cricetulus, and a low copy number of repetitive sequences on the heterochromatic chromosome arms were conserved in the subfamily Cricetinae but not in the subfamily Calomyscinae. By contrast, the other type of repetitive sequences on the heterochromatic chromosome arms, which had sequence similarities to a LINE sequence of rodents, was conserved through the three subfamilies, Cricetinae, Calomyscinae and Murinae. The nucleotide divergence of the repetitive sequences of heterochromatin was well correlated with the phylogenetic relationships of the Cricetinae species, and each sequence has been independently amplified and diverged in the same genome.

  19. Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

    PubMed Central

    2011-01-01

    Background BAC-based physical maps provide for sequencing across an entire genome or a selected sub-genomic region of biological interest. Such a region can be approached with next-generation whole-genome sequencing and assembly as if it were an independent small genome. Using the minimum tiling path as a guide, specific BAC clones representing the prioritized genomic interval are selected, pooled, and used to prepare a sequencing library. Results This pooled BAC approach was taken to sequence and assemble a QTL-rich region, of ~3 Mbp and represented by twenty-seven BACs, on linkage group 5 of the Theobroma cacao cv. Matina 1-6 genome. Using various mixtures of read coverages from paired-end and linear 454 libraries, multiple assemblies of varied quality were generated. Quality was assessed by comparing the assembly of 454 reads with a subset of ten BACs individually sequenced and assembled using Sanger reads. A mixture of reads optimal for assembly was identified. We found, furthermore, that a quality assembly suitable for serving as a reference genome template could be obtained even with a reduced depth of sequencing coverage. Annotation of the resulting assembly revealed several genes potentially responsible for three T. cacao traits: black pod disease resistance, bean shape index, and pod weight. Conclusions Our results, as with other pooled BAC sequencing reports, suggest that pooling portions of a minimum tiling path derived from a BAC-based physical map is an effective method to target sub-genomic regions for sequencing. While we focused on a single QTL region, other QTL regions of importance could be similarly sequenced allowing for biological discovery to take place before a high quality whole-genome assembly is completed. PMID:21794110

  20. Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes.

    PubMed

    Feltus, Frank A; Saski, Christopher A; Mockaitis, Keithanne; Haiminen, Niina; Parida, Laxmi; Smith, Zachary; Ford, James; Staton, Margaret E; Ficklin, Stephen P; Blackmon, Barbara P; Cheng, Chun-Huai; Schnell, Raymond J; Kuhn, David N; Motamayor, Juan-Carlos

    2011-07-27

    BAC-based physical maps provide for sequencing across an entire genome or a selected sub-genomic region of biological interest. Such a region can be approached with next-generation whole-genome sequencing and assembly as if it were an independent small genome. Using the minimum tiling path as a guide, specific BAC clones representing the prioritized genomic interval are selected, pooled, and used to prepare a sequencing library. This pooled BAC approach was taken to sequence and assemble a QTL-rich region, of ~3 Mbp and represented by twenty-seven BACs, on linkage group 5 of the Theobroma cacao cv. Matina 1-6 genome. Using various mixtures of read coverages from paired-end and linear 454 libraries, multiple assemblies of varied quality were generated. Quality was assessed by comparing the assembly of 454 reads with a subset of ten BACs individually sequenced and assembled using Sanger reads. A mixture of reads optimal for assembly was identified. We found, furthermore, that a quality assembly suitable for serving as a reference genome template could be obtained even with a reduced depth of sequencing coverage. Annotation of the resulting assembly revealed several genes potentially responsible for three T. cacao traits: black pod disease resistance, bean shape index, and pod weight. Our results, as with other pooled BAC sequencing reports, suggest that pooling portions of a minimum tiling path derived from a BAC-based physical map is an effective method to target sub-genomic regions for sequencing. While we focused on a single QTL region, other QTL regions of importance could be similarly sequenced allowing for biological discovery to take place before a high quality whole-genome assembly is completed.

  1. Comparative Genomics of Completely Sequenced Lactobacillus helveticus Genomes Provides Insights into Strain-Specific Genes and Resolves Metagenomics Data Down to the Strain Level.

    PubMed

    Schmid, Michael; Muri, Jonathan; Melidis, Damianos; Varadarajan, Adithi R; Somerville, Vincent; Wicki, Adrian; Moser, Aline; Bourqui, Marc; Wenzel, Claudia; Eugster-Meier, Elisabeth; Frey, Juerg E; Irmler, Stefan; Ahrens, Christian H

    2018-01-01

    Although complete genome sequences hold particular value for an accurate description of core genomes, the identification of strain-specific genes, and as the optimal basis for functional genomics studies, they are still largely underrepresented in public repositories. Based on an assessment of the genome assembly complexity for all lactobacilli, we used Pacific Biosciences' long read technology to sequence and de novo assemble the genomes of three Lactobacillus helveticus starter strains, raising the number of completely sequenced strains to 12. The first comparative genomics study for L. helveticus -to our knowledge-identified a core genome of 988 genes and sets of unique, strain-specific genes ranging from about 30 to more than 200 genes. Importantly, the comparison of MiSeq- and PacBio-based assemblies uncovered that not only accessory but also core genes can be missed in incomplete genome assemblies based on short reads. Analysis of the three genomes revealed that a large number of pseudogenes were enriched for functional Gene Ontology categories such as amino acid transmembrane transport and carbohydrate metabolism, which is in line with a reductive genome evolution in the rich natural habitat of L. helveticus . Notably, the functional Clusters of Orthologous Groups of proteins categories "cell wall/membrane biogenesis" and "defense mechanisms" were found to be enriched among the strain-specific genes. A genome mining effort uncovered examples where an experimentally observed phenotype could be linked to the underlying genotype, such as for cell envelope proteinase PrtH3 of strain FAM8627. Another possible link identified for peptidoglycan hydrolases will require further experiments. Of note, strain FAM22155 did not harbor a CRISPR/Cas system; its loss was also observed in other L. helveticus strains and lactobacillus species, thus questioning the value of the CRISPR/Cas system for diagnostic purposes. Importantly, the complete genome sequences proved to be very useful for the analysis of natural whey starter cultures with metagenomics, as a larger percentage of the sequenced reads of these complex mixtures could be unambiguously assigned down to the strain level.

  2. Comparative Genomics of Completely Sequenced Lactobacillus helveticus Genomes Provides Insights into Strain-Specific Genes and Resolves Metagenomics Data Down to the Strain Level

    PubMed Central

    Schmid, Michael; Muri, Jonathan; Melidis, Damianos; Varadarajan, Adithi R.; Somerville, Vincent; Wicki, Adrian; Moser, Aline; Bourqui, Marc; Wenzel, Claudia; Eugster-Meier, Elisabeth; Frey, Juerg E.; Irmler, Stefan; Ahrens, Christian H.

    2018-01-01

    Although complete genome sequences hold particular value for an accurate description of core genomes, the identification of strain-specific genes, and as the optimal basis for functional genomics studies, they are still largely underrepresented in public repositories. Based on an assessment of the genome assembly complexity for all lactobacilli, we used Pacific Biosciences' long read technology to sequence and de novo assemble the genomes of three Lactobacillus helveticus starter strains, raising the number of completely sequenced strains to 12. The first comparative genomics study for L. helveticus—to our knowledge—identified a core genome of 988 genes and sets of unique, strain-specific genes ranging from about 30 to more than 200 genes. Importantly, the comparison of MiSeq- and PacBio-based assemblies uncovered that not only accessory but also core genes can be missed in incomplete genome assemblies based on short reads. Analysis of the three genomes revealed that a large number of pseudogenes were enriched for functional Gene Ontology categories such as amino acid transmembrane transport and carbohydrate metabolism, which is in line with a reductive genome evolution in the rich natural habitat of L. helveticus. Notably, the functional Clusters of Orthologous Groups of proteins categories “cell wall/membrane biogenesis” and “defense mechanisms” were found to be enriched among the strain-specific genes. A genome mining effort uncovered examples where an experimentally observed phenotype could be linked to the underlying genotype, such as for cell envelope proteinase PrtH3 of strain FAM8627. Another possible link identified for peptidoglycan hydrolases will require further experiments. Of note, strain FAM22155 did not harbor a CRISPR/Cas system; its loss was also observed in other L. helveticus strains and lactobacillus species, thus questioning the value of the CRISPR/Cas system for diagnostic purposes. Importantly, the complete genome sequences proved to be very useful for the analysis of natural whey starter cultures with metagenomics, as a larger percentage of the sequenced reads of these complex mixtures could be unambiguously assigned down to the strain level. PMID:29441050

  3. Coverage Bias and Sensitivity of Variant Calling for Four Whole-genome Sequencing Technologies

    PubMed Central

    Lasitschka, Bärbel; Jones, David; Northcott, Paul; Hutter, Barbara; Jäger, Natalie; Kool, Marcel; Taylor, Michael; Lichter, Peter; Pfister, Stefan; Wolf, Stephan; Brors, Benedikt; Eils, Roland

    2013-01-01

    The emergence of high-throughput, next-generation sequencing technologies has dramatically altered the way we assess genomes in population genetics and in cancer genomics. Currently, there are four commonly used whole-genome sequencing platforms on the market: Illumina’s HiSeq2000, Life Technologies’ SOLiD 4 and its completely redesigned 5500xl SOLiD, and Complete Genomics’ technology. A number of earlier studies have compared a subset of those sequencing platforms or compared those platforms with Sanger sequencing, which is prohibitively expensive for whole genome studies. Here we present a detailed comparison of the performance of all currently available whole genome sequencing platforms, especially regarding their ability to call SNVs and to evenly cover the genome and specific genomic regions. Unlike earlier studies, we base our comparison on four different samples, allowing us to assess the between-sample variation of the platforms. We find a pronounced GC bias in GC-rich regions for Life Technologies’ platforms, with Complete Genomics performing best here, while we see the least bias in GC-poor regions for HiSeq2000 and 5500xl. HiSeq2000 gives the most uniform coverage and displays the least sample-to-sample variation. In contrast, Complete Genomics exhibits by far the smallest fraction of bases not covered, while the SOLiD platforms reveal remarkable shortcomings, especially in covering CpG islands. When comparing the performance of the four platforms for calling SNPs, HiSeq2000 and Complete Genomics achieve the highest sensitivity, while the SOLiD platforms show the lowest false positive rate. Finally, we find that integrating sequencing data from different platforms offers the potential to combine the strengths of different technologies. In summary, our results detail the strengths and weaknesses of all four whole-genome sequencing platforms. It indicates application areas that call for a specific sequencing platform and disallow other platforms. This helps to identify the proper sequencing platform for whole genome studies with different application scopes. PMID:23776689

  4. Alignment-free genome tree inference by learning group-specific distance metrics.

    PubMed

    Patil, Kaustubh R; McHardy, Alice C

    2013-01-01

    Understanding the evolutionary relationships between organisms is vital for their in-depth study. Gene-based methods are often used to infer such relationships, which are not without drawbacks. One can now attempt to use genome-scale information, because of the ever increasing number of genomes available. This opportunity also presents a challenge in terms of computational efficiency. Two fundamentally different methods are often employed for sequence comparisons, namely alignment-based and alignment-free methods. Alignment-free methods rely on the genome signature concept and provide a computationally efficient way that is also applicable to nonhomologous sequences. The genome signature contains evolutionary signal as it is more similar for closely related organisms than for distantly related ones. We used genome-scale sequence information to infer taxonomic distances between organisms without additional information such as gene annotations. We propose a method to improve genome tree inference by learning specific distance metrics over the genome signature for groups of organisms with similar phylogenetic, genomic, or ecological properties. Specifically, our method learns a Mahalanobis metric for a set of genomes and a reference taxonomy to guide the learning process. By applying this method to more than a thousand prokaryotic genomes, we showed that, indeed, better distance metrics could be learned for most of the 18 groups of organisms tested here. Once a group-specific metric is available, it can be used to estimate the taxonomic distances for other sequenced organisms from the group. This study also presents a large scale comparison between 10 methods--9 alignment-free and 1 alignment-based.

  5. Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

    PubMed Central

    2009-01-01

    Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes. PMID:19656416

  6. Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

    PubMed

    Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

    2009-08-06

    Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes.

  7. Complete genome sequence of Tomato mosaic virus isolated from jasmine in the United States

    USDA-ARS?s Scientific Manuscript database

    Tomato mosaic virus (ToMV) was first identified in jasmine in the U.S. in Florida in 1999. This report provides the first full genome sequence of a ToMV isolate from jasmine. The full genome sequence of this virus will enable research scientists to develop additional specific diagnostic tests for ...

  8. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses.

    PubMed

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A; Janke, Axel

    2015-05-27

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets

    PubMed Central

    Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.

    2013-01-01

    Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147

  10. kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets.

    PubMed

    Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S; Beer, Michael A

    2013-07-01

    Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167-80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org.

  11. Carnivore-specific SINEs (Can-SINEs): distribution, evolution, and genomic impact.

    PubMed

    Walters-Conte, Kathryn B; Johnson, Diana L E; Allard, Marc W; Pecon-Slattery, Jill

    2011-01-01

    Short interspersed nuclear elements (SINEs) are a type of class 1 transposable element (retrotransposon) with features that allow investigators to resolve evolutionary relationships between populations and species while providing insight into genome composition and function. Characterization of a Carnivora-specific SINE family, Can-SINEs, has, has aided comparative genomic studies by providing rare genomic changes, and neutral sequence variants often needed to resolve difficult evolutionary questions. In addition, Can-SINEs constitute a significant source of functional diversity with Carnivora. Publication of the whole-genome sequence of domestic dog, domestic cat, and giant panda serves as a valuable resource in comparative genomic inferences gleaned from Can-SINEs. In anticipation of forthcoming studies bolstered by new genomic data, this review describes the discovery and characterization of Can-SINE motifs as well as describes composition, distribution, and effect on genome function. As the contribution of noncoding sequences to genomic diversity becomes more apparent, SINEs and other transposable elements will play an increasingly large role in mammalian comparative genomics.

  12. Carnivore-Specific SINEs (Can-SINEs): Distribution, Evolution, and Genomic Impact

    PubMed Central

    Johnson, Diana L.E.; Allard, Marc W.; Pecon-Slattery, Jill

    2011-01-01

    Short interspersed nuclear elements (SINEs) are a type of class 1 transposable element (retrotransposon) with features that allow investigators to resolve evolutionary relationships between populations and species while providing insight into genome composition and function. Characterization of a Carnivora-specific SINE family, Can-SINEs, has, has aided comparative genomic studies by providing rare genomic changes, and neutral sequence variants often needed to resolve difficult evolutionary questions. In addition, Can-SINEs constitute a significant source of functional diversity with Carnivora. Publication of the whole-genome sequence of domestic dog, domestic cat, and giant panda serves as a valuable resource in comparative genomic inferences gleaned from Can-SINEs. In anticipation of forthcoming studies bolstered by new genomic data, this review describes the discovery and characterization of Can-SINE motifs as well as describes composition, distribution, and effect on genome function. As the contribution of noncoding sequences to genomic diversity becomes more apparent, SINEs and other transposable elements will play an increasingly large role in mammalian comparative genomics. PMID:21846743

  13. Evolution Analysis of Simple Sequence Repeats in Plant Genome.

    PubMed

    Qin, Zhen; Wang, Yanping; Wang, Qingmei; Li, Aixian; Hou, Fuyun; Zhang, Liming

    2015-01-01

    Simple sequence repeats (SSRs) are widespread units on genome sequences, and play many important roles in plants. In order to reveal the evolution of plant genomes, we investigated the evolutionary regularities of SSRs during the evolution of plant species and the plant kingdom by analysis of twelve sequenced plant genome sequences. First, in the twelve studied plant genomes, the main SSRs were those which contain repeats of 1-3 nucleotides combination. Second, in mononucleotide SSRs, the A/T percentage gradually increased along with the evolution of plants (except for P. patens). With the increase of SSRs repeat number the percentage of A/T in C. reinhardtii had no significant change, while the percentage of A/T in terrestrial plants species gradually declined. Third, in dinucleotide SSRs, the percentage of AT/TA increased along with the evolution of plant kingdom and the repeat number increased in terrestrial plants species. This trend was more obvious in dicotyledon than monocotyledon. The percentage of CG/GC showed the opposite pattern to the AT/TA. Forth, in trinucleotide SSRs, the percentages of combinations including two or three A/T were in a rising trend along with the evolution of plant kingdom; meanwhile with the increase of SSRs repeat number in plants species, different species chose different combinations as dominant SSRs. SSRs in C. reinhardtii, P. patens, Z. mays and A. thaliana showed their specific patterns related to evolutionary position or specific changes of genome sequences. The results showed that, SSRs not only had the general pattern in the evolution of plant kingdom, but also were associated with the evolution of the specific genome sequence. The study of the evolutionary regularities of SSRs provided new insights for the analysis of the plant genome evolution.

  14. From Conventional to Next Generation Sequencing of Epstein-Barr Virus Genomes.

    PubMed

    Kwok, Hin; Chiang, Alan Kwok Shing

    2016-02-24

    Genomic sequences of Epstein-Barr virus (EBV) have been of interest because the virus is associated with cancers, such as nasopharyngeal carcinoma, and conditions such as infectious mononucleosis. The progress of whole-genome EBV sequencing has been limited by the inefficiency and cost of the first-generation sequencing technology. With the advancement of next-generation sequencing (NGS) and target enrichment strategies, increasing number of EBV genomes has been published. These genomes were sequenced using different approaches, either with or without EBV DNA enrichment. This review provides an overview of the EBV genomes published to date, and a description of the sequencing technology and bioinformatic analyses employed in generating these sequences. We further explored ways through which the quality of sequencing data can be improved, such as using DNA oligos for capture hybridization, and longer insert size and read length in the sequencing runs. These advances will enable large-scale genomic sequencing of EBV which will facilitate a better understanding of the genetic variations of EBV in different geographic regions and discovery of potentially pathogenic variants in specific diseases.

  15. Research progress of plant population genomics based on high-throughput sequencing.

    PubMed

    Wang, Yun-sheng

    2016-08-01

    Population genomics, a new paradigm for population genetics, combine the concepts and techniques of genomics with the theoretical system of population genetics and improve our understanding of microevolution through identification of site-specific effect and genome-wide effects using genome-wide polymorphic sites genotypeing. With the appearance and improvement of the next generation high-throughput sequencing technology, the numbers of plant species with complete genome sequences increased rapidly and large scale resequencing has also been carried out in recent years. Parallel sequencing has also been done in some plant species without complete genome sequences. These studies have greatly promoted the development of population genomics and deepened our understanding of the genetic diversity, level of linking disequilibium, selection effect, demographical history and molecular mechanism of complex traits of relevant plant population at a genomic level. In this review, I briely introduced the concept and research methods of population genomics and summarized the research progress of plant population genomics based on high-throughput sequencing. I also discussed the prospect as well as existing problems of plant population genomics in order to provide references for related studies.

  16. Neptune: a bioinformatics tool for rapid discovery of genomic variation in bacterial populations

    PubMed Central

    Marinier, Eric; Zaheer, Rahat; Berry, Chrystal; Weedmark, Kelly A.; Domaratzki, Michael; Mabon, Philip; Knox, Natalie C.; Reimer, Aleisha R.; Graham, Morag R.; Chui, Linda; Patterson-Fortin, Laura; Zhang, Jian; Pagotto, Franco; Farber, Jeff; Mahony, Jim; Seyer, Karine; Bekal, Sadjia; Tremblay, Cécile; Isaac-Renton, Judy; Prystajecky, Natalie; Chen, Jessica; Slade, Peter

    2017-01-01

    Abstract The ready availability of vast amounts of genomic sequence data has created the need to rethink comparative genomics algorithms using ‘big data’ approaches. Neptune is an efficient system for rapidly locating differentially abundant genomic content in bacterial populations using an exact k-mer matching strategy, while accommodating k-mer mismatches. Neptune’s loci discovery process identifies sequences that are sufficiently common to a group of target sequences and sufficiently absent from non-targets using probabilistic models. Neptune uses parallel computing to efficiently identify and extract these loci from draft genome assemblies without requiring multiple sequence alignments or other computationally expensive comparative sequence analyses. Tests on simulated and real datasets showed that Neptune rapidly identifies regions that are both sensitive and specific. We demonstrate that this system can identify trait-specific loci from different bacterial lineages. Neptune is broadly applicable for comparative bacterial analyses, yet will particularly benefit pathogenomic applications, owing to efficient and sensitive discovery of differentially abundant genomic loci. The software is available for download at: http://github.com/phac-nml/neptune. PMID:29048594

  17. Strain/species identification in metagenomes using genome-specific markers

    PubMed Central

    Tu, Qichao; He, Zhili; Zhou, Jizhong

    2014-01-01

    Shotgun metagenome sequencing has become a fast, cheap and high-throughput technology for characterizing microbial communities in complex environments and human body sites. However, accurate identification of microorganisms at the strain/species level remains extremely challenging. We present a novel k-mer-based approach, termed GSMer, that identifies genome-specific markers (GSMs) from currently sequenced microbial genomes, which were then used for strain/species-level identification in metagenomes. Using 5390 sequenced microbial genomes, 8 770 321 50-mer strain-specific and 11 736 360 species-specific GSMs were identified for 4088 strains and 2005 species (4933 strains), respectively. The GSMs were first evaluated against mock community metagenomes, recently sequenced genomes and real metagenomes from different body sites, suggesting that the identified GSMs were specific to their targeting genomes. Sensitivity evaluation against synthetic metagenomes with different coverage suggested that 50 GSMs per strain were sufficient to identify most microbial strains with ≥0.25× coverage, and 10% of selected GSMs in a database should be detected for confident positive callings. Application of GSMs identified 45 and 74 microbial strains/species significantly associated with type 2 diabetes patients and obese/lean individuals from corresponding gastrointestinal tract metagenomes, respectively. Our result agreed with previous studies but provided strain-level information. The approach can be directly applied to identify microbial strains/species from raw metagenomes, without the effort of complex data pre-processing. PMID:24523352

  18. The complete genome sequencing of Prevotella intermedia strain OMA14 and a subsequent fine-scale, intra-species genomic comparison reveal an unusual amplification of conjugative and mobile transposons and identify a novel Prevotella-lineage-specific repeat

    PubMed Central

    Naito, Mariko; Ogura, Yoshitoshi; Itoh, Takehiko; Shoji, Mikio; Okamoto, Masaaki; Hayashi, Tetsuya; Nakayama, Koji

    2016-01-01

    Prevotella intermedia is a pathogenic bacterium involved in periodontal diseases. Here, we present the complete genome sequence of a clinical strain, OMA14, of this bacterium along with the results of comparative genome analysis with strain 17 of the same species whose genome has also been sequenced, but not fully analysed yet. The genomes of both strains consist of two circular chromosomes: the larger chromosomes are similar in size and exhibit a high overall linearity of gene organizations, whereas the smaller chromosomes show a significant size variation and have undergone remarkable genome rearrangements. Unique features of the Pre. intermedia genomes are the presence of a remarkable number of essential genes on the second chromosomes and the abundance of conjugative and mobilizable transposons (CTns and MTns). The CTns/MTns are particularly abundant in the second chromosomes, involved in its extensive genome rearrangement, and have introduced a number of strain-specific genes into each strain. We also found a novel 188-bp repeat sequence that has been highly amplified in Pre. intermedia and are specifically distributed among the Pre. intermedia-related species. These findings expand our understanding of the genetic features of Pre. intermedia and the roles of CTns and MTns in the evolution of bacteria. PMID:26645327

  19. The Genome sequences of four non-human/non-clinical Salmonella enterica serovar Kentucky ST198 isolates recovered between 1972 and 1973

    USDA-ARS?s Scientific Manuscript database

    Salmonella Kentucky is a polyphyletic member of S. enterica subclade A1 with multiple sequence types that often colonize the same hosts but in different frequencies on different continents. To evaluate the genomic features involved in S. Kentucky host specificity we sequenced the genomes of four iso...

  20. Genome assembly reborn: recent computational challenges

    PubMed Central

    2009-01-01

    Research into genome assembly algorithms has experienced a resurgence due to new challenges created by the development of next generation sequencing technologies. Several genome assemblers have been published in recent years specifically targeted at the new sequence data; however, the ever-changing technological landscape leads to the need for continued research. In addition, the low cost of next generation sequencing data has led to an increased use of sequencing in new settings. For example, the new field of metagenomics relies on large-scale sequencing of entire microbial communities instead of isolate genomes, leading to new computational challenges. In this article, we outline the major algorithmic approaches for genome assembly and describe recent developments in this domain. PMID:19482960

  1. Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

    PubMed Central

    Bergman, Casey M.; Haddrill, Penelope R.

    2015-01-01

    To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center. PMID:25717372

  2. Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

    PubMed

    Bergman, Casey M; Haddrill, Penelope R

    2015-01-01

    To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center.

  3. Sequence comparison of prefrontal cortical brain transcriptome from a tame and an aggressive silver fox (Vulpes vulpes).

    PubMed

    Kukekova, Anna V; Johnson, Jennifer L; Teiling, Clotilde; Li, Lewyn; Oskina, Irina N; Kharlamova, Anastasiya V; Gulevich, Rimma G; Padte, Ravee; Dubreuil, Michael M; Vladimirova, Anastasiya V; Shepeleva, Darya V; Shikhevich, Svetlana G; Sun, Qi; Ponnala, Lalit; Temnykh, Svetlana V; Trut, Lyudmila N; Acland, Gregory M

    2011-10-03

    Two strains of the silver fox (Vulpes vulpes), with markedly different behavioral phenotypes, have been developed by long-term selection for behavior. Foxes from the tame strain exhibit friendly behavior towards humans, paralleling the sociability of canine puppies, whereas foxes from the aggressive strain are defensive and exhibit aggression to humans. To understand the genetic differences underlying these behavioral phenotypes fox-specific genomic resources are needed. cDNA from mRNA from pre-frontal cortex of a tame and an aggressive fox was sequenced using the Roche 454 FLX Titanium platform (> 2.5 million reads & 0.9 Gbase of tame fox sequence; >3.3 million reads & 1.2 Gbase of aggressive fox sequence). Over 80% of the fox reads were assembled into contigs. Mapping fox reads against the fox transcriptome assembly and the dog genome identified over 30,000 high confidence fox-specific SNPs. Fox transcripts for approximately 14,000 genes were identified using SwissProt and the dog RefSeq databases. An at least 2-fold expression difference between the two samples (p < 0.05) was observed for 335 genes, fewer than 3% of the total number of genes identified in the fox transcriptome. Transcriptome sequencing significantly expanded genomic resources available for the fox, a species without a sequenced genome. In a very cost efficient manner this yielded a large number of fox-specific SNP markers for genetic studies and provided significant insights into the gene expression profile of the fox pre-frontal cortex; expression differences between the two fox samples; and a catalogue of potentially important gene-specific sequence variants. This result demonstrates the utility of this approach for developing genomic resources in species with limited genomic information.

  4. Sequence comparison of prefrontal cortical brain transcriptome from a tame and an aggressive silver fox (Vulpes vulpes)

    PubMed Central

    2011-01-01

    Background Two strains of the silver fox (Vulpes vulpes), with markedly different behavioral phenotypes, have been developed by long-term selection for behavior. Foxes from the tame strain exhibit friendly behavior towards humans, paralleling the sociability of canine puppies, whereas foxes from the aggressive strain are defensive and exhibit aggression to humans. To understand the genetic differences underlying these behavioral phenotypes fox-specific genomic resources are needed. Results cDNA from mRNA from pre-frontal cortex of a tame and an aggressive fox was sequenced using the Roche 454 FLX Titanium platform (> 2.5 million reads & 0.9 Gbase of tame fox sequence; >3.3 million reads & 1.2 Gbase of aggressive fox sequence). Over 80% of the fox reads were assembled into contigs. Mapping fox reads against the fox transcriptome assembly and the dog genome identified over 30,000 high confidence fox-specific SNPs. Fox transcripts for approximately 14,000 genes were identified using SwissProt and the dog RefSeq databases. An at least 2-fold expression difference between the two samples (p < 0.05) was observed for 335 genes, fewer than 3% of the total number of genes identified in the fox transcriptome. Conclusions Transcriptome sequencing significantly expanded genomic resources available for the fox, a species without a sequenced genome. In a very cost efficient manner this yielded a large number of fox-specific SNP markers for genetic studies and provided significant insights into the gene expression profile of the fox pre-frontal cortex; expression differences between the two fox samples; and a catalogue of potentially important gene-specific sequence variants. This result demonstrates the utility of this approach for developing genomic resources in species with limited genomic information. PMID:21967120

  5. Origin of the Y genome in Elymus and its relationship to other genomes in Triticeae based on evidence from elongation factor G (EF-G) gene sequences.

    PubMed

    Sun, Genlou; Komatsuda, Takao

    2010-08-01

    It is well known that Elymus arose through hybridization between representatives of different genera. Cytogenetic analyses show that all its members include the St genome in combination with one or more of four other genomes, the H, Y, P, and W genomes. The origins of the H, P, and W genomes are known, but not for the Y genome. We analyzed the single copy nuclear gene coding for elongation factor G (EF-G) from 28 accessions of polyploid Elymus species and 45 accessions of diploid Triticeae species in order to investigate origin of the Y genome and its relationship to other genomes in the tribe Triticeae. Sequence comparisons among the St, H, Y, P, W, and E genomes detected genome-specific polymorphisms at 66 nucleotide positions. The St and Y genomes are relatively dissimilar. The phylogeny of the Y genome sequences was investigated for the first time. They were most similar to the W genome sequences. The Y genome sequences were placed in two different groups. These two groups were included in an unresolved clade that included the W and E sequences as well as sequences from many annual species. The H genomes sequences were in a clade with the F, P, and Ns genome sequences as sister groups. These two clades were more closely related to each other and to the L and Xp genomes than they were to the St genome sequences. These data support the hypothesis that the Y genome evolved in a diploid species and has a different origin from the St genome. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

    PubMed Central

    Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

    2006-01-01

    Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

  7. Genomic Sequence and Experimental Tractability of a New Decapod Shrimp Model, Neocaridina denticulata

    PubMed Central

    Kenny, Nathan J.; Sin, Yung Wa; Shen, Xin; Zhe, Qu; Wang, Wei; Chan, Ting Fung; Tobe, Stephen S.; Shimeld, Sebastian M.; Chu, Ka Hou; Hui, Jerome H. L.

    2014-01-01

    The speciose Crustacea is the largest subphylum of arthropods on the planet after the Insecta. To date, however, the only publically available sequenced crustacean genome is that of the water flea, Daphnia pulex, a member of the Branchiopoda. While Daphnia is a well-established ecotoxicological model, previous study showed that one-third of genes contained in its genome are lineage-specific and could not be identified in any other metazoan genomes. To better understand the genomic evolution of crustaceans and arthropods, we have sequenced the genome of a novel shrimp model, Neocaridina denticulata, and tested its experimental malleability. A library of 170-bp nominal fragment size was constructed from DNA of a starved single adult and sequenced using the Illumina HiSeq2000 platform. Core eukaryotic genes, the mitochondrial genome, developmental patterning genes (such as Hox) and microRNA processing pathway genes are all present in this animal, suggesting it has not undergone massive genomic loss. Comparison with the published genome of Daphnia pulex has allowed us to reveal 3750 genes that are indeed specific to the lineage containing malacostracans and branchiopods, rather than Daphnia-specific (E-value: 10−6). We also show the experimental tractability of N. denticulata, which, together with the genomic resources presented here, make it an ideal model for a wide range of further aquacultural, developmental, ecotoxicological, food safety, genetic, hormonal, physiological and reproductive research, allowing better understanding of the evolution of crustaceans and other arthropods. PMID:24619275

  8. The genome sequence of taurine cattle: a window to ruminant biology and evolution.

    PubMed

    Elsik, Christine G; Tellam, Ross L; Worley, Kim C; Gibbs, Richard A; Muzny, Donna M; Weinstock, George M; Adelson, David L; Eichler, Evan E; Elnitski, Laura; Guigó, Roderic; Hamernik, Debora L; Kappes, Steve M; Lewin, Harris A; Lynn, David J; Nicholas, Frank W; Reymond, Alexandre; Rijnkels, Monique; Skow, Loren C; Zdobnov, Evgeny M; Schook, Lawrence; Womack, James; Alioto, Tyler; Antonarakis, Stylianos E; Astashyn, Alex; Chapple, Charles E; Chen, Hsiu-Chuan; Chrast, Jacqueline; Câmara, Francisco; Ermolaeva, Olga; Henrichsen, Charlotte N; Hlavina, Wratko; Kapustin, Yuri; Kiryutin, Boris; Kitts, Paul; Kokocinski, Felix; Landrum, Melissa; Maglott, Donna; Pruitt, Kim; Sapojnikov, Victor; Searle, Stephen M; Solovyev, Victor; Souvorov, Alexandre; Ucla, Catherine; Wyss, Carine; Anzola, Juan M; Gerlach, Daniel; Elhaik, Eran; Graur, Dan; Reese, Justin T; Edgar, Robert C; McEwan, John C; Payne, Gemma M; Raison, Joy M; Junier, Thomas; Kriventseva, Evgenia V; Eyras, Eduardo; Plass, Mireya; Donthu, Ravikiran; Larkin, Denis M; Reecy, James; Yang, Mary Q; Chen, Lin; Cheng, Ze; Chitko-McKown, Carol G; Liu, George E; Matukumalli, Lakshmi K; Song, Jiuzhou; Zhu, Bin; Bradley, Daniel G; Brinkman, Fiona S L; Lau, Lilian P L; Whiteside, Matthew D; Walker, Angela; Wheeler, Thomas T; Casey, Theresa; German, J Bruce; Lemay, Danielle G; Maqbool, Nauman J; Molenaar, Adrian J; Seo, Seongwon; Stothard, Paul; Baldwin, Cynthia L; Baxter, Rebecca; Brinkmeyer-Langford, Candice L; Brown, Wendy C; Childers, Christopher P; Connelley, Timothy; Ellis, Shirley A; Fritz, Krista; Glass, Elizabeth J; Herzig, Carolyn T A; Iivanainen, Antti; Lahmers, Kevin K; Bennett, Anna K; Dickens, C Michael; Gilbert, James G R; Hagen, Darren E; Salih, Hanni; Aerts, Jan; Caetano, Alexandre R; Dalrymple, Brian; Garcia, Jose Fernando; Gill, Clare A; Hiendleder, Stefan G; Memili, Erdogan; Spurlock, Diane; Williams, John L; Alexander, Lee; Brownstein, Michael J; Guan, Leluo; Holt, Robert A; Jones, Steven J M; Marra, Marco A; Moore, Richard; Moore, Stephen S; Roberts, Andy; Taniguchi, Masaaki; Waterman, Richard C; Chacko, Joseph; Chandrabose, Mimi M; Cree, Andy; Dao, Marvin Diep; Dinh, Huyen H; Gabisi, Ramatu Ayiesha; Hines, Sandra; Hume, Jennifer; Jhangiani, Shalini N; Joshi, Vandita; Kovar, Christie L; Lewis, Lora R; Liu, Yih-Shin; Lopez, John; Morgan, Margaret B; Nguyen, Ngoc Bich; Okwuonu, Geoffrey O; Ruiz, San Juana; Santibanez, Jireh; Wright, Rita A; Buhay, Christian; Ding, Yan; Dugan-Rocha, Shannon; Herdandez, Judith; Holder, Michael; Sabo, Aniko; Egan, Amy; Goodell, Jason; Wilczek-Boney, Katarzyna; Fowler, Gerald R; Hitchens, Matthew Edward; Lozado, Ryan J; Moen, Charles; Steffen, David; Warren, James T; Zhang, Jingkun; Chiu, Readman; Schein, Jacqueline E; Durbin, K James; Havlak, Paul; Jiang, Huaiyang; Liu, Yue; Qin, Xiang; Ren, Yanru; Shen, Yufeng; Song, Henry; Bell, Stephanie Nicole; Davis, Clay; Johnson, Angela Jolivet; Lee, Sandra; Nazareth, Lynne V; Patel, Bella Mayurkumar; Pu, Ling-Ling; Vattathil, Selina; Williams, Rex Lee; Curry, Stacey; Hamilton, Cerissa; Sodergren, Erica; Wheeler, David A; Barris, Wes; Bennett, Gary L; Eggen, André; Green, Ronnie D; Harhay, Gregory P; Hobbs, Matthew; Jann, Oliver; Keele, John W; Kent, Matthew P; Lien, Sigbjørn; McKay, Stephanie D; McWilliam, Sean; Ratnakumar, Abhirami; Schnabel, Robert D; Smith, Timothy; Snelling, Warren M; Sonstegard, Tad S; Stone, Roger T; Sugimoto, Yoshikazu; Takasuga, Akiko; Taylor, Jeremy F; Van Tassell, Curtis P; Macneil, Michael D; Abatepaulo, Antonio R R; Abbey, Colette A; Ahola, Virpi; Almeida, Iassudara G; Amadio, Ariel F; Anatriello, Elen; Bahadue, Suria M; Biase, Fernando H; Boldt, Clayton R; Carroll, Jeffery A; Carvalho, Wanessa A; Cervelatti, Eliane P; Chacko, Elsa; Chapin, Jennifer E; Cheng, Ye; Choi, Jungwoo; Colley, Adam J; de Campos, Tatiana A; De Donato, Marcos; Santos, Isabel K F de Miranda; de Oliveira, Carlo J F; Deobald, Heather; Devinoy, Eve; Donohue, Kaitlin E; Dovc, Peter; Eberlein, Annett; Fitzsimmons, Carolyn J; Franzin, Alessandra M; Garcia, Gustavo R; Genini, Sem; Gladney, Cody J; Grant, Jason R; Greaser, Marion L; Green, Jonathan A; Hadsell, Darryl L; Hakimov, Hatam A; Halgren, Rob; Harrow, Jennifer L; Hart, Elizabeth A; Hastings, Nicola; Hernandez, Marta; Hu, Zhi-Liang; Ingham, Aaron; Iso-Touru, Terhi; Jamis, Catherine; Jensen, Kirsty; Kapetis, Dimos; Kerr, Tovah; Khalil, Sari S; Khatib, Hasan; Kolbehdari, Davood; Kumar, Charu G; Kumar, Dinesh; Leach, Richard; Lee, Justin C-M; Li, Changxi; Logan, Krystin M; Malinverni, Roberto; Marques, Elisa; Martin, William F; Martins, Natalia F; Maruyama, Sandra R; Mazza, Raffaele; McLean, Kim L; Medrano, Juan F; Moreno, Barbara T; Moré, Daniela D; Muntean, Carl T; Nandakumar, Hari P; Nogueira, Marcelo F G; Olsaker, Ingrid; Pant, Sameer D; Panzitta, Francesca; Pastor, Rosemeire C P; Poli, Mario A; Poslusny, Nathan; Rachagani, Satyanarayana; Ranganathan, Shoba; Razpet, Andrej; Riggs, Penny K; Rincon, Gonzalo; Rodriguez-Osorio, Nelida; Rodriguez-Zas, Sandra L; Romero, Natasha E; Rosenwald, Anne; Sando, Lillian; Schmutz, Sheila M; Shen, Libing; Sherman, Laura; Southey, Bruce R; Lutzow, Ylva Strandberg; Sweedler, Jonathan V; Tammen, Imke; Telugu, Bhanu Prakash V L; Urbanski, Jennifer M; Utsunomiya, Yuri T; Verschoor, Chris P; Waardenberg, Ashley J; Wang, Zhiquan; Ward, Robert; Weikard, Rosemarie; Welsh, Thomas H; White, Stephen N; Wilming, Laurens G; Wunderlich, Kris R; Yang, Jianqi; Zhao, Feng-Qi

    2009-04-24

    To understand the biology and evolution of ruminants, the cattle genome was sequenced to about sevenfold coverage. The cattle genome contains a minimum of 22,000 genes, with a core set of 14,345 orthologs shared among seven mammalian species of which 1217 are absent or undetected in noneutherian (marsupial or monotreme) genomes. Cattle-specific evolutionary breakpoint regions in chromosomes have a higher density of segmental duplications, enrichment of repetitive elements, and species-specific variations in genes associated with lactation and immune responsiveness. Genes involved in metabolism are generally highly conserved, although five metabolic genes are deleted or extensively diverged from their human orthologs. The cattle genome sequence thus provides a resource for understanding mammalian evolution and accelerating livestock genetic improvement for milk and meat production.

  9. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    PubMed

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was shared by mitochondrial genomes of CMS and male-fertile pepper lines, extensive genome rearrangements were detected. CMS candidate genes located on the edges of highly-rearranged CMS-specific DNA regions and near to repeat sequences. These characteristics were detected among CMS-associated genes in other species, implying a common mechanism might be involved in the evolution of CMS-associated genes.

  10. UFO: a web server for ultra-fast functional profiling of whole genome protein sequences.

    PubMed

    Meinicke, Peter

    2009-09-02

    Functional profiling is a key technique to characterize and compare the functional potential of entire genomes. The estimation of profiles according to an assignment of sequences to functional categories is a computationally expensive task because it requires the comparison of all protein sequences from a genome with a usually large database of annotated sequences or sequence families. Based on machine learning techniques for Pfam domain detection, the UFO web server for ultra-fast functional profiling allows researchers to process large protein sequence collections instantaneously. Besides the frequencies of Pfam and GO categories, the user also obtains the sequence specific assignments to Pfam domain families. In addition, a comparison with existing genomes provides dissimilarity scores with respect to 821 reference proteomes. Considering the underlying UFO domain detection, the results on 206 test genomes indicate a high sensitivity of the approach. In comparison with current state-of-the-art HMMs, the runtime measurements show a considerable speed up in the range of four orders of magnitude. For an average size prokaryotic genome, the computation of a functional profile together with its comparison typically requires about 10 seconds of processing time. For the first time the UFO web server makes it possible to get a quick overview on the functional inventory of newly sequenced organisms. The genome scale comparison with a large number of precomputed profiles allows a first guess about functionally related organisms. The service is freely available and does not require user registration or specification of a valid email address.

  11. Genome Sequences of Shewanella baltica and Shewanella morhuae Strains Isolated from the Gastrointestinal Tract of Freshwater Fish.

    PubMed

    Castillo, Daniel; Gram, Lone; Dailey, Frank E

    2018-06-21

    We present here the genome sequences of Shewanella baltica strain CW2 and Shewanella morhuae strain CW7, isolated from the gastrointestinal tract of Salvelinus namaycush (lean lake trout) and Coregonus clupeaformis (whitefish), respectively. These genome sequences provide insights into the niche adaptation of these specific species in freshwater systems. Copyright © 2018 Castillo et al.

  12. Lineage-Specific Biology Revealed by a Finished Genome Assembly of the Mouse

    PubMed Central

    Hillier, LaDeana W.; Zody, Michael C.; Goldstein, Steve; She, Xinwe; Bult, Carol J.; Agarwala, Richa; Cherry, Joshua L.; DiCuccio, Michael; Hlavina, Wratko; Kapustin, Yuri; Meric, Peter; Maglott, Donna; Birtle, Zoë; Marques, Ana C.; Graves, Tina; Zhou, Shiguo; Teague, Brian; Potamousis, Konstantinos; Churas, Christopher; Place, Michael; Herschleb, Jill; Runnheim, Ron; Forrest, Daniel; Amos-Landgraf, James; Schwartz, David C.; Cheng, Ze; Lindblad-Toh, Kerstin; Eichler, Evan E.; Ponting, Chris P.

    2009-01-01

    The mouse (Mus musculus) is the premier animal model for understanding human disease and development. Here we show that a comprehensive understanding of mouse biology is only possible with the availability of a finished, high-quality genome assembly. The finished clone-based assembly of the mouse strain C57BL/6J reported here has over 175,000 fewer gaps and over 139 Mb more of novel sequence, compared with the earlier MGSCv3 draft genome assembly. In a comprehensive analysis of this revised genome sequence, we are now able to define 20,210 protein-coding genes, over a thousand more than predicted in the human genome (19,042 genes). In addition, we identified 439 long, non–protein-coding RNAs with evidence for transcribed orthologs in human. We analyzed the complex and repetitive landscape of 267 Mb of sequence that was missing or misassembled in the previously published assembly, and we provide insights into the reasons for its resistance to sequencing and assembly by whole-genome shotgun approaches. Duplicated regions within newly assembled sequence tend to be of more recent ancestry than duplicates in the published draft, correcting our initial understanding of recent evolution on the mouse lineage. These duplicates appear to be largely composed of sequence regions containing transposable elements and duplicated protein-coding genes; of these, some may be fixed in the mouse population, but at least 40% of segmentally duplicated sequences are copy number variable even among laboratory mouse strains. Mouse lineage-specific regions contain 3,767 genes drawn mainly from rapidly-changing gene families associated with reproductive functions. The finished mouse genome assembly, therefore, greatly improves our understanding of rodent-specific biology and allows the delineation of ancestral biological functions that are shared with human from derived functions that are not. PMID:19468303

  13. A new strategy for genome assembly using short sequence reads and reduced representation libraries.

    PubMed

    Young, Andrew L; Abaan, Hatice Ozel; Zerbino, Daniel; Mullikin, James C; Birney, Ewan; Margulies, Elliott H

    2010-02-01

    We have developed a novel approach for using massively parallel short-read sequencing to generate fast and inexpensive de novo genomic assemblies comparable to those generated by capillary-based methods. The ultrashort (<100 base) sequences generated by this technology pose specific biological and computational challenges for de novo assembly of large genomes. To account for this, we devised a method for experimentally partitioning the genome using reduced representation (RR) libraries prior to assembly. We use two restriction enzymes independently to create a series of overlapping fragment libraries, each containing a tractable subset of the genome. Together, these libraries allow us to reassemble the entire genome without the need of a reference sequence. As proof of concept, we applied this approach to sequence and assembled the majority of the 125-Mb Drosophila melanogaster genome. We subsequently demonstrate the accuracy of our assembly method with meaningful comparisons against the current available D. melanogaster reference genome (dm3). The ease of assembly and accuracy for comparative genomics suggest that our approach will scale to future mammalian genome-sequencing efforts, saving both time and money without sacrificing quality.

  14. AGAPE (Automated Genome Analysis PipelinE) for Pan-Genome Analysis of Saccharomyces cerevisiae

    PubMed Central

    Song, Giltae; Dickins, Benjamin J. A.; Demeter, Janos; Engel, Stacia; Dunn, Barbara; Cherry, J. Michael

    2015-01-01

    The characterization and public release of genome sequences from thousands of organisms is expanding the scope for genetic variation studies. However, understanding the phenotypic consequences of genetic variation remains a challenge in eukaryotes due to the complexity of the genotype-phenotype map. One approach to this is the intensive study of model systems for which diverse sources of information can be accumulated and integrated. Saccharomyces cerevisiae is an extensively studied model organism, with well-known protein functions and thoroughly curated phenotype data. To develop and expand the available resources linking genomic variation with function in yeast, we aim to model the pan-genome of S. cerevisiae. To initiate the yeast pan-genome, we newly sequenced or re-sequenced the genomes of 25 strains that are commonly used in the yeast research community using advanced sequencing technology at high quality. We also developed a pipeline for automated pan-genome analysis, which integrates the steps of assembly, annotation, and variation calling. To assign strain-specific functional annotations, we identified genes that were not present in the reference genome. We classified these according to their presence or absence across strains and characterized each group of genes with known functional and phenotypic features. The functional roles of novel genes not found in the reference genome and associated with strains or groups of strains appear to be consistent with anticipated adaptations in specific lineages. As more S. cerevisiae strain genomes are released, our analysis can be used to collate genome data and relate it to lineage-specific patterns of genome evolution. Our new tool set will enhance our understanding of genomic and functional evolution in S. cerevisiae, and will be available to the yeast genetics and molecular biology community. PMID:25781462

  15. BioNano genome mapping of individual chromosomes supports physical mapping and sequence assembly in complex plant genomes.

    PubMed

    Staňková, Helena; Hastie, Alex R; Chan, Saki; Vrána, Jan; Tulpová, Zuzana; Kubaláková, Marie; Visendi, Paul; Hayashi, Satomi; Luo, Mingcheng; Batley, Jacqueline; Edwards, David; Doležel, Jaroslav; Šimková, Hana

    2016-07-01

    The assembly of a reference genome sequence of bread wheat is challenging due to its specific features such as the genome size of 17 Gbp, polyploid nature and prevalence of repetitive sequences. BAC-by-BAC sequencing based on chromosomal physical maps, adopted by the International Wheat Genome Sequencing Consortium as the key strategy, reduces problems caused by the genome complexity and polyploidy, but the repeat content still hampers the sequence assembly. Availability of a high-resolution genomic map to guide sequence scaffolding and validate physical map and sequence assemblies would be highly beneficial to obtaining an accurate and complete genome sequence. Here, we chose the short arm of chromosome 7D (7DS) as a model to demonstrate for the first time that it is possible to couple chromosome flow sorting with genome mapping in nanochannel arrays and create a de novo genome map of a wheat chromosome. We constructed a high-resolution chromosome map composed of 371 contigs with an N50 of 1.3 Mb. Long DNA molecules achieved by our approach facilitated chromosome-scale analysis of repetitive sequences and revealed a ~800-kb array of tandem repeats intractable to current DNA sequencing technologies. Anchoring 7DS sequence assemblies obtained by clone-by-clone sequencing to the 7DS genome map provided a valuable tool to improve the BAC-contig physical map and validate sequence assembly on a chromosome-arm scale. Our results indicate that creating genome maps for the whole wheat genome in a chromosome-by-chromosome manner is feasible and that they will be an affordable tool to support the production of improved pseudomolecules. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Comparative genomic analysis of bacteriophages specific to the channel catfish pathogen Edwardsiella ictaluri

    PubMed Central

    2011-01-01

    Background The bacterial pathogen Edwardsiella ictaluri is a primary cause of mortality in channel catfish raised commercially in aquaculture farms. Additional treatment and diagnostic regimes are needed for this enteric pathogen, motivating the discovery and characterization of bacteriophages specific to E. ictaluri. Results The genomes of three Edwardsiella ictaluri-specific bacteriophages isolated from geographically distant aquaculture ponds, at different times, were sequenced and analyzed. The genomes for phages eiAU, eiDWF, and eiMSLS are 42.80 kbp, 42.12 kbp, and 42.69 kbp, respectively, and are greater than 95% identical to each other at the nucleotide level. Nucleotide differences were mostly observed in non-coding regions and in structural proteins, with significant variability in the sequences of putative tail fiber proteins. The genome organization of these phages exhibit a pattern shared by other Siphoviridae. Conclusions These E. ictaluri-specific phage genomes reveal considerable conservation of genomic architecture and sequence identity, even with considerable temporal and spatial divergence in their isolation. Their genomic homogeneity is similarly observed among E. ictaluri bacterial isolates. The genomic analysis of these phages supports the conclusion that these are virulent phages, lacking the capacity for lysogeny or expression of virulence genes. This study contributes to our knowledge of phage genomic diversity and facilitates studies on the diagnostic and therapeutic applications of these phages. PMID:21214923

  17. Illustrative case studies in the return of exome and genome sequencing results

    PubMed Central

    Amendola, Laura M; Lautenbach, Denise; Scollon, Sarah; Bernhardt, Barbara; Biswas, Sawona; East, Kelly; Everett, Jessica; Gilmore, Marian J; Himes, Patricia; Raymond, Victoria M; Wynn, Julia; Hart, Ragan; Jarvik, Gail P

    2015-01-01

    Whole genome and exome sequencing tests are increasingly being ordered in clinical practice, creating a need for research exploring the return of results from these tests. A goal of the Clinical Sequencing and Exploratory Research (CSER) consortium is to gain experience with this process to develop best practice recommendations for offering exome and genome testing and returning results. Genetic counselors in the CSER consortium have an integral role in the return of results from these genomic sequencing tests and have gained valuable insight. We present seven emerging themes related to return of exome and genome sequencing results accompanied by case descriptions illustrating important lessons learned, counseling challenges specific to these tests and considerations for future research and practice. PMID:26478737

  18. Noncoding sequence classification based on wavelet transform analysis: part I

    NASA Astrophysics Data System (ADS)

    Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

    2017-09-01

    DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

  19. Progress of targeted genome modification approaches in higher plants.

    PubMed

    Cardi, Teodoro; Neal Stewart, C

    2016-07-01

    Transgene integration in plants is based on illegitimate recombination between non-homologous sequences. The low control of integration site and number of (trans/cis)gene copies might have negative consequences on the expression of transferred genes and their insertion within endogenous coding sequences. The first experiments conducted to use precise homologous recombination for gene integration commenced soon after the first demonstration that transgenic plants could be produced. Modern transgene targeting categories used in plant biology are: (a) homologous recombination-dependent gene targeting; (b) recombinase-mediated site-specific gene integration; (c) oligonucleotide-directed mutagenesis; (d) nuclease-mediated site-specific genome modifications. New tools enable precise gene replacement or stacking with exogenous sequences and targeted mutagenesis of endogeneous sequences. The possibility to engineer chimeric designer nucleases, which are able to target virtually any genomic site, and use them for inducing double-strand breaks in host DNA create new opportunities for both applied plant breeding and functional genomics. CRISPR is the most recent technology available for precise genome editing. Its rapid adoption in biological research is based on its inherent simplicity and efficacy. Its utilization, however, depends on available sequence information, especially for genome-wide analysis. We will review the approaches used for genome modification, specifically those for affecting gene integration and modification in higher plants. For each approach, the advantages and limitations will be noted. We also will speculate on how their actual commercial development and implementation in plant breeding will be affected by governmental regulations.

  20. The complete genome sequencing of Prevotella intermedia strain OMA14 and a subsequent fine-scale, intra-species genomic comparison reveal an unusual amplification of conjugative and mobile transposons and identify a novel Prevotella-lineage-specific repeat.

    PubMed

    Naito, Mariko; Ogura, Yoshitoshi; Itoh, Takehiko; Shoji, Mikio; Okamoto, Masaaki; Hayashi, Tetsuya; Nakayama, Koji

    2016-02-01

    Prevotella intermedia is a pathogenic bacterium involved in periodontal diseases. Here, we present the complete genome sequence of a clinical strain, OMA14, of this bacterium along with the results of comparative genome analysis with strain 17 of the same species whose genome has also been sequenced, but not fully analysed yet. The genomes of both strains consist of two circular chromosomes: the larger chromosomes are similar in size and exhibit a high overall linearity of gene organizations, whereas the smaller chromosomes show a significant size variation and have undergone remarkable genome rearrangements. Unique features of the Pre. intermedia genomes are the presence of a remarkable number of essential genes on the second chromosomes and the abundance of conjugative and mobilizable transposons (CTns and MTns). The CTns/MTns are particularly abundant in the second chromosomes, involved in its extensive genome rearrangement, and have introduced a number of strain-specific genes into each strain. We also found a novel 188-bp repeat sequence that has been highly amplified in Pre. intermedia and are specifically distributed among the Pre. intermedia-related species. These findings expand our understanding of the genetic features of Pre. intermedia and the roles of CTns and MTns in the evolution of bacteria. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  1. Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs).

    PubMed

    Cantsilieris, Stuart; Stessman, Holly A; Shendure, Jay; Eichler, Evan E

    2017-01-01

    Molecular inversion probes (MIPs) in combination with massively parallel DNA sequencing represent a versatile, yet economical tool for targeted sequencing of genomic DNA. Several thousand genomic targets can be selectively captured using long oligonucleotides containing unique targeting arms and universal linkers. The ability to append sequencing adaptors and sample-specific barcodes allows large-scale pooling and subsequent high-throughput sequencing at relatively low cost per sample. Here, we describe a "wet bench" protocol detailing the capture and subsequent sequencing of >2000 genomic targets from 192 samples, representative of a single lane on the Illumina HiSeq 2000 platform.

  2. Engineering of a target site-specific recombinase by a combined evolution- and structure-guided approach

    PubMed Central

    Abi-Ghanem, Josephine; Chusainow, Janet; Karimova, Madina; Spiegel, Christopher; Hofmann-Sieber, Helga; Hauber, Joachim; Buchholz, Frank; Pisabarro, M. Teresa

    2013-01-01

    Site-specific recombinases (SSRs) can perform DNA rearrangements, including deletions, inversions and translocations when their naive target sequences are placed strategically into the genome of an organism. Hence, in order to employ SSRs in heterologous hosts, their target sites have to be introduced into the genome of an organism before the enzyme can be practically employed. Engineered SSRs hold great promise for biotechnology and advanced biomedical applications, as they promise to extend the usefulness of SSRs to allow efficient and specific recombination of pre-existing, natural genomic sequences. However, the generation of enzymes with desired properties remains challenging. Here, we use substrate-linked directed evolution in combination with molecular modeling to rationally engineer an efficient and specific recombinase (sTre) that readily and specifically recombines a sequence present in the HIV-1 genome. We elucidate the role of key residues implicated in the molecular recognition mechanism and we present a rationale for sTre’s enhanced specificity. Combining evolutionary and rational approaches should help in accelerating the generation of enzymes with desired properties for use in biotechnology and biomedicine. PMID:23275541

  3. A survey of tools for variant analysis of next-generation genome sequencing data

    PubMed Central

    Pabinger, Stephan; Dander, Andreas; Fischer, Maria; Snajder, Rene; Sperk, Michael; Efremova, Mirjana; Krabichler, Birgit; Speicher, Michael R.; Zschocke, Johannes

    2014-01-01

    Recent advances in genome sequencing technologies provide unprecedented opportunities to characterize individual genomic landscapes and identify mutations relevant for diagnosis and therapy. Specifically, whole-exome sequencing using next-generation sequencing (NGS) technologies is gaining popularity in the human genetics community due to the moderate costs, manageable data amounts and straightforward interpretation of analysis results. While whole-exome and, in the near future, whole-genome sequencing are becoming commodities, data analysis still poses significant challenges and led to the development of a plethora of tools supporting specific parts of the analysis workflow or providing a complete solution. Here, we surveyed 205 tools for whole-genome/whole-exome sequencing data analysis supporting five distinct analytical steps: quality assessment, alignment, variant identification, variant annotation and visualization. We report an overview of the functionality, features and specific requirements of the individual tools. We then selected 32 programs for variant identification, variant annotation and visualization, which were subjected to hands-on evaluation using four data sets: one set of exome data from two patients with a rare disease for testing identification of germline mutations, two cancer data sets for testing variant callers for somatic mutations, copy number variations and structural variations, and one semi-synthetic data set for testing identification of copy number variations. Our comprehensive survey and evaluation of NGS tools provides a valuable guideline for human geneticists working on Mendelian disorders, complex diseases and cancers. PMID:23341494

  4. A genome-specific repetitive DNA sequence from Oryza eichingeri: characterization, localization, and introgression to O. sativa.

    PubMed

    Yan, H. H.; Liu, G. Q.; Cheng, Z. K.; Li, X. B.; Liu, G. Z.; Min, S. K.; Zhu, L.H.

    2002-02-01

    In the course of transferring the brown planthopper resistance from a diploid, CC-genome wild rice species, Oryza eichingeri (IRGC acc. 105159 and 105163), to the cultivated rice variety 02428, we have isolated many alien addition and introgression lines. The O. eichingeri chromatin in some of these lines has previously been identified using genomic in situ hybridization and molecular-marker analysis. Here we cloned a tandemly repetitive DNA sequence from O. eichingeri IRGC acc105163, and detected it in 25 introgression lines. This repetitive DNA sequence showed high specificity to the rice CC genome, but was absent from all the four tetraploid species with BBCC or CCDD genomes. The monomer in this repetitive DNA sequence is 325-366-bp long, with a copy number of about 5,000 per 1 C of the O. eichingerigenome, showing 88% homology to a repetitive DNA sequence isolated from Oryza officinalis(2n=2 x=24, CC). Fluorescent in situ hybridization revealed 11 signals distributed over eight O. eichingeri chromosomes, mostly in terminal or subterminal regions.

  5. The Genome Sequence of Taurine Cattle: A window to ruminant biology and evolution

    PubMed Central

    Elsik, Christine G.; Tellam, Ross L.; Worley, Kim C.

    2010-01-01

    To understand the biology and evolution of ruminants, the cattle genome was sequenced to ∼7× coverage. The cattle genome contains a minimum of 22,000 genes, with a core set of 14,345 orthologs shared among seven mammalian species of which 1,217 are absent or undetected in non-eutherian (marsupial or monotreme) genomes. Cattle-specific evolutionary breakpoint regions in chromosomes have a higher density of segmental duplications, enrichment of repetitive elements, and species-specific variations in genes associated with lactation and immune responsiveness. Genes involved in metabolism are generally highly conserved, although five metabolic genes are deleted or extensively diverged from their human orthologs. The cattle genome sequence thus provides an enabling resource for understanding mammalian evolution and accelerating livestock genetic improvement for milk and meat production. PMID:19390049

  6. Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes).

    PubMed

    Dessimoz, Christophe; Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

    2011-09-01

    Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references.

  7. Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes)

    PubMed Central

    Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

    2011-01-01

    Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references. PMID:21712341

  8. ProDeGe: A computational protocol for fully automated decontamination of genomes

    DOE PAGES

    Tennessen, Kristin; Andersen, Evan; Clingenpeel, Scott; ...

    2015-06-09

    Single amplified genomes and genomes assembled from metagenomes have enabled the exploration of uncultured microorganisms at an unprecedented scale. However, both these types of products are plagued by contamination. Since these genomes are now being generated in a high-throughput manner and sequences from them are propagating into public databases to drive novel scientific discoveries, rigorous quality controls and decontamination protocols are urgently needed. Here, we present ProDeGe (Protocol for fully automated Decontamination of Genomes), the first computational protocol for fully automated decontamination of draft genomes. ProDeGe classifies sequences into two classes—clean and contaminant—using a combination of homology and feature-based methodologies.more » On average, 84% of sequence from the non-target organism is removed from the data set (specificity) and 84% of the sequence from the target organism is retained (sensitivity). Lastly, the procedure operates successfully at a rate of ~0.30 CPU core hours per megabase of sequence and can be applied to any type of genome sequence.« less

  9. ProDeGe: A computational protocol for fully automated decontamination of genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tennessen, Kristin; Andersen, Evan; Clingenpeel, Scott

    Single amplified genomes and genomes assembled from metagenomes have enabled the exploration of uncultured microorganisms at an unprecedented scale. However, both these types of products are plagued by contamination. Since these genomes are now being generated in a high-throughput manner and sequences from them are propagating into public databases to drive novel scientific discoveries, rigorous quality controls and decontamination protocols are urgently needed. Here, we present ProDeGe (Protocol for fully automated Decontamination of Genomes), the first computational protocol for fully automated decontamination of draft genomes. ProDeGe classifies sequences into two classes—clean and contaminant—using a combination of homology and feature-based methodologies.more » On average, 84% of sequence from the non-target organism is removed from the data set (specificity) and 84% of the sequence from the target organism is retained (sensitivity). Lastly, the procedure operates successfully at a rate of ~0.30 CPU core hours per megabase of sequence and can be applied to any type of genome sequence.« less

  10. Mapping Second Chromosome Mutations to Defined Genomic Regions in Drosophila melanogaster

    PubMed Central

    Kahsai, Lily; Cook, Kevin R.

    2017-01-01

    Hundreds of Drosophila melanogaster stocks are currently maintained at the Bloomington Drosophila Stock Center with mutations that have not been associated with sequence-defined genes. They have been preserved because they have interesting loss-of-function phenotypes. The experimental value of these mutations would be increased by tying them to specific genomic intervals so that geneticists can more easily associate them with annotated genes. Here, we report the mapping of 85 second chromosome complementation groups in the Bloomington collection to specific, small clusters of contiguous genes or individual genes in the sequenced genome. This information should prove valuable to Drosophila geneticists interested in processes associated with particular phenotypes and those searching for mutations affecting specific sequence-defined genes. PMID:29066472

  11. Applications and challenges of next-generation sequencing in Brassica species.

    PubMed

    Wei, Lijuan; Xiao, Meili; Hayward, Alice; Fu, Donghui

    2013-12-01

    Next-generation sequencing (NGS) produces numerous (often millions) short DNA sequence reads, typically varying between 25 and 400 bp in length, at a relatively low cost and in a short time. This revolutionary technology is being increasingly applied in whole-genome, transcriptome, epigenome and small RNA sequencing, molecular marker and gene discovery, comparative and evolutionary genomics, and association studies. The Brassica genus comprises some of the most agro-economically important crops, providing abundant vegetables, condiments, fodder, oil and medicinal products. Many Brassica species have undergone the process of polyploidization, which makes their genomes exceptionally complex and can create difficulties in genomics research. NGS injects new vigor into Brassica research, yet also faces specific challenges in the analysis of complex crop genomes and traits. In this article, we review the advantages and limitations of different NGS technologies and their applications and challenges, using Brassica as an advanced model system for agronomically important, polyploid crops. Specifically, we focus on the use of NGS for genome resequencing, transcriptome sequencing, development of single-nucleotide polymorphism markers, and identification of novel microRNAs and their targets. We present trends and advances in NGS technology in relation to Brassica crop improvement, with wide application for sophisticated genomics research into agronomically important polyploid crops.

  12. Sequencing and comparative genomic analysis of 1227 Felis catus cDNA sequences enriched for developmental, clinical and nutritional phenotypes

    PubMed Central

    2012-01-01

    Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742

  13. Sequencing Needs for Viral Diagnostics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S N; Lam, M; Mulakken, N J

    2004-01-26

    We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to prevent false negatives) and unique relative to other species (for specificity, to avoid false positives). We performed simulations, based on existing sequence data, to assess the number of genome sequences of a target species and of close phylogenetic relatives (''nearmore » neighbors'') that are required to predict diagnostic signature regions that are conserved among strains of the target species and unique relative to other bacterial and viral species. For DNA viruses such as variola (smallpox), three target genomes provide sufficient guidance for selecting species-wide signatures. Three near neighbor genomes are critical for species specificity. In contrast, most RNA viruses require four target genomes and no near neighbor genomes, since lack of conservation among strains is more limiting than uniqueness. SARS and Ebola Zaire are exceptional, as additional target genomes currently do not improve predictions, but near neighbor sequences are urgently needed. Our results also indicate that double stranded DNA viruses are more conserved among strains than are RNA viruses, since in most cases there was at least one conserved signature candidate for the DNA viruses and zero conserved signature candidates for the RNA viruses.« less

  14. CHOgenome.org 2.0: Genome resources and website updates.

    PubMed

    Kremkow, Benjamin G; Baik, Jong Youn; MacDonald, Madolyn L; Lee, Kelvin H

    2015-07-01

    Chinese hamster ovary (CHO) cells are a major host cell line for the production of therapeutic proteins, and CHO cell and Chinese hamster (CH) genomes have recently been sequenced using next-generation sequencing methods. CHOgenome.org was launched in 2011 (version 1.0) to serve as a database repository and to provide bioinformatics tools for the CHO community. CHOgenome.org (version 1.0) maintained GenBank CHO-K1 genome data, identified CHO-omics literature, and provided a CHO-specific BLAST service. Recent major updates to CHOgenome.org (version 2.0) include new sequence and annotation databases for both CHO and CH genomes, a more user-friendly website, and new research tools, including a proteome browser and a genome viewer. CHO cell-line specific sequences and annotations facilitate cell line development opportunities, several of which are discussed. Moving forward, CHOgenome.org will host the increasing amount of CHO-omics data and continue to make useful bioinformatics tools available to the CHO community. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Complete genome sequences of three Erwinia amylovora phages isolated in north america and a bacteriophage induced from an Erwinia tasmaniensis strain.

    PubMed

    Müller, I; Kube, M; Reinhardt, R; Jelkmann, W; Geider, K

    2011-02-01

    Fire blight, a plant disease of economic importance caused by Erwinia amylovora, may be controlled by the application of bacteriophages. Here, we provide the complete genome sequences and the annotation of three E. amylovora-specific phages isolated in North America and genomic information about a bacteriophage induced by mitomycin C treatment of an Erwinia tasmaniensis strain that is antagonistic for E. amylovora. The American phages resemble two already-described viral genomes, whereas the E. tasmaniensis phage displays a singular genomic sequence in BLAST searches.

  16. Draft Genome Sequence of Lactobacillus johnsonii Strain 16, Isolated from Mice.

    PubMed

    Buhnik-Rosenblau, Keren; Danin-Poleg, Yael; Elgavish, Sharona; Kashi, Yechezkel

    2015-10-08

    Here, we report the genome sequence of Lactobacillus johnsonii, a member of the gut lactobacilli. This draft genome of L. johnsonii strain 16 isolated from C57BL/6J mice enables the identification of bacterial genes responsible for host-specific gut persistence. Copyright © 2015 Buhnik-Rosenblau et al.

  17. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    PubMed

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  18. Whole-Genome Sequence Variation among Multiple Isolates of Pseudomonas aeruginosa

    PubMed Central

    Spencer, David H.; Kas, Arnold; Smith, Eric E.; Raymond, Christopher K.; Sims, Elizabeth H.; Hastings, Michele; Burns, Jane L.; Kaul, Rajinder; Olson, Maynard V.

    2003-01-01

    Whole-genome shotgun sequencing was used to study the sequence variation of three Pseudomonas aeruginosa isolates, two from clonal infections of cystic fibrosis patients and one from an aquatic environment, relative to the genomic sequence of reference strain PAO1. The majority of the PAO1 genome is represented in these strains; however, at least three prominent islands of PAO1-specific sequence are apparent. Conversely, ∼10% of the sequencing reads derived from each isolate fail to align with the PAO1 backbone. While average sequence variation among all strains is roughly 0.5%, regions of pronounced differences were evident in whole-genome scans of nucleotide diversity. We analyzed two such divergent loci, the pyoverdine and O-antigen biosynthesis regions, by complete resequencing. A thorough analysis of isolates collected over time from one of the cystic fibrosis patients revealed independent mutations resulting in the loss of O-antigen synthesis alternating with a mucoid phenotype. Overall, we conclude that most of the PAO1 genome represents a core P. aeruginosa backbone sequence while the strains addressed in this study possess additional genetic material that accounts for at least 10% of their genomes. Approximately half of these additional sequences are novel. PMID:12562802

  19. Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-08-01

    The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

  20. Core-SINE blocks comprise a large fraction of monotreme genomes; implications for vertebrate chromosome evolution.

    PubMed

    Kirby, Patrick J; Greaves, Ian K; Koina, Edda; Waters, Paul D; Marshall Graves, Jennifer A

    2007-01-01

    The genomes of the egg-laying platypus and echidna are of particular interest because monotremes are the most basal mammal group. The chromosomal distribution of an ancient family of short interspersed repeats (SINEs), the core-SINEs, was investigated to better understand monotreme genome organization and evolution. Previous studies have identified the core-SINE as the predominant SINE in the platypus genome, and in this study we quantified, characterized and localized subfamilies. Dot blot analysis suggested that a very large fraction (32% of the platypus and 16% of the echidna genome) is composed of Mon core-SINEs. Core-SINE-specific primers were used to amplify PCR products from platypus and echidna genomic DNA. Sequence analysis suggests a common consensus sequence Mon 1-B, shared by platypus and echidna, as well as platypus-specific Mon 1-C and echidna specific Mon 1-D consensus sequences. FISH mapping of the Mon core-SINE products to platypus metaphase spreads demonstrates that the Mon-1C subfamily is responsible for the striking Mon core-SINE accumulation in the distal regions of the six large autosomal pairs and the largest X chromosome. This unusual distribution highlights the dichotomy between the seven large chromosome pairs and the 19 smaller pairs in the monotreme karyotype, which has some similarity to the macro- and micro-chromosomes of birds and reptiles, and suggests that accumulation of repetitive sequences may have enlarged small chromosomes in an ancestral vertebrate. In the forthcoming sequence of the platypus genome there are still large gaps, and the extensive Mon core-SINE accumulation on the distal regions of the six large autosomal pairs may provide one explanation for this missing sequence.

  1. Improved Annotation of 3′ Untranslated Regions and Complex Loci by Combination of Strand-Specific Direct RNA Sequencing, RNA-Seq and ESTs

    PubMed Central

    Song, Junfang; Duc, Céline; Storey, Kate G.; McLean, W. H. Irwin; Brown, Sara J.; Simpson, Gordon G.; Barton, Geoffrey J.

    2014-01-01

    The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3′ untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3′ polyadenylation sites to within +/− 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1) gene and 3′ UTR re-annotation (including extension of one 3′ UTR by 5.9 kb); (2) disentangling of gene expression in complex regions; (3) clearer interpretation of small RNA expression and (4) identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data. PMID:24722185

  2. Tissue-specific Proteogenomic Analysis of Plutella xylostella Larval Midgut Using a Multialgorithm Pipeline*

    PubMed Central

    Zhu, Xun; Xie, Shangbo; Armengaud, Jean; Xie, Wen; Guo, Zhaojiang; Kang, Shi; Wu, Qingjun; Wang, Shaoli; Xia, Jixing; He, Rongjun; Zhang, Youjun

    2016-01-01

    The diamondback moth, Plutella xylostella (L.), is the major cosmopolitan pest of brassica and other cruciferous crops. Its larval midgut is a dynamic tissue that interfaces with a wide variety of toxicological and physiological processes. The draft sequence of the P. xylostella genome was recently released, but its annotation remains challenging because of the low sequence coverage of this branch of life and the poor description of exon/intron splicing rules for these insects. Peptide sequencing by computational assignment of tandem mass spectra to genome sequence information provides an experimental independent approach for confirming or refuting protein predictions, a concept that has been termed proteogenomics. In this study, we carried out an in-depth proteogenomic analysis to complement genome annotation of P. xylostella larval midgut based on shotgun HPLC-ESI-MS/MS data by means of a multialgorithm pipeline. A total of 876,341 tandem mass spectra were searched against the predicted P. xylostella protein sequences and a whole-genome six-frame translation database. Based on a data set comprising 2694 novel genome search specific peptides, we discovered 439 novel protein-coding genes and corrected 128 existing gene models. To get the most accurate data to seed further insect genome annotation, more than half of the novel protein-coding genes, i.e. 235 over 439, were further validated after RT-PCR amplification and sequencing of the corresponding transcripts. Furthermore, we validated 53 novel alternative splicings. Finally, a total of 6764 proteins were identified, resulting in one of the most comprehensive proteogenomic study of a nonmodel animal. As the first tissue-specific proteogenomics analysis of P. xylostella, this study provides the fundamental basis for high-throughput proteomics and functional genomics approaches aimed at deciphering the molecular mechanisms of resistance and controlling this pest. PMID:26902207

  3. Phylogenetic shadowing of primate sequences to find functional regions of the human genome.

    PubMed

    Boffelli, Dario; McAuliffe, Jon; Ovcharenko, Dmitriy; Lewis, Keith D; Ovcharenko, Ivan; Pachter, Lior; Rubin, Edward M

    2003-02-28

    Nonhuman primates represent the most relevant model organisms to understand the biology of Homo sapiens. The recent divergence and associated overall sequence conservation between individual members of this taxon have nonetheless largely precluded the use of primates in comparative sequence studies. We used sequence comparisons of an extensive set of Old World and New World monkeys and hominoids to identify functional regions in the human genome. Analysis of these data enabled the discovery of primate-specific gene regulatory elements and the demarcation of the exons of multiple genes. Much of the information content of the comprehensive primate sequence comparisons could be captured with a small subset of phylogenetically close primates. These results demonstrate the utility of intraprimate sequence comparisons to discover common mammalian as well as primate-specific functional elements in the human genome, which are unattainable through the evaluation of more evolutionarily distant species.

  4. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure

    PubMed Central

    2013-01-01

    Background Candida albicans is a ubiquitous opportunistic fungal pathogen that afflicts immunocompromised human hosts. With rare and transient exceptions the yeast is diploid, yet despite its clinical relevance the respective sequences of its two homologous chromosomes have not been completely resolved. Results We construct a phased diploid genome assembly by deep sequencing a standard laboratory wild-type strain and a panel of strains homozygous for particular chromosomes. The assembly has 700-fold coverage on average, allowing extensive revision and expansion of the number of known SNPs and indels. This phased genome significantly enhances the sensitivity and specificity of allele-specific expression measurements by enabling pooling and cross-validation of signal across multiple polymorphic sites. Additionally, the diploid assembly reveals pervasive and unexpected patterns in allelic differences between homologous chromosomes. Firstly, we see striking clustering of indels, concentrated primarily in the repeat sequences in promoters. Secondly, both indels and their repeat-sequence substrate are enriched near replication origins. Finally, we reveal an intimate link between repeat sequences and indels, which argues that repeat length is under selective pressure for most eukaryotes. This connection is described by a concise one-parameter model that explains repeat-sequence abundance in C. albicans as a function of the indel rate, and provides a general framework to interpret repeat abundance in species ranging from bacteria to humans. Conclusions The phased genome assembly and insights into repeat plasticity will be valuable for better understanding allele-specific phenomena and genome evolution. PMID:24025428

  5. Organizational heterogeneity of vertebrate genomes.

    PubMed

    Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham

    2012-01-01

    Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

  6. Comparative genomics of Burkholderia multivorans, a ubiquitous pathogen with a highly conserved genomic structure

    PubMed Central

    Cooper, Vaughn S.; Hatcher, Philip J.; Verheyde, Bart; Carlier, Aurélien; Vandamme, Peter

    2017-01-01

    The natural environment serves as a reservoir of opportunistic pathogens. A well-established method for studying the epidemiology of such opportunists is multilocus sequence typing, which in many cases has defined strains predisposed to causing infection. Burkholderia multivorans is an important pathogen in people with cystic fibrosis (CF) and its epidemiology suggests that strains are acquired from non-human sources such as the natural environment. This raises the central question of whether the isolation source (CF or environment) or the multilocus sequence type (ST) of B. multivorans better predicts their genomic content and functionality. We identified four pairs of B. multivorans isolates, representing distinct STs and consisting of one CF and one environmental isolate each. All genomes were sequenced using the PacBio SMRT sequencing technology, which resulted in eight high-quality B. multivorans genome assemblies. The present study demonstrated that the genomic structure of the examined B. multivorans STs is highly conserved and that the B. multivorans genomic lineages are defined by their ST. Orthologous protein families were not uniformly distributed among chromosomes, with core orthologs being enriched on the primary chromosome and ST-specific orthologs being enriched on the second and third chromosome. The ST-specific orthologs were enriched in genes involved in defense mechanisms and secondary metabolism, corroborating the strain-specificity of these virulence characteristics. Finally, the same B. multivorans genomic lineages occur in both CF and environmental samples and on different continents, demonstrating their ubiquity and evolutionary persistence. PMID:28430818

  7. The Complete Mitochondrial Genome of Gossypium hirsutum and Evolutionary Analysis of Higher Plant Mitochondrial Genomes

    PubMed Central

    Su, Aiguo; Geng, Jianing; Grover, Corrinne E.; Hu, Songnian; Hua, Jinping

    2013-01-01

    Background Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. Methodology/Principal Findings We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. Conclusion The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species. PMID:23940520

  8. The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

    PubMed

    Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping

    2013-01-01

    Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

  9. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  10. Re-Assembly and Analysis of an Ancient Variola Virus Genome.

    PubMed

    Smithson, Chad; Imbery, Jacob; Upton, Chris

    2017-09-08

    We report a major improvement to the assembly of published short read sequencing data from an ancient variola virus (VARV) genome by the removal of contig-capping sequencing tags and manual searches for gap-spanning reads. The new assembly, together with camelpox and taterapox genomes, permitted new dates to be calculated for the last common ancestor of all VARV genomes. The analysis of recently sequenced VARV-like cowpox virus genomes showed that single nucleotide polymorphisms (SNPs) and amino acid changes in the vaccinia virus (VACV)-Cop-O1L ortholog, predicted to be associated with VARV host specificity and virulence, were introduced into the lineage before the divergence of these viruses. A comparison of the ancient and modern VARV genome sequences also revealed a measurable drift towards adenine + thymine (A + T) richness.

  11. The minimum information about a genome sequence (MIGS) specification

    PubMed Central

    Field, Dawn; Garrity, George; Gray, Tanya; Morrison, Norman; Selengut, Jeremy; Sterk, Peter; Tatusova, Tatiana; Thomson, Nicholas; Allen, Michael J; Angiuoli, Samuel V; Ashburner, Michael; Axelrod, Nelson; Baldauf, Sandra; Ballard, Stuart; Boore, Jeffrey; Cochrane, Guy; Cole, James; Dawyndt, Peter; De Vos, Paul; dePamphilis, Claude; Edwards, Robert; Faruque, Nadeem; Feldman, Robert; Gilbert, Jack; Gilna, Paul; Glöckner, Frank Oliver; Goldstein, Philip; Guralnick, Robert; Haft, Dan; Hancock, David; Hermjakob, Henning; Hertz-Fowler, Christiane; Hugenholtz, Phil; Joint, Ian; Kagan, Leonid; Kane, Matthew; Kennedy, Jessie; Kowalchuk, George; Kottmann, Renzo; Kolker, Eugene; Kravitz, Saul; Kyrpides, Nikos; Leebens-Mack, Jim; Lewis, Suzanna E; Li, Kelvin; Lister, Allyson L; Lord, Phillip; Maltsev, Natalia; Markowitz, Victor; Martiny, Jennifer; Methe, Barbara; Mizrachi, Ilene; Moxon, Richard; Nelson, Karen; Parkhill, Julian; Proctor, Lita; White, Owen; Sansone, Susanna-Assunta; Spiers, Andrew; Stevens, Robert; Swift, Paul; Taylor, Chris; Tateno, Yoshio; Tett, Adrian; Turner, Sarah; Ussery, David; Vaughan, Bob; Ward, Naomi; Whetzel, Trish; Gil, Ingio San; Wilson, Gareth; Wipat, Anil

    2008-01-01

    With the quantity of genomic data increasing at an exponential rate, it is imperative that these data be captured electronically, in a standard format. Standardization activities must proceed within the auspices of open-access and international working bodies. To tackle the issues surrounding the development of better descriptions of genomic investigations, we have formed the Genomic Standards Consortium (GSC). Here, we introduce the minimum information about a genome sequence (MIGS) specification with the intent of promoting participation in its development and discussing the resources that will be required to develop improved mechanisms of metadata capture and exchange. As part of its wider goals, the GSC also supports improving the ‘transparency’ of the information contained in existing genomic databases. PMID:18464787

  12. [Efficient genome editing in human pluripotent stem cells through CRISPR/Cas9].

    PubMed

    Liu, Gai-gai; Li, Shuang; Wei, Yu-da; Zhang, Yong-xian; Ding, Qiu-rong

    2015-11-01

    The RNA-guided CRISPR (clustered regularly interspaced short palindromic repeat)-associated Cas9 nuclease has offered a new platform for genome editing with high efficiency. Here, we report the use of CRISPR/Cas9 technology to target a specific genomic region in human pluripotent stem cells. We show that CRISPR/Cas9 can be used to disrupt a gene by introducing frameshift mutations to gene coding region; to knock in specific sequences (e.g. FLAG tag DNA sequence) to targeted genomic locus via homology directed repair; to induce large genomic deletion through dual-guide multiplex. Our results demonstrate the versatile application of CRISPR/Cas9 in stem cell genome editing, which can be widely utilized for functional studies of genes or genome loci in human pluripotent stem cells.

  13. Pooled-BAC sequencing of a black pod resistance region (cBPQTL12) in T. cacao

    USDA-ARS?s Scientific Manuscript database

    Whole genome sequencing (WGS) is an expensive and technically challenging endeavor. An alternative to WGS is to sequence specific chromosomal segments of biological interest (e.g. a QTL interval). This method is cheaper than WGS and reduces the risk of misassembly from distal parts of the genome. Us...

  14. Repetitive sequences in plant nuclear DNA: types, distribution, evolution and function.

    PubMed

    Mehrotra, Shweta; Goyal, Vinod

    2014-08-01

    Repetitive DNA sequences are a major component of eukaryotic genomes and may account for up to 90% of the genome size. They can be divided into minisatellite, microsatellite and satellite sequences. Satellite DNA sequences are considered to be a fast-evolving component of eukaryotic genomes, comprising tandemly-arrayed, highly-repetitive and highly-conserved monomer sequences. The monomer unit of satellite DNA is 150-400 base pairs (bp) in length. Repetitive sequences may be species- or genus-specific, and may be centromeric or subtelomeric in nature. They exhibit cohesive and concerted evolution caused by molecular drive, leading to high sequence homogeneity. Repetitive sequences accumulate variations in sequence and copy number during evolution, hence they are important tools for taxonomic and phylogenetic studies, and are known as "tuning knobs" in the evolution. Therefore, knowledge of repetitive sequences assists our understanding of the organization, evolution and behavior of eukaryotic genomes. Repetitive sequences have cytoplasmic, cellular and developmental effects and play a role in chromosomal recombination. In the post-genomics era, with the introduction of next-generation sequencing technology, it is possible to evaluate complex genomes for analyzing repetitive sequences and deciphering the yet unknown functional potential of repetitive sequences. Copyright © 2014 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.

  15. Repetitive sequence analysis and karyotyping reveals centromere-associated DNA sequences in radish (Raphanus sativus L.).

    PubMed

    He, Qunyan; Cai, Zexi; Hu, Tianhua; Liu, Huijun; Bao, Chonglai; Mao, Weihai; Jin, Weiwei

    2015-04-18

    Radish (Raphanus sativus L., 2n = 2x = 18) is a major root vegetable crop especially in eastern Asia. Radish root contains various nutritions which play an important role in strengthening immunity. Repetitive elements are primary components of the genomic sequence and the most important factors in genome size variations in higher eukaryotes. To date, studies about repetitive elements of radish are still limited. To better understand genome structure of radish, we undertook a study to evaluate the proportion of repetitive elements and their distribution in radish. We conducted genome-wide characterization of repetitive elements in radish with low coverage genome sequencing followed by similarity-based cluster analysis. Results showed that about 31% of the genome was composed of repetitive sequences. Satellite repeats were the most dominating elements of the genome. The distribution pattern of three satellite repeat sequences (CL1, CL25, and CL43) on radish chromosomes was characterized using fluorescence in situ hybridization (FISH). CL1 was predominantly located at the centromeric region of all chromosomes, CL25 located at the subtelomeric region, and CL43 was a telomeric satellite. FISH signals of two satellite repeats, CL1 and CL25, together with 5S rDNA and 45S rDNA, provide useful cytogenetic markers to identify each individual somatic metaphase chromosome. The centromere-specific histone H3 (CENH3) has been used as a marker to identify centromere DNA sequences. One putative CENH3 (RsCENH3) was characterized and cloned from radish. Its deduced amino acid sequence shares high similarities to those of the CENH3s in Brassica species. An antibody against B. rapa CENH3, specifically stained radish centromeres. Immunostaining and chromatin immunoprecipitation (ChIP) tests with anti-BrCENH3 antibody demonstrated that both the centromere-specific retrotransposon (CR-Radish) and satellite repeat (CL1) are directly associated with RsCENH3 in radish. Proportions of repetitive elements in radish were estimated and satellite repeats were the most dominating elements. Fine karyotyping analysis was established which allow us to easily identify each individual somatic metaphase chromosome. Immunofluorescence- and ChIP-based assays demonstrated the functional significance of satellite and centromere-specific retrotransposon at centromeres. Our study provides a valuable basis for future genomic studies in radish.

  16. Characterization of species-specific repeated DNA sequences from B. nigra.

    PubMed

    Gupta, V; Lakshmisita, G; Shaila, M S; Jagannathan, V; Lakshmikumaran, M S

    1992-07-01

    The construction and characterization of two genome-specific recombinant DNA clones from B. nigra are described. Southern analysis showed that the two clones belong to a dispersed repeat family. They differ from each other in their length, distribution and sequence, though the average GC content is nearly the same (45%). These B genome-specific repeats have been used to analyse the phylogenetic relationships between cultivated and wild species of the family Brassicaceae.

  17. Targeted sequencing for high-resolution evolutionary analyses following genome duplication in salmonid fish: Proof of concept for key components of the insulin-like growth factor axis.

    PubMed

    Lappin, Fiona M; Shaw, Rebecca L; Macqueen, Daniel J

    2016-12-01

    High-throughput sequencing has revolutionised comparative and evolutionary genome biology. It has now become relatively commonplace to generate multiple genomes and/or transcriptomes to characterize the evolution of large taxonomic groups of interest. Nevertheless, such efforts may be unsuited to some research questions or remain beyond the scope of some research groups. Here we show that targeted high-throughput sequencing offers a viable alternative to study genome evolution across a vertebrate family of great scientific interest. Specifically, we exploited sequence capture and Illumina sequencing to characterize the evolution of key components from the insulin-like growth (IGF) signalling axis of salmonid fish at unprecedented phylogenetic resolution. The IGF axis represents a central governor of vertebrate growth and its core components were expanded by whole genome duplication in the salmonid ancestor ~95Ma. Using RNA baits synthesised to genes encoding the complete family of IGF binding proteins (IGFBP) and an IGF hormone (IGF2), we captured, sequenced and assembled orthologous and paralogous exons from species representing all ten salmonid genera. This approach generated 299 novel sequences, most as complete or near-complete protein-coding sequences. Phylogenetic analyses confirmed congruent evolutionary histories for all nineteen recognized salmonid IGFBP family members and identified novel salmonid-specific IGF2 paralogues. Moreover, we reconstructed the evolution of duplicated IGF axis paralogues across a replete salmonid phylogeny, revealing complex historic selection regimes - both ancestral to salmonids and lineage-restricted - that frequently involved asymmetric paralogue divergence under positive and/or relaxed purifying selection. Our findings add to an emerging literature highlighting diverse applications for targeted sequencing in comparative-evolutionary genomics. We also set out a viable approach to obtain large sets of nuclear genes for any member of the salmonid family, which should enable insights into the evolutionary role of whole genome duplication before additional nuclear genome sequences become available. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  18. The cotton centromere contains a Ty3-gypsy-like LTR retroelement.

    PubMed

    Luo, Song; Mach, Jennifer; Abramson, Bradley; Ramirez, Rolando; Schurr, Robert; Barone, Pierluigi; Copenhaver, Gregory; Folkerts, Otto

    2012-01-01

    The centromere is a repeat-rich structure essential for chromosome segregation; with the long-term aim of understanding centromere structure and function, we set out to identify cotton centromere sequences. To isolate centromere-associated sequences from cotton, (Gossypium hirsutum) we surveyed tandem and dispersed repetitive DNA in the genus. Centromere-associated elements in other plants include tandem repeats and, in some cases, centromere-specific retroelements. Examination of cotton genomic survey sequences for tandem repeats yielded sequences that did not localize to the centromere. However, among the repetitive sequences we also identified a gypsy-like LTR retrotransposon (Centromere Retroelement Gossypium, CRG) that localizes to the centromere region of all chromosomes in domestic upland cotton, Gossypium hirsutum, the major commercially grown cotton. The location of the functional centromere was confirmed by immunostaining with antiserum to the centromere-specific histone CENH3, which co-localizes with CRG hybridization on metaphase mitotic chromosomes. G. hirsutum is an allotetraploid composed of A and D genomes and CRG is also present in the centromere regions of other AD cotton species. Furthermore, FISH and genomic dot blot hybridization revealed that CRG is found in D-genome diploid cotton species, but not in A-genome diploid species, indicating that this retroelement may have invaded the A-genome centromeres during allopolyploid formation and amplified during evolutionary history. CRG is also found in other diploid Gossypium species, including B and E2 genome species, but not in the C, E1, F, and G genome species tested. Isolation of this centromere-specific retrotransposon from Gossypium provides a probe for further understanding of centromere structure, and a tool for future engineering of centromere mini-chromosomes in this important crop species.

  19. The Cotton Centromere Contains a Ty3-gypsy-like LTR Retroelement

    PubMed Central

    Luo, Song; Mach, Jennifer; Abramson, Bradley; Ramirez, Rolando; Schurr, Robert; Barone, Pierluigi; Copenhaver, Gregory; Folkerts, Otto

    2012-01-01

    The centromere is a repeat-rich structure essential for chromosome segregation; with the long-term aim of understanding centromere structure and function, we set out to identify cotton centromere sequences. To isolate centromere-associated sequences from cotton, (Gossypium hirsutum) we surveyed tandem and dispersed repetitive DNA in the genus. Centromere-associated elements in other plants include tandem repeats and, in some cases, centromere-specific retroelements. Examination of cotton genomic survey sequences for tandem repeats yielded sequences that did not localize to the centromere. However, among the repetitive sequences we also identified a gypsy-like LTR retrotransposon (Centromere Retroelement Gossypium, CRG) that localizes to the centromere region of all chromosomes in domestic upland cotton, Gossypium hirsutum, the major commercially grown cotton. The location of the functional centromere was confirmed by immunostaining with antiserum to the centromere-specific histone CENH3, which co-localizes with CRG hybridization on metaphase mitotic chromosomes. G. hirsutum is an allotetraploid composed of A and D genomes and CRG is also present in the centromere regions of other AD cotton species. Furthermore, FISH and genomic dot blot hybridization revealed that CRG is found in D-genome diploid cotton species, but not in A-genome diploid species, indicating that this retroelement may have invaded the A-genome centromeres during allopolyploid formation and amplified during evolutionary history. CRG is also found in other diploid Gossypium species, including B and E2 genome species, but not in the C, E1, F, and G genome species tested. Isolation of this centromere-specific retrotransposon from Gossypium provides a probe for further understanding of centromere structure, and a tool for future engineering of centromere mini-chromosomes in this important crop species. PMID:22536361

  20. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

    PubMed Central

    Eastman, Alexander W.; Yuan, Ze-Chun

    2015-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID:25653642

  1. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    PubMed Central

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

  2. Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs

    PubMed Central

    Oduru, Sreedhar; Campbell, Janee L; Karri, SriTulasi; Hendry, William J; Khan, Shafiq A; Williams, Simon C

    2003-01-01

    Background Complete genome annotation will likely be achieved through a combination of computer-based analysis of available genome sequences combined with direct experimental characterization of expressed regions of individual genomes. We have utilized a comparative genomics approach involving the sequencing of randomly selected hamster testis cDNAs to begin to identify genes not previously annotated on the human, mouse, rat and Fugu (pufferfish) genomes. Results 735 distinct sequences were analyzed for their relatedness to known sequences in public databases. Eight of these sequences were derived from previously unidentified genes and expression of these genes in testis was confirmed by Northern blotting. The genomic locations of each sequence were mapped in human, mouse, rat and pufferfish, where applicable, and the structure of their cognate genes was derived using computer-based predictions, genomic comparisons and analysis of uncharacterized cDNA sequences from human and macaque. Conclusion The use of a comparative genomics approach resulted in the identification of eight cDNAs that correspond to previously uncharacterized genes in the human genome. The proteins encoded by these genes included a new member of the kinesin superfamily, a SET/MYND-domain protein, and six proteins for which no specific function could be predicted. Each gene was expressed primarily in testis, suggesting that they may play roles in the development and/or function of testicular cells. PMID:12783626

  3. Genome sequence of the pathogenic Herbaspirillum seropedicae strain Os34, isolated from rice roots.

    PubMed

    Ye, Weijun; Ye, Shuting; Liu, Jian; Chang, Siping; Chen, Mingyue; Zhu, Bo; Guo, Longbiao; An, Qianli

    2012-12-01

    Most Herbaspirillum seropedicae strains are beneficial endophytes to plants. In contrast, H. seropedicae strain Os34, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os34 presented here allows in-depth comparative genome analyses to understand the specific mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions.

  4. Genome Sequence of the Pathogenic Herbaspirillum seropedicae Strain Os34, Isolated from Rice Roots

    PubMed Central

    Ye, Weijun; Ye, Shuting; Liu, Jian; Chang, Siping; Chen, Mingyue; Zhu, Bo

    2012-01-01

    Most Herbaspirillum seropedicae strains are beneficial endophytes to plants. In contrast, H. seropedicae strain Os34, isolated from rice roots, is pathogenic. The draft genome sequence of strain Os34 presented here allows in-depth comparative genome analyses to understand the specific mechanisms of beneficial and pathogenic Herbaspirillum-plant interactions. PMID:23209241

  5. Comparative Analysis of the Genomes of Two Field Isolates of the Rice Blast Fungus Magnaporthe oryzae

    PubMed Central

    Li, Zhigang; Hu, Songnian; Yao, Nan; Dean, Ralph A.; Zhao, Wensheng; Shen, Mi; Zhang, Haiwang; Li, Chao; Liu, Liyuan; Cao, Lei; Xu, Xiaowen; Xing, Yunfei; Hsiang, Tom; Zhang, Ziding; Xu, Jin-Rong; Peng, You-Liang

    2012-01-01

    Rice blast caused by Magnaporthe oryzae is one of the most destructive diseases of rice worldwide. The fungal pathogen is notorious for its ability to overcome host resistance. To better understand its genetic variation in nature, we sequenced the genomes of two field isolates, Y34 and P131. In comparison with the previously sequenced laboratory strain 70-15, both field isolates had a similar genome size but slightly more genes. Sequences from the field isolates were used to improve genome assembly and gene prediction of 70-15. Although the overall genome structure is similar, a number of gene families that are likely involved in plant-fungal interactions are expanded in the field isolates. Genome-wide analysis on asynonymous to synonymous nucleotide substitution rates revealed that many infection-related genes underwent diversifying selection. The field isolates also have hundreds of isolate-specific genes and a number of isolate-specific gene duplication events. Functional characterization of randomly selected isolate-specific genes revealed that they play diverse roles, some of which affect virulence. Furthermore, each genome contains thousands of loci of transposon-like elements, but less than 30% of them are conserved among different isolates, suggesting active transposition events in M. oryzae. A total of approximately 200 genes were disrupted in these three strains by transposable elements. Interestingly, transposon-like elements tend to be associated with isolate-specific or duplicated sequences. Overall, our results indicate that gain or loss of unique genes, DNA duplication, gene family expansion, and frequent translocation of transposon-like elements are important factors in genome variation of the rice blast fungus. PMID:22876203

  6. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  7. Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

    PubMed

    Jia, Xianbo; Lin, Xinjian; Chen, Jichen

    2017-11-02

    Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

  8. Human Contamination in Public Genome Assemblies.

    PubMed

    Kryukov, Kirill; Imanishi, Tadashi

    2016-01-01

    Contamination in genome assembly can lead to wrong or confusing results when using such genome as reference in sequence comparison. Although bacterial contamination is well known, the problem of human-originated contamination received little attention. In this study we surveyed 45,735 available genome assemblies for evidence of human contamination. We used lineage specificity to distinguish between contamination and conservation. We found that 154 genome assemblies contain fragments that with high confidence originate as contamination from human DNA. Majority of contaminating human sequences were present in the reference human genome assembly for over a decade. We recommend that existing contaminated genomes should be revised to remove contaminated sequence, and that new assemblies should be thoroughly checked for presence of human DNA before submitting them to public databases.

  9. GenomePeek—an online tool for prokaryotic genome and metagenome analysis

    DOE PAGES

    McNair, Katelyn; Edwards, Robert A.

    2015-06-16

    As increases in prokaryotic sequencing take place, a method to quickly and accurately analyze this data is needed. Previous tools are mainly designed for metagenomic analysis and have limitations; such as long runtimes and significant false positive error rates. The online tool GenomePeek (edwards.sdsu.edu/GenomePeek) was developed to analyze both single genome and metagenome sequencing files, quickly and with low error rates. GenomePeek uses a sequence assembly approach where reads to a set of conserved genes are extracted, assembled and then aligned against the highly specific reference database. GenomePeek was found to be faster than traditional approaches while still keeping errormore » rates low, as well as offering unique data visualization options.« less

  10. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.

    PubMed

    2004-12-09

    We present here a draft genome sequence of the red jungle fowl, Gallus gallus. Because the chicken is a modern descendant of the dinosaurs and the first non-mammalian amniote to have its genome sequenced, the draft sequence of its genome--composed of approximately one billion base pairs of sequence and an estimated 20,000-23,000 genes--provides a new perspective on vertebrate genome evolution, while also improving the annotation of mammalian genomes. For example, the evolutionary distance between chicken and human provides high specificity in detecting functional elements, both non-coding and coding. Notably, many conserved non-coding sequences are far from genes and cannot be assigned to defined functional classes. In coding regions the evolutionary dynamics of protein domains and orthologous groups illustrate processes that distinguish the lineages leading to birds and mammals. The distinctive properties of avian microchromosomes, together with the inferred patterns of conserved synteny, provide additional insights into vertebrate chromosome architecture.

  11. Genome sequence of an Australian kangaroo, Macropus eugenii, provides insight into the evolution of mammalian reproduction and development

    PubMed Central

    2011-01-01

    Background We present the genome sequence of the tammar wallaby, Macropus eugenii, which is a member of the kangaroo family and the first representative of the iconic hopping mammals that symbolize Australia to be sequenced. The tammar has many unusual biological characteristics, including the longest period of embryonic diapause of any mammal, extremely synchronized seasonal breeding and prolonged and sophisticated lactation within a well-defined pouch. Like other marsupials, it gives birth to highly altricial young, and has a small number of very large chromosomes, making it a valuable model for genomics, reproduction and development. Results The genome has been sequenced to 2 × coverage using Sanger sequencing, enhanced with additional next generation sequencing and the integration of extensive physical and linkage maps to build the genome assembly. We also sequenced the tammar transcriptome across many tissues and developmental time points. Our analyses of these data shed light on mammalian reproduction, development and genome evolution: there is innovation in reproductive and lactational genes, rapid evolution of germ cell genes, and incomplete, locus-specific X inactivation. We also observe novel retrotransposons and a highly rearranged major histocompatibility complex, with many class I genes located outside the complex. Novel microRNAs in the tammar HOX clusters uncover new potential mammalian HOX regulatory elements. Conclusions Analyses of these resources enhance our understanding of marsupial gene evolution, identify marsupial-specific conserved non-coding elements and critical genes across a range of biological systems, including reproduction, development and immunity, and provide new insight into marsupial and mammalian biology and genome evolution. PMID:21854559

  12. Genome sequence of an Australian kangaroo, Macropus eugenii, provides insight into the evolution of mammalian reproduction and development.

    PubMed

    Renfree, Marilyn B; Papenfuss, Anthony T; Deakin, Janine E; Lindsay, James; Heider, Thomas; Belov, Katherine; Rens, Willem; Waters, Paul D; Pharo, Elizabeth A; Shaw, Geoff; Wong, Emily S W; Lefèvre, Christophe M; Nicholas, Kevin R; Kuroki, Yoko; Wakefield, Matthew J; Zenger, Kyall R; Wang, Chenwei; Ferguson-Smith, Malcolm; Nicholas, Frank W; Hickford, Danielle; Yu, Hongshi; Short, Kirsty R; Siddle, Hannah V; Frankenberg, Stephen R; Chew, Keng Yih; Menzies, Brandon R; Stringer, Jessica M; Suzuki, Shunsuke; Hore, Timothy A; Delbridge, Margaret L; Patel, Hardip R; Mohammadi, Amir; Schneider, Nanette Y; Hu, Yanqiu; O'Hara, William; Al Nadaf, Shafagh; Wu, Chen; Feng, Zhi-Ping; Cocks, Benjamin G; Wang, Jianghui; Flicek, Paul; Searle, Stephen M J; Fairley, Susan; Beal, Kathryn; Herrero, Javier; Carone, Dawn M; Suzuki, Yutaka; Sugano, Sumio; Toyoda, Atsushi; Sakaki, Yoshiyuki; Kondo, Shinji; Nishida, Yuichiro; Tatsumoto, Shoji; Mandiou, Ion; Hsu, Arthur; McColl, Kaighin A; Lansdell, Benjamin; Weinstock, George; Kuczek, Elizabeth; McGrath, Annette; Wilson, Peter; Men, Artem; Hazar-Rethinam, Mehlika; Hall, Allison; Davis, John; Wood, David; Williams, Sarah; Sundaravadanam, Yogi; Muzny, Donna M; Jhangiani, Shalini N; Lewis, Lora R; Morgan, Margaret B; Okwuonu, Geoffrey O; Ruiz, San Juana; Santibanez, Jireh; Nazareth, Lynne; Cree, Andrew; Fowler, Gerald; Kovar, Christie L; Dinh, Huyen H; Joshi, Vandita; Jing, Chyn; Lara, Fremiet; Thornton, Rebecca; Chen, Lei; Deng, Jixin; Liu, Yue; Shen, Joshua Y; Song, Xing-Zhi; Edson, Janette; Troon, Carmen; Thomas, Daniel; Stephens, Amber; Yapa, Lankesha; Levchenko, Tanya; Gibbs, Richard A; Cooper, Desmond W; Speed, Terence P; Fujiyama, Asao; Graves, Jennifer A M; O'Neill, Rachel J; Pask, Andrew J; Forrest, Susan M; Worley, Kim C

    2011-08-29

    We present the genome sequence of the tammar wallaby, Macropus eugenii, which is a member of the kangaroo family and the first representative of the iconic hopping mammals that symbolize Australia to be sequenced. The tammar has many unusual biological characteristics, including the longest period of embryonic diapause of any mammal, extremely synchronized seasonal breeding and prolonged and sophisticated lactation within a well-defined pouch. Like other marsupials, it gives birth to highly altricial young, and has a small number of very large chromosomes, making it a valuable model for genomics, reproduction and development. The genome has been sequenced to 2 × coverage using Sanger sequencing, enhanced with additional next generation sequencing and the integration of extensive physical and linkage maps to build the genome assembly. We also sequenced the tammar transcriptome across many tissues and developmental time points. Our analyses of these data shed light on mammalian reproduction, development and genome evolution: there is innovation in reproductive and lactational genes, rapid evolution of germ cell genes, and incomplete, locus-specific X inactivation. We also observe novel retrotransposons and a highly rearranged major histocompatibility complex, with many class I genes located outside the complex. Novel microRNAs in the tammar HOX clusters uncover new potential mammalian HOX regulatory elements. Analyses of these resources enhance our understanding of marsupial gene evolution, identify marsupial-specific conserved non-coding elements and critical genes across a range of biological systems, including reproduction, development and immunity, and provide new insight into marsupial and mammalian biology and genome evolution.

  13. Dcode.org anthology of comparative genomic tools.

    PubMed

    Loots, Gabriela G; Ovcharenko, Ivan

    2005-07-01

    Comparative genomics provides the means to demarcate functional regions in anonymous DNA sequences. The successful application of this method to identifying novel genes is currently shifting to deciphering the non-coding encryption of gene regulation across genomes. To facilitate the practical application of comparative sequence analysis to genetics and genomics, we have developed several analytical and visualization tools for the analysis of arbitrary sequences and whole genomes. These tools include two alignment tools, zPicture and Mulan; a phylogenetic shadowing tool, eShadow for identifying lineage- and species-specific functional elements; two evolutionary conserved transcription factor analysis tools, rVista and multiTF; a tool for extracting cis-regulatory modules governing the expression of co-regulated genes, Creme 2.0; and a dynamic portal to multiple vertebrate and invertebrate genome alignments, the ECR Browser. Here, we briefly describe each one of these tools and provide specific examples on their practical applications. All the tools are publicly available at the http://www.dcode.org/ website.

  14. Scanning the human genome at kilobase resolution.

    PubMed

    Chen, Jun; Kim, Yeong C; Jung, Yong-Chul; Xuan, Zhenyu; Dworkin, Geoff; Zhang, Yanming; Zhang, Michael Q; Wang, San Ming

    2008-05-01

    Normal genome variation and pathogenic genome alteration frequently affect small regions in the genome. Identifying those genomic changes remains a technical challenge. We report here the development of the DGS (Ditag Genome Scanning) technique for high-resolution analysis of genome structure. The basic features of DGS include (1) use of high-frequent restriction enzymes to fractionate the genome into small fragments; (2) collection of two tags from two ends of a given DNA fragment to form a ditag to represent the fragment; (3) application of the 454 sequencing system to reach a comprehensive ditag sequence collection; (4) determination of the genome origin of ditags by mapping to reference ditags from known genome sequences; (5) use of ditag sequences directly as the sense and antisense PCR primers to amplify the original DNA fragment. To study the relationship between ditags and genome structure, we performed a computational study by using the human genome reference sequences as a model, and analyzed the ditags experimentally collected from the well-characterized normal human DNA GM15510 and the leukemic human DNA of Kasumi-1 cells. Our studies show that DGS provides a kilobase resolution for studying genome structure with high specificity and high genome coverage. DGS can be applied to validate genome assembly, to compare genome similarity and variation in normal populations, and to identify genomic abnormality including insertion, inversion, deletion, translocation, and amplification in pathological genomes such as cancer genomes.

  15. The Pinus taeda genome is characterized by diverse and highly diverged repetitive sequences

    PubMed Central

    2010-01-01

    Background In today's age of genomic discovery, no attempt has been made to comprehensively sequence a gymnosperm genome. The largest genus in the coniferous family Pinaceae is Pinus, whose 110-120 species have extremely large genomes (c. 20-40 Gb, 2N = 24). The size and complexity of these genomes have prompted much speculation as to the feasibility of completing a conifer genome sequence. Conifer genomes are reputed to be highly repetitive, but there is little information available on the nature and identity of repetitive units in gymnosperms. The pines have extensive genetic resources, with approximately 329000 ESTs from eleven species and genetic maps in eight species, including a dense genetic map of the twelve linkage groups in Pinus taeda. Results We present here the Sanger sequence and annotation of ten P. taeda BAC clones and Genome Analyzer II whole genome shotgun (WGS) sequences representing 7.5% of the genome. Computational annotation of ten BACs predicts three putative protein-coding genes and at least fifteen likely pseudogenes in nearly one megabase of sequence. We found three conifer-specific LTR retroelements in the BACs, and tentatively identified at least 15 others based on evidence from the distantly related angiosperms. Alignment of WGS sequences to the BACs indicates that 80% of BAC sequences have similar copies (≥ 75% nucleotide identity) elsewhere in the genome, but only 23% have identical copies (99% identity). The three most common repetitive elements in the genome were identified and, when combined, represent less than 5% of the genome. Conclusions This study indicates that the majority of repeats in the P. taeda genome are 'novel' and will therefore require additional BAC or genomic sequencing for accurate characterization. The pine genome contains a very large number of diverged and probably defunct repetitive elements. This study also provides new evidence that sequencing a pine genome using a WGS approach is a feasible goal. PMID:20609256

  16. Re-sequencing and genetic variation identification of a rice line with ideal plant architecture.

    PubMed

    Li, Shuangcheng; Xie, Kailong; Li, Wenbo; Zou, Ting; Ren, Yun; Wang, Shiquan; Deng, Qiming; Zheng, Aiping; Zhu, Jun; Liu, Huainian; Wang, Lingxia; Ai, Peng; Gao, Fengyan; Huang, Bin; Cao, Xuemei; Li, Ping

    2012-12-01

    The ideal plant architecture (IPA) includes several important characteristics such as low tiller numbers, few or no unproductive tillers, more grains per panicle, and thick and sturdy stems. We have developed an indica restorer line 7302R that displays the IPA phenotype in terms of tiller number, grain number, and stem strength. However, its mechanism had to be clarified. We performed re-sequencing and genome-wide variation analysis of 7302R using the Solexa sequencing technology. With the genomic sequence of the indica cultivar 9311 as reference, 307 627 SNPs, 57 372 InDels, and 3 096 SVs were identified in the 7302R genome. The 7302R-specific variations were investigated via the synteny analysis of all the SNPs of 7302R with those of the previous sequenced none-IPA-type lines IR24, MH63, and SH527. Moreover, we found 178 168 7302R-specific SNPs across the whole genome and 30 239 SNPs in the predicted mRNA regions, among which 8 517 were Non-syn CDS. In addition, 263 large-effect SNPs that were expected to affect the integrity of encoded proteins were identified from the 7302R-specific SNPs. SNPs of several important previously cloned rice genes were also identified by aligning the 7302R sequence with other sequence lines. Our results provided several candidates account for the IPA phenotype of 7302R. These results therefore lay the groundwork for long-term efforts to uncover important genes and alleles for rice plant architecture construction, also offer useful data resources for future genetic and genomic studies in rice.

  17. Genome Analysis of the Domestic Dog (Korean Jindo) by Massively Parallel Sequencing

    PubMed Central

    Kim, Ryong Nam; Kim, Dae-Soo; Choi, Sang-Haeng; Yoon, Byoung-Ha; Kang, Aram; Nam, Seong-Hyeuk; Kim, Dong-Wook; Kim, Jong-Joo; Ha, Ji-Hong; Toyoda, Atsushi; Fujiyama, Asao; Kim, Aeri; Kim, Min-Young; Park, Kun-Hyang; Lee, Kang Seon; Park, Hong-Seog

    2012-01-01

    Although pioneering sequencing projects have shed light on the boxer and poodle genomes, a number of challenges need to be met before the sequencing and annotation of the dog genome can be considered complete. Here, we present the DNA sequence of the Jindo dog genome, sequenced to 45-fold average coverage using Illumina massively parallel sequencing technology. A comparison of the sequence to the reference boxer genome led to the identification of 4 675 437 single nucleotide polymorphisms (SNPs, including 3 346 058 novel SNPs), 71 642 indels and 8131 structural variations. Of these, 339 non-synonymous SNPs and 3 indels are located within coding sequences (CDS). In particular, 3 non-synonymous SNPs and a 26-bp deletion occur in the TCOF1 locus, implying that the difference observed in cranial facial morphology between Jindo and boxer dogs might be influenced by those variations. Through the annotation of the Jindo olfactory receptor gene family, we found 2 unique olfactory receptor genes and 236 olfactory receptor genes harbouring non-synonymous homozygous SNPs that are likely to affect smelling capability. In addition, we determined the DNA sequence of the Jindo dog mitochondrial genome and identified Jindo dog-specific mtDNA genotypes. This Jindo genome data upgrade our understanding of dog genomic architecture and will be a very valuable resource for investigating not only dog genetics and genomics but also human and dog disease genetics and comparative genomics. PMID:22474061

  18. Minimum information about a single amplified genome (MISAG) and a metagenome-assembled genome (MIMAG) of bacteria and archaea

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowers, Robert M.; Kyrpides, Nikos C.; Stepanauskas, Ramunas

    The number of genomes from uncultivated microbes will soon surpass the number of isolate genomes in public databases (Hugenholtz, Skarshewski, & Parks, 2016). Technological advancements in high-throughput sequencing and assembly, including single-cell genomics and the computational extraction of genomes from metagenomes (GFMs), are largely responsible. Here we propose community standards for reporting the Minimum Information about a Single-Cell Genome (MIxS-SCG) and Minimum Information about Genomes extracted From Metagenomes (MIxS-GFM) specific for Bacteria and Archaea. The standards have been developed in the context of the International Genomics Standards Consortium (GSC) community (Field et al., 2014) and can be viewed as amore » supplement to other GSC checklists including the Minimum Information about a Genome Sequence (MIGS), Minimum information about a Metagenomic Sequence(s) (MIMS) (Field et al., 2008) and Minimum Information about a Marker Gene Sequence (MIMARKS) (P. Yilmaz et al., 2011). Community-wide acceptance of MIxS-SCG and MIxS-GFM for Bacteria and Archaea will enable broad comparative analyses of genomes from the majority of taxa that remain uncultivated, improving our understanding of microbial function, ecology, and evolution.« less

  19. Sequence and functional characterization of MIRNA164 promoters from Brassica shows copy number dependent regulatory diversification among homeologs.

    PubMed

    Jain, Aditi; Anand, Saurabh; Singh, Neer K; Das, Sandip

    2018-03-12

    The impact of polyploidy on functional diversification of cis-regulatory elements is poorly understood. This is primarily on account of lack of well-defined structure of cis-elements and a universal regulatory code. To the best of our knowledge, this is the first report on characterization of sequence and functional diversification of paralogous and homeologous promoter elements associated with MIR164 from Brassica. The availability of whole genome sequence allowed us to identify and isolate a total of 42 homologous copies of MIR164 from diploid species-Brassica rapa (A-genome), Brassica nigra (B-genome), Brassica oleracea (C-genome), and allopolyploids-Brassica juncea (AB-genome), Brassica carinata (BC-genome) and Brassica napus (AC-genome). Additionally, we retrieved homologous sequences based on comparative genomics from Arabidopsis lyrata, Capsella rubella, and Thellungiella halophila, spanning ca. 45 million years of evolutionary history of Brassicaceae. Sequence comparison across Brassicaceae revealed lineage-, karyotype, species-, and sub-genome specific changes providing a snapshot of evolutionary dynamics of miRNA promoters in polyploids. Tree topology of cis-elements associated with MIR164 was found to re-capitulate the species and family evolutionary history. Phylogenetic shadowing identified transcription factor binding sites (TFBS) conserved across Brassicaceae, of which, some are already known as regulators of MIR164 expression. Some of the TFBS were found to be distributed in a sub-genome specific (e.g., SOX specific to promoter of MIR164c from MF2 sub-genome), lineage-specific (YABBY binding motif, specific to C. rubella in MIR164b), or species-specific (e.g., VOZ in A. thaliana MIR164a) manner which might contribute towards genetic and adaptive variation. Reporter activity driven by promoters associated with MIR164 paralogs and homeologs was majorly in agreement with known role of miR164 in leaf shaping, regulation of lateral root development and senescence, and one previously un-described novel role in trichome. The impact of polyploidy was most profound when reporter activity across three MIR164c homeologs were compared that revealed negligible overlap, whereas reporter activity among two homeologs of MIR164a displays significant overlap. A copy number dependent cis-regulatory divergence thus exists in MIR164 genes in Brassica juncea. The full extent of regulatory diversification towards adaptive strategies will only be known when future endeavors analyze the promoter function under duress of stress and hormonal regimes.

  20. Salmonella enterica Prophage Sequence Profiles Reflect Genome Diversity and Can Be Used for High Discrimination Subtyping.

    PubMed

    Mottawea, Walid; Duceppe, Marc-Olivier; Dupras, Andrée A; Usongo, Valentine; Jeukens, Julie; Freschi, Luca; Emond-Rheault, Jean-Guillaume; Hamel, Jeremie; Kukavica-Ibrulj, Irena; Boyle, Brian; Gill, Alexander; Burnett, Elton; Franz, Eelco; Arya, Gitanjali; Weadge, Joel T; Gruenheid, Samantha; Wiedmann, Martin; Huang, Hongsheng; Daigle, France; Moineau, Sylvain; Bekal, Sadjia; Levesque, Roger C; Goodridge, Lawrence D; Ogunremi, Dele

    2018-01-01

    Non-typhoidal Salmonella is a leading cause of foodborne illness worldwide. Prompt and accurate identification of the sources of Salmonella responsible for disease outbreaks is crucial to minimize infections and eliminate ongoing sources of contamination. Current subtyping tools including single nucleotide polymorphism (SNP) typing may be inadequate, in some instances, to provide the required discrimination among epidemiologically unrelated Salmonella strains. Prophage genes represent the majority of the accessory genes in bacteria genomes and have potential to be used as high discrimination markers in Salmonella . In this study, the prophage sequence diversity in different Salmonella serovars and genetically related strains was investigated. Using whole genome sequences of 1,760 isolates of S. enterica representing 151 Salmonella serovars and 66 closely related bacteria, prophage sequences were identified from assembled contigs using PHASTER. We detected 154 different prophages in S. enterica genomes. Prophage sequences were highly variable among S. enterica serovars with a median ± interquartile range (IQR) of 5 ± 3 prophage regions per genome. While some prophage sequences were highly conserved among the strains of specific serovars, few regions were lineage specific. Therefore, strains belonging to each serovar could be clustered separately based on their prophage content. Analysis of S . Enteritidis isolates from seven outbreaks generated distinct prophage profiles for each outbreak. Taken altogether, the diversity of the prophage sequences correlates with genome diversity. Prophage repertoires provide an additional marker for differentiating S. enterica subtypes during foodborne outbreaks.

  1. Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae: Implications for the microbial “pan-genome”

    PubMed Central

    Tettelin, Hervé; Masignani, Vega; Cieslewicz, Michael J.; Donati, Claudio; Medini, Duccio; Ward, Naomi L.; Angiuoli, Samuel V.; Crabtree, Jonathan; Jones, Amanda L.; Durkin, A. Scott; DeBoy, Robert T.; Davidsen, Tanja M.; Mora, Marirosa; Scarselli, Maria; Margarit y Ros, Immaculada; Peterson, Jeremy D.; Hauser, Christopher R.; Sundaram, Jaideep P.; Nelson, William C.; Madupu, Ramana; Brinkac, Lauren M.; Dodson, Robert J.; Rosovitz, Mary J.; Sullivan, Steven A.; Daugherty, Sean C.; Haft, Daniel H.; Selengut, Jeremy; Gwinn, Michelle L.; Zhou, Liwei; Zafar, Nikhat; Khouri, Hoda; Radune, Diana; Dimitrov, George; Watkins, Kisha; O'Connor, Kevin J. B.; Smith, Shannon; Utterback, Teresa R.; White, Owen; Rubens, Craig E.; Grandi, Guido; Madoff, Lawrence C.; Kasper, Dennis L.; Telford, John L.; Wessels, Michael R.; Rappuoli, Rino; Fraser, Claire M.

    2005-01-01

    The development of efficient and inexpensive genome sequencing methods has revolutionized the study of human bacterial pathogens and improved vaccine design. Unfortunately, the sequence of a single genome does not reflect how genetic variability drives pathogenesis within a bacterial species and also limits genome-wide screens for vaccine candidates or for antimicrobial targets. We have generated the genomic sequence of six strains representing the five major disease-causing serotypes of Streptococcus agalactiae, the main cause of neonatal infection in humans. Analysis of these genomes and those available in databases showed that the S. agalactiae species can be described by a pan-genome consisting of a core genome shared by all isolates, accounting for ≈80% of any single genome, plus a dispensable genome consisting of partially shared and strain-specific genes. Mathematical extrapolation of the data suggests that the gene reservoir available for inclusion in the S. agalactiae pan-genome is vast and that unique genes will continue to be identified even after sequencing hundreds of genomes. PMID:16172379

  2. The COG database: a tool for genome-scale analysis of protein functions and evolution

    PubMed Central

    Tatusov, Roman L.; Galperin, Michael Y.; Natale, Darren A.; Koonin, Eugene V.

    2000-01-01

    Rational classification of proteins encoded in sequenced genomes is critical for making the genome sequences maximally useful for functional and evolutionary studies. The database of Clusters of Orthologous Groups of proteins (COGs) is an attempt on a phylogenetic classification of the proteins encoded in 21 complete genomes of bacteria, archaea and eukaryotes (http://www.ncbi.nlm.nih.gov/COG ). The COGs were constructed by applying the criterion of consistency of genome-specific best hits to the results of an exhaustive comparison of all protein sequences from these genomes. The database comprises 2091 COGs that include 56–83% of the gene products from each of the complete bacterial and archaeal genomes and ~35% of those from the yeast Saccharomyces cerevisiae genome. The COG database is accompanied by the COGNITOR program that is used to fit new proteins into the COGs and can be applied to functional and phylogenetic annotation of newly sequenced genomes. PMID:10592175

  3. Enhancing genomic laboratory reports from the patients' view: A qualitative analysis.

    PubMed

    Stuckey, Heather; Williams, Janet L; Fan, Audrey L; Rahm, Alanna Kulchak; Green, Jamie; Feldman, Lynn; Bonhag, Michele; Zallen, Doris T; Segal, Michael M; Williams, Marc S

    2015-10-01

    The purpose of this study was to develop a family genomic laboratory report designed to communicate genome sequencing results to parents of children who were participating in a whole genome sequencing clinical research study. Semi-structured interviews were conducted with parents of children who participated in a whole genome sequencing clinical research study to address the elements, language and format of a sample family-directed genome laboratory report. The qualitative interviews were followed by two focus groups aimed at evaluating example presentations of information about prognosis and next steps related to the whole genome sequencing result. Three themes emerged from the qualitative data: (i) Parents described a continual search for valid information and resources regarding their child's condition, a need that prior reports did not meet for parents; (ii) Parents believed that the Family Report would help facilitate communication with physicians and family members; and (iii) Parents identified specific items they appreciated in a genomics Family Report: simplicity of language, logical flow, visual appeal, information on what to expect in the future and recommended next steps. Parents affirmed their desire for a family genomic results report designed for their use and reference. They articulated the need for clear, easy to understand language that provided information with temporal detail and specific recommendations regarding relevant findings consistent with that available to clinicians. © 2015 Wiley Periodicals, Inc.

  4. Enhancing genomic laboratory reports from the patients' view: A qualitative analysis

    PubMed Central

    Stuckey, Heather; Fan, Audrey L.; Rahm, Alanna Kulchak; Green, Jamie; Feldman, Lynn; Bonhag, Michele; Zallen, Doris T.; Segal, Michael M.; Williams, Marc S.

    2015-01-01

    The purpose of this study was to develop a family genomic laboratory report designed to communicate genome sequencing results to parents of children who were participating in a whole genome sequencing clinical research study. Semi‐structured interviews were conducted with parents of children who participated in a whole genome sequencing clinical research study to address the elements, language and format of a sample family‐directed genome laboratory report. The qualitative interviews were followed by two focus groups aimed at evaluating example presentations of information about prognosis and next steps related to the whole genome sequencing result. Three themes emerged from the qualitative data: (i) Parents described a continual search for valid information and resources regarding their child's condition, a need that prior reports did not meet for parents; (ii) Parents believed that the Family Report would help facilitate communication with physicians and family members; and (iii) Parents identified specific items they appreciated in a genomics Family Report: simplicity of language, logical flow, visual appeal, information on what to expect in the future and recommended next steps. Parents affirmed their desire for a family genomic results report designed for their use and reference. They articulated the need for clear, easy to understand language that provided information with temporal detail and specific recommendations regarding relevant findings consistent with that available to clinicians. PMID:26086630

  5. Mining of Microbial Genomes for the Novel Sources of Nitrilases.

    PubMed

    Sharma, Nikhil; Thakur, Neerja; Raj, Tilak; Savitri; Bhalla, Tek Chand

    2017-01-01

    Next-generation DNA sequencing (NGS) has made it feasible to sequence large number of microbial genomes and advancements in computational biology have opened enormous opportunities to mine genome sequence data for novel genes and enzymes or their sources. In the present communication in silico mining of microbial genomes has been carried out to find novel sources of nitrilases. The sequences selected were analyzed for homology and considered for designing motifs. The manually designed motifs based on amino acid sequences of nitrilases were used to screen 2000 microbial genomes (translated to proteomes). This resulted in identification of one hundred thirty-eight putative/hypothetical sequences which could potentially code for nitrilase activity. In vitro validation of nine predicted sources of nitrilases was done for nitrile/cyanide hydrolyzing activity. Out of nine predicted nitrilases, Gluconacetobacter diazotrophicus , Sphingopyxis alaskensis , Saccharomonospora viridis , and Shimwellia blattae were specific for aliphatic nitriles, whereas nitrilases from Geodermatophilus obscurus , Nocardiopsis dassonvillei , Runella slithyformis , and Streptomyces albus possessed activity for aromatic nitriles. Flavobacterium indicum was specific towards potassium cyanide (KCN) which revealed the presence of nitrilase homolog, that is, cyanide dihydratase with no activity for either aliphatic, aromatic, or aryl nitriles. The present study reports the novel sources of nitrilases and cyanide dihydratase which were not reported hitherto by in silico or in vitro studies.

  6. Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence

    PubMed Central

    Chen, Lei; Pospíšilová, Petra; Strouhal, Michal; Qin, Xiang; Mikalová, Lenka; Norris, Steven J.; Muzny, Donna M.; Gibbs, Richard A.; Fulton, Lucinda L.; Sodergren, Erica; Weinstock, George M.; Šmajs, David

    2012-01-01

    Background The yaws treponemes, Treponema pallidum ssp. pertenue (TPE) strains, are closely related to syphilis causing strains of Treponema pallidum ssp. pallidum (TPA). Both yaws and syphilis are distinguished on the basis of epidemiological characteristics, clinical symptoms, and several genetic signatures of the corresponding causative agents. Methodology/Principal Findings To precisely define genetic differences between TPA and TPE, high-quality whole genome sequences of three TPE strains (Samoa D, CDC-2, Gauthier) were determined using next-generation sequencing techniques. TPE genome sequences were compared to four genomes of TPA strains (Nichols, DAL-1, SS14, Chicago). The genome structure was identical in all three TPE strains with similar length ranging between 1,139,330 bp and 1,139,744 bp. No major genome rearrangements were found when compared to the four TPA genomes. The whole genome nucleotide divergence (dA) between TPA and TPE subspecies was 4.7 and 4.8 times higher than the observed nucleotide diversity (π) among TPA and TPE strains, respectively, corresponding to 99.8% identity between TPA and TPE genomes. A set of 97 (9.9%) TPE genes encoded proteins containing two or more amino acid replacements or other major sequence changes. The TPE divergent genes were mostly from the group encoding potential virulence factors and genes encoding proteins with unknown function. Conclusions/Significance Hypothetical genes, with genetic differences, consistently found between TPE and TPA strains are candidates for syphilitic treponemes virulence factors. Seventeen TPE genes were predicted under positive selection, and eleven of them coded either for predicted exported proteins or membrane proteins suggesting their possible association with the cell surface. Sequence changes between TPE and TPA strains and changes specific to individual strains represent suitable targets for subspecies- and strain-specific molecular diagnostics. PMID:22292095

  7. Draft genome of the living fossil Ginkgo biloba.

    PubMed

    Guan, Rui; Zhao, Yunpeng; Zhang, He; Fan, Guangyi; Liu, Xin; Zhou, Wenbin; Shi, Chengcheng; Wang, Jiahao; Liu, Weiqing; Liang, Xinming; Fu, Yuanyuan; Ma, Kailong; Zhao, Lijun; Zhang, Fumin; Lu, Zuhong; Lee, Simon Ming-Yuen; Xu, Xun; Wang, Jian; Yang, Huanming; Fu, Chengxin; Ge, Song; Chen, Wenbin

    2016-11-21

    Ginkgo biloba L. (Ginkgoaceae) is one of the most distinctive plants. It possesses a suite of fascinating characteristics including a large genome, outstanding resistance/tolerance to abiotic and biotic stresses, and dioecious reproduction, making it an ideal model species for biological studies. However, the lack of a high-quality genome sequence has been an impediment to our understanding of its biology and evolution. The 10.61 Gb genome sequence containing 41,840 annotated genes was assembled in the present study. Repetitive sequences account for 76.58% of the assembled sequence, and long terminal repeat retrotransposons (LTR-RTs) are particularly prevalent. The diversity and abundance of LTR-RTs is due to their gradual accumulation and a remarkable amplification between 16 and 24 million years ago, and they contribute to the long introns and large genome. Whole genome duplication (WGD) may have occurred twice, with an ancient WGD consistent with that shown to occur in other seed plants, and a more recent event specific to ginkgo. Abundant gene clusters from tandem duplication were also evident, and enrichment of expanded gene families indicates a remarkable array of chemical and antibacterial defense pathways. The ginkgo genome consists mainly of LTR-RTs resulting from ancient gradual accumulation and two WGD events. The multiple defense mechanisms underlying the characteristic resilience of ginkgo are fostered by a remarkable enrichment in ancient duplicated and ginkgo-specific gene clusters. The present study sheds light on sequencing large genomes, and opens an avenue for further genetic and evolutionary research.

  8. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

    PubMed Central

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

    2016-01-01

    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

  9. A sequence-based survey of the complex structural organization of tumor genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Collins, Colin; Raphael, Benjamin J.; Volik, Stanislav

    2008-04-03

    The genomes of many epithelial tumors exhibit extensive chromosomal rearrangements. All classes of genome rearrangements can be identified using End Sequencing Profiling (ESP), which relies on paired-end sequencing of cloned tumor genomes. In this study, brain, breast, ovary and prostate tumors along with three breast cancer cell lines were surveyed with ESP yielding the largest available collection of sequence-ready tumor genome breakpoints and providing evidence that some rearrangements may be recurrent. Sequencing and fluorescence in situ hybridization (FISH) confirmed translocations and complex tumor genome structures that include coamplification and packaging of disparate genomic loci with associated molecular heterogeneity. Comparison ofmore » the tumor genomes suggests recurrent rearrangements. Some are likely to be novel structural polymorphisms, whereas others may be bona fide somatic rearrangements. A recurrent fusion transcript in breast tumors and a constitutional fusion transcript resulting from a segmental duplication were identified. Analysis of end sequences for single nucleotide polymorphisms (SNPs) revealed candidate somatic mutations and an elevated rate of novel SNPs in an ovarian tumor. These results suggest that the genomes of many epithelial tumors may be far more dynamic and complex than previously appreciated and that genomic fusions including fusion transcripts and proteins may be common, possibly yielding tumor-specific biomarkers and therapeutic targets.« less

  10. USE OF COMPETITIVE GENOMIC HYBRIDIZATION TO ENRICH FOR GENOME-SPECIFIC DIFFERENCES BETWEEN TWO CLOSELY RELATED HUMAN FECAL INDICATOR BACTERIA

    EPA Science Inventory

    Enterococci are frequently used as indicators of fecal pollution in surface waters. To accelerate the identification of Enterococcus faecalis-specific DNA sequences, we employed a comparative genomic strategy utilizing a positive selection process to compare E. faec...

  11. Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

    PubMed

    Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

    2016-02-24

    Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

  12. Long Terminal Repeat Retrotransposon Content in Eight Diploid Sunflower Species Inferred from Next-Generation Sequence Data

    PubMed Central

    Tetreault, Hannah M.; Ungerer, Mark C.

    2016-01-01

    The most abundant transposable elements (TEs) in plant genomes are Class I long terminal repeat (LTR) retrotransposons represented by superfamilies gypsy and copia. Amplification of these superfamilies directly impacts genome structure and contributes to differential patterns of genome size evolution among plant lineages. Utilizing short-read Illumina data and sequence information from a panel of Helianthus annuus (sunflower) full-length gypsy and copia elements, we explore the contribution of these sequences to genome size variation among eight diploid Helianthus species and an outgroup taxon, Phoebanthus tenuifolius. We also explore transcriptional dynamics of these elements in both leaf and bud tissue via RT-PCR. We demonstrate that most LTR retrotransposon sublineages (i.e., families) display patterns of similar genomic abundance across species. A small number of LTR retrotransposon sublineages exhibit lineage-specific amplification, particularly in the genomes of species with larger estimated nuclear DNA content. RT-PCR assays reveal that some LTR retrotransposon sublineages are transcriptionally active across all species and tissue types, whereas others display species-specific and tissue-specific expression. The species with the largest estimated genome size, H. agrestis, has experienced amplification of LTR retrotransposon sublineages, some of which have proliferated independently in other lineages in the Helianthus phylogeny. PMID:27233667

  13. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    NASA Astrophysics Data System (ADS)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  14. Regions flanking ori sequences affect the replication efficiency of the mitochondrial genome of ori+ petite mutants from yeast.

    PubMed

    Rayko, E; Goursot, R; Cherif-Zahar, B; Melis, R; Bernardi, G

    1988-03-31

    The mitochondrial genomes of progenies from 26 crosses between 17 cytoplasmic, spontaneous, suppressive, ori+ petite mutants of Saccharomyces cerevisiae have been studied by electrophoresis of restriction fragments. Only parental genomes (or occasionally, genomes derived from them by secondary excisions) were found in the progenies of the almost 500 diploids investigated; no evidence for illegitimate, site-specific mitochondrial recombination was detected. One of the parental genomes was always found to be predominate over the other one, although to different extents in different crosses. This predominance appears to be due to a higher replication efficiency, which is correlated with a greater density of ori sequences on the mitochondrial genome (and with a shorter repeat unit size of the latter). Exceptions to the 'repeat-unit-size rule' were found, however, even when the parental mitochondrial genomes carried the same ori sequence. This indicates that noncoding, intergenic sequences outside ori sequences also play a role in modulating replication efficiency. Since in different petites such sequences differ in primary structure, size, and position relative to ori sequences, this modulation is likely to take place through an indirect effect on DNA and nucleoid structure.

  15. Haemonchus contortus: Genome Structure, Organization and Comparative Genomics.

    PubMed

    Laing, R; Martinelli, A; Tracey, A; Holroyd, N; Gilleard, J S; Cotton, J A

    2016-01-01

    One of the first genome sequencing projects for a parasitic nematode was that for Haemonchus contortus. The open access data from the Wellcome Trust Sanger Institute provided a valuable early resource for the research community, particularly for the identification of specific genes and genetic markers. Later, a second sequencing project was initiated by the University of Melbourne, and the two draft genome sequences for H. contortus were published back-to-back in 2013. There is a pressing need for long-range genomic information for genetic mapping, population genetics and functional genomic studies, so we are continuing to improve the Wellcome Trust Sanger Institute assembly to provide a finished reference genome for H. contortus. This review describes this process, compares the H. contortus genome assemblies with draft genomes from other members of the strongylid group and discusses future directions for parasite genomics using the H. contortus model. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Unknown sequence amplification: Application to in vitro genome walking in Chlamydia trachomatis L2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Copley, C.G.; Boot, C.; Bundell, K.

    1991-01-01

    A recently described technique, Chemical Genetics' unknown sequence amplification method, which requires only one specific oligonucleotide, has broadened the applicability of the polymerase chain reaction to DNA of unknown sequence. The authors have adapted this technique to the study of the genome of Chlamydia trachomatis, an obligate intracellular bacterium, and describe modifications that significantly improve the utility of this approach. These techniques allow for rapid genomic analysis entirely in vitro, using DNA of limited quantity of purity.

  17. Identification of ecotype-specific marker genes for categorization of beer-spoiling Lactobacillus brevis.

    PubMed

    Behr, Jürgen; Geissler, Andreas J; Preissler, Patrick; Ehrenreich, Armin; Angelov, Angel; Vogel, Rudi F

    2015-10-01

    The tolerance to hop compounds, which is mainly associated with inhibition of bacterial growth in beer, is a multi-factorial trait. Any approaches to predict the physiological differences between beer-spoiling and non-spoiling strains on the basis of a single marker gene are limited. We identified ecotype-specific genes related to the ability to grow in Pilsner beer via comparative genome sequencing. The genome sequences of four different strains of Lactobacillus brevis were compared, including newly established genomes of two highly hop tolerant beer isolates, one strain isolated from faeces and one published genome of a silage isolate. Gene fragments exclusively occurring in beer-spoiling strains as well as sequences only occurring in non-spoiling strains were identified. Comparative genomic arrays were established and hybridized with a set of L. brevis strains, which are characterized by their ability to spoil beer. As result, a set of 33 and 4 oligonucleotide probes could be established specifically detecting beer-spoilers and non-spoilers, respectively. The detection of more than one of these marker sequences according to a genetic barcode enables scoring of L. brevis for their beer-spoiling potential and can thus assist in risk evaluation in brewing industry. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Genome-Wide Stochastic Adaptive DNA Amplification at Direct and Inverted DNA Repeats in the Parasite Leishmania

    PubMed Central

    Plourde, Marie; Gingras, Hélène; Roy, Gaétan; Lapointe, Andréanne; Leprohon, Philippe; Papadopoulou, Barbara; Corbeil, Jacques; Ouellette, Marc

    2014-01-01

    Gene amplification of specific loci has been described in all kingdoms of life. In the protozoan parasite Leishmania, the product of amplification is usually part of extrachromosomal circular or linear amplicons that are formed at the level of direct or inverted repeated sequences. A bioinformatics screen revealed that repeated sequences are widely distributed in the Leishmania genome and the repeats are chromosome-specific, conserved among species, and generally present in low copy number. Using sensitive PCR assays, we provide evidence that the Leishmania genome is continuously being rearranged at the level of these repeated sequences, which serve as a functional platform for constitutive and stochastic amplification (and deletion) of genomic segments in the population. This process is adaptive as the copy number of advantageous extrachromosomal circular or linear elements increases upon selective pressure and is reversible when selection is removed. We also provide mechanistic insights on the formation of circular and linear amplicons through RAD51 recombinase-dependent and -independent mechanisms, respectively. The whole genome of Leishmania is thus stochastically rearranged at the level of repeated sequences, and the selection of parasite subpopulations with changes in the copy number of specific loci is used as a strategy to respond to a changing environment. PMID:24844805

  19. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

    PubMed

    Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

    2015-01-01

    Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

  20. Multi-Platform Next-Generation Sequencing of the Domestic Turkey (Meleagris gallopavo): Genome Assembly and Analysis

    PubMed Central

    Aslam, Luqman; Beal, Kathryn; Ann Blomberg, Le; Bouffard, Pascal; Burt, David W.; Crasta, Oswald; Crooijmans, Richard P. M. A.; Cooper, Kristal; Coulombe, Roger A.; De, Supriyo; Delany, Mary E.; Dodgson, Jerry B.; Dong, Jennifer J.; Evans, Clive; Frederickson, Karin M.; Flicek, Paul; Florea, Liliana; Folkerts, Otto; Groenen, Martien A. M.; Harkins, Tim T.; Herrero, Javier; Hoffmann, Steve; Megens, Hendrik-Jan; Jiang, Andrew; de Jong, Pieter; Kaiser, Pete; Kim, Heebal; Kim, Kyu-Won; Kim, Sungwon; Langenberger, David; Lee, Mi-Kyung; Lee, Taeheon; Mane, Shrinivasrao; Marcais, Guillaume; Marz, Manja; McElroy, Audrey P.; Modise, Thero; Nefedov, Mikhail; Notredame, Cédric; Paton, Ian R.; Payne, William S.; Pertea, Geo; Prickett, Dennis; Puiu, Daniela; Qioa, Dan; Raineri, Emanuele; Ruffier, Magali; Salzberg, Steven L.; Schatz, Michael C.; Scheuring, Chantel; Schmidt, Carl J.; Schroeder, Steven; Searle, Stephen M. J.; Smith, Edward J.; Smith, Jacqueline; Sonstegard, Tad S.; Stadler, Peter F.; Tafer, Hakim; Tu, Zhijian (Jake); Van Tassell, Curtis P.; Vilella, Albert J.; Williams, Kelly P.; Yorke, James A.; Zhang, Liqing; Zhang, Hong-Bin; Zhang, Xiaojun; Zhang, Yang; Reed, Kent M.

    2010-01-01

    A synergistic combination of two next-generation sequencing platforms with a detailed comparative BAC physical contig map provided a cost-effective assembly of the genome sequence of the domestic turkey (Meleagris gallopavo). Heterozygosity of the sequenced source genome allowed discovery of more than 600,000 high quality single nucleotide variants. Despite this heterozygosity, the current genome assembly (∼1.1 Gb) includes 917 Mb of sequence assigned to specific turkey chromosomes. Annotation identified nearly 16,000 genes, with 15,093 recognized as protein coding and 611 as non-coding RNA genes. Comparative analysis of the turkey, chicken, and zebra finch genomes, and comparing avian to mammalian species, supports the characteristic stability of avian genomes and identifies genes unique to the avian lineage. Clear differences are seen in number and variety of genes of the avian immune system where expansions and novel genes are less frequent than examples of gene loss. The turkey genome sequence provides resources to further understand the evolution of vertebrate genomes and genetic variation underlying economically important quantitative traits in poultry. This integrated approach may be a model for providing both gene and chromosome level assemblies of other species with agricultural, ecological, and evolutionary interest. PMID:20838655

  1. Plastome Sequence Determination and Comparative Analysis for Members of the Lolium-Festuca Grass Species Complex

    PubMed Central

    Hand, Melanie L.; Spangenberg, German C.; Forster, John W.; Cogan, Noel O. I.

    2013-01-01

    Chloroplast genome sequences are of broad significance in plant biology, due to frequent use in molecular phylogenetics, comparative genomics, population genetics, and genetic modification studies. The present study used a second-generation sequencing approach to determine and assemble the plastid genomes (plastomes) of four representatives from the agriculturally important Lolium-Festuca species complex of pasture grasses (Lolium multiflorum, Festuca pratensis, Festuca altissima, and Festuca ovina). Total cellular DNA was extracted from either roots or leaves, was sequenced, and the output was filtered for plastome-related reads. A comparison between sources revealed fewer plastome-related reads from root-derived template but an increase in incidental bacterium-derived sequences. Plastome assembly and annotation indicated high levels of sequence identity and a conserved organization and gene content between species. However, frequent deletions within the F. ovina plastome appeared to contribute to a smaller plastid genome size. Comparative analysis with complete plastome sequences from other members of the Poaceae confirmed conservation of most grass-specific features. Detailed analysis of the rbcL–psaI intergenic region, however, revealed a “hot-spot” of variation characterized by independent deletion events. The evolutionary implications of this observation are discussed. The complete plastome sequences are anticipated to provide the basis for potential organelle-specific genetic modification of pasture grasses. PMID:23550121

  2. Complete Chloroplast Genome of the Multifunctional Crop Globe Artichoke and Comparison with Other Asteraceae

    PubMed Central

    Curci, Pasquale L.; De Paola, Domenico; Danzi, Donatella; Vendramin, Giovanni G.; Sonnante, Gabriella

    2015-01-01

    With over 20,000 species, Asteraceae is the second largest plant family. High-throughput sequencing of nuclear and chloroplast genomes has allowed for a better understanding of the evolutionary relationships within large plant families. Here, the globe artichoke chloroplast (cp) genome was obtained by a combination of whole-genome and BAC clone high-throughput sequencing. The artichoke cp genome is 152,529 bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 25,155 bp, representing the longest IRs found in the Asteraceae family so far. The large (LSC) and the small (SSC) single-copy regions span 83,578 bp and 18,641 bp, respectively. The artichoke cp sequence was compared to the other eight Asteraceae complete cp genomes available, revealing an IR expansion at the SSC/IR boundary. This expansion consists of 17 bp of the ndhF gene generating an overlap between the ndhF and ycf1 genes. A total of 127 cp simple sequence repeats (cpSSRs) were identified in the artichoke cp genome, potentially suitable for future population studies in the Cynara genus. Parsimony-informative regions were evaluated and allowed to place a Cynara species within the Asteraceae family tree. The eight most informative coding regions were also considered and tested for “specific barcode” purpose in the Asteraceae family. Our results highlight the usefulness of cp genome sequencing in exploring plant genome diversity and retrieving reliable molecular resources for phylogenetic and evolutionary studies, as well as for specific barcodes in plants. PMID:25774672

  3. Complete chloroplast genome of the multifunctional crop globe artichoke and comparison with other Asteraceae.

    PubMed

    Curci, Pasquale L; De Paola, Domenico; Danzi, Donatella; Vendramin, Giovanni G; Sonnante, Gabriella

    2015-01-01

    With over 20,000 species, Asteraceae is the second largest plant family. High-throughput sequencing of nuclear and chloroplast genomes has allowed for a better understanding of the evolutionary relationships within large plant families. Here, the globe artichoke chloroplast (cp) genome was obtained by a combination of whole-genome and BAC clone high-throughput sequencing. The artichoke cp genome is 152,529 bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 25,155 bp, representing the longest IRs found in the Asteraceae family so far. The large (LSC) and the small (SSC) single-copy regions span 83,578 bp and 18,641 bp, respectively. The artichoke cp sequence was compared to the other eight Asteraceae complete cp genomes available, revealing an IR expansion at the SSC/IR boundary. This expansion consists of 17 bp of the ndhF gene generating an overlap between the ndhF and ycf1 genes. A total of 127 cp simple sequence repeats (cpSSRs) were identified in the artichoke cp genome, potentially suitable for future population studies in the Cynara genus. Parsimony-informative regions were evaluated and allowed to place a Cynara species within the Asteraceae family tree. The eight most informative coding regions were also considered and tested for "specific barcode" purpose in the Asteraceae family. Our results highlight the usefulness of cp genome sequencing in exploring plant genome diversity and retrieving reliable molecular resources for phylogenetic and evolutionary studies, as well as for specific barcodes in plants.

  4. CRISPR/Cas9 for genome editing: progress, implications and challenges.

    PubMed

    Zhang, Feng; Wen, Yan; Guo, Xiong

    2014-09-15

    Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system provides a robust and multiplexable genome editing tool, enabling researchers to precisely manipulate specific genomic elements, and facilitating the elucidation of target gene function in biology and diseases. CRISPR/Cas9 comprises of a nonspecific Cas9 nuclease and a set of programmable sequence-specific CRISPR RNA (crRNA), which can guide Cas9 to cleave DNA and generate double-strand breaks at target sites. Subsequent cellular DNA repair process leads to desired insertions, deletions or substitutions at target sites. The specificity of CRISPR/Cas9-mediated DNA cleavage requires target sequences matching crRNA and a protospacer adjacent motif locating at downstream of target sequences. Here, we review the molecular mechanism, applications and challenges of CRISPR/Cas9-mediated genome editing and clinical therapeutic potential of CRISPR/Cas9 in future. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Overview of the creative genome: effects of genome structure and sequence on the generation of variation and evolution.

    PubMed

    Caporale, Lynn Helena

    2012-09-01

    This overview of a special issue of Annals of the New York Academy of Sciences discusses uneven distribution of distinct types of variation across the genome, the dependence of specific types of variation upon distinct classes of DNA sequences and/or the induction of specific proteins, the circumstances in which distinct variation-generating systems are activated, and the implications of this work for our understanding of evolution and of cancer. Also discussed is the value of non text-based computational methods for analyzing information carried by DNA, early insights into organizational frameworks that affect genome behavior, and implications of this work for comparative genomics. © 2012 New York Academy of Sciences.

  6. Complete genome sequence of Enterococcus faecium strain TX16 and comparative genomic analysis of Enterococcus faecium genomes

    PubMed Central

    2012-01-01

    Background Enterococci are among the leading causes of hospital-acquired infections in the United States and Europe, with Enterococcus faecalis and Enterococcus faecium being the two most common species isolated from enterococcal infections. In the last decade, the proportion of enterococcal infections caused by E. faecium has steadily increased compared to other Enterococcus species. Although the underlying mechanism for the gradual replacement of E. faecalis by E. faecium in the hospital environment is not yet understood, many studies using genotyping and phylogenetic analysis have shown the emergence of a globally dispersed polyclonal subcluster of E. faecium strains in clinical environments. Systematic study of the molecular epidemiology and pathogenesis of E. faecium has been hindered by the lack of closed, complete E. faecium genomes that can be used as references. Results In this study, we report the complete genome sequence of the E. faecium strain TX16, also known as DO, which belongs to multilocus sequence type (ST) 18, and was the first E. faecium strain ever sequenced. Whole genome comparison of the TX16 genome with 21 E. faecium draft genomes confirmed that most clinical, outbreak, and hospital-associated (HA) strains (including STs 16, 17, 18, and 78), in addition to strains of non-hospital origin, group in the same clade (referred to as the HA clade) and are evolutionally considerably more closely related to each other by phylogenetic and gene content similarity analyses than to isolates in the community-associated (CA) clade with approximately a 3–4% average nucleotide sequence difference between the two clades at the core genome level. Our study also revealed that many genomic loci in the TX16 genome are unique to the HA clade. 380 ORFs in TX16 are HA-clade specific and antibiotic resistance genes are enriched in HA-clade strains. Mobile elements such as IS16 and transposons were also found almost exclusively in HA strains, as previously reported. Conclusions Our findings along with other studies show that HA clonal lineages harbor specific genetic elements as well as sequence differences in the core genome which may confer selection advantages over the more heterogeneous CA E. faecium isolates. Which of these differences are important for the success of specific E. faecium lineages in the hospital environment remain(s) to be determined. PMID:22769602

  7. The genome of melon (Cucumis melo L.)

    PubMed Central

    Garcia-Mas, Jordi; Benjak, Andrej; Sanseverino, Walter; Bourgeois, Michael; Mir, Gisela; González, Víctor M.; Hénaff, Elizabeth; Câmara, Francisco; Cozzuto, Luca; Lowy, Ernesto; Alioto, Tyler; Capella-Gutiérrez, Salvador; Blanca, Jose; Cañizares, Joaquín; Ziarsolo, Pello; Gonzalez-Ibeas, Daniel; Rodríguez-Moreno, Luis; Droege, Marcus; Du, Lei; Alvarez-Tejado, Miguel; Lorente-Galdos, Belen; Melé, Marta; Yang, Luming; Weng, Yiqun; Navarro, Arcadi; Marques-Bonet, Tomas; Aranda, Miguel A.; Nuez, Fernando; Picó, Belén; Gabaldón, Toni; Roma, Guglielmo; Guigó, Roderic; Casacuberta, Josep M.; Arús, Pere; Puigdomènech, Pere

    2012-01-01

    We report the genome sequence of melon, an important horticultural crop worldwide. We assembled 375 Mb of the double-haploid line DHL92, representing 83.3% of the estimated melon genome. We predicted 27,427 protein-coding genes, which we analyzed by reconstructing 22,218 phylogenetic trees, allowing mapping of the orthology and paralogy relationships of sequenced plant genomes. We observed the absence of recent whole-genome duplications in the melon lineage since the ancient eudicot triplication, and our data suggest that transposon amplification may in part explain the increased size of the melon genome compared with the close relative cucumber. A low number of nucleotide-binding site–leucine-rich repeat disease resistance genes were annotated, suggesting the existence of specific defense mechanisms in this species. The DHL92 genome was compared with that of its parental lines allowing the quantification of sequence variability in the species. The use of the genome sequence in future investigations will facilitate the understanding of evolution of cucurbits and the improvement of breeding strategies. PMID:22753475

  8. Swine and Poultry Pathogens: the Complete Genome Sequences of Two Strains of Mycoplasma hyopneumoniae and a Strain of Mycoplasma synoviae†

    PubMed Central

    Vasconcelos, Ana Tereza R.; Ferreira, Henrique B.; Bizarro, Cristiano V.; Bonatto, Sandro L.; Carvalho, Marcos O.; Pinto, Paulo M.; Almeida, Darcy F.; Almeida, Luiz G. P.; Almeida, Rosana; Alves-Filho, Leonardo; Assunção, Enedina N.; Azevedo, Vasco A. C.; Bogo, Maurício R.; Brigido, Marcelo M.; Brocchi, Marcelo; Burity, Helio A.; Camargo, Anamaria A.; Camargo, Sandro S.; Carepo, Marta S.; Carraro, Dirce M.; de Mattos Cascardo, Júlio C.; Castro, Luiza A.; Cavalcanti, Gisele; Chemale, Gustavo; Collevatti, Rosane G.; Cunha, Cristina W.; Dallagiovanna, Bruno; Dambrós, Bibiana P.; Dellagostin, Odir A.; Falcão, Clarissa; Fantinatti-Garboggini, Fabiana; Felipe, Maria S. S.; Fiorentin, Laurimar; Franco, Gloria R.; Freitas, Nara S. A.; Frías, Diego; Grangeiro, Thalles B.; Grisard, Edmundo C.; Guimarães, Claudia T.; Hungria, Mariangela; Jardim, Sílvia N.; Krieger, Marco A.; Laurino, Jomar P.; Lima, Lucymara F. A.; Lopes, Maryellen I.; Loreto, Élgion L. S.; Madeira, Humberto M. F.; Manfio, Gilson P.; Maranhão, Andrea Q.; Martinkovics, Christyanne T.; Medeiros, Sílvia R. B.; Moreira, Miguel A. M.; Neiva, Márcia; Ramalho-Neto, Cicero E.; Nicolás, Marisa F.; Oliveira, Sergio C.; Paixão, Roger F. C.; Pedrosa, Fábio O.; Pena, Sérgio D. J.; Pereira, Maristela; Pereira-Ferrari, Lilian; Piffer, Itamar; Pinto, Luciano S.; Potrich, Deise P.; Salim, Anna C. M.; Santos, Fabrício R.; Schmitt, Renata; Schneider, Maria P. C.; Schrank, Augusto; Schrank, Irene S.; Schuck, Adriana F.; Seuanez, Hector N.; Silva, Denise W.; Silva, Rosane; Silva, Sérgio C.; Soares, Célia M. A.; Souza, Kelly R. L.; Souza, Rangel C.; Staats, Charley C.; Steffens, Maria B. R.; Teixeira, Santuza M. R.; Urmenyi, Turan P.; Vainstein, Marilene H.; Zuccherato, Luciana W.; Simpson, Andrew J. G.; Zaha, Arnaldo

    2005-01-01

    This work reports the results of analyses of three complete mycoplasma genomes, a pathogenic (7448) and a nonpathogenic (J) strain of the swine pathogen Mycoplasma hyopneumoniae and a strain of the avian pathogen Mycoplasma synoviae; the genome sizes of the three strains were 920,079 bp, 897,405 bp, and 799,476 bp, respectively. These genomes were compared with other sequenced mycoplasma genomes reported in the literature to examine several aspects of mycoplasma evolution. Strain-specific regions, including integrative and conjugal elements, and genome rearrangements and alterations in adhesin sequences were observed in the M. hyopneumoniae strains, and all of these were potentially related to pathogenicity. Genomic comparisons revealed that reduction in genome size implied loss of redundant metabolic pathways, with maintenance of alternative routes in different species. Horizontal gene transfer was consistently observed between M. synoviae and Mycoplasma gallisepticum. Our analyses indicated a likely transfer event of hemagglutinin-coding DNA sequences from M. gallisepticum to M. synoviae. PMID:16077101

  9. RNA Editing in Plant Mitochondria

    NASA Astrophysics Data System (ADS)

    Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

    1989-12-01

    Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

  10. A genome-wide SNP scan accelerates trait-regulatory genomic loci identification in chickpea

    PubMed Central

    Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C.L.L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

    2015-01-01

    We identified 44844 high-quality SNPs by sequencing 92 diverse chickpea accessions belonging to a seed and pod trait-specific association panel using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays. A GWAS (genome-wide association study) in an association panel of 211, including the 92 sequenced accessions, identified 22 major genomic loci showing significant association (explaining 23–47% phenotypic variation) with pod and seed number/plant and 100-seed weight. Eighteen trait-regulatory major genomic loci underlying 13 robust QTLs were validated and mapped on an intra-specific genetic linkage map by QTL mapping. A combinatorial approach of GWAS, QTL mapping and gene haplotype-specific LD mapping and transcript profiling uncovered one superior haplotype and favourable natural allelic variants in the upstream regulatory region of a CesA-type cellulose synthase (Ca_Kabuli_CesA3) gene regulating high pod and seed number/plant (explaining 47% phenotypic variation) in chickpea. The up-regulation of this superior gene haplotype correlated with increased transcript expression of Ca_Kabuli_CesA3 gene in the pollen and pod of high pod/seed number accession, resulting in higher cellulose accumulation for normal pollen and pollen tube growth. A rapid combinatorial genome-wide SNP genotyping-based approach has potential to dissect complex quantitative agronomic traits and delineate trait-regulatory genomic loci (candidate genes) for genetic enhancement in crop plants, including chickpea. PMID:26058368

  11. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements

    PubMed Central

    Maliszewska-Olejniczak, Kamila; Gruchota, Julita; Gromadka, Robert; Denby Wilkes, Cyril; Arnaiz, Olivier; Mathy, Nathalie; Duharcourt, Sandra; Bétermier, Mireille; Nowak, Jacek K.

    2015-01-01

    Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs) in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline) nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs). Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium, and establishes for the first time a specific role of TFIIS in non-coding transcription in eukaryotes. PMID:26177014

  12. Nature and distribution of feline sarcoma virus nucleotide sequences.

    PubMed Central

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  13. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    PubMed

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  14. Floral gene resources from basal angiosperms for comparative genomics research

    PubMed Central

    Albert, Victor A; Soltis, Douglas E; Carlson, John E; Farmerie, William G; Wall, P Kerr; Ilut, Daniel C; Solow, Teri M; Mueller, Lukas A; Landherr, Lena L; Hu, Yi; Buzgo, Matyas; Kim, Sangtae; Yoo, Mi-Jeong; Frohlich, Michael W; Perl-Treves, Rafael; Schlarbaum, Scott E; Bliss, Barbara J; Zhang, Xiaohong; Tanksley, Steven D; Oppenheimer, David G; Soltis, Pamela S; Ma, Hong; dePamphilis, Claude W; Leebens-Mack, James H

    2005-01-01

    Background The Floral Genome Project was initiated to bridge the genomic gap between the most broadly studied plant model systems. Arabidopsis and rice, although now completely sequenced and under intensive comparative genomic investigation, are separated by at least 125 million years of evolutionary time, and cannot in isolation provide a comprehensive perspective on structural and functional aspects of flowering plant genome dynamics. Here we discuss new genomic resources available to the scientific community, comprising cDNA libraries and Expressed Sequence Tag (EST) sequences for a suite of phylogenetically basal angiosperms specifically selected to bridge the evolutionary gaps between model plants and provide insights into gene content and genome structure in the earliest flowering plants. Results Random sequencing of cDNAs from representatives of phylogenetically important eudicot, non-grass monocot, and gymnosperm lineages has so far (as of 12/1/04) generated 70,514 ESTs and 48,170 assembled unigenes. Efficient sorting of EST sequences into putative gene families based on whole Arabidopsis/rice proteome comparison has permitted ready identification of cDNA clones for finished sequencing. Preliminarily, (i) proportions of functional categories among sequenced floral genes seem representative of the entire Arabidopsis transcriptome, (ii) many known floral gene homologues have been captured, and (iii) phylogenetic analyses of ESTs are providing new insights into the process of gene family evolution in relation to the origin and diversification of the angiosperms. Conclusion Initial comparisons illustrate the utility of the EST data sets toward discovery of the basic floral transcriptome. These first findings also afford the opportunity to address a number of conspicuous evolutionary genomic questions, including reproductive organ transcriptome overlap between angiosperms and gymnosperms, genome-wide duplication history, lineage-specific gene duplication and functional divergence, and analyses of adaptive molecular evolution. Since not all genes in the floral transcriptome will be associated with flowering, these EST resources will also be of interest to plant scientists working on other functions, such as photosynthesis, signal transduction, and metabolic pathways. PMID:15799777

  15. Comparative genomics of four closely related Clostridium perfringens bacteriophages reveals variable evolution among core genes with therapeutic potential

    PubMed Central

    2011-01-01

    Background Because biotechnological uses of bacteriophage gene products as alternatives to conventional antibiotics will require a thorough understanding of their genomic context, we sequenced and analyzed the genomes of four closely related phages isolated from Clostridium perfringens, an important agricultural and human pathogen. Results Phage whole-genome tetra-nucleotide signatures and proteomic tree topologies correlated closely with host phylogeny. Comparisons of our phage genomes to 26 others revealed three shared COGs; of particular interest within this core genome was an endolysin (PF01520, an N-acetylmuramoyl-L-alanine amidase) and a holin (PF04531). Comparative analyses of the evolutionary history and genomic context of these common phage proteins revealed two important results: 1) strongly significant host-specific sequence variation within the endolysin, and 2) a protein domain architecture apparently unique to our phage genomes in which the endolysin is located upstream of its associated holin. Endolysin sequences from our phages were one of two very distinct genotypes distinguished by variability within the putative enzymatically-active domain. The shared or core genome was comprised of genes with multiple sequence types belonging to five pfam families, and genes belonging to 12 pfam families, including the holin genes, which were nearly identical. Conclusions Significant genomic diversity exists even among closely-related bacteriophages. Holins and endolysins represent conserved functions across divergent phage genomes and, as we demonstrate here, endolysins can have significant variability and host-specificity even among closely-related genomes. Endolysins in our phage genomes may be subject to different selective pressures than the rest of the genome. These findings may have important implications for potential biotechnological applications of phage gene products. PMID:21631945

  16. Identification of Human Lineage-Specific Transcriptional Coregulators Enabled by a Glossary of Binding Modules and Tunable Genomic Backgrounds.

    PubMed

    Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L

    2017-09-27

    Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Structure and Distribution of Centromeric Retrotransposons at Diploid and Allotetraploid Coffea Centromeric and Pericentromeric Regions

    PubMed Central

    de Castro Nunes, Renata; Orozco-Arias, Simon; Crouzillat, Dominique; Mueller, Lukas A.; Strickler, Suzy R.; Descombes, Patrick; Fournier, Coralie; Moine, Deborah; de Kochko, Alexandre; Yuyama, Priscila M.; Vanzela, André L. L.; Guyot, Romain

    2018-01-01

    Centromeric regions of plants are generally composed of large array of satellites from a specific lineage of Gypsy LTR-retrotransposons, called Centromeric Retrotransposons. Repeated sequences interact with a specific H3 histone, playing a crucial function on kinetochore formation. To study the structure and composition of centromeric regions in the genus Coffea, we annotated and classified Centromeric Retrotransposons sequences from the allotetraploid C. arabica genome and its two diploid ancestors: Coffea canephora and C. eugenioides. Ten distinct CRC (Centromeric Retrotransposons in Coffea) families were found. The sequence mapping and FISH experiments of CRC Reverse Transcriptase domains in C. canephora, C. eugenioides, and C. arabica clearly indicate a strong and specific targeting mainly onto proximal chromosome regions, which can be associated also with heterochromatin. PacBio genome sequence analyses of putative centromeric regions on C. arabica and C. canephora chromosomes showed an exceptional density of one family of CRC elements, and the complete absence of satellite arrays, contrasting with usual structure of plant centromeres. Altogether, our data suggest a specific centromere organization in Coffea, contrasting with other plant genomes. PMID:29497436

  18. The sequence and de novo assembly of the giant panda genome

    PubMed Central

    Li, Ruiqiang; Fan, Wei; Tian, Geng; Zhu, Hongmei; He, Lin; Cai, Jing; Huang, Quanfei; Cai, Qingle; Li, Bo; Bai, Yinqi; Zhang, Zhihe; Zhang, Yaping; Wang, Wen; Li, Jun; Wei, Fuwen; Li, Heng; Jian, Min; Li, Jianwen; Zhang, Zhaolei; Nielsen, Rasmus; Li, Dawei; Gu, Wanjun; Yang, Zhentao; Xuan, Zhaoling; Ryder, Oliver A.; Leung, Frederick Chi-Ching; Zhou, Yan; Cao, Jianjun; Sun, Xiao; Fu, Yonggui; Fang, Xiaodong; Guo, Xiaosen; Wang, Bo; Hou, Rong; Shen, Fujun; Mu, Bo; Ni, Peixiang; Lin, Runmao; Qian, Wubin; Wang, Guodong; Yu, Chang; Nie, Wenhui; Wang, Jinhuan; Wu, Zhigang; Liang, Huiqing; Min, Jiumeng; Wu, Qi; Cheng, Shifeng; Ruan, Jue; Wang, Mingwei; Shi, Zhongbin; Wen, Ming; Liu, Binghang; Ren, Xiaoli; Zheng, Huisong; Dong, Dong; Cook, Kathleen; Shan, Gao; Zhang, Hao; Kosiol, Carolin; Xie, Xueying; Lu, Zuhong; Zheng, Hancheng; Li, Yingrui; Steiner, Cynthia C.; Lam, Tommy Tsan-Yuk; Lin, Siyuan; Zhang, Qinghui; Li, Guoqing; Tian, Jing; Gong, Timing; Liu, Hongde; Zhang, Dejin; Fang, Lin; Ye, Chen; Zhang, Juanbin; Hu, Wenbo; Xu, Anlong; Ren, Yuanyuan; Zhang, Guojie; Bruford, Michael W.; Li, Qibin; Ma, Lijia; Guo, Yiran; An, Na; Hu, Yujie; Zheng, Yang; Shi, Yongyong; Li, Zhiqiang; Liu, Qing; Chen, Yanling; Zhao, Jing; Qu, Ning; Zhao, Shancen; Tian, Feng; Wang, Xiaoling; Wang, Haiyin; Xu, Lizhi; Liu, Xiao; Vinar, Tomas; Wang, Yajun; Lam, Tak-Wah; Yiu, Siu-Ming; Liu, Shiping; Zhang, Hemin; Li, Desheng; Huang, Yan; Wang, Xia; Yang, Guohua; Jiang, Zhi; Wang, Junyi; Qin, Nan; Li, Li; Li, Jingxiang; Bolund, Lars; Kristiansen, Karsten; Wong, Gane Ka-Shu; Olson, Maynard; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian; Wang, Jun

    2013-01-01

    Using next-generation sequencing technology alone, we have successfully generated and assembled a draft sequence of the giant panda genome. The assembled contigs (2.25 gigabases (Gb)) cover approximately 94% of the whole genome, and the remaining gaps (0.05 Gb) seem to contain carnivore-specific repeats and tandem repeats. Comparisons with the dog and human showed that the panda genome has a lower divergence rate. The assessment of panda genes potentially underlying some of its unique traits indicated that its bamboo diet might be more dependent on its gut microbiome than its own genetic composition. We also identified more than 2.7 million heterozygous single nucleotide polymorphisms in the diploid genome. Our data and analyses provide a foundation for promoting mammalian genetic research, and demonstrate the feasibility for using next-generation sequencing technologies for accurate, cost-effective and rapid de novo assembly of large eukaryotic genomes. PMID:20010809

  19. Comparative “Omics” of the Fusarium fujikuroi Species Complex Highlights Differences in Genetic Potential and Metabolite Synthesis

    PubMed Central

    Niehaus, Eva-Maria; Münsterkötter, Martin; Proctor, Robert H.; Brown, Daren W.; Sharon, Amir; Idan, Yifat; Oren-Young, Liat; Sieber, Christian M.; Novák, Ondřej; Pěnčík, Aleš; Tarkowská, Danuše; Hromadová, Kristýna; Freeman, Stanley; Maymon, Marcel; Elazar, Meirav; Youssef, Sahar A.; El-Shabrawy, El Said M.; Shalaby, Abdel Baset A.; Houterman, Petra; Brock, Nelson L.; Burkhardt, Immo; Tsavkelova, Elena A.; Dickschat, Jeroen S.; Galuszka, Petr; Güldener, Ulrich; Tudzynski, Bettina

    2016-01-01

    Species of the Fusarium fujikuroi species complex (FFC) cause a wide spectrum of often devastating diseases on diverse agricultural crops, including coffee, fig, mango, maize, rice, and sugarcane. Although species within the FFC are difficult to distinguish by morphology, and their genes often share 90% sequence similarity, they can differ in host plant specificity and life style. FFC species can also produce structurally diverse secondary metabolites (SMs), including the mycotoxins fumonisins, fusarins, fusaric acid, and beauvericin, and the phytohormones gibberellins, auxins, and cytokinins. The spectrum of SMs produced can differ among closely related species, suggesting that SMs might be determinants of host specificity. To date, genomes of only a limited number of FFC species have been sequenced. Here, we provide draft genome sequences of three more members of the FFC: a single isolate of F. mangiferae, the cause of mango malformation, and two isolates of F. proliferatum, one a pathogen of maize and the other an orchid endophyte. We compared these genomes to publicly available genome sequences of three other FFC species. The comparisons revealed species-specific and isolate-specific differences in the composition and expression (in vitro and in planta) of genes involved in SM production including those for phytohormome biosynthesis. Such differences have the potential to impact host specificity and, as in the case of F. proliferatum, the pathogenic versus endophytic life style. PMID:28040774

  20. Comparative genomics of citric-acid producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andersen, Mikael R.; Salazar, Margarita; Schaap, Peter

    2011-06-01

    The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regionsmore » have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up regulation of genes associated with biosynthesis of amino acids that are abundant in glucoamylase A, tRNA-synthases and protein transporters.« less

  1. RSAT 2015: Regulatory Sequence Analysis Tools

    PubMed Central

    Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A.; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M.; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques

    2015-01-01

    RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/. PMID:25904632

  2. Evolutionary conservation, diversity and specificity of LTR retrotransposons in flowering plants: insights from genome-wide analysis and multi-specific comparison

    USDA-ARS?s Scientific Manuscript database

    The availability of complete or nearly complete genome sequences from several plant species permits detailed discovery and cross-species comparison of transposable elements (TEs) at the whole genome level. We initially investigated 510 LTR-retrotransposon (LTR-RT) families that are comprised of 32,...

  3. Advances in Cryptococcus genomics: insights into the evolution of pathogenesis.

    PubMed

    Cuomo, Christina A; Rhodes, Johanna; Desjardins, Christopher A

    2018-01-01

    Cryptococcus species are the causative agents of cryptococcal meningitis, a significant source of mortality in immunocompromised individuals. Initial work on the molecular epidemiology of this fungal pathogen utilized genotyping approaches to describe the genetic diversity and biogeography of two species, Cryptococcus neoformans and Cryptococcus gattii. Whole genome sequencing of representatives of both species resulted in reference assemblies enabling a wide array of downstream studies and genomic resources. With the increasing availability of whole genome sequencing, both species have now had hundreds of individual isolates sequenced, providing fine-scale insight into the evolution and diversification of Cryptococcus and allowing for the first genome-wide association studies to identify genetic variants associated with human virulence. Sequencing has also begun to examine the microevolution of isolates during prolonged infection and to identify variants specific to outbreak lineages, highlighting the potential role of hyper-mutation in evolving within short time scales. We can anticipate that further advances in sequencing technology and sequencing microbial genomes at scale, including metagenomics approaches, will continue to refine our view of how the evolution of Cryptococcus drives its success as a pathogen.

  4. Tissue-specific Proteogenomic Analysis of Plutella xylostella Larval Midgut Using a Multialgorithm Pipeline.

    PubMed

    Zhu, Xun; Xie, Shangbo; Armengaud, Jean; Xie, Wen; Guo, Zhaojiang; Kang, Shi; Wu, Qingjun; Wang, Shaoli; Xia, Jixing; He, Rongjun; Zhang, Youjun

    2016-06-01

    The diamondback moth, Plutella xylostella (L.), is the major cosmopolitan pest of brassica and other cruciferous crops. Its larval midgut is a dynamic tissue that interfaces with a wide variety of toxicological and physiological processes. The draft sequence of the P. xylostella genome was recently released, but its annotation remains challenging because of the low sequence coverage of this branch of life and the poor description of exon/intron splicing rules for these insects. Peptide sequencing by computational assignment of tandem mass spectra to genome sequence information provides an experimental independent approach for confirming or refuting protein predictions, a concept that has been termed proteogenomics. In this study, we carried out an in-depth proteogenomic analysis to complement genome annotation of P. xylostella larval midgut based on shotgun HPLC-ESI-MS/MS data by means of a multialgorithm pipeline. A total of 876,341 tandem mass spectra were searched against the predicted P. xylostella protein sequences and a whole-genome six-frame translation database. Based on a data set comprising 2694 novel genome search specific peptides, we discovered 439 novel protein-coding genes and corrected 128 existing gene models. To get the most accurate data to seed further insect genome annotation, more than half of the novel protein-coding genes, i.e. 235 over 439, were further validated after RT-PCR amplification and sequencing of the corresponding transcripts. Furthermore, we validated 53 novel alternative splicings. Finally, a total of 6764 proteins were identified, resulting in one of the most comprehensive proteogenomic study of a nonmodel animal. As the first tissue-specific proteogenomics analysis of P. xylostella, this study provides the fundamental basis for high-throughput proteomics and functional genomics approaches aimed at deciphering the molecular mechanisms of resistance and controlling this pest. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Peregrine and saker falcon genome sequences provide insights into evolution of a predatory lifestyle.

    PubMed

    Zhan, Xiangjiang; Pan, Shengkai; Wang, Junyi; Dixon, Andrew; He, Jing; Muller, Margit G; Ni, Peixiang; Hu, Li; Liu, Yuan; Hou, Haolong; Chen, Yuanping; Xia, Jinquan; Luo, Qiong; Xu, Pengwei; Chen, Ying; Liao, Shengguang; Cao, Changchang; Gao, Shukun; Wang, Zhaobao; Yue, Zhen; Li, Guoqing; Yin, Ye; Fox, Nick C; Wang, Jun; Bruford, Michael W

    2013-05-01

    As top predators, falcons possess unique morphological, physiological and behavioral adaptations that allow them to be successful hunters: for example, the peregrine is renowned as the world's fastest animal. To examine the evolutionary basis of predatory adaptations, we sequenced the genomes of both the peregrine (Falco peregrinus) and saker falcon (Falco cherrug), and we present parallel, genome-wide evidence for evolutionary innovation and selection for a predatory lifestyle. The genomes, assembled using Illumina deep sequencing with greater than 100-fold coverage, are both approximately 1.2 Gb in length, with transcriptome-assisted prediction of approximately 16,200 genes for both species. Analysis of 8,424 orthologs in both falcons, chicken, zebra finch and turkey identified consistent evidence for genome-wide rapid evolution in these raptors. SNP-based inference showed contrasting recent demographic trajectories for the two falcons, and gene-based analysis highlighted falcon-specific evolutionary novelties for beak development and olfaction and specifically for homeostasis-related genes in the arid environment-adapted saker.

  6. Comparative genome analysis in the integrated microbial genomes (IMG) system.

    PubMed

    Markowitz, Victor M; Kyrpides, Nikos C

    2007-01-01

    Comparative genome analysis is critical for the effective exploration of a rapidly growing number of complete and draft sequences for microbial genomes. The Integrated Microbial Genomes (IMG) system (img.jgi.doe.gov) has been developed as a community resource that provides support for comparative analysis of microbial genomes in an integrated context. IMG allows users to navigate the multidimensional microbial genome data space and focus their analysis on a subset of genes, genomes, and functions of interest. IMG provides graphical viewers, summaries, and occurrence profile tools for comparing genes, pathways, and functions (terms) across specific genomes. Genes can be further examined using gene neighborhoods and compared with sequence alignment tools.

  7. Aligner optimization increases accuracy and decreases compute times in multi-species sequence data.

    PubMed

    Robinson, Kelly M; Hawkins, Aziah S; Santana-Cruz, Ivette; Adkins, Ricky S; Shetty, Amol C; Nagaraj, Sushma; Sadzewicz, Lisa; Tallon, Luke J; Rasko, David A; Fraser, Claire M; Mahurkar, Anup; Silva, Joana C; Dunning Hotopp, Julie C

    2017-09-01

    As sequencing technologies have evolved, the tools to analyze these sequences have made similar advances. However, for multi-species samples, we observed important and adverse differences in alignment specificity and computation time for bwa- mem (Burrows-Wheeler aligner-maximum exact matches) relative to bwa-aln. Therefore, we sought to optimize bwa-mem for alignment of data from multi-species samples in order to reduce alignment time and increase the specificity of alignments. In the multi-species cases examined, there was one majority member (i.e. Plasmodium falciparum or Brugia malayi ) and one minority member (i.e. human or the Wolbachia endosymbiont w Bm) of the sequence data. Increasing bwa-mem seed length from the default value reduced the number of read pairs from the majority sequence member that incorrectly aligned to the reference genome of the minority sequence member. Combining both source genomes into a single reference genome increased the specificity of mapping, while also reducing the central processing unit (CPU) time. In Plasmodium , at a seed length of 18 nt, 24.1 % of reads mapped to the human genome using 1.7±0.1 CPU hours, while 83.6 % of reads mapped to the Plasmodium genome using 0.2±0.0 CPU hours (total: 107.7 % reads mapping; in 1.9±0.1 CPU hours). In contrast, 97.1 % of the reads mapped to a combined Plasmodium- human reference in only 0.7±0.0 CPU hours. Overall, the results suggest that combining all references into a single reference database and using a 23 nt seed length reduces the computational time, while maximizing specificity. Similar results were found for simulated sequence reads from a mock metagenomic data set. We found similar improvements to computation time in a publicly available human-only data set.

  8. Rapid and highly efficient construction of TALE-based transcriptional regulators and nucleases for genome modification.

    PubMed

    Li, Lixin; Piatek, Marek J; Atef, Ahmed; Piatek, Agnieszka; Wibowo, Anjar; Fang, Xiaoyun; Sabir, J S M; Zhu, Jian-Kang; Mahfouz, Magdy M

    2012-03-01

    Transcription activator-like effectors (TALEs) can be used as DNA-targeting modules by engineering their repeat domains to dictate user-selected sequence specificity. TALEs have been shown to function as site-specific transcriptional activators in a variety of cell types and organisms. TALE nucleases (TALENs), generated by fusing the FokI cleavage domain to TALE, have been used to create genomic double-strand breaks. The identity of the TALE repeat variable di-residues, their number, and their order dictate the DNA sequence specificity. Because TALE repeats are nearly identical, their assembly by cloning or even by synthesis is challenging and time consuming. Here, we report the development and use of a rapid and straightforward approach for the construction of designer TALE (dTALE) activators and nucleases with user-selected DNA target specificity. Using our plasmid set of 100 repeat modules, researchers can assemble repeat domains for any 14-nucleotide target sequence in one sequential restriction-ligation cloning step and in only 24 h. We generated several custom dTALEs and dTALENs with new target sequence specificities and validated their function by transient expression in tobacco leaves and in vitro DNA cleavage assays, respectively. Moreover, we developed a web tool, called idTALE, to facilitate the design of dTALENs and the identification of their genomic targets and potential off-targets in the genomes of several model species. Our dTALE repeat assembly approach along with the web tool idTALE will expedite genome-engineering applications in a variety of cell types and organisms including plants.

  9. India Allele Finder: a web-based annotation tool for identifying common alleles in next-generation sequencing data of Indian origin.

    PubMed

    Zhang, Jimmy F; James, Francis; Shukla, Anju; Girisha, Katta M; Paciorkowski, Alex R

    2017-06-27

    We built India Allele Finder, an online searchable database and command line tool, that gives researchers access to variant frequencies of Indian Telugu individuals, using publicly available fastq data from the 1000 Genomes Project. Access to appropriate population-based genomic variant annotation can accelerate the interpretation of genomic sequencing data. In particular, exome analysis of individuals of Indian descent will identify population variants not reflected in European exomes, complicating genomic analysis for such individuals. India Allele Finder offers improved ease-of-use to investigators seeking to identify and annotate sequencing data from Indian populations. We describe the use of India Allele Finder to identify common population variants in a disease quartet whole exome dataset, reducing the number of candidate single nucleotide variants from 84 to 7. India Allele Finder is freely available to investigators to annotate genomic sequencing data from Indian populations. Use of India Allele Finder allows efficient identification of population variants in genomic sequencing data, and is an example of a population-specific annotation tool that simplifies analysis and encourages international collaboration in genomics research.

  10. Genome Sequence of the Freshwater Yangtze Finless Porpoise.

    PubMed

    Yuan, Yuan; Zhang, Peijun; Wang, Kun; Liu, Mingzhong; Li, Jing; Zheng, Jingsong; Wang, Ding; Xu, Wenjie; Lin, Mingli; Dong, Lijun; Zhu, Chenglong; Qiu, Qiang; Li, Songhai

    2018-04-16

    The Yangtze finless porpoise ( Neophocaena asiaeorientalis ssp. asiaeorientalis ) is a subspecies of the narrow-ridged finless porpoise ( N. asiaeorientalis ). In total, 714.28 gigabases (Gb) of raw reads were generated by whole-genome sequencing of the Yangtze finless porpoise, using an Illumina HiSeq 2000 platform. After filtering the low-quality and duplicated reads, we assembled a draft genome of 2.22 Gb, with contig N50 and scaffold N50 values of 46.69 kilobases (kb) and 1.71 megabases (Mb), respectively. We identified 887.63 Mb of repetitive sequences and predicted 18,479 protein-coding genes in the assembled genome. The phylogenetic tree showed a relationship between the Yangtze finless porpoise and the Yangtze River dolphin, which diverged approximately 20.84 million years ago. In comparisons with the genomes of 10 other mammals, we detected 44 species-specific gene families, 164 expanded gene families, and 313 positively selected genes in the Yangtze finless porpoise genome. The assembled genome sequence and underlying sequence data are available at the National Center for Biotechnology Information under BioProject accession number PRJNA433603.

  11. Genome Sequence of the Freshwater Yangtze Finless Porpoise

    PubMed Central

    Yuan, Yuan; Zhang, Peijun; Wang, Kun; Liu, Mingzhong; Li, Jing; Zheng, Jinsong; Wang, Ding; Xu, Wenjie; Lin, Mingli; Dong, Lijun; Zhu, Chenglong; Qiu, Qiang

    2018-01-01

    The Yangtze finless porpoise (Neophocaena asiaeorientalis ssp. asiaeorientalis) is a subspecies of the narrow-ridged finless porpoise (N. asiaeorientalis). In total, 714.28 gigabases (Gb) of raw reads were generated by whole-genome sequencing of the Yangtze finless porpoise, using an Illumina HiSeq 2000 platform. After filtering the low-quality and duplicated reads, we assembled a draft genome of 2.22 Gb, with contig N50 and scaffold N50 values of 46.69 kilobases (kb) and 1.71 megabases (Mb), respectively. We identified 887.63 Mb of repetitive sequences and predicted 18,479 protein-coding genes in the assembled genome. The phylogenetic tree showed a relationship between the Yangtze finless porpoise and the Yangtze River dolphin, which diverged approximately 20.84 million years ago. In comparisons with the genomes of 10 other mammals, we detected 44 species-specific gene families, 164 expanded gene families, and 313 positively selected genes in the Yangtze finless porpoise genome. The assembled genome sequence and underlying sequence data are available at the National Center for Biotechnology Information under BioProject accession number PRJNA433603. PMID:29659530

  12. CoCoNUT: an efficient system for the comparison and analysis of genomes

    PubMed Central

    2008-01-01

    Background Comparative genomics is the analysis and comparison of genomes from different species. This area of research is driven by the large number of sequenced genomes and heavily relies on efficient algorithms and software to perform pairwise and multiple genome comparisons. Results Most of the software tools available are tailored for one specific task. In contrast, we have developed a novel system CoCoNUT (Computational Comparative geNomics Utility Toolkit) that allows solving several different tasks in a unified framework: (1) finding regions of high similarity among multiple genomic sequences and aligning them, (2) comparing two draft or multi-chromosomal genomes, (3) locating large segmental duplications in large genomic sequences, and (4) mapping cDNA/EST to genomic sequences. Conclusion CoCoNUT is competitive with other software tools w.r.t. the quality of the results. The use of state of the art algorithms and data structures allows CoCoNUT to solve comparative genomics tasks more efficiently than previous tools. With the improved user interface (including an interactive visualization component), CoCoNUT provides a unified, versatile, and easy-to-use software tool for large scale studies in comparative genomics. PMID:19014477

  13. Emergence and Evolution of Hominidae-Specific Coding and Noncoding Genomic Sequences

    PubMed Central

    Saber, Morteza Mahmoudi; Adeyemi Babarinde, Isaac; Hettiarachchi, Nilmini; Saitou, Naruya

    2016-01-01

    Family Hominidae, which includes humans and great apes, is recognized for unique complex social behavior and intellectual abilities. Despite the increasing genome data, however, the genomic origin of its phenotypic uniqueness has remained elusive. Clade-specific genes and highly conserved noncoding sequences (HCNSs) are among the high-potential evolutionary candidates involved in driving clade-specific characters and phenotypes. On this premise, we analyzed whole genome sequences along with gene orthology data retrieved from major DNA databases to find Hominidae-specific (HS) genes and HCNSs. We discovered that Down syndrome critical region 4 (DSCR4) is the only experimentally verified gene uniquely present in Hominidae. DSCR4 has no structural homology to any known protein and was inferred to have emerged in several steps through LTR/ERV1, LTR/ERVL retrotransposition, and transversion. Using the genomic distance as neutral evolution threshold, we identified 1,658 HS HCNSs. Polymorphism coverage and derived allele frequency analysis of HS HCNSs showed that these HCNSs are under purifying selection, indicating that they may harbor important functions. They are overrepresented in promoters/untranslated regions, in close proximity of genes involved in sensory perception of sound and developmental process, and also showed a significantly lower nucleosome occupancy probability. Interestingly, many ancestral sequences of the HS HCNSs showed very high evolutionary rates. This suggests that new functions emerged through some kind of positive selection, and then purifying selection started to operate to keep these functions. PMID:27289096

  14. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12.

    PubMed

    Hayashi, T; Makino, K; Ohnishi, M; Kurokawa, K; Ishii, K; Yokoyama, K; Han, C G; Ohtsubo, E; Nakayama, K; Murata, T; Tanaka, M; Tobe, T; Iida, T; Takami, H; Honda, T; Sasakawa, C; Ogasawara, N; Yasunaga, T; Kuhara, S; Shiba, T; Hattori, M; Shinagawa, H

    2001-02-28

    Escherichia coli O157:H7 is a major food-borne infectious pathogen that causes diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome. Here we report the complete chromosome sequence of an O157:H7 strain isolated from the Sakai outbreak, and the results of genomic comparison with a benign laboratory strain, K-12 MG1655. The chromosome is 5.5 Mb in size, 859 Kb larger than that of K-12. We identified a 4.1-Mb sequence highly conserved between the two strains, which may represent the fundamental backbone of the E. coli chromosome. The remaining 1.4-Mb sequence comprises of O157:H7-specific sequences, most of which are horizontally transferred foreign DNAs. The predominant roles of bacteriophages in the emergence of O157:H7 is evident by the presence of 24 prophages and prophage-like elements that occupy more than half of the O157:H7-specific sequences. The O157:H7 chromosome encodes 1632 proteins and 20 tRNAs that are not present in K-12. Among these, at least 131 proteins are assumed to have virulence-related functions. Genome-wide codon usage analysis suggested that the O157:H7-specific tRNAs are involved in the efficient expression of the strain-specific genes. A complete set of the genes specific to O157:H7 presented here sheds new insight into the pathogenicity and the physiology of O157:H7, and will open a way to fully understand the molecular mechanisms underlying the O157:H7 infection.

  15. Sequencing of the variable region of rpsB to discriminate between Streptococcus pneumoniae and other streptococcal species.

    PubMed

    Wyllie, Anne L; Pannekoek, Yvonne; Bovenkerk, Sandra; van Engelsdorp Gastelaars, Jody; Ferwerda, Bart; van de Beek, Diederik; Sanders, Elisabeth A M; Trzciński, Krzysztof; van der Ende, Arie

    2017-09-01

    The vast majority of streptococci colonizing the human upper respiratory tract are commensals, only sporadically implicated in disease. Of these, the most pathogenic is Mitis group member, Streptococcus pneumoniae Phenotypic and genetic similarities between streptococci can cause difficulties in species identification. Using ribosomal S2-gene sequences extracted from whole-genome sequences published from 501 streptococci, we developed a method to identify streptococcal species. We validated this method on non-pneumococcal isolates cultured from cases of severe streptococcal disease ( n = 101) and from carriage ( n = 103), and on non-typeable pneumococci from asymptomatic individuals ( n = 17) and on whole-genome sequences of 1157 pneumococcal isolates from meningitis in the Netherlands. Following this, we tested 221 streptococcal isolates in molecular assays originally assumed specific for S. pneumoniae , targeting cpsA , lytA , piaB , ply , Spn9802, zmpC and capsule-type-specific genes. Cluster analysis of S2-sequences showed grouping according to species in line with published phylogenies of streptococcal core genomes. S2-typing convincingly distinguished pneumococci from non-pneumococcal species (99.2% sensitivity, 100% specificity). Molecular assays targeting regions of lytA and piaB were 100% specific for S. pneumoniae , whereas assays targeting cpsA , ply , Spn9802, zmpC and selected serotype-specific assays (but not capsular sequence typing) showed a lack of specificity. False positive results were over-represented in species associated with carriage, although no particular confounding signal was unique for carriage isolates. © 2017 The Authors.

  16. Sequencing of the variable region of rpsB to discriminate between Streptococcus pneumoniae and other streptococcal species

    PubMed Central

    Pannekoek, Yvonne; Bovenkerk, Sandra; van Engelsdorp Gastelaars, Jody; Ferwerda, Bart; van de Beek, Diederik; Sanders, Elisabeth A. M.; Trzciński, Krzysztof; van der Ende, Arie

    2017-01-01

    The vast majority of streptococci colonizing the human upper respiratory tract are commensals, only sporadically implicated in disease. Of these, the most pathogenic is Mitis group member, Streptococcus pneumoniae. Phenotypic and genetic similarities between streptococci can cause difficulties in species identification. Using ribosomal S2-gene sequences extracted from whole-genome sequences published from 501 streptococci, we developed a method to identify streptococcal species. We validated this method on non-pneumococcal isolates cultured from cases of severe streptococcal disease (n = 101) and from carriage (n = 103), and on non-typeable pneumococci from asymptomatic individuals (n = 17) and on whole-genome sequences of 1157 pneumococcal isolates from meningitis in the Netherlands. Following this, we tested 221 streptococcal isolates in molecular assays originally assumed specific for S. pneumoniae, targeting cpsA, lytA, piaB, ply, Spn9802, zmpC and capsule-type-specific genes. Cluster analysis of S2-sequences showed grouping according to species in line with published phylogenies of streptococcal core genomes. S2-typing convincingly distinguished pneumococci from non-pneumococcal species (99.2% sensitivity, 100% specificity). Molecular assays targeting regions of lytA and piaB were 100% specific for S. pneumoniae, whereas assays targeting cpsA, ply, Spn9802, zmpC and selected serotype-specific assays (but not capsular sequence typing) showed a lack of specificity. False positive results were over-represented in species associated with carriage, although no particular confounding signal was unique for carriage isolates. PMID:28931649

  17. Tempo and mode of genomic mutations unveil human evolutionary history.

    PubMed

    Hara, Yuichiro

    2015-01-01

    Mutations that have occurred in human genomes provide insight into various aspects of evolutionary history such as speciation events and degrees of natural selection. Comparing genome sequences between human and great apes or among humans is a feasible approach for inferring human evolutionary history. Recent advances in high-throughput or so-called 'next-generation' DNA sequencing technologies have enabled the sequencing of thousands of individual human genomes, as well as a variety of reference genomes of hominids, many of which are publicly available. These sequence data can help to unveil the detailed demographic history of the lineage leading to humans as well as the explosion of modern human population size in the last several thousand years. In addition, high-throughput sequencing illustrates the tempo and mode of de novo mutations, which are producing human genetic variation at this moment. Pedigree-based human genome sequencing has shown that mutation rates vary significantly across the human genome. These studies have also provided an improved timescale of human evolution, because the mutation rate estimated from pedigree analysis is half that estimated from traditional analyses based on molecular phylogeny. Because of the dramatic reduction in sequencing cost, sequencing on-demand samples designed for specific studies is now also becoming popular. To produce data of sufficient quality to meet the requirements of the study, it is necessary to set an explicit sequencing plan that includes the choice of sample collection methods, sequencing platforms, and number of sequence reads.

  18. An analysis of possible off target effects following CAS9/CRISPR targeted deletions of neuropeptide gene enhancers from the mouse genome.

    PubMed

    Hay, Elizabeth Anne; Khalaf, Abdulla Razak; Marini, Pietro; Brown, Andrew; Heath, Karyn; Sheppard, Darrin; MacKenzie, Alasdair

    2017-08-01

    We have successfully used comparative genomics to identify putative regulatory elements within the human genome that contribute to the tissue specific expression of neuropeptides such as galanin and receptors such as CB1. However, a previous inability to rapidly delete these elements from the mouse genome has prevented optimal assessment of their function in-vivo. This has been solved using CAS9/CRISPR genome editing technology which uses a bacterial endonuclease called CAS9 that, in combination with specifically designed guide RNA (gRNA) molecules, cuts specific regions of the mouse genome. However, reports of "off target" effects, whereby the CAS9 endonuclease is able to cut sites other than those targeted, limits the appeal of this technology. We used cytoplasmic microinjection of gRNA and CAS9 mRNA into 1-cell mouse embryos to rapidly generate enhancer knockout mouse lines. The current study describes our analysis of the genomes of these enhancer knockout lines to detect possible off-target effects. Bioinformatic analysis was used to identify the most likely putative off-target sites and to design PCR primers that would amplify these sequences from genomic DNA of founder enhancer deletion mouse lines. Amplified DNA was then sequenced and blasted against the mouse genome sequence to detect off-target effects. Using this approach we were unable to detect any evidence of off-target effects in the genomes of three founder lines using any of the four gRNAs used in the analysis. This study suggests that the problem of off-target effects in transgenic mice have been exaggerated and that CAS9/CRISPR represents a highly effective and accurate method of deleting putative neuropeptide gene enhancer sequences from the mouse genome. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. In silico comparison of genomic regions containing genes coding for enzymes and transcription factors for the phenylpropanoid pathway in Phaseolus vulgaris L. and Glycine max L. Merr

    PubMed Central

    Reinprecht, Yarmilla; Yadegari, Zeinab; Perry, Gregory E.; Siddiqua, Mahbuba; Wright, Lori C.; McClean, Phillip E.; Pauls, K. Peter

    2013-01-01

    Legumes contain a variety of phytochemicals derived from the phenylpropanoid pathway that have important effects on human health as well as seed coat color, plant disease resistance and nodulation. However, the information about the genes involved in this important pathway is fragmentary in common bean (Phaseolus vulgaris L.). The objectives of this research were to isolate genes that function in and control the phenylpropanoid pathway in common bean, determine their genomic locations in silico in common bean and soybean, and analyze sequences of the 4CL gene family in two common bean genotypes. Sequences of phenylpropanoid pathway genes available for common bean or other plant species were aligned, and the conserved regions were used to design sequence-specific primers. The PCR products were cloned and sequenced and the gene sequences along with common bean gene-based (g) markers were BLASTed against the Glycine max v.1.0 genome and the P. vulgaris v.1.0 (Andean) early release genome. In addition, gene sequences were BLASTed against the OAC Rex (Mesoamerican) genome sequence assembly. In total, fragments of 46 structural and regulatory phenylpropanoid pathway genes were characterized in this way and placed in silico on common bean and soybean sequence maps. The maps contain over 250 common bean g and SSR (simple sequence repeat) markers and identify the positions of more than 60 additional phenylpropanoid pathway gene sequences, plus the putative locations of seed coat color genes. The majority of cloned phenylpropanoid pathway gene sequences were mapped to one location in the common bean genome but had two positions in soybean. The comparison of the genomic maps confirmed previous studies, which show that common bean and soybean share genomic regions, including those containing phenylpropanoid pathway gene sequences, with conserved synteny. Indels identified in the comparison of Andean and Mesoamerican common bean 4CL gene sequences might be used to develop inter-pool phenylpropanoid pathway gene-based markers. We anticipate that the information obtained by this study will simplify and accelerate selections of common bean with specific phenylpropanoid pathway alleles to increase the contents of beneficial phenylpropanoids in common bean and other legumes. PMID:24046770

  20. Development of chromosome-specific markers with high polymorphism for allotetraploid cotton based on genome-wide characterization of simple sequence repeats in diploid cottons (Gossypium arboreum L. and Gossypium raimondii Ulbrich).

    PubMed

    Lu, Cairui; Zou, Changsong; Zhang, Youping; Yu, Daoqian; Cheng, Hailiang; Jiang, Pengfei; Yang, Wencui; Wang, Qiaolian; Feng, Xiaoxu; Prosper, Mtawa Andrew; Guo, Xiaoping; Song, Guoli

    2015-02-06

    Tetraploid cotton contains two sets of homologous chromosomes, the At- and Dt-subgenomes. Consequently, many markers in cotton were mapped to multiple positions during linkage genetic map construction, posing a challenge to anchoring linkage groups and mapping economically-important genes to particular chromosomes. Chromosome-specific markers could solve this problem. Recently, the genomes of two diploid species were sequenced whose progenitors were putative contributors of the At- and Dt-subgenomes to tetraploid cotton. These sequences provide a powerful tool for developing chromosome-specific markers given the high level of synteny among tetraploid and diploid cotton genomes. In this study, simple sequence repeats (SSRs) on each chromosome in the two diploid genomes were characterized. Chromosome-specific SSRs were developed by comparative analysis and proved to distinguish chromosomes. A total of 200,744 and 142,409 SSRs were detected on the 13 chromosomes of Gossypium arboreum L. and Gossypium raimondii Ulbrich, respectively. Chromosome-specific SSRs were obtained by comparing SSR flanking sequences from each chromosome with those from the other 25 chromosomes. The average was 7,996 per chromosome. To confirm their chromosome specificity, these SSRs were used to distinguish two homologous chromosomes in tetraploid cotton through linkage group construction. The chromosome-specific SSRs and previously-reported chromosome markers were grouped together, and no marker mapped to another homologous chromosome, proving that the chromosome-specific SSRs were unique and could distinguish homologous chromosomes in tetraploid cotton. Because longer dinucleotide AT-rich repeats were the most polymorphic in previous reports, the SSRs on each chromosome were sorted by motif type and repeat length for convenient selection. The primer sequences of all chromosome-specific SSRs were also made publicly available. Chromosome-specific SSRs are efficient tools for chromosome identification by anchoring linkage groups to particular chromosomes during genetic mapping and are especially useful in mapping of qualitative-trait genes or quantitative trait loci with just a few markers. The SSRs reported here will facilitate a number of genetic and genomic studies in cotton, including construction of high-density genetic maps, positional gene cloning, fingerprinting, and genetic diversity and comparative evolutionary analyses among Gossypium species.

  1. Optimizing high performance computing workflow for protein functional annotation.

    PubMed

    Stanberry, Larissa; Rekepalli, Bhanu; Liu, Yuan; Giblock, Paul; Higdon, Roger; Montague, Elizabeth; Broomall, William; Kolker, Natali; Kolker, Eugene

    2014-09-10

    Functional annotation of newly sequenced genomes is one of the major challenges in modern biology. With modern sequencing technologies, the protein sequence universe is rapidly expanding. Newly sequenced bacterial genomes alone contain over 7.5 million proteins. The rate of data generation has far surpassed that of protein annotation. The volume of protein data makes manual curation infeasible, whereas a high compute cost limits the utility of existing automated approaches. In this work, we present an improved and optmized automated workflow to enable large-scale protein annotation. The workflow uses high performance computing architectures and a low complexity classification algorithm to assign proteins into existing clusters of orthologous groups of proteins. On the basis of the Position-Specific Iterative Basic Local Alignment Search Tool the algorithm ensures at least 80% specificity and sensitivity of the resulting classifications. The workflow utilizes highly scalable parallel applications for classification and sequence alignment. Using Extreme Science and Engineering Discovery Environment supercomputers, the workflow processed 1,200,000 newly sequenced bacterial proteins. With the rapid expansion of the protein sequence universe, the proposed workflow will enable scientists to annotate big genome data.

  2. Optimizing high performance computing workflow for protein functional annotation

    PubMed Central

    Stanberry, Larissa; Rekepalli, Bhanu; Liu, Yuan; Giblock, Paul; Higdon, Roger; Montague, Elizabeth; Broomall, William; Kolker, Natali; Kolker, Eugene

    2014-01-01

    Functional annotation of newly sequenced genomes is one of the major challenges in modern biology. With modern sequencing technologies, the protein sequence universe is rapidly expanding. Newly sequenced bacterial genomes alone contain over 7.5 million proteins. The rate of data generation has far surpassed that of protein annotation. The volume of protein data makes manual curation infeasible, whereas a high compute cost limits the utility of existing automated approaches. In this work, we present an improved and optmized automated workflow to enable large-scale protein annotation. The workflow uses high performance computing architectures and a low complexity classification algorithm to assign proteins into existing clusters of orthologous groups of proteins. On the basis of the Position-Specific Iterative Basic Local Alignment Search Tool the algorithm ensures at least 80% specificity and sensitivity of the resulting classifications. The workflow utilizes highly scalable parallel applications for classification and sequence alignment. Using Extreme Science and Engineering Discovery Environment supercomputers, the workflow processed 1,200,000 newly sequenced bacterial proteins. With the rapid expansion of the protein sequence universe, the proposed workflow will enable scientists to annotate big genome data. PMID:25313296

  3. Regulatory sequence analysis tools.

    PubMed

    van Helden, Jacques

    2003-07-01

    The web resource Regulatory Sequence Analysis Tools (RSAT) (http://rsat.ulb.ac.be/rsat) offers a collection of software tools dedicated to the prediction of regulatory sites in non-coding DNA sequences. These tools include sequence retrieval, pattern discovery, pattern matching, genome-scale pattern matching, feature-map drawing, random sequence generation and other utilities. Alternative formats are supported for the representation of regulatory motifs (strings or position-specific scoring matrices) and several algorithms are proposed for pattern discovery. RSAT currently holds >100 fully sequenced genomes and these data are regularly updated from GenBank.

  4. Unbiased Combinatorial Genomic Approaches to Identify Alternative Therapeutic Targets within the TSC Signaling Network

    DTIC Science & Technology

    2013-06-01

    number of ways to generate either random mutations or specific alterations to the genome sequence . Unlike previous approaches however, both TALENs and...made to the donor construct will be incorporated into the endogenous genomic sequence (examples in Liu et al., 2012; Zu et al., 2013). One challenge... Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics. 2013. Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, et al. Efficient genome

  5. Ebolavirus comparative genomics

    DOE PAGES

    Jun, Se-Ran; Leuze, Michael R.; Nookaew, Intawat; ...

    2015-07-14

    The 2014 Ebola outbreak in West Africa is the largest documented for this virus. We examine the dynamics of this genome, comparing more than one hundred currently available ebolavirus genomes to each other and to other viral genomes. Based on oligomer frequency analysis, the family Filoviridae forms a distinct group from all other sequenced viral genomes. All filovirus genomes sequenced to date encode proteins with similar functions and gene order, although there is considerable divergence in sequences between the three genera Ebolavirus, Cuevavirus, and Marburgvirus within the family Filoviridae. Whereas all ebolavirus genomes are quite similar (multiple sequences of themore » same strain are often identical), variation is most common in the intergenic regions and within specific areas of the genes encoding the glycoprotein (GP), nucleoprotein (NP), and polymerase (L). We predict regions that could contain epitope-binding sites, which might be good vaccine targets. In conclusion, this information, combined with glycosylation sites and experimentally determined epitopes, can identify the most promising regions for the development of therapeutic strategies.« less

  6. A Platform for Designing Genome-Based Personalized Immunotherapy or Vaccine against Cancer

    PubMed Central

    Gupta, Sudheer; Chaudhary, Kumardeep; Dhanda, Sandeep Kumar; Kumar, Rahul; Kumar, Shailesh; Sehgal, Manika; Nagpal, Gandharva

    2016-01-01

    Due to advancement in sequencing technology, genomes of thousands of cancer tissues or cell-lines have been sequenced. Identification of cancer-specific epitopes or neoepitopes from cancer genomes is one of the major challenges in the field of immunotherapy or vaccine development. This paper describes a platform Cancertope, developed for designing genome-based immunotherapy or vaccine against a cancer cell. Broadly, the integrated resources on this platform are apportioned into three precise sections. First section explains a cancer-specific database of neoepitopes generated from genome of 905 cancer cell lines. This database harbors wide range of epitopes (e.g., B-cell, CD8+ T-cell, HLA class I, HLA class II) against 60 cancer-specific vaccine antigens. Second section describes a partially personalized module developed for predicting potential neoepitopes against a user-specific cancer genome. Finally, we describe a fully personalized module developed for identification of neoepitopes from genomes of cancerous and healthy cells of a cancer-patient. In order to assist the scientific community, wide range of tools are incorporated in this platform that includes screening of epitopes against human reference proteome (http://www.imtech.res.in/raghava/cancertope/). PMID:27832200

  7. Draft genome sequences of four parasaccharibacter apium strains isolated from honey bees

    USDA-ARS?s Scientific Manuscript database

    Parasaccharibacter apium is a newly described bacterium of honey bees that exhibits multiple ecological strategies in their host, from beneficial to pathogenic. Using niche-specific 16S rRNA gene sequences and bacterial genomes, we describe the ecology of this bacterium and its relationship to other...

  8. Multiple Myeloma Genomics: A Systematic Review.

    PubMed

    Weaver, Casey J; Tariman, Joseph D

    2017-08-01

    This integrative review describes the genomic variants that have been found to be associated with poor prognosis in patients diagnosed with multiple myeloma (MM). Second, it identifies MM genetic and genomic changes using next-generation sequencing, specifically whole-genome sequencing or exome sequencing. A search for peer-reviewed articles through PubMed, EBSCOhost, and DePaul WorldCat Libraries Worldwide yielded 33 articles that were included in the final analysis. The most commonly reported genetic changes were KRAS, NRAS, TP53, FAM46C, BRAF, DIS3, ATM, and CCND1. These genetic changes play a role in the pathogenesis of MM, prognostication, and therapeutic targets for novel therapies. MM genetics and genomics are expanding rapidly; oncology nurse clinicians must have basic competencies in genetics and genomics to help patients understand the complexities of genetic and genomic alterations and be able to refer patients to appropriate genomic professionals if needed. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Efficient sequence-specific isolation of DNA fragments and chromatin by in vitro enChIP technology using recombinant CRISPR ribonucleoproteins.

    PubMed

    Fujita, Toshitsugu; Yuno, Miyuki; Fujii, Hodaka

    2016-04-01

    The clustered regularly interspaced short palindromic repeats (CRISPR) system is widely used for various biological applications, including genome editing. We developed engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR to isolate target genomic regions from cells for their biochemical characterization. In this study, we developed 'in vitro enChIP' using recombinant CRISPR ribonucleoproteins (RNPs) to isolate target genomic regions. in vitro enChIP has the great advantage over conventional enChIP of not requiring expression of CRISPR complexes in cells. We first showed that in vitro enChIP using recombinant CRISPR RNPs can be used to isolate target DNA from mixtures of purified DNA in a sequence-specific manner. In addition, we showed that this technology can be used to efficiently isolate target genomic regions, while retaining their intracellular molecular interactions, with negligible contamination from irrelevant genomic regions. Thus, in vitro enChIP technology is of potential use for sequence-specific isolation of DNA, as well as for identification of molecules interacting with genomic regions of interest in vivo in combination with downstream analysis. © 2016 The Authors. Genes to Cells published by Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  10. The scope and strength of sex-specific selection in genome evolution

    PubMed Central

    Wright, A E; Mank, J E

    2013-01-01

    Males and females share the vast majority of their genomes and yet are often subject to different, even conflicting, selection. Genomic and transcriptomic developments have made it possible to assess sex-specific selection at the molecular level, and it is clear that sex-specific selection shapes the evolutionary properties of several genomic characteristics, including transcription, post-transcriptional regulation, imprinting, genome structure and gene sequence. Sex-specific selection is strongly influenced by mating system, which also causes neutral evolutionary changes that affect different regions of the genome in different ways. Here, we synthesize theoretical and molecular work in order to provide a cohesive view of the role of sex-specific selection and mating system in genome evolution. We also highlight the need for a combined approach, incorporating both genomic data and experimental phenotypic studies, in order to understand precisely how sex-specific selection drives evolutionary change across the genome. PMID:23848139

  11. Deciphering the distance to antibiotic resistance for the pneumococcus using genome sequencing data

    PubMed Central

    Mobegi, Fredrick M.; Cremers, Amelieke J. H.; de Jonge, Marien I.; Bentley, Stephen D.; van Hijum, Sacha A. F. T.; Zomer, Aldert

    2017-01-01

    Advances in genome sequencing technologies and genome-wide association studies (GWAS) have provided unprecedented insights into the molecular basis of microbial phenotypes and enabled the identification of the underlying genetic variants in real populations. However, utilization of genome sequencing in clinical phenotyping of bacteria is challenging due to the lack of reliable and accurate approaches. Here, we report a method for predicting microbial resistance patterns using genome sequencing data. We analyzed whole genome sequences of 1,680 Streptococcus pneumoniae isolates from four independent populations using GWAS and identified probable hotspots of genetic variation which correlate with phenotypes of resistance to essential classes of antibiotics. With the premise that accumulation of putative resistance-conferring SNPs, potentially in combination with specific resistance genes, precedes full resistance, we retrogressively surveyed the hotspot loci and quantified the number of SNPs and/or genes, which if accumulated would confer full resistance to an otherwise susceptible strain. We name this approach the ‘distance to resistance’. It can be used to identify the creep towards complete antibiotics resistance in bacteria using genome sequencing. This approach serves as a basis for the development of future sequencing-based methods for predicting resistance profiles of bacterial strains in hospital microbiology and public health settings. PMID:28205635

  12. Molecular Analysis and Genomic Organization of Major DNA Satellites in Banana (Musa spp.)

    PubMed Central

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa. PMID:23372772

  13. Molecular analysis and genomic organization of major DNA satellites in banana (Musa spp.).

    PubMed

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa.

  14. VCFtoTree: a user-friendly tool to construct locus-specific alignments and phylogenies from thousands of anthropologically relevant genome sequences.

    PubMed

    Xu, Duo; Jaber, Yousef; Pavlidis, Pavlos; Gokcumen, Omer

    2017-09-26

    Constructing alignments and phylogenies for a given locus from large genome sequencing studies with relevant outgroups allow novel evolutionary and anthropological insights. However, no user-friendly tool has been developed to integrate thousands of recently available and anthropologically relevant genome sequences to construct complete sequence alignments and phylogenies. Here, we provide VCFtoTree, a user friendly tool with a graphical user interface that directly accesses online databases to download, parse and analyze genome variation data for regions of interest. Our pipeline combines popular sequence datasets and tree building algorithms with custom data parsing to generate accurate alignments and phylogenies using all the individuals from the 1000 Genomes Project, Neanderthal and Denisovan genomes, as well as reference genomes of Chimpanzee and Rhesus Macaque. It can also be applied to other phased human genomes, as well as genomes from other species. The output of our pipeline includes an alignment in FASTA format and a tree file in newick format. VCFtoTree fulfills the increasing demand for constructing alignments and phylogenies for a given loci from thousands of available genomes. Our software provides a user friendly interface for a wider audience without prerequisite knowledge in programming. VCFtoTree can be accessed from https://github.com/duoduoo/VCFtoTree_3.0.0 .

  15. Mitochondrial genome sequences and comparative genomics ofPhytophthora ramorum and P. sojae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, Frank N.; Douda, Bensasson; Tyler, Brett M.

    The complete sequences of the mitochondrial genomes of theoomycetes of Phytophthora ramorum and P. sojae were determined during thecourse of their complete nuclear genome sequencing (Tyler, et al. 2006).Both are circular, with sizes of 39,314 bp for P. ramorum and 42,975 bpfor P. sojae. Each contains a total of 37 identifiable protein-encodinggenes, 25 or 26 tRNAs (P. sojae and P. ramorum, respectively)specifying19 amino acids, and a variable number of ORFs (7 for P. ramorum and 12for P. sojae) which are potentially additional functional genes.Non-coding regions comprise approximately 11.5 percent and 18.4 percentof the genomes of P. ramorum and P. sojae,more » respectively. Relative to P.sojae, there is an inverted repeat of 1,150 bp in P. ramorum thatincludes an unassigned unique ORF, a tRNA gene, and adjacent non-codingsequences, but otherwise the gene order in both species is identical.Comparisons of these genomes with published sequences of the P. infestansmitochondrial genome reveals a number of similarities, but the gene orderin P. infestans differs in two adjacent locations due to inversions.Sequence alignments of the three genomes indicated sequence conservationranging from 75 to 85 percent and that specific regions were morevariable than others.« less

  16. Simultaneous non-contiguous deletions using large synthetic DNA and site-specific recombinases

    PubMed Central

    Krishnakumar, Radha; Grose, Carissa; Haft, Daniel H.; Zaveri, Jayshree; Alperovich, Nina; Gibson, Daniel G.; Merryman, Chuck; Glass, John I.

    2014-01-01

    Toward achieving rapid and large scale genome modification directly in a target organism, we have developed a new genome engineering strategy that uses a combination of bioinformatics aided design, large synthetic DNA and site-specific recombinases. Using Cre recombinase we swapped a target 126-kb segment of the Escherichia coli genome with a 72-kb synthetic DNA cassette, thereby effectively eliminating over 54 kb of genomic DNA from three non-contiguous regions in a single recombination event. We observed complete replacement of the native sequence with the modified synthetic sequence through the action of the Cre recombinase and no competition from homologous recombination. Because of the versatility and high-efficiency of the Cre-lox system, this method can be used in any organism where this system is functional as well as adapted to use with other highly precise genome engineering systems. Compared to present-day iterative approaches in genome engineering, we anticipate this method will greatly speed up the creation of reduced, modularized and optimized genomes through the integration of deletion analyses data, transcriptomics, synthetic biology and site-specific recombination. PMID:24914053

  17. MIPS: analysis and annotation of proteins from whole genomes

    PubMed Central

    Mewes, H. W.; Amid, C.; Arnold, R.; Frishman, D.; Güldener, U.; Mannhaupt, G.; Münsterkötter, M.; Pagel, P.; Strack, N.; Stümpflen, V.; Warfsmann, J.; Ruepp, A.

    2004-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF), Neuherberg, Germany, provides protein sequence-related information based on whole-genome analysis. The main focus of the work is directed toward the systematic organization of sequence-related attributes as gathered by a variety of algorithms, primary information from experimental data together with information compiled from the scientific literature. MIPS maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the database of complete cDNAs (German Human Genome Project, NGFN), the database of mammalian protein–protein interactions (MPPI), the database of FASTA homologies (SIMAP), and the interface for the fast retrieval of protein-associated information (QUIPOS). The Arabidopsis thaliana database, the rice database, the plant EST databases (MATDB, MOsDB, SPUTNIK), as well as the databases for the comprehensive set of genomes (PEDANT genomes) are described elsewhere in the 2003 and 2004 NAR database issues, respectively. All databases described, and the detailed descriptions of our projects can be accessed through the MIPS web server (http://mips.gsf.de). PMID:14681354

  18. MIPS: analysis and annotation of proteins from whole genomes.

    PubMed

    Mewes, H W; Amid, C; Arnold, R; Frishman, D; Güldener, U; Mannhaupt, G; Münsterkötter, M; Pagel, P; Strack, N; Stümpflen, V; Warfsmann, J; Ruepp, A

    2004-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF), Neuherberg, Germany, provides protein sequence-related information based on whole-genome analysis. The main focus of the work is directed toward the systematic organization of sequence-related attributes as gathered by a variety of algorithms, primary information from experimental data together with information compiled from the scientific literature. MIPS maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the database of complete cDNAs (German Human Genome Project, NGFN), the database of mammalian protein-protein interactions (MPPI), the database of FASTA homologies (SIMAP), and the interface for the fast retrieval of protein-associated information (QUIPOS). The Arabidopsis thaliana database, the rice database, the plant EST databases (MATDB, MOsDB, SPUTNIK), as well as the databases for the comprehensive set of genomes (PEDANT genomes) are described elsewhere in the 2003 and 2004 NAR database issues, respectively. All databases described, and the detailed descriptions of our projects can be accessed through the MIPS web server (http://mips.gsf.de).

  19. A new genome of Acidithiobacillus thiooxidans provides insights into adaptation to a bioleaching environment.

    PubMed

    Travisany, Dante; Cortés, María Paz; Latorre, Mauricio; Di Genova, Alex; Budinich, Marko; Bobadilla-Fazzini, Roberto A; Parada, Pilar; González, Mauricio; Maass, Alejandro

    2014-11-01

    Acidithiobacillus thiooxidans is a sulfur oxidizing acidophilic bacterium found in many sulfur-rich environments. It is particularly interesting due to its role in bioleaching of sulphide minerals. In this work, we report the genome sequence of At. thiooxidans Licanantay, the first strain from a copper mine to be sequenced and currently used in bioleaching industrial processes. Through comparative genomic analysis with two other At. thiooxidans non-metal mining strains (ATCC 19377 and A01) we determined that these strains share a large core genome of 2109 coding sequences and a high average nucleotide identity over 98%. Nevertheless, the presence of 841 strain-specific genes (absent in other At. thiooxidans strains) suggests a particular adaptation of Licanantay to its specific biomining environment. Among this group, we highlight genes encoding for proteins involved in heavy metal tolerance, mineral cell attachment and cysteine biosynthesis. Several of these genes were located near genetic motility genes (e.g. transposases and integrases) in genomic regions of over 10 kbp absent in the other strains, suggesting the presence of genomic islands in the Licanantay genome probably produced by horizontal gene transfer in mining environments. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  20. Recapitulating phylogenies using k-mers: from trees to networks.

    PubMed

    Bernard, Guillaume; Ragan, Mark A; Chan, Cheong Xin

    2016-01-01

    Ernst Haeckel based his landmark Tree of Life on the supposed ontogenic recapitulation of phylogeny, i.e. that successive embryonic stages during the development of an organism re-trace the morphological forms of its ancestors over the course of evolution. Much of this idea has since been discredited. Today, phylogenies are often based on families of molecular sequences. The standard approach starts with a multiple sequence alignment, in which the sequences are arranged relative to each other in a way that maximises a measure of similarity position-by-position along their entire length. A tree (or sometimes a network) is then inferred. Rigorous multiple sequence alignment is computationally demanding, and evolutionary processes that shape the genomes of many microbes (bacteria, archaea and some morphologically simple eukaryotes) can add further complications. In particular, recombination, genome rearrangement and lateral genetic transfer undermine the assumptions that underlie multiple sequence alignment, and imply that a tree-like structure may be too simplistic. Here, using genome sequences of 143 bacterial and archaeal genomes, we construct a network of phylogenetic relatedness based on the number of shared k -mers (subsequences at fixed length k ). Our findings suggest that the network captures not only key aspects of microbial genome evolution as inferred from a tree, but also features that are not treelike. The method is highly scalable, allowing for investigation of genome evolution across a large number of genomes. Instead of using specific regions or sequences from genome sequences, or indeed Haeckel's idea of ontogeny, we argue that genome phylogenies can be inferred using k -mers from whole-genome sequences. Representing these networks dynamically allows biological questions of interest to be formulated and addressed quickly and in a visually intuitive manner.

  1. Component identification of electron transport chains in curdlan-producing Agrobacterium sp. ATCC 31749 and its genome-specific prediction using comparative genome and phylogenetic trees analysis.

    PubMed

    Zhang, Hongtao; Setubal, Joao Carlos; Zhan, Xiaobei; Zheng, Zhiyong; Yu, Lijun; Wu, Jianrong; Chen, Dingqiang

    2011-06-01

    Agrobacterium sp. ATCC 31749 (formerly named Alcaligenes faecalis var. myxogenes) is a non-pathogenic aerobic soil bacterium used in large scale biotechnological production of curdlan. However, little is known about its genomic information. DNA partial sequence of electron transport chains (ETCs) protein genes were obtained in order to understand the components of ETC and genomic-specificity in Agrobacterium sp. ATCC 31749. Degenerate primers were designed according to ETC conserved sequences in other reported species. DNA partial sequences of ETC genes in Agrobacterium sp. ATCC 31749 were cloned by the PCR method using degenerate primers. Based on comparative genomic analysis, nine electron transport elements were ascertained, including NADH ubiquinone oxidoreductase, succinate dehydrogenase complex II, complex III, cytochrome c, ubiquinone biosynthesis protein ubiB, cytochrome d terminal oxidase, cytochrome bo terminal oxidase, cytochrome cbb (3)-type terminal oxidase and cytochrome caa (3)-type terminal oxidase. Similarity and phylogenetic analyses of these genes revealed that among fully sequenced Agrobacterium species, Agrobacterium sp. ATCC 31749 is closest to Agrobacterium tumefaciens C58. Based on these results a comprehensive ETC model for Agrobacterium sp. ATCC 31749 is proposed.

  2. Genomics-inspired discovery of natural products.

    PubMed

    Winter, Jaclyn M; Behnken, Swantje; Hertweck, Christian

    2011-02-01

    The massive surge in genome sequencing projects has opened our eyes to the overlooked biosynthetic potential and metabolic diversity of microorganisms. While traditional approaches have been successful at identifying many useful therapeutic agents from these organisms, new tactics are needed in order to exploit their true biosynthetic potential. Several genomics-inspired strategies have been successful in unveiling new metabolites that were overlooked under standard fermentation and detection conditions. In addition, genome sequences have given us valuable insight for genetically engineering biosynthesis gene clusters that remain silent or are poorly expressed in the absence of a specific trigger. As more genome sequences are becoming available, we are noticing the emergence of underexplored or neglected organisms as alternative resources for new therapeutic agents. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association

    PubMed Central

    2012-01-01

    Background The genome of Mycobacterium avium subspecies paratuberculosis (MAP) is remarkably homogeneous among the genomes of bovine, human and wildlife isolates. However, previous work in our laboratories with the bovine K-10 strain has revealed substantial differences compared to sheep isolates. To systematically characterize all genomic differences that may be associated with the specific hosts, we sequenced the genomes of three U.S. sheep isolates and also obtained an optical map. Results Our analysis of one of the isolates, MAP S397, revealed a genome 4.8 Mb in size with 4,700 open reading frames (ORFs). Comparative analysis of the MAP S397 isolate showed it acquired approximately 10 large sequence regions that are shared with the human M. avium subsp. hominissuis strain 104 and lost 2 large regions that are present in the bovine strain. In addition, optical mapping defined the presence of 7 large inversions between the bovine and ovine genomes (~ 2.36 Mb). Whole-genome sequencing of 2 additional sheep strains of MAP (JTC1074 and JTC7565) further confirmed genomic homogeneity of the sheep isolates despite the presence of polymorphisms on the nucleotide level. Conclusions Comparative sequence analysis employed here provided a better understanding of the host association, evolution of members of the M. avium complex and could help in deciphering the phenotypic differences observed among sheep and cattle strains of MAP. A similar approach based on whole-genome sequencing combined with optical mapping could be employed to examine closely related pathogens. We propose an evolutionary scenario for M. avium complex strains based on these genome sequences. PMID:22409516

  4. Identifying Specific Genes Controlling Complex Traits Through A Genome-Wide Screen For cis-Acting Regulatory Elements - An Example Using Marek's Disease

    USDA-ARS?s Scientific Manuscript database

    The identification of specific genes underlying phenotypic variation of complex traits remains one of the greatest challenges in biology despite having genome sequences and more powerful tools. Most genome-wide screens lack sufficient resolving power as they typically depend on linkage. One altern...

  5. Complete Chloroplast Genome Sequences of Important Oilseed Crop Sesamum indicum L

    PubMed Central

    Yi, Dong-Keun; Kim, Ki-Joong

    2012-01-01

    Sesamum indicum is an important crop plant species for yielding oil. The complete chloroplast (cp) genome of S. indicum (GenBank acc no. JN637766) is 153,324 bp in length, and has a pair of inverted repeat (IR) regions consisting of 25,141 bp each. The lengths of the large single copy (LSC) and the small single copy (SSC) regions are 85,170 bp and 17,872 bp, respectively. Comparative cp DNA sequence analyses of S. indicum with other cp genomes reveal that the genome structure, gene order, gene and intron contents, AT contents, codon usage, and transcription units are similar to the typical angiosperm cp genomes. Nucleotide diversity of the IR region between Sesamum and three other cp genomes is much lower than that of the LSC and SSC regions in both the coding region and noncoding region. As a summary, the regional constraints strongly affect the sequence evolution of the cp genomes, while the functional constraints weakly affect the sequence evolution of cp genomes. Five short inversions associated with short palindromic sequences that form step-loop structures were observed in the chloroplast genome of S. indicum. Twenty-eight different simple sequence repeat loci have been detected in the chloroplast genome of S. indicum. Almost all of the SSR loci were composed of A or T, so this may also contribute to the A-T richness of the cp genome of S. indicum. Seven large repeated loci in the chloroplast genome of S. indicum were also identified and these loci are useful to developing S. indicum-specific cp genome vectors. The complete cp DNA sequences of S. indicum reported in this paper are prerequisite to modifying this important oilseed crop by cp genetic engineering techniques. PMID:22606240

  6. Detection of Bacillus anthracis DNA in Complex Soil and Air Samples Using Next-Generation Sequencing

    PubMed Central

    Be, Nicholas A.; Thissen, James B.; Gardner, Shea N.; McLoughlin, Kevin S.; Fofanov, Viacheslav Y.; Koshinsky, Heather; Ellingson, Sally R.; Brettin, Thomas S.; Jackson, Paul J.; Jaing, Crystal J.

    2013-01-01

    Bacillus anthracis is the potentially lethal etiologic agent of anthrax disease, and is a significant concern in the realm of biodefense. One of the cornerstones of an effective biodefense strategy is the ability to detect infectious agents with a high degree of sensitivity and specificity in the context of a complex sample background. The nature of the B. anthracis genome, however, renders specific detection difficult, due to close homology with B. cereus and B. thuringiensis. We therefore elected to determine the efficacy of next-generation sequencing analysis and microarrays for detection of B. anthracis in an environmental background. We applied next-generation sequencing to titrated genome copy numbers of B. anthracis in the presence of background nucleic acid extracted from aerosol and soil samples. We found next-generation sequencing to be capable of detecting as few as 10 genomic equivalents of B. anthracis DNA per nanogram of background nucleic acid. Detection was accomplished by mapping reads to either a defined subset of reference genomes or to the full GenBank database. Moreover, sequence data obtained from B. anthracis could be reliably distinguished from sequence data mapping to either B. cereus or B. thuringiensis. We also demonstrated the efficacy of a microbial census microarray in detecting B. anthracis in the same samples, representing a cost-effective and high-throughput approach, complementary to next-generation sequencing. Our results, in combination with the capacity of sequencing for providing insights into the genomic characteristics of complex and novel organisms, suggest that these platforms should be considered important components of a biosurveillance strategy. PMID:24039948

  7. Analysis of the genome-wide variations among multiple strains of the plant pathogenic bacterium Xylella fastidiosa

    PubMed Central

    Doddapaneni, Harshavardhan; Yao, Jiqiang; Lin, Hong; Walker, M Andrew; Civerolo, Edwin L

    2006-01-01

    Background The Gram-negative, xylem-limited phytopathogenic bacterium Xylella fastidiosa is responsible for causing economically important diseases in grapevine, citrus and many other plant species. Despite its economic impact, relatively little is known about the genomic variations among strains isolated from different hosts and their influence on the population genetics of this pathogen. With the availability of genome sequence information for four strains, it is now possible to perform genome-wide analyses to identify and categorize such DNA variations and to understand their influence on strain functional divergence. Results There are 1,579 genes and 194 non-coding homologous sequences present in the genomes of all four strains, representing a 76. 2% conservation of the sequenced genome. About 60% of the X. fastidiosa unique sequences exist as tandem gene clusters of 6 or more genes. Multiple alignments identified 12,754 SNPs and 14,449 INDELs in the 1528 common genes and 20,779 SNPs and 10,075 INDELs in the 194 non-coding sequences. The average SNP frequency was 1.08 × 10-2 per base pair of DNA and the average INDEL frequency was 2.06 × 10-2 per base pair of DNA. On an average, 60.33% of the SNPs were synonymous type while 39.67% were non-synonymous type. The mutation frequency, primarily in the form of external INDELs was the main type of sequence variation. The relative similarity between the strains was discussed according to the INDEL and SNP differences. The number of genes unique to each strain were 60 (9a5c), 54 (Dixon), 83 (Ann1) and 9 (Temecula-1). A sub-set of the strain specific genes showed significant differences in terms of their codon usage and GC composition from the native genes suggesting their xenologous origin. Tandem repeat analysis of the genomic sequences of the four strains identified associations of repeat sequences with hypothetical and phage related functions. Conclusion INDELs and strain specific genes have been identified as the main source of variations among strains, with individual strains showing different rates of genome evolution. Based on these genome comparisons, it appears that the Pierce's disease strain Temecula-1 genome represents the ancestral genome of the X. fastidiosa. Results of this analysis are publicly available in the form of a web database. PMID:16948851

  8. A universal protocol to generate consensus level genome sequences for foot-and-mouth disease virus and other positive-sense polyadenylated RNA viruses using the Illumina MiSeq.

    PubMed

    Logan, Grace; Freimanis, Graham L; King, David J; Valdazo-González, Begoña; Bachanek-Bankowska, Katarzyna; Sanderson, Nicholas D; Knowles, Nick J; King, Donald P; Cottam, Eleanor M

    2014-09-30

    Next-Generation Sequencing (NGS) is revolutionizing molecular epidemiology by providing new approaches to undertake whole genome sequencing (WGS) in diagnostic settings for a variety of human and veterinary pathogens. Previous sequencing protocols have been subject to biases such as those encountered during PCR amplification and cell culture, or are restricted by the need for large quantities of starting material. We describe here a simple and robust methodology for the generation of whole genome sequences on the Illumina MiSeq. This protocol is specific for foot-and-mouth disease virus (FMDV) or other polyadenylated RNA viruses and circumvents both the use of PCR and the requirement for large amounts of initial template. The protocol was successfully validated using five FMDV positive clinical samples from the 2001 epidemic in the United Kingdom, as well as a panel of representative viruses from all seven serotypes. In addition, this protocol was successfully used to recover 94% of an FMDV genome that had previously been identified as cell culture negative. Genome sequences from three other non-FMDV polyadenylated RNA viruses (EMCV, ERAV, VESV) were also obtained with minor protocol amendments. We calculated that a minimum coverage depth of 22 reads was required to produce an accurate consensus sequence for FMDV O. This was achieved in 5 FMDV/O/UKG isolates and the type O FMDV from the serotype panel with the exception of the 5' genomic termini and area immediately flanking the poly(C) region. We have developed a universal WGS method for FMDV and other polyadenylated RNA viruses. This method works successfully from a limited quantity of starting material and eliminates the requirement for genome-specific PCR amplification. This protocol has the potential to generate consensus-level sequences within a routine high-throughput diagnostic environment.

  9. Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

    PubMed Central

    Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

    2004-01-01

    Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

  10. SMM-system: A mining tool to identify specific markers in Salmonella enterica.

    PubMed

    Yu, Shuijing; Liu, Weibing; Shi, Chunlei; Wang, Dapeng; Dan, Xianlong; Li, Xiao; Shi, Xianming

    2011-03-01

    This report presents SMM-system, a software package that implements various personalized pre- and post-BLASTN tasks for mining specific markers of microbial pathogens. The main functionalities of SMM-system are summarized as follows: (i) converting multi-FASTA file, (ii) cutting interesting genomic sequence, (iii) automatic high-throughput BLASTN searches, and (iv) screening target sequences. The utility of SMM-system was demonstrated by using it to identify 214 Salmonella enterica-specific protein-coding sequences (CDSs). Eighteen primer pairs were designed based on eighteen S. enterica-specific CDSs, respectively. Seven of these primer pairs were validated with PCR assay, which showed 100% inclusivity for the 101 S. enterica genomes and 100% exclusivity of 30 non-S. enterica genomes. Three specific primer pairs were chosen to develop a multiplex PCR assay, which generated specific amplicons with a size of 180bp (SC1286), 238bp (SC1598) and 405bp (SC4361), respectively. This study demonstrates that SMM-system is a high-throughput specific marker generation tool that can be used to identify genus-, species-, serogroup- and even serovar-specific DNA sequences of microbial pathogens, which has a potential to be applied in food industries, diagnostics and taxonomic studies. SMM-system is freely available and can be downloaded from http://foodsafety.sjtu.edu.cn/SMM-system.html. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

    PubMed Central

    Martin, William F.

    2017-01-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

  12. Genomic paradigms for food-borne enteric pathogen analysis at the USFDA: case studies highlighting method utility, integration and resolution.

    PubMed

    Elkins, C A; Kotewicz, M L; Jackson, S A; Lacher, D W; Abu-Ali, G S; Patel, I R

    2013-01-01

    Modern risk control and food safety practices involving food-borne bacterial pathogens are benefiting from new genomic technologies for rapid, yet highly specific, strain characterisations. Within the United States Food and Drug Administration (USFDA) Center for Food Safety and Applied Nutrition (CFSAN), optical genome mapping and DNA microarray genotyping have been used for several years to quickly assess genomic architecture and gene content, respectively, for outbreak strain subtyping and to enhance retrospective trace-back analyses. The application and relative utility of each method varies with outbreak scenario and the suspect pathogen, with comparative analytical power enhanced by database scale and depth. Integration of these two technologies allows high-resolution scrutiny of the genomic landscapes of enteric food-borne pathogens with notable examples including Shiga toxin-producing Escherichia coli (STEC) and Salmonella enterica serovars from a variety of food commodities. Moreover, the recent application of whole genome sequencing technologies to food-borne pathogen outbreaks and surveillance has enhanced resolution to the single nucleotide scale. This new wealth of sequence data will support more refined next-generation custom microarray designs, targeted re-sequencing and "genomic signature recognition" approaches involving a combination of genes and single nucleotide polymorphism detection to distil strain-specific fingerprinting to a minimised scale. This paper examines the utility of microarrays and optical mapping in analysing outbreaks, reviews best practices and the limits of these technologies for pathogen differentiation, and it considers future integration with whole genome sequencing efforts.

  13. VCGDB: a dynamic genome database of the Chinese population

    PubMed Central

    2014-01-01

    Background The data released by the 1000 Genomes Project contain an increasing number of genome sequences from different nations and populations with a large number of genetic variations. As a result, the focus of human genome studies is changing from single and static to complex and dynamic. The currently available human reference genome (GRCh37) is based on sequencing data from 13 anonymous Caucasian volunteers, which might limit the scope of genomics, transcriptomics, epigenetics, and genome wide association studies. Description We used the massive amount of sequencing data published by the 1000 Genomes Project Consortium to construct the Virtual Chinese Genome Database (VCGDB), a dynamic genome database of the Chinese population based on the whole genome sequencing data of 194 individuals. VCGDB provides dynamic genomic information, which contains 35 million single nucleotide variations (SNVs), 0.5 million insertions/deletions (indels), and 29 million rare variations, together with genomic annotation information. VCGDB also provides a highly interactive user-friendly virtual Chinese genome browser (VCGBrowser) with functions like seamless zooming and real-time searching. In addition, we have established three population-specific consensus Chinese reference genomes that are compatible with mainstream alignment software. Conclusions VCGDB offers a feasible strategy for processing big data to keep pace with the biological data explosion by providing a robust resource for genomics studies; in particular, studies aimed at finding regions of the genome associated with diseases. PMID:24708222

  14. Standards for Clinical Grade Genomic Databases.

    PubMed

    Yohe, Sophia L; Carter, Alexis B; Pfeifer, John D; Crawford, James M; Cushman-Vokoun, Allison; Caughron, Samuel; Leonard, Debra G B

    2015-11-01

    Next-generation sequencing performed in a clinical environment must meet clinical standards, which requires reproducibility of all aspects of the testing. Clinical-grade genomic databases (CGGDs) are required to classify a variant and to assist in the professional interpretation of clinical next-generation sequencing. Applying quality laboratory standards to the reference databases used for sequence-variant interpretation presents a new challenge for validation and curation. To define CGGD and the categories of information contained in CGGDs and to frame recommendations for the structure and use of these databases in clinical patient care. Members of the College of American Pathologists Personalized Health Care Committee reviewed the literature and existing state of genomic databases and developed a framework for guiding CGGD development in the future. Clinical-grade genomic databases may provide different types of information. This work group defined 3 layers of information in CGGDs: clinical genomic variant repositories, genomic medical data repositories, and genomic medicine evidence databases. The layers are differentiated by the types of genomic and medical information contained and the utility in assisting with clinical interpretation of genomic variants. Clinical-grade genomic databases must meet specific standards regarding submission, curation, and retrieval of data, as well as the maintenance of privacy and security. These organizing principles for CGGDs should serve as a foundation for future development of specific standards that support the use of such databases for patient care.

  15. CRISPR: From Prokaryotic Immune Systems to Plant Genome Editing Tools.

    PubMed

    Bandyopadhyay, Anindya; Mazumdar, Shamik; Yin, Xiaojia; Quick, William Paul

    2017-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR) system is a prokaryotic adaptive immune system that has the ability to identify specific locations on the bacteriophage (phage) genome to create breaks in it, and internalize the phage genome fragments in its own genome as CRISPR arrays for memory-dependent resistance. Although CRISPR has been used in the dairy industry for a long time, it recently gained importance in the field of genome editing because of its ability to precisely target locations in a genome. This system has further been modified to locate and target any region of a genome of choice due to modifications in the components of the system. By changing the nucleotide sequence of the 20-nucleotide target sequence in the guide RNA, targeting any location is possible. It has found an application in the modification of plant genomes with its ability to generate mutations and insertions, thus helping to create new varieties of plants. With the ability to introduce specific sequences into the plant genome after cleavage by the CRISPR system and subsequent DNA repair through homology-directed repair (HDR), CRISPR ensures that genome editing can be successfully applied in plants, thus generating stronger and more improved traits. Also, the use of the CRISPR editing system can generate plants that are transgene-free and have mutations that are stably inherited, thus helping to circumvent current GMO regulations.

  16. A Segment of the Apospory-Specific Genomic Region Is Highly Microsyntenic Not Only between the Apomicts Pennisetum squamulatum and Buffelgrass, But Also with a Rice Chromosome 11 Centromeric-Proximal Genomic Region1[W

    PubMed Central

    Gualtieri, Gustavo; Conner, Joann A.; Morishige, Daryl T.; Moore, L. David; Mullet, John E.; Ozias-Akins, Peggy

    2006-01-01

    Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory. PMID:16415213

  17. A segment of the apospory-specific genomic region is highly microsyntenic not only between the apomicts Pennisetum squamulatum and buffelgrass, but also with a rice chromosome 11 centromeric-proximal genomic region.

    PubMed

    Gualtieri, Gustavo; Conner, Joann A; Morishige, Daryl T; Moore, L David; Mullet, John E; Ozias-Akins, Peggy

    2006-03-01

    Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory.

  18. Analysis of whole genome sequences of 16 strains of rubella virus from the United States, 1961-2009.

    PubMed

    Abernathy, Emily; Chen, Min-hsin; Bera, Jayati; Shrivastava, Susmita; Kirkness, Ewen; Zheng, Qi; Bellini, William; Icenogle, Joseph

    2013-01-25

    Rubella virus is the causative agent of rubella, a mild rash illness, and a potent teratogenic agent when contracted by a pregnant woman. Global rubella control programs target the reduction and elimination of congenital rubella syndrome. Phylogenetic analysis of partial sequences of rubella viruses has contributed to virus surveillance efforts and played an important role in demonstrating that indigenous rubella viruses have been eliminated in the United States. Sixteen wild-type rubella viruses were chosen for whole genome sequencing. All 16 viruses were collected in the United States from 1961 to 2009 and are from 8 of the 13 known rubella genotypes. Phylogenetic analysis of 30 whole genome sequences produced a maximum likelihood tree giving high bootstrap values for all genotypes except provisional genotype 1a. Comparison of the 16 new complete sequences and 14 previously sequenced wild-type viruses found regions with clusters of variable amino acids. The 5' 250 nucleotides of the genome are more conserved than any other part of the genome. Genotype specific deletions in the untranslated region between the non-structural and structural open reading frames were observed for genotypes 2B and genotype 1G. No evidence was seen for recombination events among the 30 viruses. The analysis presented here is consistent with previous reports on the genetic characterization of rubella virus genomes. Conserved and variable regions were identified and additional evidence for genotype specific nucleotide deletions in the intergenic region was found. Phylogenetic analysis confirmed genotype groupings originally based on structural protein coding region sequences, which provides support for the WHO nomenclature for genetic characterization of wild-type rubella viruses.

  19. Comparative and Evolutionary Analysis of Grass Pollen Allergens Using Brachypodium distachyon as a Model System.

    PubMed

    Sharma, Akanksha; Sharma, Niharika; Bhalla, Prem; Singh, Mohan

    2017-01-01

    Comparative genomics have facilitated the mining of biological information from a genome sequence, through the detection of similarities and differences with genomes of closely or more distantly related species. By using such comparative approaches, knowledge can be transferred from the model to non-model organisms and insights can be gained in the structural and evolutionary patterns of specific genes. In the absence of sequenced genomes for allergenic grasses, this study was aimed at understanding the structure, organisation and expression profiles of grass pollen allergens using the genomic data from Brachypodium distachyon as it is phylogenetically related to the allergenic grasses. Combining genomic data with the anther RNA-Seq dataset revealed 24 pollen allergen genes belonging to eight allergen groups mapping on the five chromosomes in B. distachyon. High levels of anther-specific expression profiles were observed for the 24 identified putative allergen-encoding genes in Brachypodium. The genomic evidence suggests that gene encoding the group 5 allergen, the most potent trigger of hay fever and allergic asthma originated as a pollen specific orphan gene in a common grass ancestor of Brachypodium and Triticiae clades. Gene structure analysis showed that the putative allergen-encoding genes in Brachypodium either lack or contain reduced number of introns. Promoter analysis of the identified Brachypodium genes revealed the presence of specific cis-regulatory sequences likely responsible for high anther/pollen-specific expression. With the identification of putative allergen-encoding genes in Brachypodium, this study has also described some important plant gene families (e.g. expansin superfamily, EF-Hand family, profilins etc) for the first time in the model plant Brachypodium. Altogether, the present study provides new insights into structural characterization and evolution of pollen allergens and will further serve as a base for their functional characterization in related grass species.

  20. Artificial selection increased body weight but induced increase of runs of homozygosity in Hanwoo cattle

    PubMed Central

    Kim, Kwondo; Jung, Jaehoon; Caetano-Anollés, Kelsey; Sung, Samsun; Yoo, DongAhn; Choi, Bong-Hwan; Kim, Hyung-Chul; Jeong, Jin-Young; Cho, Yong-Min; Park, Eung-Woo; Choi, Tae-Jeong; Park, Byoungho; Lim, Dajeong

    2018-01-01

    Artificial selection has been demonstrated to have a rapid and significant effect on the phenotype and genome of an organism. However, most previous studies on artificial selection have focused solely on genomic sequences modified by artificial selection or genomic sequences associated with a specific trait. In this study, we generated whole genome sequencing data of 126 cattle under artificial selection, and 24,973,862 single nucleotide variants to investigate the relationship among artificial selection, genomic sequences and trait. Using runs of homozygosity detected by the variants, we showed increase of inbreeding for decades, and at the same time demonstrated a little influence of recent inbreeding on body weight. Also, we could identify ~0.2 Mb runs of homozygosity segment which may be created by recent artificial selection. This approach may aid in development of genetic markers directly influenced by artificial selection, and provide insight into the process of artificial selection. PMID:29561881

  1. A-to-I RNA editing occurs at over a hundred million genomic sites, located in a majority of human genes.

    PubMed

    Bazak, Lily; Haviv, Ami; Barak, Michal; Jacob-Hirsch, Jasmine; Deng, Patricia; Zhang, Rui; Isaacs, Farren J; Rechavi, Gideon; Li, Jin Billy; Eisenberg, Eli; Levanon, Erez Y

    2014-03-01

    RNA molecules transmit the information encoded in the genome and generally reflect its content. Adenosine-to-inosine (A-to-I) RNA editing by ADAR proteins converts a genomically encoded adenosine into inosine. It is known that most RNA editing in human takes place in the primate-specific Alu sequences, but the extent of this phenomenon and its effect on transcriptome diversity are not yet clear. Here, we analyzed large-scale RNA-seq data and detected ∼1.6 million editing sites. As detection sensitivity increases with sequencing coverage, we performed ultradeep sequencing of selected Alu sequences and showed that the scope of editing is much larger than anticipated. We found that virtually all adenosines within Alu repeats that form double-stranded RNA undergo A-to-I editing, although most sites exhibit editing at only low levels (<1%). Moreover, using high coverage sequencing, we observed editing of transcripts resulting from residual antisense expression, doubling the number of edited sites in the human genome. Based on bioinformatic analyses and deep targeted sequencing, we estimate that there are over 100 million human Alu RNA editing sites, located in the majority of human genes. These findings set the stage for exploring how this primate-specific massive diversification of the transcriptome is utilized.

  2. Reverse Genetics and High Throughput Sequencing Methodologies for Plant Functional Genomics

    PubMed Central

    Ben-Amar, Anis; Daldoul, Samia; Reustle, Götz M.; Krczal, Gabriele; Mliki, Ahmed

    2016-01-01

    In the post-genomic era, increasingly sophisticated genetic tools are being developed with the long-term goal of understanding how the coordinated activity of genes gives rise to a complex organism. With the advent of the next generation sequencing associated with effective computational approaches, wide variety of plant species have been fully sequenced giving a wealth of data sequence information on structure and organization of plant genomes. Since thousands of gene sequences are already known, recently developed functional genomics approaches provide powerful tools to analyze plant gene functions through various gene manipulation technologies. Integration of different omics platforms along with gene annotation and computational analysis may elucidate a complete view in a system biology level. Extensive investigations on reverse genetics methodologies were deployed for assigning biological function to a specific gene or gene product. We provide here an updated overview of these high throughout strategies highlighting recent advances in the knowledge of functional genomics in plants. PMID:28217003

  3. The DL1 repeats in the genome of Diphyllobothrium latum.

    PubMed

    Usmanova, Nadezhda M; Kazakov, Vasiliy I

    2010-07-01

    Diphyllobothrium latum is a widespread intestinal parasite, which has a great clinical relevance, but there are no sequences of its nuclear genome. In this paper, a repetitive element in the D. latum genome is firstly described. The adult D. latum was obtained in the result of expulsion from intestinum of a patient suffering from diphyllobothriasis. Genomic DNA was isolated from several proglottids of this individual. PstI restriction products of D. latum genomic DNA were sequenced. Polymerase chain reaction (PCR) amplification of these products using genomic DNA and selected primers was carried out. Thereby a cluster of a repetitive element, called DL1, was discovered. For precise identification of a beginning and an end of the repeat, a product of PCR amplification of D. latum genomic DNA with one specific primer was sequenced. In discussion, several evidences that DL1 repeat is a member of the SINE family of retroposons were adduced.

  4. Comparative analysis of the complete sequence of the plastid genome of Parthenium argentatum and identification of DNA barcodes to differentiate Parthenium species and lines

    PubMed Central

    2009-01-01

    Background Parthenium argentatum (guayule) is an industrial crop that produces latex, which was recently commercialized as a source of latex rubber safe for people with Type I latex allergy. The complete plastid genome of P. argentatum was sequenced. The sequence provides important information useful for genetic engineering strategies. Comparison to the sequences of plastid genomes from three other members of the Asteraceae, Lactuca sativa, Guitozia abyssinica and Helianthus annuus revealed details of the evolution of the four genomes. Chloroplast-specific DNA barcodes were developed for identification of Parthenium species and lines. Results The complete plastid genome of P. argentatum is 152,803 bp. Based on the overall comparison of individual protein coding genes with those in L. sativa, G. abyssinica and H. annuus, we demonstrate that the P. argentatum chloroplast genome sequence is most closely related to that of H. annuus. Similar to chloroplast genomes in G. abyssinica, L. sativa and H. annuus, the plastid genome of P. argentatum has a large 23 kb inversion with a smaller 3.4 kb inversion, within the large inversion. Using the matK and psbA-trnH spacer chloroplast DNA barcodes, three of the four Parthenium species tested, P. tomentosum, P. hysterophorus and P. schottii, can be differentiated from P. argentatum. In addition, we identified lines within P. argentatum. Conclusion The genome sequence of the P. argentatum chloroplast will enrich the sequence resources of plastid genomes in commercial crops. The availability of the complete plastid genome sequence may facilitate transformation efficiency by using the precise sequence of endogenous flanking sequences and regulatory elements in chloroplast transformation vectors. The DNA barcoding study forms the foundation for genetic identification of commercially significant lines of P. argentatum that are important for producing latex. PMID:19917140

  5. Draft Genome Sequence of Staphylococcus aureus Strain HD1410, Isolated from a Persistent Nasal Carrier.

    PubMed

    Nurjadi, Dennis; Boutin, Sébastien; Dalpke, Alexander; Heeg, Klaus; Zanger, Philipp

    2018-05-10

    We report here the draft genome sequence of a Staphylococcus aureus strain isolated from the nares of an 18-year-old female healthy persistent-carrier individual, and it was used to investigate S. aureus -specific immune responses in colonized and noncolonized individuals. Copyright © 2018 Nurjadi et al.

  6. Draft Genome Sequence of Staphylococcus aureus Strain HD1410, Isolated from a Persistent Nasal Carrier

    PubMed Central

    Boutin, Sébastien; Dalpke, Alexander; Heeg, Klaus; Zanger, Philipp

    2018-01-01

    ABSTRACT We report here the draft genome sequence of a Staphylococcus aureus strain isolated from the nares of an 18-year-old female healthy persistent-carrier individual, and it was used to investigate S. aureus-specific immune responses in colonized and noncolonized individuals. PMID:29748411

  7. Genome Sequence of the Enterohemorrhagic Escherichia coli Bacteriophage UFV-AREG1

    PubMed Central

    Batalha, Laís Silva; Albino, Luiz Augusto A.; Boggione, Delaine Meireles Gouveia; Gontijo, Marco Tulio Pardini; Bazzolli, Denise M. Soares; Mendonca, Regina C. Santos

    2016-01-01

    Here, we present the genome sequence of the Escherichia coli bacteriophage UFV-AREG1. This phage was isolated from cowshed wastewater and showed specificity for enterohemorrhagic E. coli O157:H7 (ATCC 43895), E. coli 0111 (CDC O11ab) and E. coli (ATCC 23229). PMID:27738021

  8. Islander: A database of precisely mapped genomic islands in tRNA and tmRNA genes

    DOE PAGES

    Hudson, Corey M.; Lau, Britney Y.; Williams, Kelly P.

    2014-11-05

    Genomic islands are mobile DNAs that are major agents of bacterial and archaeal evolution. Integration into prokaryotic chromosomes usually occurs site-specifically at tRNA or tmRNA gene (together, tDNA) targets, catalyzed by tyrosine integrases. This splits the target gene, yet sequences within the island restore the disrupted gene; the regenerated target and its displaced fragment precisely mark the endpoints of the island. We applied this principle to search for islands in genomic DNA sequences. Our algorithm identifies tDNAs, finds fragments of those tDNAs in the same replicon and removes unlikely candidate islands through a series of filters. A search for islandsmore » in 2168 whole prokaryotic genomes produced 3919 candidates. The website Islander (recently moved to http://bioinformatics.sandia.gov/islander/) presents these precisely mapped candidate islands, the gene content and the island sequence. The algorithm further insists that each island encode an integrase, and attachment site sequence identity is carefully noted; therefore, the database also serves in the study of integrase site-specificity and its evolution.« less

  9. Visualization of specific repetitive genomic sequences with fluorescent TALEs in Arabidopsis thaliana

    PubMed Central

    Fujimoto, Satoru; Sugano, Shigeo S.; Kuwata, Keiko; Osakabe, Keishi; Matsunaga, Sachihiro

    2016-01-01

    Live imaging of the dynamics of nuclear organization provides the opportunity to uncover the mechanisms responsible for four-dimensional genome architecture. Here, we describe the use of fluorescent protein (FP) fusions of transcription activator-like effectors (TALEs) to visualize endogenous genomic sequences in Arabidopsis thaliana. The ability to engineer sequence-specific TALEs permits the investigation of precise genomic sequences. We could detect TALE-FP signals associated with centromeric, telomeric, and rDNA repeats and the signal distribution was consistent with that observed by fluorescent in situ hybridization. TALE-FPs are advantageous because they permit the observation of intact tissues. We used our TALE-FP method to investigate the nuclei of several multicellular plant tissues including roots, hypocotyls, leaves, and flowers. Because TALE-FPs permit live-cell imaging, we successfully observed the temporal dynamics of centromeres and telomeres in plant organs. Fusing TALEs to multimeric FPs enhanced the signal intensity when observing telomeres. We found that the mobility of telomeres was different in sub-nuclear regions. Transgenic plants stably expressing TALE-FPs will provide new insights into chromatin organization and dynamics in multicellular organisms. PMID:27811079

  10. Protecting genomic sequence anonymity with generalization lattices.

    PubMed

    Malin, B A

    2005-01-01

    Current genomic privacy technologies assume the identity of genomic sequence data is protected if personal information, such as demographics, are obscured, removed, or encrypted. While demographic features can directly compromise an individual's identity, recent research demonstrates such protections are insufficient because sequence data itself is susceptible to re-identification. To counteract this problem, we introduce an algorithm for anonymizing a collection of person-specific DNA sequences. The technique is termed DNA lattice anonymization (DNALA), and is based upon the formal privacy protection schema of k -anonymity. Under this model, it is impossible to observe or learn features that distinguish one genetic sequence from k-1 other entries in a collection. To maximize information retained in protected sequences, we incorporate a concept generalization lattice to learn the distance between two residues in a single nucleotide region. The lattice provides the most similar generalized concept for two residues (e.g. adenine and guanine are both purines). The method is tested and evaluated with several publicly available human population datasets ranging in size from 30 to 400 sequences. Our findings imply the anonymization schema is feasible for the protection of sequences privacy. The DNALA method is the first computational disclosure control technique for general DNA sequences. Given the computational nature of the method, guarantees of anonymity can be formally proven. There is room for improvement and validation, though this research provides the groundwork from which future researchers can construct genomics anonymization schemas tailored to specific datasharing scenarios.

  11. Enhanced Methods for Local Ancestry Assignment in Sequenced Admixed Individuals

    PubMed Central

    Brown, Robert; Pasaniuc, Bogdan

    2014-01-01

    Inferring the ancestry at each locus in the genome of recently admixed individuals (e.g., Latino Americans) plays a major role in medical and population genetic inferences, ranging from finding disease-risk loci, to inferring recombination rates, to mapping missing contigs in the human genome. Although many methods for local ancestry inference have been proposed, most are designed for use with genotyping arrays and fail to make use of the full spectrum of data available from sequencing. In addition, current haplotype-based approaches are very computationally demanding, requiring large computational time for moderately large sample sizes. Here we present new methods for local ancestry inference that leverage continent-specific variants (CSVs) to attain increased performance over existing approaches in sequenced admixed genomes. A key feature of our approach is that it incorporates the admixed genomes themselves jointly with public datasets, such as 1000 Genomes, to improve the accuracy of CSV calling. We use simulations to show that our approach attains accuracy similar to widely used computationally intensive haplotype-based approaches with large decreases in runtime. Most importantly, we show that our method recovers comparable local ancestries, as the 1000 Genomes consensus local ancestry calls in the real admixed individuals from the 1000 Genomes Project. We extend our approach to account for low-coverage sequencing and show that accurate local ancestry inference can be attained at low sequencing coverage. Finally, we generalize CSVs to sub-continental population-specific variants (sCSVs) and show that in some cases it is possible to determine the sub-continental ancestry for short chromosomal segments on the basis of sCSVs. PMID:24743331

  12. The draft genome sequence of Mangrovibacter sp. strain MP23, an endophyte isolated from the roots of Phragmites karka.

    PubMed

    Behera, Pratiksha; Vaishampayan, Parag; Singh, Nitin K; Mishra, Samir R; Raina, Vishakha; Suar, Mrutyunjay; Pattnaik, Ajit K; Rastogi, Gurdeep

    2016-09-01

    Till date, only one draft genome has been reported within the genus Mangrovibacter. Here, we report the second draft genome shotgun sequence of a Mangrovibacter sp. strain MP23 that was isolated from the roots of Phargmites karka (P. karka), an invasive weed growing in the Chilika Lagoon, Odisha, India. Strain MP23 is a facultative anaerobic, nitrogen-fixing endophytic bacteria that grows optimally at 37 °C, 7.0 pH, and 1% NaCl concentration. The draft genome sequence of strain MP23 contains 4,947,475 bp with an estimated G + C content of 49.9% and total 4392 protein coding genes. The genome sequence has provided information on putative genes that code for proteins involved in oxidative stress, uptake of nutrients, and nitrogen fixation that might offer niche specific ecological fitness and explain the invasive success of P. karka in Chilika Lagoon. The draft genome sequence and annotation have been deposited at DDBJ/EMBL/GenBank under the accession number LYRP00000000.

  13. Comprehensive Interrogation of Natural TALE DNA Binding Modules and Transcriptional Repressor Domains

    PubMed Central

    Cong, Le; Zhou, Ruhong; Kuo, Yu-chi; Cunniff, Margaret; Zhang, Feng

    2012-01-01

    Transcription activator-like effectors (TALE) are sequence-specific DNA binding proteins that harbor modular, repetitive DNA binding domains. TALEs have enabled the creation of customizable designer transcriptional factors and sequence-specific nucleases for genome engineering. Here we report two improvements of the TALE toolbox for achieving efficient activation and repression of endogenous gene expression in mammalian cells. We show that the naturally occurring repeat variable diresidue (RVD) Asn-His (NH) has high biological activity and specificity for guanine, a highly prevalent base in mammalian genomes. We also report an effective TALE transcriptional repressor architecture for targeted inhibition of transcription in mammalian cells. These findings will improve the precision and effectiveness of genome engineering that can be achieved using TALEs. PMID:22828628

  14. Evaluation of next generation mtGenome sequencing using the Ion Torrent Personal Genome Machine (PGM)☆

    PubMed Central

    Parson, Walther; Strobl, Christina; Huber, Gabriela; Zimmermann, Bettina; Gomes, Sibylle M.; Souto, Luis; Fendt, Liane; Delport, Rhena; Langit, Reina; Wootton, Sharon; Lagacé, Robert; Irwin, Jodi

    2013-01-01

    Insights into the human mitochondrial phylogeny have been primarily achieved by sequencing full mitochondrial genomes (mtGenomes). In forensic genetics (partial) mtGenome information can be used to assign haplotypes to their phylogenetic backgrounds, which may, in turn, have characteristic geographic distributions that would offer useful information in a forensic case. In addition and perhaps even more relevant in the forensic context, haplogroup-specific patterns of mutations form the basis for quality control of mtDNA sequences. The current method for establishing (partial) mtDNA haplotypes is Sanger-type sequencing (STS), which is laborious, time-consuming, and expensive. With the emergence of Next Generation Sequencing (NGS) technologies, the body of available mtDNA data can potentially be extended much more quickly and cost-efficiently. Customized chemistries, laboratory workflows and data analysis packages could support the community and increase the utility of mtDNA analysis in forensics. We have evaluated the performance of mtGenome sequencing using the Personal Genome Machine (PGM) and compared the resulting haplotypes directly with conventional Sanger-type sequencing. A total of 64 mtGenomes (>1 million bases) were established that yielded high concordance with the corresponding STS haplotypes (<0.02% differences). About two-thirds of the differences were observed in or around homopolymeric sequence stretches. In addition, the sequence alignment algorithm employed to align NGS reads played a significant role in the analysis of the data and the resulting mtDNA haplotypes. Further development of alignment software would be desirable to facilitate the application of NGS in mtDNA forensic genetics. PMID:23948325

  15. Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family-specific impact on gene structure and genome organization.

    PubMed

    Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas

    2016-05-01

    Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  16. Scientific Goals of the Human Genome Project.

    ERIC Educational Resources Information Center

    Wills, Christopher

    1993-01-01

    The Human Genome Project, an effort to sequence all the DNA of a human cell, is needed to better understand the behavior of chromosomes during cell division, with the ultimate goal of understanding the specific genes contributing to specific diseases and disabilities. (MSE)

  17. [Tale nucleases--new tool for genome editing].

    PubMed

    Glazkova, D V; Shipulin, G A

    2014-01-01

    The ability to introduce targeted changes in the genome of living cells or entire organisms enables researchers to meet the challenges of basic life sciences, biotechnology and medicine. Knockdown of target genes in the zygotes gives the opportunity to investigate the functions of these genes in different organisms. Replacement of single nucleotide in the DNA sequence allows to correct mutations in genes and thus to cure hereditary diseases. Adding transgene to specific genomic.loci can be used in biotechnology for generation of organisms with certain properties or cell lines for biopharmaceutical production. Such manipulations of gene sequences in their natural chromosomal context became possible after the emergence of the technology called "genome editing". This technology is based on the induction of a double-strand break in a specific genomic target DNA using endonucleases that recognize the unique sequences in the genome and on subsequent recovery of DNA integrity through the use of cellular repair mechanisms. A necessary tool for the genome editing is a custom-designed endonuclease which is able to recognize selected sequences. The emergence of a new type of programmable endonucleases, which were constructed on the basis of bacterial proteins--TAL-effectors (Transcription activators like effector), has become an important stage in the development of technology and promoted wide spread of the genome editing. This article reviews the history of the discovery of TAL effectors and creation of TALE nucleases, and describes their advantages over zinc finger endonucleases that appeared earlier. A large section is devoted to description of genetic modifications that can be performed using the genome editing.

  18. Initial Genomics of the Human Nucleolus

    PubMed Central

    Németh, Attila; Conesa, Ana; Santoyo-Lopez, Javier; Medina, Ignacio; Montaner, David; Péterfia, Bálint; Solovei, Irina; Cremer, Thomas; Dopazo, Joaquin; Längst, Gernot

    2010-01-01

    We report for the first time the genomics of a nuclear compartment of the eukaryotic cell. 454 sequencing and microarray analysis revealed the pattern of nucleolus-associated chromatin domains (NADs) in the linear human genome and identified different gene families and certain satellite repeats as the major building blocks of NADs, which constitute about 4% of the genome. Bioinformatic evaluation showed that NAD–localized genes take part in specific biological processes, like the response to other organisms, odor perception, and tissue development. 3D FISH and immunofluorescence experiments illustrated the spatial distribution of NAD–specific chromatin within interphase nuclei and its alteration upon transcriptional changes. Altogether, our findings describe the nature of DNA sequences associated with the human nucleolus and provide insights into the function of the nucleolus in genome organization and establishment of nuclear architecture. PMID:20361057

  19. Chromosomal location and gene paucity of the male specific region on papaya Y chromosome.

    PubMed

    Yu, Qingyi; Hou, Shaobin; Hobza, Roman; Feltus, F Alex; Wang, Xiue; Jin, Weiwei; Skelton, Rachel L; Blas, Andrea; Lemke, Cornelia; Saw, Jimmy H; Moore, Paul H; Alam, Maqsudul; Jiang, Jiming; Paterson, Andrew H; Vyskot, Boris; Ming, Ray

    2007-08-01

    Sex chromosomes in flowering plants evolved recently and many of them remain homomorphic, including those in papaya. We investigated the chromosomal location of papaya's small male specific region of the hermaphrodite Y (Yh) chromosome (MSY) and its genomic features. We conducted chromosome fluorescence in situ hybridization mapping of Yh-specific bacterial artificial chromosomes (BACs) and placed the MSY near the centromere of the papaya Y chromosome. Then we sequenced five MSY BACs to examine the genomic features of this specialized region, which resulted in the largest collection of contiguous genomic DNA sequences of a Y chromosome in flowering plants. Extreme gene paucity was observed in the papaya MSY with no functional gene identified in 715 kb MSY sequences. A high density of retroelements and local sequence duplications were detected in the MSY that is suppressed for recombination. Location of the papaya MSY near the centromere might have provided recombination suppression and fostered paucity of genes in the male specific region of the Y chromosome. Our findings provide critical information for deciphering the sex chromosomes in papaya and reference information for comparative studies of other sex chromosomes in animals and plants.

  20. [A family of short retroposons (Squaml) from squamate reptiles (Reptilia: Squamata): structure, evolution and correlation with phylogeny].

    PubMed

    Kosushkin, S A; Borodulina, O R; Solov'eva, E N; Grechko, V V

    2008-01-01

    We have isolated and characterised sequences of a SINE family specific for squamate reptiles from a genome of lacertid lizard that we called Squam1. Copies are 360-390 bp in length and share a significant similarity with tRNA gene sequence on its 5'-end. This family was also detected by us in DNA of representatives of varanids, iguanids (anolis), gekkonids, and snakes. No signs of it were found in DNA of mammals, birds, amphibians, and crocodiles. Detailed analysis of primary structure of the retroposons obtained by us from genomic libraries or GenBank sequences was carried out. Most taxa possess 2-3 subfamilies of the SINE in their genomes with specific diagnostic features in their primary structure. Individual variability of copies in different families is about 85% and is just slightly lower on the genera level. Comparison of consensus sequences on family level reveals a high degree of structural similarity with a number of specific apomorphic features which makes it a useful marker of phylogeny for this group of reptiles. Snakes do not show specific affinity to varanids when compared to other lizards, as it was suggested earlier.

  1. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    PubMed Central

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Hubisz, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Zhang, Peili; Liu, Jing; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catharine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenée; Verduzco, Daniel; Clerc-Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2005-01-01

    We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each arm gene order has been extensively reshuffled, leading to a minimum of 921 syntenic blocks shared between the species. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila. PMID:15632085

  2. Complete genome sequence of Enterobacter sp. IIT-BT 08: A potential microbial strain for high rate hydrogen production.

    PubMed

    Khanna, Namita; Ghosh, Ananta Kumar; Huntemann, Marcel; Deshpande, Shweta; Han, James; Chen, Amy; Kyrpides, Nikos; Mavrommatis, Kostas; Szeto, Ernest; Markowitz, Victor; Ivanova, Natalia; Pagani, Ioanna; Pati, Amrita; Pitluck, Sam; Nolan, Matt; Woyke, Tanja; Teshima, Hazuki; Chertkov, Olga; Daligault, Hajnalka; Davenport, Karen; Gu, Wei; Munk, Christine; Zhang, Xiaojing; Bruce, David; Detter, Chris; Xu, Yan; Quintana, Beverly; Reitenga, Krista; Kunde, Yulia; Green, Lance; Erkkila, Tracy; Han, Cliff; Brambilla, Evelyne-Marie; Lang, Elke; Klenk, Hans-Peter; Goodwin, Lynne; Chain, Patrick; Das, Debabrata

    2013-12-20

    Enterobacter sp. IIT-BT 08 belongs to Phylum: Proteobacteria, Class: Gammaproteobacteria, Order: Enterobacteriales, Family: Enterobacteriaceae. The organism was isolated from the leaves of a local plant near the Kharagpur railway station, Kharagpur, West Bengal, India. It has been extensively studied for fermentative hydrogen production because of its high hydrogen yield. For further enhancement of hydrogen production by strain development, complete genome sequence analysis was carried out. Sequence analysis revealed that the genome was linear, 4.67 Mbp long and had a GC content of 56.01%. The genome properties encode 4,393 protein-coding and 179 RNA genes. Additionally, a putative pathway of hydrogen production was suggested based on the presence of formate hydrogen lyase complex and other related genes identified in the genome. Thus, in the present study we describe the specific properties of the organism and the generation, annotation and analysis of its genome sequence as well as discuss the putative pathway of hydrogen production by this organism.

  3. Comprehensive evaluation of non-hybrid genome assembly tools for third-generation PacBio long-read sequence data.

    PubMed

    Jayakumar, Vasanthan; Sakakibara, Yasubumi

    2017-11-03

    Long reads obtained from third-generation sequencing platforms can help overcome the long-standing challenge of the de novo assembly of sequences for the genomic analysis of non-model eukaryotic organisms. Numerous long-read-aided de novo assemblies have been published recently, which exhibited superior quality of the assembled genomes in comparison with those achieved using earlier second-generation sequencing technologies. Evaluating assemblies is important in guiding the appropriate choice for specific research needs. In this study, we evaluated 10 long-read assemblers using a variety of metrics on Pacific Biosciences (PacBio) data sets from different taxonomic categories with considerable differences in genome size. The results allowed us to narrow down the list to a few assemblers that can be effectively applied to eukaryotic assembly projects. Moreover, we highlight how best to use limited genomic resources for effectively evaluating the genome assemblies of non-model organisms. © The Author 2017. Published by Oxford University Press.

  4. Sequencing and characterizing the genome of Estrella lausannensis as an undergraduate project: training students and biological insights.

    PubMed

    Bertelli, Claire; Aeby, Sébastien; Chassot, Bérénice; Clulow, James; Hilfiker, Olivier; Rappo, Samuel; Ritzmann, Sébastien; Schumacher, Paolo; Terrettaz, Céline; Benaglio, Paola; Falquet, Laurent; Farinelli, Laurent; Gharib, Walid H; Goesmann, Alexander; Harshman, Keith; Linke, Burkhard; Miyazaki, Ryo; Rivolta, Carlo; Robinson-Rechavi, Marc; van der Meer, Jan Roelof; Greub, Gilbert

    2015-01-01

    With the widespread availability of high-throughput sequencing technologies, sequencing projects have become pervasive in the molecular life sciences. The huge bulk of data generated daily must be analyzed further by biologists with skills in bioinformatics and by "embedded bioinformaticians," i.e., bioinformaticians integrated in wet lab research groups. Thus, students interested in molecular life sciences must be trained in the main steps of genomics: sequencing, assembly, annotation and analysis. To reach that goal, a practical course has been set up for master students at the University of Lausanne: the "Sequence a genome" class. At the beginning of the academic year, a few bacterial species whose genome is unknown are provided to the students, who sequence and assemble the genome(s) and perform manual annotation. Here, we report the progress of the first class from September 2010 to June 2011 and the results obtained by seven master students who specifically assembled and annotated the genome of Estrella lausannensis, an obligate intracellular bacterium related to Chlamydia. The draft genome of Estrella is composed of 29 scaffolds encompassing 2,819,825 bp that encode for 2233 putative proteins. Estrella also possesses a 9136 bp plasmid that encodes for 14 genes, among which we found an integrase and a toxin/antitoxin module. Like all other members of the Chlamydiales order, Estrella possesses a highly conserved type III secretion system, considered as a key virulence factor. The annotation of the Estrella genome also allowed the characterization of the metabolic abilities of this strictly intracellular bacterium. Altogether, the students provided the scientific community with the Estrella genome sequence and a preliminary understanding of the biology of this recently-discovered bacterial genus, while learning to use cutting-edge technologies for sequencing and to perform bioinformatics analyses.

  5. Genome sequence and analysis of a stress-tolerant, wild-derived strain of Saccharomyces cerevisiae used in biofuels research

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McIlwain, Sean J.; Peris, Davis; Sardi, Maria

    The genome sequences of more than 100 strains of the yeast Saccharomyces cerevisiae have been published. Unfortunately, most of these genome assemblies contain dozens to hundreds of gaps at repetitive sequences, including transposable elements, tRNAs, and subtelomeric regions, which is where novel genes generally reside. Relatively few strains have been chosen for genome sequencing based on their biofuel production potential, leaving an additional knowledge gap. Here, we describe the nearly complete genome sequence of GLBRCY22-3 (Y22-3), a strain of S. cerevisiae derived from the stress-tolerant wild strain NRRL YB-210 and subsequently engineered for xylose metabolism. After benchmarking several genome assemblymore » approaches, we developed a pipeline to integrate Pacific Biosciences (PacBio) and Illumina sequencing data and achieved one of the highest quality genome assemblies for any S. cerevisiae strain. Specifically, the contig N50 is 693 kbp, and the sequences of most chromosomes, the mitochondrial genome, and the 2-micron plasmid are complete. Our annotation predicts 92 genes that are not present in the reference genome of the laboratory strain S288c, over 70% of which were expressed. We predicted functions for 43 of these genes, 28 of which were previously uncharacterized and unnamed. Remarkably, many of these genes are predicted to be involved in stress tolerance and carbon metabolism and are shared with a Brazilian bioethanol production strain, even though the strains differ dramatically at most genetic loci. Lastly, the Y22-3 genome sequence provides an exceptionally high-quality resource for basic and applied research in bioenergy and genetics.« less

  6. Genome sequence and analysis of a stress-tolerant, wild-derived strain of Saccharomyces cerevisiae used in biofuels research

    DOE PAGES

    McIlwain, Sean J.; Peris, Davis; Sardi, Maria; ...

    2016-04-20

    The genome sequences of more than 100 strains of the yeast Saccharomyces cerevisiae have been published. Unfortunately, most of these genome assemblies contain dozens to hundreds of gaps at repetitive sequences, including transposable elements, tRNAs, and subtelomeric regions, which is where novel genes generally reside. Relatively few strains have been chosen for genome sequencing based on their biofuel production potential, leaving an additional knowledge gap. Here, we describe the nearly complete genome sequence of GLBRCY22-3 (Y22-3), a strain of S. cerevisiae derived from the stress-tolerant wild strain NRRL YB-210 and subsequently engineered for xylose metabolism. After benchmarking several genome assemblymore » approaches, we developed a pipeline to integrate Pacific Biosciences (PacBio) and Illumina sequencing data and achieved one of the highest quality genome assemblies for any S. cerevisiae strain. Specifically, the contig N50 is 693 kbp, and the sequences of most chromosomes, the mitochondrial genome, and the 2-micron plasmid are complete. Our annotation predicts 92 genes that are not present in the reference genome of the laboratory strain S288c, over 70% of which were expressed. We predicted functions for 43 of these genes, 28 of which were previously uncharacterized and unnamed. Remarkably, many of these genes are predicted to be involved in stress tolerance and carbon metabolism and are shared with a Brazilian bioethanol production strain, even though the strains differ dramatically at most genetic loci. Lastly, the Y22-3 genome sequence provides an exceptionally high-quality resource for basic and applied research in bioenergy and genetics.« less

  7. Genome-Wide Identification of Regulatory Sequences Undergoing Accelerated Evolution in the Human Genome

    PubMed Central

    Dong, Xinran; Wang, Xiao; Zhang, Feng; Tian, Weidong

    2016-01-01

    Accelerated evolution of regulatory sequence can alter the expression pattern of target genes, and cause phenotypic changes. In this study, we used DNase I hypersensitive sites (DHSs) to annotate putative regulatory sequences in the human genome, and conducted a genome-wide analysis of the effects of accelerated evolution on regulatory sequences. Working under the assumption that local ancient repeat elements of DHSs are under neutral evolution, we discovered that ∼0.44% of DHSs are under accelerated evolution (ace-DHSs). We found that ace-DHSs tend to be more active than background DHSs, and are strongly associated with epigenetic marks of active transcription. The target genes of ace-DHSs are significantly enriched in neuron-related functions, and their expression levels are positively selected in the human brain. Thus, these lines of evidences strongly suggest that accelerated evolution on regulatory sequences plays important role in the evolution of human-specific phenotypes. PMID:27401230

  8. Emergence and Evolution of Hominidae-Specific Coding and Noncoding Genomic Sequences.

    PubMed

    Saber, Morteza Mahmoudi; Adeyemi Babarinde, Isaac; Hettiarachchi, Nilmini; Saitou, Naruya

    2016-07-12

    Family Hominidae, which includes humans and great apes, is recognized for unique complex social behavior and intellectual abilities. Despite the increasing genome data, however, the genomic origin of its phenotypic uniqueness has remained elusive. Clade-specific genes and highly conserved noncoding sequences (HCNSs) are among the high-potential evolutionary candidates involved in driving clade-specific characters and phenotypes. On this premise, we analyzed whole genome sequences along with gene orthology data retrieved from major DNA databases to find Hominidae-specific (HS) genes and HCNSs. We discovered that Down syndrome critical region 4 (DSCR4) is the only experimentally verified gene uniquely present in Hominidae. DSCR4 has no structural homology to any known protein and was inferred to have emerged in several steps through LTR/ERV1, LTR/ERVL retrotransposition, and transversion. Using the genomic distance as neutral evolution threshold, we identified 1,658 HS HCNSs. Polymorphism coverage and derived allele frequency analysis of HS HCNSs showed that these HCNSs are under purifying selection, indicating that they may harbor important functions. They are overrepresented in promoters/untranslated regions, in close proximity of genes involved in sensory perception of sound and developmental process, and also showed a significantly lower nucleosome occupancy probability. Interestingly, many ancestral sequences of the HS HCNSs showed very high evolutionary rates. This suggests that new functions emerged through some kind of positive selection, and then purifying selection started to operate to keep these functions. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. RSAT 2015: Regulatory Sequence Analysis Tools.

    PubMed

    Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques

    2015-07-01

    RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Comparison of simple sequence repeats in 19 Archaea.

    PubMed

    Trivedi, S

    2006-12-05

    All organisms that have been studied until now have been found to have differential distribution of simple sequence repeats (SSRs), with more SSRs in intergenic than in coding sequences. SSR distribution was investigated in Archaea genomes where complete chromosome sequences of 19 Archaea were analyzed with the program SPUTNIK to find di- to penta-nucleotide repeats. The number of repeats was determined for the complete chromosome sequences and for the coding and non-coding sequences. Different from what has been found for other groups of organisms, there is an abundance of SSRs in coding regions of the genome of some Archaea. Dinucleotide repeats were rare and CG repeats were found in only two Archaea. In general, trinucleotide repeats are the most abundant SSR motifs; however, pentanucleotide repeats are abundant in some Archaea. Some of the tetranucleotide and pentanucleotide repeat motifs are organism specific. In general, repeats are short and CG-rich repeats are present in Archaea having a CG-rich genome. Among the 19 Archaea, SSR density was not correlated with genome size or with optimum growth temperature. Pentanucleotide density had an inverse correlation with the CG content of the genome.

  11. Variation in the genomic locations and sequence conservation of STAR elements among staphylococcal species provides insight into DNA repeat evolution

    PubMed Central

    2012-01-01

    Background Staphylococcus aureus Repeat (STAR) elements are a type of interspersed intergenic direct repeat. In this study the conservation and variation in these elements was explored by bioinformatic analyses of published staphylococcal genome sequences and through sequencing of specific STAR element loci from a large set of S. aureus isolates. Results Using bioinformatic analyses, we found that the STAR elements were located in different genomic loci within each staphylococcal species. There was no correlation between the number of STAR elements in each genome and the evolutionary relatedness of staphylococcal species, however higher levels of repeats were observed in both S. aureus and S. lugdunensis compared to other staphylococcal species. Unexpectedly, sequencing of the internal spacer sequences of individual repeat elements from multiple isolates showed conservation at the sequence level within deep evolutionary lineages of S. aureus. Whilst individual STAR element loci were demonstrated to expand and contract, the sequences associated with each locus were stable and distinct from one another. Conclusions The high degree of lineage and locus-specific conservation of these intergenic repeat regions suggests that STAR elements are maintained due to selective or molecular forces with some of these elements having an important role in cell physiology. The high prevalence in two of the more virulent staphylococcal species is indicative of a potential role for STAR elements in pathogenesis. PMID:23020678

  12. High-Resolution Whole-Genome Sequencing Reveals That Specific Chromatin Domains from Most Human Chromosomes Associate with Nucleoli

    PubMed Central

    van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.

    2010-01-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608

  13. High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

    PubMed

    van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

    2010-11-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

  14. The Effects of Signal Erosion and Core Genome Reduction on the Identification of Diagnostic Markers

    PubMed Central

    Sahl, Jason W.; Vazquez, Adam J.; Hall, Carina M.; Busch, Joseph D.; Tuanyok, Apichai; Mayo, Mark; Schupp, James M.; Lummis, Madeline; Pearson, Talima; Shippy, Kenzie; Allender, Christopher J.; Theobald, Vanessa; Hutcheson, Alex; Korlach, Jonas; LiPuma, John J.; Ladner, Jason; Lovett, Sean; Koroleva, Galina; Palacios, Gustavo; Limmathurotsakul, Direk; Wuthiekanun, Vanaporn; Wongsuwan, Gumphol; Currie, Bart J.

    2016-01-01

    ABSTRACT Whole-genome sequence (WGS) data are commonly used to design diagnostic targets for the identification of bacterial pathogens. To do this effectively, genomics databases must be comprehensive to identify the strict core genome that is specific to the target pathogen. As additional genomes are analyzed, the core genome size is reduced and there is erosion of the target-specific regions due to commonality with related species, potentially resulting in the identification of false positives and/or false negatives. PMID:27651357

  15. Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

    PubMed

    Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

    2014-06-01

    It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

  16. Genome-Wide Prediction and Analysis of 3D-Domain Swapped Proteins in the Human Genome from Sequence Information.

    PubMed

    Upadhyay, Atul Kumar; Sowdhamini, Ramanathan

    2016-01-01

    3D-domain swapping is one of the mechanisms of protein oligomerization and the proteins exhibiting this phenomenon have many biological functions. These proteins, which undergo domain swapping, have acquired much attention owing to their involvement in human diseases, such as conformational diseases, amyloidosis, serpinopathies, proteionopathies etc. Early realisation of proteins in the whole human genome that retain tendency to domain swap will enable many aspects of disease control management. Predictive models were developed by using machine learning approaches with an average accuracy of 78% (85.6% of sensitivity, 87.5% of specificity and an MCC value of 0.72) to predict putative domain swapping in protein sequences. These models were applied to many complete genomes with special emphasis on the human genome. Nearly 44% of the protein sequences in the human genome were predicted positive for domain swapping. Enrichment analysis was performed on the positively predicted sequences from human genome for their domain distribution, disease association and functional importance based on Gene Ontology (GO). Enrichment analysis was also performed to infer a better understanding of the functional importance of these sequences. Finally, we developed hinge region prediction, in the given putative domain swapped sequence, by using important physicochemical properties of amino acids.

  17. Assembly of the Lactuca sativa, L. cv. Tizian draft genome sequence reveals differences within major resistance complex 1 as compared to the cv. Salinas reference genome.

    PubMed

    Verwaaijen, Bart; Wibberg, Daniel; Nelkner, Johanna; Gordin, Miriam; Rupp, Oliver; Winkler, Anika; Bremges, Andreas; Blom, Jochen; Grosch, Rita; Pühler, Alfred; Schlüter, Andreas

    2018-02-10

    Lettuce (Lactuca sativa, L.) is an important annual plant of the family Asteraceae (Compositae). The commercial lettuce cultivar Tizian has been used in various scientific studies investigating the interaction of the plant with phytopathogens or biological control agents. Here, we present the de novo draft genome sequencing and gene prediction for this specific cultivar derived from transcriptome sequence data. The assembled scaffolds amount to a size of 2.22 Gb. Based on RNAseq data, 31,112 transcript isoforms were identified. Functional predictions for these transcripts were determined within the GenDBE annotation platform. Comparison with the cv. Salinas reference genome revealed a high degree of sequence similarity on genome and transcriptome levels, with an average amino acid identity of 99%. Furthermore, it was observed that two large regions are either missing or are highly divergent within the cv. Tizian genome compared to cv. Salinas. One of these regions covers the major resistance complex 1 region of cv. Salinas. The cv. Tizian draft genome sequence provides a valuable resource for future functional and transcriptome analyses focused on this lettuce cultivar. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Assembly of highly repetitive genomes using short reads: the genome of discrete typing unit III Trypanosoma cruzi strain 231.

    PubMed

    Baptista, Rodrigo P; Reis-Cunha, Joao Luis; DeBarry, Jeremy D; Chiari, Egler; Kissinger, Jessica C; Bartholomeu, Daniella C; Macedo, Andrea M

    2018-02-14

    Next-generation sequencing (NGS) methods are low-cost high-throughput technologies that produce thousands to millions of sequence reads. Despite the high number of raw sequence reads, their short length, relative to Sanger, PacBio or Nanopore reads, complicates the assembly of genomic repeats. Many genome tools are available, but the assembly of highly repetitive genome sequences using only NGS short reads remains challenging. Genome assembly of organisms responsible for important neglected diseases such as Trypanosoma cruzi, the aetiological agent of Chagas disease, is known to be challenging because of their repetitive nature. Only three of six recognized discrete typing units (DTUs) of the parasite have their draft genomes published and therefore genome evolution analyses in the taxon are limited. In this study, we developed a computational workflow to assemble highly repetitive genomes via a combination of de novo and reference-based assembly strategies to better overcome the intrinsic limitations of each, based on Illumina reads. The highly repetitive genome of the human-infecting parasite T. cruzi 231 strain was used as a test subject. The combined-assembly approach shown in this study benefits from the reference-based assembly ability to resolve highly repetitive sequences and from the de novo capacity to assemble genome-specific regions, improving the quality of the assembly. The acceptable confidence obtained by analyzing our results showed that our combined approach is an attractive option to assemble highly repetitive genomes with NGS short reads. Phylogenomic analysis including the 231 strain, the first representative of DTU III whose genome was sequenced, was also performed and provides new insights into T. cruzi genome evolution.

  19. Correcting Inconsistencies and Errors in Bacterial Genome Metadata Using an Automated Curation Tool in Excel (AutoCurE).

    PubMed

    Schmedes, Sarah E; King, Jonathan L; Budowle, Bruce

    2015-01-01

    Whole-genome data are invaluable for large-scale comparative genomic studies. Current sequencing technologies have made it feasible to sequence entire bacterial genomes with relative ease and time with a substantially reduced cost per nucleotide, hence cost per genome. More than 3,000 bacterial genomes have been sequenced and are available at the finished status. Publically available genomes can be readily downloaded; however, there are challenges to verify the specific supporting data contained within the download and to identify errors and inconsistencies that may be present within the organizational data content and metadata. AutoCurE, an automated tool for bacterial genome database curation in Excel, was developed to facilitate local database curation of supporting data that accompany downloaded genomes from the National Center for Biotechnology Information. AutoCurE provides an automated approach to curate local genomic databases by flagging inconsistencies or errors by comparing the downloaded supporting data to the genome reports to verify genome name, RefSeq accession numbers, the presence of archaea, BioProject/UIDs, and sequence file descriptions. Flags are generated for nine metadata fields if there are inconsistencies between the downloaded genomes and genomes reports and if erroneous or missing data are evident. AutoCurE is an easy-to-use tool for local database curation for large-scale genome data prior to downstream analyses.

  20. CHALLENGES FOR IMPLEMENTING A PTSD PREVENTIVE GENOMIC SEQUENCING PROGRAM IN THE U.S. MILITARY

    PubMed Central

    Lázaro-Muñoz, Gabriel; Juengst, Eric T.

    2015-01-01

    There is growing interest in using the quickly developing field of genomics to contribute to military readiness and effectiveness. Specifically, influential military advisory panels have recommended that the U.S. military apply genomics to help treat, prevent, or minimize the risk for post-traumatic stress disorder (PTSD) among service members. This article highlights some important scientific, legal, and ethical challenges regarding the development and deployment of a preventive genomic sequencing (PGS) program to predict the risk of PTSD among military service members. PMID:26401056

  1. DCODE.ORG Anthology of Comparative Genomic Tools

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loots, G G; Ovcharenko, I

    2005-01-11

    Comparative genomics provides the means to demarcate functional regions in anonymous DNA sequences. The successful application of this method to identifying novel genes is currently shifting to deciphering the noncoding encryption of gene regulation across genomes. To facilitate the use of comparative genomics to practical applications in genetics and genomics we have developed several analytical and visualization tools for the analysis of arbitrary sequences and whole genomes. These tools include two alignment tools: zPicture and Mulan; a phylogenetic shadowing tool: eShadow for identifying lineage- and species-specific functional elements; two evolutionary conserved transcription factor analysis tools: rVista and multiTF; a toolmore » for extracting cis-regulatory modules governing the expression of co-regulated genes, CREME; and a dynamic portal to multiple vertebrate and invertebrate genome alignments, the ECR Browser. Here we briefly describe each one of these tools and provide specific examples on their practical applications. All the tools are publicly available at the http://www.dcode.org/ web site.« less

  2. Draft genome sequence of Halomonas lutea strain YIM 91125 T (DSM 23508 T) isolated from the alkaline Lake Ebinur in Northwest China

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei

    Species of the genus Halomonas are halophilic and their flexible adaption to changes of salinity and temperature brings considerable potential biotechnology applications, such as degradation of organic pollutants and enzyme production. The type strain Halomonas lutea YIM 91125 T was isolated from a hypersaline lake in China. The genome of strain YIM 91125 T becomes the twelfth species sequenced in Halomonas, and the thirteenth species sequenced in Halomonadaceae. We described the features of H. lutea YIM 91125 T, together with the high quality draft genome sequence and annotation of its type strain. The 4,533,090 bp long genome of strain YIMmore » 91125 T with its 4,284 protein-coding and 84 RNA genes is a part of Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG-I) project. From the viewpoint of comparative genomics, H. lutea has a larger genome size and more specific genes, which indicated acquisition of function bringing better adaption to its environment. Finally, DDH analysis demonstrated that H. lutea is a distinctive species, and halophilic features and nitrogen metabolism related genes were discovered in its genome.« less

  3. Draft genome sequence of Halomonas lutea strain YIM 91125 T (DSM 23508 T) isolated from the alkaline Lake Ebinur in Northwest China

    DOE PAGES

    Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; ...

    2015-01-20

    Species of the genus Halomonas are halophilic and their flexible adaption to changes of salinity and temperature brings considerable potential biotechnology applications, such as degradation of organic pollutants and enzyme production. The type strain Halomonas lutea YIM 91125 T was isolated from a hypersaline lake in China. The genome of strain YIM 91125 T becomes the twelfth species sequenced in Halomonas, and the thirteenth species sequenced in Halomonadaceae. We described the features of H. lutea YIM 91125 T, together with the high quality draft genome sequence and annotation of its type strain. The 4,533,090 bp long genome of strain YIMmore » 91125 T with its 4,284 protein-coding and 84 RNA genes is a part of Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG-I) project. From the viewpoint of comparative genomics, H. lutea has a larger genome size and more specific genes, which indicated acquisition of function bringing better adaption to its environment. Finally, DDH analysis demonstrated that H. lutea is a distinctive species, and halophilic features and nitrogen metabolism related genes were discovered in its genome.« less

  4. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus

    PubMed Central

    Scannell, Devin R.; Zill, Oliver A.; Rokas, Antonis; Payen, Celia; Dunham, Maitreya J.; Eisen, Michael B.; Rine, Jasper; Johnston, Mark; Hittinger, Chris Todd

    2011-01-01

    High-quality, well-annotated genome sequences and standardized laboratory strains fuel experimental and evolutionary research. We present improved genome sequences of three species of Saccharomyces sensu stricto yeasts: S. bayanus var. uvarum (CBS 7001), S. kudriavzevii (IFO 1802T and ZP 591), and S. mikatae (IFO 1815T), and describe their comparison to the genomes of S. cerevisiae and S. paradoxus. The new sequences, derived by assembling millions of short DNA sequence reads together with previously published Sanger shotgun reads, have vastly greater long-range continuity and far fewer gaps than the previously available genome sequences. New gene predictions defined a set of 5261 protein-coding orthologs across the five most commonly studied Saccharomyces yeasts, enabling a re-examination of the tempo and mode of yeast gene evolution and improved inferences of species-specific gains and losses. To facilitate experimental investigations, we generated genetically marked, stable haploid strains for all three of these Saccharomyces species. These nearly complete genome sequences and the collection of genetically marked strains provide a valuable toolset for comparative studies of gene function, metabolism, and evolution, and render Saccharomyces sensu stricto the most experimentally tractable model genus. These resources are freely available and accessible through www.SaccharomycesSensuStricto.org. PMID:22384314

  5. Comparison of taxon-specific versus general locus sets for targeted sequence capture in plant phylogenomics.

    PubMed

    Chau, John H; Rahfeldt, Wolfgang A; Olmstead, Richard G

    2018-03-01

    Targeted sequence capture can be used to efficiently gather sequence data for large numbers of loci, such as single-copy nuclear loci. Most published studies in plants have used taxon-specific locus sets developed individually for a clade using multiple genomic and transcriptomic resources. General locus sets can also be developed from loci that have been identified as single-copy and have orthologs in large clades of plants. We identify and compare a taxon-specific locus set and three general locus sets (conserved ortholog set [COSII], shared single-copy nuclear [APVO SSC] genes, and pentatricopeptide repeat [PPR] genes) for targeted sequence capture in Buddleja (Scrophulariaceae) and outgroups. We evaluate their performance in terms of assembly success, sequence variability, and resolution and support of inferred phylogenetic trees. The taxon-specific locus set had the most target loci. Assembly success was high for all locus sets in Buddleja samples. For outgroups, general locus sets had greater assembly success. Taxon-specific and PPR loci had the highest average variability. The taxon-specific data set produced the best-supported tree, but all data sets showed improved resolution over previous non-sequence capture data sets. General locus sets can be a useful source of sequence capture targets, especially if multiple genomic resources are not available for a taxon.

  6. Deep whole-genome sequencing of 90 Han Chinese genomes.

    PubMed

    Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

    2017-09-01

    Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency < 5%), including 5 813 503 single nucleotide polymorphisms, 1 169 199 InDels, and 17 927 structural variants. Using deep sequencing data, we have built a greatly expanded spectrum of genetic variation for the Han Chinese genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000 Genomes Project, as well as to other human genome projects. © The Authors 2017. Published by Oxford University Press.

  7. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.

    1998-12-22

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.

  8. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna

    1998-01-01

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.

  9. In silico Comparison of 19 Porphyromonas gingivalis Strains in Genomics, Phylogenetics, Phylogenomics and Functional Genomics.

    PubMed

    Chen, Tsute; Siddiqui, Huma; Olsen, Ingar

    2017-01-01

    Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica . All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/.

  10. In silico Comparison of 19 Porphyromonas gingivalis Strains in Genomics, Phylogenetics, Phylogenomics and Functional Genomics

    PubMed Central

    Chen, Tsute; Siddiqui, Huma; Olsen, Ingar

    2017-01-01

    Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica. All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/. PMID:28261563

  11. Barley whole exome capture: a tool for genomic research in the genus Hordeum and beyond

    PubMed Central

    Mascher, Martin; Richmond, Todd A; Gerhardt, Daniel J; Himmelbach, Axel; Clissold, Leah; Sampath, Dharanya; Ayling, Sarah; Steuernagel, Burkhard; Pfeifer, Matthias; D'Ascenzo, Mark; Akhunov, Eduard D; Hedley, Pete E; Gonzales, Ana M; Morrell, Peter L; Kilian, Benjamin; Blattner, Frank R; Scholz, Uwe; Mayer, Klaus FX; Flavell, Andrew J; Muehlbauer, Gary J; Waugh, Robbie; Jeddeloh, Jeffrey A; Stein, Nils

    2013-01-01

    Advanced resources for genome-assisted research in barley (Hordeum vulgare) including a whole-genome shotgun assembly and an integrated physical map have recently become available. These have made possible studies that aim to assess genetic diversity or to isolate single genes by whole-genome resequencing and in silico variant detection. However such an approach remains expensive given the 5 Gb size of the barley genome. Targeted sequencing of the mRNA-coding exome reduces barley genomic complexity more than 50-fold, thus dramatically reducing this heavy sequencing and analysis load. We have developed and employed an in-solution hybridization-based sequence capture platform to selectively enrich for a 61.6 megabase coding sequence target that includes predicted genes from the genome assembly of the cultivar Morex as well as publicly available full-length cDNAs and de novo assembled RNA-Seq consensus sequence contigs. The platform provides a highly specific capture with substantial and reproducible enrichment of targeted exons, both for cultivated barley and related species. We show that this exome capture platform provides a clear path towards a broader and deeper understanding of the natural variation residing in the mRNA-coding part of the barley genome and will thus constitute a valuable resource for applications such as mapping-by-sequencing and genetic diversity analyzes. PMID:23889683

  12. A new age in functional genomics using CRISPR/Cas9 in arrayed library screening.

    PubMed

    Agrotis, Alexander; Ketteler, Robin

    2015-01-01

    CRISPR technology has rapidly changed the face of biological research, such that precise genome editing has now become routine for many labs within several years of its initial development. What makes CRISPR/Cas9 so revolutionary is the ability to target a protein (Cas9) to an exact genomic locus, through designing a specific short complementary nucleotide sequence, that together with a common scaffold sequence, constitute the guide RNA bridging the protein and the DNA. Wild-type Cas9 cleaves both DNA strands at its target sequence, but this protein can also be modified to exert many other functions. For instance, by attaching an activation domain to catalytically inactive Cas9 and targeting a promoter region, it is possible to stimulate the expression of a specific endogenous gene. In principle, any genomic region can be targeted, and recent efforts have successfully generated pooled guide RNA libraries for coding and regulatory regions of human, mouse and Drosophila genomes with high coverage, thus facilitating functional phenotypic screening. In this review, we will highlight recent developments in the area of CRISPR-based functional genomics and discuss potential future directions, with a special focus on mammalian cell systems and arrayed library screening.

  13. A high-throughput Sanger strategy for human mitochondrial genome sequencing

    PubMed Central

    2013-01-01

    Background A population reference database of complete human mitochondrial genome (mtGenome) sequences is needed to enable the use of mitochondrial DNA (mtDNA) coding region data in forensic casework applications. However, the development of entire mtGenome haplotypes to forensic data quality standards is difficult and laborious. A Sanger-based amplification and sequencing strategy that is designed for automated processing, yet routinely produces high quality sequences, is needed to facilitate high-volume production of these mtGenome data sets. Results We developed a robust 8-amplicon Sanger sequencing strategy that regularly produces complete, forensic-quality mtGenome haplotypes in the first pass of data generation. The protocol works equally well on samples representing diverse mtDNA haplogroups and DNA input quantities ranging from 50 pg to 1 ng, and can be applied to specimens of varying DNA quality. The complete workflow was specifically designed for implementation on robotic instrumentation, which increases throughput and reduces both the opportunities for error inherent to manual processing and the cost of generating full mtGenome sequences. Conclusions The described strategy will assist efforts to generate complete mtGenome haplotypes which meet the highest data quality expectations for forensic genetic and other applications. Additionally, high-quality data produced using this protocol can be used to assess mtDNA data developed using newer technologies and chemistries. Further, the amplification strategy can be used to enrich for mtDNA as a first step in sample preparation for targeted next-generation sequencing. PMID:24341507

  14. Highly Iterated Palindromic Sequences (HIPs) and Their Relationship to DNA Methyltransferases

    PubMed Central

    Elhai, Jeff

    2015-01-01

    The sequence GCGATCGC (Highly Iterated Palindrome, HIP1) is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences. PMID:25789551

  15. Highly Iterated Palindromic Sequences (HIPs) and Their Relationship to DNA Methyltransferases.

    PubMed

    Elhai, Jeff

    2015-03-17

    The sequence GCGATCGC (Highly Iterated Palindrome, HIP1) is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences.

  16. Establishing gene models from the Pinus pinaster genome using gene capture and BAC sequencing.

    PubMed

    Seoane-Zonjic, Pedro; Cañas, Rafael A; Bautista, Rocío; Gómez-Maldonado, Josefa; Arrillaga, Isabel; Fernández-Pozo, Noé; Claros, M Gonzalo; Cánovas, Francisco M; Ávila, Concepción

    2016-02-27

    In the era of DNA throughput sequencing, assembling and understanding gymnosperm mega-genomes remains a challenge. Although drafts of three conifer genomes have recently been published, this number is too low to understand the full complexity of conifer genomes. Using techniques focused on specific genes, gene models can be established that can aid in the assembly of gene-rich regions, and this information can be used to compare genomes and understand functional evolution. In this study, gene capture technology combined with BAC isolation and sequencing was used as an experimental approach to establish de novo gene structures without a reference genome. Probes were designed for 866 maritime pine transcripts to sequence genes captured from genomic DNA. The gene models were constructed using GeneAssembler, a new bioinformatic pipeline, which reconstructed over 82% of the gene structures, and a high proportion (85%) of the captured gene models contained sequences from the promoter regulatory region. In a parallel experiment, the P. pinaster BAC library was screened to isolate clones containing genes whose cDNA sequence were already available. BAC clones containing the asparagine synthetase, sucrose synthase and xyloglucan endotransglycosylase gene sequences were isolated and used in this study. The gene models derived from the gene capture approach were compared with the genomic sequences derived from the BAC clones. This combined approach is a particularly efficient way to capture the genomic structures of gene families with a small number of members. The experimental approach used in this study is a valuable combined technique to study genomic gene structures in species for which a reference genome is unavailable. It can be used to establish exon/intron boundaries in unknown gene structures, to reconstruct incomplete genes and to obtain promoter sequences that can be used for transcriptional studies. A bioinformatics algorithm (GeneAssembler) is also provided as a Ruby gem for this class of analyses.

  17. Analysis of Epstein-Barr Virus Genomes and Expression Profiles in Gastric Adenocarcinoma.

    PubMed

    Borozan, Ivan; Zapatka, Marc; Frappier, Lori; Ferretti, Vincent

    2018-01-15

    Epstein-Barr virus (EBV) is a causative agent of a variety of lymphomas, nasopharyngeal carcinoma (NPC), and ∼9% of gastric carcinomas (GCs). An important question is whether particular EBV variants are more oncogenic than others, but conclusions are currently hampered by the lack of sequenced EBV genomes. Here, we contribute to this question by mining whole-genome sequences of 201 GCs to identify 13 EBV-positive GCs and by assembling 13 new EBV genome sequences, almost doubling the number of available GC-derived EBV genome sequences and providing the first non-Asian EBV genome sequences from GC. Whole-genome sequence comparisons of all EBV isolates sequenced to date (85 from tumors and 57 from healthy individuals) showed that most GC and NPC EBV isolates were closely related although American Caucasian GC samples were more distant, suggesting a geographical component. However, EBV GC isolates were found to contain some consistent changes in protein sequences regardless of geographical origin. In addition, transcriptome data available for eight of the EBV-positive GCs were analyzed to determine which EBV genes are expressed in GC. In addition to the expected latency proteins (EBNA1, LMP1, and LMP2A), specific subsets of lytic genes were consistently expressed that did not reflect a typical lytic or abortive lytic infection, suggesting a novel mechanism of EBV gene regulation in the context of GC. These results are consistent with a model in which a combination of specific latent and lytic EBV proteins promotes tumorigenesis. IMPORTANCE Epstein-Barr virus (EBV) is a widespread virus that causes cancer, including gastric carcinoma (GC), in a small subset of individuals. An important question is whether particular EBV variants are more cancer associated than others, but more EBV sequences are required to address this question. Here, we have generated 13 new EBV genome sequences from GC, almost doubling the number of EBV sequences from GC isolates and providing the first EBV sequences from non-Asian GC. We further identify sequence changes in some EBV proteins common to GC isolates. In addition, gene expression analysis of eight of the EBV-positive GCs showed consistent expression of both the expected latency proteins and a subset of lytic proteins that was not consistent with typical lytic or abortive lytic expression. These results suggest that novel mechanisms activate expression of some EBV lytic proteins and that their expression may contribute to oncogenesis. Copyright © 2018 American Society for Microbiology.

  18. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.

    PubMed

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Structure, sequence and expression of the hepatitis delta (δ) viral genome

    NASA Astrophysics Data System (ADS)

    Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael

    1986-10-01

    Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.

  20. The scope and strength of sex-specific selection in genome evolution.

    PubMed

    Wright, A E; Mank, J E

    2013-09-01

    Males and females share the vast majority of their genomes and yet are often subject to different, even conflicting, selection. Genomic and transcriptomic developments have made it possible to assess sex-specific selection at the molecular level, and it is clear that sex-specific selection shapes the evolutionary properties of several genomic characteristics, including transcription, post-transcriptional regulation, imprinting, genome structure and gene sequence. Sex-specific selection is strongly influenced by mating system, which also causes neutral evolutionary changes that affect different regions of the genome in different ways. Here, we synthesize theoretical and molecular work in order to provide a cohesive view of the role of sex-specific selection and mating system in genome evolution. We also highlight the need for a combined approach, incorporating both genomic data and experimental phenotypic studies, in order to understand precisely how sex-specific selection drives evolutionary change across the genome. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.

  1. Multiple genome sequences reveal adaptations of a phototrophic bacterium to sediment microenvironments.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oda, Yasuhiro; Larimer, Frank W; Chain, Patrick S. G.

    The bacterial genus Rhodopseudomonas is comprised of photosynthetic bacteria found widely distributed in aquatic sediments. Members of the genus catalyze hydrogen gas production, carbon dioxide sequestration, and biomass turnover. The genome sequence of Rhodopseudomonas palustris CGA009 revealed a surprising richness of metabolic versatility that would seem to explain its ability to live in a heterogeneous environment like sediment. However, there is considerable genotypic diversity among Rhodopseudomonas isolates. Here we report the complete genome sequences of four additional members of the genus isolated from a restricted geographical area. The sequences confirm that the isolates belong to a coherent taxonomic unit, butmore » they also have significant differences. Whole genome alignments show that the circular chromosomes of the isolates consist of a collinear backbone with a moderate number of genomic rearrangements that impact local gene order and orientation. There are 3,319 genes, 70% of the genes in each genome, shared by four or more strains. Between 10% and 18% of the genes in each genome are strain specific. Some of these genes suggest specialized physiological traits, which we verified experimentally, that include expanded light harvesting, oxygen respiration, and nitrogen fixation capabilities, as well as anaerobic fermentation. Strain-specific adaptations include traits that may be useful in bioenergy applications. This work suggests that against a backdrop of metabolic versatility that is a defining characteristic of Rhodopseudomonas, different ecotypes have evolved to take advantage of physical and chemical conditions in sediment microenvironments that are too small for human observation.« less

  2. Centromere reference models for human chromosomes X and Y satellite arrays

    PubMed Central

    Miga, Karen H.; Newton, Yulia; Jain, Miten; Altemose, Nicolas; Willard, Huntington F.; Kent, W. James

    2014-01-01

    The human genome sequence remains incomplete, with multimegabase-sized gaps representing the endogenous centromeres and other heterochromatic regions. Available sequence-based studies within these sites in the genome have demonstrated a role in centromere function and chromosome pairing, necessary to ensure proper chromosome segregation during cell division. A common genomic feature of these regions is the enrichment of long arrays of near-identical tandem repeats, known as satellite DNAs, which offer a limited number of variant sites to differentiate individual repeat copies across millions of bases. This substantial sequence homogeneity challenges available assembly strategies and, as a result, centromeric regions are omitted from ongoing genomic studies. To address this problem, we utilize monomer sequence and ordering information obtained from whole-genome shotgun reads to model two haploid human satellite arrays on chromosomes X and Y, resulting in an initial characterization of 3.83 Mb of centromeric DNA within an individual genome. To further expand the utility of each centromeric reference sequence model, we evaluate sites within the arrays for short-read mappability and chromosome specificity. Because satellite DNAs evolve in a concerted manner, we use these centromeric assemblies to assess the extent of sequence variation among 366 individuals from distinct human populations. We thus identify two satellite array variants in both X and Y centromeres, as determined by array length and sequence composition. This study provides an initial sequence characterization of a regional centromere and establishes a foundation to extend genomic characterization to these sites as well as to other repeat-rich regions within complex genomes. PMID:24501022

  3. A 'new lease of life': FnCpf1 possesses DNA cleavage activity for genome editing in human cells.

    PubMed

    Tu, Mengjun; Lin, Li; Cheng, Yilu; He, Xiubin; Sun, Huihui; Xie, Haihua; Fu, Junhao; Liu, Changbao; Li, Jin; Chen, Ding; Xi, Haitao; Xue, Dongyu; Liu, Qi; Zhao, Junzhao; Gao, Caixia; Song, Zongming; Qu, Jia; Gu, Feng

    2017-11-02

    Cpf1 nucleases were recently reported to be highly specific and programmable nucleases with efficiencies comparable to those of SpCas9. AsCpf1 and LbCpf1 require a single crRNA and recognize a 5'-TTTN-3' protospacer adjacent motif (PAM) at the 5' end of the protospacer for genome editing. For widespread application in precision site-specific human genome editing, the range of sequences that AsCpf1 and LbCpf1 can recognize is limited due to the size of this PAM. To address this limitation, we sought to identify a novel Cpf1 nuclease with simpler PAM requirements. Specifically, here we sought to test and engineer FnCpf1, one reported Cpf1 nuclease (FnCpf1) only requires 5'-TTN-3' as a PAM but does not exhibit detectable levels of nuclease-induced indels at certain locus in human cells. Surprisingly, we found that FnCpf1 possesses DNA cleavage activity in human cells at multiple loci. We also comprehensively and quantitatively examined various FnCpf1 parameters in human cells, including spacer sequence, direct repeat sequence and the PAM sequence. Our study identifies FnCpf1 as a new member of the Cpf1 family for human genome editing with distinctive characteristics, which shows promise as a genome editing tool with the potential for both research and therapeutic applications. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. A ‘new lease of life’: FnCpf1 possesses DNA cleavage activity for genome editing in human cells

    PubMed Central

    Tu, Mengjun; Lin, Li; Cheng, Yilu; He, Xiubin; Sun, Huihui; Xie, Haihua; Fu, Junhao; Liu, Changbao; Li, Jin; Chen, Ding; Xi, Haitao; Xue, Dongyu; Liu, Qi; Zhao, Junzhao; Gao, Caixia; Song, Zongming; Qu, Jia

    2017-01-01

    Abstract Cpf1 nucleases were recently reported to be highly specific and programmable nucleases with efficiencies comparable to those of SpCas9. AsCpf1 and LbCpf1 require a single crRNA and recognize a 5′-TTTN-3′ protospacer adjacent motif (PAM) at the 5′ end of the protospacer for genome editing. For widespread application in precision site-specific human genome editing, the range of sequences that AsCpf1 and LbCpf1 can recognize is limited due to the size of this PAM. To address this limitation, we sought to identify a novel Cpf1 nuclease with simpler PAM requirements. Specifically, here we sought to test and engineer FnCpf1, one reported Cpf1 nuclease (FnCpf1) only requires 5′-TTN-3′ as a PAM but does not exhibit detectable levels of nuclease-induced indels at certain locus in human cells. Surprisingly, we found that FnCpf1 possesses DNA cleavage activity in human cells at multiple loci. We also comprehensively and quantitatively examined various FnCpf1 parameters in human cells, including spacer sequence, direct repeat sequence and the PAM sequence. Our study identifies FnCpf1 as a new member of the Cpf1 family for human genome editing with distinctive characteristics, which shows promise as a genome editing tool with the potential for both research and therapeutic applications. PMID:28977650

  5. Discriminative prediction of mammalian enhancers from DNA sequence

    PubMed Central

    Lee, Dongwon; Karchin, Rachel; Beer, Michael A.

    2011-01-01

    Accurately predicting regulatory sequences and enhancers in entire genomes is an important but difficult problem, especially in large vertebrate genomes. With the advent of ChIP-seq technology, experimental detection of genome-wide EP300/CREBBP bound regions provides a powerful platform to develop predictive tools for regulatory sequences and to study their sequence properties. Here, we develop a support vector machine (SVM) framework which can accurately identify EP300-bound enhancers using only genomic sequence and an unbiased set of general sequence features. Moreover, we find that the predictive sequence features identified by the SVM classifier reveal biologically relevant sequence elements enriched in the enhancers, but we also identify other features that are significantly depleted in enhancers. The predictive sequence features are evolutionarily conserved and spatially clustered, providing further support of their functional significance. Although our SVM is trained on experimental data, we also predict novel enhancers and show that these putative enhancers are significantly enriched in both ChIP-seq signal and DNase I hypersensitivity signal in the mouse brain and are located near relevant genes. Finally, we present results of comparisons between other EP300/CREBBP data sets using our SVM and uncover sequence elements enriched and/or depleted in the different classes of enhancers. Many of these sequence features play a role in specifying tissue-specific or developmental-stage-specific enhancer activity, but our results indicate that some features operate in a general or tissue-independent manner. In addition to providing a high confidence list of enhancer targets for subsequent experimental investigation, these results contribute to our understanding of the general sequence structure of vertebrate enhancers. PMID:21875935

  6. Comparative genomics of Lactobacillus

    PubMed Central

    Kant, Ravi; Blom, Jochen; Palva, Airi; Siezen, Roland J.; de Vos, Willem M.

    2011-01-01

    Summary The genus Lactobacillus includes a diverse group of bacteria consisting of many species that are associated with fermentations of plants, meat or milk. In addition, various lactobacilli are natural inhabitants of the intestinal tract of humans and other animals. Finally, several Lactobacillus strains are marketed as probiotics as their consumption can confer a health benefit to host. Presently, 154 Lactobacillus species are known and a growing fraction of these are subject to draft genome sequencing. However, complete genome sequences are needed to provide a platform for detailed genomic comparisons. Therefore, we selected a total of 20 genomes of various Lactobacillus strains for which complete genomic sequences have been reported. These genomes had sizes varying from 1.8 to 3.3 Mb and other characteristic features, such as G+C content that ranged from 33% to 51%. The Lactobacillus pan genome was found to consist of approximately 14 000 protein‐encoding genes while all 20 genomes shared a total of 383 sets of orthologous genes that defined the Lactobacillus core genome (LCG). Based on advanced phylogeny of the proteins encoded by this LCG, we grouped the 20 strains into three main groups and defined core group genes present in all genomes of a single group, signature group genes shared in all genomes of one group but absent in all other Lactobacillus genomes, and Group‐specific ORFans present in core group genes of one group and absent in all other complete genomes. The latter are of specific value in defining the different groups of genomes. The study provides a platform for present individual comparisons as well as future analysis of new Lactobacillus genomes. PMID:21375712

  7. Recruiting Human Microbiome Shotgun Data to Site-Specific Reference Genomes

    PubMed Central

    Xie, Gary; Lo, Chien-Chi; Scholz, Matthew; Chain, Patrick S. G.

    2014-01-01

    The human body consists of innumerable multifaceted environments that predispose colonization by a number of distinct microbial communities, which play fundamental roles in human health and disease. In addition to community surveys and shotgun metagenomes that seek to explore the composition and diversity of these microbiomes, there are significant efforts to sequence reference microbial genomes from many body sites of healthy adults. To illustrate the utility of reference genomes when studying more complex metagenomes, we present a reference-based analysis of sequence reads generated from 55 shotgun metagenomes, selected from 5 major body sites, including 16 sub-sites. Interestingly, between 13% and 92% (62.3% average) of these shotgun reads were aligned to a then-complete list of 2780 reference genomes, including 1583 references for the human microbiome. However, no reference genome was universally found in all body sites. For any given metagenome, the body site-specific reference genomes, derived from the same body site as the sample, accounted for an average of 58.8% of the mapped reads. While different body sites did differ in abundant genera, proximal or symmetrical body sites were found to be most similar to one another. The extent of variation observed, both between individuals sampled within the same microenvironment, or at the same site within the same individual over time, calls into question comparative studies across individuals even if sampled at the same body site. This study illustrates the high utility of reference genomes and the need for further site-specific reference microbial genome sequencing, even within the already well-sampled human microbiome. PMID:24454771

  8. Discovery of common sequences absent in the human reference genome using pooled samples from next generation sequencing.

    PubMed

    Liu, Yu; Koyutürk, Mehmet; Maxwell, Sean; Xiang, Min; Veigl, Martina; Cooper, Richard S; Tayo, Bamidele O; Li, Li; LaFramboise, Thomas; Wang, Zhenghe; Zhu, Xiaofeng; Chance, Mark R

    2014-08-16

    Sequences up to several megabases in length have been found to be present in individual genomes but absent in the human reference genome. These sequences may be common in populations, and their absence in the reference genome may indicate rare variants in the genomes of individuals who served as donors for the human genome project. As the reference genome is used in probe design for microarray technology and mapping short reads in next generation sequencing (NGS), this missing sequence could be a source of bias in functional genomic studies and variant analysis. One End Anchor (OEA) and/or orphan reads from paired-end sequencing have been used to identify novel sequences that are absent in reference genome. However, there is no study to investigate the distribution, evolution and functionality of those sequences in human populations. To systematically identify and study the missing common sequences (micSeqs), we extended the previous method by pooling OEA reads from large number of individuals and applying strict filtering methods to remove false sequences. The pipeline was applied to data from phase 1 of the 1000 Genomes Project. We identified 309 micSeqs that are present in at least 1% of the human population, but absent in the reference genome. We confirmed 76% of these 309 micSeqs by comparison to other primate genomes, individual human genomes, and gene expression data. Furthermore, we randomly selected fifteen micSeqs and confirmed their presence using PCR validation in 38 additional individuals. Functional analysis using published RNA-seq and ChIP-seq data showed that eleven micSeqs are highly expressed in human brain and three micSeqs contain transcription factor (TF) binding regions, suggesting they are functional elements. In addition, the identified micSeqs are absent in non-primates and show dynamic acquisition during primate evolution culminating with most micSeqs being present in Africans, suggesting some micSeqs may be important sources of human diversity. 76% of micSeqs were confirmed by a comparative genomics approach. Fourteen micSeqs are expressed in human brain or contain TF binding regions. Some micSeqs are primate-specific, conserved and may play a role in the evolution of primates.

  9. Initial description of primate-specific cystine-knot Prometheus genes and differential gene expansions of D-dopachrome tautomerase genes

    PubMed Central

    Premzl, Marko

    2015-01-01

    Using eutherian comparative genomic analysis protocol and public genomic sequence data sets, the present work attempted to update and revise two gene data sets. The most comprehensive third party annotation gene data sets of eutherian adenohypophysis cystine-knot genes (128 complete coding sequences), and d-dopachrome tautomerases and macrophage migration inhibitory factor genes (30 complete coding sequences) were annotated. For example, the present study first described primate-specific cystine-knot Prometheus genes, as well as differential gene expansions of D-dopachrome tautomerase genes. Furthermore, new frameworks of future experiments of two eutherian gene data sets were proposed. PMID:25941635

  10. The spectrum of genomic signatures: from dinucleotides to chaos game representation.

    PubMed

    Wang, Yingwei; Hill, Kathleen; Singh, Shiva; Kari, Lila

    2005-02-14

    In the post genomic era, access to complete genome sequence data for numerous diverse species has opened multiple avenues for examining and comparing primary DNA sequence organization of entire genomes. Previously, the concept of a genomic signature was introduced with the observation of species-type specific Dinucleotide Relative Abundance Profiles (DRAPs); dinucleotides were identified as the subsequences with the greatest bias in representation in a majority of genomes. Herein, we demonstrate that DRAP is one particular genomic signature contained within a broader spectrum of signatures. Within this spectrum, an alternative genomic signature, Chaos Game Representation (CGR), provides a unique visualization of patterns in sequence organization. A genomic signature is associated with a particular integer order or subsequence length that represents a measure of the resolution or granularity in the analysis of primary DNA sequence organization. We quantitatively explore the organizational information provided by genomic signatures of different orders through different distance measures, including a novel Image Distance. The Image Distance and other existing distance measures are evaluated by comparing the phylogenetic trees they generate for 26 complete mitochondrial genomes from a diversity of species. The phylogenetic tree generated by the Image Distance is compatible with the known relatedness of species. Quantitative evaluation of the spectrum of genomic signatures may be used to ultimately gain insight into the determinants and biological relevance of the genome signatures.

  11. Minke whale genome and aquatic adaptation in cetaceans

    PubMed Central

    Yim, Hyung-Soon; Cho, Yun Sung; Guang, Xuanmin; Kang, Sung Gyun; Jeong, Jae-Yeon; Cha, Sun-Shin; Oh, Hyun-Myung; Lee, Jae-Hak; Yang, Eun Chan; Kwon, Kae Kyoung; Kim, Yun Jae; Kim, Tae Wan; Kim, Wonduck; Jeon, Jeong Ho; Kim, Sang-Jin; Choi, Dong Han; Jho, Sungwoong; Kim, Hak-Min; Ko, Junsu; Kim, Hyunmin; Shin, Young-Ah; Jung, Hyun-Ju; Zheng, Yuan; Wang, Zhuo; Chen, Yan

    2014-01-01

    The shift from terrestrial to aquatic life by whales was a substantial evolutionary event. Here we report the whole-genome sequencing and de novo assembly of the minke whale genome, as well as the whole-genome sequences of three minke whales, a fin whale, a bottlenose dolphin and a finless porpoise. Our comparative genomic analysis identified an expansion in the whale lineage of gene families associated with stress-responsive proteins and anaerobic metabolism, whereas gene families related to body hair and sensory receptors were contracted. Our analysis also identified whale-specific mutations in genes encoding antioxidants and enzymes controlling blood pressure and salt concentration. Overall the whale-genome sequences exhibited distinct features that are associated with the physiological and morphological changes needed for life in an aquatic environment, marked by resistance to physiological stresses caused by a lack of oxygen, increased amounts of reactive oxygen species and high salt levels. PMID:24270359

  12. Minke whale genome and aquatic adaptation in cetaceans.

    PubMed

    Yim, Hyung-Soon; Cho, Yun Sung; Guang, Xuanmin; Kang, Sung Gyun; Jeong, Jae-Yeon; Cha, Sun-Shin; Oh, Hyun-Myung; Lee, Jae-Hak; Yang, Eun Chan; Kwon, Kae Kyoung; Kim, Yun Jae; Kim, Tae Wan; Kim, Wonduck; Jeon, Jeong Ho; Kim, Sang-Jin; Choi, Dong Han; Jho, Sungwoong; Kim, Hak-Min; Ko, Junsu; Kim, Hyunmin; Shin, Young-Ah; Jung, Hyun-Ju; Zheng, Yuan; Wang, Zhuo; Chen, Yan; Chen, Ming; Jiang, Awei; Li, Erli; Zhang, Shu; Hou, Haolong; Kim, Tae Hyung; Yu, Lili; Liu, Sha; Ahn, Kung; Cooper, Jesse; Park, Sin-Gi; Hong, Chang Pyo; Jin, Wook; Kim, Heui-Soo; Park, Chankyu; Lee, Kyooyeol; Chun, Sung; Morin, Phillip A; O'Brien, Stephen J; Lee, Hang; Kimura, Jumpei; Moon, Dae Yeon; Manica, Andrea; Edwards, Jeremy; Kim, Byung Chul; Kim, Sangsoo; Wang, Jun; Bhak, Jong; Lee, Hyun Sook; Lee, Jung-Hyun

    2014-01-01

    The shift from terrestrial to aquatic life by whales was a substantial evolutionary event. Here we report the whole-genome sequencing and de novo assembly of the minke whale genome, as well as the whole-genome sequences of three minke whales, a fin whale, a bottlenose dolphin and a finless porpoise. Our comparative genomic analysis identified an expansion in the whale lineage of gene families associated with stress-responsive proteins and anaerobic metabolism, whereas gene families related to body hair and sensory receptors were contracted. Our analysis also identified whale-specific mutations in genes encoding antioxidants and enzymes controlling blood pressure and salt concentration. Overall the whale-genome sequences exhibited distinct features that are associated with the physiological and morphological changes needed for life in an aquatic environment, marked by resistance to physiological stresses caused by a lack of oxygen, increased amounts of reactive oxygen species and high salt levels.

  13. Gene conversion events and variable degree of homogenization of rDNA loci in cultivars of Brassica napus

    PubMed Central

    Sochorová, Jana; Coriton, Olivier; Kuderová, Alena; Lunerová, Jana; Chèvre, Anne-Marie; Kovařík, Aleš

    2017-01-01

    Background and aims Brassica napus (AACC, 2n = 38, oilseed rape) is a relatively recent allotetraploid species derived from the putative progenitor diploid species Brassica rapa (AA, 2n = 20) and Brassica oleracea (CC, 2n = 18). To determine the influence of intensive breeding conditions on the evolution of its genome, we analysed structure and copy number of rDNA in 21 cultivars of B. napus, representative of genetic diversity. Methods We used next-generation sequencing genomic approaches, Southern blot hybridization, expression analysis and fluorescence in situ hybridization (FISH). Subgenome-specific sequences derived from rDNA intergenic spacers (IGS) were used as probes for identification of loci composition on chromosomes. Key Results Most B. napus cultivars (18/21, 86 %) had more A-genome than C-genome rDNA copies. Three cultivars analysed by FISH (‘Darmor’, ‘Yudal’ and ‘Asparagus kale’) harboured the same number (12 per diploid set) of loci. In B. napus ‘Darmor’, the A-genome-specific rDNA probe hybridized to all 12 rDNA loci (eight on the A-genome and four on the C-genome) while the C-genome-specific probe showed weak signals on the C-genome loci only. Deep sequencing revealed high homogeneity of arrays suggesting that the C-genome genes were largely overwritten by the A-genome variants in B. napus ‘Darmor’. In contrast, B. napus ‘Yudal’ showed a lack of gene conversion evidenced by additive inheritance of progenitor rDNA variants and highly localized hybridization signals of subgenome-specific probes on chromosomes. Brassica napus ‘Asparagus kale’ showed an intermediate pattern to ‘Darmor’ and ‘Yudal’. At the expression level, most cultivars (95 %) exhibited stable A-genome nucleolar dominance while one cultivar (‘Norin 9’) showed co-dominance. Conclusions The B. napus cultivars differ in the degree and direction of rDNA homogenization. The prevalent direction of gene conversion (towards the A-genome) correlates with the direction of expression dominance indicating that gene activity may be needed for interlocus gene conversion. PMID:27707747

  14. A robust and cost-effective approach to sequence and analyze complete genomes of small RNA viruses

    USDA-ARS?s Scientific Manuscript database

    Background: Next-generation sequencing (NGS) allows ultra-deep sequencing of nucleic acids. The use of sequence-independent amplification of viral nucleic acids without utilization of target-specific primers provides advantages over traditional sequencing methods and allows detection of unsuspected ...

  15. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

    PubMed

    Hazkani-Covo, Einat; Martin, William F

    2017-05-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Whole genome sequencing analyses of Listeria monocytogenes that persisted in a milkshake machine for a year and caused illnesses in Washington State.

    PubMed

    Li, Zhen; Pérez-Osorio, Ailyn; Wang, Yu; Eckmann, Kaye; Glover, William A; Allard, Marc W; Brown, Eric W; Chen, Yi

    2017-06-15

    In 2015, in addition to a United States multistate outbreak linked to contaminated ice cream, another outbreak linked to ice cream was reported in the Pacific Northwest of the United States. It was a hospital-acquired outbreak linked to milkshakes, made from contaminated ice cream mixes and milkshake maker, served to patients. Here we performed multiple analyses on isolates associated with this outbreak: pulsed-field gel electrophoresis (PFGE), whole genome single nucleotide polymorphism (SNP) analysis, species-specific core genome multilocus sequence typing (cgMLST), lineage-specific cgMLST and whole genome-specific MLST (wgsMLST)/outbreak-specific cgMLST. We also analyzed the prophages and virulence genes. The outbreak isolates belonged to sequence type 1038, clonal complex 101, genetic lineage II. There were no pre-mature stop codons in inlA. Isolates contained Listeria Pathogenicity Island 1 and multiple internalins. PFGE and multiple whole genome sequencing (WGS) analyses all clustered together food, environmental and clinical isolates when compared to outgroup from the same clonal complex, which supported the finding that L. monocytogenes likely persisted in the soft serve ice cream/milkshake maker from November 2014 to November 2015 and caused 3 illnesses, and that the outbreak strain was transmitted between two ice cream production facilities. The whole genome SNP analysis, one of the two species-specific cgMLST, the lineage II-specific cgMLST and the wgsMLST/outbreak-specific cgMLST showed that L. monocytogenes cells persistent in the milkshake maker for a year formed a unique clade inside the outbreak cluster. This clustering was consistent with the cleaning practice after the outbreak was initially recognized in late 2014 and early 2015. Putative prophages were conserved among prophage-containing isolates. The loss of a putative prophage in two isolates resulted in the loss of the AscI restriction site in the prophage, which contributed to their AscI-PFGE banding pattern differences from other isolates. The high resolution of WGS analyses allowed the differentiation of epidemiologically unrelated isolates, as well as the elucidation of the microevolution and persistence of isolates within the scope of one outbreak. We applied a wgsMLST scheme which is essentially the outbreak-specific cgMLST. This scheme can be combined with lineage-specific cgMLST and species-specific cgMLST to maximize the resolution of WGS.

  17. Comparison of Next-Generation Sequencing Systems

    PubMed Central

    Liu, Lin; Li, Yinhu; Li, Siliang; Hu, Ni; He, Yimin; Pong, Ray; Lin, Danni; Lu, Lihua; Law, Maggie

    2012-01-01

    With fast development and wide applications of next-generation sequencing (NGS) technologies, genomic sequence information is within reach to aid the achievement of goals to decode life mysteries, make better crops, detect pathogens, and improve life qualities. NGS systems are typically represented by SOLiD/Ion Torrent PGM from Life Sciences, Genome Analyzer/HiSeq 2000/MiSeq from Illumina, and GS FLX Titanium/GS Junior from Roche. Beijing Genomics Institute (BGI), which possesses the world's biggest sequencing capacity, has multiple NGS systems including 137 HiSeq 2000, 27 SOLiD, one Ion Torrent PGM, one MiSeq, and one 454 sequencer. We have accumulated extensive experience in sample handling, sequencing, and bioinformatics analysis. In this paper, technologies of these systems are reviewed, and first-hand data from extensive experience is summarized and analyzed to discuss the advantages and specifics associated with each sequencing system. At last, applications of NGS are summarized. PMID:22829749

  18. Mining biological databases for candidate disease genes

    NASA Astrophysics Data System (ADS)

    Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

    2001-07-01

    The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

  19. GTRAC: fast retrieval from compressed collections of genomic variants

    PubMed Central

    Tatwawadi, Kedar; Hernaez, Mikel; Ochoa, Idoia; Weissman, Tsachy

    2016-01-01

    Motivation: The dramatic decrease in the cost of sequencing has resulted in the generation of huge amounts of genomic data, as evidenced by projects such as the UK10K and the Million Veteran Project, with the number of sequenced genomes ranging in the order of 10 K to 1 M. Due to the large redundancies among genomic sequences of individuals from the same species, most of the medical research deals with the variants in the sequences as compared with a reference sequence, rather than with the complete genomic sequences. Consequently, millions of genomes represented as variants are stored in databases. These databases are constantly updated and queried to extract information such as the common variants among individuals or groups of individuals. Previous algorithms for compression of this type of databases lack efficient random access capabilities, rendering querying the database for particular variants and/or individuals extremely inefficient, to the point where compression is often relinquished altogether. Results: We present a new algorithm for this task, called GTRAC, that achieves significant compression ratios while allowing fast random access over the compressed database. For example, GTRAC is able to compress a Homo sapiens dataset containing 1092 samples in 1.1 GB (compression ratio of 160), while allowing for decompression of specific samples in less than a second and decompression of specific variants in 17 ms. GTRAC uses and adapts techniques from information theory, such as a specialized Lempel-Ziv compressor, and tailored succinct data structures. Availability and Implementation: The GTRAC algorithm is available for download at: https://github.com/kedartatwawadi/GTRAC Contact: kedart@stanford.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27587665

  20. GTRAC: fast retrieval from compressed collections of genomic variants.

    PubMed

    Tatwawadi, Kedar; Hernaez, Mikel; Ochoa, Idoia; Weissman, Tsachy

    2016-09-01

    The dramatic decrease in the cost of sequencing has resulted in the generation of huge amounts of genomic data, as evidenced by projects such as the UK10K and the Million Veteran Project, with the number of sequenced genomes ranging in the order of 10 K to 1 M. Due to the large redundancies among genomic sequences of individuals from the same species, most of the medical research deals with the variants in the sequences as compared with a reference sequence, rather than with the complete genomic sequences. Consequently, millions of genomes represented as variants are stored in databases. These databases are constantly updated and queried to extract information such as the common variants among individuals or groups of individuals. Previous algorithms for compression of this type of databases lack efficient random access capabilities, rendering querying the database for particular variants and/or individuals extremely inefficient, to the point where compression is often relinquished altogether. We present a new algorithm for this task, called GTRAC, that achieves significant compression ratios while allowing fast random access over the compressed database. For example, GTRAC is able to compress a Homo sapiens dataset containing 1092 samples in 1.1 GB (compression ratio of 160), while allowing for decompression of specific samples in less than a second and decompression of specific variants in 17 ms. GTRAC uses and adapts techniques from information theory, such as a specialized Lempel-Ziv compressor, and tailored succinct data structures. The GTRAC algorithm is available for download at: https://github.com/kedartatwawadi/GTRAC CONTACT: : kedart@stanford.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Uncovering the novel characteristics of Asian honey bee, Apis cerana, by whole genome sequencing.

    PubMed

    Park, Doori; Jung, Je Won; Choi, Beom-Soon; Jayakodi, Murukarthick; Lee, Jeongsoo; Lim, Jongsung; Yu, Yeisoo; Choi, Yong-Soo; Lee, Myeong-Lyeol; Park, Yoonseong; Choi, Ik-Young; Yang, Tae-Jin; Edwards, Owain R; Nah, Gyoungju; Kwon, Hyung Wook

    2015-01-02

    The honey bee is an important model system for increasing understanding of molecular and neural mechanisms underlying social behaviors relevant to the agricultural industry and basic science. The western honey bee, Apis mellifera, has served as a model species, and its genome sequence has been published. In contrast, the genome of the Asian honey bee, Apis cerana, has not yet been sequenced. A. cerana has been raised in Asian countries for thousands of years and has brought considerable economic benefits to the apicultural industry. A cerana has divergent biological traits compared to A. mellifera and it has played a key role in maintaining biodiversity in eastern and southern Asia. Here we report the first whole genome sequence of A. cerana. Using de novo assembly methods, we produced a 238 Mbp draft of the A. cerana genome and generated 10,651 genes. A.cerana-specific genes were analyzed to better understand the novel characteristics of this honey bee species. Seventy-two percent of the A. cerana-specific genes had more than one GO term, and 1,696 enzymes were categorized into 125 pathways. Genes involved in chemoreception and immunity were carefully identified and compared to those from other sequenced insect models. These included 10 gustatory receptors, 119 odorant receptors, 10 ionotropic receptors, and 160 immune-related genes. This first report of the whole genome sequence of A. cerana provides resources for comparative sociogenomics, especially in the field of social insect communication. These important tools will contribute to a better understanding of the complex behaviors and natural biology of the Asian honey bee and to anticipate its future evolutionary trajectory.

  2. The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Devor, E.J.; Dill-Devor, R.M.

    1994-09-01

    We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCRmore » assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.« less

  3. Genomes Behave as Social Entities: Alien Chromatin Minorities Evolve Through Specificities Reduction

    USDA-ARS?s Scientific Manuscript database

    Hybridization and chromosome doubling entailed by allopolyploidization requires genetic and epigenetic modifications, resulting in the adjustment of different genomes to the same nuclear environment. Recently, the main role of retrotransposon/microsatellite-rich regions of the genome in DNA sequenc...

  4. Comparative Analysis of the Orphan CRISPR2 Locus in 242 Enterococcus faecalis Strains

    PubMed Central

    Hullahalli, Karthik; Rodrigues, Marinelle; Schmidt, Brendan D.; Li, Xiang; Bhardwaj, Pooja; Palmer, Kelli L.

    2015-01-01

    Clustered, Regularly Interspaced Short Palindromic Repeats and their associated Cas proteins (CRISPR-Cas) provide prokaryotes with a mechanism for defense against mobile genetic elements (MGEs). A CRISPR locus is a molecular memory of MGE encounters. It contains an array of short sequences, called spacers, that generally have sequence identity to MGEs. Three different CRISPR loci have been identified among strains of the opportunistic pathogen Enterococcus faecalis. CRISPR1 and CRISPR3 are associated with the cas genes necessary for blocking MGEs, but these loci are present in only a subset of E. faecalis strains. The orphan CRISPR2 lacks cas genes and is ubiquitous in E. faecalis, although its spacer content varies from strain to strain. Because CRISPR2 is a variable locus occurring in all E. faecalis, comparative analysis of CRISPR2 sequences may provide information about the clonality of E. faecalis strains. We examined CRISPR2 sequences from 228 E. faecalis genomes in relationship to subspecies phylogenetic lineages (sequence types; STs) determined by multilocus sequence typing (MLST), and to a genome phylogeny generated for a representative 71 genomes. We found that specific CRISPR2 sequences are associated with specific STs and with specific branches on the genome tree. To explore possible applications of CRISPR2 analysis, we evaluated 14 E. faecalis bloodstream isolates using CRISPR2 analysis and MLST. CRISPR2 analysis identified two groups of clonal strains among the 14 isolates, an assessment that was confirmed by MLST. CRISPR2 analysis was also used to accurately predict the ST of a subset of isolates. We conclude that CRISPR2 analysis, while not a replacement for MLST, is an inexpensive method to assess clonality among E. faecalis isolates, and can be used in conjunction with MLST to identify recombination events occurring between STs. PMID:26398194

  5. An Evaluation Framework for Lossy Compression of Genome Sequencing Quality Values.

    PubMed

    Alberti, Claudio; Daniels, Noah; Hernaez, Mikel; Voges, Jan; Goldfeder, Rachel L; Hernandez-Lopez, Ana A; Mattavelli, Marco; Berger, Bonnie

    2016-01-01

    This paper provides the specification and an initial validation of an evaluation framework for the comparison of lossy compressors of genome sequencing quality values. The goal is to define reference data, test sets, tools and metrics that shall be used to evaluate the impact of lossy compression of quality values on human genome variant calling. The functionality of the framework is validated referring to two state-of-the-art genomic compressors. This work has been spurred by the current activity within the ISO/IEC SC29/WG11 technical committee (a.k.a. MPEG), which is investigating the possibility of starting a standardization activity for genomic information representation.

  6. Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

    PubMed

    Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

    2014-10-29

    Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

  7. The draft genome of MD-2 pineapple using hybrid error correction of long reads

    PubMed Central

    Redwan, Raimi M.; Saidin, Akzam; Kumar, S. Vijay

    2016-01-01

    The introduction of the elite pineapple variety, MD-2, has caused a significant market shift in the pineapple industry. Better productivity, overall increased in fruit quality and taste, resilience to chilled storage and resistance to internal browning are among the key advantages of the MD-2 as compared with its previous predecessor, the Smooth Cayenne. Here, we present the genome sequence of the MD-2 pineapple (Ananas comosus (L.) Merr.) by using the hybrid sequencing technology from two highly reputable platforms, i.e. the PacBio long sequencing reads and the accurate Illumina short reads. Our draft genome achieved 99.6% genome coverage with 27,017 predicted protein-coding genes while 45.21% of the genome was identified as repetitive elements. Furthermore, differential expression of ripening RNASeq library of pineapple fruits revealed ethylene-related transcripts, believed to be involved in regulating the process of non-climacteric pineapple fruit ripening. The MD-2 pineapple draft genome serves as an example of how a complex heterozygous genome is amenable to whole genome sequencing by using a hybrid technology that is both economical and accurate. The genome will make genomic applications more feasible as a medium to understand complex biological processes specific to pineapple. PMID:27374615

  8. Single-cell sequencing provides clues about the host interactions of segmented filamentous bacteria (SFB)

    PubMed Central

    Pamp, Sünje J.; Harrington, Eoghan D.; Quake, Stephen R.; Relman, David A.; Blainey, Paul C.

    2012-01-01

    Segmented filamentous bacteria (SFB) are host-specific intestinal symbionts that comprise a distinct clade within the Clostridiaceae, designated Candidatus Arthromitus. SFB display a unique life cycle within the host, involving differentiation into multiple cell types. The latter include filaments that attach intimately to intestinal epithelial cells, and from which “holdfasts” and spores develop. SFB induce a multifaceted immune response, leading to host protection from intestinal pathogens. Cultivation resistance has hindered characterization of these enigmatic bacteria. In the present study, we isolated five SFB filaments from a mouse using a microfluidic device equipped with laser tweezers, generated genome sequences from each, and compared these sequences with each other, as well as to recently published SFB genome sequences. Based on the resulting analyses, SFB appear to be dependent on the host for a variety of essential nutrients. SFB have a relatively high abundance of predicted proteins devoted to cell cycle control and to envelope biogenesis, and have a group of SFB-specific autolysins and a dynamin-like protein. Among the five filament genomes, an average of 8.6% of predicted proteins were novel, including a family of secreted SFB-specific proteins. Four ADP-ribosyltransferase (ADPRT) sequence types, and a myosin-cross-reactive antigen (MCRA) protein were discovered; we hypothesize that they are involved in modulation of host responses. The presence of polymorphisms among mouse SFB genomes suggests the evolution of distinct SFB lineages. Overall, our results reveal several aspects of SFB adaptation to the mammalian intestinal tract. PMID:22434425

  9. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  10. Optical mapping reveals a large genetic inversion between two methicillin-resistant Staphylococcus aureus strains.

    PubMed

    Shukla, Sanjay K; Kislow, Jennifer; Briska, Adam; Henkhaus, John; Dykes, Colin

    2009-09-01

    Staphylococcus aureus is a highly versatile and evolving bacterium of great clinical importance. S. aureus can evolve by acquiring single nucleotide polymorphisms and mobile genetic elements and by recombination events. Identification and location of novel genomic elements in a bacterial genome are not straightforward, unless the whole genome is sequenced. Optical mapping is a new tool that creates a high-resolution, in situ ordered restriction map of a bacterial genome. These maps can be used to determine genomic organization and perform comparative genomics to identify genomic rearrangements, such as insertions, deletions, duplications, and inversions, compared to an in silico (virtual) restriction map of a known genome sequence. Using this technology, we report here the identification, approximate location, and characterization of a genetic inversion of approximately 500 kb of a DNA element between the NRS387 (USA800) and FPR3757 (USA300) strains. The presence of the inversion and location of its junction sites were confirmed by site-specific PCR and sequencing. At both the left and right junction sites in NRS387, an IS1181 element and a 73-bp sequence were identified as inverted repeats, which could explain the possible mechanism of the inversion event.

  11. Characterization of the temperate phage vB_RleM_PPF1 and its site-specific integration into the Rhizobium leguminosarum F1 genome.

    PubMed

    Halmillawewa, Anupama P; Restrepo-Córdoba, Marcela; Perry, Benjamin J; Yost, Christopher K; Hynes, Michael F

    2016-02-01

    Bacteriophages may play an important role in regulating population size and diversity of the root nodule symbiont Rhizobium leguminosarum, as well as participating in horizontal gene transfer. Although phages that infect this species have been isolated in the past, our knowledge of their molecular biology, and especially of genome composition, is extremely limited, and this lack of information impacts on the ability to assess phage population dynamics and limits potential agricultural applications of rhizobiophages. To help address this deficit in available sequence and biological information, the complete genome sequence of the Myoviridae temperate phage PPF1 that infects R. leguminosarum biovar viciae strain F1 was determined. The genome is 54,506 bp in length with an average G+C content of 61.9 %. The genome contains 94 putative open reading frames (ORFs) and 74.5 % of these predicted ORFs share homology at the protein level with previously reported sequences in the database. However, putative functions could only be assigned to 25.5 % (24 ORFs) of the predicted genes. PPF1 was capable of efficiently lysogenizing its rhizobial host R. leguminosarum F1. The site-specific recombination system of the phage targets an integration site that lies within a putative tRNA-Pro (CGG) gene in R. leguminosarum F1. Upon integration, the phage is capable of restoring the disrupted tRNA gene, owing to the 50 bp homologous sequence (att core region) it shares with its rhizobial host genome. Phage PPF1 is the first temperate phage infecting members of the genus Rhizobium for which a complete genome sequence, as well as other biological data such as the integration site, is available.

  12. Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

    PubMed

    Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

    2016-06-01

    We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  13. Genomic analysis of Ascochyta rabiei identifies dynamic genome environments of solanapyrone biosynthesis gene cluster and a novel type of pathway-specific regulator

    USDA-ARS?s Scientific Manuscript database

    Secondary metabolite genes are often clustered together and situated in particular genomic regions such as the subtelomere, which can facilitate niche adaptation in fungi. Solanapyrones are toxic secondary metabolites produced by fungi occupying different ecological niches. Full genome sequencing of...

  14. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.).

    PubMed

    Aramrak, Attawan; Kidwell, Kimberlee K; Steber, Camille M; Burke, Ian C

    2015-10-23

    5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway, and is the target of the herbicide glyphosate. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the allohexaploid wheat EPSPS gene were cloned and characterized. Genomic and coding DNA sequences of EPSPS from the three related genomes of allohexaploid wheat were isolated using PCR and inverse PCR approaches from soft white spring "Louise'. Development of genome-specific primers allowed the mapping and expression analysis of TaEPSPS-7A1, TaEPSPS-7D1, and TaEPSPS-4A1 on chromosomes 7A, 7D, and 4A, respectively. Sequence alignments of cDNA sequences from wheat and wheat relatives served as a basis for phylogenetic analysis. The three genomic copies of wheat EPSPS differed by insertion/deletion and single nucleotide polymorphisms (SNPs), largely in intron sequences. RT-PCR analysis and cDNA cloning revealed that EPSPS is expressed from all three genomic copies. However, TaEPSPS-4A1 is expressed at much lower levels than TaEPSPS-7A1 and TaEPSPS-7D1 in wheat seedlings. Phylogenetic analysis of 1190-bp cDNA clones from wheat and wheat relatives revealed that: 1) TaEPSPS-7A1 is most similar to EPSPS from the tetraploid AB genome donor, T. turgidum (99.7 % identity); 2) TaEPSPS-7D1 most resembles EPSPS from the diploid D genome donor, Aegilops tauschii (100 % identity); and 3) TaEPSPS-4A1 resembles EPSPS from the diploid B genome relative, Ae. speltoides (97.7 % identity). Thus, EPSPS sequences in allohexaploid wheat are preserved from the most two recent ancestors. The wheat EPSPS genes are more closely related to Lolium multiflorum and Brachypodium distachyon than to Oryza sativa (rice). The three related EPSPS homoeologues of wheat exhibited conservation of the exon/intron structure and of coding region sequence, but contained significant sequence variation within intron regions. The genome-specific primers developed will enable future characterization of natural and induced variation in EPSPS sequence and expression. This can be useful in investigating new causes of glyphosate herbicide resistance.

  15. Paul Spellman, Ph.D., Talks about TCGA at AACR 2011 - TCGA

    Cancer.gov

    Dr. Paul Spellman talks about The Cancer Genome Atlas (TCGA) and how this could help further the treatment of cancer. TCGA is a project working to catalog genetic mutations responsible for cancer. Clinicians are sequencing the genomes of patients with any of 20 different cancers and hope that this could target clinical trials at the specific patient sub-groups that would benefit most. Dr. Spellman explains how an increasing number of laboratories are becoming able to conduct genome sequencing and contribute to the TCGA project, discusses how clinicians could apply the findings in practice to decide on treatment and effect patient outlook and suggests that in future patients may start to request for their genome to be sequenced in order to aid their treatment.

  16. Ecological and evolutionary genomics of marine photosynthetic organisms.

    PubMed

    Coelho, Susana M; Simon, Nathalie; Ahmed, Sophia; Cock, J Mark; Partensky, Frédéric

    2013-02-01

    Environmental (ecological) genomics aims to understand the genetic basis of relationships between organisms and their abiotic and biotic environments. It is a rapidly progressing field of research largely due to recent advances in the speed and volume of genomic data being produced by next generation sequencing (NGS) technologies. Building on information generated by NGS-based approaches, functional genomic methodologies are being applied to identify and characterize genes and gene systems of both environmental and evolutionary relevance. Marine photosynthetic organisms (MPOs) were poorly represented amongst the early genomic models, but this situation is changing rapidly. Here we provide an overview of the recent advances in the application of ecological genomic approaches to both prokaryotic and eukaryotic MPOs. We describe how these approaches are being used to explore the biology and ecology of marine cyanobacteria and algae, particularly with regard to their functions in a broad range of marine ecosystems. Specifically, we review the ecological and evolutionary insights gained from whole genome and transcriptome sequencing projects applied to MPOs and illustrate how their genomes are yielding information on the specific features of these organisms. © 2012 Blackwell Publishing Ltd.

  17. Pervasive sequence patents cover the entire human genome.

    PubMed

    Rosenfeld, Jeffrey A; Mason, Christopher E

    2013-01-01

    The scope and eligibility of patents for genetic sequences have been debated for decades, but a critical case regarding gene patents (Association of Molecular Pathologists v. Myriad Genetics) is now reaching the US Supreme Court. Recent court rulings have supported the assertion that such patents can provide intellectual property rights on sequences as small as 15 nucleotides (15mers), but an analysis of all current US patent claims and the human genome presented here shows that 15mer sequences from all human genes match at least one other gene. The average gene matches 364 other genes as 15mers; the breast-cancer-associated gene BRCA1 has 15mers matching at least 689 other genes. Longer sequences (1,000 bp) still showed extensive cross-gene matches. Furthermore, 15mer-length claims from bovine and other animal patents could also claim as much as 84% of the genes in the human genome. In addition, when we expanded our analysis to full-length patent claims on DNA from all US patents to date, we found that 41% of the genes in the human genome have been claimed. Thus, current patents for both short and long nucleotide sequences are extraordinarily non-specific and create an uncertain, problematic liability for genomic medicine, especially in regard to targeted re-sequencing and other sequence diagnostic assays.

  18. Specific detection of Neospora caninum oocysts in fecal samples from experimentally-infected dogs using the polymerase chain reaction.

    PubMed

    Hill, D E; Liddell, S; Jenkins, M C; Dubey, J P

    2001-04-01

    Neospora caninum oocysts, passed in the feces of a definitive host (dog), were isolated, and genomic DNA was extracted. A polymerase cahin reaction (PCR) targeting the N. caninum-specific Nc 5 genomic sequence was performed using the isolated DNA. A synthesized competitor molecule containing part of the Nc 5 sequence was included in the assay as a check against false-negative PCR results and to quantify N. caninum oocyst DNA in fecal samples. A standard curve of the ratio of fluorescence intensity of PCR-amplified competitor to that of oocyst DNA was constructed to compare oocyst equivalents from fecal samples containing unknown numbers of N. caninum oocysts and to assess the sensitivity of the assay. The specificity of the assay was determined using the Nc 5-specific primers in PCR assays against other parasites likely to be found in canine feces. Genomic DNA sequences from the canine coccidians Hammondia heydorni, Cryptosporidium parvum, Sarcocystis cruzi, S. tenella, and Isospora ohioensis and the canine helminth parasites Strongyloides stercoralis, Toxocara canis, Dipylidium caninum, and Ancylostoma caninum were not amplified. In addition, genomic DNA sequences from oocysts of coccidian parasites that might contaminate dog feces, such as Hammondia hammondi, Toxoplasma gondii, or Eimeria tenella, were not amplified in the PCR assay. The assay should be useful in epidemiological surveys of both domestic and wild canine hosts and in investigations of oocyst biology in experimental infections.

  19. SGP-1: Prediction and Validation of Homologous Genes Based on Sequence Alignments

    PubMed Central

    Wiehe, Thomas; Gebauer-Jung, Steffi; Mitchell-Olds, Thomas; Guigó, Roderic

    2001-01-01

    Conventional methods of gene prediction rely on the recognition of DNA-sequence signals, the coding potential or the comparison of a genomic sequence with a cDNA, EST, or protein database. Reasons for limited accuracy in many circumstances are species-specific training and the incompleteness of reference databases. Lately, comparative genome analysis has attracted increasing attention. Several analysis tools that are based on human/mouse comparisons are already available. Here, we present a program for the prediction of protein-coding genes, termed SGP-1 (Syntenic Gene Prediction), which is based on the similarity of homologous genomic sequences. In contrast to most existing tools, the accuracy of SGP-1 depends little on species-specific properties such as codon usage or the nucleotide distribution. SGP-1 may therefore be applied to nonstandard model organisms in vertebrates as well as in plants, without the need for extensive parameter training. In addition to predicting genes in large-scale genomic sequences, the program may be useful to validate gene structure annotations from databases. To this end, SGP-1 output also contains comparisons between predicted and annotated gene structures in HTML format. The program can be accessed via a Web server at http://soft.ice.mpg.de/sgp-1. The source code, written in ANSI C, is available on request from the authors. PMID:11544202

  20. Clinical genomics, big data, and electronic medical records: reconciling patient rights with research when privacy and science collide.

    PubMed

    Kulynych, Jennifer; Greely, Henry T

    2017-04-01

    Widespread use of medical records for research, without consent, attracts little scrutiny compared to biospecimen research, where concerns about genomic privacy prompted recent federal proposals to mandate consent. This paper explores an important consequence of the proliferation of electronic health records (EHRs) in this permissive atmosphere: with the advent of clinical gene sequencing, EHR-based secondary research poses genetic privacy risks akin to those of biospecimen research, yet regulators still permit researchers to call gene sequence data 'de-identified', removing such data from the protection of the federal Privacy Rule and federal human subjects regulations. Medical centers and other providers seeking to offer genomic 'personalized medicine' now confront the problem of governing the secondary use of clinical genomic data as privacy risks escalate. We argue that regulators should no longer permit HIPAA-covered entities to treat dense genomic data as de-identified health information. Even with this step, the Privacy Rule would still permit disclosure of clinical genomic data for research, without consent, under a data use agreement, so we also urge that providers give patients specific notice before disclosing clinical genomic data for research, permitting (where possible) some degree of choice and control. To aid providers who offer clinical gene sequencing, we suggest both general approaches and specific actions to reconcile patients' rights and interests with genomic research.

  1. Clinical genomics, big data, and electronic medical records: reconciling patient rights with research when privacy and science collide

    PubMed Central

    Greely, Henry T.

    2017-01-01

    Abstract Widespread use of medical records for research, without consent, attracts little scrutiny compared to biospecimen research, where concerns about genomic privacy prompted recent federal proposals to mandate consent. This paper explores an important consequence of the proliferation of electronic health records (EHRs) in this permissive atmosphere: with the advent of clinical gene sequencing, EHR-based secondary research poses genetic privacy risks akin to those of biospecimen research, yet regulators still permit researchers to call gene sequence data ‘de-identified’, removing such data from the protection of the federal Privacy Rule and federal human subjects regulations. Medical centers and other providers seeking to offer genomic ‘personalized medicine’ now confront the problem of governing the secondary use of clinical genomic data as privacy risks escalate. We argue that regulators should no longer permit HIPAA-covered entities to treat dense genomic data as de-identified health information. Even with this step, the Privacy Rule would still permit disclosure of clinical genomic data for research, without consent, under a data use agreement, so we also urge that providers give patients specific notice before disclosing clinical genomic data for research, permitting (where possible) some degree of choice and control. To aid providers who offer clinical gene sequencing, we suggest both general approaches and specific actions to reconcile patients’ rights and interests with genomic research. PMID:28852559

  2. Sequence and expression variation in SUPPRESSOR of OVEREXPRESSION of CONSTANS 1 (SOC1): homeolog evolution in Indian Brassicas.

    PubMed

    Sri, Tanu; Mayee, Pratiksha; Singh, Anandita

    2015-09-01

    Whole genome sequence analyses allow unravelling such evolutionary consequences of meso-triplication event in Brassicaceae (∼14-20 million years ago (MYA)) as differential gene fractionation and diversification in homeologous sub-genomes. This study presents a simple gene-centric approach involving microsynteny and natural genetic variation analysis for understanding SUPPRESSOR of OVEREXPRESSION of CONSTANS 1 (SOC1) homeolog evolution in Brassica. Analysis of microsynteny in Brassica rapa homeologous regions containing SOC1 revealed differential gene fractionation correlating to reported fractionation status of sub-genomes of origin, viz. least fractionated (LF), moderately fractionated 1 (MF1) and most fractionated (MF2), respectively. Screening 18 cultivars of 6 Brassica species led to the identification of 8 genomic and 27 transcript variants of SOC1, including splice-forms. Co-occurrence of both interrupted and intronless SOC1 genes was detected in few Brassica species. In silico analysis characterised Brassica SOC1 as MADS intervening, K-box, C-terminal (MIKC(C)) transcription factor, with highly conserved MADS and I domains relative to K-box and C-terminal domain. Phylogenetic analyses and multiple sequence alignments depicting shared pattern of silent/non-silent mutations assigned Brassica SOC1 homologs into groups based on shared diploid base genome. In addition, a sub-genome structure in uncharacterised Brassica genomes was inferred. Expression analysis of putative MF2 and LF (Brassica diploid base genome A (AA)) sub-genome-specific SOC1 homeologs of Brassica juncea revealed near identical expression pattern. However, MF2-specific homeolog exhibited significantly higher expression implying regulatory diversification. In conclusion, evidence for polyploidy-induced sequence and regulatory evolution in Brassica SOC1 is being presented wherein differential homeolog expression is implied in functional diversification.

  3. Putative and unique gene sequence utilization for the design of species specific probes as modeled by Lactobacillus plantarum

    USDA-ARS?s Scientific Manuscript database

    The concept of utilizing putative and unique gene sequences for the design of species specific probes was tested. The abundance profile of assigned functions within the Lactobacillus plantarum genome was used for the identification of the putative and unique gene sequence, csh. The targeted gene (cs...

  4. Draft genome of the medaka fish: a comprehensive resource for medaka developmental genetics and vertebrate evolutionary biology.

    PubMed

    Takeda, Hiroyuki

    2008-06-01

    The medaka Oryzias latipes is a small egg-laying freshwater teleost, and has become an excellent model system for developmental genetics and evolutionary biology. The medaka genome is relatively small in size, approximately 800 Mb, and the genome sequencing project was recently completed by Japanese research groups, providing a high-quality draft genome sequence of the inbred Hd-rR strain of medaka. In this review, I present an overview of the medaka genome project including genome resources, followed by specific findings obtained with the medaka draft genome. In particular, I focus on the analysis that was done by taking advantage of the medaka system, such as the sex chromosome differentiation and the regional history of medaka species using single nucleotide polymorphisms as genomic markers.

  5. Packaging signals in two single-stranded RNA viruses imply a conserved assembly mechanism and geometry of the packaged genome.

    PubMed

    Dykeman, Eric C; Stockley, Peter G; Twarock, Reidun

    2013-09-09

    The current paradigm for assembly of single-stranded RNA viruses is based on a mechanism involving non-sequence-specific packaging of genomic RNA driven by electrostatic interactions. Recent experiments, however, provide compelling evidence for sequence specificity in this process both in vitro and in vivo. The existence of multiple RNA packaging signals (PSs) within viral genomes has been proposed, which facilitates assembly by binding coat proteins in such a way that they promote the protein-protein contacts needed to build the capsid. The binding energy from these interactions enables the confinement or compaction of the genomic RNAs. Identifying the nature of such PSs is crucial for a full understanding of assembly, which is an as yet untapped potential drug target for this important class of pathogens. Here, for two related bacterial viruses, we determine the sequences and locations of their PSs using Hamiltonian paths, a concept from graph theory, in combination with bioinformatics and structural studies. Their PSs have a common secondary structure motif but distinct consensus sequences and positions within the respective genomes. Despite these differences, the distributions of PSs in both viruses imply defined conformations for the packaged RNA genomes in contact with the protein shell in the capsid, consistent with a recent asymmetric structure determination of the MS2 virion. The PS distributions identified moreover imply a preferred, evolutionarily conserved assembly pathway with respect to the RNA sequence with potentially profound implications for other single-stranded RNA viruses known to have RNA PSs, including many animal and human pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Comparative genomics and prediction of conditionally dispensable sequences in legume-infecting Fusarium oxysporum formae speciales facilitates identification of candidate effectors.

    PubMed

    Williams, Angela H; Sharma, Mamta; Thatcher, Louise F; Azam, Sarwar; Hane, James K; Sperschneider, Jana; Kidd, Brendan N; Anderson, Jonathan P; Ghosh, Raju; Garg, Gagan; Lichtenzveig, Judith; Kistler, H Corby; Shea, Terrance; Young, Sarah; Buck, Sally-Anne G; Kamphuis, Lars G; Saxena, Rachit; Pande, Suresh; Ma, Li-Jun; Varshney, Rajeev K; Singh, Karam B

    2016-03-05

    Soil-borne fungi of the Fusarium oxysporum species complex cause devastating wilt disease on many crops including legumes that supply human dietary protein needs across many parts of the globe. We present and compare draft genome assemblies for three legume-infecting formae speciales (ff. spp.): F. oxysporum f. sp. ciceris (Foc-38-1) and f. sp. pisi (Fop-37622), significant pathogens of chickpea and pea respectively, the world's second and third most important grain legumes, and lastly f. sp. medicaginis (Fom-5190a) for which we developed a model legume pathosystem utilising Medicago truncatula. Focusing on the identification of pathogenicity gene content, we leveraged the reference genomes of Fusarium pathogens F. oxysporum f. sp. lycopersici (tomato-infecting) and F. solani (pea-infecting) and their well-characterised core and dispensable chromosomes to predict genomic organisation in the newly sequenced legume-infecting isolates. Dispensable chromosomes are not essential for growth and in Fusarium species are known to be enriched in host-specificity and pathogenicity-associated genes. Comparative genomics of the publicly available Fusarium species revealed differential patterns of sequence conservation across F. oxysporum formae speciales, with legume-pathogenic formae speciales not exhibiting greater sequence conservation between them relative to non-legume-infecting formae speciales, possibly indicating the lack of a common ancestral source for legume pathogenicity. Combining predicted dispensable gene content with in planta expression in the model legume-infecting isolate, we identified small conserved regions and candidate effectors, four of which shared greatest similarity to proteins from another legume-infecting ff. spp. We demonstrate that distinction of core and potential dispensable genomic regions of novel F. oxysporum genomes is an effective tool to facilitate effector discovery and the identification of gene content possibly linked to host specificity. While the legume-infecting isolates didn't share large genomic regions of pathogenicity-related content, smaller regions and candidate effector proteins were highly conserved, suggesting that they may play specific roles in inducing disease on legume hosts.

  7. Effector profiles distinguish formae speciales of Fusarium oxysporum.

    PubMed

    van Dam, Peter; Fokkens, Like; Schmidt, Sarah M; Linmans, Jasper H J; Kistler, H Corby; Ma, Li-Jun; Rep, Martijn

    2016-11-01

    Formae speciales (ff.spp.) of the fungus Fusarium oxysporum are often polyphyletic within the species complex, making it impossible to identify them on the basis of conserved genes. However, sequences that determine host-specific pathogenicity may be expected to be similar between strains within the same forma specialis. Whole genome sequencing was performed on strains from five different ff.spp. (cucumerinum, niveum, melonis, radicis-cucumerinum and lycopersici). In each genome, genes for putative effectors were identified based on small size, secretion signal, and vicinity to a "miniature impala" transposable element. The candidate effector genes of all genomes were collected and the presence/absence patterns in each individual genome were clustered. Members of the same forma specialis turned out to group together, with cucurbit-infecting strains forming a supercluster separate from other ff.spp. Moreover, strains from different clonal lineages within the same forma specialis harbour identical effector gene sequences, supporting horizontal transfer of genetic material. These data offer new insight into the genetic basis of host specificity in the F. oxysporum species complex and show that (putative) effectors can be used to predict host specificity in F. oxysporum. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  8. Inferring Selective Constraint from Population Genomic Data Suggests Recent Regulatory Turnover in the Human Brain

    PubMed Central

    Schrider, Daniel R.; Kern, Andrew D.

    2015-01-01

    The comparative genomics revolution of the past decade has enabled the discovery of functional elements in the human genome via sequence comparison. While that is so, an important class of elements, those specific to humans, is entirely missed by searching for sequence conservation across species. Here we present an analysis based on variation data among human genomes that utilizes a supervised machine learning approach for the identification of human-specific purifying selection in the genome. Using only allele frequency information from the complete low-coverage 1000 Genomes Project data set in conjunction with a support vector machine trained from known functional and nonfunctional portions of the genome, we are able to accurately identify portions of the genome constrained by purifying selection. Our method identifies previously known human-specific gains or losses of function and uncovers many novel candidates. Candidate targets for gain and loss of function along the human lineage include numerous putative regulatory regions of genes essential for normal development of the central nervous system, including a significant enrichment of gain of function events near neurotransmitter receptor genes. These results are consistent with regulatory turnover being a key mechanism in the evolution of human-specific characteristics of brain development. Finally, we show that the majority of the genome is unconstrained by natural selection currently, in agreement with what has been estimated from phylogenetic methods but in sharp contrast to estimates based on transcriptomics or other high-throughput functional methods. PMID:26590212

  9. Anonymization of electronic medical records for validating genome-wide association studies

    PubMed Central

    Loukides, Grigorios; Gkoulalas-Divanis, Aris; Malin, Bradley

    2010-01-01

    Genome-wide association studies (GWAS) facilitate the discovery of genotype–phenotype relations from population-based sequence databases, which is an integral facet of personalized medicine. The increasing adoption of electronic medical records allows large amounts of patients’ standardized clinical features to be combined with the genomic sequences of these patients and shared to support validation of GWAS findings and to enable novel discoveries. However, disseminating these data “as is” may lead to patient reidentification when genomic sequences are linked to resources that contain the corresponding patients’ identity information based on standardized clinical features. This work proposes an approach that provably prevents this type of data linkage and furnishes a result that helps support GWAS. Our approach automatically extracts potentially linkable clinical features and modifies them in a way that they can no longer be used to link a genomic sequence to a small number of patients, while preserving the associations between genomic sequences and specific sets of clinical features corresponding to GWAS-related diseases. Extensive experiments with real patient data derived from the Vanderbilt's University Medical Center verify that our approach generates data that eliminate the threat of individual reidentification, while supporting GWAS validation and clinical case analysis tasks. PMID:20385806

  10. Refining the structure and content of clinical genomic reports.

    PubMed

    Dorschner, Michael O; Amendola, Laura M; Shirts, Brian H; Kiedrowski, Lesli; Salama, Joseph; Gordon, Adam S; Fullerton, Stephanie M; Tarczy-Hornoch, Peter; Byers, Peter H; Jarvik, Gail P

    2014-03-01

    To effectively articulate the results of exome and genome sequencing we refined the structure and content of molecular test reports. To communicate results of a randomized control trial aimed at the evaluation of exome sequencing for clinical medicine, we developed a structured narrative report. With feedback from genetics and non-genetics professionals, we developed separate indication-specific and incidental findings reports. Standard test report elements were supplemented with research study-specific language, which highlighted the limitations of exome sequencing and provided detailed, structured results, and interpretations. The report format we developed to communicate research results can easily be transformed for clinical use by removal of research-specific statements and disclaimers. The development of clinical reports for exome sequencing has shown that accurate and open communication between the clinician and laboratory is ideally an ongoing process to address the increasing complexity of molecular genetic testing. © 2014 Wiley Periodicals, Inc.

  11. Refining the Structure and Content of Clinical Genomic Reports

    PubMed Central

    DORSCHNER, MICHAEL O.; AMENDOLA, LAURA M.; SHIRTS, BRIAN H.; KIEDROWSKI, LESLI; SALAMA, JOSEPH; GORDON, ADAM S.; FULLERTON, STEPHANIE M.; TARCZY-HORNOCH, PETER; BYERS, PETER H.; JARVIK, GAIL P.

    2014-01-01

    To effectively articulate the results of exome and genome sequencing we refined the structure and content of molecular test reports. To communicate results of a randomized control trial aimed at the evaluation of exome sequencing for clinical medicine, we developed a structured narrative report. With feedback from genetics and non-genetics professionals, we developed separate indication-specific and incidental findings reports. Standard test report elements were supplemented with research study-specific language, which highlighted the limitations of exome sequencing and provided detailed, structured results, and interpretations. The report format we developed to communicate research results can easily be transformed for clinical use by removal of research-specific statements and disclaimers. The development of clinical reports for exome sequencing has shown that accurate and open communication between the clinician and laboratory is ideally an ongoing process to address the increasing complexity of molecular genetic testing. PMID:24616401

  12. Draft sequencing and comparative genomics of Xylella fastidiosa strains reveal novel biological insights.

    PubMed

    Bhattacharyya, Anamitra; Stilwagen, Stephanie; Reznik, Gary; Feil, Helene; Feil, William S; Anderson, Iain; Bernal, Axel; D'Souza, Mark; Ivanova, Natalia; Kapatral, Vinayak; Larsen, Niels; Los, Tamara; Lykidis, Athanasios; Selkov, Eugene; Walunas, Theresa L; Purcell, Alexander; Edwards, Rob A; Hawkins, Trevor; Haselkorn, Robert; Overbeek, Ross; Kyrpides, Nikos C; Predki, Paul F

    2002-10-01

    Draft sequencing is a rapid and efficient method for determining the near-complete sequence of microbial genomes. Here we report a comparative analysis of one complete and two draft genome sequences of the phytopathogenic bacterium, Xylella fastidiosa, which causes serious disease in plants, including citrus, almond, and oleander. We present highlights of an in silico analysis based on a comparison of reconstructions of core biological subsystems. Cellular pathway reconstructions have been used to identify a small number of genes, which are likely to reside within the draft genomes but are not captured in the draft assembly. These represented only a small fraction of all genes and were predominantly large and small ribosomal subunit protein components. By using this approach, some of the inherent limitations of draft sequence can be significantly reduced. Despite the incomplete nature of the draft genomes, it is possible to identify several phage-related genes, which appear to be absent from the draft genomes and not the result of insufficient sequence sampling. This region may therefore identify potential host-specific functions. Based on this first functional reconstruction of a phytopathogenic microbe, we spotlight an unusual respiration machinery as a potential target for biological control. We also predicted and developed a new defined growth medium for Xylella.

  13. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    PubMed

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  14. RNA-Seq Alignment to Individualized Genomes Improves Transcript Abundance Estimates in Multiparent Populations

    PubMed Central

    Munger, Steven C.; Raghupathy, Narayanan; Choi, Kwangbom; Simons, Allen K.; Gatti, Daniel M.; Hinerfeld, Douglas A.; Svenson, Karen L.; Keller, Mark P.; Attie, Alan D.; Hibbs, Matthew A.; Graber, Joel H.; Chesler, Elissa J.; Churchill, Gary A.

    2014-01-01

    Massively parallel RNA sequencing (RNA-seq) has yielded a wealth of new insights into transcriptional regulation. A first step in the analysis of RNA-seq data is the alignment of short sequence reads to a common reference genome or transcriptome. Genetic variants that distinguish individual genomes from the reference sequence can cause reads to be misaligned, resulting in biased estimates of transcript abundance. Fine-tuning of read alignment algorithms does not correct this problem. We have developed Seqnature software to construct individualized diploid genomes and transcriptomes for multiparent populations and have implemented a complete analysis pipeline that incorporates other existing software tools. We demonstrate in simulated and real data sets that alignment to individualized transcriptomes increases read mapping accuracy, improves estimation of transcript abundance, and enables the direct estimation of allele-specific expression. Moreover, when applied to expression QTL mapping we find that our individualized alignment strategy corrects false-positive linkage signals and unmasks hidden associations. We recommend the use of individualized diploid genomes over reference sequence alignment for all applications of high-throughput sequencing technology in genetically diverse populations. PMID:25236449

  15. Templated sequence insertion polymorphisms in the human genome

    NASA Astrophysics Data System (ADS)

    Onozawa, Masahiro; Aplan, Peter

    2016-11-01

    Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

  16. The Mouse Genomes Project: a repository of inbred laboratory mouse strain genomes.

    PubMed

    Adams, David J; Doran, Anthony G; Lilue, Jingtao; Keane, Thomas M

    2015-10-01

    The Mouse Genomes Project was initiated in 2009 with the goal of using next-generation sequencing technologies to catalogue molecular variation in the common laboratory mouse strains, and a selected set of wild-derived inbred strains. The initial sequencing and survey of sequence variation in 17 inbred strains was completed in 2011 and included comprehensive catalogue of single nucleotide polymorphisms, short insertion/deletions, larger structural variants including their fine scale architecture and landscape of transposable element variation, and genomic sites subject to post-transcriptional alteration of RNA. From this beginning, the resource has expanded significantly to include 36 fully sequenced inbred laboratory mouse strains, a refined and updated data processing pipeline, and new variation querying and data visualisation tools which are available on the project's website ( http://www.sanger.ac.uk/resources/mouse/genomes/ ). The focus of the project is now the completion of de novo assembled chromosome sequences and strain-specific gene structures for the core strains. We discuss how the assembled chromosomes will power comparative analysis, data access tools and future directions of mouse genetics.

  17. Diversity of the Arabidopsis mitochondrial genome occurs via nuclear-controlled recombination activity.

    PubMed

    Arrieta-Montiel, Maria P; Shedge, Vikas; Davila, Jaime; Christensen, Alan C; Mackenzie, Sally A

    2009-12-01

    The plant mitochondrial genome is recombinogenic, with DNA exchange activity controlled to a large extent by nuclear gene products. One nuclear gene, MSH1, appears to participate in suppressing recombination in Arabidopsis at every repeated sequence ranging in size from 108 to 556 bp. Present in a wide range of plant species, these mitochondrial repeats display evidence of successful asymmetric DNA exchange in Arabidopsis when MSH1 is disrupted. Recombination frequency appears to be influenced by repeat sequence homology and size, with larger size repeats corresponding to increased DNA exchange activity. The extensive mitochondrial genomic reorganization of the msh1 mutant produced altered mitochondrial transcription patterns. Comparison of mitochondrial genomes from the Arabidopsis ecotypes C24, Col-0, and Ler suggests that MSH1 activity accounts for most or all of the polymorphisms distinguishing these genomes, producing ecotype-specific stoichiometric changes in each line. Our observations suggest that MSH1 participates in mitochondrial genome evolution by influencing the lineage-specific pattern of mitochondrial genetic variation in higher plants.

  18. Identification of copy number variants in whole-genome data using Reference Coverage Profiles

    PubMed Central

    Glusman, Gustavo; Severson, Alissa; Dhankani, Varsha; Robinson, Max; Farrah, Terry; Mauldin, Denise E.; Stittrich, Anna B.; Ament, Seth A.; Roach, Jared C.; Brunkow, Mary E.; Bodian, Dale L.; Vockley, Joseph G.; Shmulevich, Ilya; Niederhuber, John E.; Hood, Leroy

    2015-01-01

    The identification of DNA copy numbers from short-read sequencing data remains a challenge for both technical and algorithmic reasons. The raw data for these analyses are measured in tens to hundreds of gigabytes per genome; transmitting, storing, and analyzing such large files is cumbersome, particularly for methods that analyze several samples simultaneously. We developed a very efficient representation of depth of coverage (150–1000× compression) that enables such analyses. Current methods for analyzing variants in whole-genome sequencing (WGS) data frequently miss copy number variants (CNVs), particularly hemizygous deletions in the 1–100 kb range. To fill this gap, we developed a method to identify CNVs in individual genomes, based on comparison to joint profiles pre-computed from a large set of genomes. We analyzed depth of coverage in over 6000 high quality (>40×) genomes. The depth of coverage has strong sequence-specific fluctuations only partially explained by global parameters like %GC. To account for these fluctuations, we constructed multi-genome profiles representing the observed or inferred diploid depth of coverage at each position along the genome. These Reference Coverage Profiles (RCPs) take into account the diverse technologies and pipeline versions used. Normalization of the scaled coverage to the RCP followed by hidden Markov model (HMM) segmentation enables efficient detection of CNVs and large deletions in individual genomes. Use of pre-computed multi-genome coverage profiles improves our ability to analyze each individual genome. We make available RCPs and tools for performing these analyses on personal genomes. We expect the increased sensitivity and specificity for individual genome analysis to be critical for achieving clinical-grade genome interpretation. PMID:25741365

  19. Genomic and Genetic Diversity within the Pseudomonas fluorescens Complex

    PubMed Central

    Garrido-Sanz, Daniel; Meier-Kolthoff, Jan P.; Göker, Markus; Martín, Marta; Rivilla, Rafael; Redondo-Nieto, Miguel

    2016-01-01

    The Pseudomonas fluorescens complex includes Pseudomonas strains that have been taxonomically assigned to more than fifty different species, many of which have been described as plant growth-promoting rhizobacteria (PGPR) with potential applications in biocontrol and biofertilization. So far the phylogeny of this complex has been analyzed according to phenotypic traits, 16S rDNA, MLSA and inferred by whole-genome analysis. However, since most of the type strains have not been fully sequenced and new species are frequently described, correlation between taxonomy and phylogenomic analysis is missing. In recent years, the genomes of a large number of strains have been sequenced, showing important genomic heterogeneity and providing information suitable for genomic studies that are important to understand the genomic and genetic diversity shown by strains of this complex. Based on MLSA and several whole-genome sequence-based analyses of 93 sequenced strains, we have divided the P. fluorescens complex into eight phylogenomic groups that agree with previous works based on type strains. Digital DDH (dDDH) identified 69 species and 75 subspecies within the 93 genomes. The eight groups corresponded to clustering with a threshold of 31.8% dDDH, in full agreement with our MLSA. The Average Nucleotide Identity (ANI) approach showed inconsistencies regarding the assignment to species and to the eight groups. The small core genome of 1,334 CDSs and the large pan-genome of 30,848 CDSs, show the large diversity and genetic heterogeneity of the P. fluorescens complex. However, a low number of strains were enough to explain most of the CDSs diversity at core and strain-specific genomic fractions. Finally, the identification and analysis of group-specific genome and the screening for distinctive characters revealed a phylogenomic distribution of traits among the groups that provided insights into biocontrol and bioremediation applications as well as their role as PGPR. PMID:26915094

  20. Full-length genome sequences of porcine epidemic diarrhoea virus strain CV777; Use of NGS to analyse genomic and sub-genomic RNAs

    PubMed Central

    Rasmussen, Thomas Bruun; Boniotti, Maria Beatrice; Papetti, Alice; Grasland, Béatrice; Frossard, Jean-Pierre; Dastjerdi, Akbar; Hulst, Marcel; Hanke, Dennis; Pohlmann, Anne; Blome, Sandra; van der Poel, Wim H. M.; Steinbach, Falko; Blanchard, Yannick; Lavazza, Antonio; Bøtner, Anette

    2018-01-01

    Porcine epidemic diarrhoea virus, strain CV777, was initially characterized in 1978 as the causative agent of a disease first identified in the UK in 1971. This coronavirus has been widely distributed among laboratories and has been passaged both within pigs and in cell culture. To determine the variability between different stocks of the PEDV strain CV777, sequencing of the full-length genome (ca. 28kb) has been performed in 6 different laboratories, using different protocols. Not surprisingly, each of the different full genome sequences were distinct from each other and from the reference sequence (Accession number AF353511) but they are >99% identical. Unique and shared differences between sequences were identified. The coding region for the surface-exposed spike protein showed the highest proportion of variability including both point mutations and small deletions. The predicted expression of the ORF3 gene product was more dramatically affected in three different variants of this virus through either loss of the initiation codon or gain of a premature termination codon. The genome of one isolate had a substantially rearranged 5´-terminal sequence. This rearrangement was validated through the analysis of sub-genomic mRNAs from infected cells. It is clearly important to know the features of the specific sample of CV777 being used for experimental studies. PMID:29494671

  1. Recovering complete mitochondrial genome sequences from RNA-Seq: A case study of Polytomella non-photosynthetic green algae.

    PubMed

    Tian, Yao; Smith, David Roy

    2016-05-01

    Thousands of mitochondrial genomes have been sequenced, but there are comparatively few available mitochondrial transcriptomes. This might soon be changing. High-throughput RNA sequencing (RNA-Seq) techniques have made it fast and cheap to generate massive amounts of mitochondrial transcriptomic data. Here, we explore the utility of RNA-Seq for assembling mitochondrial genomes and studying their expression patterns. Specifically, we investigate the mitochondrial transcriptomes from Polytomella non-photosynthetic green algae, which have among the smallest, most reduced mitochondrial genomes from the Archaeplastida as well as fragmented rRNA-coding regions, palindromic genes, and linear chromosomes with telomeres. Isolation of whole genomic RNA from the four known Polytomella species followed by Illumina paired-end sequencing generated enough mitochondrial-derived reads to easily recover almost-entire mitochondrial genome sequences. Read-mapping and coverage statistics also gave insights into Polytomella mitochondrial transcriptional architecture, revealing polycistronic transcripts and the expression of telomeres and palindromic genes. Ultimately, RNA-Seq is a promising, cost-effective technique for studying mitochondrial genetics, but it does have drawbacks, which are discussed. One of its greatest potentials, as shown here, is that it can be used to generate near-complete mitochondrial genome sequences, which could be particularly useful in situations where there is a lack of available mtDNA data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Identification and Resolution of Microdiversity through Metagenomic Sequencing of Parallel Consortia

    PubMed Central

    Maezato, Yukari; Wu, Yu-Wei; Romine, Margaret F.; Lindemann, Stephen R.

    2015-01-01

    To gain a predictive understanding of the interspecies interactions within microbial communities that govern community function, the genomic complement of every member population must be determined. Although metagenomic sequencing has enabled the de novo reconstruction of some microbial genomes from environmental communities, microdiversity confounds current genome reconstruction techniques. To overcome this issue, we performed short-read metagenomic sequencing on parallel consortia, defined as consortia cultivated under the same conditions from the same natural community with overlapping species composition. The differences in species abundance between the two consortia allowed reconstruction of near-complete (at an estimated >85% of gene complement) genome sequences for 17 of the 20 detected member species. Two Halomonas spp. indistinguishable by amplicon analysis were found to be present within the community. In addition, comparison of metagenomic reads against the consensus scaffolds revealed within-species variation for one of the Halomonas populations, one of the Rhodobacteraceae populations, and the Rhizobiales population. Genomic comparison of these representative instances of inter- and intraspecies microdiversity suggests differences in functional potential that may result in the expression of distinct roles in the community. In addition, isolation and complete genome sequence determination of six member species allowed an investigation into the sensitivity and specificity of genome reconstruction processes, demonstrating robustness across a wide range of sequence coverage (9× to 2,700×) within the metagenomic data set. PMID:26497460

  3. Raalin, a transcript enriched in the honey bee brain, is a remnant of genomic rearrangement in Hymenoptera.

    PubMed

    Tirosh, Y; Morpurgo, N; Cohen, M; Linial, M; Bloch, G

    2012-06-01

    We identified a predicted compact cysteine-rich sequence in the honey bee genome that we called 'Raalin'. Raalin transcripts are enriched in the brain of adult honey bee workers and drones, with only minimum expression in other tissues or in pre-adult stages. Open-reading frame (ORF) homologues of Raalin were identified in the transcriptomes of fruit flies, mosquitoes and moths. The Raalin-like gene from Drosophila melanogaster encodes for a short secreted protein that is maximally expressed in the adult brain with negligible expression in other tissues or pre-imaginal stages. Raalin-like sequences have also been found in the recently sequenced genomes of six ant species, but not in the jewel wasp Nasonia vitripennis. As in the honey bee, the Raalin-like sequences of ants do not have an ORF. A comparison of the genome region containing Raalin in the genomes of bees, ants and the wasp provides evolutionary support for an extensive genome rearrangement in this sequence. Our analyses identify a new family of ancient cysteine-rich short sequences in insects in which insertions and genome rearrangements may have disrupted this locus in the branch leading to the Hymenoptera. The regulated expression of this transcript suggests that it has a brain-specific function. © 2012 The Authors. Insect Molecular Biology © 2012 The Royal Entomological Society.

  4. Identification and Resolution of Microdiversity through Metagenomic Sequencing of Parallel Consortia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nelson, William C.; Maezato, Yukari; Wu, Yu-Wei

    2015-10-23

    To gain a predictive understanding of the interspecies interactions within microbial communities that govern community function, the genomic complement of every member population must be determined. Although metagenomic sequencing has enabled thede novoreconstruction of some microbial genomes from environmental communities, microdiversity confounds current genome reconstruction techniques. To overcome this issue, we performed short-read metagenomic sequencing on parallel consortia, defined as consortia cultivated under the same conditions from the same natural community with overlapping species composition. The differences in species abundance between the two consortia allowed reconstruction of near-complete (at an estimated >85% of gene complement) genome sequences for 17 ofmore » the 20 detected member species. TwoHalomonasspp. indistinguishable by amplicon analysis were found to be present within the community. In addition, comparison of metagenomic reads against the consensus scaffolds revealed within-species variation for one of theHalomonaspopulations, one of theRhodobacteraceaepopulations, and theRhizobialespopulation. Genomic comparison of these representative instances of inter- and intraspecies microdiversity suggests differences in functional potential that may result in the expression of distinct roles in the community. In addition, isolation and complete genome sequence determination of six member species allowed an investigation into the sensitivity and specificity of genome reconstruction processes, demonstrating robustness across a wide range of sequence coverage (9× to 2,700×) within the metagenomic data set.« less

  5. Comparison of Methods of Detection of Exceptional Sequences in Prokaryotic Genomes.

    PubMed

    Rusinov, I S; Ershova, A S; Karyagina, A S; Spirin, S A; Alexeevski, A V

    2018-02-01

    Many proteins need recognition of specific DNA sequences for functioning. The number of recognition sites and their distribution along the DNA might be of biological importance. For example, the number of restriction sites is often reduced in prokaryotic and phage genomes to decrease the probability of DNA cleavage by restriction endonucleases. We call a sequence an exceptional one if its frequency in a genome significantly differs from one predicted by some mathematical model. An exceptional sequence could be either under- or over-represented, depending on its frequency in comparison with the predicted one. Exceptional sequences could be considered biologically meaningful, for example, as targets of DNA-binding proteins or as parts of abundant repetitive elements. Several methods to predict frequency of a short sequence in a genome, based on actual frequencies of certain its subsequences, are used. The most popular are methods based on Markov chain models. But any rigorous comparison of the methods has not previously been performed. We compared three methods for the prediction of short sequence frequencies: the maximum-order Markov chain model-based method, the method that uses geometric mean of extended Markovian estimates, and the method that utilizes frequencies of all subsequences including discontiguous ones. We applied them to restriction sites in complete genomes of 2500 prokaryotic species and demonstrated that the results depend greatly on the method used: lists of 5% of the most under-represented sites differed by up to 50%. The method designed by Burge and coauthors in 1992, which utilizes all subsequences of the sequence, showed a higher precision than the other two methods both on prokaryotic genomes and randomly generated sequences after computational imitation of selective pressure. We propose this method as the first choice for detection of exceptional sequences in prokaryotic genomes.

  6. pyGeno: A Python package for precision medicine and proteogenomics.

    PubMed

    Daouda, Tariq; Perreault, Claude; Lemieux, Sébastien

    2016-01-01

    pyGeno is a Python package mainly intended for precision medicine applications that revolve around genomics and proteomics. It integrates reference sequences and annotations from Ensembl, genomic polymorphisms from the dbSNP database and data from next-gen sequencing into an easy to use, memory-efficient and fast framework, therefore allowing the user to easily explore subject-specific genomes and proteomes. Compared to a standalone program, pyGeno gives the user access to the complete expressivity of Python, a general programming language. Its range of application therefore encompasses both short scripts and large scale genome-wide studies.

  7. pyGeno: A Python package for precision medicine and proteogenomics

    PubMed Central

    Daouda, Tariq; Perreault, Claude; Lemieux, Sébastien

    2016-01-01

    pyGeno is a Python package mainly intended for precision medicine applications that revolve around genomics and proteomics. It integrates reference sequences and annotations from Ensembl, genomic polymorphisms from the dbSNP database and data from next-gen sequencing into an easy to use, memory-efficient and fast framework, therefore allowing the user to easily explore subject-specific genomes and proteomes. Compared to a standalone program, pyGeno gives the user access to the complete expressivity of Python, a general programming language. Its range of application therefore encompasses both short scripts and large scale genome-wide studies. PMID:27785359

  8. Occurrence of and Sequence Variation among F-Specific RNA Bacteriophage Subgroups in Feces and Wastewater of Urban and Animal Origins

    PubMed Central

    Hartard, C.; Rivet, R.; Banas, S.

    2015-01-01

    F-specific RNA bacteriophages (FRNAPH) have been widely studied as tools for evaluating fecal or viral pollution in water. It has also been proposed that they can be used to differentiate human from animal fecal contamination. While FRNAPH subgroup I (FRNAPH-I) and FRNAPH-IV are often associated with animal pollution, FRNAPH-II and -III prevail in human wastewater. However, this distribution is not absolute, and variable survival rates in these subgroups lead to misinterpretation of the original distribution. In this context, we studied FRNAPH distribution in urban wastewater and animal feces/wastewater. To increase the specificity, we partially sequenced the genomes of phages of urban and animal origins. The persistence of the genomes and infectivity were also studied, over time in wastewater and during treatment, for each subgroup. FRNAPH-I genome sequences did not show any specific urban or animal clusters to allow development of molecular tools for differentiation. They were the most resistant and as such may be used as fecal or viral indicators. FRNAPH-II's low prevalence and low sequence variability in animal stools, combined with specific clusters formed by urban strains, allowed differentiation between urban and animal pollution by using a specific reverse transcription-PCR (RT-PCR) method. The subgroup's resistance over time was comparable to that of FRNAPH-I, but its surface properties allowed higher elimination rates during activated-sludge treatment. FRNAPH-III's low sequence variability in animal wastewater and specific cluster formation by urban strains also allowed differentiation by using a specific RT-PCR method. Nevertheless, its low resistance restricted it to being used only for recent urban pollution detection. FRNAPH-IV was too rare to be used. PMID:26162878

  9. Occurrence of and Sequence Variation among F-Specific RNA Bacteriophage Subgroups in Feces and Wastewater of Urban and Animal Origins.

    PubMed

    Hartard, C; Rivet, R; Banas, S; Gantzer, C

    2015-09-01

    F-specific RNA bacteriophages (FRNAPH) have been widely studied as tools for evaluating fecal or viral pollution in water. It has also been proposed that they can be used to differentiate human from animal fecal contamination. While FRNAPH subgroup I (FRNAPH-I) and FRNAPH-IV are often associated with animal pollution, FRNAPH-II and -III prevail in human wastewater. However, this distribution is not absolute, and variable survival rates in these subgroups lead to misinterpretation of the original distribution. In this context, we studied FRNAPH distribution in urban wastewater and animal feces/wastewater. To increase the specificity, we partially sequenced the genomes of phages of urban and animal origins. The persistence of the genomes and infectivity were also studied, over time in wastewater and during treatment, for each subgroup. FRNAPH-I genome sequences did not show any specific urban or animal clusters to allow development of molecular tools for differentiation. They were the most resistant and as such may be used as fecal or viral indicators. FRNAPH-II's low prevalence and low sequence variability in animal stools, combined with specific clusters formed by urban strains, allowed differentiation between urban and animal pollution by using a specific reverse transcription-PCR (RT-PCR) method. The subgroup's resistance over time was comparable to that of FRNAPH-I, but its surface properties allowed higher elimination rates during activated-sludge treatment. FRNAPH-III's low sequence variability in animal wastewater and specific cluster formation by urban strains also allowed differentiation by using a specific RT-PCR method. Nevertheless, its low resistance restricted it to being used only for recent urban pollution detection. FRNAPH-IV was too rare to be used. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. Nonparametric Bayesian clustering to detect bipolar methylated genomic loci.

    PubMed

    Wu, Xiaowei; Sun, Ming-An; Zhu, Hongxiao; Xie, Hehuang

    2015-01-16

    With recent development in sequencing technology, a large number of genome-wide DNA methylation studies have generated massive amounts of bisulfite sequencing data. The analysis of DNA methylation patterns helps researchers understand epigenetic regulatory mechanisms. Highly variable methylation patterns reflect stochastic fluctuations in DNA methylation, whereas well-structured methylation patterns imply deterministic methylation events. Among these methylation patterns, bipolar patterns are important as they may originate from allele-specific methylation (ASM) or cell-specific methylation (CSM). Utilizing nonparametric Bayesian clustering followed by hypothesis testing, we have developed a novel statistical approach to identify bipolar methylated genomic regions in bisulfite sequencing data. Simulation studies demonstrate that the proposed method achieves good performance in terms of specificity and sensitivity. We used the method to analyze data from mouse brain and human blood methylomes. The bipolar methylated segments detected are found highly consistent with the differentially methylated regions identified by using purified cell subsets. Bipolar DNA methylation often indicates epigenetic heterogeneity caused by ASM or CSM. With allele-specific events filtered out or appropriately taken into account, our proposed approach sheds light on the identification of cell-specific genes/pathways under strong epigenetic control in a heterogeneous cell population.

  11. Isolation and characterization of Y chromosome sequences from the African malaria mosquito Anopheles gambiae.

    PubMed Central

    Krzywinski, Jaroslaw; Nusskern, Deborah R; Kern, Marcia K; Besansky, Nora J

    2004-01-01

    The karyotype of the African malaria mosquito Anopheles gambiae contains two pairs of autosomes and a pair of sex chromosomes. The Y chromosome, constituting approximately 10% of the genome, remains virtually unexplored, despite the recent completion of the A. gambiae genome project. Here we report the identification and characterization of Y chromosome sequences of total length approaching 150 kb. We developed 11 Y-specific PCR markers that consistently yielded male-specific products in specimens from both laboratory colony and natural populations. The markers are characterized by low sequence polymorphism in samples collected across Africa and by presence in more than one copy on the Y. Screening of the A. gambiae BAC library using these markers allowed detection of 90 Y-linked BAC clones. Analysis of the BAC sequences and other Y-derived fragments showed massive accumulation of a few transposable elements. Nevertheless, more complex sequences are apparently present on the Y; these include portions of an approximately 48-kb-long unmapped AAAB01008227 scaffold from the whole genome shotgun assembly. Anopheles Y appears not to harbor any of the genes identified in Drosophila Y. However, experiments suggest that one of the ORFs from the AAAB01008227 scaffold represents a fragment of a gene with male-specific expression. PMID:15082548

  12. Genome of Epinotia aporema granulovirus (EpapGV), a polyorganotropic fast killing betabaculovirus with a novel thymidylate kinase gene

    PubMed Central

    2012-01-01

    Background Epinotia aporema (Lepidoptera: Tortricidae) is an important pest of legume crops in South America. Epinotia aporema granulovirus (EpapGV) is a baculovirus that causes a polyorganotropic infection in the host larva. Its high pathogenicity and host specificity make EpapGV an excellent candidate to be used as a biological control agent. Results The genome of Epinotia aporema granulovirus (EpapGV) was sequenced and analyzed. Its circular double-stranded DNA genome is 119,082 bp in length and codes for 133 putative genes. It contains the 31 baculovirus core genes and a set of 19 genes that are GV exclusive. Seventeen ORFs were unique to EpapGV in comparison with other baculoviruses. Of these, 16 found no homologues in GenBank, and one encoded a thymidylate kinase. Analysis of nucleotide sequence repeats revealed the presence of 16 homologous regions (hrs) interspersed throughout the genome. Each hr was characterized by the presence of 1 to 3 clustered imperfect palindromes which are similar to previously described palindromes of tortricid-specific GVs. Also, one of the hrs (hr4) has flanking sequences suggestive of a putative non-hr ori. Interestingly, two more complex hrs were found in opposite loci, dividing the circular dsDNA genome in two halves. Gene synteny maps showed the great colinearity of sequenced GVs, being EpapGV the most dissimilar as it has a 20 kb-long gene block inversion. Phylogenetic study performed with 31 core genes of 58 baculoviral genomes suggests that EpapGV is the baculovirus isolate closest to the putative common ancestor of tortricid specific betabaculoviruses. Conclusions This study, along with previous characterization of EpapGV infection, is useful for the better understanding of the pathology caused by this virus and its potential utilization as a bioinsecticide. PMID:23051685

  13. A Single Transcriptome of a Green Toad (Bufo viridis) Yields Candidate Genes for Sex Determination and -Differentiation and Non-Anonymous Population Genetic Markers

    PubMed Central

    Gerchen, Jörn F.; Reichert, Samuel J.; Röhr, Johannes T.; Dieterich, Christoph; Kloas, Werner

    2016-01-01

    Large genome size, including immense repetitive and non-coding fractions, still present challenges for capacity, bioinformatics and thus affordability of whole genome sequencing in most amphibians. Here, we test the performance of a single transcriptome to understand whether it can provide a cost-efficient resource for species with large unknown genomes. Using RNA from six different tissues from a single Palearctic green toad (Bufo viridis) specimen and Hiseq2000, we obtained 22,5 Mio reads and publish >100,000 unigene sequences. To evaluate efficacy and quality, we first use this data to identify green toad specific candidate genes, known from other vertebrates for their role in sex determination and differentiation. Of a list of 37 genes, the transcriptome yielded 32 (87%), many of which providing the first such data for this non-model anuran species. However, for many of these genes, only fragments could be retrieved. In order to allow also applications to population genetics, we further used the transcriptome for the targeted development of 21 non-anonymous microsatellites and tested them in genetic families and backcrosses. Eleven markers were specifically developed to be located on the B. viridis sex chromosomes; for eight markers we can indeed demonstrate sex-specific transmission in genetic families. Depending on phylogenetic distance, several markers, which are sex-linked in green toads, show high cross-amplification success across the anuran phylogeny, involving nine systematic anuran families. Our data support the view that single transcriptome sequencing (based on multiple tissues) provides a reliable genomic resource and cost-efficient method for non-model amphibian species with large genome size and, despite limitations, should be considered as long as genome sequencing remains unaffordable for most species. PMID:27232626

  14. Complete genome sequences and comparative genome analysis of Lactobacillus plantarum strain 5-2 isolated from fermented soybean.

    PubMed

    Liu, Chen-Jian; Wang, Rui; Gong, Fu-Ming; Liu, Xiao-Feng; Zheng, Hua-Jun; Luo, Yi-Yong; Li, Xiao-Ran

    2015-12-01

    Lactobacillus plantarum is an important probiotic and is mostly isolated from fermented foods. We sequenced the genome of L. plantarum strain 5-2, which was derived from fermented soybean isolated from Yunnan province, China. The strain was determined to contain 3114 genes. Fourteen complete insertion sequence (IS) elements were found in 5-2 chromosome. There were 24 DNA replication proteins and 76 DNA repair proteins in the 5-2 genome. Consistent with the classification of L. plantarum as a facultative heterofermentative lactobacillus, the 5-2 genome encodes key enzymes required for the EMP (Embden-Meyerhof-Parnas) and phosphoketolase (PK) pathways. Several components of the secretion machinery are found in the 5-2 genome, which was compared with L. plantarum ST-III, JDM1 and WCFS1. Most of the specific proteins in the four genomes appeared to be related to their prophage elements. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts

    PubMed Central

    Jukam, David; Teran, Nicole A; Risca, Viviana I; Smith, Owen K; Johnson, Whitney L; Skotheim, Jan M; Greenleaf, William James

    2018-01-01

    RNA is a critical component of chromatin in eukaryotes, both as a product of transcription, and as an essential constituent of ribonucleoprotein complexes that regulate both local and global chromatin states. Here, we present a proximity ligation and sequencing method called Chromatin-Associated RNA sequencing (ChAR-seq) that maps all RNA-to-DNA contacts across the genome. Using Drosophila cells, we show that ChAR-seq provides unbiased, de novo identification of targets of chromatin-bound RNAs including nascent transcripts, chromosome-specific dosage compensation ncRNAs, and genome-wide trans-associated RNAs involved in co-transcriptional RNA processing. PMID:29648534

  16. DNA methylation at hepatitis B viral integrants is associated with methylation at flanking human genomic sequences

    PubMed Central

    Watanabe, Yoshiyuki; Yamamoto, Hiroyuki; Oikawa, Ritsuko; Toyota, Minoru; Yamamoto, Masakazu; Kokudo, Norihiro; Tanaka, Shinji; Arii, Shigeki; Yotsuyanagi, Hiroshi; Koike, Kazuhiko; Itoh, Fumio

    2015-01-01

    Integration of DNA viruses into the human genome plays an important role in various types of tumors, including hepatitis B virus (HBV)–related hepatocellular carcinoma. However, the molecular details and clinical impact of HBV integration on either human or HBV epigenomes are unknown. Here, we show that methylation of the integrated HBV DNA is related to the methylation status of the flanking human genome. We developed a next-generation sequencing-based method for structural methylation analysis of integrated viral genomes (denoted G-NaVI). This method is a novel approach that enables enrichment of viral fragments for sequencing using unique baits based on the sequence of the HBV genome. We detected integrated HBV sequences in the genome of the PLC/PRF/5 cell line and found variable levels of methylation within the integrated HBV genomes. Allele-specific methylation analysis revealed that the HBV genome often became significantly methylated when integrated into highly methylated host sites. After integration into unmethylated human genome regions such as promoters, however, the HBV DNA remains unmethylated and may eventually play an important role in tumorigenesis. The observed dynamic changes in DNA methylation of the host and viral genomes may functionally affect the biological behavior of HBV. These findings may impact public health given that millions of people worldwide are carriers of HBV. We also believe our assay will be a powerful tool to increase our understanding of the various types of DNA virus-associated tumorigenesis. PMID:25653310

  17. A specific indel marker for the Philippines Schistosoma japonicum revealed by analysis of mitochondrial genome sequences.

    PubMed

    Li, Juan; Chen, Fen; Sugiyama, Hiromu; Blair, David; Lin, Rui-Qing; Zhu, Xing-Quan

    2015-07-01

    In the present study, near-complete mitochondrial (mt) genome sequences for Schistosoma japonicum from different regions in the Philippines and Japan were amplified and sequenced. Comparisons among S. japonicum from the Philippines, Japan, and China revealed a geographically based length difference in mt genomes, but the mt genomic organization and gene arrangement were the same. Sequence differences among samples from the Philippines and all samples from the three endemic areas were 0.57-2.12 and 0.76-3.85 %, respectively. The most variable part of the mt genome was the non-coding region. In the coding portion of the genome, protein-coding genes varied more than rRNA genes and tRNAs. The near-complete mt genome sequences for Philippine specimens were identical in length (14,091 bp) which was 4 bp longer than those of S. japonicum samples from Japan and China. This indel provides a unique genetic marker for S. japonicum samples from the Philippines. Phylogenetic analyses based on the concatenated amino acids of 12 protein-coding genes showed that samples of S. japonicum clustered according to their geographical origins. The identified mitochondrial indel marker will be useful for tracing the source of S. japonicum infection in humans and animals in Southeast Asia.

  18. Chromosomal targeting by CRISPR-Cas systems can contribute to genome plasticity in bacteria

    PubMed Central

    Dy, Ron L; Pitman, Andrew R; Fineran, Peter C

    2013-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR) and their associated (Cas) proteins form adaptive immune systems in bacteria to combat phage and other foreign genetic elements. Typically, short spacer sequences are acquired from the invader DNA and incorporated into CRISPR arrays in the bacterial genome. Small RNAs are generated that contain these spacer sequences and enable sequence-specific destruction of the foreign nucleic acids. Occasionally, spacers are acquired from the chromosome, which instead leads to targeting of the host genome. Chromosomal targeting is highly toxic to the bacterium, providing a strong selective pressure for a variety of evolutionary routes that enable host cell survival. Mutations that inactivate the CRISPR-Cas functionality, such as within the cas genes, CRISPR repeat, protospacer adjacent motifs (PAM), and target sequence, mediate escape from toxicity. This self-targeting might provide some explanation for the incomplete distribution of CRISPR-Cas systems in less than half of sequenced bacterial genomes. More importantly, self-genome targeting can cause large-scale genomic alterations, including remodeling or deletion of pathogenicity islands and other non-mobile chromosomal regions. While control of horizontal gene transfer is perceived as their main function, our recent work illuminates an alternative role of CRISPR-Cas systems in causing host genomic changes and influencing bacterial evolution. PMID:24251073

  19. The Genome Portal of the Department of Energy Joint Genome Institute

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nordberg, Henrik; Cantor, Michael; Dushekyo, Serge

    2014-03-14

    The JGI Genome Portal (http://genome.jgi.doe.gov) provides unified access to all JGI genomic databases and analytical tools. A user can search, download and explore multiple data sets available for all DOE JGI sequencing projects including their status, assemblies and annotations of sequenced genomes. Genome Portal in the past 2 years was significantly updated, with a specific emphasis on efficient handling of the rapidly growing amount of diverse genomic data accumulated in JGI. A critical aspect of handling big data in genomics is the development of visualization and analysis tools that allow scientists to derive meaning from what are otherwise terrabases ofmore » inert sequence. An interactive visualization tool developed in the group allows us to explore contigs resulting from a single metagenome assembly. Implemented with modern web technologies that take advantage of the power of the computer's graphical processing unit (gpu), the tool allows the user to easily navigate over a 100,000 data points in multiple dimensions, among many biologically meaningful parameters of a dataset such as relative abundance, contig length, and G+C content.« less

  20. Integrated genome sequence and linkage map of physic nut (Jatropha curcas L.), a biodiesel plant.

    PubMed

    Wu, Pingzhi; Zhou, Changpin; Cheng, Shifeng; Wu, Zhenying; Lu, Wenjia; Han, Jinli; Chen, Yanbo; Chen, Yan; Ni, Peixiang; Wang, Ying; Xu, Xun; Huang, Ying; Song, Chi; Wang, Zhiwen; Shi, Nan; Zhang, Xudong; Fang, Xiaohua; Yang, Qing; Jiang, Huawu; Chen, Yaping; Li, Meiru; Wang, Ying; Chen, Fan; Wang, Jun; Wu, Guojiang

    2015-03-01

    The family Euphorbiaceae includes some of the most efficient biomass accumulators. Whole genome sequencing and the development of genetic maps of these species are important components in molecular breeding and genetic improvement. Here we report the draft genome of physic nut (Jatropha curcas L.), a biodiesel plant. The assembled genome has a total length of 320.5 Mbp and contains 27,172 putative protein-coding genes. We established a linkage map containing 1208 markers and anchored the genome assembly (81.7%) to this map to produce 11 pseudochromosomes. After gene family clustering, 15,268 families were identified, of which 13,887 existed in the castor bean genome. Analysis of the genome highlighted specific expansion and contraction of a number of gene families during the evolution of this species, including the ribosome-inactivating proteins and oil biosynthesis pathway enzymes. The genomic sequence and linkage map provide a valuable resource not only for fundamental and applied research on physic nut but also for evolutionary and comparative genomics analysis, particularly in the Euphorbiaceae. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  1. Ten years of maintaining and expanding a microbial genome and metagenome analysis system.

    PubMed

    Markowitz, Victor M; Chen, I-Min A; Chu, Ken; Pati, Amrita; Ivanova, Natalia N; Kyrpides, Nikos C

    2015-11-01

    Launched in March 2005, the Integrated Microbial Genomes (IMG) system is a comprehensive data management system that supports multidimensional comparative analysis of genomic data. At the core of the IMG system is a data warehouse that contains genome and metagenome datasets sequenced at the Joint Genome Institute or provided by scientific users, as well as public genome datasets available at the National Center for Biotechnology Information Genbank sequence data archive. Genomes and metagenome datasets are processed using IMG's microbial genome and metagenome sequence data processing pipelines and are integrated into the data warehouse using IMG's data integration toolkits. Microbial genome and metagenome application specific data marts and user interfaces provide access to different subsets of IMG's data and analysis toolkits. This review article revisits IMG's original aims, highlights key milestones reached by the system during the past 10 years, and discusses the main challenges faced by a rapidly expanding system, in particular the complexity of maintaining such a system in an academic setting with limited budgets and computing and data management infrastructure. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. “A draft Musa balbisiana genome sequence for molecular genetics in polyploid, inter- and intra-specific Musa hybrids”

    PubMed Central

    2013-01-01

    Background Modern banana cultivars are primarily interspecific triploid hybrids of two species, Musa acuminata and Musa balbisiana, which respectively contribute the A- and B-genomes. The M. balbisiana genome has been associated with improved vigour and tolerance to biotic and abiotic stresses and is thus a target for Musa breeding programs. However, while a reference M. acuminata genome has recently been released (Nature 488:213–217, 2012), little sequence data is available for the corresponding B-genome. To address these problems we carried out Next Generation gDNA sequencing of the wild diploid M. balbisiana variety ‘Pisang Klutuk Wulung’ (PKW). Our strategy was to align PKW gDNA reads against the published A-genome and to extract the mapped consensus sequences for subsequent rounds of evaluation and gene annotation. Results The resulting B-genome is 79% the size of the A-genome, and contains 36,638 predicted functional gene sequences which is nearly identical to the 36,542 of the A-genome. There is substantial sequence divergence from the A-genome at a frequency of 1 homozygous SNP per 23.1 bp, and a high degree of heterozygosity corresponding to one heterozygous SNP per 55.9 bp. Using expressed small RNA data, a similar number of microRNA sequences were predicted in both A- and B-genomes, but additional novel miRNAs were detected, including some that are unique to each genome. The usefulness of this B-genome sequence was evaluated by mapping RNA-seq data from a set of triploid AAA and AAB hybrids simultaneously to both genomes. Results for the plantains demonstrated the expected 2:1 distribution of reads across the A- and B-genomes, but for the AAA genomes, results show they contain regions of significant homology to the B-genome supporting proposals that there has been a history of interspecific recombination between homeologous A and B chromosomes in Musa hybrids. Conclusions We have generated and annotated a draft reference Musa B-genome and demonstrate that this can be used for molecular genetic mapping of gene transcripts and small RNA expression data from several allopolyploid banana cultivars. This draft therefore represents a valuable resource to support the study of metabolism in inter- and intraspecific triploid Musa hybrids and to help direct breeding programs. PMID:24094114

  3. Within-genome evolution of REPINs: a new family of miniature mobile DNA in bacteria.

    PubMed

    Bertels, Frederic; Rainey, Paul B

    2011-06-01

    Repetitive sequences are a conserved feature of many bacterial genomes. While first reported almost thirty years ago, and frequently exploited for genotyping purposes, little is known about their origin, maintenance, or processes affecting the dynamics of within-genome evolution. Here, beginning with analysis of the diversity and abundance of short oligonucleotide sequences in the genome of Pseudomonas fluorescens SBW25, we show that over-represented short sequences define three distinct groups (GI, GII, and GIII) of repetitive extragenic palindromic (REP) sequences. Patterns of REP distribution suggest that closely linked REP sequences form a functional replicative unit: REP doublets are over-represented, randomly distributed in extragenic space, and more highly conserved than singlets. In addition, doublets are organized as inverted repeats, which together with intervening spacer sequences are predicted to form hairpin structures in ssDNA or mRNA. We refer to these newly defined entities as REPINs (REP doublets forming hairpins) and identify short reads from population sequencing that reveal putative transposition intermediates. The proximal relationship between GI, GII, and GIII REPINs and specific REP-associated tyrosine transposases (RAYTs), combined with features of the putative transposition intermediate, suggests a mechanism for within-genome dissemination. Analysis of the distribution of REPs in a range of RAYT-containing bacterial genomes, including Escherichia coli K-12 and Nostoc punctiforme, show that REPINs are a widely distributed, but hitherto unrecognized, family of miniature non-autonomous mobile DNA.

  4. Sensitivity to sequencing depth in single-cell cancer genomics.

    PubMed

    Alves, João M; Posada, David

    2018-04-16

    Querying cancer genomes at single-cell resolution is expected to provide a powerful framework to understand in detail the dynamics of cancer evolution. However, given the high costs currently associated with single-cell sequencing, together with the inevitable technical noise arising from single-cell genome amplification, cost-effective strategies that maximize the quality of single-cell data are critically needed. Taking advantage of previously published single-cell whole-genome and whole-exome cancer datasets, we studied the impact of sequencing depth and sampling effort towards single-cell variant detection. Five single-cell whole-genome and whole-exome cancer datasets were independently downscaled to 25, 10, 5, and 1× sequencing depth. For each depth level, ten technical replicates were generated, resulting in a total of 6280 single-cell BAM files. The sensitivity of variant detection, including structural and driver mutations, genotyping, clonal inference, and phylogenetic reconstruction to sequencing depth was evaluated using recent tools specifically designed for single-cell data. Altogether, our results suggest that for relatively large sample sizes (25 or more cells) sequencing single tumor cells at depths > 5× does not drastically improve somatic variant discovery, characterization of clonal genotypes, or estimation of single-cell phylogenies. We suggest that sequencing multiple individual tumor cells at a modest depth represents an effective alternative to explore the mutational landscape and clonal evolutionary patterns of cancer genomes.

  5. Genome organization of epidemic Acinetobacter baumannii strains.

    PubMed

    Di Nocera, Pier Paolo; Rocco, Francesco; Giannouli, Maria; Triassi, Maria; Zarrilli, Raffaele

    2011-10-10

    Acinetobacter baumannii is an opportunistic pathogen responsible for hospital-acquired infections. A. baumannii epidemics described world-wide were caused by few genotypic clusters of strains. The occurrence of epidemics caused by multi-drug resistant strains assigned to novel genotypes have been reported over the last few years. In the present study, we compared whole genome sequences of three A. baumannii strains assigned to genotypes ST2, ST25 and ST78, representative of the most frequent genotypes responsible for epidemics in several Mediterranean hospitals, and four complete genome sequences of A. baumannii strains assigned to genotypes ST1, ST2 and ST77. Comparative genome analysis showed extensive synteny and identified 3068 coding regions which are conserved, at the same chromosomal position, in all A. baumannii genomes. Genome alignments also identified 63 DNA regions, ranging in size from 4 o 126 kb, all defined as genomic islands, which were present in some genomes, but were either missing or replaced by non-homologous DNA sequences in others. Some islands are involved in resistance to drugs and metals, others carry genes encoding surface proteins or enzymes involved in specific metabolic pathways, and others correspond to prophage-like elements. Accessory DNA regions encode 12 to 19% of the potential gene products of the analyzed strains. The analysis of a collection of epidemic A. baumannii strains showed that some islands were restricted to specific genotypes. The definition of the genome components of A. baumannii provides a scaffold to rapidly evaluate the genomic organization of novel clinical A. baumannii isolates. Changes in island profiling will be useful in genomic epidemiology of A. baumannii population.

  6. MBGD update 2015: microbial genome database for flexible ortholog analysis utilizing a diverse set of genomic data.

    PubMed

    Uchiyama, Ikuo; Mihara, Motohiro; Nishide, Hiroyo; Chiba, Hirokazu

    2015-01-01

    The microbial genome database for comparative analysis (MBGD) (available at http://mbgd.genome.ad.jp/) is a comprehensive ortholog database for flexible comparative analysis of microbial genomes, where the users are allowed to create an ortholog table among any specified set of organisms. Because of the rapid increase in microbial genome data owing to the next-generation sequencing technology, it becomes increasingly challenging to maintain high-quality orthology relationships while allowing the users to incorporate the latest genomic data available into an analysis. Because many of the recently accumulating genomic data are draft genome sequences for which some complete genome sequences of the same or closely related species are available, MBGD now stores draft genome data and allows the users to incorporate them into a user-specific ortholog database using the MyMBGD functionality. In this function, draft genome data are incorporated into an existing ortholog table created only from the complete genome data in an incremental manner to prevent low-quality draft data from affecting clustering results. In addition, to provide high-quality orthology relationships, the standard ortholog table containing all the representative genomes, which is first created by the rapid classification program DomClust, is now refined using DomRefine, a recently developed program for improving domain-level clustering using multiple sequence alignment information. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Expanding probe repertoire and improving reproducibility in human genomic hybridization

    PubMed Central

    Dorman, Stephanie N.; Shirley, Ben C.; Knoll, Joan H. M.; Rogan, Peter K.

    2013-01-01

    Diagnostic DNA hybridization relies on probes composed of single copy (sc) genomic sequences. Sc sequences in probe design ensure high specificity and avoid cross-hybridization to other regions of the genome, which could lead to ambiguous results that are difficult to interpret. We examine how the distribution and composition of repetitive sequences in the genome affects sc probe performance. A divide and conquer algorithm was implemented to design sc probes. With this approach, sc probes can include divergent repetitive elements, which hybridize to unique genomic targets under higher stringency experimental conditions. Genome-wide custom probe sets were created for fluorescent in situ hybridization (FISH) and microarray genomic hybridization. The scFISH probes were developed for detection of copy number changes within small tumour suppressor genes and oncogenes. The microarrays demonstrated increased reproducibility by eliminating cross-hybridization to repetitive sequences adjacent to probe targets. The genome-wide microarrays exhibited lower median coefficients of variation (17.8%) for two HapMap family trios. The coefficients of variations of commercial probes within 300 nt of a repetitive element were 48.3% higher than the nearest custom probe. Furthermore, the custom microarray called a chromosome 15q11.2q13 deletion more consistently. This method for sc probe design increases probe coverage for FISH and lowers variability in genomic microarrays. PMID:23376933

  8. AmphiBase: A new genomic resource for non-model amphibian species.

    PubMed

    Kwon, Taejoon

    2017-01-01

    More than five thousand genes annotated in the recently published Xenopus laevis and Xenopus tropicalis genomes do not have a candidate orthologous counterpart in other vertebrate species. To determine whether these sequences represent genuine amphibian-specific genes or annotation errors, it is necessary to analyze them alongside sequences from other amphibian species. However, due to large genome sizes and an abundance of repeat sequences, there are limited numbers of gene sequences available from amphibian species other than Xenopus. AmphiBase is a new genomic resource covering non-model amphibian species, based on public domain transcriptome data and computational methods developed during the X. laevis genome project. Here, I review the current status of AmphiBase, including amphibian species with available transcriptome data or biological samples, and describe the challenges of building a comprehensive amphibian genomic resource in the absence of genomes. This mini-review will be informative for researchers interested in functional genomic experiments using amphibian model organisms, such as Xenopus and axolotl, and will assist in interpretation of results implicating "orphan genes." Additionally, this study highlights an opportunity for researchers working on non-model amphibian species to collaborate in their future efforts and develop amphibian genomic resources as a community. © 2017 Wiley Periodicals, Inc.

  9. Dynamics and Differential Proliferation of Transposable Elements During the Evolution of the B and A Genomes of Wheat

    PubMed Central

    Charles, Mathieu; Belcram, Harry; Just, Jérémy; Huneau, Cécile; Viollet, Agnès; Couloux, Arnaud; Segurens, Béatrice; Carter, Meredith; Huteau, Virginie; Coriton, Olivier; Appels, Rudi; Samain, Sylvie; Chalhoub, Boulos

    2008-01-01

    Transposable elements (TEs) constitute >80% of the wheat genome but their dynamics and contribution to size variation and evolution of wheat genomes (Triticum and Aegilops species) remain unexplored. In this study, 10 genomic regions have been sequenced from wheat chromosome 3B and used to constitute, along with all publicly available genomic sequences of wheat, 1.98 Mb of sequence (from 13 BAC clones) of the wheat B genome and 3.63 Mb of sequence (from 19 BAC clones) of the wheat A genome. Analysis of TE sequence proportions (as percentages), ratios of complete to truncated copies, and estimation of insertion dates of class I retrotransposons showed that specific types of TEs have undergone waves of differential proliferation in the B and A genomes of wheat. While both genomes show similar rates and relatively ancient proliferation periods for the Athila retrotransposons, the Copia retrotransposons proliferated more recently in the A genome whereas Gypsy retrotransposon proliferation is more recent in the B genome. It was possible to estimate for the first time the proliferation periods of the abundant CACTA class II DNA transposons, relative to that of the three main retrotransposon superfamilies. Proliferation of these TEs started prior to and overlapped with that of the Athila retrotransposons in both genomes. However, they also proliferated during the same periods as Gypsy and Copia retrotransposons in the A genome, but not in the B genome. As estimated from their insertion dates and confirmed by PCR-based tracing analysis, the majority of differential proliferation of TEs in B and A genomes of wheat (87 and 83%, respectively), leading to rapid sequence divergence, occurred prior to the allotetraploidization event that brought them together in Triticum turgidum and Triticum aestivum, <0.5 million years ago. More importantly, the allotetraploidization event appears to have neither enhanced nor repressed retrotranspositions. We discuss the apparent proliferation of TEs as resulting from their insertion, removal, and/or combinations of both evolutionary forces. PMID:18780739

  10. In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

    PubMed Central

    2013-01-01

    Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

  11. Genome sequence of the model medicinal mushroom Ganoderma lucidum

    PubMed Central

    Chen, Shilin; Xu, Jiang; Liu, Chang; Zhu, Yingjie; Nelson, David R.; Zhou, Shiguo; Li, Chunfang; Wang, Lizhi; Guo, Xu; Sun, Yongzhen; Luo, Hongmei; Li, Ying; Song, Jingyuan; Henrissat, Bernard; Levasseur, Anthony; Qian, Jun; Li, Jianqin; Luo, Xiang; Shi, Linchun; He, Liu; Xiang, Li; Xu, Xiaolan; Niu, Yunyun; Li, Qiushi; Han, Mira V.; Yan, Haixia; Zhang, Jin; Chen, Haimei; Lv, Aiping; Wang, Zhen; Liu, Mingzhu; Schwartz, David C.; Sun, Chao

    2012-01-01

    Ganoderma lucidum is a widely used medicinal macrofungus in traditional Chinese medicine that creates a diverse set of bioactive compounds. Here we report its 43.3-Mb genome, encoding 16,113 predicted genes, obtained using next-generation sequencing and optical mapping approaches. The sequence analysis reveals an impressive array of genes encoding cytochrome P450s (CYPs), transporters and regulatory proteins that cooperate in secondary metabolism. The genome also encodes one of the richest sets of wood degradation enzymes among all of the sequenced basidiomycetes. In all, 24 physical CYP gene clusters are identified. Moreover, 78 CYP genes are coexpressed with lanosterol synthase, and 16 of these show high similarity to fungal CYPs that specifically hydroxylate testosterone, suggesting their possible roles in triterpenoid biosynthesis. The elucidation of the G. lucidum genome makes this organism a potential model system for the study of secondary metabolic pathways and their regulation in medicinal fungi. PMID:22735441

  12. Draft Genome Sequences of Two Species of "Difficult-to-Identify" Human-Pathogenic Corynebacteria: Implications for Better Identification Tests.

    PubMed

    Pacheco, Luis G C; Mattos-Guaraldi, Ana L; Santos, Carolina S; Veras, Adonney A O; Guimarães, Luis C; Abreu, Vinícius; Pereira, Felipe L; Soares, Siomar C; Dorella, Fernanda A; Carvalho, Alex F; Leal, Carlos G; Figueiredo, Henrique C P; Ramos, Juliana N; Vieira, Veronica V; Farfour, Eric; Guiso, Nicole; Hirata, Raphael; Azevedo, Vasco; Silva, Artur; Ramos, Rommel T J

    2015-01-01

    Non-diphtheriae Corynebacterium species have been increasingly recognized as the causative agents of infections in humans. Differential identification of these bacteria in the clinical microbiology laboratory by the most commonly used biochemical tests is challenging, and normally requires additional molecular methods. Herein, we present the annotated draft genome sequences of two isolates of "difficult-to-identify" human-pathogenic corynebacterial species: C. xerosis and C. minutissimum. The genome sequences of ca. 2.7 Mbp, with a mean number of 2,580 protein encoding genes, were also compared with the publicly available genome sequences of strains of C. amycolatum and C. striatum. These results will aid the exploration of novel biochemical reactions to improve existing identification tests as well as the development of more accurate molecular identification methods through detection of species-specific target genes for isolate's identification or drug susceptibility profiling.

  13. Metavir 2: new tools for viral metagenome comparison and assembled virome analysis

    PubMed Central

    2014-01-01

    Background Metagenomics, based on culture-independent sequencing, is a well-fitted approach to provide insights into the composition, structure and dynamics of environmental viral communities. Following recent advances in sequencing technologies, new challenges arise for existing bioinformatic tools dedicated to viral metagenome (i.e. virome) analysis as (i) the number of viromes is rapidly growing and (ii) large genomic fragments can now be obtained by assembling the huge amount of sequence data generated for each metagenome. Results To face these challenges, a new version of Metavir was developed. First, all Metavir tools have been adapted to support comparative analysis of viromes in order to improve the analysis of multiple datasets. In addition to the sequence comparison previously provided, viromes can now be compared through their k-mer frequencies, their taxonomic compositions, recruitment plots and phylogenetic trees containing sequences from different datasets. Second, a new section has been specifically designed to handle assembled viromes made of thousands of large genomic fragments (i.e. contigs). This section includes an annotation pipeline for uploaded viral contigs (gene prediction, similarity search against reference viral genomes and protein domains) and an extensive comparison between contigs and reference genomes. Contigs and their annotations can be explored on the website through specifically developed dynamic genomic maps and interactive networks. Conclusions The new features of Metavir 2 allow users to explore and analyze viromes composed of raw reads or assembled fragments through a set of adapted tools and a user-friendly interface. PMID:24646187

  14. HuMiChip: Development of a Functional Gene Array for the Study of Human Microbiomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tu, Q.; Deng, Ye; Lin, Lu

    Microbiomes play very important roles in terms of nutrition, health and disease by interacting with their hosts. Based on sequence data currently available in public domains, we have developed a functional gene array to monitor both organismal and functional gene profiles of normal microbiota in human and mouse hosts, and such an array is called human and mouse microbiota array, HMM-Chip. First, seed sequences were identified from KEGG databases, and used to construct a seed database (seedDB) containing 136 gene families in 19 metabolic pathways closely related to human and mouse microbiomes. Second, a mother database (motherDB) was constructed withmore » 81 genomes of bacterial strains with 54 from gut and 27 from oral environments, and 16 metagenomes, and used for selection of genes and probe design. Gene prediction was performed by Glimmer3 for bacterial genomes, and by the Metagene program for metagenomes. In total, 228,240 and 801,599 genes were identified for bacterial genomes and metagenomes, respectively. Then the motherDB was searched against the seedDB using the HMMer program, and gene sequences in the motherDB that were highly homologous with seed sequences in the seedDB were used for probe design by the CommOligo software. Different degrees of specific probes, including gene-specific, inclusive and exclusive group-specific probes were selected. All candidate probes were checked against the motherDB and NCBI databases for specificity. Finally, 7,763 probes covering 91.2percent (12,601 out of 13,814) HMMer confirmed sequences from 75 bacterial genomes and 16 metagenomes were selected. This developed HMM-Chip is able to detect the diversity and abundance of functional genes, the gene expression of microbial communities, and potentially, the interactions of microorganisms and their hosts.« less

  15. Mechanistically Distinct Pathways of Divergent Regulatory DNA Creation Contribute to Evolution of Human-Specific Genomic Regulatory Networks Driving Phenotypic Divergence of Homo sapiens

    PubMed Central

    Glinsky, Gennadi V.

    2016-01-01

    Abstract Thousands of candidate human-specific regulatory sequences (HSRS) have been identified, supporting the hypothesis that unique to human phenotypes result from human-specific alterations of genomic regulatory networks. Collectively, a compendium of multiple diverse families of HSRS that are functionally and structurally divergent from Great Apes could be defined as the backbone of human-specific genomic regulatory networks. Here, the conservation patterns analysis of 18,364 candidate HSRS was carried out requiring that 100% of bases must remap during the alignments of human, chimpanzee, and bonobo sequences. A total of 5,535 candidate HSRS were identified that are: (i) highly conserved in Great Apes; (ii) evolved by the exaptation of highly conserved ancestral DNA; (iii) defined by either the acceleration of mutation rates on the human lineage or the functional divergence from non-human primates. The exaptation of highly conserved ancestral DNA pathway seems mechanistically distinct from the evolution of regulatory DNA segments driven by the species-specific expansion of transposable elements. Genome-wide proximity placement analysis of HSRS revealed that a small fraction of topologically associating domains (TADs) contain more than half of HSRS from four distinct families. TADs that are enriched for HSRS and termed rapidly evolving in humans TADs (revTADs) comprise 0.8–10.3% of 3,127 TADs in the hESC genome. RevTADs manifest distinct correlation patterns between placements of human accelerated regions, human-specific transcription factor-binding sites, and recombination rates. There is a significant enrichment within revTAD boundaries of hESC-enhancers, primate-specific CTCF-binding sites, human-specific RNAPII-binding sites, hCONDELs, and H3K4me3 peaks with human-specific enrichment at TSS in prefrontal cortex neurons (P < 0.0001 in all instances). Present analysis supports the idea that phenotypic divergence of Homo sapiens is driven by the evolution of human-specific genomic regulatory networks via at least two mechanistically distinct pathways of creation of divergent sequences of regulatory DNA: (i) recombination-associated exaptation of the highly conserved ancestral regulatory DNA segments; (ii) human-specific insertions of transposable elements. PMID:27503290

  16. Comparative Analysis of Genome Sequences Covering the Seven Cronobacter Species

    PubMed Central

    Cummings, Craig A.; Shih, Rita; Degoricija, Lovorka; Rico, Alain; Brzoska, Pius; Hamby, Stephen E.; Masood, Naqash; Hariri, Sumyya; Sonbol, Hana; Chuzhanova, Nadia; McClelland, Michael; Furtado, Manohar R.; Forsythe, Stephen J.

    2012-01-01

    Background Species of Cronobacter are widespread in the environment and are occasional food-borne pathogens associated with serious neonatal diseases, including bacteraemia, meningitis, and necrotising enterocolitis. The genus is composed of seven species: C. sakazakii, C. malonaticus, C. turicensis, C. dublinensis, C. muytjensii, C. universalis, and C. condimenti. Clinical cases are associated with three species, C. malonaticus, C. turicensis and, in particular, with C. sakazakii multilocus sequence type 4. Thus, it is plausible that virulence determinants have evolved in certain lineages. Methodology/Principal Findings We generated high quality sequence drafts for eleven Cronobacter genomes representing the seven Cronobacter species, including an ST4 strain of C. sakazakii. Comparative analysis of these genomes together with the two publicly available genomes revealed Cronobacter has over 6,000 genes in one or more strains and over 2,000 genes shared by all Cronobacter. Considerable variation in the presence of traits such as type six secretion systems, metal resistance (tellurite, copper and silver), and adhesins were found. C. sakazakii is unique in the Cronobacter genus in encoding genes enabling the utilization of exogenous sialic acid which may have clinical significance. The C. sakazakii ST4 strain 701 contained additional genes as compared to other C. sakazakii but none of them were known specific virulence-related genes. Conclusions/Significance Genome comparison revealed that pair-wise DNA sequence identity varies between 89 and 97% in the seven Cronobacter species, and also suggested various degrees of divergence. Sets of universal core genes and accessory genes unique to each strain were identified. These gene sequences can be used for designing genus/species specific detection assays. Genes encoding adhesins, T6SS, and metal resistance genes as well as prophages are found in only subsets of genomes and have contributed considerably to the variation of genomic content. Differences in gene content likely contribute to differences in the clinical and environmental distribution of species and sequence types. PMID:23166675

  17. Genome-Wide Identification of Regulatory Sequences Undergoing Accelerated Evolution in the Human Genome.

    PubMed

    Dong, Xinran; Wang, Xiao; Zhang, Feng; Tian, Weidong

    2016-10-01

    Accelerated evolution of regulatory sequence can alter the expression pattern of target genes, and cause phenotypic changes. In this study, we used DNase I hypersensitive sites (DHSs) to annotate putative regulatory sequences in the human genome, and conducted a genome-wide analysis of the effects of accelerated evolution on regulatory sequences. Working under the assumption that local ancient repeat elements of DHSs are under neutral evolution, we discovered that ∼0.44% of DHSs are under accelerated evolution (ace-DHSs). We found that ace-DHSs tend to be more active than background DHSs, and are strongly associated with epigenetic marks of active transcription. The target genes of ace-DHSs are significantly enriched in neuron-related functions, and their expression levels are positively selected in the human brain. Thus, these lines of evidences strongly suggest that accelerated evolution on regulatory sequences plays important role in the evolution of human-specific phenotypes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Analyses of deep mammalian sequence alignments and constraint predictions for 1% of the human genome

    PubMed Central

    Margulies, Elliott H.; Cooper, Gregory M.; Asimenos, George; Thomas, Daryl J.; Dewey, Colin N.; Siepel, Adam; Birney, Ewan; Keefe, Damian; Schwartz, Ariel S.; Hou, Minmei; Taylor, James; Nikolaev, Sergey; Montoya-Burgos, Juan I.; Löytynoja, Ari; Whelan, Simon; Pardi, Fabio; Massingham, Tim; Brown, James B.; Bickel, Peter; Holmes, Ian; Mullikin, James C.; Ureta-Vidal, Abel; Paten, Benedict; Stone, Eric A.; Rosenbloom, Kate R.; Kent, W. James; Bouffard, Gerard G.; Guan, Xiaobin; Hansen, Nancy F.; Idol, Jacquelyn R.; Maduro, Valerie V.B.; Maskeri, Baishali; McDowell, Jennifer C.; Park, Morgan; Thomas, Pamela J.; Young, Alice C.; Blakesley, Robert W.; Muzny, Donna M.; Sodergren, Erica; Wheeler, David A.; Worley, Kim C.; Jiang, Huaiyang; Weinstock, George M.; Gibbs, Richard A.; Graves, Tina; Fulton, Robert; Mardis, Elaine R.; Wilson, Richard K.; Clamp, Michele; Cuff, James; Gnerre, Sante; Jaffe, David B.; Chang, Jean L.; Lindblad-Toh, Kerstin; Lander, Eric S.; Hinrichs, Angie; Trumbower, Heather; Clawson, Hiram; Zweig, Ann; Kuhn, Robert M.; Barber, Galt; Harte, Rachel; Karolchik, Donna; Field, Matthew A.; Moore, Richard A.; Matthewson, Carrie A.; Schein, Jacqueline E.; Marra, Marco A.; Antonarakis, Stylianos E.; Batzoglou, Serafim; Goldman, Nick; Hardison, Ross; Haussler, David; Miller, Webb; Pachter, Lior; Green, Eric D.; Sidow, Arend

    2007-01-01

    A key component of the ongoing ENCODE project involves rigorous comparative sequence analyses for the initially targeted 1% of the human genome. Here, we present orthologous sequence generation, alignment, and evolutionary constraint analyses of 23 mammalian species for all ENCODE targets. Alignments were generated using four different methods; comparisons of these methods reveal large-scale consistency but substantial differences in terms of small genomic rearrangements, sensitivity (sequence coverage), and specificity (alignment accuracy). We describe the quantitative and qualitative trade-offs concomitant with alignment method choice and the levels of technical error that need to be accounted for in applications that require multisequence alignments. Using the generated alignments, we identified constrained regions using three different methods. While the different constraint-detecting methods are in general agreement, there are important discrepancies relating to both the underlying alignments and the specific algorithms. However, by integrating the results across the alignments and constraint-detecting methods, we produced constraint annotations that were found to be robust based on multiple independent measures. Analyses of these annotations illustrate that most classes of experimentally annotated functional elements are enriched for constrained sequences; however, large portions of each class (with the exception of protein-coding sequences) do not overlap constrained regions. The latter elements might not be under primary sequence constraint, might not be constrained across all mammals, or might have expendable molecular functions. Conversely, 40% of the constrained sequences do not overlap any of the functional elements that have been experimentally identified. Together, these findings demonstrate and quantify how many genomic functional elements await basic molecular characterization. PMID:17567995

  19. A scalable, fully automated process for construction of sequence-ready human exome targeted capture libraries

    PubMed Central

    2011-01-01

    Genome targeting methods enable cost-effective capture of specific subsets of the genome for sequencing. We present here an automated, highly scalable method for carrying out the Solution Hybrid Selection capture approach that provides a dramatic increase in scale and throughput of sequence-ready libraries produced. Significant process improvements and a series of in-process quality control checkpoints are also added. These process improvements can also be used in a manual version of the protocol. PMID:21205303

  20. [Evolution of genomic imprinting in mammals: what a zoo!].

    PubMed

    Proudhon, Charlotte; Bourc'his, Déborah

    2010-05-01

    Genomic imprinting imposes an obligate mode of biparental reproduction in mammals. This phenomenon results from the monoparental expression of a subset of genes. This specific gene regulation mechanism affects viviparous mammals, especially eutherians, but also marsupials to a lesser extent. Oviparous mammals, or monotremes, do not seem to demonstrate monoparental allele expression. This phylogenic confinement suggests that the evolution of the placenta imposed a selective pressure for the emergence of genomic imprinting. This physiological argument is now complemented by recent genomic evidence facilitated by the sequencing of the platypus genome, a rare modern day case of a monotreme. Analysis of the platypus genome in comparison to eutherian genomes shows a chronological and functional coincidence between the appearance of genomic imprinting and transposable element accumulation. The systematic comparative analyses of genomic sequences in different species is essential for the further understanding of genomic imprinting emergence and divergent evolution along mammalian speciation.

  1. The Sequenced Angiosperm Genomes and Genome Databases.

    PubMed

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology.

  2. The Sequenced Angiosperm Genomes and Genome Databases

    PubMed Central

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology. PMID:29706973

  3. Bioinformatics prediction of siRNAs as potential antiviral agents against dengue viruses

    PubMed Central

    Villegas-Rosales, Paula M; Méndez-Tenorio, Alfonso; Ortega-Soto, Elizabeth; Barrón, Blanca L

    2012-01-01

    Dengue virus (DENV 1-4) represents the major emerging arthropod-borne viral infection in the world. Currently, there is neither an available vaccine nor a specific treatment. Hence, there is a need of antiviral drugs for these viral infections; we describe the prediction of short interfering RNA (siRNA) as potential therapeutic agents against the four DENV serotypes. Our strategy was to carry out a series of multiple alignments using ClustalX program to find conserved sequences among the four DENV serotype genomes to obtain a consensus sequence for siRNAs design. A highly conserved sequence among the four DENV serotypes, located in the encoding sequence for NS4B and NS5 proteins was found. A total of 2,893 complete DENV genomes were downloaded from the NCBI, and after a depuration procedure to identify identical sequences, 220 complete DENV genomes were left. They were edited to select the NS4B and NS5 sequences, which were aligned to obtain a consensus sequence. Three different servers were used for siRNA design, and the resulting siRNAs were aligned to identify the most prevalent sequences. Three siRNAs were chosen, one targeted the genome region that codifies for NS4B protein and the other two; the region for NS5 protein. Predicted secondary structure for DENV genomes was used to demonstrate that the siRNAs were able to target the viral genome forming double stranded structures, necessary to activate the RNA silencing machinery. PMID:22829722

  4. Reads2Type: a web application for rapid microbial taxonomy identification.

    PubMed

    Saputra, Dhany; Rasmussen, Simon; Larsen, Mette V; Haddad, Nizar; Sperotto, Maria Maddalena; Aarestrup, Frank M; Lund, Ole; Sicheritz-Pontén, Thomas

    2015-11-25

    Identification of bacteria may be based on sequencing and molecular analysis of a specific locus such as 16S rRNA, or a set of loci such as in multilocus sequence typing. In the near future, healthcare institutions and routine diagnostic microbiology laboratories may need to sequence the entire genome of microbial isolates. Therefore we have developed Reads2Type, a web-based tool for taxonomy identification based on whole bacterial genome sequence data. Raw sequencing data provided by the user are mapped against a set of marker probes that are derived from currently available bacteria complete genomes. Using a dataset of 1003 whole genome sequenced bacteria from various sequencing platforms, Reads2Type was able to identify the species with 99.5 % accuracy and on the minutes time scale. In comparison with other tools, Reads2Type offers the advantage of not needing to transfer sequencing files, as the entire computational analysis is done on the computer of whom utilizes the web application. This also prevents data privacy issues to arise. The Reads2Type tool is available at http://www.cbs.dtu.dk/~dhany/reads2type.html.

  5. Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing.

    PubMed

    Hribová, Eva; Neumann, Pavel; Matsumoto, Takashi; Roux, Nicolas; Macas, Jirí; Dolezel, Jaroslav

    2010-09-16

    Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA markers to be used in genetic diversity studies and in marker-assisted selection.

  6. Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing

    PubMed Central

    2010-01-01

    Background Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. Results In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. Conclusion A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA markers to be used in genetic diversity studies and in marker-assisted selection. PMID:20846365

  7. Genomic analysis and temperature-dependent transcriptome profiles of the rhizosphere originating strain Pseudomonas aeruginosa M18

    PubMed Central

    2011-01-01

    Background Our previously published reports have described an effective biocontrol agent named Pseudomonas sp. M18 as its 16S rDNA sequence and several regulator genes share homologous sequences with those of P. aeruginosa, but there are several unusual phenotypic features. This study aims to explore its strain specific genomic features and gene expression patterns at different temperatures. Results The complete M18 genome is composed of a single chromosome of 6,327,754 base pairs containing 5684 open reading frames. Seven genomic islands, including two novel prophages and five specific non-phage islands were identified besides the conserved P. aeruginosa core genome. Each prophage contains a putative chitinase coding gene, and the prophage II contains a capB gene encoding a putative cold stress protein. The non-phage genomic islands contain genes responsible for pyoluteorin biosynthesis, environmental substance degradation and type I and III restriction-modification systems. Compared with other P. aeruginosa strains, the fewest number (3) of insertion sequences and the most number (3) of clustered regularly interspaced short palindromic repeats in M18 genome may contribute to the relative genome stability. Although the M18 genome is most closely related to that of P. aeruginosa strain LESB58, the strain M18 is more susceptible to several antimicrobial agents and easier to be erased in a mouse acute lung infection model than the strain LESB58. The whole M18 transcriptomic analysis indicated that 10.6% of the expressed genes are temperature-dependent, with 22 genes up-regulated at 28°C in three non-phage genomic islands and one prophage but none at 37°C. Conclusions The P. aeruginosa strain M18 has evolved its specific genomic structures and temperature dependent expression patterns to meet the requirement of its fitness and competitiveness under selective pressures imposed on the strain in rhizosphere niche. PMID:21884571

  8. Burkholderia pseudomallei sequencing identifies genomic clades with distinct recombination, accessory, and epigenetic profiles

    PubMed Central

    Nandi, Tannistha; Holden, Matthew T.G.; Didelot, Xavier; Mehershahi, Kurosh; Boddey, Justin A.; Beacham, Ifor; Peak, Ian; Harting, John; Baybayan, Primo; Guo, Yan; Wang, Susana; How, Lee Chee; Sim, Bernice; Essex-Lopresti, Angela; Sarkar-Tyson, Mitali; Nelson, Michelle; Smither, Sophie; Ong, Catherine; Aw, Lay Tin; Hoon, Chua Hui; Michell, Stephen; Studholme, David J.; Titball, Richard; Chen, Swaine L.; Parkhill, Julian

    2015-01-01

    Burkholderia pseudomallei (Bp) is the causative agent of the infectious disease melioidosis. To investigate population diversity, recombination, and horizontal gene transfer in closely related Bp isolates, we performed whole-genome sequencing (WGS) on 106 clinical, animal, and environmental strains from a restricted Asian locale. Whole-genome phylogenies resolved multiple genomic clades of Bp, largely congruent with multilocus sequence typing (MLST). We discovered widespread recombination in the Bp core genome, involving hundreds of regions associated with multiple haplotypes. Highly recombinant regions exhibited functional enrichments that may contribute to virulence. We observed clade-specific patterns of recombination and accessory gene exchange, and provide evidence that this is likely due to ongoing recombination between clade members. Reciprocally, interclade exchanges were rarely observed, suggesting mechanisms restricting gene flow between clades. Interrogation of accessory elements revealed that each clade harbored a distinct complement of restriction-modification (RM) systems, predicted to cause clade-specific patterns of DNA methylation. Using methylome sequencing, we confirmed that representative strains from separate clades indeed exhibit distinct methylation profiles. Finally, using an E. coli system, we demonstrate that Bp RM systems can inhibit uptake of non-self DNA. Our data suggest that RM systems borne on mobile elements, besides preventing foreign DNA invasion, may also contribute to limiting exchanges of genetic material between individuals of the same species. Genomic clades may thus represent functional units of genetic isolation in Bp, modulating intraspecies genetic diversity. PMID:25236617

  9. A comparative analysis of whole genome sequencing of esophageal adenocarcinoma pre- and post-chemotherapy

    PubMed Central

    Noorani, Ayesha; Lynch, Andy G.; Achilleos, Achilleas; Eldridge, Matthew; Bower, Lawrence; Weaver, Jamie M.J.; Crawte, Jason; Ong, Chin-Ann; Shannon, Nicholas; MacRae, Shona; Grehan, Nicola; Nutzinger, Barbara; O'Donovan, Maria; Hardwick, Richard; Tavaré, Simon; Fitzgerald, Rebecca C.

    2017-01-01

    The scientific community has avoided using tissue samples from patients that have been exposed to systemic chemotherapy to infer the genomic landscape of a given cancer. Esophageal adenocarcinoma is a heterogeneous, chemoresistant tumor for which the availability and size of pretreatment endoscopic samples are limiting. This study compares whole-genome sequencing data obtained from chemo-naive and chemo-treated samples. The quality of whole-genomic sequencing data is comparable across all samples regardless of chemotherapy status. Inclusion of samples collected post-chemotherapy increased the proportion of late-stage tumors. When comparing matched pre- and post-chemotherapy samples from 10 cases, the mutational signatures, copy number, and SNV mutational profiles reflect the expected heterogeneity in this disease. Analysis of SNVs in relation to allele-specific copy-number changes pinpoints the common ancestor to a point prior to chemotherapy. For cases in which pre- and post-chemotherapy samples do show substantial differences, the timing of the divergence is near-synchronous with endoreduplication. Comparison across a large prospective cohort (62 treatment-naive, 58 chemotherapy-treated samples) reveals no significant differences in the overall mutation rate, mutation signatures, specific recurrent point mutations, or copy-number events in respect to chemotherapy status. In conclusion, whole-genome sequencing of samples obtained following neoadjuvant chemotherapy is representative of the genomic landscape of esophageal adenocarcinoma. Excluding these samples reduces the material available for cataloging and introduces a bias toward the earlier stages of cancer. PMID:28465312

  10. Microbial ecology in the age of genomics and metagenomics: concepts, tools, and recent advances.

    PubMed

    Xu, Jianping

    2006-06-01

    Microbial ecology examines the diversity and activity of micro-organisms in Earth's biosphere. In the last 20 years, the application of genomics tools have revolutionized microbial ecological studies and drastically expanded our view on the previously underappreciated microbial world. This review first introduces the basic concepts in microbial ecology and the main genomics methods that have been used to examine natural microbial populations and communities. In the ensuing three specific sections, the applications of the genomics in microbial ecological research are highlighted. The first describes the widespread application of multilocus sequence typing and representational difference analysis in studying genetic variation within microbial species. Such investigations have identified that migration, horizontal gene transfer and recombination are common in natural microbial populations and that microbial strains can be highly variable in genome size and gene content. The second section highlights and summarizes the use of four specific genomics methods (phylogenetic analysis of ribosomal RNA, DNA-DNA re-association kinetics, metagenomics, and micro-arrays) in analysing the diversity and potential activity of microbial populations and communities from a variety of terrestrial and aquatic environments. Such analyses have identified many unexpected phylogenetic lineages in viruses, bacteria, archaea, and microbial eukaryotes. Functional analyses of environmental DNA also revealed highly prevalent, but previously unknown, metabolic processes in natural microbial communities. In the third section, the ecological implications of sequenced microbial genomes are briefly discussed. Comparative analyses of prokaryotic genomic sequences suggest the importance of ecology in determining microbial genome size and gene content. The significant variability in genome size and gene content among strains and species of prokaryotes indicate the highly fluid nature of prokaryotic genomes, a result consistent with those from multilocus sequence typing and representational difference analyses. The integration of various levels of ecological analyses coupled to the application and further development of high throughput technologies are accelerating the pace of discovery in microbial ecology.

  11. Enrichment of individual KIR2DL4 sequences from genomic DNA using long-template PCR and allele-specific hybridization to magnetic bead-bound oligonucleotide probes.

    PubMed

    Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E

    2007-06-01

    DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.

  12. Comparative whole genome analysis of six diagnostic brucellaphages.

    PubMed

    Farlow, Jason; Filippov, Andrey A; Sergueev, Kirill V; Hang, Jun; Kotorashvili, Adam; Nikolich, Mikeljon P

    2014-05-15

    Whole genome sequencing of six diagnostic brucellaphages, Tbilisi (Tb), Firenze (Fz), Weybridge (Wb), S708, Berkeley (Bk) and R/C, was followed with genomic comparisons including recently described genomes of the Tb phage from Mexico (TbM) and Pr phage to elucidate genomic diversity and candidate host range determinants. Comparative whole genome analysis revealed high sequence homogeneity among these brucellaphage genomes and resolved three genetic groups consistent with defined host range phenotypes. Group I was composed of Tb and Fz phages that are predominantly lytic for Brucella abortus and Brucella neotomae; Group II included Bk, R/C, and Pr phages that are lytic mainly for B. abortus, Brucella melitensis and Brucella suis; Group III was composed of Wb and S708 phages that are lytic for B. suis, B. abortus and B. neotomae. We found that the putative phage collar protein is a variable locus with features that may be contributing to the host specificities exhibited by different brucellaphage groups. The presence of several candidate host range determinants is illustrated herein for future dissection of the differential host specificity observed among these phages. Published by Elsevier B.V.

  13. Genomic comparison of the closely-related Salmonella enterica serovars enteritidis, dublin and gallinarum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matthews, T. David; Schmieder, Robert; Silva, Genivaldo G. Z.

    The Salmonella enterica serovars Enteritidis, Dublin, and Gallinarum are closely related but differ in virulence and host range. To identify the genetic elements responsible for these differences and to better understand how these serovars are evolving, we sequenced the genomes of Enteritidis strain LK5 and Dublin strain SARB12 and compared these genomes to the publicly available Enteritidis P125109, Dublin CT 02021853 and Dublin SD3246 genome sequences. We also compared the publicly available Gallinarum genome sequences from biotype Gallinarum 287/91 and Pullorum RKS5078. Using bioinformatic approaches, we identified single nucleotide polymorphisms, insertions, deletions, and differences in prophage and pseudogene content betweenmore » strains belonging to the same serovar. Through our analysis we also identified several prophage cargo genes and pseudogenes that affect virulence and may contribute to a host-specific, systemic lifestyle. These results strongly argue that the Enteritidis, Dublin and Gallinarum serovars of Salmonella enterica evolve by acquiring new genes through horizontal gene transfer, followed by the formation of pseudogenes. As a result, the loss of genes necessary for a gastrointestinal lifestyle ultimately leads to a systemic lifestyle and niche exclusion in the host-specific serovars.« less

  14. Genomic comparison of the closely-related Salmonella enterica serovars enteritidis, dublin and gallinarum

    DOE PAGES

    Matthews, T. David; Schmieder, Robert; Silva, Genivaldo G. Z.; ...

    2015-06-03

    The Salmonella enterica serovars Enteritidis, Dublin, and Gallinarum are closely related but differ in virulence and host range. To identify the genetic elements responsible for these differences and to better understand how these serovars are evolving, we sequenced the genomes of Enteritidis strain LK5 and Dublin strain SARB12 and compared these genomes to the publicly available Enteritidis P125109, Dublin CT 02021853 and Dublin SD3246 genome sequences. We also compared the publicly available Gallinarum genome sequences from biotype Gallinarum 287/91 and Pullorum RKS5078. Using bioinformatic approaches, we identified single nucleotide polymorphisms, insertions, deletions, and differences in prophage and pseudogene content betweenmore » strains belonging to the same serovar. Through our analysis we also identified several prophage cargo genes and pseudogenes that affect virulence and may contribute to a host-specific, systemic lifestyle. These results strongly argue that the Enteritidis, Dublin and Gallinarum serovars of Salmonella enterica evolve by acquiring new genes through horizontal gene transfer, followed by the formation of pseudogenes. As a result, the loss of genes necessary for a gastrointestinal lifestyle ultimately leads to a systemic lifestyle and niche exclusion in the host-specific serovars.« less

  15. Genomic Comparison of the Closely-Related Salmonella enterica Serovars Enteritidis, Dublin and Gallinarum

    PubMed Central

    Matthews, T. David; Schmieder, Robert; Silva, Genivaldo G. Z.; Busch, Julia; Cassman, Noriko; Dutilh, Bas E.; Green, Dawn; Matlock, Brian; Heffernan, Brian; Olsen, Gary J.; Farris Hanna, Leigh; Schifferli, Dieter M.; Maloy, Stanley; Dinsdale, Elizabeth A.; Edwards, Robert A.

    2015-01-01

    The Salmonella enterica serovars Enteritidis, Dublin, and Gallinarum are closely related but differ in virulence and host range. To identify the genetic elements responsible for these differences and to better understand how these serovars are evolving, we sequenced the genomes of Enteritidis strain LK5 and Dublin strain SARB12 and compared these genomes to the publicly available Enteritidis P125109, Dublin CT 02021853 and Dublin SD3246 genome sequences. We also compared the publicly available Gallinarum genome sequences from biotype Gallinarum 287/91 and Pullorum RKS5078. Using bioinformatic approaches, we identified single nucleotide polymorphisms, insertions, deletions, and differences in prophage and pseudogene content between strains belonging to the same serovar. Through our analysis we also identified several prophage cargo genes and pseudogenes that affect virulence and may contribute to a host-specific, systemic lifestyle. These results strongly argue that the Enteritidis, Dublin and Gallinarum serovars of Salmonella enterica evolve by acquiring new genes through horizontal gene transfer, followed by the formation of pseudogenes. The loss of genes necessary for a gastrointestinal lifestyle ultimately leads to a systemic lifestyle and niche exclusion in the host-specific serovars. PMID:26039056

  16. Evaluating whole genome sequence data from the Genetic Absence Epilepsy Rat from Strasbourg and its related non-epileptic strain

    PubMed Central

    Powell, Kim L.; Zhu, Mingfu; Campbell, C. Ryan; Maia, Jessica M.; Ren, Zhong; Jones, Nigel C.; O’Brien, Terence J.; Petrovski, Slavé

    2017-01-01

    Objective The Genetic Absence Epilepsy Rats from Strasbourg (GAERS) are an inbreed Wistar rat strain widely used as a model of genetic generalised epilepsy with absence seizures. As in humans, the genetic architecture that results in genetic generalized epilepsy in GAERS is poorly understood. Here we present the strain-specific variants found among the epileptic GAERS and their related Non-Epileptic Control (NEC) strain. The GAERS and NEC represent a powerful opportunity to identify neurobiological factors that are associated with the genetic generalised epilepsy phenotype. Methods We performed whole genome sequencing on adult epileptic GAERS and adult NEC rats, a strain derived from the same original Wistar colony. We also generated whole genome sequencing on four double-crossed (GAERS with NEC) F2 selected for high-seizing (n = 2) and non-seizing (n = 2) phenotypes. Results Specific to the GAERS genome, we identified 1.12 million single nucleotide variants, 296.5K short insertion-deletions, and 354 putative copy number variants that result in complete or partial loss/duplication of 41 genes. Of the GAERS-specific variants that met high quality criteria, 25 are annotated as stop codon gain/loss, 56 as putative essential splice sites, and 56 indels are predicted to result in a frameshift. Subsequent screening against the two F2 progeny sequenced for having the highest and two F2 progeny for having the lowest seizure burden identified only the selected Cacna1h GAERS-private protein-coding variant as exclusively co-segregating with the two high-seizing F2 rats. Significance This study highlights an approach for using whole genome sequencing to narrow down to a manageable candidate list of genetic variants in a complex genetic epilepsy animal model, and suggests utility of this sequencing design to investigate other spontaneously occurring animal models of human disease. PMID:28708842

  17. Directional genomic hybridization for chromosomal inversion discovery and detection.

    PubMed

    Ray, F Andrew; Zimmerman, Erin; Robinson, Bruce; Cornforth, Michael N; Bedford, Joel S; Goodwin, Edwin H; Bailey, Susan M

    2013-04-01

    Chromosomal rearrangements are a source of structural variation within the genome that figure prominently in human disease, where the importance of translocations and deletions is well recognized. In principle, inversions-reversals in the orientation of DNA sequences within a chromosome-should have similar detrimental potential. However, the study of inversions has been hampered by traditional approaches used for their detection, which are not particularly robust. Even with significant advances in whole genome approaches, changes in the absolute orientation of DNA remain difficult to detect routinely. Consequently, our understanding of inversions is still surprisingly limited, as is our appreciation for their frequency and involvement in human disease. Here, we introduce the directional genomic hybridization methodology of chromatid painting-a whole new way of looking at structural features of the genome-that can be employed with high resolution on a cell-by-cell basis, and demonstrate its basic capabilities for genome-wide discovery and targeted detection of inversions. Bioinformatics enabled development of sequence- and strand-specific directional probe sets, which when coupled with single-stranded hybridization, greatly improved the resolution and ease of inversion detection. We highlight examples of the far-ranging applicability of this cytogenomics-based approach, which include confirmation of the alignment of the human genome database and evidence that individuals themselves share similar sequence directionality, as well as use in comparative and evolutionary studies for any species whose genome has been sequenced. In addition to applications related to basic mechanistic studies, the information obtainable with strand-specific hybridization strategies may ultimately enable novel gene discovery, thereby benefitting the diagnosis and treatment of a variety of human disease states and disorders including cancer, autism, and idiopathic infertility.

  18. Transmissible Gastroenteritis Coronavirus Genome Packaging Signal Is Located at the 5′ End of the Genome and Promotes Viral RNA Incorporation into Virions in a Replication-Independent Process

    PubMed Central

    Morales, Lucia; Mateos-Gomez, Pedro A.; Capiscol, Carmen; del Palacio, Lorena; Sola, Isabel

    2013-01-01

    Preferential RNA packaging in coronaviruses involves the recognition of viral genomic RNA, a crucial process for viral particle morphogenesis mediated by RNA-specific sequences, known as packaging signals. An essential packaging signal component of transmissible gastroenteritis coronavirus (TGEV) has been further delimited to the first 598 nucleotides (nt) from the 5′ end of its RNA genome, by using recombinant viruses transcribing subgenomic mRNA that included potential packaging signals. The integrity of the entire sequence domain was necessary because deletion of any of the five structural motifs defined within this region abrogated specific packaging of this viral RNA. One of these RNA motifs was the stem-loop SL5, a highly conserved motif in coronaviruses located at nucleotide positions 106 to 136. Partial deletion or point mutations within this motif also abrogated packaging. Using TGEV-derived defective minigenomes replicated in trans by a helper virus, we have shown that TGEV RNA packaging is a replication-independent process. Furthermore, the last 494 nt of the genomic 3′ end were not essential for packaging, although this region increased packaging efficiency. TGEV RNA sequences identified as necessary for viral genome packaging were not sufficient to direct packaging of a heterologous sequence derived from the green fluorescent protein gene. These results indicated that TGEV genome packaging is a complex process involving many factors in addition to the identified RNA packaging signal. The identification of well-defined RNA motifs within the TGEV RNA genome that are essential for packaging will be useful for designing packaging-deficient biosafe coronavirus-derived vectors and providing new targets for antiviral therapies. PMID:23966403

  19. Comparative and Evolutionary Analysis of Grass Pollen Allergens Using Brachypodium distachyon as a Model System

    PubMed Central

    Sharma, Akanksha; Sharma, Niharika; Bhalla, Prem; Singh, Mohan

    2017-01-01

    Comparative genomics have facilitated the mining of biological information from a genome sequence, through the detection of similarities and differences with genomes of closely or more distantly related species. By using such comparative approaches, knowledge can be transferred from the model to non-model organisms and insights can be gained in the structural and evolutionary patterns of specific genes. In the absence of sequenced genomes for allergenic grasses, this study was aimed at understanding the structure, organisation and expression profiles of grass pollen allergens using the genomic data from Brachypodium distachyon as it is phylogenetically related to the allergenic grasses. Combining genomic data with the anther RNA-Seq dataset revealed 24 pollen allergen genes belonging to eight allergen groups mapping on the five chromosomes in B. distachyon. High levels of anther-specific expression profiles were observed for the 24 identified putative allergen-encoding genes in Brachypodium. The genomic evidence suggests that gene encoding the group 5 allergen, the most potent trigger of hay fever and allergic asthma originated as a pollen specific orphan gene in a common grass ancestor of Brachypodium and Triticiae clades. Gene structure analysis showed that the putative allergen-encoding genes in Brachypodium either lack or contain reduced number of introns. Promoter analysis of the identified Brachypodium genes revealed the presence of specific cis-regulatory sequences likely responsible for high anther/pollen-specific expression. With the identification of putative allergen-encoding genes in Brachypodium, this study has also described some important plant gene families (e.g. expansin superfamily, EF-Hand family, profilins etc) for the first time in the model plant Brachypodium. Altogether, the present study provides new insights into structural characterization and evolution of pollen allergens and will further serve as a base for their functional characterization in related grass species. PMID:28103252

  20. GRIDSS: sensitive and specific genomic rearrangement detection using positional de Bruijn graph assembly

    PubMed Central

    Do, Hongdo; Molania, Ramyar

    2017-01-01

    The identification of genomic rearrangements with high sensitivity and specificity using massively parallel sequencing remains a major challenge, particularly in precision medicine and cancer research. Here, we describe a new method for detecting rearrangements, GRIDSS (Genome Rearrangement IDentification Software Suite). GRIDSS is a multithreaded structural variant (SV) caller that performs efficient genome-wide break-end assembly prior to variant calling using a novel positional de Bruijn graph-based assembler. By combining assembly, split read, and read pair evidence using a probabilistic scoring, GRIDSS achieves high sensitivity and specificity on simulated, cell line, and patient tumor data, recently winning SV subchallenge #5 of the ICGC-TCGA DREAM8.5 Somatic Mutation Calling Challenge. On human cell line data, GRIDSS halves the false discovery rate compared to other recent methods while matching or exceeding their sensitivity. GRIDSS identifies nontemplate sequence insertions, microhomologies, and large imperfect homologies, estimates a quality score for each breakpoint, stratifies calls into high or low confidence, and supports multisample analysis. PMID:29097403

  1. The future is now: single-cell genomics of bacteria and archaea

    PubMed Central

    Blainey, Paul C.

    2013-01-01

    Interest in the expanding catalog of uncultivated microorganisms, increasing recognition of heterogeneity among seemingly similar cells, and technological advances in whole-genome amplification and single-cell manipulation are driving considerable progress in single-cell genomics. Here, the spectrum of applications for single-cell genomics, key advances in the development of the field, and emerging methodology for single-cell genome sequencing are reviewed by example with attention to the diversity of approaches and their unique characteristics. Experimental strategies transcending specific methodologies are identified and organized as a road map for future studies in single-cell genomics of environmental microorganisms. Over the next decade, increasingly powerful tools for single-cell genome sequencing and analysis will play key roles in accessing the genomes of uncultivated organisms, determining the basis of microbial community functions, and fundamental aspects of microbial population biology. PMID:23298390

  2. Construction of random sheared fosmid library from Chinese cabbage and its use for Brassica rapa genome sequencing project.

    PubMed

    Park, Tae-Ho; Park, Beom-Seok; Kim, Jin-A; Hong, Joon Ki; Jin, Mina; Seol, Young-Joo; Mun, Jeong-Hwan

    2011-01-01

    As a part of the Multinational Genome Sequencing Project of Brassica rapa, linkage group R9 and R3 were sequenced using a bacterial artificial chromosome (BAC) by BAC strategy. The current physical contigs are expected to cover approximately 90% euchromatins of both chromosomes. As the project progresses, BAC selection for sequence extension becomes more limited because BAC libraries are restriction enzyme-specific. To support the project, a random sheared fosmid library was constructed. The library consists of 97536 clones with average insert size of approximately 40 kb corresponding to seven genome equivalents, assuming a Chinese cabbage genome size of 550 Mb. The library was screened with primers designed at the end of sequences of nine points of scaffold gaps where BAC clones cannot be selected to extend the physical contigs. The selected positive clones were end-sequenced to check the overlap between the fosmid clones and the adjacent BAC clones. Nine fosmid clones were selected and fully sequenced. The sequences revealed two completed gap filling and seven sequence extensions, which can be used for further selection of BAC clones confirming that the fosmid library will facilitate the sequence completion of B. rapa. Copyright © 2011. Published by Elsevier Ltd.

  3. Cloud-based adaptive exon prediction for DNA analysis.

    PubMed

    Putluri, Srinivasareddy; Zia Ur Rahman, Md; Fathima, Shaik Yasmeen

    2018-02-01

    Cloud computing offers significant research and economic benefits to healthcare organisations. Cloud services provide a safe place for storing and managing large amounts of such sensitive data. Under conventional flow of gene information, gene sequence laboratories send out raw and inferred information via Internet to several sequence libraries. DNA sequencing storage costs will be minimised by use of cloud service. In this study, the authors put forward a novel genomic informatics system using Amazon Cloud Services, where genomic sequence information is stored and accessed for processing. True identification of exon regions in a DNA sequence is a key task in bioinformatics, which helps in disease identification and design drugs. Three base periodicity property of exons forms the basis of all exon identification techniques. Adaptive signal processing techniques found to be promising in comparison with several other methods. Several adaptive exon predictors (AEPs) are developed using variable normalised least mean square and its maximum normalised variants to reduce computational complexity. Finally, performance evaluation of various AEPs is done based on measures such as sensitivity, specificity and precision using various standard genomic datasets taken from National Center for Biotechnology Information genomic sequence database.

  4. A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

    PubMed

    Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

    2015-07-01

    Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Genome Sequences of Populus tremula Chloroplast and Mitochondrion: Implications for Holistic Poplar Breeding

    PubMed Central

    Mader, Malte; Le Paslier, Marie-Christine; Bounon, Rémi; Berard, Aurélie; Vettori, Cristina; Schroeder, Hilke; Leplé, Jean-Charles; Fladung, Matthias

    2016-01-01

    Complete Populus genome sequences are available for the nucleus (P. trichocarpa; section Tacamahaca) and for chloroplasts (seven species), but not for mitochondria. Here, we provide the complete genome sequences of the chloroplast and the mitochondrion for the clones P. tremula W52 and P. tremula x P. alba 717-1B4 (section Populus). The organization of the chloroplast genomes of both Populus clones is described. A phylogenetic tree constructed from all available complete chloroplast DNA sequences of Populus was not congruent with the assignment of the related species to different Populus sections. In total, 3,024 variable nucleotide positions were identified among all compared Populus chloroplast DNA sequences. The 5-prime part of the LSC from trnH to atpA showed the highest frequency of variations. The variable positions included 163 positions with SNPs allowing for differentiating the two clones with P. tremula chloroplast genomes (W52, 717-1B4) from the other seven Populus individuals. These potential P. tremula-specific SNPs were displayed as a whole-plastome barcode on the P. tremula W52 chloroplast DNA sequence. Three of these SNPs and one InDel in the trnH-psbA linker were successfully validated by Sanger sequencing in an extended set of Populus individuals. The complete mitochondrial genome sequence of P. tremula is the first in the family of Salicaceae. The mitochondrial genomes of the two clones are 783,442 bp (W52) and 783,513 bp (717-1B4) in size, structurally very similar and organized as single circles. DNA sequence regions with high similarity to the W52 chloroplast sequence account for about 2% of the W52 mitochondrial genome. The mean SNP frequency was found to be nearly six fold higher in the chloroplast than in the mitochondrial genome when comparing 717-1B4 with W52. The availability of the genomic information of all three DNA-containing cell organelles will allow a holistic approach in poplar molecular breeding in the future. PMID:26800039

  6. Looking for Trouble: Preventive Genomic Sequencing in the General Population and the Role of Patient Choice

    PubMed Central

    Lázaro-Muñoz, Gabriel; Conley, John M.; Davis, Arlene M.; Van Riper, Marcia; Walker, Rebecca L.; Juengst, Eric T.

    2015-01-01

    Advances in genomics have led to calls for developing population-based preventive genomic sequencing (PGS) programs with the goal of identifying genetic health risks in adults without known risk factors. One critical issue for minimizing the harms and maximizing the benefits of PGS is determining the kind and degree of control individuals should have over the generation, use, and handling of their genomic information. In this article we examine whether PGS programs should offer individuals the opportunity to selectively opt-out of the sequencing or analysis of specific genomic conditions (the menu approach) or whether PGS should be implemented using an all-or-nothing panel approach. We conclude that any responsible scale up of PGS will require a menu approach that may seem impractical to some, but which draws its justification from a rich mix of normative, legal, and practical considerations. PMID:26147254

  7. The Genomes On Line Database (GOLD) in 2009: status of genomic and metagenomic projects and their associated metadata.

    PubMed

    Liolios, Konstantinos; Chen, I-Min A; Mavromatis, Konstantinos; Tavernarakis, Nektarios; Hugenholtz, Philip; Markowitz, Victor M; Kyrpides, Nikos C

    2010-01-01

    The Genomes On Line Database (GOLD) is a comprehensive resource for centralized monitoring of genome and metagenome projects worldwide. Both complete and ongoing projects, along with their associated metadata, can be accessed in GOLD through precomputed tables and a search page. As of September 2009, GOLD contains information for more than 5800 sequencing projects, of which 1100 have been completed and their sequence data deposited in a public repository. GOLD continues to expand, moving toward the goal of providing the most comprehensive repository of metadata information related to the projects and their organisms/environments in accordance with the Minimum Information about a (Meta)Genome Sequence (MIGS/MIMS) specification. GOLD is available at: http://www.genomesonline.org and has a mirror site at the Institute of Molecular Biology and Biotechnology, Crete, Greece, at: http://gold.imbb.forth.gr/

  8. The Genomes On Line Database (GOLD) in 2009: status of genomic and metagenomic projects and their associated metadata

    PubMed Central

    Liolios, Konstantinos; Chen, I-Min A.; Mavromatis, Konstantinos; Tavernarakis, Nektarios; Hugenholtz, Philip; Markowitz, Victor M.; Kyrpides, Nikos C.

    2010-01-01

    The Genomes On Line Database (GOLD) is a comprehensive resource for centralized monitoring of genome and metagenome projects worldwide. Both complete and ongoing projects, along with their associated metadata, can be accessed in GOLD through precomputed tables and a search page. As of September 2009, GOLD contains information for more than 5800 sequencing projects, of which 1100 have been completed and their sequence data deposited in a public repository. GOLD continues to expand, moving toward the goal of providing the most comprehensive repository of metadata information related to the projects and their organisms/environments in accordance with the Minimum Information about a (Meta)Genome Sequence (MIGS/MIMS) specification. GOLD is available at: http://www.genomesonline.org and has a mirror site at the Institute of Molecular Biology and Biotechnology, Crete, Greece, at: http://gold.imbb.forth.gr/ PMID:19914934

  9. Using Full Genomic Information to Predict Disease: Breaking Down the Barriers Between Complex and Mendelian Diseases.

    PubMed

    Jordan, Daniel M; Do, Ron

    2018-04-11

    While sequence-based genetic tests have long been available for specific loci, especially for Mendelian disease, the rapidly falling costs of genome-wide genotyping arrays, whole-exome sequencing, and whole-genome sequencing are moving us toward a future where full genomic information might inform the prognosis and treatment of a variety of diseases, including complex disease. Similarly, the availability of large populations with full genomic information has enabled new insights about the etiology and genetic architecture of complex disease. Insights from the latest generation of genomic studies suggest that our categorization of diseases as complex may conceal a wide spectrum of genetic architectures and causal mechanisms that ranges from Mendelian forms of complex disease to complex regulatory structures underlying Mendelian disease. Here, we review these insights, along with advances in the prediction of disease risk and outcomes from full genomic information. Expected final online publication date for the Annual Review of Genomics and Human Genetics Volume 19 is August 31, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

  10. Genomic Diversity in the Endosymbiotic Bacterium Rhizobium leguminosarum.

    PubMed

    Sánchez-Cañizares, Carmen; Jorrín, Beatriz; Durán, David; Nadendla, Suvarna; Albareda, Marta; Rubio-Sanz, Laura; Lanza, Mónica; González-Guerrero, Manuel; Prieto, Rosa Isabel; Brito, Belén; Giglio, Michelle G; Rey, Luis; Ruiz-Argüeso, Tomás; Palacios, José M; Imperial, Juan

    2018-01-24

    Rhizobium leguminosarum bv. viciae is a soil α-proteobacterium that establishes a diazotrophic symbiosis with different legumes of the Fabeae tribe. The number of genome sequences from rhizobial strains available in public databases is constantly increasing, although complete, fully annotated genome structures from rhizobial genomes are scarce. In this work, we report and analyse the complete genome of R. leguminosarum bv. viciae UPM791. Whole genome sequencing can provide new insights into the genetic features contributing to symbiotically relevant processes such as bacterial adaptation to the rhizosphere, mechanisms for efficient competition with other bacteria, and the ability to establish a complex signalling dialogue with legumes, to enter the root without triggering plant defenses, and, ultimately, to fix nitrogen within the host. Comparison of the complete genome sequences of two strains of R. leguminosarum bv. viciae , 3841 and UPM791, highlights the existence of different symbiotic plasmids and a common core chromosome. Specific genomic traits, such as plasmid content or a distinctive regulation, define differential physiological capabilities of these endosymbionts. Among them, strain UPM791 presents unique adaptations for recycling the hydrogen generated in the nitrogen fixation process.

  11. Draft Genome Sequence of Escherichia coli MS499, Isolated from the Infected Uterus of a Postpartum Cow with Metritis

    PubMed Central

    Goldstone, Robert J.; Talbot, Richard; Schuberth, Hans-Joachim; Sandra, Olivier; Sheldon, I. Martin

    2014-01-01

    Specific Escherichia coli strains associated with bovine postpartum uterine infection have recently been described. Many recognized virulence factors are absent in these strains; therefore, to define a prototypic strain, we report here the genome sequence of E. coli isolate MS499 from a cow with the postpartum disease metritis. PMID:24994791

  12. Genome sequence of Lactobacillus johnsonii PF01, isolated from piglet feces.

    PubMed

    Lee, Je Hee; Chae, Jong Pyo; Lee, Ji Yoon; Lim, Jong-Sung; Kim, Geun-Bae; Ham, Jun-Sang; Chun, Jongsik; Kang, Dae-Kyung

    2011-09-01

    Lactobacillus johnsonii PF01, an autochthonous bacterium of the gastrointestinal tract, was isolated from a fecal sample from a piglet. The strain adhered specifically to the duodenal and jejunal epithelial cells of the piglet and had high bile resistance activity. Here we report the genomic sequence of L. johnsonii PF01. Copyright © 2011, American Society for Microbiology. All Rights Reserved.

  13. Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

    PubMed

    Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

    2009-10-01

    A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

  14. Stratification of co-evolving genomic groups using ranked phylogenetic profiles

    PubMed Central

    Freilich, Shiri; Goldovsky, Leon; Gottlieb, Assaf; Blanc, Eric; Tsoka, Sophia; Ouzounis, Christos A

    2009-01-01

    Background Previous methods of detecting the taxonomic origins of arbitrary sequence collections, with a significant impact to genome analysis and in particular metagenomics, have primarily focused on compositional features of genomes. The evolutionary patterns of phylogenetic distribution of genes or proteins, represented by phylogenetic profiles, provide an alternative approach for the detection of taxonomic origins, but typically suffer from low accuracy. Herein, we present rank-BLAST, a novel approach for the assignment of protein sequences into genomic groups of the same taxonomic origin, based on the ranking order of phylogenetic profiles of target genes or proteins across the reference database. Results The rank-BLAST approach is validated by computing the phylogenetic profiles of all sequences for five distinct microbial species of varying degrees of phylogenetic proximity, against a reference database of 243 fully sequenced genomes. The approach - a combination of sequence searches, statistical estimation and clustering - analyses the degree of sequence divergence between sets of protein sequences and allows the classification of protein sequences according to the species of origin with high accuracy, allowing taxonomic classification of 64% of the proteins studied. In most cases, a main cluster is detected, representing the corresponding species. Secondary, functionally distinct and species-specific clusters exhibit different patterns of phylogenetic distribution, thus flagging gene groups of interest. Detailed analyses of such cases are provided as examples. Conclusion Our results indicate that the rank-BLAST approach can capture the taxonomic origins of sequence collections in an accurate and efficient manner. The approach can be useful both for the analysis of genome evolution and the detection of species groups in metagenomics samples. PMID:19860884

  15. Genotyping by Sequencing Using Specific Allelic Capture to Build a High-Density Genetic Map of Durum Wheat

    PubMed Central

    Holtz, Yan; Ardisson, Morgane; Ranwez, Vincent; Besnard, Alban; Leroy, Philippe; Poux, Gérard; Roumet, Pierre; Viader, Véronique; Santoni, Sylvain; David, Jacques

    2016-01-01

    Targeted sequence capture is a promising technology which helps reduce costs for sequencing and genotyping numerous genomic regions in large sets of individuals. Bait sequences are designed to capture specific alleles previously discovered in parents or reference populations. We studied a set of 135 RILs originating from a cross between an emmer cultivar (Dic2) and a recent durum elite cultivar (Silur). Six thousand sequence baits were designed to target Dic2 vs. Silur polymorphisms discovered in a previous RNAseq study. These baits were exposed to genomic DNA of the RIL population. Eighty percent of the targeted SNPs were recovered, 65% of which were of high quality and coverage. The final high density genetic map consisted of more than 3,000 markers, whose genetic and physical mapping were consistent with those obtained with large arrays. PMID:27171472

  16. Genomics and functional genomics in Chlamydomonas reinhardtii

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blaby, Ian K.; Blaby-Haas, Crysten E.

    The availability of the Chlamydomonas reinhardtii nuclear genome sequence continues to enable researchers to address biological questions relevant to algae, land plants and animals in unprecedented ways. As we continue to characterize and understand biological processes in C. reinhardtii and translate that knowledge to other systems, we are faced with the realization that many genes encode proteins without a defined function. The field of functional genomics aims to close this gap between genome sequence and protein function. Transcriptomes, proteomes and phenomes can each provide layers of gene-specific functional data while supplying a global snapshot of cellular behavior under different conditions.more » Herein we present a brief history of functional genomics, the present status of the C. reinhardtii genome, how genome-wide experiments can aid in supplying protein function inferences, and provide an outlook for functional genomics in C. reinhardtii.« less

  17. Genomics and functional genomics in Chlamydomonas reinhardtii

    DOE PAGES

    Blaby, Ian K.; Blaby-Haas, Crysten E.

    2017-03-21

    The availability of the Chlamydomonas reinhardtii nuclear genome sequence continues to enable researchers to address biological questions relevant to algae, land plants and animals in unprecedented ways. As we continue to characterize and understand biological processes in C. reinhardtii and translate that knowledge to other systems, we are faced with the realization that many genes encode proteins without a defined function. The field of functional genomics aims to close this gap between genome sequence and protein function. Transcriptomes, proteomes and phenomes can each provide layers of gene-specific functional data while supplying a global snapshot of cellular behavior under different conditions.more » Herein we present a brief history of functional genomics, the present status of the C. reinhardtii genome, how genome-wide experiments can aid in supplying protein function inferences, and provide an outlook for functional genomics in C. reinhardtii.« less

  18. A brief introduction to web-based genome browsers.

    PubMed

    Wang, Jun; Kong, Lei; Gao, Ge; Luo, Jingchu

    2013-03-01

    Genome browser provides a graphical interface for users to browse, search, retrieve and analyze genomic sequence and annotation data. Web-based genome browsers can be classified into general genome browsers with multiple species and species-specific genome browsers. In this review, we attempt to give an overview for the main functions and features of web-based genome browsers, covering data visualization, retrieval, analysis and customization. To give a brief introduction to the multiple-species genome browser, we describe the user interface and main functions of the Ensembl and UCSC genome browsers using the human alpha-globin gene cluster as an example. We further use the MSU and the Rice-Map genome browsers to show some special features of species-specific genome browser, taking a rice transcription factor gene OsSPL14 as an example.

  19. Mammalian genomic regulatory regions predicted by utilizing human genomics, transcriptomics, and epigenetics data

    PubMed Central

    Nguyen, Quan H; Tellam, Ross L; Naval-Sanchez, Marina; Porto-Neto, Laercio R; Barendse, William; Reverter, Antonio; Hayes, Benjamin; Kijas, James; Dalrymple, Brian P

    2018-01-01

    Abstract Genome sequences for hundreds of mammalian species are available, but an understanding of their genomic regulatory regions, which control gene expression, is only beginning. A comprehensive prediction of potential active regulatory regions is necessary to functionally study the roles of the majority of genomic variants in evolution, domestication, and animal production. We developed a computational method to predict regulatory DNA sequences (promoters, enhancers, and transcription factor binding sites) in production animals (cows and pigs) and extended its broad applicability to other mammals. The method utilizes human regulatory features identified from thousands of tissues, cell lines, and experimental assays to find homologous regions that are conserved in sequences and genome organization and are enriched for regulatory elements in the genome sequences of other mammalian species. Importantly, we developed a filtering strategy, including a machine learning classification method, to utilize a very small number of species-specific experimental datasets available to select for the likely active regulatory regions. The method finds the optimal combination of sensitivity and accuracy to unbiasedly predict regulatory regions in mammalian species. Furthermore, we demonstrated the utility of the predicted regulatory datasets in cattle for prioritizing variants associated with multiple production and climate change adaptation traits and identifying potential genome editing targets. PMID:29618048

  20. Mammalian genomic regulatory regions predicted by utilizing human genomics, transcriptomics, and epigenetics data.

    PubMed

    Nguyen, Quan H; Tellam, Ross L; Naval-Sanchez, Marina; Porto-Neto, Laercio R; Barendse, William; Reverter, Antonio; Hayes, Benjamin; Kijas, James; Dalrymple, Brian P

    2018-03-01

    Genome sequences for hundreds of mammalian species are available, but an understanding of their genomic regulatory regions, which control gene expression, is only beginning. A comprehensive prediction of potential active regulatory regions is necessary to functionally study the roles of the majority of genomic variants in evolution, domestication, and animal production. We developed a computational method to predict regulatory DNA sequences (promoters, enhancers, and transcription factor binding sites) in production animals (cows and pigs) and extended its broad applicability to other mammals. The method utilizes human regulatory features identified from thousands of tissues, cell lines, and experimental assays to find homologous regions that are conserved in sequences and genome organization and are enriched for regulatory elements in the genome sequences of other mammalian species. Importantly, we developed a filtering strategy, including a machine learning classification method, to utilize a very small number of species-specific experimental datasets available to select for the likely active regulatory regions. The method finds the optimal combination of sensitivity and accuracy to unbiasedly predict regulatory regions in mammalian species. Furthermore, we demonstrated the utility of the predicted regulatory datasets in cattle for prioritizing variants associated with multiple production and climate change adaptation traits and identifying potential genome editing targets.

  1. GRAbB: Selective Assembly of Genomic Regions, a New Niche for Genomic Research

    PubMed Central

    Zhang, Hao; van Diepeningen, Anne D.; van der Lee, Theo A. J.; Waalwijk, Cees; de Hoog, G. Sybren

    2016-01-01

    GRAbB (Genomic Region Assembly by Baiting) is a new program that is dedicated to assemble specific genomic regions from NGS data. This approach is especially useful when dealing with multi copy regions, such as mitochondrial genome and the rDNA repeat region, parts of the genome that are often neglected or poorly assembled, although they contain interesting information from phylogenetic or epidemiologic perspectives, but also single copy regions can be assembled. The program is capable of targeting multiple regions within a single run. Furthermore, GRAbB can be used to extract specific loci from NGS data, based on homology, like sequences that are used for barcoding. To make the assembly specific, a known part of the region, such as the sequence of a PCR amplicon or a homologous sequence from a related species must be specified. By assembling only the region of interest, the assembly process is computationally much less demanding and may lead to assemblies of better quality. In this study the different applications and functionalities of the program are demonstrated such as: exhaustive assembly (rDNA region and mitochondrial genome), extracting homologous regions or genes (IGS, RPB1, RPB2 and TEF1a), as well as extracting multiple regions within a single run. The program is also compared with MITObim, which is meant for the exhaustive assembly of a single target based on a similar query sequence. GRAbB is shown to be more efficient than MITObim in terms of speed, memory and disk usage. The other functionalities (handling multiple targets simultaneously and extracting homologous regions) of the new program are not matched by other programs. The program is available with explanatory documentation at https://github.com/b-brankovics/grabb. GRAbB has been tested on Ubuntu (12.04 and 14.04), Fedora (23), CentOS (7.1.1503) and Mac OS X (10.7). Furthermore, GRAbB is available as a docker repository: brankovics/grabb (https://hub.docker.com/r/brankovics/grabb/). PMID:27308864

  2. GRAbB: Selective Assembly of Genomic Regions, a New Niche for Genomic Research.

    PubMed

    Brankovics, Balázs; Zhang, Hao; van Diepeningen, Anne D; van der Lee, Theo A J; Waalwijk, Cees; de Hoog, G Sybren

    2016-06-01

    GRAbB (Genomic Region Assembly by Baiting) is a new program that is dedicated to assemble specific genomic regions from NGS data. This approach is especially useful when dealing with multi copy regions, such as mitochondrial genome and the rDNA repeat region, parts of the genome that are often neglected or poorly assembled, although they contain interesting information from phylogenetic or epidemiologic perspectives, but also single copy regions can be assembled. The program is capable of targeting multiple regions within a single run. Furthermore, GRAbB can be used to extract specific loci from NGS data, based on homology, like sequences that are used for barcoding. To make the assembly specific, a known part of the region, such as the sequence of a PCR amplicon or a homologous sequence from a related species must be specified. By assembling only the region of interest, the assembly process is computationally much less demanding and may lead to assemblies of better quality. In this study the different applications and functionalities of the program are demonstrated such as: exhaustive assembly (rDNA region and mitochondrial genome), extracting homologous regions or genes (IGS, RPB1, RPB2 and TEF1a), as well as extracting multiple regions within a single run. The program is also compared with MITObim, which is meant for the exhaustive assembly of a single target based on a similar query sequence. GRAbB is shown to be more efficient than MITObim in terms of speed, memory and disk usage. The other functionalities (handling multiple targets simultaneously and extracting homologous regions) of the new program are not matched by other programs. The program is available with explanatory documentation at https://github.com/b-brankovics/grabb. GRAbB has been tested on Ubuntu (12.04 and 14.04), Fedora (23), CentOS (7.1.1503) and Mac OS X (10.7). Furthermore, GRAbB is available as a docker repository: brankovics/grabb (https://hub.docker.com/r/brankovics/grabb/).

  3. CRISPR/Cas9 in Genome Editing and Beyond.

    PubMed

    Wang, Haifeng; La Russa, Marie; Qi, Lei S

    2016-06-02

    The Cas9 protein (CRISPR-associated protein 9), derived from type II CRISPR (clustered regularly interspaced short palindromic repeats) bacterial immune systems, is emerging as a powerful tool for engineering the genome in diverse organisms. As an RNA-guided DNA endonuclease, Cas9 can be easily programmed to target new sites by altering its guide RNA sequence, and its development as a tool has made sequence-specific gene editing several magnitudes easier. The nuclease-deactivated form of Cas9 further provides a versatile RNA-guided DNA-targeting platform for regulating and imaging the genome, as well as for rewriting the epigenetic status, all in a sequence-specific manner. With all of these advances, we have just begun to explore the possible applications of Cas9 in biomedical research and therapeutics. In this review, we describe the current models of Cas9 function and the structural and biochemical studies that support it. We focus on the applications of Cas9 for genome editing, regulation, and imaging, discuss other possible applications and some technical considerations, and highlight the many advantages that CRISPR/Cas9 technology offers.

  4. snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome.

    PubMed

    Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu

    2006-01-01

    Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker programs, for the highly efficient and specific screening of both guide and orphan snoRNA genes in mammalian genomes. By using these programs, we have systematically scanned four human-mammal whole-genome alignment (WGA) sequences and identified 54 novel candidates including 26 orphan candidates as well as 266 known snoRNA genes. Eighteen novel snoRNAs were further experimentally confirmed with four snoRNAs exhibiting a tissue-specific or restricted expression pattern. The results of this study provide the most comprehensive listing of two families of snoRNA genes in the human genome till date.

  5. The PiGeOn project: protocol of a longitudinal study examining psychosocial and ethical issues and outcomes in germline genomic sequencing for cancer.

    PubMed

    Best, Megan; Newson, Ainsley J; Meiser, Bettina; Juraskova, Ilona; Goldstein, David; Tucker, Kathy; Ballinger, Mandy L; Hess, Dominique; Schlub, Timothy E; Biesecker, Barbara; Vines, Richard; Vines, Kate; Thomas, David; Young, Mary-Anne; Savard, Jacqueline; Jacobs, Chris; Butow, Phyllis

    2018-04-23

    Advances in genomics offer promise for earlier detection or prevention of cancer, by personalisation of medical care tailored to an individual's genomic risk status. However genome sequencing can generate an unprecedented volume of results for the patient to process with potential implications for their families and reproductive choices. This paper describes a protocol for a study (PiGeOn) that aims to explore how patients and their blood relatives experience germline genomic sequencing, to help guide the appropriate future implementation of genome sequencing into routine clinical practice. We have designed a mixed-methods, prospective, cohort sub-study of a germline genomic sequencing study that targets adults with cancer suggestive of a genetic aetiology. One thousand probands and 2000 of their blood relatives will undergo germline genomic sequencing as part of the parent study in Sydney, Australia between 2016 and 2020. Test results are expected within12-15 months of recruitment. For the PiGeOn sub-study, participants will be invited to complete surveys at baseline, three months and twelve months after baseline using self-administered questionnaires, to assess the experience of long waits for results (despite being informed that results may not be returned) and expectations of receiving them. Subsets of both probands and blood relatives will be purposively sampled and invited to participate in three semi-structured qualitative interviews (at baseline and each follow-up) to triangulate the data. Ethical themes identified in the data will be used to inform critical revisions of normative ethical concepts or frameworks. This will be one of the first studies internationally to follow the psychosocial impact on probands and their blood relatives who undergo germline genome sequencing, over time. Study results will inform ongoing ethical debates on issues such as informed consent for genomic sequencing, and informing participants and their relatives of specific results. The study will also provide important outcome data concerning the psychological impact of prolonged waiting for germline genomic sequencing. These data are needed to ensure that when germline genomic sequencing is introduced into standard clinical settings, ethical concepts are embedded, and patients and their relatives are adequately prepared and supported during and after the testing process.

  6. Whole-genome sequence, SNP chips and pedigree structure: building demographic profiles in domestic dog breeds to optimize genetic-trait mapping.

    PubMed

    Dreger, Dayna L; Rimbault, Maud; Davis, Brian W; Bhatnagar, Adrienne; Parker, Heidi G; Ostrander, Elaine A

    2016-12-01

    In the decade following publication of the draft genome sequence of the domestic dog, extraordinary advances with application to several fields have been credited to the canine genetic system. Taking advantage of closed breeding populations and the subsequent selection for aesthetic and behavioral characteristics, researchers have leveraged the dog as an effective natural model for the study of complex traits, such as disease susceptibility, behavior and morphology, generating unique contributions to human health and biology. When designing genetic studies using purebred dogs, it is essential to consider the unique demography of each population, including estimation of effective population size and timing of population bottlenecks. The analytical design approach for genome-wide association studies (GWAS) and analysis of whole-genome sequence (WGS) experiments are inextricable from demographic data. We have performed a comprehensive study of genomic homozygosity, using high-depth WGS data for 90 individuals, and Illumina HD SNP data from 800 individuals representing 80 breeds. These data were coupled with extensive pedigree data analyses for 11 breeds that, together, allowed us to compute breed structure, demography, and molecular measures of genome diversity. Our comparative analyses characterize the extent, formation and implication of breed-specific diversity as it relates to population structure. These data demonstrate the relationship between breed-specific genome dynamics and population architecture, and provide important considerations influencing the technological and cohort design of association and other genomic studies. © 2016. Published by The Company of Biologists Ltd.

  7. Whole-genome sequence, SNP chips and pedigree structure: building demographic profiles in domestic dog breeds to optimize genetic-trait mapping

    PubMed Central

    Dreger, Dayna L.; Rimbault, Maud; Davis, Brian W.; Bhatnagar, Adrienne; Parker, Heidi G.

    2016-01-01

    ABSTRACT In the decade following publication of the draft genome sequence of the domestic dog, extraordinary advances with application to several fields have been credited to the canine genetic system. Taking advantage of closed breeding populations and the subsequent selection for aesthetic and behavioral characteristics, researchers have leveraged the dog as an effective natural model for the study of complex traits, such as disease susceptibility, behavior and morphology, generating unique contributions to human health and biology. When designing genetic studies using purebred dogs, it is essential to consider the unique demography of each population, including estimation of effective population size and timing of population bottlenecks. The analytical design approach for genome-wide association studies (GWAS) and analysis of whole-genome sequence (WGS) experiments are inextricable from demographic data. We have performed a comprehensive study of genomic homozygosity, using high-depth WGS data for 90 individuals, and Illumina HD SNP data from 800 individuals representing 80 breeds. These data were coupled with extensive pedigree data analyses for 11 breeds that, together, allowed us to compute breed structure, demography, and molecular measures of genome diversity. Our comparative analyses characterize the extent, formation and implication of breed-specific diversity as it relates to population structure. These data demonstrate the relationship between breed-specific genome dynamics and population architecture, and provide important considerations influencing the technological and cohort design of association and other genomic studies. PMID:27874836

  8. High-throughput illumina strand-specific RNA sequencing library preparation

    USDA-ARS?s Scientific Manuscript database

    Conventional Illumina RNA-Seq does not have the resolution to decode the complex eukaryote transcriptome due to the lack of RNA polarity information. Strand-specific RNA sequencing (ssRNA-Seq) can overcome these limitations and as such is better suited for genome annotation, de novo transcriptome as...

  9. The study of human Y chromosome variation through ancient DNA.

    PubMed

    Kivisild, Toomas

    2017-05-01

    High throughput sequencing methods have completely transformed the study of human Y chromosome variation by offering a genome-scale view on genetic variation retrieved from ancient human remains in context of a growing number of high coverage whole Y chromosome sequence data from living populations from across the world. The ancient Y chromosome sequences are providing us the first exciting glimpses into the past variation of male-specific compartment of the genome and the opportunity to evaluate models based on previously made inferences from patterns of genetic variation in living populations. Analyses of the ancient Y chromosome sequences are challenging not only because of issues generally related to ancient DNA work, such as DNA damage-induced mutations and low content of endogenous DNA in most human remains, but also because of specific properties of the Y chromosome, such as its highly repetitive nature and high homology with the X chromosome. Shotgun sequencing of uniquely mapping regions of the Y chromosomes to sufficiently high coverage is still challenging and costly in poorly preserved samples. To increase the coverage of specific target SNPs capture-based methods have been developed and used in recent years to generate Y chromosome sequence data from hundreds of prehistoric skeletal remains. Besides the prospects of testing directly as how much genetic change in a given time period has accompanied changes in material culture the sequencing of ancient Y chromosomes allows us also to better understand the rate at which mutations accumulate and get fixed over time. This review considers genome-scale evidence on ancient Y chromosome diversity that has recently started to accumulate in geographic areas favourable to DNA preservation. More specifically the review focuses on examples of regional continuity and change of the Y chromosome haplogroups in North Eurasia and in the New World.

  10. Comprehensive definition of genome features in Spirodela polyrhiza by high-depth physical mapping and short-read DNA sequencing strategies.

    PubMed

    Michael, Todd P; Bryant, Douglas; Gutierrez, Ryan; Borisjuk, Nikolai; Chu, Philomena; Zhang, Hanzhong; Xia, Jing; Zhou, Junfei; Peng, Hai; El Baidouri, Moaine; Ten Hallers, Boudewijn; Hastie, Alex R; Liang, Tiffany; Acosta, Kenneth; Gilbert, Sarah; McEntee, Connor; Jackson, Scott A; Mockler, Todd C; Zhang, Weixiong; Lam, Eric

    2017-02-01

    Spirodela polyrhiza is a fast-growing aquatic monocot with highly reduced morphology, genome size and number of protein-coding genes. Considering these biological features of Spirodela and its basal position in the monocot lineage, understanding its genome architecture could shed light on plant adaptation and genome evolution. Like many draft genomes, however, the 158-Mb Spirodela genome sequence has not been resolved to chromosomes, and important genome characteristics have not been defined. Here we deployed rapid genome-wide physical maps combined with high-coverage short-read sequencing to resolve the 20 chromosomes of Spirodela and to empirically delineate its genome features. Our data revealed a dramatic reduction in the number of the rDNA repeat units in Spirodela to fewer than 100, which is even fewer than that reported for yeast. Consistent with its unique phylogenetic position, small RNA sequencing revealed 29 Spirodela-specific microRNA, with only two being shared with Elaeis guineensis (oil palm) and Musa balbisiana (banana). Combining DNA methylation data and small RNA sequencing enabled the accurate prediction of 20.5% long terminal repeats (LTRs) that doubled the previous estimate, and revealed a high Solo:Intact LTR ratio of 8.2. Interestingly, we found that Spirodela has the lowest global DNA methylation levels (9%) of any plant species tested. Taken together our results reveal a genome that has undergone reduction, likely through eliminating non-essential protein coding genes, rDNA and LTRs. In addition to delineating the genome features of this unique plant, the methodologies described and large-scale genome resources from this work will enable future evolutionary and functional studies of this basal monocot family. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  11. Comparative Genomics of Erwinia amylovora and Related Erwinia Species—What do We Learn?

    PubMed Central

    Zhao, Youfu; Qi, Mingsheng

    2011-01-01

    Erwinia amylovora, the causal agent of fire blight disease of apples and pears, is one of the most important plant bacterial pathogens with worldwide economic significance. Recent reports on the complete or draft genome sequences of four species in the genus Erwinia, including E. amylovora, E. pyrifoliae, E. tasmaniensis, and E. billingiae, have provided us near complete genetic information about this pathogen and its closely-related species. This review describes in silico subtractive hybridization-based comparative genomic analyses of eight genomes currently available, and highlights what we have learned from these comparative analyses, as well as genetic and functional genomic studies. Sequence analyses reinforce the assumption that E. amylovora is a relatively homogeneous species and support the current classification scheme of E. amylovora and its related species. The potential evolutionary origin of these Erwinia species is also proposed. The current understanding of the pathogen, its virulence mechanism and host specificity from genome sequencing data is summarized. Future research directions are also suggested. PMID:24710213

  12. A high-throughput next-generation sequencing-based method for detecting the mutational fingerprint of carcinogens

    PubMed Central

    Besaratinia, Ahmad; Li, Haiqing; Yoon, Jae-In; Zheng, Albert; Gao, Hanlin; Tommasi, Stella

    2012-01-01

    Many carcinogens leave a unique mutational fingerprint in the human genome. These mutational fingerprints manifest as specific types of mutations often clustering at certain genomic loci in tumor genomes from carcinogen-exposed individuals. To develop a high-throughput method for detecting the mutational fingerprint of carcinogens, we have devised a cost-, time- and labor-effective strategy, in which the widely used transgenic Big Blue® mouse mutation detection assay is made compatible with the Roche/454 Genome Sequencer FLX Titanium next-generation sequencing technology. As proof of principle, we have used this novel method to establish the mutational fingerprints of three prominent carcinogens with varying mutagenic potencies, including sunlight ultraviolet radiation, 4-aminobiphenyl and secondhand smoke that are known to be strong, moderate and weak mutagens, respectively. For verification purposes, we have compared the mutational fingerprints of these carcinogens obtained by our newly developed method with those obtained by parallel analyses using the conventional low-throughput approach, that is, standard mutation detection assay followed by direct DNA sequencing using a capillary DNA sequencer. We demonstrate that this high-throughput next-generation sequencing-based method is highly specific and sensitive to detect the mutational fingerprints of the tested carcinogens. The method is reproducible, and its accuracy is comparable with that of the currently available low-throughput method. In conclusion, this novel method has the potential to move the field of carcinogenesis forward by allowing high-throughput analysis of mutations induced by endogenous and/or exogenous genotoxic agents. PMID:22735701

  13. A high-throughput next-generation sequencing-based method for detecting the mutational fingerprint of carcinogens.

    PubMed

    Besaratinia, Ahmad; Li, Haiqing; Yoon, Jae-In; Zheng, Albert; Gao, Hanlin; Tommasi, Stella

    2012-08-01

    Many carcinogens leave a unique mutational fingerprint in the human genome. These mutational fingerprints manifest as specific types of mutations often clustering at certain genomic loci in tumor genomes from carcinogen-exposed individuals. To develop a high-throughput method for detecting the mutational fingerprint of carcinogens, we have devised a cost-, time- and labor-effective strategy, in which the widely used transgenic Big Blue mouse mutation detection assay is made compatible with the Roche/454 Genome Sequencer FLX Titanium next-generation sequencing technology. As proof of principle, we have used this novel method to establish the mutational fingerprints of three prominent carcinogens with varying mutagenic potencies, including sunlight ultraviolet radiation, 4-aminobiphenyl and secondhand smoke that are known to be strong, moderate and weak mutagens, respectively. For verification purposes, we have compared the mutational fingerprints of these carcinogens obtained by our newly developed method with those obtained by parallel analyses using the conventional low-throughput approach, that is, standard mutation detection assay followed by direct DNA sequencing using a capillary DNA sequencer. We demonstrate that this high-throughput next-generation sequencing-based method is highly specific and sensitive to detect the mutational fingerprints of the tested carcinogens. The method is reproducible, and its accuracy is comparable with that of the currently available low-throughput method. In conclusion, this novel method has the potential to move the field of carcinogenesis forward by allowing high-throughput analysis of mutations induced by endogenous and/or exogenous genotoxic agents.

  14. Identification of Sinorhizobium (Ensifer) medicae based on a specific genomic sequence unveiled by M13-PCR fingerprinting.

    PubMed

    Dourado, Ana Catarina; Alves, Paula I L; Tenreiro, Tania; Ferreira, Eugénio M; Tenreiro, Rogério; Fareleira, Paula; Crespo, M Teresa Barreto

    2009-12-01

    A collection of nodule isolates from Medicago polymorpha obtained from southern and central Portugal was evaluated by M13-PCR fingerprinting and hierarchical cluster analysis. Several genomic clusters were obtained which, by 16S rRNA gene sequencing of selected representatives, were shown to be associated with particular taxonomic groups of rhizobia and other soil bacteria. The method provided a clear separation between rhizobia and co-isolated non-symbiotic soil contaminants. Ten M13-PCR groups were assigned to Sinorhizobium (Ensifer) medicae and included all isolates responsible for the formation of nitrogen-fixing nodules upon re-inoculation of M. polymorpha test-plants. In addition, enterobacterial repetitive intergenic consensus (ERIC)-PCR fingerprinting indicated a high genomic heterogeneity within the major M13- PCR clusters of S. medicae isolates. Based on nucleotide sequence data of an M13-PCR amplicon of ca. 1500 bp, observed only in S. medicae isolates and spanning locus Smed_3707 to Smed_3709 from the pSMED01 plasmid sequence of S. medicae WSM419 genome's sequence, a pair of PCR primers was designed and used for direct PCR amplification of a 1399-bp sequence within this fragment. Additional in silico and in vitro experiments, as well as phylogenetic analysis, confirmed the specificity of this primer combination and therefore the reliability of this approach in the prompt identification of S. medicae isolates and their distinction from other soil bacteria.

  15. Detection of PIWI and piRNAs in the mitochondria of mammalian cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kwon, ChangHyuk, E-mail: netbuyer@hanmail.net; Tak, Hyosun, E-mail: chuberry@naver.com; Rho, Mina, E-mail: minarho@hanyang.ac.kr

    2014-03-28

    Highlights: • piRNA sequences were mapped to human mitochondrial (mt) genome. • We inspected small RNA-Seq datasets from somatic cell mt subcellular fractions. • Piwi and piRNA transcripts are present in mammalian somatic cancer cell mt fractions. - Abstract: Piwi-interacting RNAs (piRNAs) are 26–31 nt small noncoding RNAs that are processed from their longer precursor transcripts by Piwi proteins. Localization of Piwi and piRNA has been reported mostly in nucleus and cytoplasm of higher eukaryotes germ-line cells, where it is believed that known piRNA sequences are located in repeat regions of nuclear genome in germ-line cells. However, localization of PIWImore » and piRNA in mammalian somatic cell mitochondria yet remains largely unknown. We identified 29 piRNA sequence alignments from various regions of the human mitochondrial genome. Twelve out 29 piRNA sequences matched stem-loop fragment sequences of seven distinct tRNAs. We observed their actual expression in mitochondria subcellular fractions by inspecting mitochondrial-specific small RNA-Seq datasets. Of interest, the majority of the 29 piRNAs overlapped with multiple longer transcripts (expressed sequence tags) that are unique to the human mitochondrial genome. The presence of mature piRNAs in mitochondria was detected by qRT-PCR of mitochondrial subcellular RNAs. Further validation showed detection of Piwi by colocalization using anti-Piwil1 and mitochondria organelle-specific protein antibodies.« less

  16. The 193-base pair Gsg2 (haspin) promoter region regulates germ cell-specific expression bidirectionally and synchronously.

    PubMed

    Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu

    2007-03-01

    Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.

  17. Utility of NIST Whole-Genome Reference Materials for the Technical Validation of a Multigene Next-Generation Sequencing Test.

    PubMed

    Shum, Bennett O V; Henner, Ilya; Belluoccio, Daniele; Hinchcliffe, Marcus J

    2017-07-01

    The sensitivity and specificity of next-generation sequencing laboratory developed tests (LDTs) are typically determined by an analyte-specific approach. Analyte-specific validations use disease-specific controls to assess an LDT's ability to detect known pathogenic variants. Alternatively, a methods-based approach can be used for LDT technical validations. Methods-focused validations do not use disease-specific controls but use benchmark reference DNA that contains known variants (benign, variants of unknown significance, and pathogenic) to assess variant calling accuracy of a next-generation sequencing workflow. Recently, four whole-genome reference materials (RMs) from the National Institute of Standards and Technology (NIST) were released to standardize methods-based validations of next-generation sequencing panels across laboratories. We provide a practical method for using NIST RMs to validate multigene panels. We analyzed the utility of RMs in validating a novel newborn screening test that targets 70 genes, called NEO1. Despite the NIST RM variant truth set originating from multiple sequencing platforms, replicates, and library types, we discovered a 5.2% false-negative variant detection rate in the RM truth set genes that were assessed in our validation. We developed a strategy using complementary non-RM controls to demonstrate 99.6% sensitivity of the NEO1 test in detecting variants. Our findings have implications for laboratories or proficiency testing organizations using whole-genome NIST RMs for testing. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  18. Translocation and deletion breakpoints in cancer genomes are associated with potential non-B DNA-forming sequences.

    PubMed

    Bacolla, Albino; Tainer, John A; Vasquez, Karen M; Cooper, David N

    2016-07-08

    Gross chromosomal rearrangements (including translocations, deletions, insertions and duplications) are a hallmark of cancer genomes and often create oncogenic fusion genes. An obligate step in the generation of such gross rearrangements is the formation of DNA double-strand breaks (DSBs). Since the genomic distribution of rearrangement breakpoints is non-random, intrinsic cellular factors may predispose certain genomic regions to breakage. Notably, certain DNA sequences with the potential to fold into secondary structures [potential non-B DNA structures (PONDS); e.g. triplexes, quadruplexes, hairpin/cruciforms, Z-DNA and single-stranded looped-out structures with implications in DNA replication and transcription] can stimulate the formation of DNA DSBs. Here, we tested the postulate that these DNA sequences might be found at, or in close proximity to, rearrangement breakpoints. By analyzing the distribution of PONDS-forming sequences within ±500 bases of 19 947 translocation and 46 365 sequence-characterized deletion breakpoints in cancer genomes, we find significant association between PONDS-forming repeats and cancer breakpoints. Specifically, (AT)n, (GAA)n and (GAAA)n constitute the most frequent repeats at translocation breakpoints, whereas A-tracts occur preferentially at deletion breakpoints. Translocation breakpoints near PONDS-forming repeats also recur in different individuals and patient tumor samples. Hence, PONDS-forming sequences represent an intrinsic risk factor for genomic rearrangements in cancer genomes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Jisen; Sharma, Anupma; Yu, Qingyi

    Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less

  20. Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

    DOE PAGES

    Zhang, Jisen; Sharma, Anupma; Yu, Qingyi; ...

    2016-06-10

    Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less

  1. PET-Tool: a software suite for comprehensive processing and managing of Paired-End diTag (PET) sequence data.

    PubMed

    Chiu, Kuo Ping; Wong, Chee-Hong; Chen, Qiongyu; Ariyaratne, Pramila; Ooi, Hong Sain; Wei, Chia-Lin; Sung, Wing-Kin Ken; Ruan, Yijun

    2006-08-25

    We recently developed the Paired End diTag (PET) strategy for efficient characterization of mammalian transcriptomes and genomes. The paired end nature of short PET sequences derived from long DNA fragments raised a new set of bioinformatics challenges, including how to extract PETs from raw sequence reads, and correctly yet efficiently map PETs to reference genome sequences. To accommodate and streamline data analysis of the large volume PET sequences generated from each PET experiment, an automated PET data process pipeline is desirable. We designed an integrated computation program package, PET-Tool, to automatically process PET sequences and map them to the genome sequences. The Tool was implemented as a web-based application composed of four modules: the Extractor module for PET extraction; the Examiner module for analytic evaluation of PET sequence quality; the Mapper module for locating PET sequences in the genome sequences; and the Project Manager module for data organization. The performance of PET-Tool was evaluated through the analyses of 2.7 million PET sequences. It was demonstrated that PET-Tool is accurate and efficient in extracting PET sequences and removing artifacts from large volume dataset. Using optimized mapping criteria, over 70% of quality PET sequences were mapped specifically to the genome sequences. With a 2.4 GHz LINUX machine, it takes approximately six hours to process one million PETs from extraction to mapping. The speed, accuracy, and comprehensiveness have proved that PET-Tool is an important and useful component in PET experiments, and can be extended to accommodate other related analyses of paired-end sequences. The Tool also provides user-friendly functions for data quality check and system for multi-layer data management.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sikorski, Johannes; Lapidus, Alla L.; Copeland, A

    Segniliparus rotundus Butler 2005 is the type species of the genus Segniliparus, which is cur-rently the only genus in the corynebacterial family Segniliparaceae. This family is of large in-terest because of a novel late-emerging genus-specific mycolate pattern. The type strain has been isolated from human sputum and is probably an opportunistic pathogen. Here we de-scribe the features of this organism, together with the complete genome sequence and anno-tation. This is the first completed genome sequence of the family Segniliparaceae. The 3,157,527 bp long genome with its 3,081 protein-coding and 52 RNA genes is part of the Genomic Encyclopedia of Bacteriamore » and Archaea project.« less

  3. The genome of Theobroma cacao.

    PubMed

    Argout, Xavier; Salse, Jerome; Aury, Jean-Marc; Guiltinan, Mark J; Droc, Gaetan; Gouzy, Jerome; Allegre, Mathilde; Chaparro, Cristian; Legavre, Thierry; Maximova, Siela N; Abrouk, Michael; Murat, Florent; Fouet, Olivier; Poulain, Julie; Ruiz, Manuel; Roguet, Yolande; Rodier-Goud, Maguy; Barbosa-Neto, Jose Fernandes; Sabot, Francois; Kudrna, Dave; Ammiraju, Jetty Siva S; Schuster, Stephan C; Carlson, John E; Sallet, Erika; Schiex, Thomas; Dievart, Anne; Kramer, Melissa; Gelley, Laura; Shi, Zi; Bérard, Aurélie; Viot, Christopher; Boccara, Michel; Risterucci, Ange Marie; Guignon, Valentin; Sabau, Xavier; Axtell, Michael J; Ma, Zhaorong; Zhang, Yufan; Brown, Spencer; Bourge, Mickael; Golser, Wolfgang; Song, Xiang; Clement, Didier; Rivallan, Ronan; Tahi, Mathias; Akaza, Joseph Moroh; Pitollat, Bertrand; Gramacho, Karina; D'Hont, Angélique; Brunel, Dominique; Infante, Diogenes; Kebe, Ismael; Costet, Pierre; Wing, Rod; McCombie, W Richard; Guiderdoni, Emmanuel; Quetier, Francis; Panaud, Olivier; Wincker, Patrick; Bocs, Stephanie; Lanaud, Claire

    2011-02-01

    We sequenced and assembled the draft genome of Theobroma cacao, an economically important tropical-fruit tree crop that is the source of chocolate. This assembly corresponds to 76% of the estimated genome size and contains almost all previously described genes, with 82% of these genes anchored on the 10 T. cacao chromosomes. Analysis of this sequence information highlighted specific expansion of some gene families during evolution, for example, flavonoid-related genes. It also provides a major source of candidate genes for T. cacao improvement. Based on the inferred paleohistory of the T. cacao genome, we propose an evolutionary scenario whereby the ten T. cacao chromosomes were shaped from an ancestor through eleven chromosome fusions.

  4. Draft genome of the mountain pine beetle, Dendroctonus ponderosae Hopkins, a major forest pest

    PubMed Central

    2013-01-01

    Background The mountain pine beetle, Dendroctonus ponderosae Hopkins, is the most serious insect pest of western North American pine forests. A recent outbreak destroyed more than 15 million hectares of pine forests, with major environmental effects on forest health, and economic effects on the forest industry. The outbreak has in part been driven by climate change, and will contribute to increased carbon emissions through decaying forests. Results We developed a genome sequence resource for the mountain pine beetle to better understand the unique aspects of this insect's biology. A draft de novo genome sequence was assembled from paired-end, short-read sequences from an individual field-collected male pupa, and scaffolded using mate-paired, short-read genomic sequences from pooled field-collected pupae, paired-end short-insert whole-transcriptome shotgun sequencing reads of mRNA from adult beetle tissues, and paired-end Sanger EST sequences from various life stages. We describe the cytochrome P450, glutathione S-transferase, and plant cell wall-degrading enzyme gene families important to the survival of the mountain pine beetle in its harsh and nutrient-poor host environment, and examine genome-wide single-nucleotide polymorphism variation. A horizontally transferred bacterial sucrose-6-phosphate hydrolase was evident in the genome, and its tissue-specific transcription suggests a functional role for this beetle. Conclusions Despite Coleoptera being the largest insect order with over 400,000 described species, including many agricultural and forest pest species, this is only the second genome sequence reported in Coleoptera, and will provide an important resource for the Curculionoidea and other insects. PMID:23537049

  5. The complete chloroplast genome sequence of date palm (Phoenix dactylifera L.).

    PubMed

    Yang, Meng; Zhang, Xiaowei; Liu, Guiming; Yin, Yuxin; Chen, Kaifu; Yun, Quanzheng; Zhao, Duojun; Al-Mssallem, Ibrahim S; Yu, Jun

    2010-09-15

    Date palm (Phoenix dactylifera L.), a member of Arecaceae family, is one of the three major economically important woody palms--the two other palms being oil palm and coconut tree--and its fruit is a staple food among Middle East and North African nations, as well as many other tropical and subtropical regions. Here we report a complete sequence of the data palm chloroplast (cp) genome based on pyrosequencing. After extracting 369,022 cp sequencing reads from our whole-genome-shotgun data, we put together an assembly and validated it with intensive PCR-based verification, coupled with PCR product sequencing. The date palm cp genome is 158,462 bp in length and has a typical quadripartite structure of the large (LSC, 86,198 bp) and small single-copy (SSC, 17,712 bp) regions separated by a pair of inverted repeats (IRs, 27,276 bp). Similar to what has been found among most angiosperms, the date palm cp genome harbors 112 unique genes and 19 duplicated fragments in the IR regions. The junctions between LSC/IRs and SSC/IRs show different features of sequence expansion in evolution. We identified 78 SNPs as major intravarietal polymorphisms within the population of a specific cp genome, most of which were located in genes with vital functions. Based on RNA-sequencing data, we also found 18 polycistronic transcription units and three highly expression-biased genes--atpF, trnA-UGC, and rrn23. Unlike most monocots, date palm has a typical cp genome similar to that of tobacco--with little rearrangement and gene loss or gain. High-throughput sequencing technology facilitates the identification of intravarietal variations in cp genomes among different cultivars. Moreover, transcriptomic analysis of cp genes provides clues for uncovering regulatory mechanisms of transcription and translation in chloroplasts.

  6. Environmental genomics of "Haloquadratum walsbyi" in a saltern crystallizer indicates a large pool of accessory genes in an otherwise coherent species

    PubMed Central

    Legault, Boris A; Lopez-Lopez, Arantxa; Alba-Casado, Jose Carlos; Doolittle, W Ford; Bolhuis, Henk; Rodriguez-Valera, Francisco; Papke, R Thane

    2006-01-01

    Background Mature saturated brine (crystallizers) communities are largely dominated (>80% of cells) by the square halophilic archaeon "Haloquadratum walsbyi". The recent cultivation of the strain HBSQ001 and thesequencing of its genome allows comparison with the metagenome of this taxonomically simplified environment. Similar studies carried out in other extreme environments have revealed very little diversity in gene content among the cell lineages present. Results The metagenome of the microbial community of a crystallizer pond has been analyzed by end sequencing a 2000 clone fosmid library and comparing the sequences obtained with the genome sequence of "Haloquadratum walsbyi". The genome of the sequenced strain was retrieved nearly complete within this environmental DNA library. However, many ORF's that could be ascribed to the "Haloquadratum" metapopulation by common genome characteristics or scaffolding to the strain genome were not present in the specific sequenced isolate. Particularly, three regions of the sequenced genome were associated with multiple rearrangements and the presence of different genes from the metapopulation. Many transposition and phage related genes were found within this pool which, together with the associated atypical GC content in these areas, supports lateral gene transfer mediated by these elements as the most probable genetic cause of this variability. Additionally, these sequences were highly enriched in putative regulatory and signal transduction functions. Conclusion These results point to a large pan-genome (total gene repertoire of the genus/species) even in this highly specialized extremophile and at a single geographic location. The extensive gene repertoire is what might be expected of a population that exploits a diverse nutrient pool, resulting from the degradation of biomass produced at lower salinities. PMID:16820057

  7. Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pennacchio, L.A.

    1994-05-06

    We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

  8. Employing genome-wide SNP discovery and genotyping strategy to extrapolate the natural allelic diversity and domestication patterns in chickpea

    PubMed Central

    Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

    2015-01-01

    The genome-wide discovery and high-throughput genotyping of SNPs in chickpea natural germplasm lines is indispensable to extrapolate their natural allelic diversity, domestication, and linkage disequilibrium (LD) patterns leading to the genetic enhancement of this vital legume crop. We discovered 44,844 high-quality SNPs by sequencing of 93 diverse cultivated desi, kabuli, and wild chickpea accessions using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays that were physically mapped across eight chromosomes of desi and kabuli. Of these, 22,542 SNPs were structurally annotated in different coding and non-coding sequence components of genes. Genes with 3296 non-synonymous and 269 regulatory SNPs could functionally differentiate accessions based on their contrasting agronomic traits. A high experimental validation success rate (92%) and reproducibility (100%) along with strong sensitivity (93–96%) and specificity (99%) of GBS-based SNPs was observed. This infers the robustness of GBS as a high-throughput assay for rapid large-scale mining and genotyping of genome-wide SNPs in chickpea with sub-optimal use of resources. With 23,798 genome-wide SNPs, a relatively high intra-specific polymorphic potential (49.5%) and broader molecular diversity (13–89%)/functional allelic diversity (18–77%) was apparent among 93 chickpea accessions, suggesting their tremendous applicability in rapid selection of desirable diverse accessions/inter-specific hybrids in chickpea crossbred varietal improvement program. The genome-wide SNPs revealed complex admixed domestication pattern, extensive LD estimates (0.54–0.68) and extended LD decay (400–500 kb) in a structured population inclusive of 93 accessions. These findings reflect the utility of our identified SNPs for subsequent genome-wide association study (GWAS) and selective sweep-based domestication trait dissection analysis to identify potential genomic loci (gene-associated targets) specifically regulating important complex quantitative agronomic traits in chickpea. The numerous informative genome-wide SNPs, natural allelic diversity-led domestication pattern, and LD-based information generated in our study have got multidimensional applicability with respect to chickpea genomics-assisted breeding. PMID:25873920

  9. GBshape: a genome browser database for DNA shape annotations

    PubMed Central

    Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J.; Parker, Stephen C.J.; Nuzhdin, Sergey V.; Tullius, Thomas D.; Rohs, Remo

    2015-01-01

    Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. PMID:25326329

  10. Genomics of Methylotrophy in Gram-Positive Methylamine-Utilizing Bacteria

    PubMed Central

    McTaggart, Tami L.; Beck, David A. C.; Setboonsarng, Usanisa; Shapiro, Nicole; Woyke, Tanja; Lidstrom, Mary E.; Kalyuzhnaya, Marina G.; Chistoserdova, Ludmila

    2015-01-01

    Gram-positive methylotrophic bacteria have been known for a long period of time, some serving as model organisms for characterizing the specific details of methylotrophy pathways/enzymes within this group. However, genome-based knowledge of methylotrophy within this group has been so far limited to a single species, Bacillus methanolicus (Firmicutes). The paucity of whole-genome data for Gram-positive methylotrophs limits our global understanding of methylotrophy within this group, including their roles in specific biogeochemical cycles, as well as their biotechnological potential. Here, we describe the isolation of seven novel strains of Gram-positive methylotrophs that include two strains of Bacillus and five representatives of Actinobacteria classified within two genera, Arthrobacter and Mycobacterium. We report whole-genome sequences for these isolates and present comparative analysis of the methylotrophy functional modules within these genomes. The genomic sequences of these seven novel organisms, all capable of growth on methylated amines, present an important reference dataset for understanding the genomic basis of methylotrophy in Gram-positive methylotrophic bacteria. This study is a major contribution to the field of methylotrophy, aimed at closing the gap in the genomic knowledge of methylotrophy within this diverse group of bacteria. PMID:27682081

  11. A programmable method for massively parallel targeted sequencing

    PubMed Central

    Hopmans, Erik S.; Natsoulis, Georges; Bell, John M.; Grimes, Susan M.; Sieh, Weiva; Ji, Hanlee P.

    2014-01-01

    We have developed a targeted resequencing approach referred to as Oligonucleotide-Selective Sequencing. In this study, we report a series of significant improvements and novel applications of this method whereby the surface of a sequencing flow cell is modified in situ to capture specific genomic regions of interest from a sample and then sequenced. These improvements include a fully automated targeted sequencing platform through the use of a standard Illumina cBot fluidics station. Targeting optimization increased the yield of total on-target sequencing data 2-fold compared to the previous iteration, while simultaneously increasing the percentage of reads that could be mapped to the human genome. The described assays cover up to 1421 genes with a total coverage of 5.5 Megabases (Mb). We demonstrate a 10-fold abundance uniformity of greater than 90% in 1 log distance from the median and a targeting rate of up to 95%. We also sequenced continuous genomic loci up to 1.5 Mb while simultaneously genotyping SNPs and genes. Variants with low minor allele fraction were sensitively detected at levels of 5%. Finally, we determined the exact breakpoint sequence of cancer rearrangements. Overall, this approach has high performance for selective sequencing of genome targets, configuration flexibility and variant calling accuracy. PMID:24782526

  12. Completion of full length genome sequence of novel avian paramyxovirus strain APMV/Shimane67 isolated from migratory wild geese in Japan.

    PubMed

    Yamamoto, Eiji; Ito, Toshihiro; Ito, Hiroshi

    2016-11-01

    The nucleotide sequences of nucleocapsid protein (N); phosphoprotein (P); matrix protein (M); hemagglutinin-neuraminidase (HN); and large polymerase protein (L) genes, 3'-end leader, 5'-end trailer and intergenic regions of the avian paramyxovirus (APMV) strain goose/Shimane/67/2000 (APMV/Shimane67) were determined. Together with previously reported data on fusion protein (F) gene sequence [46], the determination of the genome sequence of APMV/Shimane67 has been completed in this study. The genome of APMV/Shimane67 comprised 16,146 nucleotides in length and contains six genes in the order of 3'-N-P-M-F-HN-L-5'. The features of the APMV/Shimane67 genome (e.g., nucleotide length of whole genome and each of the six genes, and predicted amino acid length of each of the six genes) were distinct from those of other APMV serotypes. Phylogenetic analysis indicated that although APMV/Shimane67 was grouped with APMV-1, -9 and -12, the evolutionary distance between APMV/Shimane67 and these viruses was longer than that observed between intra-serotype viruses. These results show that the genome sequence of APMV/Shimane67 contains specific characteristics and is distinguishable from other types of APMV.

  13. Genetic Variation in Cardiomyopathy and Cardiovascular Disorders.

    PubMed

    McNally, Elizabeth M; Puckelwartz, Megan J

    2015-01-01

    With the wider deployment of massively-parallel, next-generation sequencing, it is now possible to survey human genome data for research and clinical purposes. The reduced cost of producing short-read sequencing has now shifted the burden to data analysis. Analysis of genome sequencing remains challenged by the complexity of the human genome, including redundancy and the repetitive nature of genome elements and the large amount of variation in individual genomes. Public databases of human genome sequences greatly facilitate interpretation of common and rare genetic variation, although linking database sequence information to detailed clinical information is limited by privacy and practical issues. Genetic variation is a rich source of knowledge for cardiovascular disease because many, if not all, cardiovascular disorders are highly heritable. The role of rare genetic variation in predicting risk and complications of cardiovascular diseases has been well established for hypertrophic and dilated cardiomyopathy, where the number of genes that are linked to these disorders is growing. Bolstered by family data, where genetic variants segregate with disease, rare variation can be linked to specific genetic variation that offers profound diagnostic information. Understanding genetic variation in cardiomyopathy is likely to help stratify forms of heart failure and guide therapy. Ultimately, genetic variation may be amenable to gene correction and gene editing strategies.

  14. Evolution and Diversity in Human Herpes Simplex Virus Genomes

    PubMed Central

    Gatherer, Derek; Ochoa, Alejandro; Greenbaum, Benjamin; Dolan, Aidan; Bowden, Rory J.; Enquist, Lynn W.; Legendre, Matthieu; Davison, Andrew J.

    2014-01-01

    Herpes simplex virus 1 (HSV-1) causes a chronic, lifelong infection in >60% of adults. Multiple recent vaccine trials have failed, with viral diversity likely contributing to these failures. To understand HSV-1 diversity better, we comprehensively compared 20 newly sequenced viral genomes from China, Japan, Kenya, and South Korea with six previously sequenced genomes from the United States, Europe, and Japan. In this diverse collection of passaged strains, we found that one-fifth of the newly sequenced members share a gene deletion and one-third exhibit homopolymeric frameshift mutations (HFMs). Individual strains exhibit genotypic and potential phenotypic variation via HFMs, deletions, short sequence repeats, and single-nucleotide polymorphisms, although the protein sequence identity between strains exceeds 90% on average. In the first genome-scale analysis of positive selection in HSV-1, we found signs of selection in specific proteins and residues, including the fusion protein glycoprotein H. We also confirmed previous results suggesting that recombination has occurred with high frequency throughout the HSV-1 genome. Despite this, the HSV-1 strains analyzed clustered by geographic origin during whole-genome distance analysis. These data shed light on likely routes of HSV-1 adaptation to changing environments and will aid in the selection of vaccine antigens that are invariant worldwide. PMID:24227835

  15. Effect of read-mapping biases on detecting allele-specific expression from RNA-sequencing data

    PubMed Central

    Degner, Jacob F.; Marioni, John C.; Pai, Athma A.; Pickrell, Joseph K.; Nkadori, Everlyne; Gilad, Yoav; Pritchard, Jonathan K.

    2009-01-01

    Motivation: Next-generation sequencing has become an important tool for genome-wide quantification of DNA and RNA. However, a major technical hurdle lies in the need to map short sequence reads back to their correct locations in a reference genome. Here, we investigate the impact of SNP variation on the reliability of read-mapping in the context of detecting allele-specific expression (ASE). Results: We generated 16 million 35 bp reads from mRNA of each of two HapMap Yoruba individuals. When we mapped these reads to the human genome we found that, at heterozygous SNPs, there was a significant bias toward higher mapping rates of the allele in the reference sequence, compared with the alternative allele. Masking known SNP positions in the genome sequence eliminated the reference bias but, surprisingly, did not lead to more reliable results overall. We find that even after masking, ∼5–10% of SNPs still have an inherent bias toward more effective mapping of one allele. Filtering out inherently biased SNPs removes 40% of the top signals of ASE. The remaining SNPs showing ASE are enriched in genes previously known to harbor cis-regulatory variation or known to show uniparental imprinting. Our results have implications for a variety of applications involving detection of alternate alleles from short-read sequence data. Availability: Scripts, written in Perl and R, for simulating short reads, masking SNP variation in a reference genome and analyzing the simulation output are available upon request from JFD. Raw short read data were deposited in GEO (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE18156. Contact: jdegner@uchicago.edu; marioni@uchicago.edu; gilad@uchicago.edu; pritch@uchicago.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19808877

  16. Assembly of 500,000 inter-specific catfish expressed sequence tags and large scale gene-associated marker development for whole genome association studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Catfish Genome Consortium; Wang, Shaolin; Peatman, Eric

    2010-03-23

    Background-Through the Community Sequencing Program, a catfish EST sequencing project was carried out through a collaboration between the catfish research community and the Department of Energy's Joint Genome Institute. Prior to this project, only a limited EST resource from catfish was available for the purpose of SNP identification. Results-A total of 438,321 quality ESTs were generated from 8 channel catfish (Ictalurus punctatus) and 4 blue catfish (Ictalurus furcatus) libraries, bringing the number of catfish ESTs to nearly 500,000. Assembly of all catfish ESTs resulted in 45,306 contigs and 66,272 singletons. Over 35percent of the unique sequences had significant similarities tomore » known genes, allowing the identification of 14,776 unique genes in catfish. Over 300,000 putative SNPs have been identified, of which approximately 48,000 are high-quality SNPs identified from contigs with at least four sequences and the minor allele presence of at least two sequences in the contig. The EST resource should be valuable for identification of microsatellites, genome annotation, large-scale expression analysis, and comparative genome analysis. Conclusions-This project generated a large EST resource for catfish that captured the majority of the catfish transcriptome. The parallel analysis of ESTs from two closely related Ictalurid catfishes should also provide powerful means for the evaluation of ancient and recent gene duplications, and for the development of high-density microarrays in catfish. The inter- and intra-specific SNPs identified from all catfish EST dataset assembly will greatly benefit the catfish introgression breeding program and whole genome association studies.« less

  17. BG7: A New Approach for Bacterial Genome Annotation Designed for Next Generation Sequencing Data

    PubMed Central

    Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Pareja, Eduardo; Tobes, Raquel

    2012-01-01

    BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version – which is developed in Java, takes advantage of Amazon Web Services (AWS) cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future. PMID:23185310

  18. Targeted genomic enrichment and sequencing of CyHV-3 from carp tissues confirms low nucleotide diversity and mixed genotype infections.

    PubMed

    Hammoumi, Saliha; Vallaeys, Tatiana; Santika, Ayi; Leleux, Philippe; Borzym, Ewa; Klopp, Christophe; Avarre, Jean-Christophe

    2016-01-01

    Koi herpesvirus disease (KHVD) is an emerging disease that causes mass mortality in koi and common carp, Cyprinus carpio L. Its causative agent is Cyprinid herpesvirus 3 (CyHV-3), also known as koi herpesvirus (KHV). Although data on the pathogenesis of this deadly virus is relatively abundant in the literature, still little is known about its genomic diversity and about the molecular mechanisms that lead to such a high virulence. In this context, we developed a new strategy for sequencing full-length CyHV-3 genomes directly from infected fish tissues. Total genomic DNA extracted from carp gill tissue was specifically enriched with CyHV-3 sequences through hybridization to a set of nearly 2 million overlapping probes designed to cover the entire genome length, using KHV-J sequence (GenBank accession number AP008984) as reference. Applied to 7 CyHV-3 specimens from Poland and Indonesia, this targeted genomic enrichment enabled recovery of the full genomes with >99.9% reference coverage. The enrichment rate was directly correlated to the estimated number of viral copies contained in the DNA extracts used for library preparation, which varied between ∼5000 and ∼2×10 7 . The average sequencing depth was >200 for all samples, thus allowing the search for variants with high confidence. Sequence analyses highlighted a significant proportion of intra-specimen sequence heterogeneity, suggesting the presence of mixed infections in all investigated fish. They also showed that inter-specimen genetic diversity at the genome scale was very low (>99.95% of sequence identity). By enabling full genome comparisons directly from infected fish tissues, this new method will be valuable to trace outbreaks rapidly and at a reasonable cost, and in turn to understand the transmission routes of CyHV-3.

  19. Targeted genomic enrichment and sequencing of CyHV-3 from carp tissues confirms low nucleotide diversity and mixed genotype infections

    PubMed Central

    Hammoumi, Saliha; Vallaeys, Tatiana; Santika, Ayi; Leleux, Philippe; Borzym, Ewa; Klopp, Christophe

    2016-01-01

    Koi herpesvirus disease (KHVD) is an emerging disease that causes mass mortality in koi and common carp, Cyprinus carpio L. Its causative agent is Cyprinid herpesvirus 3 (CyHV-3), also known as koi herpesvirus (KHV). Although data on the pathogenesis of this deadly virus is relatively abundant in the literature, still little is known about its genomic diversity and about the molecular mechanisms that lead to such a high virulence. In this context, we developed a new strategy for sequencing full-length CyHV-3 genomes directly from infected fish tissues. Total genomic DNA extracted from carp gill tissue was specifically enriched with CyHV-3 sequences through hybridization to a set of nearly 2 million overlapping probes designed to cover the entire genome length, using KHV-J sequence (GenBank accession number AP008984) as reference. Applied to 7 CyHV-3 specimens from Poland and Indonesia, this targeted genomic enrichment enabled recovery of the full genomes with >99.9% reference coverage. The enrichment rate was directly correlated to the estimated number of viral copies contained in the DNA extracts used for library preparation, which varied between ∼5000 and ∼2×107. The average sequencing depth was >200 for all samples, thus allowing the search for variants with high confidence. Sequence analyses highlighted a significant proportion of intra-specimen sequence heterogeneity, suggesting the presence of mixed infections in all investigated fish. They also showed that inter-specimen genetic diversity at the genome scale was very low (>99.95% of sequence identity). By enabling full genome comparisons directly from infected fish tissues, this new method will be valuable to trace outbreaks rapidly and at a reasonable cost, and in turn to understand the transmission routes of CyHV-3. PMID:27703859

  20. Allele-specific copy-number discovery from whole-genome and whole-exome sequencing

    PubMed Central

    Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J.; Szatkiewicz, Jin P.

    2015-01-01

    Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. PMID:25883151

  1. Big Data and Genome Editing Technology: A New Paradigm of Cardiovascular Genomics.

    PubMed

    Krittanawong, Chayakrit; Sun, Tao; Herzog, Eyal

    2017-01-01

    Opinion Statements: Cardiovascular diseases (CVDs) encompass a range of conditions extending from congenital heart disease to acute coronary syndrome most of which are heterogenous in nature and some of them are multiple genetic loci. However, the pathogenesis of most CVDs remains incompletely understood. The advance in genome-editing technologies, an engineering process of DNA sequences at precise genomic locations, has enabled a new paradigm that human genome can be precisely modified to achieve a therapeutic effect. Genome-editing includes the correction of genetic variants that cause disease, the addition of therapeutic genes to specific sites in the genomic locations, and the removal of deleterious genes or genome sequences. Site-specific genome engineering can be used as nucleases (known as molecular scissors) including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) systems to provide remarkable opportunities for developing novel therapies in cardiovascular clinical care. Here we discuss genetic polymorphisms and mechanistic insights in CVDs with an emphasis on the impact of genome-editing technologies. The current challenges and future prospects for genomeediting technologies in cardiovascular medicine are also discussed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  2. Microbial genomic island discovery, visualization and analysis.

    PubMed

    Bertelli, Claire; Tilley, Keith E; Brinkman, Fiona S L

    2018-06-03

    Horizontal gene transfer (also called lateral gene transfer) is a major mechanism for microbial genome evolution, enabling rapid adaptation and survival in specific niches. Genomic islands (GIs), commonly defined as clusters of bacterial or archaeal genes of probable horizontal origin, are of particular medical, environmental and/or industrial interest, as they disproportionately encode virulence factors and some antimicrobial resistance genes and may harbor entire metabolic pathways that confer a specific adaptation (solvent resistance, symbiosis properties, etc). As large-scale analyses of microbial genomes increases, such as for genomic epidemiology investigations of infectious disease outbreaks in public health, there is increased appreciation of the need to accurately predict and track GIs. Over the past decade, numerous computational tools have been developed to tackle the challenges inherent in accurate GI prediction. We review here the main types of GI prediction methods and discuss their advantages and limitations for a routine analysis of microbial genomes in this era of rapid whole-genome sequencing. An assessment is provided of 20 GI prediction software methods that use sequence-composition bias to identify the GIs, using a reference GI data set from 104 genomes obtained using an independent comparative genomics approach. Finally, we present guidelines to assist researchers in effectively identifying these key genomic regions.

  3. Genome-wide sequencing of longan (Dimocarpus longan Lour.) provides insights into molecular basis of its polyphenol-rich characteristics

    PubMed Central

    Lin, Yuling; Min, Jiumeng; Lai, Ruilian; Wu, Zhangyan; Chen, Yukun; Yu, Lili; Cheng, Chunzhen; Jin, Yuanchun; Tian, Qilin; Liu, Qingfeng; Liu, Weihua; Zhang, Chengguang; Lin, Lixia; Hu, Yan; Zhang, Dongmin; Thu, Minkyaw; Zhang, Zihao; Liu, Shengcai; Zhong, Chunshui; Fang, Xiaodong; Wang, Jian; Yang, Huanming

    2017-01-01

    Abstract Longan (Dimocarpus longan Lour.), an important subtropical fruit in the family Sapindaceae, is grown in more than 10 countries. Longan is an edible drupe fruit and a source of traditional medicine with polyphenol-rich traits. Tree size, alternate bearing, and witches' broom disease still pose serious problems. To gain insights into the genomic basis of longan traits, a draft genome sequence was assembled. The draft genome (about 471.88 Mb) of a Chinese longan cultivar, “Honghezi,” was estimated to contain 31 007 genes and 261.88 Mb of repetitive sequences. No recent whole-genome-wide duplication event was detected in the genome. Whole-genome resequencing and analysis of 13 cultivated D. longan accessions revealed the extent of genetic diversity. Comparative transcriptome studies combined with genome-wide analysis revealed polyphenol-rich and pathogen resistance characteristics. Genes involved in secondary metabolism, especially those from significantly expanded (DHS, SDH, F3΄H, ANR, and UFGT) and contracted (PAL, CHS, and F3΄5΄H) gene families with tissue-specific expression, may be important contributors to the high accumulation levels of polyphenolic compounds observed in longan fruit. The high number of genes encoding nucleotide-binding site leucine-rich repeat (NBS-LRR) and leucine-rich repeat receptor-like kinase proteins, as well as the recent expansion and contraction of the NBS-LRR family, suggested a genomic basis for resistance to insects, fungus, and bacteria in this fruit tree. These data provide insights into the evolution and diversity of the longan genome. The comparative genomic and transcriptome analyses provided information about longan-specific traits, particularly genes involved in its polyphenol-rich and pathogen resistance characteristics. PMID:28368449

  4. Longitudinal Metagenomic Analysis of Hospital Air Identifies Clinically Relevant Microbes.

    PubMed

    King, Paula; Pham, Long K; Waltz, Shannon; Sphar, Dan; Yamamoto, Robert T; Conrad, Douglas; Taplitz, Randy; Torriani, Francesca; Forsyth, R Allyn

    2016-01-01

    We describe the sampling of sixty-three uncultured hospital air samples collected over a six-month period and analysis using shotgun metagenomic sequencing. Our primary goals were to determine the longitudinal metagenomic variability of this environment, identify and characterize genomes of potential pathogens and determine whether they are atypical to the hospital airborne metagenome. Air samples were collected from eight locations which included patient wards, the main lobby and outside. The resulting DNA libraries produced 972 million sequences representing 51 gigabases. Hierarchical clustering of samples by the most abundant 50 microbial orders generated three major nodes which primarily clustered by type of location. Because the indoor locations were longitudinally consistent, episodic relative increases in microbial genomic signatures related to the opportunistic pathogens Aspergillus, Penicillium and Stenotrophomonas were identified as outliers at specific locations. Further analysis of microbial reads specific for Stenotrophomonas maltophilia indicated homology to a sequenced multi-drug resistant clinical strain and we observed broad sequence coverage of resistance genes. We demonstrate that a shotgun metagenomic sequencing approach can be used to characterize the resistance determinants of pathogen genomes that are uncharacteristic for an otherwise consistent hospital air microbial metagenomic profile.

  5. Detection of PIWI and piRNAs in the mitochondria of mammalian cancer cells.

    PubMed

    Kwon, ChangHyuk; Tak, Hyosun; Rho, Mina; Chang, Hae Ryung; Kim, Yon Hui; Kim, Kyung Tae; Balch, Curt; Lee, Eun Kyung; Nam, Seungyoon

    2014-03-28

    Piwi-interacting RNAs (piRNAs) are 26-31 nt small noncoding RNAs that are processed from their longer precursor transcripts by Piwi proteins. Localization of Piwi and piRNA has been reported mostly in nucleus and cytoplasm of higher eukaryotes germ-line cells, where it is believed that known piRNA sequences are located in repeat regions of nuclear genome in germ-line cells. However, localization of PIWI and piRNA in mammalian somatic cell mitochondria yet remains largely unknown. We identified 29 piRNA sequence alignments from various regions of the human mitochondrial genome. Twelve out 29 piRNA sequences matched stem-loop fragment sequences of seven distinct tRNAs. We observed their actual expression in mitochondria subcellular fractions by inspecting mitochondrial-specific small RNA-Seq datasets. Of interest, the majority of the 29 piRNAs overlapped with multiple longer transcripts (expressed sequence tags) that are unique to the human mitochondrial genome. The presence of mature piRNAs in mitochondria was detected by qRT-PCR of mitochondrial subcellular RNAs. Further validation showed detection of Piwi by colocalization using anti-Piwil1 and mitochondria organelle-specific protein antibodies. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  6. dbWGFP: a database and web server of human whole-genome single nucleotide variants and their functional predictions.

    PubMed

    Wu, Jiaxin; Wu, Mengmeng; Li, Lianshuo; Liu, Zhuo; Zeng, Wanwen; Jiang, Rui

    2016-01-01

    The recent advancement of the next generation sequencing technology has enabled the fast and low-cost detection of all genetic variants spreading across the entire human genome, making the application of whole-genome sequencing a tendency in the study of disease-causing genetic variants. Nevertheless, there still lacks a repository that collects predictions of functionally damaging effects of human genetic variants, though it has been well recognized that such predictions play a central role in the analysis of whole-genome sequencing data. To fill this gap, we developed a database named dbWGFP (a database and web server of human whole-genome single nucleotide variants and their functional predictions) that contains functional predictions and annotations of nearly 8.58 billion possible human whole-genome single nucleotide variants. Specifically, this database integrates 48 functional predictions calculated by 17 popular computational methods and 44 valuable annotations obtained from various data sources. Standalone software, user-friendly query services and free downloads of this database are available at http://bioinfo.au.tsinghua.edu.cn/dbwgfp. dbWGFP provides a valuable resource for the analysis of whole-genome sequencing, exome sequencing and SNP array data, thereby complementing existing data sources and computational resources in deciphering genetic bases of human inherited diseases. © The Author(s) 2016. Published by Oxford University Press.

  7. Analysis of the Aedes albopictus C6/36 genome provides insight into cell line utility for viral propagation.

    PubMed

    Miller, Jason R; Koren, Sergey; Dilley, Kari A; Puri, Vinita; Brown, David M; Harkins, Derek M; Thibaud-Nissen, Françoise; Rosen, Benjamin; Chen, Xiao-Guang; Tu, Zhijian; Sharakhov, Igor V; Sharakhova, Maria V; Sebra, Robert; Stockwell, Timothy B; Bergman, Nicholas H; Sutton, Granger G; Phillippy, Adam M; Piermarini, Peter M; Shabman, Reed S

    2018-03-01

    The 50-year-old Aedes albopictus C6/36 cell line is a resource for the detection, amplification, and analysis of mosquito-borne viruses including Zika, dengue, and chikungunya. The cell line is derived from an unknown number of larvae from an unspecified strain of Aedes albopictus mosquitoes. Toward improved utility of the cell line for research in virus transmission, we present an annotated assembly of the C6/36 genome. The C6/36 genome assembly has the largest contig N50 (3.3 Mbp) of any mosquito assembly, presents the sequences of both haplotypes for most of the diploid genome, reveals independent null mutations in both alleles of the Dicer locus, and indicates a male-specific genome. Gene annotation was computed with publicly available mosquito transcript sequences. Gene expression data from cell line RNA sequence identified enrichment of growth-related pathways and conspicuous deficiency in aquaporins and inward rectifier K+ channels. As a test of utility, RNA sequence data from Zika-infected cells were mapped to the C6/36 genome and transcriptome assemblies. Host subtraction reduced the data set by 89%, enabling faster characterization of nonhost reads. The C6/36 genome sequence and annotation should enable additional uses of the cell line to study arbovirus vector interactions and interventions aimed at restricting the spread of human disease.

  8. Within-Genome Evolution of REPINs: a New Family of Miniature Mobile DNA in Bacteria

    PubMed Central

    Bertels, Frederic; Rainey, Paul B.

    2011-01-01

    Repetitive sequences are a conserved feature of many bacterial genomes. While first reported almost thirty years ago, and frequently exploited for genotyping purposes, little is known about their origin, maintenance, or processes affecting the dynamics of within-genome evolution. Here, beginning with analysis of the diversity and abundance of short oligonucleotide sequences in the genome of Pseudomonas fluorescens SBW25, we show that over-represented short sequences define three distinct groups (GI, GII, and GIII) of repetitive extragenic palindromic (REP) sequences. Patterns of REP distribution suggest that closely linked REP sequences form a functional replicative unit: REP doublets are over-represented, randomly distributed in extragenic space, and more highly conserved than singlets. In addition, doublets are organized as inverted repeats, which together with intervening spacer sequences are predicted to form hairpin structures in ssDNA or mRNA. We refer to these newly defined entities as REPINs (REP doublets forming hairpins) and identify short reads from population sequencing that reveal putative transposition intermediates. The proximal relationship between GI, GII, and GIII REPINs and specific REP-associated tyrosine transposases (RAYTs), combined with features of the putative transposition intermediate, suggests a mechanism for within-genome dissemination. Analysis of the distribution of REPs in a range of RAYT–containing bacterial genomes, including Escherichia coli K-12 and Nostoc punctiforme, show that REPINs are a widely distributed, but hitherto unrecognized, family of miniature non-autonomous mobile DNA. PMID:21698139

  9. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    PubMed

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  10. A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers.

    PubMed

    Quail, Michael A; Smith, Miriam; Coupland, Paul; Otto, Thomas D; Harris, Simon R; Connor, Thomas R; Bertoni, Anna; Swerdlow, Harold P; Gu, Yong

    2012-07-24

    Next generation sequencing (NGS) technology has revolutionized genomic and genetic research. The pace of change in this area is rapid with three major new sequencing platforms having been released in 2011: Ion Torrent's PGM, Pacific Biosciences' RS and the Illumina MiSeq. Here we compare the results obtained with those platforms to the performance of the Illumina HiSeq, the current market leader. In order to compare these platforms, and get sufficient coverage depth to allow meaningful analysis, we have sequenced a set of 4 microbial genomes with mean GC content ranging from 19.3 to 67.7%. Together, these represent a comprehensive range of genome content. Here we report our analysis of that sequence data in terms of coverage distribution, bias, GC distribution, variant detection and accuracy. Sequence generated by Ion Torrent, MiSeq and Pacific Biosciences technologies displays near perfect coverage behaviour on GC-rich, neutral and moderately AT-rich genomes, but a profound bias was observed upon sequencing the extremely AT-rich genome of Plasmodium falciparum on the PGM, resulting in no coverage for approximately 30% of the genome. We analysed the ability to call variants from each platform and found that we could call slightly more variants from Ion Torrent data compared to MiSeq data, but at the expense of a higher false positive rate. Variant calling from Pacific Biosciences data was possible but higher coverage depth was required. Context specific errors were observed in both PGM and MiSeq data, but not in that from the Pacific Biosciences platform. All three fast turnaround sequencers evaluated here were able to generate usable sequence. However there are key differences between the quality of that data and the applications it will support.

  11. DNA Breaks and End Resection Measured Genome-wide by End Sequencing.

    PubMed

    Canela, Andres; Sridharan, Sriram; Sciascia, Nicholas; Tubbs, Anthony; Meltzer, Paul; Sleckman, Barry P; Nussenzweig, André

    2016-09-01

    DNA double-strand breaks (DSBs) arise during physiological transcription, DNA replication, and antigen receptor diversification. Mistargeting or misprocessing of DSBs can result in pathological structural variation and mutation. Here we describe a sensitive method (END-seq) to monitor DNA end resection and DSBs genome-wide at base-pair resolution in vivo. We utilized END-seq to determine the frequency and spectrum of restriction-enzyme-, zinc-finger-nuclease-, and RAG-induced DSBs. Beyond sequence preference, chromatin features dictate the repertoire of these genome-modifying enzymes. END-seq can detect at least one DSB per cell among 10,000 cells not harboring DSBs, and we estimate that up to one out of 60 cells contains off-target RAG cleavage. In addition to site-specific cleavage, we detect DSBs distributed over extended regions during immunoglobulin class-switch recombination. Thus, END-seq provides a snapshot of DNA ends genome-wide, which can be utilized for understanding genome-editing specificities and the influence of chromatin on DSB pathway choice. Published by Elsevier Inc.

  12. Consequences of splitting whole-genome sequencing effort over multiple breeds on imputation accuracy.

    PubMed

    Bouwman, Aniek C; Veerkamp, Roel F

    2014-10-03

    The aim of this study was to determine the consequences of splitting sequencing effort over multiple breeds for imputation accuracy from a high-density SNP chip towards whole-genome sequence. Such information would assist for instance numerical smaller cattle breeds, but also pig and chicken breeders, who have to choose wisely how to spend their sequencing efforts over all the breeds or lines they evaluate. Sequence data from cattle breeds was used, because there are currently relatively many individuals from several breeds sequenced within the 1,000 Bull Genomes project. The advantage of whole-genome sequence data is that it carries the causal mutations, but the question is whether it is possible to impute the causal variants accurately. This study therefore focussed on imputation accuracy of variants with low minor allele frequency and breed specific variants. Imputation accuracy was assessed for chromosome 1 and 29 as the correlation between observed and imputed genotypes. For chromosome 1, the average imputation accuracy was 0.70 with a reference population of 20 Holstein, and increased to 0.83 when the reference population was increased by including 3 other dairy breeds with 20 animals each. When the same amount of animals from the Holstein breed were added the accuracy improved to 0.88, while adding the 3 other breeds to the reference population of 80 Holstein improved the average imputation accuracy marginally to 0.89. For chromosome 29, the average imputation accuracy was lower. Some variants benefitted from the inclusion of other breeds in the reference population, initially determined by the MAF of the variant in each breed, but even Holstein specific variants did gain imputation accuracy from the multi-breed reference population. This study shows that splitting sequencing effort over multiple breeds and combining the reference populations is a good strategy for imputation from high-density SNP panels towards whole-genome sequence when reference populations are small and sequencing effort is limiting. When sequencing effort is limiting and interest lays in multiple breeds or lines this provides imputation of each breed.

  13. Genome and transcriptome of the regeneration-competent flatworm, Macrostomum lignano.

    PubMed

    Wasik, Kaja; Gurtowski, James; Zhou, Xin; Ramos, Olivia Mendivil; Delás, M Joaquina; Battistoni, Giorgia; El Demerdash, Osama; Falciatori, Ilaria; Vizoso, Dita B; Smith, Andrew D; Ladurner, Peter; Schärer, Lukas; McCombie, W Richard; Hannon, Gregory J; Schatz, Michael

    2015-10-06

    The free-living flatworm, Macrostomum lignano has an impressive regenerative capacity. Following injury, it can regenerate almost an entirely new organism because of the presence of an abundant somatic stem cell population, the neoblasts. This set of unique properties makes many flatworms attractive organisms for studying the evolution of pathways involved in tissue self-renewal, cell-fate specification, and regeneration. The use of these organisms as models, however, is hampered by the lack of a well-assembled and annotated genome sequences, fundamental to modern genetic and molecular studies. Here we report the genomic sequence of M. lignano and an accompanying characterization of its transcriptome. The genome structure of M. lignano is remarkably complex, with ∼75% of its sequence being comprised of simple repeats and transposon sequences. This has made high-quality assembly from Illumina reads alone impossible (N50=222 bp). We therefore generated 130× coverage by long sequencing reads from the Pacific Biosciences platform to create a substantially improved assembly with an N50 of 64 Kbp. We complemented the reference genome with an assembled and annotated transcriptome, and used both of these datasets in combination to probe gene-expression patterns during regeneration, examining pathways important to stem cell function.

  14. Plastome Sequences of Lygodium japonicum and Marsilea crenata Reveal the Genome Organization Transformation from Basal Ferns to Core Leptosporangiates

    PubMed Central

    Gao, Lei; Wang, Bo; Wang, Zhi-Wei; Zhou, Yuan; Su, Ying-Juan; Wang, Ting

    2013-01-01

    Previous studies have shown that core leptosporangiates, the most species-rich group of extant ferns (monilophytes), have a distinct plastid genome (plastome) organization pattern from basal fern lineages. However, the details of genome structure transformation from ancestral ferns to core leptosporangiates remain unclear because of limited plastome data available. Here, we have determined the complete chloroplast genome sequences of Lygodium japonicum (Lygodiaceae), a member of schizaeoid ferns (Schizaeales), and Marsilea crenata (Marsileaceae), a representative of heterosporous ferns (Salviniales). The two species represent the sister and the basal lineages of core leptosporangiates, respectively, for which the plastome sequences are currently unavailable. Comparative genomic analysis of all sequenced fern plastomes reveals that the gene order of L. japonicum plastome occupies an intermediate position between that of basal ferns and core leptosporangiates. The two exons of the fern ndhB gene have a unique pattern of intragenic copy number variances. Specifically, the substitution rate heterogeneity between the two exons is congruent with their copy number changes, confirming the constraint role that inverted repeats may play on the substitution rate of chloroplast gene sequences. PMID:23821521

  15. ChIP-seq Accurately Predicts Tissue-Specific Activity of Enhancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Visel, Axel; Blow, Matthew J.; Li, Zirong

    2009-02-01

    A major yet unresolved quest in decoding the human genome is the identification of the regulatory sequences that control the spatial and temporal expression of genes. Distant-acting transcriptional enhancers are particularly challenging to uncover since they are scattered amongst the vast non-coding portion of the genome. Evolutionary sequence constraint can facilitate the discovery of enhancers, but fails to predict when and where they are active in vivo. Here, we performed chromatin immunoprecipitation with the enhancer-associated protein p300, followed by massively-parallel sequencing, to map several thousand in vivo binding sites of p300 in mouse embryonic forebrain, midbrain, and limb tissue. Wemore » tested 86 of these sequences in a transgenic mouse assay, which in nearly all cases revealed reproducible enhancer activity in those tissues predicted by p300 binding. Our results indicate that in vivo mapping of p300 binding is a highly accurate means for identifying enhancers and their associated activities and suggest that such datasets will be useful to study the role of tissue-specific enhancers in human biology and disease on a genome-wide scale.« less

  16. Sequence variation of the feline immunodeficiency virus genome and its clinical relevance.

    PubMed

    Stickney, A L; Dunowska, M; Cave, N J

    2013-06-08

    The ongoing evolution of feline immunodeficiency virus (FIV) has resulted in the existence of a diverse continuum of viruses. FIV isolates differ with regards to their mutation and replication rates, plasma viral loads, cell tropism and the ability to induce apoptosis. Clinical disease in FIV-infected cats is also inconsistent. Genomic sequence variation of FIV is likely to be responsible for some of the variation in viral behaviour. The specific genetic sequences that influence these key viral properties remain to be determined. With knowledge of the specific key determinants of pathogenicity, there is the potential for veterinarians in the future to apply this information for prognostic purposes. Genomic sequence variation of FIV also presents an obstacle to effective vaccine development. Most challenge studies demonstrate acceptable efficacy of a dual-subtype FIV vaccine (Fel-O-Vax FIV) against FIV infection under experimental settings; however, vaccine efficacy in the field still remains to be proven. It is important that we discover the key determinants of immunity induced by this vaccine; such data would compliment vaccine field efficacy studies and provide the basis to make informed recommendations on its use.

  17. Human Y chromosome copy number variation in the next generation sequencing era and beyond.

    PubMed

    Massaia, Andrea; Xue, Yali

    2017-05-01

    The human Y chromosome provides a fertile ground for structural rearrangements owing to its haploidy and high content of repeated sequences. The methodologies used for copy number variation (CNV) studies have developed over the years. Low-throughput techniques based on direct observation of rearrangements were developed early on, and are still used, often to complement array-based or sequencing approaches which have limited power in regions with high repeat content and specifically in the presence of long, identical repeats, such as those found in human sex chromosomes. Some specific rearrangements have been investigated for decades; because of their effects on fertility, or their outstanding evolutionary features, the interest in these has not diminished. However, following the flourishing of large-scale genomics, several studies have investigated CNVs across the whole chromosome. These studies sometimes employ data generated within large genomic projects such as the DDD study or the 1000 Genomes Project, and often survey large samples of healthy individuals without any prior selection. Novel technologies based on sequencing long molecules and combinations of technologies, promise to stimulate the study of Y-CNVs in the immediate future.

  18. Harnessing CRISPR-Cas systems for bacterial genome editing.

    PubMed

    Selle, Kurt; Barrangou, Rodolphe

    2015-04-01

    Manipulation of genomic sequences facilitates the identification and characterization of key genetic determinants in the investigation of biological processes. Genome editing via clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) constitutes a next-generation method for programmable and high-throughput functional genomics. CRISPR-Cas systems are readily reprogrammed to induce sequence-specific DNA breaks at target loci, resulting in fixed mutations via host-dependent DNA repair mechanisms. Although bacterial genome editing is a relatively unexplored and underrepresented application of CRISPR-Cas systems, recent studies provide valuable insights for the widespread future implementation of this technology. This review summarizes recent progress in bacterial genome editing and identifies fundamental genetic and phenotypic outcomes of CRISPR targeting in bacteria, in the context of tool development, genome homeostasis, and DNA repair. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. The Genome of the Western Clawed Frog Xenopus tropicalis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hellsten, Uffe; Harland, Richard M.; Gilchrist, Michael J.

    2009-10-01

    The western clawed frog Xenopus tropicalis is an important model for vertebrate development that combines experimental advantages of the African clawed frog Xenopus laevis with more tractable genetics. Here we present a draft genome sequence assembly of X. tropicalis. This genome encodes over 20,000 protein-coding genes, including orthologs of at least 1,700 human disease genes. Over a million expressed sequence tags validated the annotation. More than one-third of the genome consists of transposable elements, with unusually prevalent DNA transposons. Like other tetrapods, the genome contains gene deserts enriched for conserved non-coding elements. The genome exhibits remarkable shared synteny with humanmore » and chicken over major parts of large chromosomes, broken by lineage-specific chromosome fusions and fissions, mainly in the mammalian lineage.« less

  20. A Phylogenomic Assessment of Ancient Polyploidy and Genome Evolution across the Poales

    PubMed Central

    McKain, Michael R.; Tang, Haibao; McNeal, Joel R.; Ayyampalayam, Saravanaraj; Davis, Jerrold I.; dePamphilis, Claude W.; Givnish, Thomas J.; Pires, J. Chris; Stevenson, Dennis Wm.; Leebens-Mack, James H.

    2016-01-01

    Comparisons of flowering plant genomes reveal multiple rounds of ancient polyploidy characterized by large intragenomic syntenic blocks. Three such whole-genome duplication (WGD) events, designated as rho (ρ), sigma (σ), and tau (τ), have been identified in the genomes of cereal grasses. Precise dating of these WGD events is necessary to investigate how they have influenced diversification rates, evolutionary innovations, and genomic characteristics such as the GC profile of protein-coding sequences. The timing of these events has remained uncertain due to the paucity of monocot genome sequence data outside the grass family (Poaceae). Phylogenomic analysis of protein-coding genes from sequenced genomes and transcriptome assemblies from 35 species, including representatives of all families within the Poales, has resolved the timing of rho and sigma relative to speciation events and placed tau prior to divergence of Asparagales and the commelinids but after divergence with eudicots. Examination of gene family phylogenies indicates that rho occurred just prior to the diversification of Poaceae and sigma occurred before early diversification of Poales lineages but after the Poales-commelinid split. Additional lineage-specific WGD events were identified on the basis of the transcriptome data. Gene families exhibiting high GC content are underrepresented among those with duplicate genes that persisted following these genome duplications. However, genome duplications had little overall influence on lineage-specific changes in the GC content of coding genes. Improved resolution of the timing of WGD events in monocot history provides evidence for the influence of polyploidization on functional evolution and species diversification. PMID:26988252

Top