Sample records for specific immune response

  1. Preexisting Salmonella-specific immunity interferes with the subsequent development of immune responses against the Salmonella strains delivering H9N2 hemagglutinin.

    PubMed

    Hajam, Irshad Ahmed; Lee, John Hwa

    2017-06-01

    Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    PubMed

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  3. Dendritic Cell Immune Responses in HIV-1 Controllers.

    PubMed

    Martin-Gayo, Enrique; Yu, Xu G

    2017-02-01

    Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.

  4. Spontaneous T-cell responses against the immune check point programmed-death-ligand 1 (PD-L1) in patients with chronic myeloproliferative neoplasms correlate with disease stage and clinical response.

    PubMed

    Holmström, Morten Orebo; Riley, Caroline Hasselbalch; Skov, Vibe; Svane, Inge Marie; Hasselbalch, Hans Carl; Andersen, Mads Hald

    2018-01-01

    The Chronic Myeloproliferative Neoplasms (MPN) are cancers characterized by hyperinflammation and immune deregulation. Concurrently, the expression of the immune check point programmed death ligand 1 (PD-L1) is induced by inflammation. In this study we report on the occurrence of spontaneous T cell responses against a PD-L1 derived epitope in patients with MPN. We show that 71% of patients display a significant immune response against PD-L1, and patients with advanced MPN have significantly fewer and weaker PD-L1 specific immune responses compared to patients with non-advanced MPN. The PD-L1 specific T cell responses are CD4 + T cell responses, and by gene expression analysis we show that expression of PD-L1 is enhanced in patients with MPN. This could imply that the tumor specific immune response in MPN could be enhanced by vaccination with PD-L1 derived epitopes by boosting the anti-regulatory immune response hereby allowing tumor specific T cell to exert anti-tumor immunity.

  5. Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas

    USGS Publications Warehouse

    Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.

    2000-01-01

    Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a detectable immune response in green turtles.

  6. Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.

    PubMed

    VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H

    1996-04-01

    Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.

  7. Persistence at one year of age of antigen-induced cellular immune responses in preterm infants vaccinated against whooping cough: comparison of three different vaccines and effect of a booster dose.

    PubMed

    Vermeulen, Françoise; Dirix, Violette; Verscheure, Virginie; Damis, Eliane; Vermeylen, Danièle; Locht, Camille; Mascart, Françoise

    2013-04-08

    Due to their high risk of developing severe Bordetella pertussis (Bp) infections, it is recommended to immunize preterm infants at their chronological age. However, little is known about the persistence of their specific immune responses, especially of the cellular responses recognized to play a role in protection. We compared here the cellular immune responses to two major antigens of Bp between three groups of one year-old children born prematurely, who received for their primary vaccination respectively the whole cell vaccine Tetracoq(®) (TC), the acellular vaccine Tetravac(®) (TV), or the acellular vaccine Infanrix-hexa(®) (IR). Whereas most children had still detectable IFN-γ responses at one year of age, they were lower in the IR-vaccinated children compared to the two other groups. In contrast, both the TV- and the IR-vaccinated children displayed higher Th2-type immune responses, resulting in higher antigen-specific IFN-γ/IL-5 ratios in TC- than in TV- or IR-vaccinated children. The IFN-γ/IL-5 ratio of mitogen-induced cytokines was also lower in IR- compared to TC- or TV-vaccinated children. No major differences in the immune responses were noted after the booster compared to the pre-booster responses for each vaccine. The IR-vaccinated children had a persistently low specific Th1-type immune response associated with high specific Th2-type immune responses, resulting in lower antigen-specific IFN-γ/IL-5 ratios compared to the two other groups. We conclude that antigen-specific cellular immune responses persisted in one year-old children born prematurely and vaccinated during infancy at their chronological age, that a booster dose did not significantly boost the cellular immune responses, and that the Th1/Th2 balance of the immune responses is modulated by the different vaccines. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Assessing immune competence in pigs by immunization with tetanus toxoid.

    PubMed

    Gimsa, U; Tuchscherer, A; Gimsa, J; Tuchscherer, M

    2018-01-01

    Immune competence can be tested by challenging organisms with a set of infectious agents. However, disease control requirements impose restrictions on the infliction of infections upon domestic pigs. Alternatively, vaccinations induce detectable immune responses that reflect immune competence. Here, we tested this approach with tetanus toxoid (TT) in young domestic pigs. To optimize the vaccination protocol, we immunized the pigs with a commercial TT vaccine at the age of 21 or 35 days. Booster immunizations were performed either 14 or 21 days later. TT-specific antibodies in plasma as well as lymphoproliferative responses were determined both 7 and 14 days after booster immunization using ELISA and lymphocyte transformation tests, respectively. In addition, general IgG and IgM plasma concentrations and mitogen-induced proliferation were measured. The highest TT-specific antibody responses were detected when blood samples were collected 1 week after a booster immunization conducted 21 days after primary immunization. The pigs' age at primary immunization did not have a significant influence on TT-specific antibody responses. Similarly, the TT-specific proliferative responses were highest when blood samples were collected 1 week after booster immunization, while age and time of primary and booster immunization were irrelevant in our setup. While general IgG and IgM plasma levels were highly age dependent, there were no significant age effects for TT-specific immune responses. In addition, mitogen-induced proliferation was independent of immunization as well as blood sampling protocols. In summary, our model of TT vaccination provides an interesting approach for the assessment of immune competence in young pigs. The detected vaccination effects were not biased by age, even though our data were acquired from immune systems that were under development during our tests.

  9. Distinct Mechanisms Underlie Boosted Polysaccharide-Specific IgG Responses Following Secondary Challenge with Intact Gram-Negative versus Gram-Positive Extracellular Bacteria.

    PubMed

    Kar, Swagata; Arjunaraja, Swadhinya; Akkoyunlu, Mustafa; Pier, Gerald B; Snapper, Clifford M

    2016-06-01

    Priming of mice with intact, heat-killed cells of Gram-negative Neisseria meningitidis, capsular serogroup C (MenC) or Gram-positive group B Streptococcus, capsular type III (GBS-III) bacteria resulted in augmented serum polysaccharide (PS)-specific IgG titers following booster immunization. Induction of memory required CD4(+) T cells during primary immunization. We determined whether PS-specific memory for IgG production was contained within the B cell and/or T cell populations, and whether augmented IgG responses following booster immunization were also dependent on CD4(+) T cells. Adoptive transfer of purified B cells from MenC- or GBS-III-primed, but not naive mice resulted in augmented PS-specific IgG responses following booster immunization. Similar responses were observed when cotransferred CD4(+) T cells were from primed or naive mice. Similarly, primary immunization with unencapsulated MenC or GBS-III, to potentially prime CD4(+) T cells, failed to enhance PS-specific IgG responses following booster immunization with their encapsulated isogenic partners. Furthermore, in contrast to GBS-III, depletion of CD4(+) T cells during secondary immunization with MenC or another Gram-negative bacteria, Acinetobacter baumannii, did not inhibit augmented PS-specific IgG booster responses of mice primed with heat-killed cells. Also, in contrast with GBS-III, booster immunization of MenC-primed mice with isolated MenC-PS, a TI Ag, or a conjugate of MenC-PS and tetanus toxoid elicited an augmented PS-specific IgG response similar to booster immunization with intact MenC. These data demonstrate that memory for augmented PS-specific IgG booster responses to Gram-negative and Gram-positive bacteria is contained solely within the B cell compartment, with a differential requirement for CD4(+) T cells for augmented IgG responses following booster immunization. Copyright © 2016 by The American Association of Immunologists, Inc.

  10. Memory and Specificity in the Insect Immune System: Current Perspectives and Future Challenges.

    PubMed

    Cooper, Dustin; Eleftherianos, Ioannis

    2017-01-01

    The immune response of a host to a pathogen is typically described as either innate or adaptive. The innate form of the immune response is conserved across all organisms, including insects. Previous and recent research has focused on the nature of the insect immune system and the results imply that the innate immune response of insects is more robust and specific than previously thought. Priming of the insect innate immune system involves the exposure of insects to dead or a sublethal dose of microbes in order to elicit an initial response. Comparing subsequent infections in primed insects to non-primed individuals indicates that the insect innate immune response may possess some of the qualities of an adaptive immune system. Although some studies demonstrate that the protective effects of priming are due to a "loitering" innate immune response, others have presented more convincing elements of adaptivity. While an immune mechanism capable of producing the same degree of recognition specificity as seen in vertebrates has yet to be discovered in insects, a few interesting cases have been identified and discussed.

  11. Suppression of antigen-specific lymphocyte activation in modeled microgravity

    NASA Technical Reports Server (NTRS)

    Cooper, D.; Pride, M. W.; Brown, E. L.; Risin, D.; Pellis, N. R.; McIntire, L. V. (Principal Investigator)

    2001-01-01

    Various parameters of immune suppression are observed in lymphocytes from astronauts during and after a space flight. It is difficult to ascribe this suppression to microgravity effects on immune cells in crew specimens, due to the complex physiological response to space flight and the resultant effect on in vitro immune performance. Use of isolated immune cells in true and modeled microgravity in immune performance tests, suggests a direct effect of microgravity on in vitro cellular function. Specifically, polyclonal activation of T-cells is severely suppressed in true and modeled microgravity. These recent findings suggest a potential suppression of oligoclonal antigen-specific lymphocyte activation in microgravity. We utilized rotating wall vessel (RWV) bioreactors as an analog of microgravity for cell cultures to analyze three models of antigen-specific activation. A mixed-lymphocyte reaction, as a model for a primary immune response, a tetanus toxoid response and a Borrelia burgdorferi response, as models of a secondary immune response, were all suppressed in the RWV bioreactor. Our findings confirm that the suppression of activation observed with polyclonal models also encompasses oligoclonal antigen-specific activation.

  12. Antigen-specific response of murine immune system toward a yeast beta-glucan preparation, zymosan.

    PubMed

    Miura, T; Ohno, N; Miura, N N; Adachi, Y; Shimada, S; Yadomae, T

    1999-06-01

    Zymosan, a particulate beta-glucan preparation from Saccharomyces cerevisiae, shows various biological activities, including anti-tumor activity. We have previously shown that soluble beta-glucan initiated anti-tumor activity was long-lived and was effective even by prophylactic treatment at 1 month prior to tumor challenge. However, the activity by zymosan was relatively short-lived. Antigen-specific responses of mice to zymosan might be a causative mechanism. In this paper, mice were immunized with zymosan and antibody production and antigen-specific responses of lymphocytes to zymosan were analyzed. Sera of zymosan immune mice contained zymosan-specific IgG assessed by enzyme-linked immunosorbent assay and FACS. Spleen and bone marrow cells of zymosan-immune mice showed higher cytokine production in response to zymosan. Specificity of zymosan-specific responses were also analyzed using various derivatives prepared from zymosan. These facts strongly suggested that mice recognize zymosan as antigen in addition to non-specific immune stimulant.

  13. Transcriptomic analysis reveals tomato genes whose expression is induced specifically during effector-triggered immunity and identifies the Epk1 protein kinase which is required for the host response to three bacterial effector proteins.

    PubMed

    Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B

    2014-01-01

    Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.

  14. Screening Immunomodulators To Skew the Antigen-Specific Autoimmune Response.

    PubMed

    Northrup, Laura; Sullivan, Bradley P; Hartwell, Brittany L; Garza, Aaron; Berkland, Cory

    2017-01-03

    Current therapies to treat autoimmune diseases often result in side effects such as nonspecific immunosuppression. Therapies that can induce antigen-specific immune tolerance provide an opportunity to reverse autoimmunity and mitigate the risks associated with global immunosuppression. In an effort to induce antigen-specific immune tolerance, co-administration of immunomodulators with autoantigens has been investigated in an effort to reprogram autoimmunity. To date, identifying immunomodulators that may skew the antigen-specific immune response has been ad hoc at best. To address this need, we utilized splenocytes obtained from mice with experimental autoimmune encephalomyelitis (EAE) in order to determine if certain immunomodulators may induce markers of immune tolerance following antigen rechallenge. Of the immunomodulatory compounds investigated, only dexamethasone modified the antigen-specific immune response by skewing the cytokine response and decreasing T-cell populations at a concentration corresponding to a relevant in vivo dose. Thus, antigen-educated EAE splenocytes provide an ex vivo screen for investigating compounds capable of skewing the antigen-specific immune response, and this approach could be extrapolated to antigen-educated cells from other diseases or human tissues.

  15. Kinetic of the CMV-specific T-cell immune response and CMV infection in CMV-seropositive kidney transplant recipients receiving rabbit anti-thymocyte globulin induction therapy: A pilot study.

    PubMed

    Martín-Gandul, Cecilia; Pérez-Romero, Pilar; Mena-Romo, Damián; Molina-Ortega, Alejandro; González-Roncero, Francisco M; Suñer, Marta; Bernal, Gabriel; Cordero, Elisa

    2018-03-23

    Some studies have suggested that rATG treatment may be associated with an increased incidence of CMV infection and delayed CMV immune response. However, the evidences supporting this matter are scarce. This study aims to characterize the kinetic of the CMV-specific T-cell immune response before and after rATG induction therapy and the relationship with the development of CMV infection in CMV-seropositive kidney transplant recipients. An observational prospective study of CMV-seropositive kidney transplant patients that received rATG induction therapy was performed. A pretransplant sample was obtained before the surgery to determine the CMV-specific immunity. CMV viral load (by PCR) and CMV-specific T-cell immune response (by flow cytometry) were determined during the follow-up at 0.5, 1, 2, 3, 6, and 12 months post transplantation. A total of 23 patients were included in the study. CMV prophylaxis was administrated for a media of 90 days after transplantation. At the end of follow-up, 18 (78.3%) patients had CMV-specific immunity with a median value of 0.31% CD8 + CD69 + INF-γ + T cells at a median of 16 weeks post transplantation. Five patients never acquired CMV-specific immunity. No statistically significant association between CMV infection and CMV-specific T-cell immune response (P = .086) was observed. However, patients with positive pretransplant CMV-specific immunity developed earlier immunity and achieved higher levels of CD8 + CD69 + INF-γ+ T-cell post-transplantation than patients with negative pretransplant immunity. CMV-specific immune monitoring in addition to CMV-serology may be useful to stratify patient's risk of CMV infection before transplantation. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Difference in immune response in vaccinated and unvaccinated Swedish individuals after the 2009 influenza pandemic

    PubMed Central

    2014-01-01

    Background Previous exposures to flu and subsequent immune responses may impact on 2009/2010 pandemic flu vaccine responses and clinical symptoms upon infection with the 2009 pandemic H1N1 influenza strain. Qualitative and quantitative differences in humoral and cellular immune responses associated with the flu vaccination in 2009/2010 (pandemic H1N1 vaccine) and natural infection have not yet been described in detail. We designed a longitudinal study to examine influenza- (flu-) specific immune responses and the association between pre-existing flu responses, symptoms of influenza-like illness (ILI), impact of pandemic flu infection, and pandemic flu vaccination in a cohort of 2,040 individuals in Sweden in 2009–2010. Methods Cellular flu-specific immune responses were assessed by whole-blood antigen stimulation assay, and humoral responses by a single radial hemolysis test. Results Previous seasonal flu vaccination was associated with significantly lower flu-specific IFN-γ responses (using a whole-blood assay) at study entry. Pandemic flu vaccination induced long-lived T-cell responses (measured by IFN-γ production) to influenza A strains, influenza B strains, and the matrix (M1) antigen. In contrast, individuals with pandemic flu infection (PCR positive) exhibited increased flu-specific T-cell responses shortly after onset of ILI symptoms but the immune response decreased after the flu season (spring 2010). We identified non-pandemic-flu vaccinated participants without ILI symptoms who showed an IFN-γ production profile similar to pandemic-flu infected participants, suggesting exposure without experiencing clinical symptoms. Conclusions Strong and long-lived flu-M1 specific immune responses, defined by IFN-γ production, in individuals after vaccination suggest that M1-responses may contribute to protective cellular immune responses. Silent flu infections appeared to be frequent in 2009/2010. The pandemic flu vaccine induced qualitatively and quantitatively different humoral and cellular immune responses as compared to infection with the 2009 H1N1 pandemic H1N1 influenza strain. PMID:24916787

  17. Cyclophilin A as a potential genetic adjuvant to improve HIV-1 Gag DNA vaccine immunogenicity by eliciting broad and long-term Gag-specific cellular immunity in mice.

    PubMed

    Hou, Jue; Zhang, Qicheng; Liu, Zheng; Wang, Shuhui; Li, Dan; Liu, Chang; Liu, Ying; Shao, Yiming

    2016-01-01

    Previous research has shown that host Cyclophilin A (CyPA) can promote dendritic cell maturation and the subsequent innate immune response when incorporated into an HIV-1 Gag protein to circumvent the resistance of dendritic cells to HIV-1 infection. This led us to hypothesize that CyPA may improve HIV-1 Gag-specific vaccine immunogenicity via binding with Gag antigen. The adjuvant effect of CyPA was evaluated using a DNA vaccine with single or dual expression cassettes. Mouse studies indicated that CyPA specifically and markedly promoted HIV-1 Gag-specific cellular immunity but not an HIV-1 Env-specific cellular response. The Gag/CyPA dual expression cassettes stimulated a greater Gag-specific cellular immune response, than Gag immunization alone. Furthermore, CyPA induced a broad Gag-specific T cell response and strong cellular immunity that lasted up to 5 months. In addition, CyPA skewed to cellular rather than humoral immunity. To investigate the mechanisms of the adjuvant effect, site-directed mutagenesis in CyPA, including active site residues H54Q and F60A resulted in mutants that were co-expressed with Gag in dual cassettes. The immune response to this vaccine was analyzed in vivo. Interestingly, the wild type CyPA markedly increased Gag cellular immunity, but the H54Q and F60A mutants drastically reduced CyPA adjuvant activation. Therefore, we suggest that the adjuvant effect of CyPA was based on Gag-CyPA-specific interactions. Herein, we report that Cyclophilin A can augment HIV-1 Gag-specific cellular immunity as a genetic adjuvant in multiplex DNA immunization strategies, and that activity of this adjuvant is specific, broad, long-term, and based on Gag-CyPA interaction.

  18. Immunological tools for the assessment of both humoral and cellular immune responses in Foxes (Vulpes vulpes) using ovalbumin and cholera toxin B as an antigenic model.

    PubMed

    Rolland-Turner, Magali; Farre, Guillaume; Muller, Delphine; Rouet, Nelly; Boue, Franck

    2004-10-22

    The immune response in the fox (Vulpes vulpes), despite the success of the oral rabies vaccine is not well characterized, and specific immunological tools are needed. To investigate both the humoral and cellular immune response, we used ovalbumin (OVA) and cholera toxin B (CTB) as an antigenic model to set-up ELISA and ELISPOT antibodies secreting cells (ASC) assays in the fox model. Identification of antibodies that cross-react with fox immunoglobulin was performed by Western blot, and their use was adapted for both the ELISA and ELISPOT ASC assay. The humoral and cellular specific immune responses were assessed after intra-muscular or intra-nasal immunization. Intra-muscular immunization resulted in the development of both cellular and humoral anti-OVA and anti-CTB responses in peripheral blood mononuclear cells (PBMCs). Immunization via the intra-nasal route resulted in the development of a cellular and humoral response against CTB in PBMCs. This immune response was confirmed using splenocytes from immunized animals by ELISPOT assay at euthanasia. Females immunized via the intra-nasal route developed specific anti-CTB IgM, IgA and IgG in vaginal fluids after the initial boost (day 26) showing that mucosal immunization produces a vaginal immune response in foxes. These immunological tools developed here are now available to be adapted to other antigenic models to facilitate further immune studies in foxes.

  19. Effects of effluent from electoplating industry on the immune response in the freshwater fish, Cyprinus carpio.

    PubMed

    Borgia, V J Florence; Thatheyus, A J; Murugesan, A G; Alexander, S Catherine P; Geetha, I

    2018-08-01

    The present study was designed to assess the effect of sublethal concentrations of electoplating industry effluent (EIE) on the non-specific and specific immune responses in the freshwater fish, Cyprinus carpio. Sublethal concentrations of electroplating industry effluent such as 0.004, 0.007, 0.010 and 0.013% were chosen based on the LC 50 values. Experimental fish were exposed to these sublethal concentrations of EIE for 28 days. After 7, 14, 21 and 28 days of treatment, non-specific immune response by serum lysozyme activity, myeloperoxidase activity and antiprotease activity and specific immune response by antibody response to Aeromonas hydrophila using bacterial agglutination assay and ELISA were assessed. The results showed that chronic exposure of fish to 0.004, 0.007, 0.010 and 0.013% EIE, dose-dependently decreased the non-specific and specific immune responses on all the days tested compared to control fish whereas statistically significant suppressive effects were observed in fish exposed to 0.013% of EIE on all activities tested. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. The Ocular Conjunctiva as a Mucosal Immunization Route: A Profile of the Immune Response to the Model Antigen Tetanus Toxoid

    PubMed Central

    Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

    2013-01-01

    Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID:23637758

  1. The ocular conjunctiva as a mucosal immunization route: a profile of the immune response to the model antigen tetanus toxoid.

    PubMed

    Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

    2013-01-01

    In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.

  2. Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation

    PubMed Central

    Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.

    1978-01-01

    A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541

  3. A T-cell response to a liver-stage Plasmodium antigen is not boosted by repeated sporozoite immunizations

    PubMed Central

    Murphy, Sean C.; Kas, Arnold; Stone, Brad C.; Bevan, Michael J.

    2013-01-01

    Development of an antimalarial subunit vaccine inducing protective cytotoxic T lymphocyte (CTL)-mediated immunity could pave the way for malaria eradication. Experimental immunization with sporozoites induces this type of protective response, but the extremely large number of proteins expressed by Plasmodium parasites has so far prohibited the identification of sufficient discrete T-cell antigens to develop subunit vaccines that produce sterile immunity. Here, using mice singly immunized with Plasmodium yoelii sporozoites and high-throughput screening, we identified a unique CTL response against the parasite ribosomal L3 protein. Unlike CTL responses to the circumsporozoite protein (CSP), the population of L3-specific CTLs was not expanded by multiple sporozoite immunizations. CSP is abundant in the sporozoite itself, whereas L3 expression does not increase until the liver stage. The response induced by a single immunization with sporozoites reduces the parasite load in the liver so greatly during subsequent immunizations that L3-specific responses are only generated during the primary exposure. Functional L3-specific CTLs can, however, be expanded by heterologous prime-boost regimens. Thus, although repeat sporozoite immunization expands responses to preformed antigens like CSP that are present in the sporozoite itself, this immunization strategy may not expand CTLs targeting parasite proteins that are synthesized later. Heterologous strategies may be needed to increase CTL responses across the entire spectrum of Plasmodium liver-stage proteins. PMID:23530242

  4. HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin

    PubMed Central

    Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago

    2014-01-01

    AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN-α-based therapy, modifies the immune response in chronic patients. The study provides evidence for the design of more effective therapeutic vaccine interventions against HCV. PMID:24415868

  5. Induction of antigen-specific immunity by pH-sensitive carbonate apatite as a potent vaccine carrier

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hebishima, Takehisa; Tada, Seiichi; Takeshima, Shin-nosuke

    Highlights: Black-Right-Pointing-Pointer To develop effective vaccine, we examined the effects of CO{sub 3}Ap as an antigen carrier. Black-Right-Pointing-Pointer OVA contained in CO{sub 3}Ap was taken up by BMDCs more effectively than free OVA. Black-Right-Pointing-Pointer OVA-immunized splenocytes was activated by OVA contained in CO{sub 3}Ap effectively. Black-Right-Pointing-Pointer OVA contained in CO{sub 3}Ap induced strong OVA-specific immune responses to C57BL/6 mice. Black-Right-Pointing-Pointer CO{sub 3}Ap is promising antigen carrier for the achievement of effective vaccine. -- Abstract: The ability of carbonate apatite (CO{sub 3}Ap) to enhance antigen-specific immunity was examined in vitro and in vivo to investigate its utility as a vaccine carrier.more » Murine bone marrow-derived dendritic cells took up ovalbumin (OVA) containing CO{sub 3}Ap more effectively than free OVA. Interestingly, mice immunized with OVA-containing CO{sub 3}Ap produced OVA-specific antibodies more effectively than mice immunized with free OVA. Furthermore, immunization of C57BL/6 mice with OVA-containing CO{sub 3}Ap induced the proliferation and antigen-specific production of IFN-{gamma} by splenocytes more strongly than immunization with free OVA. Moreover, no significant differences were detected in the induction of delayed-type hypersensitivity responses, an immune reaction involving an antigen-specific, cell-mediated immune response between OVA-containing CO{sub 3}Ap and OVA-containing alumina salt (Alum), suggesting that CO{sub 3}Ap induced cell-mediated immune response to the same degree as Alum, which is commonly used for clinical applications. This study is the first to demonstrate the induction of antigen-specific immune responses in vivo by CO{sub 3}Ap.« less

  6. Complement is a central mediator of radiotherapy-induced tumor-specific immunity and clinical response.

    PubMed

    Surace, Laura; Lysenko, Veronika; Fontana, Andrea Orlando; Cecconi, Virginia; Janssen, Hans; Bicvic, Antonela; Okoniewski, Michal; Pruschy, Martin; Dummer, Reinhard; Neefjes, Jacques; Knuth, Alexander; Gupta, Anurag; van den Broek, Maries

    2015-04-21

    Radiotherapy induces DNA damage and cell death, but recent data suggest that concomitant immune stimulation is an integral part of the therapeutic action of ionizing radiation. It is poorly understood how radiotherapy supports tumor-specific immunity. Here we report that radiotherapy induced tumor cell death and transiently activated complement both in murine and human tumors. The local production of pro-inflammatory anaphylatoxins C3a and C5a was crucial to the tumor response to radiotherapy and concomitant stimulation of tumor-specific immunity. Dexamethasone, a drug frequently given during radiotherapy, limited complement activation and the anti-tumor effects of the immune system. Overall, our findings indicate that anaphylatoxins are key players in radiotherapy-induced tumor-specific immunity and the ensuing clinical responses. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Vitamin effects on the immune system: vitamins A and D take centre stage.

    PubMed

    Mora, J Rodrigo; Iwata, Makoto; von Andrian, Ulrich H

    2008-09-01

    Vitamins are essential constituents of our diet that have long been known to influence the immune system. Vitamins A and D have received particular attention in recent years as these vitamins have been shown to have an unexpected and crucial effect on the immune response. We present and discuss our current understanding of the essential roles of vitamins in modulating a broad range of immune processes, such as lymphocyte activation and proliferation, T-helper-cell differentiation, tissue-specific lymphocyte homing, the production of specific antibody isotypes and regulation of the immune response. Finally, we discuss the clinical potential of vitamin A and D metabolites for modulating tissue-specific immune responses and for preventing and/or treating inflammation and autoimmunity.

  8. Vitamin effects on the immune system: vitamins A and D take centre stage

    PubMed Central

    Mora, J. Rodrigo; Iwata, Makoto; von Andrian, Ulrich H.

    2010-01-01

    Vitamins are essential constituents of our diet that have long been known to influence the immune system. Vitamins A and D have received particular attention in recent years as these vitamins have been shown to have an unexpected and crucial effect on the immune response. We present and discuss our current understanding of the essential roles of vitamins in modulating a broad range of immune processes, such as lymphocyte activation and proliferation, T-helper-cell differentiation, tissue-specific lymphocyte homing, the production of specific antibody isotypes and regulation of the immune response. Finally, we discuss the clinical potential of vitamin A and D metabolites for modulating tissue-specific immune responses and for preventing and/or treating inflammation and autoimmunity. PMID:19172691

  9. Immune Impact Induced by PROSTVAC (PSA-TRICOM), a Therapeutic Vaccine for Prostate Cancer

    PubMed Central

    Gulley, James L.; Madan, Ravi A.; Tsang, Kwong Y.; Jochems, Caroline; Marté, Jennifer L.; Farsaci, Benedetto; Tucker, Jo A.; Hodge, James W.; Liewehr, David J.; Steinberg, Seth M.; Heery, Christopher R.; Schlom, Jeffrey

    2013-01-01

    PSA-TRICOM (PROSTVAC) is a novel vector-based vaccine designed to generate a robust immune response against prostate-specific antigen (PSA)–expressing tumor cells. The purpose of this report is to present an overview of both published studies and new data in the evaluation of immune responses to the PSA-TRICOM vaccine platform, currently in phase III testing. Of 104 patients tested for T-cell responses, 57% (59/104) demonstrated a ≥ 2-fold increase in PSA-specific T cells 4 weeks after vaccine (median 5-fold increase) compared with pre-vaccine, and 68% (19/28) of patients tested mounted post-vaccine immune responses to tumor-associated antigens not present in the vaccine (antigen-spreading). The PSA-specific immune responses observed 28 days after vaccine (i.e., likely memory cells) are quantitatively similar to the levels of circulating T cells specific for influenza seen in the same patients. Measurements of systemic immune response to PSA may underestimate the true therapeutic immune response (as this does not account for cells that have trafficked to the tumor) and does not include antigen-spreading. Furthermore, while the entire PSA gene is the vaccine, only one epitope of PSA is evaluated in the T-cell responses. Since this therapeutic vaccine is directed at generating a cellular/Th1 immune response (T-cell costimulatory molecules and use of a viral vector), it is not surprising that < 0.6% of patients (2/349) tested have evidence of PSA antibody-induction following vaccine. This suggests that post-vaccine PSA kinetics were not affected by PSA antibodies. An ongoing phase III study will evaluate the systemic immune responses and correlation with clinical outcomes. PMID:24778277

  10. Statistical Physics of T-Cell Development and Pathogen Specificity

    NASA Astrophysics Data System (ADS)

    Košmrlj, Andrej; Kardar, Mehran; Chakraborty, Arup K.

    2013-04-01

    In addition to an innate immune system that battles pathogens in a nonspecific fashion, higher organisms, such as humans, possess an adaptive immune system to combat diverse (and evolving) microbial pathogens. Remarkably, the adaptive immune system mounts pathogen-specific responses, which can be recalled upon reinfection with the same pathogen. It is difficult to see how the adaptive immune system can be preprogrammed to respond specifically to a vast and unknown set of pathogens. Although major advances have been made in understanding pertinent molecular and cellular phenomena, the precise principles that govern many aspects of an immune response are largely unknown. We discuss complementary approaches from statistical mechanics and cell biology that can shed light on how key components of the adaptive immune system, T cells, develop to enable pathogen-specific responses against many diverse pathogens. The mechanistic understanding that emerges has implications for how host genetics may influence the development of T cells with differing responses to the human immunodeficiency virus (HIV) infection.

  11. B cell function in the immune response to helminths

    PubMed Central

    Harris, Nicola

    2010-01-01

    Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556

  12. Microwave ablation combined with OK-432 induces Th1-type response and specific antitumor immunity in a murine model of breast cancer.

    PubMed

    Li, Li; Wang, Wei; Pan, Hong; Ma, Ge; Shi, Xinyi; Xie, Hui; Liu, Xiaoan; Ding, Qiang; Zhou, Wenbin; Wang, Shui

    2017-01-31

    Minimally invasive therapies, such as microwave ablation (MWA), are widely used for the treatment of solid tumors. Previous studies suggest that MWA is feasible for the treatment of small breast cancer, and thermal ablation may induce adaptive antitumor immunity. However, the induced immune responses are mostly weak, and the immunomodulation effects of MWA in breast cancer are unclear. Immunostimulant OK-432 can induce tumor-specific T-cell responses and may augment the immunity induced by MWA. We treated 4T1 breast cancer bearing BALB/c mice with MWA, OK-432, MWA plus OK-432, or left without treatment. Survival time was evaluated with the Kaplan-Meyer method comparing survival curves by log-rank test. On day 25 after ablation, surviving mice received tumor rechallenge, and the rechallenged tumor volumes were calculated every 5 days. Immunohistochemistry and flow cytometry were used to evaluate the T-cell immune responses in ablated tissues and spleens. The tumor-specific immunity was assessed by enzyme-linked immunospot assays. Besides, the cytokine patterns were identified from enzyme-linked immunosorbent assay. Microwave ablation plus OK-432 resulted in longer survival than single treatment and protect most surviving mice from tumor rechallenge. Both local and systemic T-cell responses were induced by MWA and were further enhanced by subsequent administration of OK-432. Moreover, the combination of MWA and OK-432 induced stronger tumor-specific immune responses than MWA alone. In addition, OK-432 and MWA synergistically promoted the production of Th1-type but not Th2-type cytokines, and polarized T-cell responses to Th1-dominant state. The T-cell immune responses were activated by MWA in breast cancer. Furthermore, the combination of MWA and OK-432 induced Th1-type response and elicited specific antitumor immunity.

  13. Suppression of Antigen-Specific Lymphocyte Activation in Simulated Microgravity

    NASA Technical Reports Server (NTRS)

    Cooper, David; Pride, Michael W.; Brown, Eric L.; Risin, Diana; Pellis, Neal R.

    1999-01-01

    Various parameters of immune suppression are observed in astronauts during and after spaceflight, and in isolated immune cells in true and simulated microgravity. Specifically, polyclonal activation of T cells is severely suppressed in true and simulated microgravity. These recent findings with various polyclonal activators suggests a suppression of oligoclonal lymphocyte activation in microgravity. We utilized rotating wall vessel (RWV) bioreactors that simulate aspects of microgravity for cell cultures to analyze three models of antigen-specific activation. A mixed-lymphocyte reaction (MLR), as a model for a primary immune response; a tetanus toxoid (TT) response and a B. burgdorferi (Bb) response, as models of a secondary immune response, were all suppressed in the RWV bioreactor. Our findings confirm that the suppression of activation observed with polyclonal models also encompasses oligoclonal antigen-specific activation.

  14. Pig immune response to general stimulus and to porcine reproductive and respiratory syndrome virus infection: a meta-analysis approach

    PubMed Central

    2013-01-01

    Background The availability of gene expression data that corresponds to pig immune response challenges provides compelling material for the understanding of the host immune system. Meta-analysis offers the opportunity to confirm and expand our knowledge by combining and studying at one time a vast set of independent studies creating large datasets with increased statistical power. In this study, we performed two meta-analyses of porcine transcriptomic data: i) scrutinized the global immune response to different challenges, and ii) determined the specific response to Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) infection. To gain an in-depth knowledge of the pig response to PRRSV infection, we used an original approach comparing and eliminating the common genes from both meta-analyses in order to identify genes and pathways specifically involved in the PRRSV immune response. The software Pointillist was used to cope with the highly disparate data, circumventing the biases generated by the specific responses linked to single studies. Next, we used the Ingenuity Pathways Analysis (IPA) software to survey the canonical pathways, biological functions and transcription factors found to be significantly involved in the pig immune response. We used 779 chips corresponding to 29 datasets for the pig global immune response and 279 chips obtained from 6 datasets for the pig response to PRRSV infection, respectively. Results The pig global immune response analysis showed interconnected canonical pathways involved in the regulation of translation and mitochondrial energy metabolism. Biological functions revealed in this meta-analysis were centred around translation regulation, which included protein synthesis, RNA-post transcriptional gene expression and cellular growth and proliferation. Furthermore, the oxidative phosphorylation and mitochondria dysfunctions, associated with stress signalling, were highly regulated. Transcription factors such as MYCN, MYC and NFE2L2 were found in this analysis to be potentially involved in the regulation of the immune response. The host specific response to PRRSV infection engendered the activation of well-defined canonical pathways in response to pathogen challenge such as TREM1, toll-like receptor and hyper-cytokinemia/ hyper-chemokinemia signalling. Furthermore, this analysis brought forth the central role of the crosstalk between innate and adaptive immune response and the regulation of anti-inflammatory response. The most significant transcription factor potentially involved in this analysis was HMGB1, which is required for the innate recognition of viral nucleic acids. Other transcription factors like interferon regulatory factors IRF1, IRF3, IRF5 and IRF8 were also involved in the pig specific response to PRRSV infection. Conclusions This work reveals key genes, canonical pathways and biological functions involved in the pig global immune response to diverse challenges, including PRRSV infection. The powerful statistical approach led us to consolidate previous findings as well as to gain new insights into the pig immune response either to common stimuli or specifically to PRRSV infection. PMID:23552196

  15. Breaking self-tolerance during autoimmunity and cancer immunity: Myeloid cells and type I IFN response regulation.

    PubMed

    Tarbell, Kristin V; Egen, Jackson G

    2018-02-02

    The generation and regulation of innate immune signals are key determinants of autoimmune pathogenesis. Emerging evidence suggests that parallel processes operating in the setting of solid tumors can similarly determine the balance between tolerance and immunity and ultimately the effectiveness of the antitumor immune response. In both contexts, self-specific responses start with innate immune cell activation that leads to the initial break in self-tolerance, which can be followed by immune response amplification and maturation through innate-adaptive crosstalk, and finally immune-mediated tissue/tumor destruction that can further potentiate inflammation. Of particular importance for these processes is type I IFN, which is induced in response to endogenous ligands, such as self-nucleic acids, and acts on myeloid cells to promote the expansion of autoreactive or tumor-specific T cells and their influx into the target tissue. Evidence from the study of human disease pathophysiology and genetics and mouse models of disease has revealed an extensive and complex network of negative regulatory pathways that has evolved to restrain type I IFN production and activity. Here, we review the overlapping features of self- and tumor-specific immune responses, including the central role that regulators of the type I IFN response and innate immune cell activation play in maintaining tolerance, and discuss how a better understanding of the pathophysiology of autoimmunity can help to identify new approaches to promote immune-mediated tumor destruction. ©2018 Society for Leukocyte Biology.

  16. Antibody and Cytokine Responses of Koalas (Phascolarctos cinereus) Vaccinated with Recombinant Chlamydial Major Outer Membrane Protein (MOMP) with Two Different Adjuvants

    PubMed Central

    Khan, Shahneaz Ali; Desclozeaux, Marion; Waugh, Courtney; Hanger, Jon; Loader, Jo; Gerdts, Volker; Potter, Andrew; Polkinghorne, Adam; Beagley, Kenneth; Timms, Peter

    2016-01-01

    Developing a vaccine against Chlamydia is key to combating widespread mortalities and morbidities associated with this infection in koalas (Phascolarctos cinereus). In previous studies, we have shown that two or three doses of a Recombinant Major Outer Membrane Protein (rMOMP) antigen-based vaccine, combined with immune stimulating complex (ISC) adjuvant, results in strong cellular and humoral immune responses in koalas. We have also separately evaluated a single dose vaccine, utilising a tri-adjuvant formula that comprises polyphosphazine based poly I: C and host defense peptides, with the same antigen. This formulation also produced strong cellular and humoral immune responses in captive koalas. In this current study, we directly compared the host immune responses of two sub-groups of wild Chlamydia negative koalas in one population vaccinated with the rMOMP protein antigen and adjuvanted with either the ISC or tri-adjuvant formula. Overall, both adjuvants produced strong Chlamydia-specific cellular (IFN-γ and IL-17A) responses in circulating PBMCs as well as MOMP-specific and functional, in vitro neutralising antibodies. While the immune responses were similar, there were adjuvant-specific immune differences between the two adjuvants, particularly in relation to the specificity of the MOMP epitope antibody responses. PMID:27219467

  17. Newborn Mice Vaccination with BCG.HIVA222 + MVA.HIVA Enhances HIV-1-Specific Immune Responses: Influence of Age and Immunization Routes

    PubMed Central

    Saubi, Narcís; Im, Eung-Jun; Fernández-Lloris, Raquel; Gil, Olga; Cardona, Pere-Joan; Gatell, Josep Maria; Hanke, Tomáš; Joseph, Joan

    2011-01-01

    We have evaluated the influence of age and immunization routes for induction of HIV-1- and M. tuberculosis-specific immune responses after neonatal (7 days old) and adult (7 weeks old) BALB/c mice immunization with BCG.HIVA222 prime and MVA.HIVA boost. The specific HIV-1 cellular immune responses were analyzed in spleen cells. The body weight of the newborn mice was weekly recorded. The frequencies of HIV-specific CD8+ T cells producing IFN-γ were higher in adult mice vaccinated intradermally and lower in adult and newborn mice vaccinated subcutaneously. In all cases the IFN-γ production was significantly higher when mice were primed with BCG.HIVA222 compared with BCGwt. When the HIV-specific CTL activity was assessed, the frequencies of specific killing were higher in newborn mice than in adults. The prime-boost vaccination regimen which includes BCG.HIVA222 and MVA.HIVA was safe when inoculated to newborn mice. The administration of BCG.HIVA222 to newborn mice is safe and immunogenic and increased the HIV-specific responses induced by MVA.HIVA vaccine. It might be a good model for infant HIV and Tuberculosis bivalent vaccine. PMID:21603216

  18. Trafficking receptor signatures define blood plasmablasts responding to tissue-specific immune challenge

    PubMed Central

    Seong, Yekyung; Lazarus, Nicole H.; Sutherland, Lusijah; Habtezion, Aida; Abramson, Tzvia; He, Xiao-Song; Greenberg, Harry B.

    2017-01-01

    Antibody-secreting cells are generated in regional lymphoid tissues and traffic as plasmablasts (PBs) via lymph and blood to target sites for local immunity. We used multiparameter flow cytometry to define PB trafficking programs (TPs, combinations of adhesion molecules and chemoattractant receptors) and their imprinting in patients in response to localized infection or immune insults. TPs enriched after infection or autoimmune inflammation of mucosae correlate with sites of immune response or symptoms, with different TPs imprinted during small intestinal, colon, throat, and upper respiratory immune challenge. PBs induced after intramuscular or intradermal influenza vaccination, including flu-specific antibody–secreting cells, display TPs characterized by the lack of mucosal homing receptors. PBs of healthy donors display diverse mucosa-associated TPs, consistent with homeostatic immune activity. Identification of TP signatures of PBs may facilitate noninvasive monitoring of organ-specific immune responses. PMID:28352656

  19. Intranasal immunization with protective antigen of Bacillus anthracis induces a long-term immunological memory response.

    PubMed

    Woo, Sun-Je; Kang, Seok-Seong; Park, Sung-Moo; Yang, Jae Seung; Song, Man Ki; Yun, Cheol-Heui; Han, Seung Hyun

    2015-10-01

    Although intranasal vaccination has been shown to be effective for the protection against inhalational anthrax, establishment of long-term immunity has yet to be achieved. Here, we investigated whether intranasal immunization with recombinant protective antigen (rPA) of Bacillus anthracis induces immunological memory responses in the mucosal and systemic compartments. Intranasal immunization with rPA plus cholera toxin (CT) sustained PA-specific antibody responses for 6 months in lung, nasal washes, and vaginal washes as well as serum. A significant induction of PA-specific memory B cells was observed in spleen, cervical lymph nodes (CLNs) and lung after booster immunization. Furthermore, intranasal immunization with rPA plus CT remarkably generated effector memory CD4(+) T cells in the lung. PA-specific CD4(+) T cells preferentially increased the expression of Th1- and Th17-type cytokines in lung, but not in spleen or CLNs. Collectively, the intranasal immunization with rPA plus CT promoted immunologic memory responses in the mucosal and systemic compartments, providing long-term immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Merck Ad5/HIV induces broad innate immune activation that predicts CD8⁺ T-cell responses but is attenuated by preexisting Ad5 immunity.

    PubMed

    Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana

    2012-12-11

    To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.

  1. Mucosal immunology of HIV infection.

    PubMed

    Xu, Huanbin; Wang, Xiaolei; Veazey, Ronald S

    2013-07-01

    Recent advances in the immunology, pathogenesis, and prevention of human immunodeficiency virus (HIV) infection continue to reveal clues to the mechanisms involved in the progressive immunodeficiency attributed to infection, but more importantly have shed light on the correlates of immunity to infection and disease progression. HIV selectively infects, eliminates, and/or dysregulates several key cells of the human immune system, thwarting multiple arms of the host immune response, and inflicting severe damage to mucosal barriers, resulting in tissue infiltration of 'symbiotic' intestinal bacteria and viruses that essentially become opportunistic infections promoting systemic immune activation. This leads to activation and recruitment or more target cells for perpetuating HIV infection, resulting in persistent, high-level viral replication in lymphoid tissues, rapid evolution of resistant strains, and continued evasion of immune responses. However, vaccine studies and studies of spontaneous controllers are finally providing correlates of immunity from protection and disease progression, including virus-specific CD4(+) T-cell responses, binding anti-bodies, innate immune responses, and generation of antibodies with potent antibody-dependent cell-mediated cytotoxicity activity. Emerging correlates of immunity indicate that prevention of HIV infection may be possible through effective vaccine strategies that protect and stimulate key regulatory cells and immune responses in susceptible hosts. Furthermore, immune therapies specifically directed toward boosting specific aspects of the immune system may eventually lead to a cure for HIV-infected patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Mucosal Immunology of HIV Infection

    PubMed Central

    Xu, Huanbin; Wang, Xiaolei; Veazey, Ronald S.

    2013-01-01

    Summary Recent advances in the immunology, pathogenesis, and prevention of human immunodeficiency virus (HIV) infection continue to reveal clues to the mechanisms involved in the progressive immunodeficiency attributed to infection but more importantly have shed light on the correlates of immunity to infection and disease progression. HIV selectively infects, eliminates, and/or dysregulates several key cells of the human immune system, thwarting multiple arms of the host immune response, and inflicting severe damage to mucosal barriers, resulting in tissue infiltration of ‘symbiotic’ intestinal bacteria and viruses that essentially become opportunistic infections promoting systemic immune activation. This leads to activation and recruitment or more target cells for perpetuating HIV infection, resulting in persistent, high level viral replication in lymphoid tissues, rapid evolution of resistant strains, and continued evasion of immune responses. However, vaccine studies and studies of spontaneous controllers are finally providing correlates of immunity from protection and disease progression, including virus-specific CD4+ T-cell responses, binding antibodies, innate immune responses, and generation of antibodies with potent antibody-dependent cell-mediated cytotoxicity activity. Emerging correlates of immunity indicate that prevention of HIV infection may be possible through effective vaccine strategies that protect and stimulate key regulatory cells and immune responses in susceptible hosts. Further, immune therapies specifically directed towards boosting specific aspects of the immune system may eventually lead to a cure for HIV-infected patients. PMID:23772612

  3. Co-immunization with DNA and protein mixture: a safe and efficacious immunotherapeutic strategy for Alzheimer's disease in PDAPP mice.

    PubMed

    Liu, Si; Shi, DanYang; Wang, Hai-Chao; Yu, Yun-Zhou; Xu, Qing; Sun, Zhi-Wei

    2015-01-14

    Active immunotherapy targeting β-amyloid (Aβ) is the most promising strategy to prevent or treat Alzheimer's disease (AD). Based on pre-clinical studies and clinical trials, a safe and effective AD vaccine requires a delicate balance between providing therapeutically adequate anti-Aβ antibodies and eliminating or suppressing unwanted adverse T cell-mediated inflammatory reactions. We describe here the immunological characterization and protective efficacy of co-immunization with a 6Aβ15-T DNA and protein mixture without adjuvant as an AD immunotherapeutic strategy. Impressively, this co-immunization induced robust Th2-polarized Aβ-specific antibodies while simultaneously suppressed unwanted inflammatory T cell reactions and avoiding Aβ42-specific T cell-mediated autoimmune responses in immunized mice. Co-immunization with the DNA + protein vaccine could overcome Aβ42-associated hypo-responsiveness and elicit long-term Aβ-specific antibody responses, which helped to maintain antibody-mediated clearance of amyloid and accordingly alleviated AD symptoms in co-immunized PDAPP mice. Our DNA and protein combined vaccine, which could induce an anti-inflammatory Th2 immune response with high level Aβ-specific antibodies and low level IFN-γ production, also demonstrated the capacity to inhibit amyloid accumulation and prevent cognitive dysfunction. Hence, co-immunization with antigen-matched DNA and protein may represent a novel and efficacious strategy for AD immunotherapy to eliminate T cell inflammatory reactions while retaining high level antibody responses.

  4. A dendritic cell targeted vaccine induces long-term HIV-specific immunity within the gastrointestinal tract.

    PubMed

    Ruane, D; Do, Y; Brane, L; Garg, A; Bozzacco, L; Kraus, T; Caskey, M; Salazar, A; Trumpheller, C; Mehandru, S

    2016-09-01

    Despite significant therapeutic advances for HIV-1 infected individuals, a preventative HIV-1 vaccine remains elusive. Studies focusing on early transmission events, including the observation that there is a profound loss of gastrointestinal (GI) CD4(+) T cells during acute HIV-1 infection, highlight the importance of inducing HIV-specific immunity within the gut. Here we report on the generation of cellular and humoral immune responses in the intestines by a mucosally administered, dendritic cell (DC) targeted vaccine. Our results show that nasally delivered α-CD205-p24 vaccine in combination with polyICLC, induced polyfunctional immune responses within naso-pulmonary lymphoid sites that disseminated widely to systemic and mucosal (GI tract and the vaginal epithelium) sites. Qualitatively, while α-CD205-p24 prime-boost immunization generated CD4(+) T-cell responses, heterologous prime-boost immunization with α-CD205-p24 and NYVAC gag-p24 generated high levels of HIV-specific CD4(+) and CD8(+) T cells within the GI tract. Finally, DC-targeting enhanced the amplitude and longevity of vaccine-induced immune responses in the GI tract. This is the first report of a nasally delivered, DC-targeted vaccine to generate HIV-specific immune responses in the GI tract and will potentially inform the design of preventative approaches against HIV-1 and other mucosal infections.

  5. A Functional Toll-Interacting Protein Variant Is Associated with Bacillus Calmette-Guérin-Specific Immune Responses and Tuberculosis.

    PubMed

    Shah, Javeed A; Musvosvi, Munyaradzi; Shey, Muki; Horne, David J; Wells, Richard D; Peterson, Glenna J; Cox, Jeffery S; Daya, Michelle; Hoal, Eileen G; Lin, Lin; Gottardo, Raphael; Hanekom, Willem A; Scriba, Thomas J; Hatherill, Mark; Hawn, Thomas R

    2017-08-15

    The molecular mechanisms that regulate tuberculosis susceptibility and bacillus Calmette-Guérin (BCG)-induced immunity are mostly unknown. However, induction of the adaptive immune response is a critical step in host control of Mycobacterium tuberculosis. Toll-interacting protein (TOLLIP) is a ubiquitin-binding protein that regulates innate immune responses, including Toll-like receptor signaling, which initiate adaptive immunity. TOLLIP variation is associated with susceptibility to tuberculosis, but the mechanism by which it regulates tuberculosis immunity is poorly understood. To identify functional TOLLIP variants and evaluate the role of TOLLIP variation on innate and adaptive immune responses to mycobacteria and susceptibility to tuberculosis. We used human cellular immunology approaches to characterize the role of a functional TOLLIP variant on monocyte mRNA expression and M. tuberculosis-induced monocyte immune functions. We also examined the association of TOLLIP variation with BCG-induced T-cell responses and susceptibility to latent tuberculosis infection. We identified a functional TOLLIP promoter region single-nucleotide polymorphism, rs5743854, which was associated with decreased TOLLIP mRNA expression in infant monocytes. After M. tuberculosis infection, TOLLIP-deficient monocytes demonstrated increased IL-6, increased nitrite, and decreased bacterial replication. The TOLLIP-deficiency G/G genotype was associated with decreased BCG-specific IL-2 + CD4 + T-cell frequency and proliferation. This genotype was also associated with increased susceptibility to latent tuberculosis infection. TOLLIP deficiency is associated with decreased BCG-specific T-cell responses and increased susceptibility to tuberculosis. We hypothesize that the heightened antibacterial monocyte responses after vaccination of TOLLIP-deficient infants are responsible for decreased BCG-specific T-cell responses. Activating TOLLIP may provide a novel adjuvant strategy for BCG vaccination.

  6. Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

    PubMed

    Simi, S; Peter, Valsa S; Peter, M C Subhash

    2017-09-15

    Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential pattern of mRNA expression of Na + /K + -ATPase α-subunit isoforms; nkaα1a, nkaα1b and nkaα1c and the shift in nkaα1a and nkaα1b isoforms expression after hypoxia stress in immune-challenged fish, presents transcriptomic evidence for a modified Na + /K + ion transporter system in these fish. Collectively, our data thus provide evidence for an interactive immune-stress response in an air-breathing fish, where the patterns of cortisol-thyroid hormone interaction, the ion transporter functions and the non-specific immune responses are reversed by hypoxia stress in immune-challenged fish. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Potent Cell-Intrinsic Immune Responses in Dendritic Cells Facilitate HIV-1-Specific T Cell Immunity in HIV-1 Elite Controllers.

    PubMed

    Martin-Gayo, Enrique; Buzon, Maria Jose; Ouyang, Zhengyu; Hickman, Taylor; Cronin, Jacqueline; Pimenova, Dina; Walker, Bruce D; Lichterfeld, Mathias; Yu, Xu G

    2015-06-01

    The majority of HIV-1 elite controllers (EC) restrict HIV-1 replication through highly functional HIV-1-specific T cell responses, but mechanisms supporting the evolution of effective HIV-1-specific T cell immunity in these patients remain undefined. Cytosolic immune recognition of HIV-1 in conventional dendritic cells (cDC) can facilitate priming and expansion of HIV-1-specific T cells; however, HIV-1 seems to be able to avoid intracellular immune recognition in cDCs in most infected individuals. Here, we show that exposure of cDCs from EC to HIV-1 leads to a rapid and sustained production of type I interferons and upregulation of several interferon-stimulated effector genes. Emergence of these cell-intrinsic immune responses was associated with a reduced induction of SAMHD1 and LEDGF/p75, and an accumulation of viral reverse transcripts, but inhibited by pharmacological blockade of viral reverse transcription or siRNA-mediated silencing of the cytosolic DNA sensor cGAS. Importantly, improved cell-intrinsic immune recognition of HIV-1 in cDCs from elite controllers translated into stronger abilities to stimulate and expand HIV-1-specific CD8 T cell responses. These data suggest an important role of cell-intrinsic type I interferon secretion in dendritic cells for the induction of effective HIV-1-specific CD8 T cells, and may be helpful for eliciting functional T cell immunity against HIV-1 for preventative or therapeutic clinical purposes.

  8. Characterization of host immune responses in Ebola virus infections.

    PubMed

    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

    2014-06-01

    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  9. Efficiency of pH-Sensitive Fusogenic Polymer-Modified Liposomes as a Vaccine Carrier

    PubMed Central

    Watarai, Shinobu; Iwase, Tana; Tajima, Tomoko; Yuba, Eiji; Kono, Kenji

    2013-01-01

    The usefulness of pH-sensitive fusogenic polymer-(succinylated poly(glycidol)-(SucPG-) modified liposomes as a vaccine carrier in the induction of immune responses was evaluated. Mice were intraperitoneally immunized with ovalbumin- (OVA-) containing SucPG-modified liposomes. After immunization, significant OVA-specific antibodies were detected in the serum. When sera were analyzed for isotype distribution, OVA-specific IgG1 antibody responses were noted in mice immunized with OVA-containing polymer-unmodified liposomes, whereas immunization with OVA-containing SucPG-modified liposomes resulted in the induction of OVA-specific IgG1, IgG2a, and IgG3 Ab responses. In spleen lymphocytes from mice immunized with OVA-containing SucPG-modified liposomes, both IFN-γ-(Th1-type-) and IL-4-(Th2 type-) specific mRNA were detected. Moreover, substantial production of IFN-γ and IL-4 was demonstrated in spleen cells from OVA-containing SucPG-modified liposomes in vitro. These results suggest that the pH-sensitive fusogenic polymer-(SucPG-) modified liposomes would serve effectively as an antigen delivery vehicle for inducing Th1 and Th2 immune responses. PMID:23431260

  10. Efficiency of pH-sensitive fusogenic polymer-modified liposomes as a vaccine carrier.

    PubMed

    Watarai, Shinobu; Iwase, Tana; Tajima, Tomoko; Yuba, Eiji; Kono, Kenji

    2013-01-01

    The usefulness of pH-sensitive fusogenic polymer-(succinylated poly(glycidol)-(SucPG-) modified liposomes as a vaccine carrier in the induction of immune responses was evaluated. Mice were intraperitoneally immunized with ovalbumin- (OVA-) containing SucPG-modified liposomes. After immunization, significant OVA-specific antibodies were detected in the serum. When sera were analyzed for isotype distribution, OVA-specific IgG1 antibody responses were noted in mice immunized with OVA-containing polymer-unmodified liposomes, whereas immunization with OVA-containing SucPG-modified liposomes resulted in the induction of OVA-specific IgG1, IgG2a, and IgG3 Ab responses. In spleen lymphocytes from mice immunized with OVA-containing SucPG-modified liposomes, both IFN-γ-(Th1-type-) and IL-4-(Th2 type-) specific mRNA were detected. Moreover, substantial production of IFN-γ and IL-4 was demonstrated in spleen cells from OVA-containing SucPG-modified liposomes in vitro. These results suggest that the pH-sensitive fusogenic polymer-(SucPG-) modified liposomes would serve effectively as an antigen delivery vehicle for inducing Th1 and Th2 immune responses.

  11. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery.

    PubMed

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke

    2017-02-06

    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  12. Oral Immunization with a Recombinant Lactococcus lactis-Expressing HIV-1 Antigen on Group A Streptococcus Pilus Induces Strong Mucosal Immunity in the Gut.

    PubMed

    Chamcha, Venkateswarlu; Jones, Andrew; Quigley, Bernard R; Scott, June R; Amara, Rama Rao

    2015-11-15

    The induction of a potent humoral and cellular immune response in mucosal tissue is important for the development of an effective HIV vaccine. Most of the current HIV vaccines under development use the i.m. route for immunization, which is relatively poor in generating potent and long-lived mucosal immune responses. In this article, we explore the ability of an oral vaccination with a probiotic organism, Lactococcus lactis, to elicit HIV-specific immune responses in the mucosal and systemic compartments of BALB/c mice. We expressed the HIV-1 Gag-p24 on the tip of the T3 pilus of Streptococcus pyogenes as a fusion to the Cpa protein (LL-Gag). After four monthly LL-Gag oral immunizations, we observed strong Gag-specific IgG and IgA responses in serum, feces, and vaginal secretions. However, the Gag-specific CD8 T cell responses in the blood were at or below our detection limit. After an i.m. modified vaccinia Ankara/Gag boost, we observed robust Gag-specific CD8 T cell responses both in systemic and in mucosal tissues, including intraepithelial and lamina propria lymphocytes of the small intestine, Peyer's patches, and mesenteric lymph nodes. Consistent with strong immunogenicity, the LL-Gag induced activation of CD11c(+) CD11b(+) dendritic cells in the Peyer's patches after oral immunization. Our results demonstrate that oral immunization with L. lactis expressing an Ag on the tip of the group A Streptococcus pilus serves as an excellent vaccine platform to induce strong mucosal humoral and cellular immunity against HIV. Copyright © 2015 by The American Association of Immunologists, Inc.

  13. Therapeutic targeting of regulatory T cells enhances tumor-specific CD8+ T cell responses in Epstein–Barr virus associated nasopharyngeal carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fogg, Mark; Murphy, John R.; Lorch, Jochen

    Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, asmore » well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. - Highlights: • Viral proteins are tumor antigens in Epstein–Barr virus associated Nasopharyngeal Carcinoma. • CD8+ T cell responses against EBV proteins EBNA-1 and LMP2 are suppressed in NPC patients. • T regulatory cells are responsible for suppressing EBV immunity in NPC patients. • Depletion of Tregs with Ontak can rescue EBV-specific CD8+ T cell responses in NPC patients. • This clinically approved drug may be effective for enhancing anti-tumor immunity in NPC patients.« less

  14. Mathematical modeling provides kinetic details of the human immune response to vaccination

    PubMed Central

    Le, Dustin; Miller, Joseph D.; Ganusov, Vitaly V.

    2015-01-01

    With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data. PMID:25621280

  15. Mathematical modeling provides kinetic details of the human immune response to vaccination.

    PubMed

    Le, Dustin; Miller, Joseph D; Ganusov, Vitaly V

    2014-01-01

    With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data.

  16. Noncoding RNA danger motifs bridge innate and adaptive immunity and are potent adjuvants for vaccination

    PubMed Central

    Wang, Lilin; Smith, Dan; Bot, Simona; Dellamary, Luis; Bloom, Amy; Bot, Adrian

    2002-01-01

    The adaptive immune response is triggered by recognition of T and B cell epitopes and is influenced by “danger” motifs that act via innate immune receptors. This study shows that motifs associated with noncoding RNA are essential features in the immune response reminiscent of viral infection, mediating rapid induction of proinflammatory chemokine expression, recruitment and activation of antigen-presenting cells, modulation of regulatory cytokines, subsequent differentiation of Th1 cells, isotype switching, and stimulation of cross-priming. The heterogeneity of RNA-associated motifs results in differential binding to cellular receptors, and specifically impacts the immune profile. Naturally occurring double-stranded RNA (dsRNA) triggered activation of dendritic cells and enhancement of specific immunity, similar to selected synthetic dsRNA motifs. Based on the ability of specific RNA motifs to block tolerance induction and effectively organize the immune defense during viral infection, we conclude that such RNA species are potent danger motifs. We also demonstrate the feasibility of using selected RNA motifs as adjuvants in the context of novel aerosol carriers for optimizing the immune response to subunit vaccines. In conclusion, RNA-associated motifs produced during viral infection bridge the early response with the late adaptive phase, regulating the activation and differentiation of antigen-specific B and T cells, in addition to a short-term impact on innate immunity. PMID:12393853

  17. Induction of strong anti-HIV cellular immunity by a combination of Clostridium perfringens expressing HIV gag and virus like particles.

    PubMed

    Pegu, Poonam; Helmus, Ruth; Gupta, Phalguni; Tarwater, Patrick; Caruso, Lori; Shen, Chengli; Ross, Ted; Chen, Yue

    2011-12-01

    The lower gastrointestinal tract is a major mucosal site of HIV entry and initial infection. Thus, the induction of strong cellular immune responses at this mucosal site will be an important feature of an effective HIV vaccine. We have used a novel prime-boost vaccination approach to induce immune responses at mucosal sites. Orally delivered recombinant Clostridium perfringens expressing HIV-1 gag (Cp-Gag) was evaluated for induction of HIV-1 Gag specific T cell responses in a prime-boost model with intranasal inoculation of HIV-1 virus like particles (VLP). HIV-1 specific cellular immune responses in both the effector (Lamina propria) and inductive sites (Peyer's patches) of the gastrointestinal (GI) tract were significantly higher in mice immunized using Cp-Gag and VLPs in a prime-boost approach compared to mice immunized with either Cp-Gag or VLPs alone. Such cellular immune response was found to be mediated by both CD8(+) and CD4(+) T cells. Such a strong mucosal immune response could be very useful in developing a mucosal vaccine against HIV-1.

  18. 10 CFR 850.3 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... vitro measure of the beryllium antigen-specific, cell-mediated immune response. Beryllium worker means a... particles. Immune response refers to the series of cellular events by which the immune system reacts to...

  19. Lack of broad functional differences in immunity in fully vaccinated vs. unvaccinated children.

    PubMed

    Sherrid, Ashley M; Ruck, Candice E; Sutherland, Darren; Cai, Bing; Kollmann, Tobias R

    2017-04-01

    Concerns have been raised that with an increase in the number of vaccines administered early in life, immune development could be altered, leading to either increased or decreased immune reactivity. We investigated the impact of vaccination on immune status, contrasting the immune response to general, nonantigen-specific stimuli in a cohort of entirely unvaccinated vs. fully vaccinated children at 3-5 y of age. Innate immunity was assessed by quantifying bulk and cell-type-specific cytokine production in response to stimulation with pathogen associated microbial patterns. Adaptive immune status was characterized by assessing lymphocyte proliferation and cytokine production in response to generic T cell stimuli. Our investigations failed to reveal a broadly evident alteration of either innate or adaptive immunity in vaccinated children. Equivalently robust innate and adaptive responses to pathogen associated microbial patterns and generic T cell stimulants were observed in both groups. Although our sample size was small, our data suggest that standard childhood vaccinations do not lead to long-lasting gross alterations of the immune system.

  20. DNA β-Amyloid1–42 Trimer Immunization for Alzheimer Disease in a Wild-Type Mouse Model

    PubMed Central

    Lambracht-Washington, Doris; Qu, Bao-Xi; Fu, Min; Eagar, Todd N.; Stüve, Olaf; Rosenberg, Roger N.

    2010-01-01

    Context DNA β-amyloid1–42 (Aβ42) trimer immunization was developed to produce specific T helper 2 cell (TH2)–type antibodies to provide an effective and safe therapy for Alzheimer disease (AD) by reducing elevated levels of Aβ42 peptide that occur in the brain of patients with AD. Objective To compare the immune response in wild-type mice after immunization with DNA Aβ42 trimer and Aβ42 peptide. Design and Intervention Wild-type mice received either 4 µg of DNA Aβ42 trimer immunization administered with gene gun (n=8) or intraperitoneal injection of 100 µg of human Aβ42 peptide with the adjuvant Quil A (n=8). Titers, epitope mapping, and isotypes of the Aβ42-specific antibodies were analyzed. Main Outcome Measures Antibody titers, mapping of binding sites (epitopes), isotype profiles of the Aβ42-specific antibodies, and T-cell activation. Results DNA Aβ42 trimer immunization resulted in antibody titers with a mean of 15 µg per milliliter of plasma. The isotype profile of the antibodies differed markedly. A predominant IgG1 antibody response was found in the DNA-immunized mice, indicating a TH2 type of immune response (IgG1/IgG2a ratio of 10). The peptide-immunized mice showed a mixed TH1/TH2 immune response (IgG1/IgG2a ratio of 1) (P<.001). No increased T-cell proliferation was observed in the DNA-immunized mice (P=.03). Conclusion In this preliminary study in a wild-type mouse model, DNA Aβ42 trimer immunization protocol produced a TH2 immune response and appeared to have low potential to cause an inflammatory T-cell response. PMID:19861672

  1. DNA beta-amyloid(1-42) trimer immunization for Alzheimer disease in a wild-type mouse model.

    PubMed

    Lambracht-Washington, Doris; Qu, Bao-Xi; Fu, Min; Eagar, Todd N; Stüve, Olaf; Rosenberg, Roger N

    2009-10-28

    DNA beta-amyloid(1-42) (Abeta42) trimer immunization was developed to produce specific T helper 2 cell (T(H)2)-type antibodies to provide an effective and safe therapy for Alzheimer disease (AD) by reducing elevated levels of Abeta42 peptide that occur in the brain of patients with AD. To compare the immune response in wild-type mice after immunization with DNA Abeta42 trimer and Abeta42 peptide. Wild-type mice received either 4 microg of DNA Abeta42 trimer immunization administered with gene gun (n = 8) or intraperitoneal injection of 100 microg of human Abeta42 peptide with the adjuvant Quil A (n = 8). Titers, epitope mapping, and isotypes of the Abeta42-specific antibodies were analyzed. Antibody titers, mapping of binding sites (epitopes), isotype profiles of the Abeta42-specific antibodies, and T-cell activation. DNA Abeta42 trimer immunization resulted in antibody titers with a mean of 15 microg per milliliter of plasma. The isotype profile of the antibodies differed markedly. A predominant IgG1 antibody response was found in the DNA-immunized mice, indicating a T(H)2 type of immune response (IgG1/IgG2a ratio of 10). The peptide-immunized mice showed a mixed T(H)1/T(H)2 immune response (IgG1/IgG2a ratio of 1) (P < .001). No increased T-cell proliferation was observed in the DNA-immunized mice (P = .03). In this preliminary study in a wild-type mouse model, DNA Abeta42 trimer immunization protocol produced a T(H)2 immune response and appeared to have low potential to cause an inflammatory T-cell response.

  2. Mosaic vaccines elicit CD8+ T cell responses in monkeys that confer immune coverage of diverse HIV strains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fischer, Will; Korber, Bette

    2009-01-01

    Creation of a successful HIV vaccine will require the development of a strategy to generate cellular immunity with sufficient cross-clade breadth to deal with the extreme genetic diversity of the virus. Polyvalent mosaic immunogens derived from in silica recombination of natural strains of HIV are designed to induce cellular immune responses that maximally cover the sequence diversity of circulating virus isolates. Immunization of rhesus monkeys with plasmid DNA and recombinant vaccinia virus vaccine constructs expressing either consensus immunogens or polyvalent mosaic immunogens elicited a CD4+ T lymphocyte-biased response with comparably broad epitope-specific total T lymphocyte specificities. However, immunization with themore » mosaic immunogens induced HIV-specific CD8+ T lymphocyte responses with markedly greater depth and breadth. Therefore, the use of polyvalent mosaic immunogens is a promising strategy for a global vaccine for HIV.« less

  3. Simultaneous Presence of Non- and Highly Mutated Keyhole Limpet Hemocyanin (KLH)-Specific Plasmablasts Early after Primary KLH Immunization Suggests Cross-Reactive Memory B Cell Activation.

    PubMed

    Giesecke, Claudia; Meyer, Tim; Durek, Pawel; Maul, Jochen; Preiß, Jan; Jacobs, Joannes F M; Thiel, Andreas; Radbruch, Andreas; Ullrich, Reiner; Dörner, Thomas

    2018-06-15

    There are currently limited insights into the progression of human primary humoral immunity despite numerous studies in experimental models. In this study, we analyzed a primary and related secondary parenteral keyhole limpet hemocyanin (KLH) immunization in five human adults. The primary challenge elicited discordant KLH-specific serum and blood effector B cell responses (i.e., dominant serum KLH-specific IgG and IgM levels versus dominant KLH-specific IgA plasmablast frequencies). Single-cell IgH sequencing revealed early appearance of highly (>15 mutations) mutated circulating KLH-specific plasmablasts 2 wk after primary KLH immunization, with simultaneous KLH-specific plasmablasts carrying non- and low-mutated IgH sequences. The data suggest that the highly mutated cells might originate from cross-reactive memory B cells (mBCs) rather than from the naive B cell repertoire, consistent with previous reported mutation rates and the presence of KLH-reactive mBCs in naive vaccinees prior to immunization. Whereas upon secondary immunization, serum Ab response kinetics and plasmablast mutation loads suggested the exclusive reactivation of KLH-specific mBCs, we, however, detected only little clonal overlap between the peripheral KLH-specific secondary plasmablast IgH repertoire and the primary plasmablast and mBC repertoire, respectively. Our data provide novel mechanistic insights into human humoral immune responses and suggest that primary KLH immunization recruits both naive B cells and cross-reactive mBCs, whereas secondary challenge exclusively recruits from a memory repertoire, with little clonal overlap with the primary response. Copyright © 2018 by The American Association of Immunologists, Inc.

  4. Effect of lipoarabinomannan from Mycobacterium avium subsp avium in Freund's incomplete adjuvant on the immune response of cattle.

    PubMed

    Colavecchia, S B; Jolly, A; Fernández, B; Fontanals, A M; Fernández, E; Mundo, S L

    2012-02-01

    The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund's incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

  5. Effect of lipoarabinomannan from Mycobacterium avium subsp avium in Freund's incomplete adjuvant on the immune response of cattle

    PubMed Central

    Colavecchia, S.B.; Jolly, A.; Fernández, B.; Fontanals, A.M.; Fernández, E.; Mundo, S.L.

    2012-01-01

    The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund's incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis. PMID:22286534

  6. Adjuvants in the Driver’s Seat: How Magnitude, Type, Fine Specificity and Longevity of Immune Responses Are Driven by Distinct Classes of Immune Potentiators

    PubMed Central

    Bergmann-Leitner, Elke S.; Leitner, Wolfgang W.

    2014-01-01

    The mechanism by which vaccine adjuvants enhance immune responses has historically been considered to be the creation of an antigen depot. From here, the antigen is slowly released and provided to immune cells over an extended period of time. This “depot” was formed by associating the antigen with substances able to persist at the injection site, such as aluminum salts or emulsions. The identification of Pathogen-Associated Molecular Patterns (PAMPs) has greatly advanced our understanding of how adjuvants work beyond the simple concept of extended antigen release and has accelerated the development of novel adjuvants. This review focuses on the mode of action of different adjuvant classes in regards to the stimulation of specific immune cell subsets, the biasing of immune responses towards cellular or humoral immune response, the ability to mediate epitope spreading and the induction of persistent immunological memory. A better understanding of how particular adjuvants mediate their biological effects will eventually allow them to be selected for specific vaccines in a targeted and rational manner. PMID:26344620

  7. Vaccine-specific antibody secreting cells are a robust early marker of LAIV-induced B-cell response in ferrets.

    PubMed

    Cherukuri, Anu; Servat, Esteban; Woo, Jennifer

    2012-01-05

    Currently, a robust set of immune correlates for live attenuated influenza vaccine (LAIV) efficacy in humans has not been fully elucidated. The serum hemagglutination inhibition (HAI) assay has been historically used to measure humoral immune responses to injectable inactivated influenza vaccination. However, serum antibody titers do not reliably reflect the complete mechanism of action of LAIV, which is an intranasally delivered vaccine and is expected to induce local mucosal and cellular immune responses in addition to humoral immune responses. Therefore, we designed a study to evaluate potential immune correlates of LAIV vaccination in the ferret animal model of influenza infection. Ferrets were vaccinated with increasing doses of LAIV and four weeks later challenged with a homologous wild-type (wt) H1N1 strain. Humoral immune responses measured following LAIV vaccination included HAI, serum antibodies and antibody secreting cells (ASC); and the responses were found to correlate with the dose level of LAIV administered in this model. Protection from wt virus challenge was determined by measuring inhibition of wt viral replication in nasal washes and in lung tissue. Results demonstrated that LAIV doses ≥ 5.0 log(10) Plaque Forming Units (PFU) elicited vaccine-specific IgG and IgA ASC frequencies and induced complete protection in the lungs. Further, we developed a novel model utilizing seropositive older ferrets to demonstrate that in the background of previous wt influenza infection LAIV induces a robust vaccine-specific B-cell response even in the absence of serum antibody response, a result that suggests that effector B-cell responses generated by LAIV are not inhibited by prior viral exposure. Finally, we demonstrated that LAIV elicits strain-specific memory B-cell responses that are measurable in a background of wt influenza infections. Taken together, results from these studies identified the antigen-specific ASC frequency as a useful early biomarker of LAIV-induced B-cell immune response. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Immunotherapy with an HIV-DNA Vaccine in Children and Adults

    PubMed Central

    Palma, Paolo; Gudmundsdotter, Lindvi; Finocchi, Andrea; Eriksson, Lars E.; Mora, Nadia; Santilli, Veronica; Aquilani, Angela; Manno, Emma C.; Zangari, Paola; Romiti, Maria Luisa; Montesano, Carla; Grifoni, Alba; Brave, Andreas; Ljungberg, Karl; Blomberg, Pontus; Bernardi, Stefania; Sandström, Eric; Hejdeman, Bo; Rossi, Paolo; Wahren, Britta

    2014-01-01

    Therapeutic HIV immunization is intended to induce new HIV-specific cellular immune responses and to reduce viral load, possibly permitting extended periods without antiretroviral drugs. A multigene, multi-subtype A, B, C HIV-DNA vaccine (HIVIS) has been used in clinical trials in both children and adults with the aim of improving and broadening the infected individuals’ immune responses. Despite the different country locations, different regimens and the necessary variations in assays performed, this is, to our knowledge, the first attempt to compare children’s and adults’ responses to a particular HIV vaccine. Ten vertically HIV-infected children aged 4–16 years were immunized during antiretroviral therapy (ART). Another ten children were blindly recruited as controls. Both groups continued their antiretroviral treatment during and after vaccinations. Twelve chronically HIV-infected adults were vaccinated, followed by repeated structured therapy interruptions (STI) of their antiretroviral treatment. The adult group included four controls, receiving placebo vaccinations. The HIV-DNA vaccine was generally well tolerated, and no serious adverse events were registered in any group. In the HIV-infected children, an increased specific immune response to Gag and RT proteins was detected by antigen-specific lymphoproliferation. Moreover, the frequency of HIV-specific CD8+ T-cell lymphocytes releasing perforin was significantly higher in the vaccinees than the controls. In the HIV-infected adults, increased CD8+ T-cell responses to Gag, RT and viral protease peptides were detected. No augmentation of HIV-specific lymphoproliferative responses were detected in adults after vaccination. In conclusion, the HIV-DNA vaccine can elicit new HIV-specific cellular immune responses, particularly to Gag antigens, in both HIV-infected children and adults. Vaccinated children mounted transient new HIV-specific immune responses, including both CD4+ T-cell lymphoproliferation and late CD8+ T-cell responses. In the adult cohort, primarily CD8+ T-cell responses related to MHC class I alleles were noted. However, no clinical benefits with respect to viral load reduction were ascribable to the vaccinations alone. No severe adverse effects related to the vaccine were found in either cohort, and no virological failures or drug resistances were detected. PMID:26344746

  9. Effects of dietary L-glutamine supplementation on specific and general defense responses in mice immunized with inactivated Pasteurella multocida vaccine.

    PubMed

    Chen, Shuai; Liu, Shuping; Zhang, Fengmei; Ren, Wenkai; Li, Nengzhang; Yin, Jie; Duan, Jielin; Peng, Yuanyi; Liu, Gang; Yin, Yulong; Wu, Guoyao

    2014-10-01

    Little is known about effects of dietary glutamine supplementation on specific and general defense responses in a vaccine-immunized animal model. Thus, this study determined roles for dietary glutamine supplementation in specific and general defense responses in mice immunized with inactivated Pasteurella multocida vaccine. The measured variables included: (1) the production of pathogen-specific antibodies; (2) mRNA levels for pro-inflammatory cytokines, toll-like receptors and anti-oxidative factors; and (3) the distribution of P. multocida in tissues and the expression of its major virulence factors in vivo. Dietary supplementation with 0.5 % glutamine had a better protective role than 1 or 2 % glutamine against P. multocida infection in vaccine-immunized mice, at least partly resulting from its effects in modulation of general defense responses. Dietary glutamine supplementation had little effects on the production of P. multocida-specific antibodies. Compared to the non-supplemented group, dietary supplementation with 0.5 % glutamine had no effect on bacterial burden in vivo but decreased the expression of major virulence factors in the spleen. Collectively, supplementing 0.5 % glutamine to a conventional diet provides benefits in vaccine-immunized mice by enhancing general defense responses and decreasing expression of specific virulence factors.

  10. Quantification of systemic and local immune responses to individual rotavirus proteins during rotavirus infection in mice.

    PubMed Central

    Ishida, S; Feng, N; Tang, B; Gilbert, J M; Greenberg, H B

    1996-01-01

    The purpose of the present study was to develop a quantitative assay that could be used to measure the local and systemic immune responses to specific rotavirus proteins following rotavirus infection of adult mice. To measure these responses, we used an immunocytochemical staining assay of Spodoptera frugiperda (Sf-9) cells which were infected with recombinant baculovirus expressing selected rotavirus proteins. The specificity of the assay was documented by using a series of monoclonal antibodies to individual rotavirus proteins. We observed that the assay had high levels of sensitivity and specificity for a series of VP7- and VP4-specific neutralizing monoclonal antibodies which recognized conformation-dependent epitopes on their target proteins. We also studied immunoglobulin G (IgG) immune responses in serum and IgA immune responses in the stools of mice infected with wild-type murine rotavirus strain EHPw. In both sera and stools, the most immunogenic proteins were VP6 and VP4. VP2 was less immunogenic than VP6 or VP4, and the immune responses to VP7, NSP2, and NSP4 were very low in serum and undetectable in stools. PMID:8784572

  11. Commensal Gut-Derived Anaerobes as Novel Therapy for Inflammatory Autoimmune Diseases

    DTIC Science & Technology

    2011-05-01

    treatment of arthritis. Treatment of mice with P. histicola as probiotics and therapy are ongoing. In vitro study showed that treatment of mice with P...histicola in CII-immunized mice led to suppression of antigen-specific immune response and reduction in production of inflammatory cytokines. Our data...effect of Prevotella on antigen specific immune response and production of pro-inflammatory cytokines by antigen specific T-cells. Mice were fed

  12. Q fever in pregnant goats: humoral and cellular immune responses

    PubMed Central

    2013-01-01

    Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213

  13. An oral Sindbis virus replicon-based DNA vaccine containing VP2 gene of canine parvovirus delivered by Escherichia coli elicits immune responses in dogs.

    PubMed

    Dahiya, S S; Saini, M; Kumar, P; Gupta, P K

    2011-01-01

    A Sindbis virus replicon-based DNA vaccine containing VP2 gene of canine parvovirus (CPV) was delivered by Escherichia coli to elicit immune responses. The orally immunized dogs developed CPV-specific serum IgG and virus neutralizing antibody responses. The cellular immune responses analyzed using lymphocyte proliferation test and flow cytometry indicated CPV-specific sensitization of both CD3+CD4+ and CD3+CD8+ lymphocytes. This study demonstrated that the oral CPV DNA vaccine delivered by E. coli can be considered as a promising approach for vaccination of dogs against CPV.

  14. The Immunology of Posttransplant CMV Infection: Potential Effect of CMV Immunoglobulins on Distinct Components of the Immune Response to CMV

    PubMed Central

    Carbone, Javier

    2016-01-01

    Abstract The immune response to cytomegalovirus (CMV) infection is highly complex, including humoral, cellular, innate, and adaptive immune responses. Detection of CMV by the innate immune system triggers production of type I IFNs and inflammatory cytokines which initiate cellular and humoral responses that are critical during the early viremic phase of CMV infection. Sustained control of CMV infection is largely accounted for by cellular immunity, involving various T-cell and B-cell subsets. In solid organ transplant patients, global suppression of innate and adaptive immunities by immunosuppressive agents limits immunological defense, including inhibition of natural killer cell activity with ongoing lowering of Ig levels and CMV-specific antibody titers. This is coupled with a short-term suppression of CMV-specific T cells, the extent and duration of which can predict risk of progression to CMV viremia. CMV immunoglobulin (CMVIG) preparations have the potential to exert immunomodulatory effects as well as providing passive immunization. Specific CMVIG antibodies and virus neutralization might be enhanced by modulation of dendritic cell activity and by a decrease in T-cell activation, effects which are of importance during the initial phase of infection. In summary, the role of CMVIG in reconstituting specific anti-CMV antibodies may be enhanced by some degree of modulation of the innate and adaptive immune responses, which could help to control some of the direct and indirect effects of CMV infection. PMID:26900990

  15. The Immunology of Posttransplant CMV Infection: Potential Effect of CMV Immunoglobulins on Distinct Components of the Immune Response to CMV.

    PubMed

    Carbone, Javier

    2016-03-01

    The immune response to cytomegalovirus (CMV) infection is highly complex, including humoral, cellular, innate, and adaptive immune responses. Detection of CMV by the innate immune system triggers production of type I IFNs and inflammatory cytokines which initiate cellular and humoral responses that are critical during the early viremic phase of CMV infection. Sustained control of CMV infection is largely accounted for by cellular immunity, involving various T-cell and B-cell subsets. In solid organ transplant patients, global suppression of innate and adaptive immunities by immunosuppressive agents limits immunological defense, including inhibition of natural killer cell activity with ongoing lowering of Ig levels and CMV-specific antibody titers. This is coupled with a short-term suppression of CMV-specific T cells, the extent and duration of which can predict risk of progression to CMV viremia. CMV immunoglobulin (CMVIG) preparations have the potential to exert immunomodulatory effects as well as providing passive immunization. Specific CMVIG antibodies and virus neutralization might be enhanced by modulation of dendritic cell activity and by a decrease in T-cell activation, effects which are of importance during the initial phase of infection. In summary, the role of CMVIG in reconstituting specific anti-CMV antibodies may be enhanced by some degree of modulation of the innate and adaptive immune responses, which could help to control some of the direct and indirect effects of CMV infection.

  16. Mucosal Vaccination Overcomes the Barrier to Recombinant Vaccinia Immunization Caused by Preexisting Poxvirus Immunity

    NASA Astrophysics Data System (ADS)

    Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.

    1999-04-01

    Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.

  17. Amplifying IFN-γ Signaling in Dendritic Cells by CD11c-Specific Loss of SOCS1 Increases Innate Immunity to Infection while Decreasing Adaptive Immunity.

    PubMed

    Alice, Alejandro F; Kramer, Gwen; Bambina, Shelly; Baird, Jason R; Bahjat, Keith S; Gough, Michael J; Crittenden, Marka R

    2018-01-01

    Although prophylactic vaccines provide protective humoral immunity against infectious agents, vaccines that elicit potent CD8 T cell responses are valuable tools to shape and drive cellular immunity against cancer and intracellular infection. In particular, IFN-γ-polarized cytotoxic CD8 T cell immunity is considered optimal for protective immunity against intracellular Ags. Suppressor of cytokine signaling (SOCS)1 is a cross-functional negative regulator of TLR and cytokine receptor signaling via degradation of the receptor-signaling complex. We hypothesized that loss of SOCS1 in dendritic cells (DCs) would improve T cell responses by accentuating IFN-γ-directed immune responses. We tested this hypothesis using a recombinant Listeria monocytogenes vaccine platform that targets CD11c + DCs in mice in which SOCS1 is selectively deleted in all CD11c + cells. Unexpectedly, in mice lacking SOCS1 expression in CD11c + cells, we observed a decrease in CD8 + T cell response to the L. monocytogenes vaccine. NK cell responses were also decreased in mice lacking SOCS1 expression in CD11c + cells but did not explain the defect in CD8 + T cell immunity. We found that DCs lacking SOCS1 expression were functional in driving Ag-specific CD8 + T cell expansion in vitro but that this process was defective following infection in vivo. Instead, monocyte-derived innate TNF-α and inducible NO synthase-producing DCs dominated the antibacterial response. Thus, loss of SOCS1 in CD11c + cells skewed the balance of immune response to infection by increasing innate responses while decreasing Ag-specific adaptive responses to infectious Ags. Copyright © 2017 by The American Association of Immunologists, Inc.

  18. Induction of protective immunity against toxoplasmosis in mice by immunization with Toxoplasma gondii RNA.

    PubMed

    Dimier-Poisson, Isabelle; Aline, Fleur; Bout, Daniel; Mévélec, Marie-Noëlle

    2006-03-06

    Toxoplasma gondii enters the mucosal surfaces of the host, and so immunity at these sites is of major interest. Due to the compartmentalization of the immune response, systemic immunization does not induce high levels of immunity at mucosal surfaces. Intranasal immunization has been shown to be very effective in inducing both systemic and mucosal immune responses. Immunization with mRNA can induce both humoral and cell-mediated immune responses, both of which are important in conferring immunity to T. gondii. The efficacy of RNA vaccination by the nasal route with T. gondii RNA was evaluated. We assessed the percentage of cumulative survival after an oral challenge with a lethal dose of T. gondii cysts (40 cysts), and the number of brain cysts following a challenge with a sublethal dose of T. gondii 76 K cysts (15 cysts). Vaccinated mice were found to be significantly better protected than non-immunized mice after a challenge with a lethal dose of cysts; and a challenge with a sublethal dose also resulted in fewer brain cysts than in non-immunized mice. Sera and intestinal secretions of immunized mice recognized T. gondii antigens, suggesting that a specific humoral immune response may occur. Moreover, a specific lymphoproliferative response observed in cervical lymph nodes may confer protection. These preliminary findings suggest that RNA vaccination by a mucosal route could be feasible.

  19. CMV-specific T-cell immunity in solid organ transplant recipients at low risk of CMV infection. Chronology and applicability in preemptive therapy.

    PubMed

    Mena-Romo, Juan Damián; Pérez Romero, Pilar; Martín-Gandul, Cecilia; Gentil, Miguel Ángel; Suárez-Artacho, Gonzalo; Lage, Ernesto; Sánchez, Magdalena; Cordero, Elisa

    2017-10-01

    To characterize whether the CMV-specific cellular immune response can be used as a predictor of the control of CMV infection and disease and determine thresholds in solid organ transplant (SOT) recipients seropositive for CMV (R+). The CMV-specific T-cell response was characterized using intracellular cytokine staining and the evolution of clinical and virological parameters were recorded during the first year after transplantation. Besides having positive CMV serology, only 28.4% patients had positive immunity (CD8 + CD69 + IFN-γ + ≥0.25%) at 2 weeks after transplantation. These patients had less indication of preemptive treatment (p = 0.025) and developed less high grade (≥2000 IU/ml) CMV replication episodes (p = 0.006) than patients with no immunity. Of the 49 patients with a pretransplant sample, only 22.4% had positive immunity, and had a detectable immune response early after transplantation (median of 3.7 weeks). However, only 50% of patients with negative pretransplant immunity acquired a positive immune response and it was significantly later, at a median of 11 weeks (p < 0.001). Patients that developed CMV disease had no CMV-specific immunity. Having CMV-specific CD8 + IFN-γ + cells ≥0.25% before transplant; 0.15% at two weeks or 0.25% at four weeks after transplantation, identifies patients that may spontaneously control CMV infection and may require less monitoring. Copyright © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  20. Respiratory syncytial virus induced type I IFN production by pDC is regulated by RSV-infected airway epithelial cells, RSV-exposed monocytes and virus specific antibodies.

    PubMed

    Schijf, Marcel A; Lukens, Michael V; Kruijsen, Debby; van Uden, Nathalie O P; Garssen, Johan; Coenjaerts, Frank E J; Van't Land, Belinda; van Bleek, Grada M

    2013-01-01

    Innate immune responses elicited upon virus exposure are crucial for the effective eradication of viruses, the onset of adaptive immune responses and for establishing proper immune memory. Respiratory syncytial virus (RSV) is responsible for a high disease burden in neonates and immune compromised individuals, causing severe lower respiratory tract infections. During primary infections exuberant innate immune responses may contribute to disease severity. Furthermore, immune memory is often insufficient to protect during RSV re-exposure, which results in frequent symptomatic reinfections. Therefore, identifying the cell types and pattern recognition receptors (PRRs) involved in RSV-specific innate immune responses is necessary to understand incomplete immunity against RSV. We investigated the innate cellular response triggered upon infection of epithelial cells and peripheral blood mononuclear cells. We show that CD14(+) myeloid cells and epithelial cells are the major source of IL-8 and inflammatory cytokines, IL-6 and TNF-α, when exposed to live RSV Three routes of RSV-induced IFN-α production can be distinguished that depend on the cross-talk of different cell types and the presence or absence of virus specific antibodies, whereby pDC are the ultimate source of IFN-α. RSV-specific antibodies facilitate direct TLR7 access into endosomal compartments, while in the absence of antibodies, infection of monocytes or epithelial cells is necessary to provide an early source of type I interferons, required to engage the IFN-α,β receptor (IFNAR)-mediated pathway of IFN-α production by pDC. However, at high pDC density infection with RSV causes IFN-α production without the need for a second party cell. Our study shows that cellular context and immune status are factors affecting innate immune responses to RSV. These issues should therefore be addressed during the process of vaccine development and other interventions for RSV disease.

  1. Respiratory Syncytial Virus Induced Type I IFN Production by pDC Is Regulated by RSV-Infected Airway Epithelial Cells, RSV-Exposed Monocytes and Virus Specific Antibodies

    PubMed Central

    Schijf, Marcel A.; Lukens, Michael V.; Kruijsen, Debby; van Uden, Nathalie O. P.; Garssen, Johan; Coenjaerts, Frank E. J.; van’t Land, Belinda; van Bleek, Grada M.

    2013-01-01

    Innate immune responses elicited upon virus exposure are crucial for the effective eradication of viruses, the onset of adaptive immune responses and for establishing proper immune memory. Respiratory syncytial virus (RSV) is responsible for a high disease burden in neonates and immune compromised individuals, causing severe lower respiratory tract infections. During primary infections exuberant innate immune responses may contribute to disease severity. Furthermore, immune memory is often insufficient to protect during RSV re-exposure, which results in frequent symptomatic reinfections. Therefore, identifying the cell types and pattern recognition receptors (PRRs) involved in RSV-specific innate immune responses is necessary to understand incomplete immunity against RSV. We investigated the innate cellular response triggered upon infection of epithelial cells and peripheral blood mononuclear cells. We show that CD14+ myeloid cells and epithelial cells are the major source of IL-8 and inflammatory cytokines, IL-6 and TNF-α, when exposed to live RSV Three routes of RSV-induced IFN-α production can be distinguished that depend on the cross-talk of different cell types and the presence or absence of virus specific antibodies, whereby pDC are the ultimate source of IFN-α. RSV-specific antibodies facilitate direct TLR7 access into endosomal compartments, while in the absence of antibodies, infection of monocytes or epithelial cells is necessary to provide an early source of type I interferons, required to engage the IFN-α,β receptor (IFNAR)-mediated pathway of IFN-α production by pDC. However, at high pDC density infection with RSV causes IFN-α production without the need for a second party cell. Our study shows that cellular context and immune status are factors affecting innate immune responses to RSV. These issues should therefore be addressed during the process of vaccine development and other interventions for RSV disease. PMID:24303065

  2. Simultaneous Subcutaneous and Intranasal Administration of a CAF01-Adjuvanted Chlamydia Vaccine Elicits Elevated IgA and Protective Th1/Th17 Responses in the Genital Tract

    PubMed Central

    Wern, Jeanette Erbo; Sorensen, Maria Rathmann; Olsen, Anja Weinreich; Andersen, Peter; Follmann, Frank

    2017-01-01

    The selection of any specific immunization route is critical when defining future vaccine strategies against a genital infection like Chlamydia trachomatis (C.t.). An optimal Chlamydia vaccine needs to elicit mucosal immunity comprising both neutralizing IgA/IgG antibodies and strong Th1/Th17 responses. A strategic tool to modulate this immune profile and mucosal localization of vaccine responses is to combine parenteral and mucosal immunizations routes. In this study, we investigate whether this strategy can be adapted into a two-visit strategy by simultaneous subcutaneous (SC) and nasal immunization. Using a subunit vaccine composed of C.t. antigens (Ags) adjuvanted with CAF01, a Th1/Th17 promoting adjuvant, we comparatively evaluated Ag-specific B and T cell responses and efficacy in mice following SC and simultaneous SC and nasal immunization (SIM). We found similar peripheral responses with regard to interferon gamma and IL-17 producing Ag-specific splenocytes and IgG serum levels in both vaccine strategies but in addition, the SIM protocol also led to Ag-specific IgA responses and increased B and CD4+ T cells in the lung parenchyma, and in lower numbers also in the genital tract (GT). Following vaginal infection with C.t., we observed that SIM immunization gave rise to an early IgA response and IgA-secreting plasma cells in the GT in contrast to SC immunization, but we were not able to detect more rapid recruitment of mucosal T cells. Interestingly, although SIM vaccination in general improved mucosal immunity we observed no improved efficacy against genital infection compared to SC, a finding that warrants for further investigation. In conclusion, we demonstrate a novel vaccination strategy that combines systemic and mucosal immunity in a two-visit strategy. PMID:28567043

  3. IL-17 is not essential for inflammation and chronic pelvic pain development in an experimental model of chronic prostatitis/chronic pelvic pain syndrome.

    PubMed

    Motrich, Ruben D; Breser, María L; Sánchez, Leonardo R; Godoy, Gloria J; Prinz, Immo; Rivero, Virginia E

    2016-03-01

    Pain and inflammation in the absence of infection are hallmarks in chronic prostatitis and chronic pelvic pain syndrome (CP/CPPS) patients. The etiology of CP/CPPS is unclear, and autoimmunity has been proposed as a cause. Experimental autoimmune prostatitis (EAP) models have long been used for studying CP/CPPS. Herein, we studied prostate inflammation induction and chronic pelvic pain development in EAP using IL-12p40-KO, IL-4-KO, IL-17-KO, and wild-type (C57BL/6) mice. Prostate antigen (PAg) immunization in C57BL/6 mice induced specific Th1 and Th17 immune responses and severe prostate inflammation and cell infiltration, mainly composed of CD4 T cells and macrophages. Moreover, chronic pelvic pain was evidenced by increased allodynia responses. In immunized IL-17-KO mice, the presence of a prominent PAg-specific Th1 immune response caused similar prostate inflammation and chronic pelvic pain. Furthermore, markedly high PAg-specific Th1 immune responses, exacerbated prostate inflammation, and chronic pelvic pain were detected in immunized IL-4-KO mice. Conversely, immunized IL-12p40-KO mice developed PAg-specific Th2 immune responses, characterized by high IL-4 secretion and neither infiltration nor damage in the prostate. As observed in wild-type control animals, IL12p40-KO mice did not evidence tactile allodynia responses. Our results suggest that, as in patients, chronic pelvic pain is a consequence of prostate inflammation. After PAg immunization, a Th1-associated immune response develops and induces prostate inflammation and chronic pelvic pain. The absence of Th1 or Th2 cytokines, respectively, diminishes or enhances EAP susceptibility. In addition, IL-17 showed not to be essential for pathology induction and chronic pelvic pain development.

  4. Application of pH-sensitive fusogenic polymer-modified liposomes for development of mucosal vaccines.

    PubMed

    Watarai, Shinobu; Iwase, Tana; Tajima, Tomoko; Yuba, Eiji; Kono, Kenji; Sekiya, Yukio

    2014-03-15

    To evaluate the usefulness of pH-sensitive fusogenic polymer (succinylated poly(glycidol) (SucPG) and 3-methylglutarylated poly(glycidol) (MGluPG))-modified liposomes as mucosal vaccine in the induction of a protective immune responses was evaluated. Mice were nasally immunized with OVA-containing SucPG-modified liposomes. After immunization, significant Ag-specific Abs were detected in the serum and intestine. When sera were analyzed for isotype distribution, antigen-specific IgG1 Ab responses were noted in mice immunized with OVA-containing polymer-unmodified liposomes, whereas immunization with OVA-containing SucPG-modified liposomes resulted in the induction of OVA-specific IgG1, IgG2a and IgG3 Ab responses. In spleen lymphocytes from mice immunized with OVA-containing SucPG-modified liposomes, both IFN-γ and IL-4 mRNA were detected. The same result was obtained also in the mouse immunized with OVA-containing MGluPG-modified liposomes. Furthermore, we examined the induction of immune responses in chickens following intraocular immunization with Salmonella Enteritidis Ag-containing MGluPG-modified liposomes, and the protective effect against the challenge with S. Enteritidis. Immunization with S. Enteritidis Ag-containing MGluPG-modified liposomes induced significant Ab responses against S. Enteritidis in the serum and intestine. Less fecal excretion of bacteria was observed in chickens immunized with S. Enteritidis Ag-containing MGluPG-modified liposomes after challenge. The numbers of bacteria in the caecum were also lower in immunized chickens than in unimmunized controls. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes

    PubMed Central

    Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.

    2011-01-01

    Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430

  6. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  7. Poly-functional and long-lasting anticancer immune response elicited by a safe attenuated Pseudomonas aeruginosa vector for antigens delivery

    PubMed Central

    Chauchet, Xavier; Hannani, Dalil; Djebali, Sophia; Laurin, David; Polack, Benoit; Marvel, Jacqueline; Buffat, Laurent; Toussaint, Bertrand; Le Gouëllec, Audrey

    2016-01-01

    Live-attenuated bacterial vectors for antigens delivery have aroused growing interest in the field of cancer immunotherapy. Their potency to stimulate innate immunity and to promote intracellular antigen delivery into antigen-presenting cells could be exploited to elicit a strong and specific cellular immune response against tumor cells. We previously described genetically-modified and attenuated Pseudomonas aeruginosa vectors able to deliver in vivo protein antigens into antigen-presenting cells, through Type 3 secretion system of the bacteria. Using this approach, we managed to protect immunized mice against aggressive B16 melanoma development in both a prophylactic and therapeutic setting. In this study, we further investigated the antigen-specific CD8+ T cell response, in terms of phenotypic and functional aspects, obtained after immunizations with a killed but metabolically active P. aeruginosa attenuated vector. We demonstrated that P. aeruginosa vaccine induces a highly functional pool of antigen-specific CD8+ T cell able to infiltrate the tumor. Furthermore, multiple immunizations allowed the development of a long-lasting immune response, represented by a pool of predominantly effector memory cells which protected mice against late tumor challenge. Overall, killed but metabolically active P. aeruginosa vector is a safe and promising approach for active and specific antitumor immunotherapy. PMID:28035332

  8. Involvement of CD8+ T cell-mediated immune responses in LcrV DNA vaccine induced protection against lethal Yersinia pestis challenge.

    PubMed

    Wang, Shixia; Goguen, Jon D; Li, Fusheng; Lu, Shan

    2011-09-09

    Yersinia pestis (Y. pestis) is the causative pathogen of plague, a highly fatal disease for which an effective vaccine, especially against mucosal transmission, is still not available. Like many bacterial infections, antigen-specific antibody responses have been traditionally considered critical, if not solely responsible, for vaccine-induced protection against Y. pestis. Studies in recent years have suggested the importance of T cell immune responses against Y. pestis infection but information is still limited about the details of Y. pestis antigen-specific T cell immune responses. In current report, studies are conducted to identify the presence of CD8+ T cell epitopes in LcrV protein, the leading antigen of plague vaccine development. Furthermore, depletion of CD8+ T cells in LcrV DNA vaccinated Balb/C mice led to reduced protection against lethal intranasal challenge of Y. pestis. These findings establish that an LcrV DNA vaccine is able to elicit CD8+ T cell immune responses against specific epitopes of this key plague antigen and that a CD8+ T cell immune response is involved in LcrV DNA vaccine-elicited protection. Future studies in plague vaccine development will need to examine if the presence of detectable T cell immune responses, in particular CD8+ T-cell immune responses, will enhance the protection against Y. pestis in higher animal species or humans. Copyright © 2010 Elsevier Ltd. All rights reserved.

  9. Evaluation of humoral, mucosal, and cellular immune responses following co-immunization of HIV-1 Gag and Env proteins expressed by Newcastle disease virus

    PubMed Central

    Khattar, Sunil K; Palaniyandi, Senthilkumar; Samal, Sweety; LaBranche, Celia C; Montefiori, David C; Zhu, Xiaoping; Samal, Siba K

    2015-01-01

    The combination of multiple HIV antigens in a vaccine can broaden antiviral immune responses. In this study, we used NDV vaccine strain LaSota to generate rNDV (rLaSota/optGag) expressing human codon optimized p55 Gag protein of HIV-1. We examined the effect of co-immunization of rLaSota/optGag with rNDVs expressing different forms of Env protein gp160, gp120, gp140L [a version of gp140 that lacked cytoplasmic tail and contained complete membrane-proximal external region (MPER)] and gp140S (a version of gp140 that lacked cytoplasmic tail and distal half of MPER) on magnitude and breadth of humoral, mucosal and cellular immune responses in guinea pigs and mice. Our results showed that inclusion of rLaSota/optGag with rNDVs expressing different forms of Env HIV Gag did not affect the Env-specific humoral and mucosal immune responses in guinea pigs and that the potent immune responses generated against Env persisted for at least 13 weeks post immunization. The highest Env-specific humoral and mucosal immune responses were observed with gp140S+optGag group. The neutralizing antibody responses against HIV strains BaL.26 and MN.3 induced by gp140S+optGag and gp160+optGag were higher than those elicited by other groups. Inclusion of Gag with gp160, gp140S and gp140L enhanced the level of Env-specific IFN-γ-producing CD8+ T cells in mice. Inclusion of Gag with gp160 and gp140L also resulted in increased Env-specific CD4+ T cells. The level of Gag-specific CD8+ and CD4+ T cells was also enhanced in mice immunized with Gag along with gp140S and gp120. These results indicate lack of antigen interference in a vaccine containing rNDVs expressing Env and Gag proteins. PMID:25695657

  10. Priming T-cell responses with recombinant measles vaccine vector in a heterologous prime-boost setting in non-human primates.

    PubMed

    Bolton, Diane L; Santra, Sampa; Swett-Tapia, Cindy; Custers, Jerome; Song, Kaimei; Balachandran, Harikrishnan; Mach, Linh; Naim, Hussein; Kozlowski, Pamela A; Lifton, Michelle; Goudsmit, Jaap; Letvin, Norman; Roederer, Mario; Radošević, Katarina

    2012-09-07

    Licensed live attenuated virus vaccines capable of expressing transgenes from other pathogens have the potential to reduce the number of childhood immunizations by eliciting robust immunity to multiple pathogens simultaneously. Recombinant attenuated measles virus (rMV) derived from the Edmonston Zagreb vaccine strain was engineered to express simian immunodeficiency virus (SIV) Gag protein for the purpose of evaluating the immunogenicity of rMV as a vaccine vector in rhesus macaques. rMV-Gag immunization alone elicited robust measles-specific humoral and cellular responses, but failed to elicit transgene (Gag)-specific immune responses, following aerosol or intratracheal/intramuscular delivery. However, when administered as a priming vaccine to a heterologous boost with recombinant adenovirus serotype 5 expressing the same transgene, rMV-Gag significantly enhanced Gag-specific T lymphocyte responses following rAd5 immunization. Gag-specific humoral responses were not enhanced, however, which may be due to either the transgene or the vector. Cellular response priming by rMV against the transgene was highly effective even when using a suboptimal dose of rAd5 for the boost. These data demonstrate feasibility of using rMV as a priming component of heterologous prime-boost vaccine regimens for pathogens requiring strong cellular responses. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Alternative Effector-Function Profiling Identifies Broad HIV-Specific T-Cell Responses in Highly HIV-Exposed Individuals Who Remain Uninfected

    PubMed Central

    Ruiz-Riol, Marta; Llano, Anuska; Ibarrondo, Javier; Zamarreño, Jennifer; Yusim, Karina; Bach, Vanessa; Mothe, Beatriz; Perez-Alvarez, Susana; Fernandez, Marco A.; Requena, Gerard; Meulbroek, Michael; Pujol, Ferran; Leon, Agathe; Cobarsi, Patricia; Korber, Bette T.; Clotet, Bonaventura; Ganoza, Carmela; Sanchez, Jorge; Coll, Josep; Brander, Christian

    2015-01-01

    The characterization of host immune responses to human immunodeficiency virus (HIV) in HIV controllers and individuals with high exposure but seronegativity to HIV (HESN) is needed to guide the development of effective preventive and therapeutic vaccine candidates. However, several technical hurdles severely limit the definition of an effective virus-specific T-cell response. By using a toggle-peptide approach, which takes HIV sequence diversity into account, and a novel, boosted cytokine staining/flow cytometry strategy, we here describe new patterns of T-cell responses to HIV that would be missed by standard assays. Importantly, this approach also allows detection of broad and strong virus-specific T-cell responses in HESN individuals that are characterized by a T-helper type 1 cytokine–like effector profile and produce cytokines that have been associated with potential control of HIV infection, including interleukin 10, interleukin 13, and interleukin 22. These results establish a novel approach to improve the current understanding of HIV-specific T-cell immunity and identify cellular immune responses and individual cytokines as potential markers of relative HIV resistance. As such, the findings also help develop similar strategies for more-comprehensive assessments of host immune responses to other human infections and immune-mediated disorders. PMID:25249264

  12. Administration of sulfosuccinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate conjugated GP100{sub 25–33} peptide-coupled spleen cells effectively mounts antigen-specific immune response against mouse melanoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Xiaoli; Xia, Chang-Qing, E-mail: cqx65@yahoo.com; Department of Pathology, Immunology and Laboratory Medicine, University of Florida, Gainesville, FL32610

    It remains a top research priority to develop immunotherapeutic approaches to induce potent antigen-specific immune responses against tumors. However, in spite of some promising results, most strategies are ineffective because they generate low numbers of tumor-reactive cytotoxic T lymphocytes (CTLs). Here we designed a strategy to enhance antigen-specific immune response via administering sulfosuccinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC)-conjugated melanoma tumor antigen GP100{sub 25–33} peptide-coupled syngeneic spleen cells in a mouse model of melanoma. We found that infusion of GP100{sub 25–33} peptide-coupled spleen cells significantly attenuated the growth of melanoma in prophylactic and therapeutic immunizations. Consistent with these findings, the adoptive transfer of spleenmore » cells from immunized mice to naïve syngeneic mice was able to transfer anti-tumor effect, suggesting that GP100{sub 25–33} peptide-specific immune response was induced. Further studies showed that, CD8+ T cell proliferation and the frequency of interferon (IFN)-γ-producing CD8+ T cells upon ex vivo stimulation by GP100{sub 25–33} were significantly increased compared to control groups. Tumor antigen, GP100{sub 25–23} specific immune response was also confirmed by ELISpot and GP100-tetramer assays. This approach is simple, easy-handled, and efficiently delivering antigens to lymphoid tissues. Our study offers an opportunity for clinically translating this approach into tumor immunotherapy. - Highlights: • Infusion of GP100{sub 25–33}-coupled spleen cells leads to potent anti-melanoma immunity. • GP100{sub 25–33}-coupled spleen cell treatment induces antigen-specific IFN-γ-producing CD8 T cells. • This approach takes advantage of homing nature of immune cells.« less

  13. Demonstration of the salmonid humoral response to Renibacterium salmoninarum using a monoclonal antibody against salmonid immunoglobulin

    USGS Publications Warehouse

    Bartholomew, J.L.; Arkoosh , M.R.; Rohovec, J.S.

    1991-01-01

    The specificity of the antibody response of salmonids to Renibacterium salmoninarum antigens was demonstrated by western blotting techniques that utilized a monoclonal antibody against salmonid immunoglobulin. In this study, the specificity of the response in immunized chinook salmon Oncorhynchus tshawytschawas compared with the response in naturally infected chinook salmon and coho salmon O. kisutch, and immunized rabbits. The antibody response in immunized salmon and rabbits and the naturally infected fish was primarily against the 57–58kilodalton protein complex. In addition to recognizing these proteins in the extracellular fraction and whole-cell preparations, antibody from the immunized salmon and rabbits detected four proteins with lower molecular masses. Western blotting techniques allow identification of the specific antigens recognized and are a useful tool for comparing the immunogenicity of different R. salmoninarumpreparations. Immunofluorescent techniques with whole bacteria were less sensitive than western blotting in detecting salmonid anti-R. salmoninarumantibody.

  14. Manipulating the antigen-specific immune response by the hydrophobicity of amphiphilic poly(γ-glutamic acid) nanoparticles.

    PubMed

    Shima, Fumiaki; Akagi, Takami; Uto, Tomofumi; Akashi, Mitsuru

    2013-12-01

    The new generation vaccines are safe but poorly immunogenic, and thus they require the use of adjuvants. However, conventional vaccine adjuvants fail to induce potent cellular immunity, and their toxicity and side-effects hinder the clinical use. Therefore, a vaccine adjuvant which is safe and can induce an antigen-specific cellular immunity-biased immune response is urgently required. In the development of nanoparticle-based vaccine adjuvants, the hydrophobicity is one of the most important factors. It could control the interaction between the encapsulated antigens and/or nanoparticles with immune cells. In this study, nanoparticles (NPs) composed of amphiphilic poly(γ-glutamic acid)-graft-L-phenylalanine ethyl ester (γ-PGA-Phe) with various grafting degrees of hydrophobic side chains were prepared to evaluate the effect of hydrophobicity of vaccine carriers on the antigen encapsulation behavior, cellular uptake, activation of dendritic cells (DCs), and induction of antigen-specific cellular immunity-biased immune responses. These NPs could efficiently encapsulate antigens, and the uptake amount of the encapsulated antigen by DCs was dependent on the hydrophobicity of γ-PGA-Phe NPs. Moreover, the activation potential of the DCs and the induction of antigen-specific cellular immunity were correlated with the hydrophobicity of γ-PGA-Phe NPs. By controlling the hydrophobicity of antigen-encapsulated γ-PGA-Phe NPs, the activation potential of DCs was able to manipulate about 5 to 30-hold than the conventional vaccine, and the cellular immunity was about 10 to 40-hold. These results suggest that the hydrophobicity of NPs is a key factor for changing the interaction between NPs and immune cells, and thus the induction of cellular immunity-biased immune response could be achieved by controlling the hydrophobicity of them. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. DNA and protein co-immunization improves the magnitude and longevity of humoral immune responses in macaques.

    PubMed

    Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K

    2014-01-01

    We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.

  16. Dendritic cells pulsed with a tumor-specific peptide induce long-lasting immunity and are effective against murine intracerebral melanoma.

    PubMed

    Heimberger, Amy B; Archer, Gary E; Crotty, Laura E; McLendon, Roger E; Friedman, Allan H; Friedman, Henry S; Bigner, Darell D; Sampson, John H

    2002-01-01

    Dendritic cells (DCs) are specialized cells of the immune system that are capable of generating potent immune responses that are active even within the "immunologically privileged" central nervous system. However, immune responses generated by DCs have also been demonstrated to produce clinically significant autoimmunity. Targeting the epidermal growth factor receptor variant III (EGFRvIII), which is a mutation specific to tumor tissue, could eliminate this risk. The purpose of this study was to demonstrate that DC-based immunizations directed solely against this tumor-specific antigen, which is commonly found on tumors that originate within or metastasize to the brain, could be efficacious. C3H mice were vaccinated with DCs mixed with a keyhole limpet hemocyanin conjugate of the tumor-specific peptide, PEP-3, which spans the EGFRvIII mutation, or the random-sequence peptide, PEP-1, and were intracerebrally challenged with a syngeneic melanoma expressing a murine homologue of EGFRvIII. Systemic immunization with DCs mixed with PEP-3-keyhole limpet hemocyanin generated antigen-specific immunity. Among mice challenged with intracerebral tumors, this resulted in an approximately 600% increase in the median survival time (>300 d, P < 0.0016), relative to control values. Sixty-three percent of mice treated with DCs mixed with the tumor-specific peptide survived in the long term and 100% survived rechallenge with tumor, indicating that antitumor immunological memory was also induced. In a murine melanoma model, immunization with DCs mixed with tumor-specific peptide results in an antigen-specific immunological response that recognizes the EGFRvIII mutation, has potent antitumor efficacy against intracerebral tumors that express EGFRvIII, and results in long-lasting antitumor immunity.

  17. Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.

    PubMed

    Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna

    2017-12-11

    Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.

  18. Specific T cell induction using iron oxide based nanoparticles as subunit vaccine adjuvant.

    PubMed

    Neto, Lázaro Moreira Marques; Zufelato, Nicholas; de Sousa-Júnior, Ailton Antônio; Trentini, Monalisa Martins; da Costa, Adeliane Castro; Bakuzis, Andris Figueiroa; Kipnis, André; JunqueiraKipnis, Ana Paula

    2018-06-18

    Metal-based nanoparticles (NPs) stimulate innate immunity; however, they have never been demonstrated to be capable of aiding the generation of specific cellular immune responses. Therefore, our objective was to evaluate whether iron oxide-based NPs have adjuvant properties in generating cellular Th1, Th17 and TCD8 (Tc1) immune responses. For this purpose, a fusion protein (CMX) composed of Mycobacterium tuberculosis antigens was used as a subunit vaccine. Citrate-coated MnFe 2 O 4 NPs were synthesized by co-precipitation and evaluated by transmission electron microscopy. The vaccine was formulated by homogenizing NPs with the recombinant protein, and protein corona formation was determined by dynamic light scattering and field-emission scanning electron microscopy. The vaccine was evaluated for the best immunization route and strategy using subcutaneous and intranasal routes with 21-day intervals between immunizations. When administered subcutaneously, the vaccine generated specific CD4 + IFN-γ + (Th1) and CD8 + IFN-γ + responses. Intranasal vaccination induced specific Th1, Th17 (CD4 + IL-17 + ) and Tc1 responses, mainly in the lungs. Finally, a mixed vaccination strategy (2 subcutaneous injections followed by one intranasal vaccination) induced a Th1 (in the spleen and lungs) and splenic Tc1 response but was not capable of inducing a Th17 response in the lungs. This study shows for the first time a subunit vaccine with iron oxide based NPs as an adjuvant that generated cellular immune responses (Th1, Th17 and TCD8), thereby exhibiting good adjuvant qualities. Additionally, the immune response generated by the subcutaneous administration of the vaccine diminished the bacterial load of Mtb challenged animals, showing the potential for further improvement as a vaccine against tuberculosis.

  19. Encapsulating Immunostimulatory CpG Oligonucleotides in Listeriolysin O-Liposomes Promotes a Th1-Type Response and CTL Activity

    PubMed Central

    Andrews, Chasity D.; Huh, Myung-Sook; Patton, Kathryn; Higgins, Debbie; Van Nest, Gary; Ott, Gary; Lee, Kyung-Dall

    2013-01-01

    Immunostimulatory sequences (ISS) are short DNA sequences containing unmethylated CpG dimers that have multiple effects on the host immune system, including the ability to stimulate antigen-specific cytotoxic T lymphocytes (CTLs) and drive Th1-type immune responses. Listeriolysin O (LLO)-containing pH-sensitive liposomes have been shown to efficiently deliver macromolecules to the cytosol of APCs and efficiently stimulate CTLs. We hypothesized that encapsulating ISS-oligodeoxyribonucleotides (ODNs) in this delivery system would enhance the cell-mediated immune response and skew Th1-type responses in protein antigen-based vaccination utilizing LLO-liposomes. In vitro studies indicated that co-encapsulation of ISS in LLO-liposomes engendered activation of the NF-κB pathway while maintaining the efficient cytosolic delivery of antigen mediated by the co-encapsulated LLO. Antigen-specific CTL responses monitored by using the model antigen ovalbumin (OVA) in mice were enhanced when mice were immunized with OVA and ISS-ODN-containing LLO-liposomes compared with those immunized with either OVA-containing LLO-liposomes or OVA-ISS conjugates. The enhanced immune responses were of the Th1-type as monitored by the robust OVA-specific IgG2a induction and the OVA CD8 peptide-stimulated IFN-γ secretion. Our study suggests that including ISS-ODN in LLO-containing pH-sensitive liposomes yields a vaccine delivery system that enhances the cell-mediated immune response and skews this response toward the Th1-type. PMID:22376145

  20. Changes in T Cell and Dendritic Cell Phenotype from Mid to Late Pregnancy Are Indicative of a Shift from Immune Tolerance to Immune Activation

    PubMed Central

    Shah, Nishel Mohan; Herasimtschuk, Anna A.; Boasso, Adriano; Benlahrech, Adel; Fuchs, Dietmar; Imami, Nesrina; Johnson, Mark R.

    2017-01-01

    During pregnancy, the mother allows the immunologically distinct fetoplacental unit to develop and grow. Opinions are divided as to whether this represents a state of fetal-specific tolerance or of a generalized suppression of the maternal immune system. We hypothesized that antigen-specific T cell responses are modulated by an inhibitory T cell phenotype and modified dendritic cell (DC) phenotype in a gestation-dependent manner. We analyzed changes in surface markers of peripheral blood T cells, ex vivo antigen-specific T cell responses, indoleamine 2,3-dioxygenase (IDO) activity (kynurenine/tryptophan ratio, KTR), plasma neopterin concentration, and the in vitro expression of progesterone-induced blocking factor (PIBF) in response to peripheral blood mononuclear cell culture with progesterone. We found that mid gestation is characterized by reduced antigen-specific T cell responses associated with (1) predominance of effector memory over other T cell subsets; (2) upregulation of inhibitory markers (programmed death ligand 1); (3) heightened response to progesterone (PIBF); and (4) reduced proportions of myeloid DC and concurrent IDO activity (KTR). Conversely, antigen-specific T cell responses normalized in late pregnancy and were associated with increased markers of T cell activation (CD38, neopterin). However, these changes occur with a simultaneous upregulation of immune suppressive mechanisms including apoptosis (CD95), coinhibition (TIM-3), and immune regulation (IL-10) through the course of pregnancy. Together, our data suggest that immune tolerance dominates in the second trimester and that it is gradually reversed in the third trimester in association with immune activation as the end of pregnancy approaches. PMID:28966619

  1. Specific immune response genes of the guinea pig. II. Relationship between the poly-L-lysine gene and the genes controlling immune responsiveness to copolymers of L-glutamic acid and L-alanine and L-glutamic acid and L-tyrosine in random-bred Hartley guinea pigs.

    PubMed

    Bluestein, H G; Green, I; Benacerraf, B

    1971-08-01

    The ability of guinea pigs to make immune responses to GA, a linear random copolymer of L-glutamic acid and L-alanine, GT, a random linear copolymer of L-glutamic acid and L-tyrosine, and PLL, a linear homopolymer of L-lysine, is controlled by different autosomal dominant genes specific for each of those polymers. We have investigated the relationship between the PLL gene and the GA and GT immune response genes by simultaneously immunizing random-bred Hartley strain guinea pigs with GA and PLL, GT and PLL, or GA and GT. In most Hartley guinea pigs the ability to respond immunologically to GA and to PLL is inherited together; that is, most animals responding to GA respond to PLL and vice versa. However, a few animals respond to either GA or to PLL but not both, demonstrating that the GA and PLL immune response genes are not identical but linked in most Hartley animals. Conversely, when simultaneously immunized with GT and PLL, most Hartley guinea pigs respond to either PLL or GT but not both, indicating that GT and PLL responsiveness tends to segregate away from each other. Thus, the GT and PLL immune response genes also are not inherited independently but, rather, behave as alleles or pseudoalleles. Similar results are observed when Hartley guinea pigs are simultaneously immunized with GA and GT. The ability to respond to GA segregates away from the ability to respond to GT. Our studies demonstrated that the specific immune response genes thus far identified in guinea pigs controlling the ability to respond to GA, GT, and PLL, respectively, are found on the same chromosome. In most Hartley animals, the GA and PLL immune response genes are often linked, i.e. occur on the same chromosome strand, and tend to behave as alleles or pseudoalleles to the GT immune response gene.

  2. Sex-specific consequences of an induced immune response on reproduction in a moth.

    PubMed

    Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T

    2015-12-16

    Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.

  3. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  4. Applications of nanomaterials as vaccine adjuvants

    PubMed Central

    Zhu, Motao; Wang, Rongfu; Nie, Guangjun

    2014-01-01

    Vaccine adjuvants are applied to amplify the recipient's specific immune responses against pathogen infection or malignancy. A new generation of adjuvants is being developed to meet the demands for more potent antigen-specific responses, specific types of immune responses, and a high margin of safety. Nanotechnology provides a multifunctional stage for the integration of desired adjuvant activities performed by the building blocks of tailor-designed nanoparticles. Using nanomaterials for antigen delivery can provide high bioavailability, sustained and controlled release profiles, and targeting and imaging properties resulting from manipulation of the nanomaterials’ physicochemical properties. Moreover, the inherent immune-regulating activity of particular nanomaterials can further promote and shape the cellular and humoral immune responses toward desired types. The combination of both the delivery function and immunomodulatory effect of nanomaterials as adjuvants is thought to largely benefit the immune outcomes of vaccination. In this review, we will address the current achievements of nanotechnology in the development of novel adjuvants. The potential mechanisms by which nanomaterials impact the immune responses to a vaccine and how physicochemical properties, including size, surface charge and surface modification, impact their resulting immunological outcomes will be discussed. This review aims to provide concentrated information to promote new insights for the development of novel vaccine adjuvants. PMID:25483497

  5. The cellular immune response of Daphnia magna under host-parasite genetic variation and variation in initial dose

    PubMed Central

    Auld, Stuart K. J. R; Edel, Kai H.; Little, Tom J.

    2013-01-01

    In invertebrate-parasite systems, the likelihood of infection following parasite exposure is often dependent on the specific combination of host and parasite genotypes (termed genetic specificity). Genetic specificity can maintain diversity in host and parasite populations and is a major component of the Red Queen hypothesis. However, invertebrate immune systems are thought to only distinguish between broad classes of parasite. Using a natural host-parasite system with a well-established pattern of genetic specificity, the crustacean Daphnia magna and its bacterial parasite Pasteuria ramosa, we found that only hosts from susceptible host-parasite genetic combinations mounted a cellular response following exposure to the parasite. These data are compatible with the hypothesis that genetic specificity is attributable to barrier defenses at the site of infection (the gut), and that the systemic immune response is general, reporting the number of parasite spores entering the hemocoel. Further supporting this, we found that larger cellular responses occurred at higher initial parasite doses. By studying the natural infection route, where parasites must pass barrier defenses before interacting with systemic immune responses, these data shed light on which components of invertebrate defense underlie genetic specificity. PMID:23025616

  6. [Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

    PubMed

    Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

    2010-12-01

    The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

  7. Gelatin-specific humoral and cellular immune responses in children with immediate- and nonimmediate-type reactions to live measles, mumps, rubella, and varicella vaccines.

    PubMed

    Kumagai, T; Yamanaka, T; Wataya, Y; Umetsu, A; Kawamura, N; Ikeda, K; Furukawa, H; Kimura, K; Chiba, S; Saito, S; Sugawara, N; Kurimoto, F; Sakaguchi, M; Inouye, S

    1997-07-01

    This study was designed to investigate the development of both cellular and humoral immune responses to gelatin in patients with vaccine-related immediate and nonimmediate reactions. Our purpose was to define the nature of the responses in the different clinical states. Six patients with immediate reactions and 21 patients with nonimmediate reactions after inoculation of various live vaccines were studied. Measurement of gelatin-specific IgE was performed in all subjects. Gelatin-specific T-cell responses detected by an in vitro lymphocyte proliferation assay and by an assay for IL-2 responsiveness were investigated to compare the immune response in patients with the two types of reaction. All six patients with immediate reactions had IgE responses to gelatin, whereas none of the 21 patients with nonimmediate reactions had any anti-gelatin IgE. All of the six patients with immediate reactions and 17 of the 21 patients with nonimmediate reactions exhibited positive T-lymphocyte responses specific to gelatin. Immediate and nonimmediate reactions are caused by different types of allergy to gelatin, and cell-mediated immunity to gelatin may play an important role in the pathogenesis of nonimmediate reactions.

  8. Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response.

    PubMed

    Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E

    2000-04-01

    Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yusuf, Nabiha; Skin Diseases Research Center, University of Alabama at Birmingham, 1530 Third Avenue South, Birmingham, AL 35294-0009; Timares, Laura

    Polyaromatic hydrocarbons are ubiquitous environmental pollutants that are potent mutagens and carcinogens. Researchers have taken advantage of these properties to investigate the mechanisms by which chemicals cause cancer of the skin and other organs. When applied to the skin of mice, several carcinogenic polyaromatic hydrocarbons have also been shown to interact with the immune system, stimulating immune responses and resulting in the development of antigen-specific T-cell-mediated immunity. Development of cell-mediated immunity is strain-specific and is governed by Ah receptor genes and by genes located within the major histocompatibility complex. CD8{sup +} T cells are effector cells in the response, whereasmore » CD4{sup +} T cells down-regulate immunity. Development of an immune response appears to have a protective effect since strains of mice that develop a cell-mediated immune response to carcinogenic polyaromatic hydrocarbons are less likely to develop tumors when subjected to a polyaromatic hydrocarbon skin carcinogenesis protocol than mice that fail to develop an immune response. With respect to innate immunity, TLR4-deficient C3H/HeJ mice are more susceptible to polyaromatic hydrogen skin tumorigenesis than C3H/HeN mice in which TLR4 is normal. These findings support the hypothesis that immune responses, through their interactions with chemical carcinogens, play an active role in the prevention of chemical skin carcinogenesis during the earliest stages. Efforts to augment immune responses to the chemicals that cause tumors may be a productive approach to the prevention of tumors caused by these agents.« less

  10. Primary response against cytomegalovirus during antiviral prophylaxis with valganciclovir, in solid organ transplant recipients

    PubMed Central

    La Rosa, Corinna; Limaye, Ajit P.; Krishnan, Aparna; Blumstein, Gideon; Longmate, Jeff; Diamond, Don J.

    2012-01-01

    Antiviral prophylaxis has proved successful for prevention of cytomegalovirus (CMV) disease in solid organ transplant (SOT) patients; though emerging data suggest that antiviral agents interfere with immunity, and may inhibit immune-priming. In this context, we investigated levels and phenotype of primary CMV-specific immune responses that developed during antiviral prophylaxis in a cohort of CMV seronegative recipients (R−) of a SOT from a seropositive donor (D+). We longitudinally monitored CMV viral load, antibodies and levels of the negative immuno-modulator IL-10. PBMC were stimulated with CMV-specific peptide libraries to measure CD137 activation marker on CMV-specific T-cells and levels of PD-1 receptor, which is overexpressed on exhausted T-cells. Unexpectedly, the majority (13/18) of D+R− patients who developed a primary CMV response showed early post-transplant CMV-specific responses, though levels of PD-1 on CMV-specific T-cells remained elevated throughout prophylaxis. A strong inverse association was found between levels of plasma IL-10 and CMV-specific cellular immune responses. Our study suggests that during prophylaxis, subclinical CMV infection might have occurred in the D+R− patients, and primary CMV-specific responses were detected early post-transplant when levels of plasma IL-10 were low. Extended prophylaxis or antiviral treatment did not appear to suppress CMV-specific antibodies or T-cells, which however showed exhaustion phenotypes. PMID:21672050

  11. Extract of medicinal mushroom Agaricus blazei Murill enhances the non-specific and adaptive immune activities in BALB/c mice.

    PubMed

    Ni, Wei-Ya; Wu, Ming-Fanf; Liao, Nien-Chieh; Yeh, Ming-Yang; Lu, Hsu-Feng; Hsueh, Shu-Ching; Liu, Jia-You; Huang, Yi-Ping; Chang, Chuan-Hsun; Chung, Jing-Gung

    2013-01-01

    Agaricus blazei Murill (AbM) is traditionally used against a wide range of conditions such as ulcerative colitis, Crohn's disease, foot-and-mouth disease and chronic hepatitis C infection. In this study, we evaluated the immunomodulatory effects of AbM. For the non-specific immune response experiments, a total of 40 female BALB/c mice were divided into control (group 1) and experimental (groups 2-4) groups of 10 animals each. Groups 2, 3 and 4 were orally-administered high (819 mg/kg), medium (273 mg/kg) and low (136.5 mg/kg) doses of AbM daily for six weeks and then six parameters related to non-specific immune response were detected. For the adaptive immune response experiments, 40 female mice were similarly divided into four groups. After six weeks of treatment, animals were immunized with the OVA immunogen. Two weeks later, splenocytes and sera were collected. Four parameters related to adaptive immune response were evaluated. We found that feeding mice with AbM extract increased the IgG level in serum, promoted phagocytosis of peritoneal macrophages and elevated the activity of Natural killer cells. We also found that the highest dose of AbM increased interleukin-2 (IL-2) levels in splenocytes and that a medium dose increased interferon-γ. The levels of interleukin-4 (IL-4) were reduced or unchanged. T-helper type 1 cytokine levels were increased. AbM increased the humoral immune response and also affected the cellular immune response. These results provide evidence that AbM can modulate innate and adaptive immunity.

  12. Immunity to betanodavirus infections of marine fish.

    PubMed

    Chen, Young-Mao; Wang, Ting-Yu; Chen, Tzong-Yueh

    2014-04-01

    Betanodaviruses cause viral nervous necrosis in numerous fish species, but some species are resistant to infection by these viruses. It is essential to fully characterize the immune responses that underlie this protective response. Complete characterization of the immune responses against nodaviruses may allow the development of methods that stimulate fish immunity and of an effective betanodavirus vaccine. Such strategies could include stimulation of specific immune system responses or blockage of factors that decrease the immune response. The innate immune system clearly provides a front-line defense, and this includes the production of interferons and other cytokines. Interferons that are released inside infected cells and that suppress viral replication may be the most ancient form of innate immunity. This review focuses on the immune responses of fish to betanodavirus infection. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Influence of a cocoa-enriched diet on specific immune response in ovalbumin-sensitized rats.

    PubMed

    Pérez-Berezo, Teresa; Ramiro-Puig, Emma; Pérez-Cano, Francisco J; Castellote, Cristina; Permanyer, Joan; Franch, Angels; Castell, Margarida

    2009-03-01

    Previous studies in young rats have reported the impact of 3 weeks of high cocoa intake on healthy immune status. The present article describes the effects of a longer-term cocoa-enriched diet (9 weeks) on the specific immune response to ovalbumin (OVA) in adult Wistar rats. At 4 weeks after immunization, control rats produced anti-OVA antibodies, which, according their amount and isotype, were arranged as follows: IgG1 > IgG2a > IgM > IgG2b > IgG2c. Both cocoa diets studied (4% and 10%) down-modulated OVA-specific antibody levels of IgG1 (main subclass associated with the Th2 immune response in rats), IgG2a, IgG2c and IgM isotypes. Conversely, cocoa-fed rats presented equal or higher levels of anti-OVA IgG2b antibodies (subclass linked to the Th1 response). Spleen and lymph node cells from OVA-immunized control and cocoa-fed animals proliferated similarly under OVA stimulation. However, spleen cells from cocoa-fed animals showed decreased interleukin-4 secretion (main Th2 cytokine), and lymph node cells from the same rats displayed higher interferon-gamma secretion (main Th1 cytokine). These changes were accompanied by a reduction in the number of anti-OVA IgG-secreting cells in spleen. In conclusion, cocoa diets induced attenuation of antibody synthesis that may be attributable to specific down-regulation of the Th2 immune response.

  14. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles.

    PubMed

    Guo, Sijin; Li, Hui; Ma, Mengshi; Fu, Jian; Dong, Yizhou; Guo, Peixuan

    2017-12-15

    RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Host-Specific Response to HCV Infection in the Chimeric SCID-beige/Alb-uPA Mouse Model: Role of the Innate Antiviral Immune Response

    PubMed Central

    Thompson, Jill C; Smith, Maria W; Yeh, Matthew M; Proll, Sean; Zhu, Lin-Fu; Gao, T. J; Kneteman, Norman M; Tyrrell, D. Lorne; Katze, Michael G

    2006-01-01

    The severe combined immunodeficiency disorder (SCID)-beige/albumin (Alb)-urokinase plasminogen activator (uPA) mouse containing a human-mouse chimeric liver is currently the only small animal model capable of supporting hepatitis C virus (HCV) infection. This model was utilized to characterize the host transcriptional response to HCV infection. The purpose of these studies was to investigate the genetic component of the host response to HCV infection and also to distinguish virus-induced gene expression changes from adaptive HCV-specific immune-mediated effects. Gene expression profiles from HCV-infected mice were also compared to those from HCV-infected patients. Analyses of the gene expression data demonstrate that host factors regulate the response to HCV infection, including the nature of the innate antiviral immune response. They also indicate that HCV mediates gene expression changes, including regulation of lipid metabolism genes, which have the potential to be directly cytopathic, indicating that liver pathology may not be exclusively mediated by HCV-specific adaptive immune responses. This effect appears to be inversely related to the activation of the innate antiviral immune response. In summary, the nature of the initial interferon response to HCV infection may determine the extent of viral-mediated effects on host gene expression. PMID:16789836

  16. Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation.

    PubMed

    Godec, Jernej; Tan, Yan; Liberzon, Arthur; Tamayo, Pablo; Bhattacharya, Sanchita; Butte, Atul J; Mesirov, Jill P; Haining, W Nicholas

    2016-01-19

    Gene-expression profiling has become a mainstay in immunology, but subtle changes in gene networks related to biological processes are hard to discern when comparing various datasets. For instance, conservation of the transcriptional response to sepsis in mouse models and human disease remains controversial. To improve transcriptional analysis in immunology, we created ImmuneSigDB: a manually annotated compendium of ∼5,000 gene-sets from diverse cell states, experimental manipulations, and genetic perturbations in immunology. Analysis using ImmuneSigDB identified signatures induced in activated myeloid cells and differentiating lymphocytes that were highly conserved between humans and mice. Sepsis triggered conserved patterns of gene expression in humans and mouse models. However, we also identified species-specific biological processes in the sepsis transcriptional response: although both species upregulated phagocytosis-related genes, a mitosis signature was specific to humans. ImmuneSigDB enables granular analysis of transcriptomic data to improve biological understanding of immune processes of the human and mouse immune systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. The acute transcriptional response of the coral Acropora millepora to immune challenge: expression of GiMAP/IAN genes links the innate immune responses of corals with those of mammals and plants.

    PubMed

    Weiss, Yvonne; Forêt, Sylvain; Hayward, David C; Ainsworth, Tracy; King, Rob; Ball, Eldon E; Miller, David J

    2013-06-14

    As a step towards understanding coral immunity we present the first whole transcriptome analysis of the acute responses of Acropora millepora to challenge with the bacterial cell wall derivative MDP and the viral mimic poly I:C, defined immunogens provoking distinct but well characterised responses in higher animals. These experiments reveal similarities with the responses both of arthropods and mammals, as well as coral-specific effects. The most surprising finding was that MDP specifically induced three members of the GiMAP gene family, which has been implicated in immunity in mammals but is absent from Drosophila and Caenorhabditis. Like their mammalian homologs, GiMAP genes are arranged in a tandem cluster in the coral genome. A phylogenomic survey of this gene family implies ancient origins, multiple independent losses and lineage-specific expansions during animal evolution. Whilst functional convergence cannot be ruled out, GiMAP expression in corals may reflect an ancestral role in immunity, perhaps in phagolysosomal processing.

  18. Intestinal Immune Responses to Type 2 Oral Polio Vaccine (OPV) Challenge in Infants Previously Immunized With Bivalent OPV and Either High-Dose or Standard Inactivated Polio Vaccine.

    PubMed

    Brickley, Elizabeth B; Strauch, Carolyn B; Wieland-Alter, Wendy F; Connor, Ruth I; Lin, Shu; Weiner, Joshua A; Ackerman, Margaret E; Arita, Minetaro; Oberste, M Steven; Weldon, William C; Sáez-Llorens, Xavier; Bandyopadhyay, Ananda S; Wright, Peter F

    2018-01-17

    The impact of inactivated polio vaccines (IPVs) on intestinal mucosal immune responses to live poliovirus is poorly understood. In a 2014 phase 2 clinical trial, Panamanian infants were immunized at 6, 10, and 14 weeks of age with bivalent oral polio vaccine (bOPV) and randomized to receive either a novel monovalent high-dose type 2-specific IPV (mIPV2HD) or a standard trivalent IPV at 14 weeks. Infants were challenged at 18 weeks with a monovalent type 2 oral polio vaccine (mOPV2). Infants' intestinal immune responses during the 3 weeks following challenge were investigated by measuring poliovirus type-specific neutralization and immunoglobulin (Ig) A, IgA1, IgA2, IgD, IgG, and IgM antibodies in stool samples. Despite mIPV2HD's 4-fold higher type 2 polio D-antigen content and heightened serum neutralization profile, mIPV2HD-immunized infants' intestinal immune responses to mOPV2 challenge were largely indistinguishable from those receiving standard IPV. Mucosal responses were tightly linked to evidence of active infection and, in the 79% of participants who shed virus, robust type 2-specific IgA responses and stool neutralization were observed by 2 weeks after challenge. Enhancing IPV-induced serum neutralization does not substantively improve intestinal mucosal immune responses or limit viral shedding on mOPV2 challenge. NCT02111135. © The Author(s) 2018. Published by Oxford University Press for the Infectious Diseases Society of America.

  19. Intestinal Immune Responses to Type 2 Oral Polio Vaccine (OPV) Challenge in Infants Previously Immunized With Bivalent OPV and Either High-Dose or Standard Inactivated Polio Vaccine

    PubMed Central

    Brickley, Elizabeth B; Strauch, Carolyn B; Wieland-Alter, Wendy F; Connor, Ruth I; Lin, Shu; Weiner, Joshua A; Ackerman, Margaret E; Arita, Minetaro; Oberste, M Steven; Weldon, William C; Sáez-Llorens, Xavier; Bandyopadhyay, Ananda S; Wright, Peter F

    2018-01-01

    Abstract Background The impact of inactivated polio vaccines (IPVs) on intestinal mucosal immune responses to live poliovirus is poorly understood. Methods In a 2014 phase 2 clinical trial, Panamanian infants were immunized at 6, 10, and 14 weeks of age with bivalent oral polio vaccine (bOPV) and randomized to receive either a novel monovalent high-dose type 2–specific IPV (mIPV2HD) or a standard trivalent IPV at 14 weeks. Infants were challenged at 18 weeks with a monovalent type 2 oral polio vaccine (mOPV2). Infants’ intestinal immune responses during the 3 weeks following challenge were investigated by measuring poliovirus type-specific neutralization and immunoglobulin (Ig) A, IgA1, IgA2, IgD, IgG, and IgM antibodies in stool samples. Results Despite mIPV2HD’s 4-fold higher type 2 polio D–antigen content and heightened serum neutralization profile, mIPV2HD-immunized infants’ intestinal immune responses to mOPV2 challenge were largely indistinguishable from those receiving standard IPV. Mucosal responses were tightly linked to evidence of active infection and, in the 79% of participants who shed virus, robust type 2–specific IgA responses and stool neutralization were observed by 2 weeks after challenge. Conclusions Enhancing IPV-induced serum neutralization does not substantively improve intestinal mucosal immune responses or limit viral shedding on mOPV2 challenge. Clinical Trials Registration NCT02111135. PMID:29304199

  20. Immunization with intestinal microbiota-derived Staphylococcus aureus and Escherichia coli reduces bacteria-specific recolonization of the intestinal tract.

    PubMed

    Garfias-López, Julio Adrián; Castro-Escarpuli, Graciela; Cárdenas, Pedro E; Moreno-Altamirano, María Maximina Bertha; Padierna-Olivos, Juan; Sánchez-García, F Javier

    2018-04-01

    A wide array of microorganisms colonizes distinctive anatomical regions of animals, being the intestine the one that harbors the most abundant and complex microbiota. Phylogenetic analyses indicate that it is composed mainly of bacteria, and that Bacterioidetes and Firmicutes are the most represented phyla (>90% of the total eubacteria) in mice and humans. Intestinal microbiota plays an important role in host physiology, contributing to digestion, epithelial cells metabolism, stimulation of intestinal immune responses, and protection against intestinal pathogens. Changes in its composition may affect intestinal homeostasis, a condition known as dysbiosis, which may lead to non-specific inflammation and disease. The aim of this work was to analyze the effect that a bacteria-specific systemic immune response would have on the intestinal re-colonization by that particular bacterium. Bacteria were isolated and identified from the feces of Balb/c mice, bacterial cell-free extracts were used to immunize the same mice from which bacteria came from. Concurrently with immunization, mice were subjected to a previously described antibiotic-based protocol to eliminate most of their intestinal bacteria. Serum IgG and feces IgA, specific for the immunizing bacteria were determined. After antibiotic treatment was suspended, specific bacteria were orally administered, in an attempt to specifically re-colonize the intestine. Results showed that parenteral immunization with gut-derived bacteria elicited the production of both anti-bacterial IgG and IgA, and that immunization reduces bacteria specific recolonization of the gut. These findings support the idea that the systemic immune response may, at least in part, determine the bacterial composition of the gut. Copyright © 2018. Published by Elsevier B.V.

  1. Perturbation of gut bacteria induces a coordinated cellular immune response in the purple sea urchin larva.

    PubMed

    Ch Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P

    2016-10-01

    The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates.

  2. Immune responses during gestational malaria: a review of the current knowledge and future trend of research.

    PubMed

    Maestre, Amanda; Carmona-Fonseca, Jaime

    2014-04-15

    Women pregnant with their first child are susceptible to severe P. falciparum disease from placental malaria because they lack immunity to placenta-specific cytoadherence proteins. In subsequent pregnancies, as immunity against placental parasites is acquired, there is a reduced risk of adverse effects of malaria on the mother and fetus and asymptomatic parasitaemia is common. In the case of vivax malaria, with increasing reports of severe cases in Asia and South America, the effects of infection by this species during pregnancy remain to be elucidated. This review summarized the main aspects involved in the acquisition of specific antimalarial immune responses during pregnancy with emphasis in research carried out in America and Asia, in order to offer a framework of interpretation for studies on pregnant women with malaria which are recently being produced in these regions. The authors conclude that (1) Effective humoral responses during gestational malaria are mainly directed against variant surface antigens codified by genes of the var2Csa family of P. falciparum; (2) Acquisition of immunity against these variant antigens depends on the degree and intensity of transmission, and the chance increases with age and successive pregnancies; (3) Antibody development is guided by specific cellular immune responses in cases of placental and maternal infection, and (4) The study of the significance of acquisition of specific immunity against both P. falciparum and P. vivax in America, should be performed.

  3. Commensal–dendritic-cell interaction specifies a unique protective skin immune signature

    PubMed Central

    Naik, Shruti; Bouladoux, Nicolas; Linehan, Jonathan L.; Han, Seong-Ji; Harrison, Oliver J.; Wilhelm, Christoph; Conlan, Sean; Himmelfarb, Sarah; Byrd, Allyson L.; Deming, Clayton; Quinones, Mariam; Brenchley, Jason M.; Kong, Heidi H.; Tussiwand, Roxanne; Murphy, Kenneth M.; Merad, Miriam; Segre, Julia A; Belkaid, Yasmine

    2015-01-01

    The skin represents the primary interface between the host and the environment. This organ is also home to trillions of microorganisms that play an important role in tissue homeostasis and local immunity1–4. Skin microbial communities are highly diverse and can be remodelled over time or in response to environmental challenges5–7. How, in the context of this complexity, individual commensal microorganisms may differentially modulate skin immunity and the consequences of these responses for tissue physiology remains unclear. Here we show that defined commensals dominantly affect skin immunity and identify the cellular mediators involved in this specification. In particular, colonization with Staphylococcus epidermidis induces IL-17A+ CD8+ T cells that home to the epidermis, enhance innate barrier immunity and limit pathogen invasion. Commensal-specific T-cell responses result from the coordinated action of skin-resident dendritic cell subsets and are not associated with inflammation, revealing that tissue-resident cells are poised to sense and respond to alterations in microbial communities. This interaction may represent an evolutionary means by which the skin immune system uses fluctuating commensal signals to calibrate barrier immunity and provide heterologous protection against invasive pathogens. These findings reveal that the skin immune landscape is a highly dynamic environment that can be rapidly and specifically remodelled by encounters with defined commensals, findings that have profound implications for our understanding of tissue-specific immunity and pathologies. PMID:25539086

  4. Subcutaneous or oral immunization of mice with Lactococcus lactis expressing F4 fimbrial adhesin FaeG.

    PubMed

    Liu, Shujie; Li, Yongming; Xu, Ziwei; Wang, Yicheng

    2013-01-01

    Enterotoxigenic Escherichia coli (ETEC) is one of the most common causes of diarrhea in neonatal and postweaning piglets. Fimbrial adhesion of ETEC has been considered an important colonization factor with antigenicity. To safely and effectively deliver the F4 (K88) fimbrial adhesin FaeG to the immune system, we have previously constructed the secretory expression vector pNZ8112-faeG, and FaeG was produced in cytoplasmic form in Lactococcus lactis. In this work, BALB/c mice were immunized with recombinant L. lactis to further determine the immunogenicity of recombinant FaeG (rFaeG) via the subcutaneous or oral route. Subcutaneous immunization in mice with recombinant L. lactis induced a significant increase in the F4-specific serum IgG titer and the number of antibody-secreting cells (ASCs) in the spleen. Oral immunization of mice with recombinant L. lactis induced mucosal and systemic F4-specific immune responses and increased the number of ASCs in the spleen, mesenteric lymph nodes and Peyer's patches. High-dose (2.8 × 10(11) CFU) recombinant strains and adjuvant cholera toxin B subunit enhanced specific mucosal immune responses. The results suggest the feasibility of delivering rFaeG expressed in L. lactis to the immune system in order to induce an F4-specific immune response.

  5. Host Immune Response to Influenza A Virus Infection.

    PubMed

    Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long

    2018-01-01

    Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.

  6. OVA-bound nanoparticles induce OVA-specific IgG1, IgG2a, and IgG2b responses with low IgE synthesis.

    PubMed

    Yanase, Noriko; Toyota, Hiroko; Hata, Kikumi; Yagyu, Seina; Seki, Takahiro; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

    2014-10-14

    There is an urgent requirement for a novel vaccine that can stimulate immune responses without unwanted toxicity, including IgE elevation. We examined whether antigen ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA-NPs) with average diameter of 110nm would serve as an immune adjuvant. When BALB/c mice were immunized with OVA-NPs, they developed sufficient levels of OVA-specific IgG1 antibody responses with low levels of IgE synthesis, representing helper T (Th)2-mediated humoral immunity. OVA-specific IgG2a and IgG2b responses (i.e., Th1-mediated immunity) were also induced by secondary immunization with OVA-NPs. As expected, immunization with OVA in alum (OVA-alum) stimulated humoral immune responses, including IgG1 and IgE antibodies, with only low levels of IgG2a/IgG2b antibodies. CD4-positive T cells from mice primed with OVA-NPs produced substantial levels of IL-21 and IL-4, comparable to those from OVA-alum group. The irradiated mice receiving OVA-NPs-primed B cells together with OVA-alum-primed T cells exhibited enhanced anti-OVA IgG2b responses relative to OVA-alum-primed B cells and T cells following stimulation with OVA-NPs. Moreover, when OVA-NPs-primed, but not OVA-alum-primed, B cells were cultured in the presence of anti-CD40 monoclonal antibody, IL-4, and IL-21, or LPS plus TGF-β in vitro, OVA-specific IgG1 or IgG2b antibody responses were elicited, suggesting that immunization with OVA-NPs modulates B cells to generate IgG1 and IgG2b responses. Thus, OVA-NPs might exert their adjuvant action on B cells, and they represent a promising potential vaccine for generating both IgG1 and IgG2a/IgG2b antibody responses with low IgE synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Dose-dependent effects of an immune challenge at both ultimate and proximate levels in Drosophila melanogaster.

    PubMed

    Nystrand, M; Dowling, D K

    2014-05-01

    Immune responses are highly dynamic. The magnitude and efficiency of an immune response to a pathogen can change markedly across individuals, and such changes may be influenced by variance in a range of intrinsic (e.g. age, genotype, sex) and external (e.g. abiotic stress, pathogen identity, strain) factors. Life history theory predicts that up-regulation of the immune system will come at a physiological cost, and studies have confirmed that increased investment in immunity can reduce reproductive output and survival. Furthermore, males and females often have divergent reproductive strategies, and this might drive the evolution of sex-specific life history trade-offs involving immunity, and sexual dimorphism in immune responses per se. Here, we employ an experiment design to elucidate dose-dependent and sex-specific responses to exposure to a nonpathogenic immune elicitor at two scales--the 'ultimate' life history and the underlying 'proximate' immune level in Drosophila melanogaster. We found dose-dependent effects of immune challenges on both male and female components of reproductive success, but not on survival, as well as a response in antimicrobial activity. These results indicate that even in the absence of the direct pathogenic effects that are associated with actual disease, individual life histories respond to a perceived immune challenge--but with the magnitude of this response being contingent on the initial dose of exposure. Furthermore, the results indicate that immune responses at the ultimate life history level may indeed reflect underlying processes that occur at the proximate level. © 2014 The Authors. Journal of Evolutionary Biology © 2014 European Society For Evolutionary Biology.

  8. Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.

    PubMed

    Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

    2017-12-01

    Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.

  9. TLR7 imidazoquinoline ligand 3M-019 is a potent adjuvant for pure protein prototype vaccines.

    PubMed

    Johnston, Dean; Zaidi, Bushra; Bystryn, Jean-Claude

    2007-08-01

    Cancer vaccines, while theoretically attractive, present difficult challenges that must be overcome to be effective. Cancer vaccines are often poorly immunogenic and may require augmentation of immunogenicity through the use of adjuvants and/or immune response modifiers. Toll-like receptor (TLR) ligands are a relatively new class of immune response modifiers that may have great potential in inducing and augmenting both cellular and humoral immunity to vaccines. TLR7 ligands produce strong cellular responses and specific IgG2a and IgG2b antibody responses to protein immunogens. This study shows that a new TLR7 ligand, 3M-019, in combination with liposomes produces very strong immune responses to a pure protein prototype vaccine in mice. Female C57BL/6 mice were immunized subcutaneously with ovalbumin (OVA, 0.1 mg/dose) weekly 4x. Some groups were immunized to OVA plus 3M-019 or to OVA plus 3M-019 encapsulated in liposomes. Both antibody and cellular immune responses against OVA were measured after either two or four immunizations. Anti-OVA IgG antibody responses were significantly increased after two immunizations and were substantially higher after four immunizations in mice immunized with OVA combined with 3M-019. Encapsulation in liposomes further augmented antibody responses. IgM responses, on the other hand, were lowered by 3M-019. OVA-specific IgG2a levels were increased 625-fold by 3M-019 in liposomes compared to OVA alone, while anti-OVA IgG2b levels were over 3,000 times higher. In both cases encapsulation of 3M-019 in liposomes was stronger than either liposomes alone or 3M-019 without liposomes. Cellular immune responses were likewise increased by 3M-019 but further enhanced when it was encapsulated in liposomes. The lack of toxicity also indicates that this combination may by safe, effective method to boost immune response to cancer vaccines.

  10. [Prokaryotic expression and immunological characteristics of Mycobacterium tuberculosis Rv1886c].

    PubMed

    Tao, Chengwu; Zhao, Dan; Dong, Hui; Shan, Fa; Lian, Kai; Pan, Zhiming; Chen, Xiang; Yin, Yuelan; Jiao, Xin'an

    2014-03-04

    Ag85B (Rv1886c) is secreted during the early stages of infection by Mycobacterium tuberculosis. The purpose of this study was probed into the immune response against Ag85B in vivo. Ag85B was prokaryotic expressed and identified, its immunological characteristics were evaluated with indirect-ELSIA, Sandwich-ELISA and Ag85B was mainly expressed in form of inclusion body enzyme-linked immunospot assay (ELISPOT). confirmed by SDS-PAGE. Western blot analysis shows that the fusion protein had good specific reaction with serum of tuberculosis patient and serum of mice immunized with LM-Ag85B. C57BL/6 mice were subcutaneously immunized with Ag85B, the production of IFN-gamma and IL-4 in the spleen cells was determined by Sandwich ELISA, the level of IFN-gamma was significantly higher than that of IL-4 (P < 0.001) in the Ag85B immunization group, it indicated the protein induced Th1-tendency immune responses. Furthermore, purified protein derivative (PPD) used as coating antigen, antibody titer against Ag85B in murine serum reached 1:6400, it was demonstrated that Ag85B could also induce humoral immune responses. Additionally, C57BL/6 mice were intravenously immunized with M. tb H37Rv and bacillus Calmette-Guérin (BCG) respectively for 42 days, M. tb H37Rv group intended to induce Ag85B specific Th1 type immune response, and its ability of eliciting cellular immunity was significantly stronger than BCG group (P < 0.001). Ag85B can affectively induce strongly Th1-tendency immune response and humoral response. Whereas, BCG prime vaccination only can elicit low levels of Ag85B(240-259) specific immune response. The study laid foundation for probing the pathogenic mechanism, the development of novel vaccine and the establishment of clinical diagnostic method.

  11. Boosting BCG-primed responses with a subunit Apa vaccine during the waning phase improves immunity and imparts protection against Mycobacterium tuberculosis.

    PubMed

    Nandakumar, Subhadra; Kannanganat, Sunil; Dobos, Karen M; Lucas, Megan; Spencer, John S; Amara, Rama Rao; Plikaytis, Bonnie B; Posey, James E; Sable, Suraj B

    2016-05-13

    Heterologous prime-boosting has emerged as a powerful vaccination approach against tuberculosis. However, optimal timing to boost BCG-immunity using subunit vaccines remains unclear in clinical trials. Here, we followed the adhesin Apa-specific T-cell responses in BCG-primed mice and investigated its BCG-booster potential. The Apa-specific T-cell response peaked 32-52 weeks after parenteral or mucosal BCG-priming but waned significantly by 78 weeks. A subunit-Apa-boost during the contraction-phase of BCG-response had a greater effect on the magnitude and functional quality of specific cellular and humoral responses compared to a boost at the peak of BCG-response. The cellular response increased following mucosal BCG-prime-Apa-subunit-boost strategy compared to Apa-subunit-prime-BCG-boost approach. However, parenteral BCG-prime-Apa-subunit-boost by a homologous route was the most effective strategy in-terms of enhancing specific T-cell responses during waning in the lung and spleen. Two Apa-boosters markedly improved waning BCG-immunity and significantly reduced Mycobacterium tuberculosis burdens post-challenge. Our results highlight the challenges of optimization of prime-boost regimens in mice where BCG drives persistent immune-activation and suggest that boosting with a heterologous vaccine may be ideal once the specific persisting effector responses are contracted. Our results have important implications for design of prime-boost regimens against tuberculosis in humans.

  12. Lactobacillus plantarum Strains Can Enhance Human Mucosal and Systemic Immunity and Prevent Non-steroidal Anti-inflammatory Drug Induced Reduction in T Regulatory Cells

    PubMed Central

    de Vos, Paul; Mujagic, Zlatan; de Haan, Bart J.; Siezen, Roland J.; Bron, Peter A.; Meijerink, Marjolein; Wells, Jerry M.; Masclee, Ad A. M.; Boekschoten, Mark V.; Faas, Marijke M.; Troost, Freddy J.

    2017-01-01

    Orally ingested bacteria interact with intestinal mucosa and may impact immunity. However, insights in mechanisms involved are limited. In this randomized placebo-controlled cross-over trial, healthy human subjects were given Lactobacillus plantarum supplementation (strain TIFN101, CIP104448, or WCFS1) or placebo for 7 days. To determine whether L. plantarum can enhance immune response, we compared the effects of three stains on systemic and gut mucosal immunity, by among others assessing memory responses against tetanus toxoid (TT)-antigen, and mucosal gene transcription, in human volunteers during induction of mild immune stressor in the intestine, by giving a commonly used enteropathic drug, indomethacin [non-steroidal anti-inflammatory drug (NSAID)]. Systemic effects of the interventions were studies in peripheral blood samples. NSAID was found to induce a reduction in serum CD4+/Foxp3 regulatory cells, which was prevented by L. plantarum TIFN101. T-cell polarization experiments showed L. plantarum TIFN101 to enhance responses against TT-antigen, which indicates stimulation of memory responses by this strain. Cell extracts of the specific L. plantarum strains provoked responses after WCFS1 and TIFN101 consumption, indicating stimulation of immune responses against the specific bacteria. Mucosal immunomodulatory effects were studied in duodenal biopsies. In small intestinal mucosa, TIFN101 upregulated genes associated with maintenance of T- and B-cell function and antigen presentation. Furthermore, L. plantarum TIFN101 and WCFS1 downregulated immunological pathways involved in antigen presentation and shared downregulation of snoRNAs, which may suggest cellular destabilization, but may also be an indicator of tissue repair. Full sequencing of the L. plantarum strains revealed possible gene clusters that might be responsible for the differential biological effects of the bacteria on host immunity. In conclusion, the impact of oral consumption L. plantarum on host immunity is strain dependent and involves responses against bacterial cell components. Some strains may enhance specific responses against pathogens by enhancing antigen presentation and leukocyte maintenance in mucosa. In future studies and clinical settings, caution should be taken in selecting beneficial bacteria as closely related strains can have different effects. Our data show that specific bacterial strains can prevent immune stress induced by commonly consumed painkillers such as NSAID and can have enhancing beneficial effects on immunity of consumers by stimulating antigen presentation and memory responses. PMID:28878772

  13. Potentiation of the humoral immune response elicited by a commercial vaccine against bovine respiratory disease by Enterococcus faecalis CECT7121.

    PubMed

    Díaz, A M; Almozni, B; Molina, M A; Sparo, M D; Manghi, M A; Canellada, A M; Castro, M S

    2018-04-10

    Vaccination against pathogens involved in bovine respiratory disease (BRD) is a useful tool to reduce the risk of this disease however, it has been observed that the commercially available vaccines only partially prevent the infections caused by Pasteurella multocida and Mannheimia haemolytica. Therefore, it is recommended to search for new adjuvant strategies to minimise the economic impact of this respiratory syndrome. A possibility to improve the conventional vaccine response is to modulate the immune system with probiotics, since there is accumulating evidence that certain immunomodulatory strains administered around the time of vaccination can potentiate the immune response. Considering veterinary vaccines are frequently tested in murine models, we have developed an immunisation schedule in BALB/c mice that allows us to study the immune response elicited by BRD vaccine. In order to evaluate a potential strategy to enhance vaccine efficacy, the adjuvant effect of Enterococcus faecalis CECT7121 on the murine specific humoral immune response elicited by a commercial vaccine against BRD was studied. Results indicate that the intragastric administration of E. faecalis CECT7121 was able to induce an increase in the specific antibody titres against the bacterial components of the BRD vaccines (P. multocida and M. haemolytica). The quality of the humoral immune response, in terms of antibody avidity, was also improved. Regarding the cellular immune response, although the BRD vaccination induced a low specific secretion of cytokines in the spleen cell culture supernatants, E. faecalis CECT7121-treated mice showed higher interferon-γ production than immunised control mice. Our results allowed us to conclude that the administration of E. faecalis CECT7121 could be employed as an adjuvant strategy to potentiate humoral immune responses.

  14. HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates

    NASA Astrophysics Data System (ADS)

    Wille-Reece, Ulrike; Flynn, Barbara J.; Loré, Karin; Koup, Richard A.; Kedl, Ross M.; Mattapallil, Joseph J.; Weiss, Walter R.; Roederer, Mario; Seder, Robert A.

    2005-10-01

    Induction and maintenance of antibody and T cell responses will be critical for developing a successful vaccine against HIV. A rational approach for generating such responses is to design vaccines or adjuvants that have the capacity to activate specific antigen-presenting cells. In this regard, dendritic cells (DCs) are the most potent antigen-presenting cells for generating primary T cell responses. Here, we report that Toll-like receptor (TLR) agonists and ligands that activate DCs in vitro influence the magnitude and quality of the cellular immune response in nonhuman primates (NHPs) when administered with HIV Gag protein. NHPs immunized with HIV Gag protein and a TLR7/8 agonist or a TLR9 ligand [CpG oligodeoxynucleotides (CpG ODN)] had significantly increased Gag-specific T helper 1 and antibody responses, compared with animals immunized with HIV Gag protein alone. Importantly, conjugating the HIV Gag protein to the TLR7/8 agonist (Gag-TLR7/8 conjugate) dramatically enhanced the magnitude and altered the quality of the T helper 1 response, compared with animals immunized with HIV Gag protein and the TLR7/8 agonist or CpG ODN. Furthermore, immunization with the Gag-TLR7/8 conjugate vaccine elicited Gag-specific CD8+ T responses. Collectively, our results show that conjugating HIV Gag protein to a TLR7/8 agonist is an effective way to elicit broad-based adaptive immunity in NHPs. This type of vaccine formulation should have utility in preventive or therapeutic vaccines in which humoral and cellular immunity is required. vaccine | dendritic cell | cross-presentation | cellular immunity

  15. Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity

    PubMed Central

    Gao, Xiquan; Cox, Kevin L.; He, Ping

    2014-01-01

    An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP), which is called PAMP-triggered immunity (PTI). The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI). Calcium (Ca2+) signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs) have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF)-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response. PMID:27135498

  16. A CpG-containing oligodeoxynucleotide as an efficient adjuvant counterbalancing the Th1/Th2 immune response in diphtheria-tetanus-pertussis vaccine.

    PubMed

    Sugai, Toshiyuki; Mori, Masaaki; Nakazawa, Masatoshi; Ichino, Motohide; Naruto, Takuya; Kobayashi, Naoki; Kobayashi, Yoshinori; Minami, Mutsuhiko; Yokota, Shumpei

    2005-11-16

    Adjuvants in vaccines are immune stimulants that play an important role in the induction of effective and appropriate immune responses to vaccine component(s). Diphtheria-tetanus-pertussis (DPT) vaccine contains not only aluminum hydrate (alum) to enhance the immune response to the vaccine ingredients, but also, both for that purpose and as a principal ingredient, pertussis toxin (PT). However, both adjuvants strongly promote T helper (Th) 2 type immune responses. Th1 and Th2 type immune responses are counterbalanced in vivo, and a Th2-prone immune response is not effective against intracellular infections but promotes IgE production, which is related to allergic disease. In this study, we used the CpG motif contained in oligodeoxynucleotide (CpG-ODN), which has an adjuvant effect and also induces the Th1 response, as an adjuvant to this vaccine, and we investigated its adjuvanticity and its potential to modulate immune responses to DPT vaccine. Administration of DPT vaccine with CpG-ODN (DPT-alum/ODN) to mice significantly reduced the total IgE levels and increased the anti-PT specific IgG2a titer in serum, in comparison with ordinary DPT vaccine (DPT-alum). Moreover, we investigated the antibody response to orally administrated ovalbumin (OVA) after vaccine administration. In the DPT-alum/ODN-administered group, the OVA specific IgE production in serum greatly decreased in comparison with that in the DPT-alum-administered group. These data indicate that CpG-ODN was not useful only as an efficient vaccine adjuvant but also shifted the immune responses substantially toward Th1 and modulated the Th1/Th2 immune response in DPT vaccine. These data suggested new applications of CpG-ODN as adjuvants in DPT vaccine.

  17. Effect of gender and sex hormones on immune responses following shock.

    PubMed

    Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H

    2000-08-01

    Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.

  18. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

    PubMed Central

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

    2017-01-01

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

  19. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

    PubMed

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

    2008-10-09

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

  20. HIV Controllers Exhibit Enhanced Frequencies of Major Histocompatibility Complex Class II Tetramer+ Gag-Specific CD4+ T Cells in Chronic Clade C HIV-1 Infection

    PubMed Central

    Laher, Faatima; Ranasinghe, Srinika; Porichis, Filippos; Mewalal, Nikoshia; Pretorius, Karyn; Ismail, Nasreen; Buus, Søren; Stryhn, Anette; Carrington, Mary; Walker, Bruce D.; Ndung'u, Thumbi

    2017-01-01

    ABSTRACT Immune control of viral infections is heavily dependent on helper CD4+ T cell function. However, the understanding of the contribution of HIV-specific CD4+ T cell responses to immune protection against HIV-1, particularly in clade C infection, remains incomplete. Recently, major histocompatibility complex (MHC) class II tetramers have emerged as a powerful tool for interrogating antigen-specific CD4+ T cells without relying on effector functions. Here, we defined the MHC class II alleles for immunodominant Gag CD4+ T cell epitopes in clade C virus infection, constructed MHC class II tetramers, and then used these to define the magnitude, function, and relation to the viral load of HIV-specific CD4+ T cell responses in a cohort of untreated HIV clade C-infected persons. We observed significantly higher frequencies of MHC class II tetramer-positive CD4+ T cells in HIV controllers than progressors (P = 0.0001), and these expanded Gag-specific CD4+ T cells in HIV controllers showed higher levels of expression of the cytolytic proteins granzymes A and B. Importantly, targeting of the immunodominant Gag41 peptide in the context of HLA class II DRB1*1101 was associated with HIV control (r = −0.5, P = 0.02). These data identify an association between HIV-specific CD4+ T cell targeting of immunodominant Gag epitopes and immune control, particularly the contribution of a single class II MHC-peptide complex to the immune response against HIV-1 infection. Furthermore, these results highlight the advantage of the use of class II tetramers in evaluating HIV-specific CD4+ T cell responses in natural infections. IMPORTANCE Increasing evidence suggests that virus-specific CD4+ T cells contribute to the immune-mediated control of clade B HIV-1 infection, yet there remains a relative paucity of data regarding the role of HIV-specific CD4+ T cells in shaping adaptive immune responses in individuals infected with clade C, which is responsible for the majority of HIV infections worldwide. Understanding the contribution of HIV-specific CD4+ T cell responses in clade C infection is particularly important for developing vaccines that would be efficacious in sub-Saharan Africa, where clade C infection is dominant. Here, we employed MHC class II tetramers designed to immunodominant Gag epitopes and used them to characterize CD4+ T cell responses in HIV-1 clade C infection. Our results demonstrate an association between the frequency of HIV-specific CD4+ T cell responses targeting an immunodominant DRB1*11-Gag41 complex and HIV control, highlighting the important contribution of a single class II MHC-peptide complex to the immune response against HIV-1 infections. PMID:28077659

  1. Vaccination with plasmid DNA encoding TSA/LmSTI1 leishmanial fusion proteins confers protection against Leishmania major infection in susceptible BALB/c mice.

    PubMed

    Campos-Neto, A; Webb, J R; Greeson, K; Coler, R N; Skeiky, Y A W; Reed, S G

    2002-06-01

    We have recently shown that a cocktail containing two leishmanial recombinant antigens (LmSTI1 and TSA) and interleukin-12 (IL-12) as an adjuvant induces solid protection in both a murine and a nonhuman primate model of cutaneous leishmaniasis. However, because IL-12 is difficult to prepare, is expensive, and does not have the stability required for a vaccine product, we have investigated the possibility of using DNA as an alternative means of inducing protective immunity. Here, we present evidence that the antigens TSA and LmSTI1 delivered in a plasmid DNA format either as single genes or in a tandem digene construct induce equally solid protection against Leishmania major infection in susceptible BALB/c mice. Immunization of mice with either TSA DNA or LmSTI1 DNA induced specific CD4(+)-T-cell responses of the Th1 phenotype without a requirement for specific adjuvant. CD8 responses, as measured by cytotoxic-T-lymphocyte activity, were generated after immunization with TSA DNA but not LmSTI1 DNA. Interestingly, vaccination of mice with TSA DNA consistently induced protection to a much greater extent than LmSTI1 DNA, thus supporting the notion that CD8 responses might be an important accessory arm of the immune response for acquired resistance against leishmaniasis. Moreover, the protection induced by DNA immunization was specific for infection with Leishmania, i.e., the immunization had no effect on the course of infection of the mice challenged with an unrelated intracellular pathogen such as Mycobacterium tuberculosis. Conversely, immunization of BALB/c mice with a plasmid DNA that is protective against challenge with M. tuberculosis had no effect on the course of infection of these mice with L. major. Together, these results indicate that the protection observed with the leishmanial DNA is mediated by acquired specific immune response rather than by the activation of nonspecific innate immune mechanisms. In addition, a plasmid DNA containing a fusion construct of the two genes was also tested. Similarly to the plasmids encoding individual proteins, the fusion construct induced both specific immune responses to the individual antigens and protection against challenge with L. major. These results confirm previous observations about the possibility of DNA immunization against leishmaniasis and lend support to the idea of using a single polygenic plasmid DNA construct to achieve polyspecific immune responses to several distinct parasite antigens.

  2. Lentiviral Protein Transfer Vectors Are an Efficient Vaccine Platform and Induce a Strong Antigen-Specific Cytotoxic T Cell Response

    PubMed Central

    Uhlig, Katharina M.; Schülke, Stefan; Scheuplein, Vivian A. M.; Malczyk, Anna H.; Reusch, Johannes; Kugelmann, Stefanie; Muth, Anke; Koch, Vivian; Hutzler, Stefan; Bodmer, Bianca S.; Schambach, Axel; Buchholz, Christian J.; Waibler, Zoe; Scheurer, Stephan

    2015-01-01

    ABSTRACT To induce and trigger innate and adaptive immune responses, antigen-presenting cells (APCs) take up and process antigens. Retroviral particles are capable of transferring not only genetic information but also foreign cargo proteins when they are genetically fused to viral structural proteins. Here, we demonstrate the capacity of lentiviral protein transfer vectors (PTVs) for targeted antigen transfer directly into APCs and thereby induction of cytotoxic T cell responses. Targeting of lentiviral PTVs to APCs can be achieved analogously to gene transfer vectors by pseudotyping the particles with truncated wild-type measles virus (MV) glycoproteins (GPs), which use human SLAM (signaling lymphocyte activation molecule) as a main entry receptor. SLAM is expressed on stimulated lymphocytes and APCs, including dendritic cells. SLAM-targeted PTVs transferred the reporter protein green fluorescent protein (GFP) or Cre recombinase with strict receptor specificity into SLAM-expressing CHO and B cell lines, in contrast to broadly transducing vesicular stomatitis virus G protein (VSV-G) pseudotyped PTVs. Primary myeloid dendritic cells (mDCs) incubated with targeted or nontargeted ovalbumin (Ova)-transferring PTVs stimulated Ova-specific T lymphocytes, especially CD8+ T cells. Administration of Ova-PTVs into SLAM-transgenic and control mice confirmed the observed predominant induction of antigen-specific CD8+ T cells and demonstrated the capacity of protein transfer vectors as suitable vaccines for the induction of antigen-specific immune responses. IMPORTANCE This study demonstrates the specificity and efficacy of antigen transfer by SLAM-targeted and nontargeted lentiviral protein transfer vectors into antigen-presenting cells to trigger antigen-specific immune responses in vitro and in vivo. The observed predominant activation of antigen-specific CD8+ T cells indicates the suitability of SLAM-targeted and also nontargeted PTVs as a vaccine for the induction of cytotoxic immune responses. Since cytotoxic CD8+ T lymphocytes are a mainstay of antitumoral immune responses, PTVs could be engineered for the transfer of specific tumor antigens provoking tailored antitumoral immunity. Therefore, PTVs can be used as safe and efficient alternatives to gene transfer vectors or live attenuated replicating vector platforms, avoiding genotoxicity or general toxicity in highly immunocompromised patients, respectively. Thereby, the potential for easy envelope exchange allows the circumventing of neutralizing antibodies, e.g., during repeated boost immunizations. PMID:26085166

  3. Unique aspects of the perinatal immune system.

    PubMed

    Zhang, Xiaoming; Zhivaki, Dania; Lo-Man, Richard

    2017-08-01

    The early stages of life are associated with increased susceptibility to infection, which is in part due to an ineffective immune system. In the context of infection, the immune system must be stimulated to provide efficient protection while avoiding insufficient or excessive activation. Yet, in early life, age-dependent immune regulation at molecular and cellular levels contributes to a reduced immunological fitness in terms of pathogen clearance and response to vaccines. To enable microbial colonization to be tolerated at birth, epigenetic immune cell programming and early life-specific immune regulatory and effector mechanisms ensure that vital functions and organ development are supported and that tissue damage is avoided. Advancement in our understanding of age-related remodelling of immune networks and the consequent tuning of immune responsiveness will open up new possibilities for immune intervention and vaccine strategies that are designed specifically for early life.

  4. Influenza vaccine response profiles are affected by vaccine preparation and preexisting immunity, but not HIV infection.

    PubMed

    Berger, Christoph T; Greiff, Victor; Mehling, Matthias; Fritz, Stefanie; Meier, Marc A; Hoenger, Gideon; Conen, Anna; Recher, Mike; Battegay, Manuel; Reddy, Sai T; Hess, Christoph

    2015-01-01

    Vaccines dramatically reduce infection-related morbidity and mortality. Determining factors that modulate the host response is key to rational vaccine design and demands unsupervised analysis. To longitudinally resolve influenza-specific humoral immune response dynamics we constructed vaccine response profiles of influenza A- and B-specific IgM and IgG levels from 42 healthy and 31 HIV infected influenza-vaccinated individuals. Pre-vaccination antibody levels and levels at 3 predefined time points after vaccination were included in each profile. We performed hierarchical clustering on these profiles to study the extent to which HIV infection associated immune dysfunction, adaptive immune factors (pre-existing influenza-specific antibodies, T cell responses), an innate immune factor (Mannose Binding Lectin, MBL), demographic characteristics (gender, age), or the vaccine preparation (split vs. virosomal) impacted the immune response to influenza vaccination. Hierarchical clustering associated vaccine preparation and pre-existing IgG levels with the profiles of healthy individuals. In contrast to previous in vitro and animal data, MBL levels had no impact on the adaptive vaccine response. Importantly, while HIV infected subjects with low CD4 T cell counts showed a reduced magnitude of their vaccine response, their response profiles were indistinguishable from those of healthy controls, suggesting quantitative but not qualitative deficits. Unsupervised profile-based analysis ranks factors impacting the vaccine-response by relative importance, with substantial implications for comparing, designing and improving vaccine preparations and strategies. Profile similarity between HIV infected and HIV negative individuals suggests merely quantitative differences in the vaccine response in these individuals, offering a rationale for boosting strategies in the HIV infected population.

  5. Disruption of TNFα/TNFR1 function in resident skin cells impairs host immune response against cutaneous vaccinia virus infection

    PubMed Central

    Tian, Tian; Dubin, Krista; Jin, Qiushuang; Qureshi, Ali; King, Sandra L.; Liu, Luzheng; Jiang, Xiaodong; Murphy, George F.; Kupper, Thomas S.; Fuhlbrigge, Robert C.

    2012-01-01

    One strategy adopted by vaccinia virus (VV) to evade the host immune system is to encode homologs of TNF receptors (TNFR) that block TNFα function. The response to VV skin infection under conditions of TNFα deficiency, however, has not been reported. We found that TNFR1−/− mice developed larger primary lesions, numerous satellite lesions and higher skin virus levels after VV scarification. Following their recovery, these TNFR1−/− mice were fully protected against challenge with a lethal intranasal dose of VV, suggesting these mice developed an effective memory immune response. A functional systemic immune response of TNFR1−/− mice was further demonstrated by enhanced production of VV-specific IFNγ and VV-specific CD8+ T cells in spleens and draining lymph nodes. Interestingly, bone marrow (BM) reconstitution studies using WT BM in TNFR1−/− host mice, but not TNFR1−/− BM in WT host mice, reproduced the original results seen in TNFR1−/− mice, indicating that TNFR1 deficiency in resident skin cells, rather than hematopoietic cells, accounts for the impaired cutaneous immune response. Our data suggest that lack of TNFR1 leads to a skin-specific immune deficiency and that resident skin cells play a crucial role in mediating an optimal immune defense to VV cutaneous infection via TNFα/TNFR1 signaling. PMID:22318381

  6. Neem leaf glycoprotein enhances carcinoembryonic antigen presentation of dendritic cells to T and B cells for induction of anti-tumor immunity by allowing generation of immune effector/memory response.

    PubMed

    Sarkar, Koustav; Goswami, Shyamal; Roy, Soumyabrata; Mallick, Atanu; Chakraborty, Krishnendu; Bose, Anamika; Baral, Rathindranath

    2010-08-01

    Vaccination with neem leaf glycoprotein matured carcinoembryonic antigen (CEA) pulsed dendritic cells (DCs) enhances antigen-specific humoral and cellular immunity against CEA and restricts the growth of CEA(+) murine tumors. NLGP helps better CEA uptake, processing and presentation to T/B cells. This vaccination (DCNLGPCEA) elicits mitogen induced and CEA specific T cell proliferation, IFN gamma secretion and induces specific cytotoxic reactions to CEA(+) colon tumor cells. In addition to T cell response, DCNLGPCEA vaccine generates anti-CEA antibody response, which is principally IgG2a in nature. This antibody participates in cytotoxicity of CEA(+) cells in antibody-dependent manner. This strong anti-CEA cellular and humoral immunity protects mice from tumor development and these mice remained tumor free following second tumor inoculation, indicating generation of effector memory response. Evaluation of underlying mechanism suggests vaccination generates strong CEA specific CTL and antibody response that can completely prevent the tumor growth following adoptive transfer. In support, significant upregulation of CD44 on the surface of lymphocytes from DCNLGPCEA immunized mice was noticed with a substantial reduction in L-selectin (CD62L). (c) 2010 Elsevier B.V. All rights reserved.

  7. Therapeutic targeting of regulatory T cells enhances tumor-specific CD8+ T cell responses in Epstein–Barr virus associated nasopharyngeal carcinoma

    PubMed Central

    Fogg, Mark; Murphy, John R.; Lorch, Jochen; Posner, Marshall; Wang, Fred

    2013-01-01

    Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, as well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. PMID:23601786

  8. The specificity of immune priming in silkworm, Bombyx mori, is mediated by the phagocytic ability of granular cells.

    PubMed

    Wu, Gongqing; Li, Mei; Liu, Yi; Ding, Ying; Yi, Yunhong

    2015-10-01

    In the past decade, the phenomenon of immune priming was documented in many invertebrates in a large number of studies; however, in most of these studies, behavioral evidence was used to identify the immune priming. The underlying mechanism and the degree of specificity of the priming response remain unclear. We studied the mechanism of immune priming in the larvae of the silkworm, Bombyx mori, and analyzed the specificity of the priming response using two closely related Gram-negative pathogenic bacteria (Photorhabdus luminescens TT01 and P. luminescens H06) and one Gram-positive pathogenic bacterium (Bacillus thuringiensis HD-1). Primed with heat-killed bacteria, the B. mori larvae were more likely to survive subsequent homologous exposure (the identical bacteria used in the priming and in the subsequent challenge) than heterologous (different bacteria used in the priming and subsequent exposure) exposure to live bacteria. This result indicated that the B. mori larvae possessed a strong immune priming response and revealed a degree of specificity to TT01, H06 and HD-1 bacteria. The degree of enhanced immune protection was positively correlated with the level of phagocytic ability of the granular cells and the antibacterial activity of the cell-free hemolymph. Moreover, the granular cells of the immune-primed larvae increased the phagocytosis of a previously encountered bacterial strain compared with other bacteria. Thus, the enhanced immune protection of the B. mori larvae after priming was mediated by the phagocytic ability of the granular cells and the antibacterial activity of the hemolymph; the specificity of the priming response was primarily attributed to the phagocytosis of bacteria by the granular cells. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. The cellular immune response of Daphnia magna under host-parasite genetic variation and variation in initial dose.

    PubMed

    Auld, Stuart K J R; Edel, Kai H; Little, Tom J

    2012-10-01

    In invertebrate-parasite systems, the likelihood of infection following parasite exposure is often dependent on the specific combination of host and parasite genotypes (termed genetic specificity). Genetic specificity can maintain diversity in host and parasite populations and is a major component of the Red Queen hypothesis. However, invertebrate immune systems are thought to only distinguish between broad classes of parasite. Using a natural host-parasite system with a well-established pattern of genetic specificity, the crustacean Daphnia magna and its bacterial parasite Pasteuria ramosa, we found that only hosts from susceptible host-parasite genetic combinations mounted a cellular response following exposure to the parasite. These data are compatible with the hypothesis that genetic specificity is attributable to barrier defenses at the site of infection (the gut), and that the systemic immune response is general, reporting the number of parasite spores entering the hemocoel. Further supporting this, we found that larger cellular responses occurred at higher initial parasite doses. By studying the natural infection route, where parasites must pass barrier defenses before interacting with systemic immune responses, these data shed light on which components of invertebrate defense underlie genetic specificity. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  10. Small heat shock protein 27: An effective adjuvant for enhancement of HIV-1 Nef antigen-specific immunity.

    PubMed

    Milani, Alireza; Bolhassani, Azam; Shahbazi, Sepideh; Motevalli, Fatemeh; Sadat, Seyed Mehdi; Soleymani, Sepehr

    2017-11-01

    Novel vaccine modalities have been designed to improve the efficiency of vaccines against HIV infections. In this way, the HIV-1 Nef protein has been known as an attractive antigenic candidate in therapeutic vaccine development. Moreover, the endogenous adjuvants such as heat shock proteins (HSPs) and high mobility group box 1 protein (HMGB1) have been suggested effectively to induce antigen-specific humoral and cellular immune responses. In this study, different Nef DNA and protein constructs were produced in eukaryotic and prokaryotic expression systems, and their immunostimulatory properties were evaluated using small heat shock protein 27 (Hsp27) and the HMGB1-derived peptide (Hp91) in a mouse model. Generally, our results indicated that the Hsp27-Nef fusion DNA or protein could significantly elicit higher humoral and cellular immune responses than Nef DNA or protein, respectively. Analysis of the immune responses demonstrated that the Hsp27-Nef fusion protein, and also the mixture of Nef and Hp91 significantly enhanced the Nef-specific T cell responses. Indeed, these regimens induced high levels of IgG2a and IFN-γ directed toward Th1 responses and also Granzyme B secretion as compared to other immunization strategies. The immunostimulatory properties of Freund's adjuvant were significantly less than Hsp27 and Hp91 peptide in various immunization strategies. These findings showed that the use of Hsp27 and Hp91 in protein strategy could improve HIV-1 Nef-specific B- and T-cell immune responses, and also represent a promising HIV-1 vaccine candidate in future. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  11. Novel mucosal DNA-MVA HIV vaccination in which DNA-IL-12 plus cholera toxin B subunit (CTB) cooperates to enhance cellular systemic and mucosal genital tract immunity.

    PubMed

    Maeto, Cynthia; Rodríguez, Ana María; Holgado, María Pía; Falivene, Juliana; Gherardi, María Magdalena

    2014-01-01

    Induction of local antiviral immune responses at the mucosal portal surfaces where HIV-1 and other viral pathogens are usually first encountered remains a primary goal for most vaccines against mucosally acquired viral infections. Exploring mucosal immunization regimes in order to find optimal vector combinations and also appropriate mucosal adjuvants in the HIV vaccine development is decisive. In this study we analyzed the interaction of DNA-IL-12 and cholera toxin B subunit (CTB) after their mucosal administration in DNA prime/MVA boost intranasal regimes, defining the cooperation of both adjuvants to enhance immune responses against the HIV-1 Env antigen. Our results demonstrated that nasal mucosal DNA/MVA immunization schemes can be effectively improved by the co-delivery of DNA-IL-12 plus CTB inducing elevated HIV-specific CD8 responses in spleen and more importantly in genital tract and genito-rectal draining lymph nodes. Remarkably, these CTL responses were of superior quality showing higher avidity, polyfunctionality and a broader cytokine profile. After IL-12+CTB co-delivery, the cellular responses induced showed an enhanced breadth recognizing with higher efficiency Env peptides from different subtypes. Even more, an in vivo CTL cytolytic assay demonstrated the higher specific CD8 T-cell performance after the IL-12+CTB immunization showing in an indirect manner its potential protective capacity. Improvements observed were maintained during the memory phase where we found higher proportions of specific central memory and T memory stem-like cells T-cell subpopulations. Together, our data show that DNA-IL-12 plus CTB can be effectively employed acting as mucosal adjuvants during DNA prime/MVA boost intranasal vaccinations, enhancing magnitude and quality of HIV-specific systemic and mucosal immune responses.

  12. T-cell Responses to HSV-1 in Persons Who Have Survived Childhood Herpes Simplex Encephalitis.

    PubMed

    Ott, Mariliis; Jing, Lichen; Lorenzo, Lazaro; Casanova, Jean-Laurent; Zhang, Shen-Ying; Koelle, David M

    2017-08-01

    Herpes simplex encephalitis (HSE) after primary herpes simplex virus (HSV)-1 infection can occur in children due to inborn errors of cell-intrinsic immunity in the central nervous system. Paradoxically, symptomatic mucocutaneous HSV-1 recurrences are rare survivors of childhood HSE. T-cell-acquired immunity is thought to be involved in control of recurrent mucocutaneous HSV infection. We thus tested HSV-1-specific immunity in HSE survivors. We obtained serum and peripheral blood mononuclear cells (PBMCs) from participants a median of 13.5 years after HSE. HSV-1 and HSV-2 IgG was detected by type-specific immunoblot. PBMCs from subjects passing quality control criteria were tested using enzyme-linked immunospot assay for CD4 interferon-γ responses with an HSV-1 lysate and for CD8 responses using pooled synthetic HSV-1 peptide CD8 T-cell epitopes. Healthy adult PBMCs were used to standardize assays and as comparators. All participants were HSV-1 seropositive. Most (23/24) HSE survivors had human leukocyte antigen class I types matching the human leukocyte antigen restriction of the pooled peptides. We detected HSV-specific CD8 T-cell responses in 14 of 24 (58%) HSE survivors and in 9 of 9 healthy HSV-1 seropositive adults. HSV-specific CD4 T-cell responses were present in all 5 HSE subjects tested and in 8 of 9 healthy adults. Response magnitudes were overlapping between subject groups. The defects in cell-intrinsic immunity leading to failure to control primary central nervous system HSV-1 infection do not preclude the acquisition of specific immunity or the control of recurrent mucocutaneous HSV infections. The rarity and lack of severe or recurrent mucocutaneous HSV infection in survivors of childhood HSE corresponds with intact adaptive T-cell immunity.

  13. Methods and Protocols for Developing Prion Vaccines.

    PubMed

    Marciniuk, Kristen; Taschuk, Ryan; Napper, Scott

    2016-01-01

    Prion diseases denote a distinct form of infectivity that is based in the misfolding of a self-protein (PrP(C)) into a pathological, infectious conformation (PrP(Sc)). Efforts to develop vaccines for prion diseases have been complicated by the potential dangers that are associated with induction of immune responses against a self-protein. As a consequence, there is considerable appeal for vaccines that specifically target the misfolded prion conformation. Such conformation-specific immunotherapy is made possible through the identification of vaccine targets (epitopes) that are exclusively presented as a consequence of misfolding. An immune response directed against these targets, termed disease-specific epitopes (DSEs), has the potential to spare the function of the native form of the protein while clearing, or neutralizing, the infectious isomer. Although identification of DSEs represents a critical first step in the induction of conformation-specific immune responses, substantial efforts are required to translate these targets into functional vaccines. Due to the poor immunogenicity that is inherent to self-proteins, and that is often associated with short peptides, substantial efforts are required to overcome tolerance-to-self and maximize the resultant immune response following DSE-based immunization. This often includes optimization of target sequences in terms of immunogenicity and development of effective formulation and delivery strategies for the associated peptides. Further, these vaccines must satisfy additional criteria from perspectives of specificity (PrP(C) vs. PrP(Sc)) and safety (antibody-induced template-driven misfolding of PrP(C)). The emphasis of this report is on the steps required to translate DSEs into prion vaccines and subsequent evaluation of the resulting immune responses.

  14. Immunization with Brucella VirB Proteins Reduces Organ Colonization in Mice through a Th1-Type Immune Response and Elicits a Similar Immune Response in Dogs

    PubMed Central

    Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.

    2014-01-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276

  15. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.

    PubMed

    Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C

    2015-03-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. New generation of oral mucosal vaccines targeting dendritic cells

    PubMed Central

    Owen, Jennifer L.; Sahay, Bikash; Mohamadzadeh, Mansour

    2013-01-01

    As most infectious organisms gain entry at mucosal surfaces, there is a great deal of interest in developing vaccines that elicit effective mucosal immune responses against pathogen challenge. Targeted vaccination is one of the most effective methods available to prevent and control infectious diseases. Mucosal vaccines can offer lower costs, better accessibility, needle free delivery, and a higher capacity for mass immunizations during pandemics. Both local mucosal immunity and robust systemic responses can be achieved through mucosal vaccination. Recent progress in understanding the molecular and cellular components of the mucosal immune system have allowed for the development of a novel mucosal vaccine platform utilizing specific dendritic cell-targeting peptides and orally administered lactobacilli to elicit efficient antigen specific immune responses against infections, including B. anthracis in experimental models of disease. PMID:23835515

  17. Long-term clinical and immunological effects of p53-SLP® vaccine in patients with ovarian cancer.

    PubMed

    Leffers, Ninke; Vermeij, Renee; Hoogeboom, Baukje-Nynke; Schulze, Ute R; Wolf, Rinze; Hamming, Ineke E; van der Zee, Ate G; Melief, Kees J; van der Burg, Sjoerd H; Daemen, Toos; Nijman, Hans W

    2012-01-01

    Vaccine-induced p53-specific immune responses were previously reported to be associated with improved response to secondary chemotherapy in patients with small cell lung cancer. We investigated long-term clinical and immunological effects of the p53-synthetic long peptide (p53-SLP®) vaccine in patients with recurrent ovarian cancer. Twenty patients were immunized with the p53-SLP® vaccine between July 2006 and August 2007. Follow-up information on patients was obtained. Clinical responses to secondary chemotherapy after p53-SLP® immunizations were determined by computerized tomography and/or tumor marker levels (CA125). Disease-specific survival was compared to a matched historical control group. Immune responses were analyzed by flow cytometry, proliferation assay, interferon gamma (IFN-γ) ELISPOT and/or cytokine bead array. Lymphocytes cultured from skin biopsy were analyzed by flow cytometry and proliferation assay. Of 20 patients treated with the p53-SLP® vaccine, 17 were subsequently treated with chemotherapy. Eight of these patients volunteered another blood sample. No differences in clinical response rates to secondary chemotherapy or disease-specific survival were observed between immunized patients and historical controls (p = 0.925, resp. p = 0.601). p53-specific proliferative responses were observed in 5/8 patients and IFN-γ production in 2/7 patients. Lymphocytes cultured from a prior injection site showing inflammation during chemotherapy did not recognize p53-SLP®. Thus, treatment with the p53-SLP® vaccine does not affect responses to secondary chemotherapy or survival, although p53-specific T-cells do survive chemotherapy. Copyright © 2011 UICC.

  18. Nasal and skin delivery of IC31(®)-adjuvanted recombinant HSV-2 gD protein confers protection against genital herpes.

    PubMed

    Wizel, Benjamin; Persson, Josefine; Thörn, Karolina; Nagy, Eszter; Harandi, Ali M

    2012-06-19

    Genital herpes caused by herpes simplex virus type 2 (HSV-2) remains the leading cause of genital ulcers worldwide. Given the disappointing results of the recent genital herpes vaccine trials in humans, development of novel vaccine strategies capable of eliciting protective mucosal and systemic immune responses to HSV-2 is urgently required. Here we tested the ability of the adjuvant IC31(®) in combination with HSV-2 glycoprotein D (gD) used through intranasal (i.n.), intradermal (i.d.), or subcutaneous (s.c.) immunization routes for induction of protective immunity against genital herpes infection in C57BL/6 mice. Immunization with gD plus IC31(®) through all three routes of immunization developed elevated gD-specific serum antibody responses with HSV-2 neutralizing activity. Whereas the skin routes promoted the induction of a mixed IgG2c/IgG1 isotype profile, the i.n. route only elicited IgG1 antibodies. All immunization routes were able to induce gD-specific IgG antibody responses in the vaginas of mice immunized with IC31(®)-adjuvanted gD. Although specific lymphoproliferative responses were observed in splenocytes from mice of most groups vaccinated with IC31(®)-adjuvanted gD, only i.d. immunization resulted in a significant splenic IFN-γ response. Further, immunization with gD plus IC31(®) conferred 80-100% protection against an otherwise lethal vaginal HSV-2 challenge with amelioration of viral replication and disease severity in the vagina. These results warrant further exploration of IC31(®) for induction of protective immunity against genital herpes and other sexually transmitted infections. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Mucosal Immunization with Newcastle Disease Virus Vector Coexpressing HIV-1 Env and Gag Proteins Elicits Potent Serum, Mucosal, and Cellular Immune Responses That Protect against Vaccinia Virus Env and Gag Challenges.

    PubMed

    Khattar, Sunil K; Manoharan, Vinoth; Bhattarai, Bikash; LaBranche, Celia C; Montefiori, David C; Samal, Siba K

    2015-07-21

    Newcastle disease virus (NDV) avirulent strain LaSota was used to coexpress gp160 Env and p55 Gag from a single vector to enhance both Env-specific and Gag-specific immune responses. The optimal transcription position for both Env and Gag genes in the NDV genome was determined by generating recombinant NDV (rNDV)-Env-Gag (gp160 located between the P and M genes and Gag between the HN and L genes), rNDV-Gag-Env (Gag located between the P and M genes and gp160 between the HN and L genes), rNDV-Env/Gag (gp160 followed by Gag located between the P and M genes), and rNDV-Gag/Env (Gag followed by gp160 located between the P and M genes). All the recombinant viruses replicated at levels similar to those seen with parental NDV in embryonated chicken eggs and in chicken fibroblast cells. Both gp160 and Gag proteins were expressed at high levels in cell culture, with gp160 found to be incorporated into the envelope of NDV. The Gag and Env proteins expressed by all the recombinants except rNDV-Env-Gag self-assembled into human immunodeficiency virus type 1 (HIV-1) virus-like particles (VLPs). Immunization of guinea pigs by the intranasal route with these rNDVs produced long-lasting Env- and Gag-specific humoral immune responses. The Env-specific humoral and mucosal immune responses and Gag-specific humoral immune responses were higher in rNDV-Gag/Env and rNDV-Env/Gag than in the other recombinants. rNDV-Gag/Env and rNDV-Env/Gag were also more efficient in inducing cellular as well as protective immune responses to challenge with vaccinia viruses expressing HIV-1 Env and Gag in mice. These results suggest that vaccination with a single rNDV coexpressing Env and Gag represents a promising strategy to enhance immunogenicity and protective efficacy against HIV. A safe and effective vaccine that can induce both systemic and mucosal immune responses is needed to control HIV-1. In this study, we showed that coexpression of Env and Gag proteins of HIV-1 performed using a single Newcastle disease virus (NDV) vector led to the formation of HIV-1 virus-like particles (VLPs). Immunization of guinea pigs with recombinant NDVs (rNDVs) elicited potent long-lasting systemic and mucosal immune responses to HIV. Additionally, the rNDVs were efficient in inducing cellular immune responses to HIV and protective immunity to challenge with vaccinia viruses expressing HIV Env and Gag in mice. These results suggest that the use of a single NDV expressing Env and Gag proteins simultaneously is a novel strategy to develop a safe and effective vaccine against HIV. Copyright © 2015 Khattar et al.

  20. Tissue-enriched expression profiles in Aedes aegypti identify hemocyte-specific transcriptome responses to infection

    PubMed Central

    Choi, Young-Jun; Fuchs, Jeremy F.; Mayhew, George F.; Yu, Helen E.; Christensen, Bruce M.

    2012-01-01

    Hemocytes are integral components of mosquito immune mechanisms such as phagocytosis, melanization, and production of antimicrobial peptides. However, our understanding of hemocyte-specific molecular processes and their contribution to shaping the host immune response remains limited. To better understand the immunophysiological features distinctive of hemocytes, we conducted genome-wide analysis of hemocyte-enriched transcripts, and examined how tissue-enriched expression patterns change with the immune status of the host. Our microarray data indicate that the hemocyte-enriched trascriptome is dynamic and context-dependent. Analysis of transcripts enriched after bacterial challenge in circulating hemocytes with respect to carcass added a dimension to evaluating infection-responsive genes and immune-related gene families. We resolved patterns of transcriptional change unique to hemocytes from those that are likely shared by other immune responsive tissues, and identified clusters of genes preferentially induced in hemocytes, likely reflecting their involvement in cell type specific functions. In addition, the study revealed conserved hemocyte-enriched molecular repertoires which might be implicated in core hemocyte function by cross-species meta-analysis of microarray expression data from Anopheles gambiae and Drosophila melanogaster. PMID:22796331

  1. OAS single-nucleotide polymorphisms and haplotypes are associated with variations in immune responses to rubella vaccine

    PubMed Central

    Haralambieva, Iana H.; Dhiman, Neelam; Ovsyannikova, Inna G.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2010-01-01

    Interferon (IFN)-induced antiviral genes are crucial players in innate antiviral defense and potential determinants of immune response heterogeneity. We selected 114 candidate SNPs from 12 antiviral genes using an LD tagSNP selection approach and genotyped them in a cohort of 738 schoolchildren immunized with two doses of rubella vaccine. Associations between SNPs/haplotypes and rubella virus-specific immune measures were assessed using linear regression methodologies. We identified 23 significant associations (p<0.05) between polymorphisms within the 2′-5′-oligoadenylate synthetase (OAS) gene cluster, and rubella virus-specific IL-2, IL-10, IL-6 secretion and antibody levels. The minor allele variants of three OAS1 SNPs (rs3741981/Ser162Gly, rs1051042/Thr361Arg, rs2660), located in a linkage disequilibrium block of functional importance, were significantly associated with an increase in rubella virus-specific IL-2/Th1 response (p≤0.024). Seven OAS1 and OAS3 promoter/regulatory SNPs were similarly associated with IL-2 secretion. Importantly, two SNPs (rs3741981 and rs10774670), independently cross-regulated rubella virus-specific IL-10 secretion levels (p≤0.031). Furthermore, both global tests and individual haplotype analyses revealed significant associations between OAS1 haplotypes and rubella virus-specific cytokine secretion. Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine. PMID:20079393

  2. Immunobiology of HPV and HPV vaccines.

    PubMed

    Stanley, Margaret

    2008-05-01

    Genital human papillomavirus (HPV) infection with both low- and high-risk types is common, but most infections resolve as a result of a cell-mediated immune response. Failure to induce an effective immune response is related to inefficient activation of innate immunity and ineffective priming of the adaptive immune response; this defective immune response facilitates viral persistence, a key feature of high-risk HPV infection. This milieu becomes operationally HPV antigen tolerant, and the host's defenses become irrevocably compromised. HPV antigen-specific effector cells are poorly recruited to the infected focus and their activity is downregulated; neoplastic HPV containing cervical keratinocytes expressing high levels of E6 and E7 oncoproteins are not killed in this immunosuppressive, tolerant milieu, and progression to high-grade disease and cancer can result. Highly efficacious prophylactic HPV L1 virus-like particle (VLP) vaccines circumvent viral epithelial evasion strategies since they are delivered by intramuscular injection. The stromal dendritic cells of the muscle that encounter the highly immunogenic repeat structure of the VLP then migrate with their cargo to the lymph node, initiating an immune cascade that results in a robust T-cell dependent B-cell response, which generates high levels of L1-specific serum neutralizing antibodies and immune memory.

  3. Characterization of the immune response to canine parvovirus induced by vaccination with chimaeric plant viruses.

    PubMed

    Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D

    2002-06-21

    NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.

  4. Experimental Rhodococcus equi and equine infectious anemia virus DNA vaccination in adult and neonatal horses: Effect of IL-12, dose, and route

    PubMed Central

    Mealey, R.H.; Stone, D.M.; Hines, M.T.; Alperin, D.C.; Littke, M.H.; Leib, S.R.; Leach, S.E.; Hines, S.A.

    2012-01-01

    Improving the ability of DNA-based vaccines to induce potent Type1/Th1 responses against intracellular pathogens in large outbred species is essential. Rhodoccocus equi and equine infectious anemia virus (EIAV) are two naturally occurring equine pathogens that also serve as important large animal models of neonatal immunity and lentiviral immune control. Neonates present a unique challenge for immunization due to their diminished immunologic capabilities and apparent Th2 bias. In an effort to augment R. equi- and EIAV-specific Th1 responses induced by DNA vaccination, we hypothesized that a dual promoter plasmid encoding recombinant equine IL-12 (rEqIL-12) would function as a molecular adjuvant. In adult horses, DNA vaccines induced R. equi- and EIAV-specific antibody and lymphoproliferative responses, and EIAV-specific CTL and tetramer-positive CD8+ T lymphocytes. These responses were not enhanced by the rEqIL-12 plasmid. In neonatal foals, DNA immunization induced EIAV-specific antibody and lymphoproliferative responses, but not CTL. The R. equi vapA vaccine was poorly immunogenic in foals even when co-administered with the IL-12 plasmid. It was concluded that DNA immunization was capable of inducing Th1 responses in horses; dose and route were significant variables, but rEqIL-12 was not an effective molecular adjuvant. Additional work is needed to optimize DNA vaccine-induced Th1 responses in horses, especially in neonates. PMID:17889970

  5. Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus

    PubMed Central

    Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

    2017-01-01

    BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244

  6. [Immune response induced by HIV DNA vaccine combined with recombinant adeno-associated virus].

    PubMed

    Liu, Yan-zheng; Zhou, Ling; Wang, Qi; Ye, Shu-qing; Li, Hong-xia; Zeng, Yi

    2004-09-01

    HIV-1 DNA vaccine and recombinant adeno-associated virus (rAAV) expressing gagV3 gene of HIV-1 subtype B were constructed and BALB/c mice were immunized by vaccination regimen consisting of consecutive priming with DNA vaccine and boosting with rAAV vaccine; the CTL and antibody response were detected and compared with those induced by DNA vaccine or rAAV vaccine separately. HIV-1 subtype B gagV3 gene was inserted into the polyclonal site of plasmid pCI-neo, DNA vaccine pCI-gagV3 was thereby constructed; pCI-gagV3 was transfected into p815 cells, G-418-resistant cells were obtained through screening transfected cells with G418, the expression of HIV-1 antigen in G-418-resistant cells was detected by EIA; BALB/c mice were immunized with pCI-gagV3 and the immune response was tested; BALB/c mouse immunized with pCI-gagV3 and combined with rAAV expressing the same gagV3 genes were tested for antibody level in sera by EIA method and cytotoxicity response by LDH method. pCI-gagV3 could express HIV-1 gene in p815 cells; pCI-gagV3 could induce HIV-1 specific humoral and cell-mediated immune response in BALB/c mice. The HIV-1 specific antibody level was 1/20; when the ratio of effector cells: target cells was 50:1, the average specific cytotoxicity was 41.7%; there was no evident increase in the antibody level induced by pCI-gagV3 combined with rAAV, but there was increase in CTL response, the average specific cytotoxicity was 61.3% when effector cells: target cells ratio was 50:1. HIV-1 specific cytotoxicity in BALB/c mice can be increased by immunization of BALB/c mice with DNA vaccine combined with rAAV vaccine.

  7. Associations between race, sex and immune response variations to rubella vaccination in two independent cohorts

    PubMed Central

    Haralambieva, Iana H.; Salk, Hannah M.; Lambert, Nathaniel D.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Warner, Nathaniel D.; Pankratz, V.Shane; Poland, Gregory A.

    2014-01-01

    Introduction Immune response variations after vaccination are influenced by host genetic factors and demographic variables, such as race, ethnicity and sex. The latter have not been systematically studied in regard to live rubella vaccine, but are of interest for developing next generation vaccines for diverse populations, for predicting immune responses after vaccination, and for better understanding the variables that impact immune response. Methods We assessed associations between demographic variables, including race, ethnicity and sex, and rubella-specific neutralizing antibody levels and secreted cytokines (IFN! , IL-6) in two independent cohorts (1,994 subjects), using linear and linear mixed models approaches, and genetically defined racial and ethnic categorizations. Results Our replicated findings in two independent, large, racially diverse cohorts indicate that individuals of African descent have significantly higher rubella-specific neutralizing antibody levels compared to individuals of European descent and/or Hispanic ethnicity (p! 0.001). Conclusion Our study provides consistent evidence for racial/ethnic differences in humoral immune response following rubella vaccination. PMID:24530932

  8. Boosting BCG-primed responses with a subunit Apa vaccine during the waning phase improves immunity and imparts protection against Mycobacterium tuberculosis

    PubMed Central

    Nandakumar, Subhadra; Kannanganat, Sunil; Dobos, Karen M.; Lucas, Megan; Spencer, John S.; Amara, Rama Rao; Plikaytis, Bonnie B.; Posey, James E.; Sable, Suraj B.

    2016-01-01

    Heterologous prime–boosting has emerged as a powerful vaccination approach against tuberculosis. However, optimal timing to boost BCG-immunity using subunit vaccines remains unclear in clinical trials. Here, we followed the adhesin Apa-specific T-cell responses in BCG-primed mice and investigated its BCG-booster potential. The Apa-specific T-cell response peaked 32–52 weeks after parenteral or mucosal BCG-priming but waned significantly by 78 weeks. A subunit-Apa-boost during the contraction-phase of BCG-response had a greater effect on the magnitude and functional quality of specific cellular and humoral responses compared to a boost at the peak of BCG-response. The cellular response increased following mucosal BCG-prime–Apa-subunit-boost strategy compared to Apa-subunit-prime–BCG-boost approach. However, parenteral BCG-prime–Apa-subunit-boost by a homologous route was the most effective strategy in-terms of enhancing specific T-cell responses during waning in the lung and spleen. Two Apa-boosters markedly improved waning BCG-immunity and significantly reduced Mycobacterium tuberculosis burdens post-challenge. Our results highlight the challenges of optimization of prime–boost regimens in mice where BCG drives persistent immune-activation and suggest that boosting with a heterologous vaccine may be ideal once the specific persisting effector responses are contracted. Our results have important implications for design of prime–boost regimens against tuberculosis in humans. PMID:27173443

  9. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  10. Fallen Angels or Risen Apes? A Tale of the Intricate Complexities of Imbalanced Immune Responses in the Pathogenesis and Progression of Immune-Mediated and Viral Cancers

    PubMed Central

    Ondondo, Beatrice Omusiro

    2014-01-01

    Excessive immune responses directed against foreign pathogens, self-antigens, or commensal microflora can cause cancer establishment and progression if the execution of tight immuno-regulatory mechanisms fails. On the other hand, induction of potent tumor antigen-specific immune responses together with stimulation of the innate immune system is a pre-requisite for effective anti-tumor immunity, and if suppressed by the strong immuno-regulatory mechanisms can lead to cancer progression. Therefore, it is crucial that the inevitable co-existence of these fundamental, yet conflicting roles of immune-regulatory cells is carefully streamlined as imbalances can be detrimental to the host. Infection with chronic persistent viruses is characterized by severe immune dysfunction resulting in T cell exhaustion and sometimes deletion of antigen-specific T cells. More often, this is due to increased immuno-regulatory processes, which are triggered to down-regulate immune responses and limit immunopathology. However, such heightened levels of immune disruption cause a concomitant loss of tumor immune-surveillance and create a permissive microenvironment for cancer establishment and progression, as demonstrated by increased incidences of cancer in immunosuppressed hosts. Paradoxically, while some cancers arise as a consequence of increased immuno-regulatory mechanisms that inhibit protective immune responses and impinge on tumor surveillance, other cancers arise due to impaired immuno-regulatory mechanisms and failure to limit pathogenic inflammatory responses. This intricate complexity, where immuno-regulatory cells can be beneficial in certain immune settings but detrimental in other settings underscores the need for carefully formulated interventions to equilibrate the balance between immuno-stimulatory and immuno-regulatory processes. PMID:24639678

  11. Effect of nanovaccine chemistry on humoral immune response kinetics and maturation

    NASA Astrophysics Data System (ADS)

    Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji

    2014-10-01

    Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses. Electronic supplementary information (ESI) available: Fig. S1. See DOI: 10.1039/c4nr03724c

  12. Nasal Immunization Confers High Avidity Neutralizing Antibody Response and Immunity to Primary and Recurrent Genital Herpes in Guinea Pigs

    PubMed Central

    Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A.; Thörn, Karolina; Cairns, Tina M.; Wegmann, Frank; Sattentau, Quentin J.; Eisenberg, Roselyn J.; Cohen, Gary H.; Harandi, Ali M.

    2016-01-01

    Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes. PMID:28082979

  13. Nasal Immunization Confers High Avidity Neutralizing Antibody Response and Immunity to Primary and Recurrent Genital Herpes in Guinea Pigs.

    PubMed

    Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A; Thörn, Karolina; Cairns, Tina M; Wegmann, Frank; Sattentau, Quentin J; Eisenberg, Roselyn J; Cohen, Gary H; Harandi, Ali M

    2016-01-01

    Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes.

  14. How do plants achieve immunity? Defence without specialized immune cells.

    PubMed

    Spoel, Steven H; Dong, Xinnian

    2012-01-25

    Vertebrates have evolved a sophisticated adaptive immune system that relies on an almost infinite diversity of antigen receptors that are clonally expressed by specialized immune cells that roam the circulatory system. These immune cells provide vertebrates with extraordinary antigen-specific immune capacity and memory, while minimizing self-reactivity. Plants, however, lack specialized mobile immune cells. Instead, every plant cell is thought to be capable of launching an effective immune response. So how do plants achieve specific, self-tolerant immunity and establish immune memory? Recent developments point towards a multilayered plant innate immune system comprised of self-surveillance, systemic signalling and chromosomal changes that together establish effective immunity.

  15. Immunization of neonatal mice with LAMP/p55 HIV gag DNA elicits robust immune responses that last to adulthood

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia

    2010-10-10

    Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less

  16. Synthetic immunology: modulating the human immune system.

    PubMed

    Geering, Barbara; Fussenegger, Martin

    2015-02-01

    Humans have manipulated the immune system to dampen or boost the immune response for thousands of years. As our understanding of fundamental immunology and biotechnological methodology accumulates, we can capitalize on this combined knowledge to engineer biological devices with the aim of rationally manipulating the immune response. We address therapeutic approaches based on the principles of synthetic immunology that either ameliorate disorders of the immune system by interfering with the immune response, or improve diverse pathogenic conditions by exploiting immune cell effector functions. We specifically highlight synthetic proteins investigated in preclinical and clinical trials, summarize studies that have used engineered immune cells, and finish with a discussion of possible future therapeutic concepts. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

    PubMed Central

    Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates

    2011-01-01

    A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877

  18. Trans-nodal migration of resident dendritic cells into medullary interfollicular regions initiates immunity to influenza vaccine

    PubMed Central

    Woodruff, Matthew C.; Heesters, Balthasar A.; Herndon, Caroline N.; Groom, Joanna R.; Thomas, Paul G.; Luster, Andrew D.; Turley, Shannon J.

    2014-01-01

    Dendritic cells (DCs) are well established as potent antigen-presenting cells critical to adaptive immunity. In vaccination approaches, appropriately stimulating lymph node–resident DCs (LNDCs) is highly relevant to effective immunization. Although LNDCs have been implicated in immune response, their ability to directly drive effective immunity to lymph-borne antigen remains unclear. Using an inactive influenza vaccine model and whole node imaging approaches, we observed surprising responsiveness of LNDC populations to vaccine arrival resulting in a transnodal repositioning into specific antigen collection sites within minutes after immunization. Once there, LNDCs acquired viral antigen and initiated activation of viral specific CD4+ T cells, resulting in germinal center formation and B cell memory in the absence of skin migratory DCs. Together, these results demonstrate an unexpected stimulatory role for LNDCs where they are capable of rapidly locating viral antigen, driving early activation of T cell populations, and independently establishing functional immune response. PMID:25049334

  19. Negative regulators of the RIG-I-like receptor signaling pathway

    PubMed Central

    Quicke, Kendra M.; Diamond, Michael S.; Suthar, Mehul S.

    2017-01-01

    SUMMARY Upon recognition of specific molecular patterns on viruses, bacteria and fungi, host cells trigger an innate immune response, which culminates in the production of type I interferons (IFN), pro-inflammatory cytokines and chemokines, and restricts pathogen replication and spread within the host. At each stage of the immune response, there are stimulatory and inhibitory signals that regulate the magnitude, quality, and character of the response. Positive regulation promotes an antiviral state to control and eventually clear infection whereas negative regulation dampens inflammation and prevents immune-mediated tissue damage. An over-exuberant innate immune response can lead to the destruction of cells and tissues, and the development of spontaneous autoimmunity. The RIG-I-like receptors (RLRs) retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5) belong to a family of cytosolic host RNA helicases that recognize distinct non-self RNA signatures and trigger innate immune responses against several RNA virus infections. The RLR signaling pathway is tightly regulated to achieve a well-orchestrated response aimed at maximizing antiviral immunity and minimizing immune-mediated pathology. This review highlights contemporary findings on negative regulators of the RLR signaling pathway, with specific focus on the proteins and biological processes that directly regulate RIG-I, MDA5 and MAVS function. PMID:28295214

  20. pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity.

    PubMed

    Yuba, Eiji; Sakaguchi, Naoki; Kanda, Yuhei; Miyazaki, Maiko; Koiwai, Kazunori

    2017-11-04

    (1) Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC) and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2) Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3) Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA) into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4) Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.

  1. Suppression of allergic airway inflammation in a mouse model by Der p2 recombined BCG.

    PubMed

    Ou-Yang, Hai-Feng; Hu, Xing-Bin; Ti, Xin-Yu; Shi, Jie-Ran; Li, Shu-Jun; Qi, Hao-Wen; Wu, Chang-Gui

    2009-09-01

    Allergic asthma is a chronic inflammatory disease mediated by T helper (Th)2 cell immune responses. Currently, immunotherapies based on both immune deviation and immune suppression, including the development of recombinant mycobacteria as immunoregulatory vaccines, are attractive treatment strategies for asthma. In our previous studies, we created a genetically recombinant form of bacille Calmette-Guerin (rBCG) that expressed Der p2 of house dust mites and established that it induced a shift from a Th2 response to a Th1 response in naive mice. However, it is unclear whether rBCG could suppress allergic airway inflammation in a mouse model. In this article we report that rBCG dramatically inhibited airway inflammation, eosinophilia, mucus production and mast cell degranulation in allergic mice. Analysis of interferon-gamma (IFN-gamma) and interleukin-4 (IL-4) levels in bronchoalveolar lavage fluid (BALF) and lung tissue revealed that the suppression was associated with a shift from a Th2 response to a Th1 response. At the same time, rBCG induced a CD4(+) CD25(+) Foxp3(+) T-cell subtype that could suppress the proliferation of Th2 effector cells in vitro in an antigen-specific manner. Moreover, suppression of CD4(+) CD25(+) T cells could be adoptively transferred. Thus, our results demonstrate that rBCG induces both generic and specific immune responses. The generic immune response is associated with a shift from a Th2 to a Th1 cytokine response, whereas the specific immune response against Der p2 appears to be related to the expansion of transforming growth factor-beta (TGF-beta)-producing CD4(+) CD25(+) Foxp3(+) regulatory T cells. rBCG can suppress asthmatic airway inflammation through both immune deviation and immune suppression and may be a feasible, efficient immunotherapy for asthma.

  2. 'Order from disorder sprung': recognition and regulation in the immune system

    NASA Astrophysics Data System (ADS)

    Mak, Tak W.

    2003-06-01

    Milton's epic poem Paradise lost supplies a colourful metaphor for the immune system and its responses to pathogens. With the role of Satan played by pathogens seeking to destroy the paradise of human health, GOD intervenes and imposes order out of chaos. In this context, GOD means 'generation of diversity': the capacity of the innate and specific immune responses to recognize and eliminate a universe of pathogens. Thus, the immune system can be thought of as an entity that self-assembles the elements required to combat bodily invasion and injury. In so doing, it brings to bear the power of specific recognition: the ability to distinguish self from non-self, and the threatening from the benign. This ability to define and protect self is evolutionarily very old. Self-recognition and biochemical and barrier defences can be detected in primitive organisms, and elements of these mechanisms are built upon in an orderly way to establish the mammalian immune system. Innate immune responses depend on the use of a limited number of germline-encoded receptors to recognize conserved molecular patterns that occur on the surfaces of a broad range of pathogens. The B and T lymphocytes of the specific immune response use complex gene-rearrangement machinery to generate a diversity of antigen receptors capable of recognizing any pathogen in the universe. Binding to receptors on both innate and specific immune-system cells triggers intricate intracellular signalling pathways that lead to new gene transcription and effector-cell activation. And yet, regulation is imposed on these responses so that Paradise is not lost to the turning of the immune system onto self-tissues, the spectre of autoimmunity. Lymphocyte activation requires multiple signals and intercellular interactions. Mechanisms exist to establish tolerance to self by the selection and elimination of cells recognizing self-antigens. Immune system cell populations are reduced by programmed cell death once the pathogen threat is resolved. Once Paradise has been regained, memory cells remain in the body to sharply reduce the impact of a second exposure to a pathogen. Vaccination programs take advantage of this capacity of the human immune system for immunological memory, sparing millions the suffering associated with disease scourges. Thus does the order of the immune response spring from the disorder of pathogen attacks, and thus is Paradise preserved.

  3. 'Order from disorder sprung': recognition and regulation in the immune system.

    PubMed

    Mak, Tak W

    2003-06-15

    Milton's epic poem Paradise lost supplies a colourful metaphor for the immune system and its responses to pathogens. With the role of Satan played by pathogens seeking to destroy the paradise of human health, GOD intervenes and imposes order out of chaos. In this context, GOD means 'generation of diversity': the capacity of the innate and specific immune responses to recognize and eliminate a universe of pathogens. Thus, the immune system can be thought of as an entity that self-assembles the elements required to combat bodily invasion and injury. In so doing, it brings to bear the power of specific recognition: the ability to distinguish self from non-self, and the threatening from the benign. This ability to define and protect self is evolutionarily very old. Self-recognition and biochemical and barrier defences can be detected in primitive organisms, and elements of these mechanisms are built upon in an orderly way to establish the mammalian immune system. Innate immune responses depend on the use of a limited number of germline-encoded receptors to recognize conserved molecular patterns that occur on the surfaces of a broad range of pathogens. The B and T lymphocytes of the specific immune response use complex gene-rearrangement machinery to generate a diversity of antigen receptors capable of recognizing any pathogen in the universe. Binding to receptors on both innate and specific immune-system cells triggers intricate intracellular signalling pathways that lead to new gene transcription and effector-cell activation. And yet, regulation is imposed on these responses so that Paradise is not lost to the turning of the immune system onto self-tissues, the spectre of autoimmunity. Lymphocyte activation requires multiple signals and intercellular interactions. Mechanisms exist to establish tolerance to self by the selection and elimination of cells recognizing self-antigens. Immune system cell populations are reduced by programmed cell death once the pathogen threat is resolved. Once Paradise has been regained, memory cells remain in the body to sharply reduce the impact of a second exposure to a pathogen. Vaccination programs take advantage of this capacity of the human immune system for immunological memory, sparing millions the suffering associated with disease scourges. Thus does the order of the immune response spring from the disorder of pathogen attacks, and thus is Paradise preserved.

  4. Hypothesis: Leukocyte Endogenous Mediator/Endogenous Pyrogen/Lymphocyte-Activating Factor Modulates the Development of Nonspecific and Specific Immunity and Affects Nutritional Status

    DTIC Science & Technology

    1982-04-01

    Hypothesis: leukocyte endogenous mediator/ endogenous pyrogen /lymphocyte-activating factor modulates the development of nonspecific and specific... endogenous pyrogen /lympho- NI cyte-activating factor (LEM/EP/LAF) integrates the host’s nonspecific and specific immune responses to infection by...mediator/ endogenous pyrogen /lymphocyte-activating factor, nonspecific and specific immunity, infection, metabolism, nutrition. Introduction LAF which lead

  5. Immunology and immunity against infection: General rules

    NASA Astrophysics Data System (ADS)

    Zinkernagel, Rolf M.

    2005-12-01

    Simplified and generalizable rules of immune responses against infections or vaccines have been summarized into 20 statements previously (Scand. J. Immunol. 60 (2004) 9-13) and are restated in a slightly different form here. The key terms of immunology (e.g. specificity, tolerance and memory) are explained in terms of their co-evolutionary importance in the equilibrium between infectious agents and diseases with higher vertebrate hosts. Specificity is best defined by protective antibodies or protective activated T cells; e.g. serotype specific neutralizing antibodies against polio viruses represent the discriminatory power of an immune response very well indeed. Tolerance is reviewed in terms of reactivity rather than self-nonself discrimination. Immune respones are deleted against antigens expressed at sufficient levels within the lymphoheamopoetic system, but may well exist at both, the T and the B cell level against antigens strictly outside of secondary lymphatic organs. In this respect the immune system behaves identically against virus infections and against self antigens. Persistent virus infections delete responsive T cells, once eliminated immune T cell responses wane, if a virus keeps outside of secondary lymphatic tissues no immune response is induced. Immunological memory is usually defined as earlier and greater responses but this does not correlate with protective immunity stringently. It is summarized here that pre-existing titers of protective neutralizing antibodies or pre-existence of activated T cells are the correlates of protection acute cytopathic lethal infections and toxins or against intracellular parasites. It is concluded that many discrepancies and uncertainties in immunological research derive from model situations and experimental results that are correctly measured but cannot be related to co-evolutionary contexts, i.e. survival.

  6. Sustained AAV9-mediated expression of a non-self protein in the CNS of non-human primates after immunomodulation

    PubMed Central

    Ramsingh, Arlene I.; Gray, Steven J.; Reilly, Andrew; Koday, Michael; Bratt, Debbie; Koday, Merika Treants; Murnane, Robert; Hu, Yuhui; Messer, Anne

    2018-01-01

    A critical issue in transgene delivery studies is immune reactivity to the transgene- encoded protein and its impact on sustained gene expression. Here, we test the hypothesis that immunomodulation by rapamycin can decrease immune reactivity after intrathecal AAV9 delivery of a transgene (GFP) in non-human primates, resulting in sustained GFP expression in the CNS. We show that rapamycin treatment clearly reduced the overall immunogenicity of the AAV9/GFP vector by lowering GFP- and AAV9-specific antibody responses, and decreasing T cell responses including cytokine and cytolytic effector responses. Spinal cord GFP protein expression was sustained for twelve weeks, with no toxicity. Immune correlates of robust transgene expression include negligible GFP-specific CD4 and CD8 T cell responses, absence of GFP-specific IFN-γ producing T cells, and absence of GFP-specific cytotoxic T cells, which support the hypothesis that decreased T cell reactivity results in sustained transgene expression. These data strongly support the use of modest doses of rapamycin to modulate immune responses for intrathecal gene therapies, and potentially a much wider range of viral vector-based therapeutics. PMID:29874260

  7. Microneedle-mediated transcutaneous immunization with plasmid DNA coated on cationic PLGA nanoparticles

    PubMed Central

    Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A.; Li, Xinran; Zhu, Saijie; Cui, Zhengrong

    2012-01-01

    Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged anoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. PMID:22921518

  8. An Unmutated IgM Response to the Vi Polysaccharide of Salmonella Typhi Contributes to Protective Immunity in a Murine Model of Typhoid.

    PubMed

    Pandya, Kalgi D; Palomo-Caturla, Isabel; Walker, Justin A; K Sandilya, Vijay; Zhong, Zhijiu; Alugupalli, Kishore R

    2018-06-15

    T cell-dependent B cell responses typically develop in germinal centers. Abs generated during such responses are isotype switched and have a high affinity to the Ag because of somatic hypermutation of Ab genes. B cell responses to purified polysaccharides are T cell independent and do not result in the formation of bona fide germinal centers, and the dominant Ab isotype produced during such responses is IgM with very few or no somatic mutations. Activation-induced cytidine deaminase (AID) is required for both somatic hypermutation and Ig isotype switching in humans and mice. To test the extent to which unmutated polysaccharide-specific IgM confers protective immunity, we immunized wildtype and AID -/- mice with either heat-killed Salmonella enterica serovar Typhi ( S. Typhi) or purified Vi polysaccharide (ViPS). We found that wildtype and AID -/- mice immunized with heat-killed S. Typhi generated similar anti-ViPS IgM responses. As expected, wildtype, but not AID -/- mice generated ViPS-specific IgG. However, the differences in the Ab-dependent killing of S. Typhi mediated by the classical pathway of complement activation were not statistically significant. In ViPS-immunized wildtype and AID -/- mice, the ViPS-specific IgM levels and S. Typhi bactericidal Ab titers at 7 but not at 28 d postimmunization were also comparable. To test the protective immunity conferred by these immunizations, mice were challenged with a chimeric S. Typhimurium strain expressing ViPS. Compared with their naive counterparts, immunized wildtype and AID -/- mice exhibited significantly reduced bacterial burden regardless of the route of infection. These data indicate that an unmutated IgM response to ViPS contributes to protective immunity to S. Typhi. Copyright © 2018 by The American Association of Immunologists, Inc.

  9. What vaccination studies tell us about immunological memory within the innate immune system of cultured shrimp and crayfish.

    PubMed

    Chang, Yu-Hsuan; Kumar, Ramya; Ng, Tze Hann; Wang, Han-Ching

    2018-03-01

    The possibility of immunological memory in invertebrates is a topic that has recently attracted a lot of attention. Today, even vertebrates are known to exhibit innate immune responses that show memory-like properties, and since these responses are triggered by cells that are involved in the innate immune system, it seems that immune specificity and immune memory do not necessarily require the presence of B cells and T cells after all. This kind of immune response has been called "immune priming" or "trained immunity". In this report, we review recent observations and our current understanding of immunological memory within the innate immune system in cultured shrimp and crayfish after vaccination with live vaccine, killed vaccine and subunit vaccines. We also discuss the possible mechanisms involved in this immune response. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Distinctive roles of age, sex, and genetics in shaping transcriptional variation of human immune responses to microbial challenges.

    PubMed

    Piasecka, Barbara; Duffy, Darragh; Urrutia, Alejandra; Quach, Hélène; Patin, Etienne; Posseme, Céline; Bergstedt, Jacob; Charbit, Bruno; Rouilly, Vincent; MacPherson, Cameron R; Hasan, Milena; Albaud, Benoit; Gentien, David; Fellay, Jacques; Albert, Matthew L; Quintana-Murci, Lluis

    2018-01-16

    The contribution of host genetic and nongenetic factors to immunological differences in humans remains largely undefined. Here, we generated bacterial-, fungal-, and viral-induced immune transcriptional profiles in an age- and sex-balanced cohort of 1,000 healthy individuals and searched for the determinants of immune response variation. We found that age and sex affected the transcriptional response of most immune-related genes, with age effects being more stimulus-specific relative to sex effects, which were largely shared across conditions. Although specific cell populations mediated the effects of age and sex on gene expression, including CD8 + T cells for age and CD4 + T cells and monocytes for sex, we detected a direct effect of these intrinsic factors for the majority of immune genes. The mapping of expression quantitative trait loci (eQTLs) revealed that genetic factors had a stronger effect on immune gene regulation than age and sex, yet they affected a smaller number of genes. Importantly, we identified numerous genetic variants that manifested their regulatory effects exclusively on immune stimulation, including a Candida albicans -specific master regulator at the CR1 locus. These response eQTLs were enriched in disease-associated variants, particularly for autoimmune and inflammatory disorders, indicating that differences in disease risk may result from regulatory variants exerting their effects only in the presence of immune stress. Together, this study quantifies the respective effects of age, sex, genetics, and cellular heterogeneity on the interindividual variability of immune responses and constitutes a valuable resource for further exploration in the context of different infection risks or disease outcomes. Copyright © 2018 the Author(s). Published by PNAS.

  11. New generation of oral mucosal vaccines targeting dendritic cells.

    PubMed

    Owen, Jennifer L; Sahay, Bikash; Mohamadzadeh, Mansour

    2013-12-01

    As most infectious organisms gain entry at mucosal surfaces, there is a great deal of interest in developing vaccines that elicit effective mucosal immune responses against pathogen challenge. Targeted vaccination is one of the most effective methods available to prevent and control infectious diseases. Mucosal vaccines can offer lower costs, better accessibility, needle free delivery, and a higher capacity for mass immunizations during pandemics. Both local mucosal immunity and robust systemic responses can be achieved through mucosal vaccination. Recent progress in understanding the molecular and cellular components of the mucosal immune system have allowed for the development of a novel mucosal vaccine platform utilizing specific dendritic cell-targeting peptides and orally administered lactobacilli to elicit efficient antigen specific immune responses against infections, including Bacillus anthracis in experimental models of disease. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Mucosal Immunization with Newcastle Disease Virus Vector Coexpressing HIV-1 Env and Gag Proteins Elicits Potent Serum, Mucosal, and Cellular Immune Responses That Protect against Vaccinia Virus Env and Gag Challenges

    PubMed Central

    Khattar, Sunil K.; Manoharan, Vinoth; Bhattarai, Bikash; LaBranche, Celia C.; Montefiori, David C.

    2015-01-01

    ABSTRACT Newcastle disease virus (NDV) avirulent strain LaSota was used to coexpress gp160 Env and p55 Gag from a single vector to enhance both Env-specific and Gag-specific immune responses. The optimal transcription position for both Env and Gag genes in the NDV genome was determined by generating recombinant NDV (rNDV)-Env-Gag (gp160 located between the P and M genes and Gag between the HN and L genes), rNDV-Gag-Env (Gag located between the P and M genes and gp160 between the HN and L genes), rNDV-Env/Gag (gp160 followed by Gag located between the P and M genes), and rNDV-Gag/Env (Gag followed by gp160 located between the P and M genes). All the recombinant viruses replicated at levels similar to those seen with parental NDV in embryonated chicken eggs and in chicken fibroblast cells. Both gp160 and Gag proteins were expressed at high levels in cell culture, with gp160 found to be incorporated into the envelope of NDV. The Gag and Env proteins expressed by all the recombinants except rNDV-Env-Gag self-assembled into human immunodeficiency virus type 1 (HIV-1) virus-like particles (VLPs). Immunization of guinea pigs by the intranasal route with these rNDVs produced long-lasting Env- and Gag-specific humoral immune responses. The Env-specific humoral and mucosal immune responses and Gag-specific humoral immune responses were higher in rNDV-Gag/Env and rNDV-Env/Gag than in the other recombinants. rNDV-Gag/Env and rNDV-Env/Gag were also more efficient in inducing cellular as well as protective immune responses to challenge with vaccinia viruses expressing HIV-1 Env and Gag in mice. These results suggest that vaccination with a single rNDV coexpressing Env and Gag represents a promising strategy to enhance immunogenicity and protective efficacy against HIV. PMID:26199332

  13. HIV Controllers Exhibit Enhanced Frequencies of Major Histocompatibility Complex Class II Tetramer+ Gag-Specific CD4+ T Cells in Chronic Clade C HIV-1 Infection.

    PubMed

    Laher, Faatima; Ranasinghe, Srinika; Porichis, Filippos; Mewalal, Nikoshia; Pretorius, Karyn; Ismail, Nasreen; Buus, Søren; Stryhn, Anette; Carrington, Mary; Walker, Bruce D; Ndung'u, Thumbi; Ndhlovu, Zaza M

    2017-04-01

    Immune control of viral infections is heavily dependent on helper CD4 + T cell function. However, the understanding of the contribution of HIV-specific CD4 + T cell responses to immune protection against HIV-1, particularly in clade C infection, remains incomplete. Recently, major histocompatibility complex (MHC) class II tetramers have emerged as a powerful tool for interrogating antigen-specific CD4 + T cells without relying on effector functions. Here, we defined the MHC class II alleles for immunodominant Gag CD4 + T cell epitopes in clade C virus infection, constructed MHC class II tetramers, and then used these to define the magnitude, function, and relation to the viral load of HIV-specific CD4 + T cell responses in a cohort of untreated HIV clade C-infected persons. We observed significantly higher frequencies of MHC class II tetramer-positive CD4 + T cells in HIV controllers than progressors ( P = 0.0001), and these expanded Gag-specific CD4 + T cells in HIV controllers showed higher levels of expression of the cytolytic proteins granzymes A and B. Importantly, targeting of the immunodominant Gag41 peptide in the context of HLA class II DRB1*1101 was associated with HIV control ( r = -0.5, P = 0.02). These data identify an association between HIV-specific CD4 + T cell targeting of immunodominant Gag epitopes and immune control, particularly the contribution of a single class II MHC-peptide complex to the immune response against HIV-1 infection. Furthermore, these results highlight the advantage of the use of class II tetramers in evaluating HIV-specific CD4 + T cell responses in natural infections. IMPORTANCE Increasing evidence suggests that virus-specific CD4 + T cells contribute to the immune-mediated control of clade B HIV-1 infection, yet there remains a relative paucity of data regarding the role of HIV-specific CD4 + T cells in shaping adaptive immune responses in individuals infected with clade C, which is responsible for the majority of HIV infections worldwide. Understanding the contribution of HIV-specific CD4 + T cell responses in clade C infection is particularly important for developing vaccines that would be efficacious in sub-Saharan Africa, where clade C infection is dominant. Here, we employed MHC class II tetramers designed to immunodominant Gag epitopes and used them to characterize CD4 + T cell responses in HIV-1 clade C infection. Our results demonstrate an association between the frequency of HIV-specific CD4 + T cell responses targeting an immunodominant DRB1*11-Gag41 complex and HIV control, highlighting the important contribution of a single class II MHC-peptide complex to the immune response against HIV-1 infections. Copyright © 2017 American Society for Microbiology.

  14. Enhancing immune responses to inactivated porcine parvovirus oil emulsion vaccine by co-inoculating porcine transfer factor in mice.

    PubMed

    Wang, Rui-ning; Wang, Ya-bin; Geng, Jing-wei; Guo, Dong-hui; Liu, Fang; Chen, Hong-ying; Zhang, Hong-ying; Cui, Bao-an; Wei, Zhan-yong

    2012-07-27

    Inactivated porcine parvovirus (PPV) vaccines are available commercially and widely used in the breeding herds. However, inactivated PPV vaccines have deficiencies in induction of specific cellular immune response. Transfer factor (TF) is a material that obtained from the leukocytes, and is a novel immune-stimulatory reagent that as a modulator of the immune system. In this study, the immunogenicity of PPV oil emulsion vaccine and the immuno-regulatory activities of TF were investigated. The inactivated PPV oil emulsion vaccines with or without TF were inoculated into BALB/c mice by subcutaneous injection. Then humoral and cellular immune responses were evaluated by indirect enzyme-linked immunosorbent assays (ELISA), fluorescence-activated cell sorter analyses (FACS). The results showed that the PPV specific immune responses could be evoked in mice by inoculating with PPV oil emulsion vaccine alone or by co-inoculation with TF. The cellular immune response levels in the co-inoculation groups were higher than those groups receiving the PPV oil emulsion vaccine alone, with the phenomena of higher level of IFN-γ, a little IL-6 and a trace of IL-4 in serum, and a vigorous T-cell response. However, there was no significant difference in antibody titers between TF synergy inactivated vaccine and the inactivated vaccine group (P>0.05). In conclusion, these results suggest that TF possess better cellular immune-enhancing capability and would be exploited into an effective immune-adjuvant for inactivated vaccines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Improved proliferation of antigen-specific cytolytic T lymphocytes using a multimodal nanovaccine

    PubMed Central

    Li, Bo; Siuta, Michael; Bright, Vanessa; Koktysh, Dmitry; Matlock, Brittany K; Dumas, Megan E; Zhu, Meiying; Holt, Alex; Stec, Donald; Deng, Shenglou; Savage, Paul B; Joyce, Sebastian; Pham, Wellington

    2016-01-01

    The present study investigated the immunoenhancing property of our newly designed nanovaccine, that is, its ability to induce antigen-specific immunity. This study also evaluated the synergistic effect of a novel compound PBS-44, an α-galactosylceramide analog, in boosting the immune response induced by our nanovaccine. The nanovaccine was prepared by encapsulating ovalbumin (ova) and an adjuvant within the poly(lactic-co-glycolic acid) nanoparticles. Quantitative analysis of our study data showed that the encapsulated vaccine was physically and biologically stable; the core content of our nanovaccine was found to be released steadily and slowly, and nearly 90% of the core content was slowly released over the course of 25 days. The in vivo immunization studies exhibited that the nanovaccine induced stronger and longer immune responses compared to its soluble counterpart. Similarly, intranasal inhalation of the nanovaccine induced more robust antigen-specific CD8+ T cell response than intraperitoneal injection of nanovaccine. PMID:27895483

  16. Use of a LiESP/QA-21 Vaccine (CaniLeish) Stimulates an Appropriate Th1-Dominated Cell-Mediated Immune Response in Dogs

    PubMed Central

    Moreno, Javier; Vouldoukis, Ioannis; Martin, Virginie; McGahie, David; Cuisinier, Anne-Marie; Gueguen, Sylvie

    2012-01-01

    Canine leishmaniasis is an important zoonotic disease of dogs. The clinical outcome of infection is variable, with the efficiency of the immune response being the key determining factor. There is now a general consensus that a predominant Th1 immune profile in an overall mixed Th1/Th2 response is associated with resistance in dogs, and the absence of a strong Th1 influence is associated with a progression to clinical disease. As a result, there has been a growing demand for vaccines that can induce a specific, strong Th1 response. In this study, we measured the impact of a primary course of a newly available LiESP/QA-21 vaccine on selected humoral and cellular markers of the canine immune response during the onset of immunity. All vaccinated dogs developed a humoral response characterised by IgG2 production. More importantly, vaccinated dogs developed significantly stronger cell-mediated immunity responses than did control dogs. Vaccination induced specific cellular reactivity to soluble Leishmania antigens, with a Leishmania-specific lymphoproliferation (p = 0.0072), characterised by an increased population of T lymphocytes producing IFN-γ (p = 0.0021) and a significant ability of macrophages to reduce intracellular parasite burdens in vitro after co-culture with autologous lymphocytes (p = 0.0014). These responses were correlated with induction of the NOS pathway and production of NO derivatives, which has been shown to be an important leishmanicidal mechanism. These results confirm that vaccination with LiESP/QA-21 induces an appropriate Th1-profile cell-mediated response within three weeks of completing the primary course, and that this response effectively reduces the parasite load in pre-infected macrophages in vitro. PMID:22724031

  17. Modulation of alloimmune response by commensal gut microbiota and potential new avenues to influence the outcome of allogeneic transplantation by modification of the 'gut culture'.

    PubMed

    Kanangat, S

    2017-02-01

    Host defence response against microbial infections was the foundation for the Science of Immunology. Now, we know the mechanisms of such host defence which include innate immune responses that is generally nonspecific but effective in many cases and lead to more specific responses called adaptive immune response. The gene loci of class I, II and III of the major histocompatibility complex (MHC) play a major role in directing the adaptive immune responses by presenting processed antigens to T and B cells to induce appropriate antigen-specific cellular and or humoral immune responses. In humans, these are commonly referred to as human leucocyte antigens class I/II-HLA I/II). The class III region, the gamma region in the MHC complex, is mostly associated with regulation of immune responses along with genes associated with complement activation. The adaptive immune responses are orchestrated by T and B cells that are tuned to respond to antigens that are normally foreign to the body, because these cells are educated to avoid self-antigens by a process of thymic education and selection of the T cells that are mostly non-self-reactive which also helps the B cells in eliciting specific immune responses to non-self-antigens. A by-product of this is the ability of the T and B cells to elicit strong immune responses to foreign HLA/MHC (alloimmune response), which developed into the field of histocompatibility testing for allogeneic transplantation of stem cells and organs. Now, we are beginning to learn that such alloimmune responses can be influenced by the microbiota that symbiotically live in our body especially on the mucosal surfaces and on the skin. This review deals with new and emerging data on how the commensal mucosal and skin microbiota influence the immune homeostasis, and how manipulating the commensal microbiota of the mucosa and skin could influence the survival and long-term functions of the allografts. Also, alterations of the microbiota by the inevitable immunosuppression prior to and following allogeneic transplantation could contribute towards the outcome of the allografts by alloimmune responses generated due to microbial antigen vs HLA cross-reactivity. © 2017 John Wiley & Sons Ltd.

  18. Role of immune system in tumor progression and carcinogenesis.

    PubMed

    Upadhyay, Shishir; Sharma, Nidhi; Gupta, Kunj Bihari; Dhiman, Monisha

    2018-07-01

    Tumor micro-environment has potential to customize the behavior of the immune cell according to their need. In immune-eliminating phase, immune cells eliminate transformed cells but after tumor establishment innate and adaptive immune cells synergistically provide shelter as well as fulfill their requirement that helps in progression. In between eliminating and establishment phase, equilibrium and escaping phase regulate the immune cells response. During immune-escaping, (1) the antigenic response generated is either inadequate, or focused entirely on tolerance, and (2) immune response generated is specific and effective, but the tumor skips immune recognition. In this review, we are discussing the critical role of immune cells and their cytokines before and after the establishment of tumor which might play a critical role during immunotherapy. © 2018 Wiley Periodicals, Inc.

  19. Recombinant poxviruses as mucosal vaccine vectors.

    PubMed

    Gherardi, M Magdalena; Esteban, Mariano

    2005-11-01

    The majority of infections initiate their departure from a mucosal surface, such as Human immunodeficiency virus (HIV), a sexually transmitted virus. Therefore, the induction of mucosal immunity is a high priority in the development of vaccines against mucosal pathogens. The selection of an appropriate antigen delivery system is necessary to induce an efficient mucosal immune response. Poxvirus vectors have been the most intensively studied live recombinant vector, and numerous studies have demonstrated their ability to induce mucosal immune responses against foreign expressed antigens. Previous studies have demonstrated that recombinants based on the attenuated modified vaccinia virus Ankara (MVA) vector were effective in inducing protective responses against different respiratory viruses, such as influenza and respiratory syncytial virus, following immunization via mucosal routes. Recent studies performed in the murine and macaque models have shown that recombinant MVA (rMVA) does not only stimulate HIV-specific immunity in the genital and rectal tracts following mucosal delivery, but can also control simian/human immunodeficiency viraemia and disease progression. In addition, a prime-boost vaccination approach against tuberculosis emphasized the importance of the intranasal rMVA antigen delivery to induce protective immunity against Mycobacterium tuberculosis. The aim of this review is to summarize the studies employing recombinant poxviruses, specifically rMVA as a mucosal delivery vector. The results demonstrate that rMVAs can activate specific immune responses at mucosal surfaces, and encourage further studies to characterize and improve the MVA mucosal immunogenicity of poxvirus vectors.

  20. Parasite genetics and the immune host: recombination between antigenic types of Eimeria maxima as an entrée to the identification of protective antigens.

    PubMed

    Blake, Damer P; Hesketh, Patricia; Archer, Andrew; Carroll, Fionnadh; Smith, Adrian L; Shirley, Martin W

    2004-11-01

    The genomes of protozoan parasites encode thousands of gene products and identification of the subset that stimulates a protective immune response is a daunting task. Most screens for vaccine candidates identify molecules by capacity to induce immune responses rather than protection. This paper describes the core findings of a strategy developed with the coccidial parasite Eimeria maxima to rationally identify loci within its genome that encode immunoprotective antigens. Our strategy uses a novel combination of parasite genetics, DNA fingerprinting, drug-resistance and strain-specific immunity and centres on two strains of E. maxima that each induce a lethal strain-specific protective immune response in the host and show a differential response to anti-Eimeria chemotherapy. Through classical mating studies with these strains we have demonstrated that loci encoding molecules stimulating strain-specific protective immunity or resistance to the anti-coccidial drug robenidine segregate independently. Furthermore, passage of populations of recombinant parasites in the face of killing in the immune host was accompanied by the elimination of some polymorphic DNA markers defining the parent strain used to immunise the host. Consideration of the numbers of parasites recombinant for the two traits implicates very few antigen-encoding loci. Our data provide a potential strategy to identify putative antigen-encoding loci in other parasites.

  1. Influence of bedding type on mucosal immune responses.

    PubMed

    Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E

    2002-10-01

    The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.

  2. Intranasal delivery of recombinant parvovirus-like particles elicits cytotoxic T-cell and neutralizing antibody responses.

    PubMed

    Sedlik, C; Dridi, A; Deriaud, E; Saron, M F; Rueda, P; Sarraseca, J; Casal, J I; Leclerc, C

    1999-04-01

    We previously demonstrated that chimeric porcine parvovirus-like particles (PPV:VLP) carrying heterologous epitopes, when injected intraperitoneally into mice without adjuvant, activate strong CD4(+) and CD8(+) T-cell responses specific for the foreign epitopes. In the present study, we investigated the immunogenicity of PPV:VLP carrying a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus (LCMV) administered by mucosal routes. Mice immunized intranasally with recombinant PPV:VLP, in the absence of adjuvant, developed high levels of PPV-specific immunoglobulin G (IgG) and/or IgA in their serum, as well as in mucosal sites such as the bronchoalveolar and intestinal fluids. Antibodies in sera from mice immunized parenterally or intranasally with PPV:VLP were strongly neutralizing in vitro. Intranasal immunization with PPV:VLP carrying the LCMV CD8(+) T-cell epitope also elicited a strong peptide-specific cytotoxic-T-cell (CTL) response. In contrast, mice orally immunized with recombinant PPV:VLP did not develop any antibody or CTL responses. We also showed that mice primed with PPV:VLP are still able to develop strong CTL responses after subsequent immunization with chimeric PPV:VLP carrying a foreign CD8(+) T-cell epitope. These results highlight the attractive potential of PPV:VLP as a safe, nonreplicating antigen carrier to stimulate systemic and mucosal immunity after nasal administration.

  3. Intranasal Delivery of Recombinant Parvovirus-Like Particles Elicits Cytotoxic T-Cell and Neutralizing Antibody Responses

    PubMed Central

    Sedlik, C.; Dridi, A.; Deriaud, E.; Saron, M. F.; Rueda, P.; Sarraseca, J.; Casal, J. I.; Leclerc, C.

    1999-01-01

    We previously demonstrated that chimeric porcine parvovirus-like particles (PPV:VLP) carrying heterologous epitopes, when injected intraperitoneally into mice without adjuvant, activate strong CD4+ and CD8+ T-cell responses specific for the foreign epitopes. In the present study, we investigated the immunogenicity of PPV:VLP carrying a CD8+ T-cell epitope from the lymphocytic choriomeningitis virus (LCMV) administered by mucosal routes. Mice immunized intranasally with recombinant PPV:VLP, in the absence of adjuvant, developed high levels of PPV-specific immunoglobulin G (IgG) and/or IgA in their serum, as well as in mucosal sites such as the bronchoalveolar and intestinal fluids. Antibodies in sera from mice immunized parenterally or intranasally with PPV:VLP were strongly neutralizing in vitro. Intranasal immunization with PPV:VLP carrying the LCMV CD8+ T-cell epitope also elicited a strong peptide-specific cytotoxic-T-cell (CTL) response. In contrast, mice orally immunized with recombinant PPV:VLP did not develop any antibody or CTL responses. We also showed that mice primed with PPV:VLP are still able to develop strong CTL responses after subsequent immunization with chimeric PPV:VLP carrying a foreign CD8+ T-cell epitope. These results highlight the attractive potential of PPV:VLP as a safe, nonreplicating antigen carrier to stimulate systemic and mucosal immunity after nasal administration. PMID:10074120

  4. Presence of keratin-specific antibody-forming cells in palatine tonsils of patients with pustulosis palmaris et plantaris (PPP) and its correlation with prognosis after tonsillectomy.

    PubMed

    Tanimoto, Yoichiro; Fukuyama, Satoshi; Tanaka, Norimitsu; Ohori, Jun-Ichiro; Tanimoto, Yukari; Kurono, Yuichi

    2014-01-01

    Keratin-specific immune responses in tonsils may be associated with the pathogenesis of pustulosis palmaris et plantaris (PPP). Evaluation of keratin-specific immune responses in tonsils might be useful to predict the effectiveness of tonsillectomy for patients with PPP. The aim of the present study was to clarify the role of keratin-specific immune responses in the pathogenesis of PPP in tonsils. It has been reported that anti-keratin antibodies in serum were higher in patients with PPP and decreased after tonsillectomy, indicating that anti-keratin antibodies might be generated in tonsils. In order to demonstrate the presence of keratin-specific immune responses in tonsils, the numbers of keratin-specific antibody-forming cells (AFCs) in tonsillar and peripheral blood lymphocytes were examined by enzyme-linked immunospot assay. The prognosis of PPP was compared after tonsillectomy. The numbers of keratin-specific IgM and IgG AFCs in tonsils and of IgG AFCs in peripheral blood were significantly increased in patients with PPP. The numbers of keratin-specific IgG AFCs in peripheral blood correlated positively with tonsil and serum IgG antibodies specific to keratin. Our data show that a good prognosis in patients with PPP depended on the numbers of keratin-specific IgG and IgM AFCs in peripheral blood and the levels of keratin-specific IgG antibodies in serum being significantly decreased 6 months after tonsillectomy.

  5. Ultrasound induced cancer immunotherapy.

    PubMed

    Unga, Johan; Hashida, Mitsuru

    2014-06-01

    Recently, the use of ultrasound (US) has been shown to have potential in cancer immunotherapy. High intensity focused US destruction of tumors may lead to immunity forming in situ in the body by immune cells being exposed to the tumor debris and immune stimulatory substances that are present in the tumor remains. Another way of achieving anti-cancer immune responses is by using US in combination with microbubbles and nanobubbles to deliver genes and antigens into cells. US leads to bubble destruction and the forces released to direct delivery of the substances into the cytoplasm of the cells thus circumventing the natural barriers. In this way tumor antigens and antigen-encoding genes can be delivered to immune cells and immune response stimulating genes can be delivered to cancer cells thus enhancing immune responses. Combination of bubbles with cell-targeting ligands and US provides an even more sophisticated delivery system whereby the therapy is not only site specific but also cell specific. In this review we describe how US has been used to achieve immunity and discuss the potential and possible obstacles in future development. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Beta-Amyloid Peptides Enhance the Proliferative Response of Activated CD4+CD28+ Lymphocytes from Alzheimer Disease Patients and from Healthy Elderly

    PubMed Central

    Jóźwik, Agnieszka; Landowski, Jerzy; Bidzan, Leszek; Fülop, Tamas; Bryl, Ewa; Witkowski, Jacek M.

    2012-01-01

    Alzheimer's disease (AD) is the most frequent form of dementia among elderly. Despite the vast amount of literature on non-specific immune mechanisms in AD there is still little information about the potential antigen-specific immune response in this pathology. It is known that early stages of AD include β-amyloid (Aβ)- reactive antibodies production and inflammatory response. Despite some evidence gathered proving cellular immune response background in AD pathology, the specific reactions of CD4+ and CD8+ cells remain unknown as the previous investigations yielded conflicting results. Here we investigated the CD4+CD28+ population of human peripheral blood T cells and showed that soluble β-amyloids alone were unable to stimulate these cells to proliferate significantly, resulting only in minor, probably antigen-specific, proliferative response. On the other hand, the exposure of in vitro pre-stimulated lymphocytes to soluble Aβ peptides significantly enhanced the proliferative response of these cells which had also lead to increased levels of TNF, IL-10 and IL-6. We also proved that Aβ peptide-enhanced proliferative response of CD4+CD28+ cells is autonomous and independent from disease status while being associated with the initial, ex vivo activation status of the CD4+ cells. In conclusion, we suggest that the effect of Aβ peptides on the immune system of AD patients does not depend on the specific reactivity to Aβ epitope(s), but is rather a consequence of an unspecific modulation of the cell cycle dynamics and cytokine production by T cells, occurring simultaneously in a huge proportion of Aβ peptide-exposed T lymphocytes and affecting the immune system performance. PMID:22428008

  7. Cellular immune responses to HPV-18, -31, and -53 in healthy volunteers immunized with recombinant HPV-16 L1 virus-like particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pinto, Ligia A.; Viscidi, Raphael; Harro, Clayton D.

    Human papillomavirus-like particles (HPV VLP) are candidate vaccines that have shown to be efficacious in reducing infection and inducing robust antiviral immunity. Neutralizing antibodies generated by vaccination are largely type-specific, but little is known about the type-specificity of cellular immune responses to VLP vaccination. To determine whether vaccination with HPV-16 L1VLP induces cellular immunity to heterologous HPV types (HPV-18, HPV-31, and HPV-53), we examined proliferative and cytokine responses in vaccine (n = 11) and placebo (n = 5) recipients. Increased proliferative and cytokine responses to heterologous types were observed postvaccination in some individuals. The proportion of women responding to heterologousmore » types postvaccination (36%-55%) was lower than that observed in response to HPV-16 (73%). Response to HPV-16 VLP predicted response to other types. The strongest correlations in response were observed between HPV-16 and HPV-31, consistent with their phylogenetic relatedness. In summary, PBMC from HPV-16 VLP vaccine recipients can respond to L1VLP from heterologous HPV types, suggesting the presence of conserved T cell epitopes.« less

  8. Expanding specificity of class 1 restricted CD8+ T cells for viral epitopes following multiple inoculations of swine with a human adenivorus vectored foot-and-mouth disease virus (FMDV) vaccine

    USDA-ARS?s Scientific Manuscript database

    The immune response to the highly acute foot-and-mouth disease virus (FMDV) is routinely reported as a measure of serum antibody. However, a critical effector function of immune responses combating viral infection of mammals is the cytotoxic T lymphocyte (CTL) response, mediated by virus specific ...

  9. Immune TB Antibody Phage Display Library as a Tool To Study B Cell Immunity in TB Infections.

    PubMed

    Hamidon, Nurul Hamizah; Suraiya, Siti; Sarmiento, Maria E; Acosta, Armando; Norazmi, Mohd Nor; Lim, Theam Soon

    2018-03-01

    B cells and in particular antibodies has always played second fiddle to cellular immunity in regard to tuberculosis (TB). However, recent studies has helped position humoral immunity especially antibodies back into the foray in relation to TB immunity. Therefore, the ability to correlate the natural antibody responses of infected individuals toward TB antigens would help strengthen this concept. Phage display is an intriguing approach that can be utilized to study antibody-mediated responses against a particular infection via harvesting the B cell repertoire from infected individuals. The development of disease-specific antibody libraries or immune libraries is useful to better understand antibody-mediated immune responses against specific disease antigens. This study describes the generation of an immune single-chain variable fragment (scFv) library derived from TB-infected individuals. The immune library with an estimated diversity of 10 9 independent clones was then applied for the identification of monoclonal antibodies against Mycobacterium tuberculosis α-crystalline as a model antigen. Biopanning of the library isolated three monoclonal antibodies with unique gene usage. This strengthens the role of antibodies in TB immunity in addition to the role played by cellular immunity. The developed library can be applied against other TB antigens and aid antibody-derived TB immunity studies in the future.

  10. Pineal-adrenal-immune system relationship under thermal stress: effect on physiological, endocrine, and non-specific immune response in goats.

    PubMed

    Sejian, Veerasamy; Srivastava, Rajendra Swaroop

    2010-12-01

    The purpose of the investigation was to observe the pineal-adrenal-immune system relationships and their influence on non-specific immune response in female goats under short-term thermal stress. Six female goats had been exposed to 40°C and 60% relative humidity in the psychrometric chamber for 17 days. Blood samples were obtained on days 0 and 10 to establish control and thermal stress effects, respectively. Chemical adrenalectomy was achieved by injecting metyrapone (100 mg/kg body weight) followed by exogenous melatonin treatment (0.1 mg/kg body weight) from 11th to 17th day of experiment. Thermal stress significantly (P≤0.05) altered the physiological responses. Metyrapone and melatonin treatment significantly (P≤0.05) reduced the thermal-stress-induced increase in plasma concentrations of cortisol and corticosterone while significantly (P≤0.05) increased the plasma melatonin on days 11 and 17. Furthermore, these treatments significantly (P<0.05) increased the phagocytic activity of neutrophils as compared to both control and thermal exposure values from 11-17 days of experiment. The data generated from this study help us to understand the functional relationship between pineal, adrenal, and immune system, and how this relationship modifies the non-specific immune response for the well being of goats during thermal stress.

  11. Pre-existing immunity against Ad vectors: humoral, cellular, and innate response, what's important?.

    PubMed

    Fausther-Bovendo, Hugues; Kobinger, Gary P

    2014-01-01

    Pre-existing immunity against human adenovirus (HAd) serotype 5 derived vector in the human population is widespread, thus hampering its clinical use. Various components of the immune system, including neutralizing antibodies (nAbs), Ad specific T cells and type I IFN activated NK cells, contribute to dampening the efficacy of Ad vectors in individuals with pre-existing Ad immunity. In order to circumvent pre-existing immunity to adenovirus, numerous strategies, such as developing alternative Ad serotypes, varying immunization routes and utilizing prime-boost regimens, are under pre-clinical or clinical phases of development. However, these strategies mainly focus on one arm of pre-existing immunity. Selection of alternative serotypes has been largely driven by the absence in the human population of nAbs against them with little attention paid to cross-reactive Ad specific T cells. Conversely, varying the route of immunization appears to mainly rely on avoiding Ad specific tissue-resident T cells. Finally, prime-boost regimens do not actually circumvent pre-existing immunity but instead generate immune responses of sufficient magnitude to confer protection despite pre-existing immunity. Combining the above strategies and thus taking into account all components regulating pre-existing Ad immunity will help further improve the development of Ad vectors for animal and human use.

  12. Human leukocyte antigen and cytokine receptor gene polymorphisms associated with heterogeneous immune responses to mumps viral vaccine.

    PubMed

    Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A

    2008-05-01

    Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine-induced immune responses.

  13. Human Leukocyte Antigen and Cytokine Receptor Gene Polymorphisms Associated With Heterogeneous Immune Responses to Mumps Viral Vaccine

    PubMed Central

    Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.

    2009-01-01

    OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine–induced immune responses. PMID:18450852

  14. Human Enterovirus 71 Protein Displayed on the Surface of Saccharomyces cerevisiae as an Oral Vaccine.

    PubMed

    Zhang, Congdang; Wang, Yi; Ma, Shuzhi; Li, Leike; Chen, Liyun; Yan, Huimin; Peng, Tao

    2016-06-01

    Human enterovirus 71 (EV-A71), a major agent of hand, foot, and mouth disease, has become an important public health issue in recent years. No effective antiviral or vaccines against EV-A71 infection are currently available. EV-A71 infection intrudes bodies through the gastric mucosal surface and it is necessary to enhance mucosal immune response to protect children from these pathogens. Recently, the majority of EV-A71 vaccine candidates have been developed for parenteral immunization. However, parenteral vaccine candidates often induce poor mucosal responses. On the other hand, oral vaccines could induce effective mucosal and systemic immunity, and could be easily and safely administered. Thus, proper oral vaccines have attached more interest compared with parenteral vaccine. In this study, the major immunogenic capsid protein of EV-A71 was displayed on the surface of Saccharomyces cerevisiae. Oral immunization of mice with surface-displayed VP1 S. cerevisiae induced systemic humoral and mucosal immune responses, including virus-neutralizing titers, VP1-specific antibody, and the induction of Th1 immune responses in the spleen. Furthermore, oral immunization of mother mice with surface-displayed VP1 S. cerevisiae conferred protection to neonatal mice against the lethal EV-A71 infection. Furthermore, we observed that multiple boost immunization as well as higher immunization dosage could induce higher EV-A71-specific immune response. Our results demonstrated that surface-displayed VP1 S. cerevisiae could be used as potential oral vaccine against EV-A71 infection.

  15. Roles of microRNA in the immature immune system of neonates.

    PubMed

    Yu, Hong-Ren; Huang, Lien-Hung; Li, Sung-Chou

    2018-06-13

    Neonates have an immature immune system; therefore, their immune activities are different from the activities of adult immune systems. Such differences between neonates and adults are reflected by cell population constitutions, immune responses, cytokine production, and the expression of cellular/humoral molecules, which contribute to the specific neonatal microbial susceptibility and atopic properties. MicroRNAs (miRNAs) have been discovered to modulate many aspects of immune responses. Herein, we summarize the distinct manifestations of the neonatal immune system, including cellular and non-cellular components. We also review the current findings on the modulatory effects of miRNAs on the neonatal immune system. These findings suggest that miRNAs have the potential to be useful therapeutic targets for certain infection or inflammatory conditions by modulating the neonatal immune system. In the future, we need a more comprehensive understanding in regard to miRNAs and how they modulate specific immune cells in neonates. Copyright © 2018. Published by Elsevier B.V.

  16. Protein kinase CK2 enables regulatory T cells to suppress excessive TH2 responses in vivo.

    PubMed

    Ulges, Alexander; Klein, Matthias; Reuter, Sebastian; Gerlitzki, Bastian; Hoffmann, Markus; Grebe, Nadine; Staudt, Valérie; Stergiou, Natascha; Bohn, Toszka; Brühl, Till-Julius; Muth, Sabine; Yurugi, Hajime; Rajalingam, Krishnaraj; Bellinghausen, Iris; Tuettenberg, Andrea; Hahn, Susanne; Reißig, Sonja; Haben, Irma; Zipp, Frauke; Waisman, Ari; Probst, Hans-Christian; Beilhack, Andreas; Buchou, Thierry; Filhol-Cochet, Odile; Boldyreff, Brigitte; Breloer, Minka; Jonuleit, Helmut; Schild, Hansjörg; Schmitt, Edgar; Bopp, Tobias

    2015-03-01

    The quality of the adaptive immune response depends on the differentiation of distinct CD4(+) helper T cell subsets, and the magnitude of an immune response is controlled by CD4(+)Foxp3(+) regulatory T cells (Treg cells). However, how a tissue- and cell type-specific suppressor program of Treg cells is mechanistically orchestrated has remained largely unexplored. Through the use of Treg cell-specific gene targeting, we found that the suppression of allergic immune responses in the lungs mediated by T helper type 2 (TH2) cells was dependent on the activity of the protein kinase CK2. Genetic ablation of the β-subunit of CK2 specifically in Treg cells resulted in the proliferation of a hitherto-unexplored ILT3(+) Treg cell subpopulation that was unable to control the maturation of IRF4(+)PD-L2(+) dendritic cells required for the development of TH2 responses in vivo.

  17. Intravaginal Chlamydia trachomatis Challenge Infection Elicits TH1 and TH17 Immune Responses in Mice That Promote Pathogen Clearance and Genital Tract Damage

    PubMed Central

    Quispe Calla, Nirk E.; Pavelko, Stephen D.; Cherpes, Thomas L.

    2016-01-01

    While ascension of Chlamydia trachomatis into the upper genital tract of women can cause pelvic inflammatory disease and Fallopian tube damage, most infections elicit no symptoms or overt upper genital tract pathology. Consistent with this asymptomatic clinical presentation, genital C. trachomatis infection of women generates robust TH2 immunity. As an animal model that modeled this response would be invaluable for delineating bacterial pathogenesis and human host defenses, herein we explored if pathogen-specific TH2 immunity is similarly elicited by intravaginal (ivag) infection of mice with oculogenital C. trachomatis serovars. Analogous to clinical infection, ascension of primary C. trachomatis infection into the mouse upper genital tract produced no obvious tissue damage. Clearance of ivag challenge infection was mediated by interferon (IFN)-γ-producing CD4+ T cells, while IFN-γ signaling blockade concomitant with a single ivag challenge promoted tissue damage by enhancing Chlamydia-specific TH17 immunity. Likewise, IFN-γ and IL-17 signaling blockade or CD4+ T cell depletion eliminated the genital pathology produced in untreated controls by multiple ivag challenge infections. Conversely, we were unable to detect formation of pathogen-specific TH2 immunity in C. trachomatis-infected mice. Together, our work revealed C. trachomatis infection of mice generates TH1 and TH17 immune responses that promote pathogen clearance and immunopathological tissue damage. Absence of Chlamydia-specific TH2 immunity in these mice newly highlights the need to identify experimental models of C. trachomatis genital infection that more closely recapitulate the human host response. PMID:27606424

  18. Distinct pathways of humoral and cellular immunity induced with the mucosal administration of a nanoemulsion adjuvant.

    PubMed

    Bielinska, Anna U; Makidon, Paul E; Janczak, Katarzyna W; Blanco, Luz P; Swanson, Benjamin; Smith, Douglas M; Pham, Tiffany; Szabo, Zsuzsanna; Kukowska-Latallo, Jolanta F; Baker, James R

    2014-03-15

    Nasal administration of an oil-in-water nanoemulsion (NE) adjuvant W805EC produces potent systemic and mucosal, Th-1- and Th-17-balanced cellular responses. However, its molecular mechanism of action has not been fully characterized and is of particular interest because NE does not contain specific ligands for innate immune receptors. In these studies, we demonstrate that W805EC NE adjuvant activates innate immunity, induces specific gene transcription, and modulates NF-κB activity via TLR2 and TLR4 by a mechanism that appears to be distinct from typical TLR agonists. Nasal immunization with NE-based vaccine showed that the TLR2, TLR4, and MyD88 pathways and IL-12 and IL-12Rβ1 expression are not required for an Ab response, but they are essential for the induction of balanced Th-1 polarization and Th-17 cellular immunity. NE adjuvant induces MHC class II, CD80, and CD86 costimulatory molecule expression and dendritic cell maturation. Further, upon immunization with NE, adjuvant mice deficient in the CD86 receptor had normal Ab responses but significantly reduced Th-1 cellular responses, whereas animals deficient in both CD80 and CD86 or lacking CD40 failed to produce either humoral or cellular immunity. Overall, our data show that intranasal administration of Ag with NE induces TLR2 and TLR4 activation along with a MyD88-independent Ab response and a MyD88-dependent Th-1 and Th-17 cell-mediated immune response. These findings suggest that the unique properties of NE adjuvant may offer novel opportunities for understanding previously unrecognized mechanisms of immune activation important for generating effective mucosal and systemic immune responses.

  19. Targeting with bovine CD154 enhances humoral immune responses induced by a DNA vaccine in sheep.

    PubMed

    Manoj, Sharmila; Griebel, Philip J; Babiuk, Lorne A; van Drunen Littel-van den Hurk, Sylvia

    2003-01-15

    CD40-CD154 interactions play an important role in regulating humoral and cell-mediated immune responses. Recently, these interactions have been exploited for the development of therapeutic and preventive treatments. The objective of this study was to test the ability of bovine CD154 to target a plasmid-encoded Ag to CD40-expressing APCs. To achieve this, a plasmid coding for bovine CD154 fused to a truncated secreted form of bovine herpesvirus 1 glycoprotein D (tgD), pSLIAtgD-CD154, was constructed. The chimeric tgD-CD154 was expressed in vitro in COS-7 cells and reacted with both glycoprotein D- and CD154-specific Abs. Both tgD and tgD-CD154 were capable of binding to epithelial cells, whereas only tgD-CD154 bound to B cells. Furthermore, dual-labeling of ovine PBMCs revealed that tgD-CD154 was bound by primarily B cells. The functional integrity of the tgD-CD154 chimera was confirmed by the induction of both IL-4-dependent B cell proliferation and tgD-specific lymphoproliferative responses in vitro. Finally, sheep immunized with pSLIAtgD-CD154 developed a more rapid primary tgD-specific Ab response and a significantly stronger tgD-specific secondary response when compared with animals immunized with pSLIAtgD and control animals. Similarly, virus-neutralizing Ab titers were significantly higher after secondary immunization with pSLIAtgD-CD154. These results demonstrate that using CD154 to target plasmid-expressed Ag can significantly enhance immune responses induced by a DNA vaccine.

  20. Adjuvanting a Simian Immunodeficiency Virus Vaccine with Toll-Like Receptor Ligands Encapsulated in Nanoparticles Induces Persistent Antibody Responses and Enhanced Protection in TRIM5α Restrictive Macaques.

    PubMed

    Kasturi, Sudhir Pai; Kozlowski, Pamela A; Nakaya, Helder I; Burger, Matheus C; Russo, Pedro; Pham, Mathew; Kovalenkov, Yevgeniy; Silveira, Eduardo L V; Havenar-Daughton, Colin; Burton, Samantha L; Kilgore, Katie M; Johnson, Mathew J; Nabi, Rafiq; Legere, Traci; Sher, Zarpheen Jinnah; Chen, Xuemin; Amara, Rama R; Hunter, Eric; Bosinger, Steven E; Spearman, Paul; Crotty, Shane; Villinger, Francois; Derdeyn, Cynthia A; Wrammert, Jens; Pulendran, Bali

    2017-02-15

    Our previous work has shown that antigens adjuvanted with ligands specific for Toll-like receptor 4 (TLR4) and TLR7/8 encapsulated in poly(lactic-co-glycolic) acid (PLGA)-based nanoparticles (NPs) induce robust and durable immune responses in mice and macaques. We investigated the efficacy of these NP adjuvants in inducing protective immunity against simian immunodeficiency virus (SIV). Rhesus macaques (RMs) were immunized with NPs containing TLR4 and TLR7/8 agonists mixed with soluble recombinant SIVmac239-derived envelope (Env) gp140 and Gag p55 (protein) or with virus-like particles (VLPs) containing SIVmac239 Env and Gag. NP-adjuvanted vaccines induced robust innate responses, antigen-specific antibody responses of a greater magnitude and persistence, and enhanced plasmablast responses compared to those achieved with alum-adjuvanted vaccines. NP-adjuvanted vaccines induced antigen-specific, long-lived plasma cells (LLPCs), which persisted in the bone marrow for several months after vaccination. NP-adjuvanted vaccines induced immune responses that were associated with enhanced protection against repeated low-dose, intravaginal challenges with heterologous SIVsmE660 in animals that carried TRIM5α restrictive alleles. The protection induced by immunization with protein-NP correlated with the prechallenge titers of Env-specific IgG antibodies in serum and vaginal secretions. However, no such correlate was apparent for immunization with VLP-NP or alum as the adjuvant. Transcriptional profiling of peripheral blood mononuclear cells isolated within the first few hours to days after primary vaccination revealed that NP-adjuvanted vaccines induced a molecular signature similar to that induced by the live attenuated yellow fever viral vaccine. This systems approach identified early blood transcriptional signatures that correlate with Env-specific antibody responses in vaginal secretions and protection against infection. These results demonstrate the adjuvanticity of the NP adjuvant in inducing persistent and protective antibody responses against SIV in RMs with implications for the design of vaccines against human immunodeficiency virus (HIV). The results of the RV144 HIV vaccine trial, which demonstrated a rapid waning of protective immunity with time, have underscored the need to develop strategies to enhance the durability of protective immune responses. Our recent work in mice has highlighted the capacity of nanoparticle-encapsulated TLR ligands (NP) to induce potent and durable antibody responses that last a lifetime in mice. In the present study, we evaluated the ability of these NP adjuvants to promote robust and durable protective immune responses against SIV in nonhuman primates. Our results demonstrate that immunization of rhesus macaques with NP adjuvants mixed with soluble SIV Env or a virus-like particle form of Env (VLP) induces potent and durable Env-specific antibody responses in the serum and in vaginal secretions. These responses were superior to those induced by alum adjuvant, and they resulted in enhanced protection against a low-dose intravaginal challenge with a heterologous strain of SIV in animals with TRIM5a restrictive alleles. These results highlight the potential for such NP TLR L adjuvants in promoting robust and durable antibody responses against HIV in the next generation of HIV immunogens currently being developed. Copyright © 2017 American Society for Microbiology.

  1. Immunity to tumour antigens.

    PubMed

    Li, Geng; Ali, Selman A; McArdle, Stephanie E B; Mian, Shahid; Ahmad, Murrium; Miles, Amanda; Rees, Robert C

    2005-01-01

    During the last decade, a large number of human tumour antigens have been identified. These antigens are classified as tumour-specific shared antigens, tissue-specific differentiation antigens, overexpressed antigens, tumour antigens resulting from mutations, viral antigens and fusion proteins. Antigens recognised by effectors of immune system are potential targets for antigen-specific cancer immunotherapy. However, most tumour antigens are self-proteins and are generally of low immunogenicity and the immune response elicited towards these tumour antigens is not always effective. Strategies to induce and enhance the tumour antigen-specific response are needed. This review will summarise the approaches to discovery of tumour antigens, the current status of tumour antigens, and their potential application to cancer treatment.

  2. HIV-derived vectors for gene therapy targeting dendritic cells.

    PubMed

    Rossetti, Maura; Cavarelli, Mariangela; Gregori, Silvia; Scarlatti, Gabriella

    2013-01-01

    Human immunodeficiency virus type 1 (HIV-1)-derived lentiviral vectors (LV) have the potential to mediate stable therapeutic gene transfer. However, similarly to other viral vectors, their benefit is compromised by the induction of an immune response toward transgene-expressing cells that closely mimics antiviral immunity. LV share with the parental HIV the ability to activate dendritic cells (DC), while lack the peculiar ability of subverting DC functions, which is responsible for HIV immune escape. Understanding the interaction between LV and DC, with plasmacytoid and myeloid DC playing fundamental and distinct roles, has paved the way to novel approaches aimed at regulating transgene-specific immune responses. Thanks to the ability to target either DC subsets LV might be a powerful tool to induce immunity (i.e., gene therapy of cancer), cell death (i.e., in HIV/AIDS infection), or tolerance (i.e., gene therapy strategies for monogenic diseases). In this chapter, similarities and differences between the LV-mediated and HIV-mediated induction of immune responses, with specific focus on their interactions with DC, are discussed.

  3. Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response

    PubMed Central

    Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.

    2016-01-01

    Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed antigen-specific cancer vaccines for a wide range of malignancies. PMID:27922937

  4. Immune transfer studies in canine allogeneic marrow graft donor-recipient pairs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grosse-Wilde, H.; Krumbacher, K.; Schuening, F.D.

    1986-07-01

    Transfer of immunity occurring with bone marrow grafting was studied using the dog as a preclinical model. Allogeneic bone marrow transplantation (BMT) was performed between DLA-identical beagle litter-mates. The donors were immunized with tetanus toxoid (TT) or sheep red blood cells (SRBC), and their humoral response was monitored by hemagglutination. The recipients of bone marrow from TT-immunized donors showed a marked increase of antibody titer one week posttransplantation, while in the recipients of marrow from SRBC immunized donors the antibody titers were considerably lower. Within the following 60 days the antibody titers in both groups diminished gradually to pregrafting levels.more » Control experiments in which cell-free plasma from donors immunized with TT and SRBC respectively was transfused indicated that the initial rise of specific antibody titers after marrow grafting is likely to be due to a passive transfer of humoral immunity. A single challenge of these marrow graft recipients with the respective antigen 15-18 weeks posttransplantation led to a secondary type of humoral immune response. It could be demonstrated that transfer of memory against TT or SRBC was independent from the actual antibody titer and the time of vaccination of the donor. One dog was immunized with TT after serving as marrow donor. When the donor had shown an antibody response, a peripheral blood leukocytes (PBL) transfusion was given to his chimera. Subsequent challenge of the latter resulted in a secondary type of specific antibody response. This indicates that specific cellular-bound immunological memory can be transferred after BMT from the donor to his allogeneic bone marrow chimera by transfusion of peripheral blood leukocytes. The data may be of importance in clinical BMT to protect patients during the phase of reduced immune reactivity by transfer of memory cells.« less

  5. Nongenetically modified Lactococcus lactis-adjuvanted vaccination enhanced innate immunity against Helicobacter pylori.

    PubMed

    Liu, Wei; Tan, Zhoulin; Liu, Hai; Zeng, Zhiqin; Luo, Shuanghui; Yang, Huimin; Zheng, Lufeng; Xi, Tao; Xing, Yingying

    2017-10-01

    Gram-positive enhancer matrix particles (GEM) produced by Lactococcus lactis can enhance vaccine-induced immune response. However, the mechanism under which this adjuvant mounts the efficacy of orally administered vaccines remains unexplored. We used a prophylactic mice model to investigate the mechanism of GEM-adjuvanted vaccination. Helicobacter pylori urease-specific antibody response was monitored and detected in murine serum by ELISA. Urease-specific splenic cytokine profile was examined. Gastric inflammatory responses were measured on day 43 or 71 by quantitative real-time PCR, flow cytometry and histology. We found that GEM enhanced the efficiency of oral H. pylori vaccine by promoting innate immunity. The vaccine CUE-GEM composed of GEM particles and recombinant antigen CTB-UE provided protection of immunized mice against H. pylori insult. The protective response was associated with induction of postimmunization gastritis and local Th1/Th17 cell-medicated immune response. We showed that innate inflammatory responses including neutrophil chemokines CXCL1-2, neutrophils, and antimicrobial proteins S100A8 and MUC1 were significantly elevated. Within all infected mice, S100A8 and MUC1 levels were negatively correlated with H. pylori burden. Strikingly, mice receiving GEM also show reduction of colonization, possibly through natural host response pathways to recruit CD4 + T cells and promote S100A8 expression. These findings suggest that GEM-based vaccine may impact Th1/Th17 immunity to orchestrate innate immune response against H. pylori infection. © 2017 John Wiley & Sons Ltd.

  6. A novel ICOS-independent, but CD28- and SAP-dependent, pathway of T cell-dependent, polysaccharide-specific humoral immunity in response to intact Streptococcus pneumoniae versus pneumococcal conjugate vaccine

    PubMed Central

    Chen, Quanyi; Cannons, Jennifer L.; Paton, James C.; Akiba, Hisaya; Schwartzberg, Pamela L.; Snapper, Clifford M.

    2010-01-01

    Polysaccharide (PS)- and protein-specific murine IgG responses to intact Streptococcus pneumoniae (Pn) are both dependent upon CD4+ T cell help, B7-dependent costimulation, and CD40/CD40-ligand interactions. However, the primary PS-, relative to protein-specific, IgG response terminates more rapidly, requires a shorter period of T cell help and B7-dependent costimulation, and fails to generate memory. In light of the critical role for ICOS/ICOS-ligand interactions in sustaining T cell-dependent Ig responses and promoting germinal center reactions, we hypothesized that this interaction was non-essential for PS-specific IgG responses to Pn. We now demonstrate that ICOS-/-, relative to WT, mice elicit a normal PS-specific IgG isotype response to Pn, despite marked inhibition of both the primary and secondary IgG anti-protein (i.e. PspA, PspC, and PsaA) response. A blocking anti-ICOS-ligand mAb injected during primary Pn immunization inhibits both the primary anti-protein response and the generation of protein-specific memory, but has no effect when injected during secondary immunization. In contrast to Pn, both PS- and protein-specific IgG responses to a pneumococcal conjugate vaccine are inhibited in ICOS-/- mice. ICOS-/- mice immunized with intact Pn or conjugate exhibit nearly complete abrogation in germinal center formation. Finally, although mice that lack the adaptor molecule SAP resemble ICOS-/- mice (and can exhibit decreased ICOS expression), we observe that the PS-, as well as protein-specific IgG responses to both Pn and conjugate are markedly defective in SAP-/- mice. These data define a novel T cell-, SAP-, and B7-dependent, but ICOS-independent, extrafollicular pathway of Ig induction. PMID:19050242

  7. Hantaviruses induce cell type- and viral species-specific host microRNA expression signatures

    PubMed Central

    Shin, Ok Sarah; Kumar, Mukesh; Yanagihara, Richard; Song, Jin-Won

    2014-01-01

    The mechanisms of hantavirus-induced modulation of host cellular immunity remain poorly understood. Recently, microRNAs (miRNAs) have emerged as a class of essential regulators of host immune response genes. To ascertain if differential host miRNA expression toward representative hantavirus species correlated with immune response genes, miRNA expression profiles were analyzed in human endothelial cells, macrophages and epithelial cells infected with pathogenic and nonpathogenic rodent- and shrew-borne hantaviruses. Distinct miRNA expression profiles were observed in a cell type- and viral species-specific pattern. A subset of miRNAs, including miR-151-5p and miR-1973, were differentially expressed between Hantaan virus and Prospect Hill virus. Pathway analyses confirmed that the targets of selected miRNAs were associated with inflammatory responses and innate immune receptor-mediated signaling pathways. Our data suggest that differential immune responses following hantavirus infection may be regulated in part by cellular miRNA through dysregulation of genes critical to the inflammatory process. PMID:24074584

  8. Chimeric parasites as tools to study Plasmodium immunology and assess malaria vaccines.

    PubMed

    Cockburn, Ian

    2013-01-01

    The study of pathogen immunity relies upon being able to track antigen specific immune responses and assess their protective capacity. To study immunity to Plasmodium antigens, chimeric rodent or human malaria parasites that express proteins from other Plasmodium species or unrelated species have been developed. Different types of chimeric parasites have been used to address a range of specific questions. Parasites expressing model T cell epitopes have been used to monitor cellular immune responses to the preerythrocytic and blood stages of malaria. Other parasites have been used to assess the functional significance of immune responses targeting particular proteins. Finally, a number of rodent malaria parasites that express vaccine-candidate antigens from P. falciparum and P. vivax have been used in functional assays of vaccine-induced antibody responses. Here, I review the experimental contributions that have been made using these parasites, and discuss the potential of these approaches to continue advancing our understanding of malaria immunology and vaccine research.

  9. Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

    PubMed

    Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

    2018-01-30

    Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  10. The evolution of the major hepatitis C genotypes correlates with clinical response to interferon therapy.

    PubMed

    Pang, Phillip S; Planet, Paul J; Glenn, Jeffrey S

    2009-08-11

    Patients chronically infected with hepatitis C virus (HCV) require significantly different durations of therapy and achieve substantially different sustained virologic response rates to interferon-based therapies, depending on the HCV genotype with which they are infected. There currently exists no systematic framework that explains these genotype-specific response rates. Since humans are the only known natural hosts for HCV-a virus that is at least hundreds of years old-one possibility is that over the time frame of this relationship, HCV accumulated adaptive mutations that confer increasing resistance to the human immune system. Given that interferon therapy functions by triggering an immune response, we hypothesized that clinical response rates are a reflection of viral evolutionary adaptations to the immune system. We have performed the first phylogenetic analysis to include all available full-length HCV genomic sequences (n = 345). This resulted in a new cladogram of HCV. This tree establishes for the first time the relative evolutionary ages of the major HCV genotypes. The outcome data from prospective clinical trials that studied interferon and ribavirin therapy was then mapped onto this new tree. This mapping revealed a correlation between genotype-specific responses to therapy and respective genotype age. This correlation allows us to predict that genotypes 5 and 6, for which there currently are no published prospective trials, will likely have intermediate response rates, similar to genotype 3. Ancestral protein sequence reconstruction was also performed, which identified the HCV proteins E2 and NS5A as potential determinants of genotype-specific clinical outcome. Biochemical studies have independently identified these same two proteins as having genotype-specific abilities to inhibit the innate immune factor double-stranded RNA-dependent protein kinase (PKR). An evolutionary analysis of all available HCV genomes supports the hypothesis that immune selection was a significant driving force in the divergence of the major HCV genotypes and that viral factors that acquired the ability to inhibit the immune response may play a role in determining genotype-specific response rates to interferon therapy.

  11. Gene expression profiling of dendritic cells by microarray.

    PubMed

    Foti, Maria; Ricciardi-Castagnoli, Paola; Granucci, Francesca

    2007-01-01

    The immune system of vertebrate animals has evolved to respond to different types of perturbations (invading pathogens, stress signals), limiting self-tissue damage. The decision to activate an immune response is made by antigen-presenting cells (APCs) that are quiescent until they encounter a foreign microorganism or inflammatory stimuli. Early activated APCs trigger innate immune responses that represent the first line of reaction against invading pathogens to limit the infections. At later times, activated APCs acquire the ability to prime antigen-specific immune responses that clear the infections and give rise to memory. During the immune response self-tissue damage is limited and tolerance to self is maintained through life. Among the cells that constitute the immune system, dendritic cells (DC) play a central role. They are extremely versatile APCs involved in the initiation of both innate and adaptive immunity and also in the differentiation of regulatory T cells required for the maintenance of self-tolerance. How DC can mediate these diverse and almost contradictory functions has recently been investigated. The plasticity of these cells allows them to undergo a complete genetic reprogramming in response to external microbial stimuli with the sequential acquisition of different regulatory functions in innate and adaptive immunity. The specific genetic reprogramming DC undergo upon activation can be easily investigated by using microarrays to perform global gene expression analysis in different conditions.

  12. Innate immunity and effector and regulatory mechanisms involved in allergic contact dermatitis.

    PubMed

    Silvestre, Marilene Chaves; Sato, Maria Notomi; Reis, Vitor Manoel Silva Dos

    2018-03-01

    Skin's innate immunity is the initial activator of immune response mechanisms, influencing the development of adaptive immunity. Some contact allergens are detected by Toll-like receptors (TLRs) and inflammasome NLR3. Keratinocytes participate in innate immunity and, in addition to functioning as an anatomical barrier, secrete cytokines, such as TNF, IL-1β, and IL-18, contributing to the development of Allergic Contact Dermatitis. Dendritic cells recognize and process antigenic peptides into T cells. Neutrophils cause pro-inflammatory reactions, mast cells induce migration/maturation of skin DCs, the natural killer cells have natural cytotoxic capacity, the γδ T cells favor contact with hapten during the sensitization phase, and the innate lymphoid cells act in the early stages by secreting cytokines, as well as act in inflammation and tissue homeostasis. The antigen-specific inflammation is mediated by T cells, and each subtype of T cells (Th1/Tc1, Th2/Tc2, and Th17/Tc17) activates resident skin cells, thus contributing to inflammation. Skin's regulatory T cells have a strong ability to inhibit the proliferation of hapten-specific T cells, acting at the end of the Allergic Contact Dermatitis response and in the control of systemic immune responses. In this review, we report how cutaneous innate immunity is the first line of defense and focus its role in the activation of the adaptive immune response, with effector response induction and its regulation.

  13. Immune mechanisms in fish skin against monogeneans--a model.

    PubMed

    Buchmann, K

    1999-01-01

    Host responses against skin inhabiting monogeneans are commonly observed but the responsible immune mechanisms in the fish skin are sufficiently described. Based on recent knowledge of fish immunity and skin response mechanisms in mammals a model for the skin immunity in fish to monogenean infections is proposed. Important cellular components of the model are the epithelial cells, the mucous cells and leucocytes. The release of cytokines, e.g., IL-1, following mechanical or chemical injury of the epithelial cells, initiates a series of events leading to decrease of the ectoparasite population. Cytokines (e.g., IL-1, TNF, INF) are suggested to affect secretions from mucous cell and attract neutrophils and macrophages. Leukotrienes are probably involved in the inflammatory reactions. The subsequent production of humoral substances (among others complement factors and peptides) could be responsible for the antiparasitic response in the later stages of infection. Although non-specific factors dominate the response, the involvement of specific antibodies and lymphocytes cannot be excluded.

  14. Microneedle-mediated transcutaneous immunization with plasmid DNA coated on cationic PLGA nanoparticles.

    PubMed

    Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A; Li, Xinran; Zhu, Saijie; Cui, Zhengrong

    2012-10-28

    Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens

    PubMed Central

    Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.

    2007-01-01

    In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440

  16. [Three levels of stress reaction of the immune system in an acute infectious process in children (facts and a hypothesis)].

    PubMed

    Zheleznikova, G F

    1997-01-01

    Three variants of immune response (IR) in children with acute respiratory viral infections are determined and characterized in detail: the difference between these shows in the level of specific antibody production as well as in the non-specific immune suppression which is tested by lymphocyte blast transformation to phytogemagglutinin. According to our hypothesis, this phenomenon may by explained as a manifestation of three types of neuroendocrine IR regulation corresponding to three levels of immune system stress response. The proof of genetic and physiological factors involvement in the process of choosing any type of IR is adduced. The important role of ontogenetic development of cooperation between immune and nervous systems in IR variants formation is emphasized.

  17. Chemokine-mediated immune responses in the female genital tract mucosa.

    PubMed

    Deruaz, Maud; Luster, Andrew D

    2015-04-01

    The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

  18. Characterization of the Fine Specificity of Bovine CD8 T-Cell Responses to Defined Antigens from the Protozoan Parasite Theileria parva▿

    PubMed Central

    Graham, Simon P.; Pellé, Roger; Yamage, Mat; Mwangi, Duncan M.; Honda, Yoshikazu; Mwakubambanya, Ramadhan S.; de Villiers, Etienne P.; Abuya, Evelyne; Awino, Elias; Gachanja, James; Mbwika, Ferdinand; Muthiani, Anthony M.; Muriuki, Cecelia; Nyanjui, John K.; Onono, Fredrick O.; Osaso, Julius; Riitho, Victor; Saya, Rosemary M.; Ellis, Shirley A.; McKeever, Declan J.; MacHugh, Niall D.; Gilbert, Sarah C.; Audonnet, Jean-Christophe; Morrison, W. Ivan; van der Bruggen, Pierre; Taracha, Evans L. N.

    2008-01-01

    Immunity against the bovine intracellular protozoan parasite Theileria parva has been shown to be mediated by CD8 T cells. Six antigens targeted by CD8 T cells from T. parva-immune cattle of different major histocompatibility complex (MHC) genotypes have been identified, raising the prospect of developing a subunit vaccine. To facilitate further dissection of the specificity of protective CD8 T-cell responses and to assist in the assessment of responses to vaccination, we set out to identify the epitopes recognized in these T. parva antigens and their MHC restriction elements. Nine epitopes in six T. parva antigens, together with their respective MHC restriction elements, were successfully identified. Five of the cytotoxic-T-lymphocyte epitopes were found to be restricted by products of previously described alleles, and four were restricted by four novel restriction elements. Analyses of CD8 T-cell responses to five of the epitopes in groups of cattle carrying the defined restriction elements and immunized with live parasites demonstrated that, with one exception, the epitopes were consistently recognized by animals of the respective genotypes. The analysis of responses was extended to animals immunized with multiple antigens delivered in separate vaccine constructs. Specific CD8 T-cell responses were detected in 19 of 24 immunized cattle. All responder cattle mounted responses specific for antigens for which they carried an identified restriction element. By contrast, only 8 of 19 responder cattle displayed a response to antigens for which they did not carry an identified restriction element. These data demonstrate that the identified antigens are inherently dominant in animals with the corresponding MHC genotypes. PMID:18070892

  19. [Adjuvants in modern medicine and veterinary].

    PubMed

    Kozlov, V G; Ozherelkov, S V; Sanin, A V; Kozhevnikova, T N

    2014-01-01

    The review is dedicated to immunologic adjuvants--various natural and synthetics substances that are added to vaccines for stimulation of specific immune response, but they do not induce specific response themselves. Critically important is the selection of the correct adjuvants, for which mechanisms of effect on immune system are studied the most. The majority of these mechanisms as well as physical-chemical and biological features of modern adjuvants are analyzed in the review. The problem of safety of adjuvants, types of immune response induced by adjuvants of various nature, excipients that are being verified or already in use in modern medicine and veterinary are also examined.

  20. HIV-Exposed Infants Vaccinated with an MF59/Recombinant gp120 Vaccine Have Higher-Magnitude Anti-V1V2 IgG Responses than Adults Immunized with the Same Vaccine.

    PubMed

    McGuire, Erin P; Fong, Youyi; Toote, Christopher; Cunningham, Coleen K; McFarland, Elizabeth J; Borkowsky, William; Barnett, Susan; Itell, Hannah L; Kumar, Amit; Gray, Glenda; McElrath, M Julianna; Tomaras, Georgia D; Permar, Sallie R; Fouda, Genevieve G

    2018-01-01

    In the RV144 vaccine trial, IgG responses against the HIV envelope variable loops 1 and 2 (V1V2) were associated with decreased HIV acquisition risk. We previously reported that infants immunized with an MF59-adjuvanted rgp120 vaccine developed higher-magnitude anti-V1V2 IgG responses than adult RV144 vaccinees. To determine whether the robust antibody response in infants is due to differences in vaccine regimens or to inherent differences between the adult and infant immune systems, we compared Env-specific IgG responses in adults and infants immunized with the same MF59- and alum-adjuvanted HIV envelope vaccines. At peak immunogenicity, the magnitudes of the gp120- and V1V2-specific IgG responses were comparable between adults and infants immunized with the alum/MNrgp120 vaccine (gp120 median fluorescence intensities [FIs] in infants = 7,118 and in adults = 11,510, P = 0.070; V1V2 median MFIs of 512 [infants] and 804 [adults], P = 0.50), whereas infants immunized with the MF59/SF-2 rgp120 vaccine had higher-magnitude antibody levels than adults (gp120 median FIs of 15,509 [infants] and 2,290 [adults], P < 0.001; V1V2 median FIs of 23,926 [infants] and 1,538 [adults]; P < 0.001). Six months after peak immunogenicity, infants maintained higher levels Env-specific IgG than adults. Anti-V1V2 IgG3 antibodies that were associated with decreased HIV-1 risk in RV144 vaccinees were present in 43% of MF59/rgp120-vaccinated infants but only in 12% of the vaccinated adults ( P = 0.0018). Finally, in contrast to the rare vaccine-elicited Env-specific IgA in infants, rgp120 vaccine-elicited Env-specific IgA was frequently detected in adults. Our results suggest that vaccine adjuvants differently modulate gp120-specific antibody responses in adults and infants and that infants can robustly respond to HIV Env immunization. IMPORTANCE More than 150,000 pediatric HIV infections occur yearly, despite the availability of antiretroviral prophylaxis. A pediatric HIV vaccine could reduce the number of these ongoing infant infections and also prime for long-term immunity prior to sexual debut. We previously reported that immunization of infants with an MF59-adjuvanted recombinant gp120 vaccine induced higher-magnitude, potentially protective anti-V1V2 IgG responses than in adult vaccinees receiving the moderately effective RV144 vaccine. In the present study, we demonstrate that the robust response observed in infants is not due to differences in vaccine regimen or vaccine dose between adults and infants. Our results suggest that HIV vaccine adjuvants may differentially modulate immune responses in adults and infants, highlighting the need to conduct vaccine trials in pediatric populations. Copyright © 2017 American Society for Microbiology.

  1. Norovirus P particle efficiently elicits innate, humoral and cellular immunity.

    PubMed

    Fang, Hao; Tan, Ming; Xia, Ming; Wang, Leyi; Jiang, Xi

    2013-01-01

    Norovirus (NoV) P domain complexes, the 24 mer P particles and the P dimers, induced effective humoral immunity, but their role in the cellular immune responses remained unclear. We reported here a study on cellular immune responses of the two P domain complexes in comparison with the virus-like particle (VLP) of a GII.4 NoV (VA387) in mice. The P domain complexes induced significant central memory CD4(+) T cell phenotypes (CD4(+) CD44(+) CD62L(+) CCR7(+)) and activated polyclonal CD4(+) T cells as shown by production of Interleukin (IL)-2, Interferon (IFN)-γ, and Tumor Necrosis Factor (TNF)-α. Most importantly, VA387-specific CD4(+) T cell epitope induced a production of IFN-γ, indicating an antigen-specific CD4(+) T cell response in P domain complex-immunized mice. Furthermore, P domain complexes efficiently induced bone marrow-derived dendritic cell (BMDC) maturation, evidenced by up-regulation of co-stimulatory and MHC class II molecules, as well as production of IL-12 and IL-1β. Finally, P domain complex-induced mature dendritic cells (DCs) elicited proliferation of specific CD4(+) T cells targeting VA387 P domain. Overall, we conclude that the NoV P domain complexes are efficiently presented by DCs to elicit not only humoral but also cellular immune responses against NoVs. Since the P particle is highly effective for both humoral and cellular immune responses and easily produced in Escherichia coli (E. coli), it is a good choice of vaccine against NoVs and a vaccine platform against other diseases.

  2. CTA1-DD adjuvant promotes strong immunity against human immunodeficiency virus type 1 envelope glycoproteins following mucosal immunization.

    PubMed

    Sundling, Christopher; Schön, Karin; Mörner, Andreas; Forsell, Mattias N E; Wyatt, Richard T; Thorstensson, Rigmor; Karlsson Hedestam, Gunilla B; Lycke, Nils Y

    2008-12-01

    Strategies to induce potent and broad antibody responses against the human immunodeficiency virus type 1 (HIV-1) envelope glycoproteins (Env) at both systemic and mucosal sites represent a central goal for HIV-1 vaccine development. Here, we show that the non-toxic CTA1-DD adjuvant promoted mucosal and systemic humoral and cell-mediated immune responses following intranasal (i.n.) immunizations with trimeric or monomeric forms of HIV-1 Env in mice and in non-human primates. Env-specific IgG subclasses in the serum of immunized mice reflected a balanced Th1/Th2 type of response. Strikingly, i.n. immunizations with Env and the CTA1-DD adjuvant induced substantial levels of mucosal anti-Env IgA in bronchial alveolar lavage and also detectable levels in vaginal secretions. By contrast, parenteral immunizations of Env formulated in Ribi did not stimulate mucosal IgA responses, while the two adjuvants induced a similar distribution of Env-specific IgG-subclasses in serum. A single parenteral boost with Env in Ribi adjuvant into mice previously primed i.n. with Env and CTA1-DD, augmented the serum anti-Env IgG levels to similar magnitudes as those observed after three intraperitoneal immunizations with Env in Ribi. The augmenting potency of CTA1-DD was similar to that of LTK63 or CpG oligodeoxynucleotides (ODN). However, in contrast to CpG ODN, the effect of CTA1-DD and LTK63 appeared to be independent of MyD88 and toll-like receptor signalling. This is the first demonstration that CTA1-DD augments specific immune responses also in non-human primates, suggesting that this adjuvant could be explored further as a clinically safe mucosal vaccine adjuvant for humoral and cell-mediated immunity against HIV-1 Env.

  3. Vaccination with Human Papillomavirus Pseudovirus-Encapsidated Plasmids Targeted to Skin Using Microneedles

    PubMed Central

    Kines, Rhonda C.; Zarnitsyn, Vladimir; Johnson, Teresa R.; Pang, Yuk-Ying S.; Corbett, Kizzmekia S.; Nicewonger, John D.; Gangopadhyay, Anu; Chen, Man; Liu, Jie; Prausnitz, Mark R.; Schiller, John T.; Graham, Barney S.

    2015-01-01

    Human papilloma virus-like particles (HPV VLP) serve as the basis of the current licensed vaccines for HPV. We have previously shown that encapsidation of DNA expressing the model antigen M/M2 from respiratory syncytial virus (RSV) in HPV pseudovirions (PsV) is immunogenic when delivered intravaginally. Because the HPV capsids confer tropism for basal epithelium, they represent attractive carriers for vaccination targeted to the skin using microneedles. In this study we asked: 1) whether HPV16 VLP administered by microneedles could induce protective immune responses to HPV16 and 2) whether HPV16 PsV-encapsidated plasmids delivered by microneedles could elicit immune responses to both HPV and the antigen delivered by the transgene. Mice immunized with HPV16 VLP coated microneedles generated robust neutralizing antibody responses and were protected from HPV16 challenge. Microneedle arrays coated with HPV16-M/M2 or HPV16-F protein (genes of RSV) were then tested and dose-dependent HPV and F-specific antibody responses were detected post-immunization, and M/M2-specific T-cell responses were detected post RSV challenge, respectively. HPV16 PsV-F immunized mice were fully protected from challenge with HPV16 PsV and had reduced RSV viral load in lung and nose upon intranasal RSV challenge. In summary, HPV16 PsV-encapsidated DNA delivered by microneedles induced neutralizing antibody responses against HPV and primed for antibody and T-cell responses to RSV antigens encoded by the encapsidated plasmids. Although the immunogenicity of the DNA component was just above the dose response threshold, the HPV-specific immunity was robust. Taken together, these data suggest microneedle delivery of lyophilized HPV PsV could provide a practical, thermostable combined vaccine approach that could be developed for clinical evaluation. PMID:25785935

  4. Vaccination with human papillomavirus pseudovirus-encapsidated plasmids targeted to skin using microneedles.

    PubMed

    Kines, Rhonda C; Zarnitsyn, Vladimir; Johnson, Teresa R; Pang, Yuk-Ying S; Corbett, Kizzmekia S; Nicewonger, John D; Gangopadhyay, Anu; Chen, Man; Liu, Jie; Prausnitz, Mark R; Schiller, John T; Graham, Barney S

    2015-01-01

    Human papilloma virus-like particles (HPV VLP) serve as the basis of the current licensed vaccines for HPV. We have previously shown that encapsidation of DNA expressing the model antigen M/M2 from respiratory syncytial virus (RSV) in HPV pseudovirions (PsV) is immunogenic when delivered intravaginally. Because the HPV capsids confer tropism for basal epithelium, they represent attractive carriers for vaccination targeted to the skin using microneedles. In this study we asked: 1) whether HPV16 VLP administered by microneedles could induce protective immune responses to HPV16 and 2) whether HPV16 PsV-encapsidated plasmids delivered by microneedles could elicit immune responses to both HPV and the antigen delivered by the transgene. Mice immunized with HPV16 VLP coated microneedles generated robust neutralizing antibody responses and were protected from HPV16 challenge. Microneedle arrays coated with HPV16-M/M2 or HPV16-F protein (genes of RSV) were then tested and dose-dependent HPV and F-specific antibody responses were detected post-immunization, and M/M2-specific T-cell responses were detected post RSV challenge, respectively. HPV16 PsV-F immunized mice were fully protected from challenge with HPV16 PsV and had reduced RSV viral load in lung and nose upon intranasal RSV challenge. In summary, HPV16 PsV-encapsidated DNA delivered by microneedles induced neutralizing antibody responses against HPV and primed for antibody and T-cell responses to RSV antigens encoded by the encapsidated plasmids. Although the immunogenicity of the DNA component was just above the dose response threshold, the HPV-specific immunity was robust. Taken together, these data suggest microneedle delivery of lyophilized HPV PsV could provide a practical, thermostable combined vaccine approach that could be developed for clinical evaluation.

  5. Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses

    PubMed Central

    Feng, Pinghui; Moses, Ashlee; Früh, Klaus

    2015-01-01

    γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334

  6. Immune Response in Thyroid Cancer: Widening the Boundaries

    PubMed Central

    Ward, Laura Sterian

    2014-01-01

    The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

  7. Immunomodulatory Effects of Dietary Seaweeds in LPS Challenged Atlantic Salmon Salmo salar as Determined by Deep RNA Sequencing of the Head Kidney Transcriptome

    PubMed Central

    Palstra, Arjan P.; Kals, Jeroen; Blanco Garcia, Ainhoa; Dirks, Ron P.; Poelman, Marnix

    2018-01-01

    Seaweeds may represent immuno-stimulants that could be used as health-promoting fish feed components. This study was performed to gain insights into the immunomodulatory effects of dietary seaweeds in Atlantic salmon. Specifically tested were 10% inclusion levels of Laminaria digitata (SW1) and a commercial blend of seaweeds (Oceanfeed®) (SW2) against a fishmeal based control diet (FMC). Differences between groups were assessed in growth, feed conversion ratio and blood parameters hematocrit and hemoglobin. After a LPS challenge of fish representing each of the three groups, RNAseq was performed on the head kidney as major immune organ to determine transcriptomic differences in response to the immune activation. Atlantic salmon fed with dietary seaweeds did not show major differences in performance in comparison with fishmeal fed fish. RNAseq resulted in ∼154 million reads which were mapped against a NCBI Salmo salar reference and against a de novo assembled S. salar reference for analyses of expression of immune genes and ontology of immune processes among the 87,600 cDNA contigs. The dietary seaweeds provoked a more efficient immune response which involved more efficient identification of the infection site, and processing and presentation of antigens. More specifically, chemotaxis and the chemokine-mediated signaling were improved and therewith the defense response to Gram-positive bacterium reduced. Specific Laminaria digitata effects included reduction of the interferon-gamma-mediated signaling. Highly upregulated and specific for this diet was the expression of major histocompatibility complex class I-related gene protein. The commercial blend of seaweeds caused more differential expression than Laminaria digitata and improved immune processes such as receptor-mediated endocytosis and cell adhesion, and increased the expression of genes involved in response to lipopolysaccharide and inflammatory response. Particularly, expression of many important immune receptors was up-regulated illustrating increased responsiveness. NF-kappa-B inhibitor alpha is an important gene that marked the difference between both seaweed diets as Laminaria digitata inhibits the expression for this cytokine while the blend of seaweeds stimulates it. It can be concluded that the inclusion of seaweeds such as Laminaria digitata can have important modulatory effects on the immune capacity of Atlantic salmon resulting in a more efficient immune response. PMID:29910738

  8. The IL-1R/TLR signaling pathway is essential for efficient CD8+ T-cell responses against hepatitis B virus in the hydrodynamic injection mouse model.

    PubMed

    Ma, Zhiyong; Liu, Jia; Wu, Weimin; Zhang, Ejuan; Zhang, Xiaoyong; Li, Qian; Zelinskyy, Gennadiy; Buer, Jan; Dittmer, Ulf; Kirschning, Carsten J; Lu, Mengji

    2017-12-01

    The outcome of hepatitis B viral (HBV) infection is determined by the complex interactions between replicating HBV and the immune system. While the role of the adaptive immune system in the resolution of HBV infection has been studied extensively, the contribution of innate immune mechanisms remains to be defined. Here we examined the role of the interleukin-1 receptor/Toll-like receptor (IL-1R/TLR) signaling pathway in adaptive immune responses and viral clearance by exploring the HBV mouse model. Hydrodynamic injection with a replication-competent HBV genome was performed in wild-type mice (WT) and a panel of mouse strains lacking specific innate immunity component expression. We found higher levels of HBV protein production and replication in Tlr2 -/- , Tlr23479 -/- , 3d/Tlr24 -/- , Myd88/Trif -/- and Irak4 -/- mice, which was associated with reduced HBV-specific CD8 + T-cell responses in these mice. Importantly, HBV clearance was delayed for more than 2 weeks in 3d/Tlr24 -/- , Myd88/Trif -/- and Irak4 -/- mice compared to WT mice. HBV-specific CD8 + T-cell responses were functionally impaired for producing the cytokines IFN-γ, TNF-α and IL-2 in TLR signaling-deficient mice compared to WT mice. In conclusion, the IL-1R/TLR signaling pathway might contribute to controlling HBV infection by augmenting HBV-specific CD8 + T-cell responses.

  9. Immunodiagnostic Techniques for Bacterial Infections

    DTIC Science & Technology

    1981-01-01

    specificity that specific immune sera (the immune response) provides. The early use of immunological diagnosis was to demonstrate circulating antibodies to...testing requirements. 4. Carefully remove punched plugs by suction. 5. Fill the central well with immune serum and the surrounding wells with test...capsulatuni Serum Actinomvcesr israeli Serum Aspergillus fumiqatus Serum Protozoan: Trvnanosoma cruzi Serum Entameaba histolvtica Serum Trichinella sviralis

  10. Modulation of occluding junctions alters the hematopoietic niche to trigger immune activation

    PubMed Central

    Khadilkar, Rohan J; Vogl, Wayne; Goodwin, Katharine

    2017-01-01

    Stem cells are regulated by signals from their microenvironment, or niche. During Drosophila hematopoiesis, a niche regulates prohemocytes to control hemocyte production. Immune challenges activate cell-signalling to initiate the cellular and innate immune response. Specifically, certain immune challenges stimulate the niche to produce signals that induce prohemocyte differentiation. However, the mechanisms that promote prohemocyte differentiation subsequent to immune challenges are poorly understood. Here we show that bacterial infection induces the cellular immune response by modulating occluding-junctions at the hematopoietic niche. Occluding-junctions form a permeability barrier that regulates the accessibility of prohemocytes to niche derived signals. The immune response triggered by infection causes barrier breakdown, altering the prohemocyte microenvironment to induce immune cell production. Moreover, genetically induced barrier ablation provides protection against infection by activating the immune response. Our results reveal a novel role for occluding-junctions in regulating niche-hematopoietic progenitor signalling and link this mechanism to immune cell production following infection. PMID:28841136

  11. Vaccine development: From concept to early clinical testing.

    PubMed

    Cunningham, Anthony L; Garçon, Nathalie; Leo, Oberdan; Friedland, Leonard R; Strugnell, Richard; Laupèze, Béatrice; Doherty, Mark; Stern, Peter

    2016-12-20

    In the 21st century, an array of microbiological and molecular allow antigens for new vaccines to be specifically identified, designed, produced and delivered with the aim of optimising the induction of a protective immune response against a well-defined immunogen. New knowledge about the functioning of the immune system and host pathogen interactions has stimulated the rational design of vaccines. The design toolbox includes vaccines made from whole pathogens, protein subunits, polysaccharides, pathogen-like particles, use of viral/bacterial vectors, plus adjuvants and conjugation technology to increase and broaden the immune response. Processes such as recombinant DNA technology can simplify the complexity of manufacturing and facilitate consistent production of large quantities of antigen. Any new vaccine development is greatly enhanced by, and requires integration of information concerning: 1. Pathogen life-cycle & epidemiology. Knowledge of pathogen structure, route of entry, interaction with cellular receptors, subsequent replication sites and disease-causing mechanisms are all important to identify antigens suitable for disease prevention. The demographics of infection, specific risk groups and age-specific infection rates determine which population to immunise, and at what age. 2. Immune control & escape. Interactions between the host and pathogen are explored, with determination of the relative importance of antibodies, T-cells of different types and innate immunity, immune escape strategies during infection, and possible immune correlates of protection. This information guides identification and selection of antigen and the specific immune response required for protection. 3. Antigen selection & vaccine formulation. The selected antigen is formulated to remain suitably immunogenic and stable over time, induce an immune response that is likely to be protective, plus be amenable to eventual scale-up to commercial production. 4. Vaccine preclinical & clinical testing. The candidate vaccine must be tested for immunogenicity, safety and efficacy in preclinical and appropriately designed clinical trials. This review considers these processes using examples of differing pathogenic challenges, including human papillomavirus, malaria, and ebola. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. IL-35, a hallmark of immune-regulation in cancer progression, chronic infections and inflammatory diseases.

    PubMed

    Teymouri, Manouchehr; Pirro, Matteo; Fallarino, Francesca; Gargaro, Marco; Sahebkar, Amirhosein

    2018-03-25

    Cytokine members of the IL-12 family have attracted enormous attention in the last few years, with IL-35 being the one of the most attractive-suppressive cytokine. IL-35 is an important mediator of regulatory T cell function. Regulatory T cells play key roles in restoring immune homeostasis after facing challenges such as infection by specific pathogens. Moreover, a crucial role for regulatory T cell populations has been demonstrated in several physiological processes, including establishment of fetal-maternal tolerance, maintenance of self-tolerance and prevention of autoimmune diseases. However, a deleterious involvement of immune regulatory T cells has been documented in specific inhibition of immune responses against tumor cells, promotion of chronic infections and establishment of chronic inflammatory disorders. In this review, we attempt to shed light on the concept of immune-homoeostasis on the aforementioned issues, taking IL-35 as the hallmark of regulatory responses. The dilemma between immune-mediated cancer treatment and inflammation is discussed. Histopathological indications of chronic vs. acute infections are elaborated. Moreover, the evidence that IL-35 requires additional immune-regulatory cytokines, such as IL-10 and TGF-β, to induce effective and maximal anti-inflammatory effects suggest that immune-regulation requires multi-factorial analysis of many immune playmakers rather than a specific immune target. © 2018 UICC.

  13. Assessing the risk of CMV reactivation and reconstitution of antiviral immune response post bone marrow transplantation by the QuantiFERON-CMV-assay and real time PCR.

    PubMed

    Krawczyk, Adalbert; Ackermann, Jessica; Goitowski, Birgit; Trenschel, Rudolf; Ditschkowski, Markus; Timm, Jörg; Ottinger, Hellmut; Beelen, Dietrich W; Grüner, Nico; Fiedler, Melanie

    CMV reactivation is a major cause of severe complications in allogeneic hematopoietic stem cell transplant (HSCT) recipients. The risk of CMV reactivation depends on the serostatus (+/-) of the donor (D) and recipient (R). The reconstitution of CMV-specific T-cell responses after transplantation is crucial for the control of CMV reactivation. The study aimed to determine the cellular immune status correlating with protection from high-level CMV viremia (>5000 copies/ml) and disease. We monitored CMV-specific cellular immune responses in 9 high-risk (D-/R+), 14 intermediate risk (D+/R+) and 3 low risk individuals (D+/R-), and 8 CMV negative controls (D-/R-). Interferon- γ (IFN-γ) levels as a marker for the CD8+ T-cell response were determined by the QuantiFERON-CMV-assay and compared to viral loads determined by PCR. Early CMV reactivation was detected in all high-risk and 13/14 intermediate risk individuals. High-level viremia was detected in 5/7 high and 7/14 intermediate risk patients. Reconstitution of the CMV-specific cellular immune response started from 3 months after transplantation and resulted in protection against CMV reactivation. Re-establishing of CMV-specific T-cell immune responses with IFN- γ levels >8.9 IU/ml is crucial for protection from high-level CMV viremia. Monitoring of HSCT-recipients with the QuantiFERON-CMV-assay might be of great benefit to optimize antiviral treatment. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Nasal delivery of chitosan-coated poly(lactide-co-glycolide)-encapsulated honeybee (Apis mellifera) venom promotes Th 1-specific systemic and local intestinal immune responses in weaned pigs.

    PubMed

    Lee, Jin-A; Kim, Yun-Mi; Kim, Tae-Hoon; Lee, Sang-Ho; Lee, Cho-A; Cho, Cheong-Weon; Jeon, Jong-Woon; Park, Jin-Kyu; Kim, Sang-Ki; Jung, Bock-Gie; Lee, Bong-Joo

    2016-10-01

    Nasal delivery is a convenient and acceptable route for drug administration, and has been shown to elicit a much more potent local and systemic response compared with other drug delivery routes. We previously demonstrated that rectal administration of poly(lactide-co-glycolide)-encapsulated honeybee venom (P-HBV) could enhance systemic Th 1-specific immune responses. We therefore synthesized chitosan-coated P-HBV (CP-HBV) and then evaluated the immune-boosting efficacy of nasally administered CP-HBV on systemic and local intestinal immunity compared with non-chitosan-coated P-HBV. The nasally delivered CP-HBV effectively enhanced Th 1-specific responses, eliciting a significant increase in the CD3(+)CD4(+)CD8(-) Th cell population, lymphocyte proliferation capacity, and expression of Th 1 cytokines (IFN-γ, IL-12, and IL-2) in peripheral blood mononuclear cells. Furthermore, these immune-boosting effects persisted up to 21days post CP-HBV administration. Nasal administration of CP-HBV also led to an increase of not only the CD4(+) Th 1 and IFN-γ secreting CD4(+) Th 1 cell population but also Th 1-specific cytokines and transcription factors, including IL-12, IFN-γ, STAT4, and T-bet, in isolated mononuclear cells from the spleen and ileum. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. The Epstein-Barr virus lytic protein BZLF1 as a candidate target antigen for vaccine development1

    PubMed Central

    Hartlage, Alex S.; Liu, Tom; Patton, John T.; Garman, Sabrina L.; Zhang, Xiaoli; Kurt, Habibe; Lozanski, Gerard; Lustberg, Mark E.; Caligiuri, Michael A.; Baiocchi, Robert A.

    2015-01-01

    The Epstein-Barr virus (EBV) is an oncogenic, γ-herpesvirus associated with a broad spectrum of disease. While most immune-competent individuals can effectivley develop efficient adaptive immune responses to EBV, immunocompromised individuals are at serious risk for developing life threatening diseases such as Hodgkin’s lymphoma and post-transplant lymphoproliferative disorder (PTLD). Given the significant morbidity associated with EBV infection in high-risk populations, there is a need to develop vaccine strategies that restore or enhance EBV-specific immune responses. Here, we identify the EBV immediate-early protein BZLF1 as a potential target antigen for vaccine development. Primary tumors from patients with PTLD and a chimeric human-murine model of EBV-driven lymphoproliferative disorder (EBV-LPD) express BZLF1 protein. Pulsing human dendritic cells (DC) with recombinant BZLF1 followed by incubation with autologous mononuclear cells led to expansion of BZLF1-specific CD8(+) T cells in vitro and primed BZLF1-specific T-cell responses in vivo. In addition, vaccination of hu-PBL-SCID mice with BZLF1-transduced DCs induced specific cellular immunity and significantly prolonged survival from fatal EBV-LPD. These findings identify BZLF1 as a candidate target protein in the immunosurveillance of EBV and provide rationale for considering BZLF1 in vaccine strategies to enhance primary and recall immune responses and potentially prevent EBV-associated diseases. PMID:25735952

  16. Giardia-specific cellular immune responses in post-giardiasis chronic fatigue syndrome.

    PubMed

    Hanevik, Kurt; Kristoffersen, Einar; Mørch, Kristine; Rye, Kristin Paulsen; Sørnes, Steinar; Svärd, Staffan; Bruserud, Øystein; Langeland, Nina

    2017-01-28

    The role of pathogen specific cellular immune responses against the eliciting pathogen in development of post-infectious chronic fatigue syndrome (PI-CFS) is not known and such studies are difficult to perform. The aim of this study was to evaluate specific anti-Giardia cellular immunity in cases that developed CFS after Giardia infection compared to cases that recovered well. Patients reporting chronic fatigue in a questionnaire study three years after a Giardia outbreak were clinically evaluated five years after the outbreak and grouped according to Fukuda criteria for CFS and idiopathic chronic fatigue. Giardia specific immune responses were evaluated in 39 of these patients by proliferation assay, T cell activation and cytokine release analysis. 20 Giardia exposed non-fatigued individuals and 10 healthy unexposed individuals were recruited as controls. Patients were clinically classified into CFS (n = 15), idiopathic chronic fatigue (n = 5), fatigue from other causes (n = 9) and recovered from fatigue (n = 10). There were statistically significant antigen specific differences between these Giardia exposed groups and unexposed controls. However, we did not find differences between the Giardia exposed fatigue classification groups with regard to CD4 T cell activation, proliferation or cytokine levels in 6 days cultured PBMCs. Interestingly, sCD40L was increased in patients with PI-CFS and other persons with fatigue after Giardia infection compared to the non-fatigued group, and correlated well with fatigue levels at the time of sampling. Our data show antigen specific cellular immune responses in the groups previously exposed to Giardia and increased sCD40L in fatigued patients.

  17. Epigenetic programming of T cells impacts immune reconstitution in hematopoietic stem cell transplant recipients.

    PubMed

    Hardy, Kristine; Smith, Corey; Tu, Wen Juan; McCuaig, Robert; Panikkar, Archana; Dasari, Vijayendra; Wu, Fan; Tey, Siok-Keen; Hill, Geoffrey R; Khanna, Rajiv; Rao, Sudha

    2018-03-27

    Immune reconstitution following hematopoietic stem cell transplantation (HSCT) is critical in preventing harmful sequelae in recipients with cytomegalovirus (CMV) infection. To understand the molecular mechanisms underlying immune reconstitution kinetics, we profiled the transcriptome-chromatin accessibility landscape of CMV-specific CD8 + T cells from HCST recipients with different immune reconstitution efficiencies. CMV-specific T cells from HSCT recipients with stable antiviral immunity expressed higher levels of interferon/defense response and cell cycle genes in an interconnected network involving PI3KCG , STAT5B , NFAT , RBPJ , and lower HDAC6 , increasing chromatin accessibility at the enhancer regions of immune and T-cell receptor signaling pathway genes. By contrast, the transcriptional and epigenomic signatures of CMV-specific T cells from HSCT recipients with unstable immune reconstitution showed commonalities with T-cell responses in other nonresolving chronic infections. These signatures included higher levels of EGR and KLF factors that, along with lower JARID2 expression, maintained higher accessibility at promoter and CpG-rich regions of genes associated with apoptosis. Furthermore, epigenetic targeting via inhibition of HDAC6 or JARID2 enhanced the transcription of genes associated with differential responses, suggesting that drugs targeting epigenomic modifiers may have therapeutic potential for enhancing immune reconstitution in HSCT recipients. Taken together, these analyses demonstrate that transcription factors and chromatin modulators create different chromatin accessibility landscapes in T cells of HSCT recipients that not only affect immediate gene expression but also differentially prime cells for responses to additional signals. Epigenetic therapy may be a promising strategy to promote immune reconstitution in HSCT recipients. © 2018 by The American Society of Hematology.

  18. Critical role for Sec22b-dependent antigen cross-presentation in antitumor immunity

    PubMed Central

    Rookhuizen, Derek C.; Joannas, Leonel; Carpier, Jean-Marie; Yatim, Nader; Albert, Matthew L.

    2017-01-01

    CD8+ T cells mediate antigen-specific immune responses that can induce rejection of solid tumors. In this process, dendritic cells (DCs) are thought to take up tumor antigens, which are processed into peptides and loaded onto MHC-I molecules, a process called “cross-presentation.” Neither the actual contribution of cross-presentation to antitumor immune responses nor the intracellular pathways involved in vivo are clearly established because of the lack of experimental tools to manipulate this process. To develop such tools, we generated mice bearing a conditional DC-specific mutation in the sec22b gene, a critical regulator of endoplasmic reticulum–phagosome traffic required for cross-presentation. DCs from these mice show impaired cross-presentation ex vivo and defective cross-priming of CD8+ T cell responses in vivo. These mice are also defective for antitumor immune responses and are resistant to treatment with anti–PD-1. We conclude that Sec22b-dependent cross-presentation in DCs is required to initiate CD8+ T cell responses to dead cells and to induce effective antitumor immune responses during anti–PD-1 treatment in mice. PMID:28663435

  19. Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host

    NASA Astrophysics Data System (ADS)

    Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael

    1995-12-01

    Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.

  20. Linking the Human Gut Microbiome to Inflammatory Cytokine Production Capacity.

    PubMed

    Schirmer, Melanie; Smeekens, Sanne P; Vlamakis, Hera; Jaeger, Martin; Oosting, Marije; Franzosa, Eric A; Ter Horst, Rob; Jansen, Trees; Jacobs, Liesbeth; Bonder, Marc Jan; Kurilshikov, Alexander; Fu, Jingyuan; Joosten, Leo A B; Zhernakova, Alexandra; Huttenhower, Curtis; Wijmenga, Cisca; Netea, Mihai G; Xavier, Ramnik J

    2016-11-03

    Gut microbial dysbioses are linked to aberrant immune responses, which are often accompanied by abnormal production of inflammatory cytokines. As part of the Human Functional Genomics Project (HFGP), we investigate how differences in composition and function of gut microbial communities may contribute to inter-individual variation in cytokine responses to microbial stimulations in healthy humans. We observe microbiome-cytokine interaction patterns that are stimulus specific, cytokine specific, and cytokine and stimulus specific. Validation of two predicted host-microbial interactions reveal that TNFα and IFNγ production are associated with specific microbial metabolic pathways: palmitoleic acid metabolism and tryptophan degradation to tryptophol. Besides providing a resource of predicted microbially derived mediators that influence immune phenotypes in response to common microorganisms, these data can help to define principles for understanding disease susceptibility. The three HFGP studies presented in this issue lay the groundwork for further studies aimed at understanding the interplay between microbial, genetic, and environmental factors in the regulation of the immune response in humans. PAPERCLIP. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Influences of Plant Traits on Immune Responses of Specialist and Generalist Herbivores

    PubMed Central

    Lampert, Evan

    2012-01-01

    Specialist and generalist insect herbivore species often differ in how they respond to host plant traits, particularly defensive traits, and these responses can include weakened or strengthened immune responses to pathogens and parasites. Accurate methods to measure immune response in the presence and absence of pathogens and parasites are necessary to determine whether susceptibility to these natural enemies is reduced or increased by host plant traits. Plant chemical traits are particularly important in that host plant metabolites may function as antioxidants beneficial to the immune response, or interfere with the immune response of both specialist and generalist herbivores. Specialist herbivores that are adapted to process and sometimes accumulate specific plant compounds may experience high metabolic demands that may decrease immune response, whereas the metabolic demands of generalist species differ due to more broad-substrate enzyme systems. However, the direct deleterious effects of plant compounds on generalist herbivores may weaken their immune responses. Further research in this area is important given that the ecological relevance of plant traits to herbivore immune responses is equally important in natural systems and agroecosystems, due to potential incompatibility of some host plant species and cultivars with biological control agents of herbivorous pests. PMID:26466545

  2. Lytic and latent antigens of the human gammaherpesviruses Kaposi's sarcoma-associated herpesvirus and Epstein-Barr virus induce T-cell responses with similar functional properties and memory phenotypes.

    PubMed

    Bihl, Florian; Narayan, Murli; Chisholm, John V; Henry, Leah M; Suscovich, Todd J; Brown, Elizabeth E; Welzel, Tania M; Kaufmann, Daniel E; Zaman, Tauheed M; Dollard, Sheila; Martin, Jeff N; Wang, Fred; Scadden, David T; Kaye, Kenneth M; Brander, Christian

    2007-05-01

    The cellular immunity against Kaposi's sarcoma-associated herpesvirus (KSHV) is poorly characterized and has not been compared to T-cell responses against other human herpesviruses. Here, novel and dominant targets of KSHV-specific cellular immunity are identified and compared to T cells specific for lytic and latent antigens in a second human gammaherpesvirus, Epstein-Barr virus. The data identify a novel HLA-B57- and HLA-B58-restricted epitope in the Orf57 protein and show consistently close parallels in immune phenotypes and functional response patterns between cells targeting lytic or latent KSHV- and EBV-encoded antigens, suggesting common mechanisms in the induction of these responses.

  3. Antigen-dependent proliferation and cytokine induction in respiratory syncytial virus-infected cotton rats reflect the presence of effector-memory T cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Richter, Bettina W.M.; Onuska, Jaya M.; Niewiesk, Stefan

    2005-06-20

    Respiratory syncytial virus (RSV) is a major cause of lower airway disease in infants and children. Immunity to RSV is not long lasting, resulting in re-occurring infections throughout life. Effective long-lived immunity results when central-memory T cells that proliferate vigorously and secrete IL-2 are present. In contrast, effector-memory T cells that mainly produce IFN-{gamma}, facilitate virus clearance but are not long lived. To identify the type of memory response induced after RSV-A (Long) infection, we characterized the kinetics of the antigen-specific immune response and identified the types of cytokines induced. RSV-specific lymphocytic proliferation following primary and secondary infection was similar,more » and in both cases responses waned within a short period of time. In addition, mRNA for IFN-{gamma} but not IL-2 was induced in RSV-specific CD4{sup +} T cells. This supports the idea that the presence of effector-memory rather than central-memory T cells contributes to the ineffectiveness of the immune response to RSV.« less

  4. Streptococcal Immunity Is Constrained by Lack of Immunological Memory following a Single Episode of Pyoderma

    PubMed Central

    Pandey, Manisha; Ozberk, Victoria; Calcutt, Ainslie; Langshaw, Emma; Powell, Jessica; Rivera-Hernandez, Tania; Philips, Zachary; Batzloff, Michael R.; Good, Michael F.

    2016-01-01

    The immunobiology underlying the slow acquisition of skin immunity to group A streptococci (GAS), is not understood, but attributed to specific virulence factors impeding innate immunity and significant antigenic diversity of the type-specific M-protein, hindering acquired immunity. We used a number of epidemiologically distinct GAS strains to model the development of acquired immunity. We show that infection leads to antibody responses to the serotype-specific determinants on the M-protein and profound protective immunity; however, memory B cells do not develop and immunity is rapidly lost. Furthermore, antibodies do not develop to a conserved M-protein epitope that is able to induce immunity following vaccination. However, if re-infected with the same strain within three weeks, enduring immunity and memory B-cells (MBCs) to type-specific epitopes do develop. Such MBCs can adoptively transfer protection to naïve recipients. Thus, highly protective M-protein-specific MBCs may never develop following a single episode of pyoderma, contributing to the slow acquisition of immunity and to streptococcal endemicity in at-risk populations. PMID:28027314

  5. Polymicrobial sepsis and non-specific immunization induce adaptive immunosuppression to a similar degree.

    PubMed

    Schmoeckel, Katrin; Mrochen, Daniel M; Hühn, Jochen; Pötschke, Christian; Bröker, Barbara M

    2018-01-01

    Sepsis is frequently complicated by a state of profound immunosuppression, in its extreme form known as immunoparalysis. We have studied the role of the adaptive immune system in the murine acute peritonitis model. To read out adaptive immunosuppression, we primed post-septic and control animals by immunization with the model antigen TNP-ovalbumin in alum, and measured the specific antibody-responses via ELISA and ELISpot assay as well as T-cell responses in a proliferation assay after restimulation. Specific antibody titers, antibody affinity and plasma cell counts in the bone marrow were reduced in post-septic animals. The antigen-induced splenic proliferation was also impaired. The adaptive immunosuppression was positively correlated with an overwhelming general antibody response to the septic insult. Remarkably, antigen "overload" by non-specific immunization induced a similar degree of adaptive immunosuppression in the absence of sepsis. In both settings, depletion of regulatory T cells before priming reversed some parameters of the immunosuppression. In conclusion, our data show that adaptive immunosuppression occurs independent of profound systemic inflammation and life-threatening illness.

  6. Polymicrobial sepsis and non-specific immunization induce adaptive immunosuppression to a similar degree

    PubMed Central

    Hühn, Jochen; Pötschke, Christian

    2018-01-01

    Sepsis is frequently complicated by a state of profound immunosuppression, in its extreme form known as immunoparalysis. We have studied the role of the adaptive immune system in the murine acute peritonitis model. To read out adaptive immunosuppression, we primed post-septic and control animals by immunization with the model antigen TNP-ovalbumin in alum, and measured the specific antibody-responses via ELISA and ELISpot assay as well as T-cell responses in a proliferation assay after restimulation. Specific antibody titers, antibody affinity and plasma cell counts in the bone marrow were reduced in post-septic animals. The antigen-induced splenic proliferation was also impaired. The adaptive immunosuppression was positively correlated with an overwhelming general antibody response to the septic insult. Remarkably, antigen “overload” by non-specific immunization induced a similar degree of adaptive immunosuppression in the absence of sepsis. In both settings, depletion of regulatory T cells before priming reversed some parameters of the immunosuppression. In conclusion, our data show that adaptive immunosuppression occurs independent of profound systemic inflammation and life-threatening illness. PMID:29415028

  7. [Construction of the DNA vaccine of major outer membrane protein of Neisseria gonorrhoeae and investigation of immune effects after vaccination].

    PubMed

    Liao, Fang; He, Chao; Liu, Hai-Peng; Song, Qi-Fa; Yan, Jie

    2006-11-01

    To clone PIB gene of Neisseria gonorrhoeae, and to construct a recombinant eukaryotic expression vector pCI-PIB and to understand the effects of pCI-PIB vaccination in mice to induce specific humoral and cellular immune responses. The entire PIB gene of Neisseria gonorrhoeae (960 bp) was amplified by using PCR. An eukaryotic eukaryotic vector pCI-PIB was then constructed. BALB/c mice (n = 65, 100 microg/time/mouse) were immunized with pCI-PIB by intramuscular injection. ABC assay was employed to examine the PIB expression in muscular cells of the pCI-PIB-immunized mice (n = 10). ELISA and MTT assays were used to measure the effects of humoral and cellular immune responses of the remaining pCI-PIB-immunized mice. By using slide agglutination test and complement bacteriolytic test, the serum anti-bacterial activity of the pCI-PIB immunized mice was determined. The entire PIB gene amplification fragment of the expected size (960 bp) was successfully obtained by PCR. In comparison with the reported PIB gene sequence (GenBank No: AF090801), the homology of nucleotide sequence of the target inserted fragment in the recombinant plasmid pCI-PIB was as high as 99.28%. The muscular cells of the immunized mice could take in pCI-PIB and then express PIB. In the pCI-PIB immunized mice, the higher titer (1:4000) of specific serum IgG and the specific T lymphocyte response were found. The proliferation index (4.031) was significantly higher than that of the controls (1.127) (t = 71.71, P < 0.05). The sera and washings from the pCI-PIB immunized mice could agglutinate Neisseria gonorrhoeae and kill this microbe in presence of complements. In this study we successfully constructed a recombinant eukaryotic expression vector pCI-PIB. The mice inoculated with pCI-PIB might efficiently produce the specific humoral and cellular immune responses, suggesting that pCI-PIB should be potential service as a candidate of Neisseria gonorrhoeae DNA vaccines.

  8. Elicitation of strong immune responses by a DNA vaccine expressing a secreted form of hepatitis C virus envelope protein E2 in murine and porcine animal models

    PubMed Central

    Li, Yi-Ping; Kang, Hye Na; Babiuk, Lorne A; Liu, Qiang

    2006-01-01

    AIM: To characterize the immunogenicity of a hepatitis C virus (HCV) E2 DNA vaccine alone or with a protein vaccine boost in murine and porcine animal models. METHODS: A DNA vaccine expressing a secreted form of HCV E2 protein was constructed and used to vaccinate mice and piglets with or without boosting with a recombinant E2 protein vaccine formulated with CpG ODN and 10% Emulsigen. The immunogenicity of HCV E2 vaccines was analyzed by ELISA for antibody responses, MTT assay for lymphocyte proliferation, ELISPOT for the number of interferon-γ secreting cells, and cytotoxic T lymphocyte assays. RESULTS: Intradermal injection of E2 DNA vaccine induced strong Th1-like immune responses in mice. In piglets, E2 DNA vaccine elicited moderate and more balanced immune responses. A DNA vaccine prime and protein boost vaccination strategy induced significantly higher E2-specific antibody levels and shifted the immune response towards Th2-like ones in piglets. CONCLUSION: A DNA vaccine expressing a secreted form of HCV E2 protein elicited E2-specific immune responses in mice and piglets. Recombinant E2 protein vaccination following DNA immunization significantly increased the antibody response in piglets. These HCV E2 vaccines may represent promising hepatitis C vaccine candidates for further investigations. PMID:17131474

  9. Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.

    PubMed

    Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi

    2018-04-16

    While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Modulation of allergic immune responses by mucosal application of recombinant lactic acid bacteria producing the major birch pollen allergen Bet v 1.

    PubMed

    Daniel, C; Repa, A; Wild, C; Pollak, A; Pot, B; Breiteneder, H; Wiedermann, U; Mercenier, A

    2006-07-01

    Probiotic lactic acid bacteria (LAB) are able to modulate the host immune system and clinical trials have demonstrated that specific strains have the capacity to reduce allergic symptoms. Therefore, we aimed to evaluate the potential of recombinant LAB producing the major birch pollen allergen Bet v 1 for mucosal vaccination against birch pollen allergy. Recombinant Bet v 1-producing Lactobacillus plantarum and Lactococcus lactis strains were constructed. Their immunogenicity was compared with purified Bet v 1 by subcutaneous immunization of mice. Intranasal application of the live recombinant strains was performed to test their immunomodulatory potency in a mouse model of birch pollen allergy. Bet v 1 produced by the LAB was recognized by monoclonal anti-Bet v 1 and IgE antibodies from birch pollen-allergic patients. Systemic immunization with the recombinant strains induced significantly lower IgG1/IgG2a ratios compared with purified Bet v 1. Intranasal pretreatment led to reduced allergen-specific IgE vs enhanced IgG2a levels and reduced interleukin (IL)-5 production of splenocytes in vitro, indicating a shift towards non-allergic T-helper-1 (Th1) responses. Airway inflammation, i.e. eosinophils and IL-5 in lung lavages, was reduced using either Bet v 1-producing or control strains. Allergen-specific secretory IgA responses were enhanced in lungs and intestines after pretreatment with only the Bet v 1-producing strains. Mucosal vaccination with live recombinant LAB, leading to a shift towards non-allergic immune responses along with enhanced allergen-specific mucosal IgA levels offers a promising approach to prevent systemic and local allergic immune responses.

  11. Therapeutic Vaccination against Adjuvant Arthritis Using Autoimmune T Cells Treated with Hydrostatic Pressure

    NASA Astrophysics Data System (ADS)

    Lider, Ofer; Karin, Nathan; Shinitzky, Meir; Cohen, Irun R.

    1987-07-01

    An ideal treatment for autoimmune diseases would be a nontoxic means of specifically neutralizing the autoreactive lymphocytes responsible for the disease. This goal has been realized in experimental autoimmunity models by immunizing rats or mice against their own autoimmune cells such that the animals generate an immune response specifically repressive to the disease-producing lymphocytes. This maneuver, termed lymphocyte vaccination, was demonstrated to be effective using some, but not all, autoimmune helper T-lymphocyte lines. We now report that T lymphocytes, otherwise incapable of triggering an immune response, can be transformed into effective immunogens by treating the cells in vitro with hydrostatic pressure. Clone A2b, as effector clone that recognized cartilage proteoglycan and caused adjuvant arthritis in Lewis rats, is such a cell. Untreated A2b could not trigger an immune response, but inoculating rats with pressure-treated A2b induced early remission of established adjuvant arthritis as well as resistance to subsequent disease. Specific resistance to arthritis was associated with anti-idiotypic T-cell reactivity to clone A2b and could be transferred from vaccinated rats to naive recipients using donor lymphoid cells. Aggregation of T-lymphocyte membrane components appeared to be important for an immune response because the effects of hydrostatic pressure could be reproduced by treatment of A2b with chemical cross-linkers or with agents disrupting the cytoskeleton. Populations of lymph node cells from antigen-primed rats, when treated with hydrostatic pressure, could also induce suppression of disease. Thus, effective vaccines can be developed without having to isolate the autoimmune T lymphocytes as lines or clones. These results demonstrate that effector T lymphocytes suitably treated may serve as agents for specifically controlling the immune system.

  12. Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

    PubMed

    Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

    2008-04-01

    Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

  13. Induction and Subversion of Human Protective Immunity: Contrasting Influenza and Respiratory Syncytial Virus

    PubMed Central

    Ascough, Stephanie; Paterson, Suzanna; Chiu, Christopher

    2018-01-01

    Respiratory syncytial virus (RSV) and influenza are among the most important causes of severe respiratory disease worldwide. Despite the clinical need, barriers to developing reliably effective vaccines against these viruses have remained firmly in place for decades. Overcoming these hurdles requires better understanding of human immunity and the strategies by which these pathogens evade it. Although superficially similar, the virology and host response to RSV and influenza are strikingly distinct. Influenza induces robust strain-specific immunity following natural infection, although protection by current vaccines is short-lived. In contrast, even strain-specific protection is incomplete after RSV and there are currently no licensed RSV vaccines. Although animal models have been critical for developing a fundamental understanding of antiviral immunity, extrapolating to human disease has been problematic. It is only with recent translational advances (such as controlled human infection models and high-dimensional technologies) that the mechanisms responsible for differences in protection against RSV compared to influenza have begun to be elucidated in the human context. Influenza infection elicits high-affinity IgA in the respiratory tract and virus-specific IgG, which correlates with protection. Long-lived influenza-specific T cells have also been shown to ameliorate disease. This robust immunity promotes rapid emergence of antigenic variants leading to immune escape. RSV differs markedly, as reinfection with similar strains occurs despite natural infection inducing high levels of antibody against conserved antigens. The immunomodulatory mechanisms of RSV are thus highly effective in inhibiting long-term protection, with disturbance of type I interferon signaling, antigen presentation and chemokine-induced inflammation possibly all contributing. These lead to widespread effects on adaptive immunity with impaired B cell memory and reduced T cell generation and functionality. Here, we discuss the differences in clinical outcome and immune response following influenza and RSV. Specifically, we focus on differences in their recognition by innate immunity; the strategies used by each virus to evade these early immune responses; and effects across the innate-adaptive interface that may prevent long-lived memory generation. Thus, by comparing these globally important pathogens, we highlight mechanisms by which optimal antiviral immunity may be better induced and discuss the potential for these insights to inform novel vaccines. PMID:29552008

  14. Immunodominance and Functional Activities of Antibody Responses to Inactivated West Nile Virus and Recombinant Subunit Vaccines in Mice▿

    PubMed Central

    Zlatkovic, Juergen; Stiasny, Karin; Heinz, Franz X.

    2011-01-01

    Factors controlling the dominance of antibody responses to specific sites in viruses and/or protein antigens are ill defined but can be of great importance for the induction of potent immune responses to vaccines. West Nile virus and other related important human-pathogenic flaviviruses display the major target of neutralizing antibodies, the E protein, in an icosahedral shell at the virion surface. Potent neutralizing antibodies were shown to react with the upper surface of domain III (DIII) of this protein. Using the West Nile virus system, we conducted a study on the immunodominance and functional quality of E-specific antibody responses after immunization of mice with soluble protein E (sE) and isolated DIII in comparison to those after immunization with inactivated whole virions. With both virion and sE, the neutralizing response was dominated by DIII-specific antibodies, but the functionality of these antibodies was almost four times higher after virion immunization. Antibodies induced by the isolated DIII had an at least 15-fold lower specific neutralizing activity than those induced by the virion, and only 50% of these antibodies were able to bind to virus particles. Our results suggest that immunization with the tightly packed E in virions focuses the DIII antibody response to the externally exposed sites of this domain which are the primary targets for virus neutralization, different from sE and isolated DIII, which also display protein surfaces that are cryptic in the virion. Despite its low potency for priming, DIII was an excellent boosting antigen, suggesting novel vaccination strategies that strengthen and focus the antibody response to critical neutralizing sites in DIII. PMID:21147919

  15. Behavioural fever is a synergic signal amplifying the innate immune response.

    PubMed

    Boltaña, Sebastian; Rey, Sonia; Roher, Nerea; Vargas, Reynaldo; Huerta, Mario; Huntingford, Felicity Anne; Goetz, Frederick William; Moore, Janice; Garcia-Valtanen, Pablo; Estepa, Amparo; Mackenzie, S

    2013-09-07

    Behavioural fever, defined as an acute change in thermal preference driven by pathogen recognition, has been reported in a variety of invertebrates and ectothermic vertebrates. It has been suggested, but so far not confirmed, that such changes in thermal regime favour the immune response and thus promote survival. Here, we show that zebrafish display behavioural fever that acts to promote extensive and highly specific temperature-dependent changes in the brain transcriptome. The observed coupling of the immune response to fever acts at the gene-environment level to promote a robust, highly specific time-dependent anti-viral response that, under viral infection, increases survival. Fish that are not offered a choice of temperatures and that therefore cannot express behavioural fever show decreased survival under viral challenge. This phenomenon provides an underlying explanation for the varied functional responses observed during systemic fever. Given the effects of behavioural fever on survival and the fact that it exists across considerable phylogenetic space, such immunity-environment interactions are likely to be under strong positive selection.

  16. Deceptive Imprinting and Immune Refocusing in Vaccine Design

    USDA-ARS?s Scientific Manuscript database

    A large number of the world’s most widespread and problematic pathogens evade host immune responses by inducing strain specific immunity to immunodominant epitopes with high mutation rates capable of altering antigenic profiles. The immune system appears to be decoyed into reacting to these immunod...

  17. Is an immune reaction required for malignant transformation and cancer growth?

    PubMed

    Prehn, Richmond T; Prehn, Liisa M

    2012-07-01

    Increasing evidence has shown that probably all malignant mouse cells, even those of spontaneous sporadic cancers, are endowed with tumor-specific antigens. Stimulation of cancer growth, rather than inhibition by the immune reaction, is seemingly the prevalent effect in the animal of origin (the autochthonous animal). Small initial dosages of even strong tumor antigens tend to produce stimulatory immune reactions rather than tumor inhibition in any animal. Thus, an immune response at a low level may be an essential growth-driving feature of nascent cancers, and this may be why all cancers apparently have tumor-specific antigens. Inasmuch as a low level of immunity is stimulatory to tumor growth while larger dosages are inhibitory, immuno-selection via this low response may tend to keep the antitumor immune reaction weak and at a nearly maximal stimulatory level throughout most of a tumor's existence. These facts suggest that both suppression of tumor immunity and a heightened immune reaction might each be therapeutic although very contrasting modalities.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pomorska-Mól, Małgorzata, E-mail: mpomorska@piwet.pulawy.pl; Kwit, Krzysztof; Markowska-Daniel, Iwona

    The effect of a seven-day antibiotic therapy with doxycycline was investigated on the postvaccinal humoral and cellular immune response in pigs. The selected parameters of non-specific immunity were also studied. Fifty pigs were used (control not vaccinated (C, n = 10), control vaccinated (CV, n = 20), and experimental — received doxycycline (DOXY, n = 20)). For vaccination live-attenuated vaccine against pseudorabies (PR) was used. From day − 1 to day 5 pigs from DOXY group received doxycycline orally with drinking water, at the recommended dose. Pigs from DOXY and CV groups were vaccinated at 8 and 10 weeks ofmore » age. The results of the present study showed that cell-mediated postvaccinal immune response can be modulated by oral treatment with doxycycline. Significantly lower values of stimulation index were observed after PRV restimulation in doxycycline-treated pigs. Moreover, in the DOXY group a significant decrease in IFN-γ production after PRV restimulation was noted. The significantly lower number of CD4+CD8 + cells was also observed in doxy-treated, vaccinated pigs, 2 weeks after final vaccination. Simultaneously, specific humoral response was not disturbed. This study demonstrated the importance of defining the immune modulatory activity of doxycycline because it may alter the immune responses to vaccines. The exact mechanism of T-cell response suppression by doxycycline remains to be elucidated, however the influence of doxycycline on the secretion of various cytokines, including IFN-γ, may be considered as a possible cause. The present observations should prompt further studies on the practical significance of such phenomena in terms of clinical implications. - Highlights: • We examine the postvaccinal immune response in pigs treated with doxycycline. • Doxycycline negatively influenced the specific proliferation after recall stimulation. • Doxycycline negatively influenced secretion of IFN-γ after recall stimulation. • The lower number of CD4+CD8 + cells was observed in doxy-treated pigs. • The development of specific humoral response was not disturbed by doxycycline.« less

  19. Human papillomavirus 16 (HPV16) and HPV52 E6-specific immunity in HIV-infected adults on combination antiretroviral therapy.

    PubMed

    Leng, C Y; Low, H C; Chua, L L; Chong, M L; Sulaiman, H; Azwa, I; Roberts, J M; Kamarulzaman, A; Rajasuriar, R; Woo, Y L

    2017-05-01

    Human papillomavirus (HPV)-associated cancers disproportionately affect those infected with HIV despite effective combination antiretroviral therapy (cART). The primary aim of this study was to quantify HPV16 and HPV52 E6-specific interferon (IFN)-γ enzyme-linked immunospot (ELISPOT) T-cell responses, a correlate of protective immunity, in the first year following cART initiation and subsequently in those patients with suboptimal (sIR) and optimal (oIR) immune reconstitution. Ninety-four HIV-infected patients were recruited to the study; a longitudinal cohort of patients recruited just prior to commencing cART and followed up for 48 weeks (n = 27), and a cross-sectional cohort (n = 67) consisting of patients with sIR (CD4 T-cell count < 350 cells/μL) and oIR (CD4 T-cell count > 500 cells/μL) after a minimum of 2 years on cART. Controls (n = 29) consisted of HIV-negative individuals. IFN-γ ELISPOT responses against HPV16 and HPV52 E6 were correlated to clinical characteristics, anal and oral HPV carriage, T-cell maturational subsets, markers of activation, senescence and T-regulatory cells. HPV16 and HPV52 E6-specific T-cell responses were detected in only one of 27 patients (3.7%) during the initial phase of immune recovery. After at least 2 years of cART, those who achieved oIR had significantly higher E6-specific responses (9 of 34; 26.5%) compared with those with sIR (2 of 32; 6.3%) (P = 0.029). Apart from higher CD4 T-cell counts and lower CD4 T-cell activation, no other immunological correlates were associated with the detection of HPV16 and HPV52 E6-specific responses. HPV16 and HPV52 E6-specific IFN-γ T-cell responses, a correlate of protective immunity, were detected more frequently among HIV-infected patients who achieved optimal immune recovery on cART (26.5%) compared with those with suboptimal recovery (6.3%). © 2016 British HIV Association.

  20. Universal immunity to influenza must outwit immune evasion

    PubMed Central

    Quiñones-Parra, Sergio; Loh, Liyen; Brown, Lorena E.; Kedzierska, Katherine; Valkenburg, Sophie A.

    2014-01-01

    Although an influenza vaccine has been available for 70 years, influenza virus still causes seasonal epidemics and worldwide pandemics. Currently available vaccines elicit strain-specific antibody (Ab) responses to the surface haemagglutinin (HA) and neuraminidase (NA) proteins, but these can be ineffective against serologically-distinct viral variants and novel subtypes. Thus, there is a great need for cross-protective or “universal” influenza vaccines to overcome the necessity for annual immunization against seasonal influenza and to provide immunity to reduce the severity of infection with pandemic or outbreak viruses. It is well established that natural influenza infection can provide cross-reactive immunity that can reduce the impact of infection with distinct influenza type A strains and subtypes, including H1N1, H3N2, H2N2, H5N1, and H7N9. The key to generating universal influenza immunity through vaccination is to target functionally-conserved regions of the virus, which include epitopes on the internal proteins for cross-reactive T cell immunity or on the HA stem for broadly reactive Ab responses. In the wake of the 2009 H1N1 pandemic, broadly neutralizing antibodies (bnAbs) have been characterized and isolated from convalescent and vaccinated individuals, inspiring development of new vaccination techniques to elicit such responses. Induction of influenza-specific T cell responses through vaccination has also been recently examined in clinical trials. Strong evidence is available from human and animal models of influenza to show that established influenza-specific T cell memory can reduce viral shedding and symptom severity. However, the published evidence also shows that CD8+ T cells can efficiently select immune escape mutants early after influenza virus infection. Here, we discuss universal immunity to influenza viruses mediated by both cross-reactive T cells and Abs, the mechanisms of immune evasion in influenza, and propose how to counteract commonly occurring immune-escape variants. PMID:24971078

  1. Defective B cell response to T-dependent immunization in lupus-prone mice

    PubMed Central

    Niu, Haitao; Sobel, Eric S.; Morel, Laurence

    2009-01-01

    Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209

  2. A novel DNA vaccine for reduction of PRRSV-induced negative immunomodulatory effects: A proof of concept.

    PubMed

    Suradhat, Sanipa; Wongyanin, Piya; Kesdangsakonwut, Sawang; Teankum, Komkrich; Lumyai, Mongkol; Triyarach, Sittikorn; Thanawongnuwech, Roongroje

    2015-07-31

    Viral-induced interleukin (IL)-10 and regulatory T lymphocytes (Tregs) are believed to play a major role in shaping the immunological and clinical outcomes following Porcine Reproductive and Respiratory Syndrome virus (PRRSV) infection. Recently, it has been shown that PRRSV nucleocapsid (N) protein can induce IL-10 production which is essential for induction of PRRSV-specific Tregs. We hypothesized that immunity to N protein should reduce PRRSV-induced negative immunomodulatory effects which will be essential for establishing proper anti-PRRSV immunity in infected pigs. To investigate the immunomodulatory effects of DNA vaccine encoding a linearized, truncated form of PRRSV-N protein (pORF7t) which was designed to preferentially induce cell-mediated immunity against PRRSV N protein. Immunomodulatory effects of the novel DNA vaccine were investigated in an experimental vaccinated-challenged model. In addition, long-term immunomodulatory effects of the DNA vaccine were investigated in vaccinated pigs kept at the PRRSV-positive environment until the end of the fattening period. Pigs were vaccinated either prior to or following natural PRRSV infection. The results indicated that pORF7t could modulate the anti-PRRSV immune responses and promote the control of viral replication in the vaccinated-challenged pigs. Immunized pigs exhibited increased numbers of PRRSV-specific activated CD4(+)CD25(+) lymphocytes, reduced numbers of PRRSV-specific Tregs, and rapid viral clearance following infection. In a long-term study, regardless of the time of vaccination, DNA vaccine could modulate the host immune responses, resulted in enhanced PRRSV-specific IFN-γ producing cells, and reduced numbers of PRRSV-specific Tregs, without evidence of enhanced antibody responses. No vaccine adverse reaction was observed throughout the study. This study revealed the novel concept that PRRSV-specific immunity can be modulated by induction of cell-mediated immunity against the nucleocapsid protein. This concept could potentially benefit the development of PRRSV management and control strategies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Active and passive immunization for cancer.

    PubMed

    Baxter, David

    2014-01-01

    Vaccination started around the 10th century AD as a means of preventing smallpox. By the end of the 19th century such therapeutic vaccines were well established with both active and passive preparations being used in clinical practice. Active immunization involved administering an immunogen that might be live/ attenuated, killed/ inactivated, toxoid or subunit in origin. Passive immunization involved giving pre-formed antibodies, usually to very recently exposed individuals. At about the same time such approaches were also tried to treat a variety of cancers - proof of principle for the protective role of the immune response against malignancy was established by the observation that tumors transplanted into syngeneic hosts were rejected by the host innate and adaptive responses. The impact of these therapeutic vaccination has taken a considerable time to become established - in part because target antigens against which an adaptive response can be directed do not appear to be uniquely expressed on malignant transformed cells; and also because tumor cells are able to manipulate their environment to downregulate the host immune response. Therapeutic cancer vaccines are also divided into active and passive types - the latter being subdivided into specific and non-specific vaccines. Active immunization utilizes an immunogen to generate a host response designed to eliminate the malignant cells, whereas in passive immunization preformed antibodies or cells are administered to directly eliminate the transformed cells - examples of each are considered in this review.

  4. Immune responses to vaccines delivered by encapsulation into and/or adsorption onto cationic lipid-PLGA hybrid nanoparticles.

    PubMed

    Liu, Lanxia; Ma, Pingchuan; Wang, Hai; Zhang, Chao; Sun, Hongfan; Wang, Chun; Song, Cunxian; Leng, Xigang; Kong, Deling; Ma, Guilei

    2016-03-10

    In this study, we used cationic lipid-poly(lactide-co-glycolide) acid (PLGA) hybrid nanoparticles as antigen delivery carriers to investigate how antigen-loading methods affect antigen exposure to the immune system and evaluated the resulting antigen-specific immune responses. We formulated three classes of antigen adsorbed and/or encapsulated cationic lipid-PLGA hybrid nanoparticles; we designated antigen-adsorbed (out), antigen-encapsulated (in), and antigen-adsorbed/encapsulated (both) nanoparticles. Our results demonstrate significantly more efficient lysosomal escape and cross-presentation of antigen from dendritic cells (DCs) that were exposed to "both" and "in" nanoparticles. In vivo experiments further revealed that "both" nanoparticles significantly more effectively provided not only adequate initial antigen exposure but also long-term antigen persistence at the injection site. Data from flow cytometry and ELISA analyses demonstrated elevated in vivo immune responses from mice that were immunized with nanoparticles-delivered OVA when compared with free OVA. In addition, "in" and "both" nanoparticles elicited significantly higher antigen-specific immune response than "out" nanoparticles and free OVA. These results suggest that the location of antigen entrapment is an important factor in modulating the immune responses of antigens delivered by nanoparticles. Overall, we propose here a promising approach for the future design of vaccines using cationic lipid-PLGA nanoparticles. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Active and passive immunization for cancer

    PubMed Central

    Baxter, David

    2014-01-01

    Vaccination started around the 10th century AD as a means of preventing smallpox. By the end of the 19th century such therapeutic vaccines were well established with both active and passive preparations being used in clinical practice. Active immunization involved administering an immunogen that might be live/ attenuated, killed/ inactivated, toxoid or subunit in origin. Passive immunization involved giving pre-formed antibodies, usually to very recently exposed individuals. At about the same time such approaches were also tried to treat a variety of cancers – proof of principle for the protective role of the immune response against malignancy was established by the observation that tumors transplanted into syngeneic hosts were rejected by the host innate and adaptive responses. The impact of these therapeutic vaccination has taken a considerable time to become established - in part because target antigens against which an adaptive response can be directed do not appear to be uniquely expressed on malignant transformed cells; and also because tumor cells are able to manipulate their environment to downregulate the host immune response. Therapeutic cancer vaccines are also divided into active and passive types – the latter being subdivided into specific and non-specific vaccines. Active immunization utilizes an immunogen to generate a host response designed to eliminate the malignant cells, whereas in passive immunization preformed antibodies or cells are administered to directly eliminate the transformed cells - examples of each are considered in this review. PMID:25424829

  6. Metabolic regulation of inflammation.

    PubMed

    Gaber, Timo; Strehl, Cindy; Buttgereit, Frank

    2017-05-01

    Immune cells constantly patrol the body via the bloodstream and migrate into multiple tissues where they face variable and sometimes demanding environmental conditions. Nutrient and oxygen availability can vary during homeostasis, and especially during the course of an immune response, creating a demand for immune cells that are highly metabolically dynamic. As an evolutionary response, immune cells have developed different metabolic programmes to supply them with cellular energy and biomolecules, enabling them to cope with changing and challenging metabolic conditions. In the past 5 years, it has become clear that cellular metabolism affects immune cell function and differentiation, and that disease-specific metabolic configurations might provide an explanation for the dysfunctional immune responses seen in rheumatic diseases. This Review outlines the metabolic challenges faced by immune cells in states of homeostasis and inflammation, as well as the variety of metabolic configurations utilized by immune cells during differentiation and activation. Changes in cellular metabolism that contribute towards the dysfunctional immune responses seen in rheumatic diseases are also briefly discussed.

  7. Immunization of mice with baculovirus-derived recombinant SV40 large tumour antigen induces protective tumour immunity to a lethal challenge with SV40-transformed cells.

    PubMed Central

    Shearer, M H; Bright, R K; Lanford, R E; Kennedy, R C

    1993-01-01

    In this study, we examined the humoral immune responses and in vivo tumour immunity induced by baculovirus recombinant simian virus 40 (SV40) large tumour antigen (rSV40 T-ag). BALB/c mice immunized with rSV40 T-ag produced antibody responses that recognized SV40 large tumour antigen (T-ag) by ELISA. Analysis of these anti-SV40 T-ag responses indicated that the antibodies recognized epitopes associated with both the carboxy and amino terminus of SV40 T-ag. This pattern of SV40 T-ag epitope recognition was similar to that observed in anti-SV40 T-ag responses induced by inoculation with irradiated SV40-transformed cells. Mice immunized with either rSV40 T-ag or with the inactivated transformed cells were protected from a subsequent in vivo lethal tumour challenge with live SV40-transformed cells. These studies suggest that humoral immune responses induced by rSV40 T-ag are similar in epitope specificity to that induced by inactivated SV40-transformed cells. In addition, recombinant tumour-specific antigens from papovaviruses, such as SV40, can be used to induce tumour immunity which protects from a subsequent lethal tumour challenge. This study may provide insight into the use of recombinant tumour antigens as putative tumour vaccines and in the development of active immunotherapeutic strategies for treating virus-induced cancers. PMID:7679059

  8. Innate immunity and effector and regulatory mechanisms involved in allergic contact dermatitis*

    PubMed Central

    Silvestre, Marilene Chaves; Sato, Maria Notomi; dos Reis, Vitor Manoel Silva

    2018-01-01

    Skin's innate immunity is the initial activator of immune response mechanisms, influencing the development of adaptive immunity. Some contact allergens are detected by Toll-like receptors (TLRs) and inflammasome NLR3. Keratinocytes participate in innate immunity and, in addition to functioning as an anatomical barrier, secrete cytokines, such as TNF, IL-1β, and IL-18, contributing to the development of Allergic Contact Dermatitis. Dendritic cells recognize and process antigenic peptides into T cells. Neutrophils cause pro-inflammatory reactions, mast cells induce migration/maturation of skin DCs, the natural killer cells have natural cytotoxic capacity, the γδ T cells favor contact with hapten during the sensitization phase, and the innate lymphoid cells act in the early stages by secreting cytokines, as well as act in inflammation and tissue homeostasis. The antigen-specific inflammation is mediated by T cells, and each subtype of T cells (Th1/Tc1, Th2/Tc2, and Th17/Tc17) activates resident skin cells, thus contributing to inflammation. Skin's regulatory T cells have a strong ability to inhibit the proliferation of hapten-specific T cells, acting at the end of the Allergic Contact Dermatitis response and in the control of systemic immune responses. In this review, we report how cutaneous innate immunity is the first line of defense and focus its role in the activation of the adaptive immune response, with effector response induction and its regulation. PMID:29723367

  9. Toxoplasma gondii Antigen-Pulsed-Dendritic Cell-Derived Exosomes Induce a Protective Immune Response against T. gondii Infection

    PubMed Central

    Aline, Fleur; Bout, Daniel; Amigorena, Sébastian; Roingeard, Philippe; Dimier-Poisson, Isabelle

    2004-01-01

    It was previously demonstrated that immunizing mice with spleen dendritic cells (DCs) that had been pulsed ex vivo with Toxoplasma gondii antigens triggers a systemic Th1-biased specific immune response and induces protection against infection. T. gondii can cause severe sequelae in the fetuses of mothers who acquire the infection during pregnancy, as well as life-threatening neuropathy in immunocompromised patients, in particular those with AIDS. Here, we investigate the efficacy of a novel cell-free vaccine composed of DC exosomes, which are secreted antigen-presenting vesicles that express functional major histocompatibility complex class I and II and T-cell-costimulatory molecules. They have already been shown to induce potent antitumor immune responses. We investigated the potential of DC2.4 cell line-derived exosomes to induce protective immunity against toxoplasmosis. Our data show that most adoptively transferred T. gondii-pulsed DC-derived exosomes were transferred to the spleen, elicited a strong systemic Th1-modulated Toxoplasma-specific immune response in vivo, and conferred good protection against infection. These findings support the possibility that DC-derived exosomes can be used for T. gondii immunoprophylaxis and for immunoprophylaxis against many other pathogens. PMID:15213158

  10. How sex and age affect immune responses, susceptibility to infections, and response to vaccination

    PubMed Central

    Giefing-Kröll, Carmen; Berger, Peter; Lepperdinger, Günter; Grubeck-Loebenstein, Beatrix

    2015-01-01

    Do men die young and sick, or do women live long and healthy? By trying to explain the sexual dimorphism in life expectancy, both biological and environmental aspects are presently being addressed. Besides age-related changes, both the immune and the endocrine system exhibit significant sex-specific differences. This review deals with the aging immune system and its interplay with sex steroid hormones. Together, they impact on the etiopathology of many infectious diseases, which are still the major causes of morbidity and mortality in people at old age. Among men, susceptibilities toward many infectious diseases and the corresponding mortality rates are higher. Responses to various types of vaccination are often higher among women thereby also mounting stronger humoral responses. Women appear immune-privileged. The major sex steroid hormones exhibit opposing effects on cells of both the adaptive and the innate immune system: estradiol being mainly enhancing, testosterone by and large suppressive. However, levels of sex hormones change with age. At menopause transition, dropping estradiol potentially enhances immunosenescence effects posing postmenopausal women at additional, yet specific risks. Conclusively during aging, interventions, which distinctively consider the changing level of individual hormones, shall provide potent options in maintaining optimal immune functions. PMID:25720438

  11. [Effect of immune modulation on immunogenic and protective activity of a live plague vaccine].

    PubMed

    Karal'nik, B V; Ponomareva, T S; Deriabin, P N; Denisova, T G; Mel'nikova, N N; Tugambaev, T I; Atshabar, B B; Zakarian, S B

    2014-01-01

    Comparative evaluation of the effect of polyoxidonium and betaleukin on immunogenic and protective activity of a live plague vaccine in model animal experiments. Plague vaccine EV, polyoxidonium, betaleukin, erythrocytic antigenic diagnosticum for determination of F1 antibodies and immune reagents for detection of lymphocytes with F1 receptors (LFR) in adhesive test developed by the authors were used. The experiments were carried out in 12 rabbits and 169 guinea pigs. Immune modulation accelerated the appearance and disappearance of LFR (early phase) and ensured a more rapid and intensive antibody formation (effector phase). Activation by betaleukin is more pronounced than by polyoxidonium. The more rapid and intensive was the development of early phase, the more effective was antibody response to the vaccine. Immune modulation in the experiment with guinea pigs significantly increased protective activity of the vaccine. The use of immune modulators increased immunogenic (in both early and effector phases of antigen-specific response) and protective activity of the EV vaccine. A connection between the acceleration of the first phase of antigen-specific response and general intensity of effector phase of immune response to the EV vaccine was detected. ,

  12. Strain difference in the immune response to hydralazine in inbred guinea-pigs

    PubMed Central

    Ellman, L.; Inman, J.; Green, Ira

    1971-01-01

    Guinea-pigs were immunized with hydralazine in Freund's complete adjuvant. A marked strain difference in the immune response involving both anti-hydralazine antibody and delayed hypersensitivity to hydralazine was observed in different strains of guinea-pigs: Hartley guinea-pigs and inbred strain 13 guinea-pigs were able to mount a vigorous immune response to the drug while inbred strain 2 guinea-pigs appeared to be `low or non-responders'. This difference could not be explained in terms of metabolism of the drug in that no differences in acetylation were observed. Breeding studies suggest that immune responsiveness to hydralazine is inherited in an autosomal dominant manner. The immune response to hydralazine may be controlled by a `specific immune response gene' which appears not to be linked to the major strain 13 histocompatibility gene. Anti-nuclear and anti-DNA antibodies could not be demonstrated at a time when the animals manifested a strong immune response to hydralazine. Thus, the development of auto-immune phenomena does not appear to be related to the development of an immune response to the drug in short term immunization. Hydralazine-protein conjugates were synthesized, radio-iodinated and used in a Farr technique for the measurement of anti-hydralazine antibody. These techniques for the assay of anti-hydralazine antibodies may be useful in clinical investigations. Imagesp933-a PMID:5316639

  13. Maternal inflammation modulates infant immune response patterns to viral lung challenge in a murine model.

    PubMed

    Gleditsch, Dorothy D; Shornick, Laurie P; Van Steenwinckel, Juliette; Gressens, Pierre; Weisert, Ryan P; Koenig, Joyce M

    2014-07-01

    Chorioamnionitis, an inflammatory gestational disorder, commonly precedes preterm delivery. Preterm infants may be at particular risk for inflammation-related morbidity related to infection, although the pathogenic mechanisms are unclear. We hypothesized that maternal inflammation modulates immune programming to drive postnatal inflammatory processes. We used a novel combined murine model to treat late gestation dams with low-dose lipopolysaccharide (LPS) and to secondarily challenge exposed neonates or weanlings with Sendai virus (SeV) lung infection. Multiple organs were analyzed to characterize age-specific postnatal immune and inflammatory responses. Maternal LPS treatment enhanced innate immune populations in the lungs, livers, and/or spleens of exposed neonates or weanlings. Secondary lung SeV infection variably affected neutrophil, macrophage, and dendritic cell proportions in multiple organs of exposed pups. Neonatal lung infection induced brain interleukin (IL)-4 expression, although this response was muted in LPS-exposed pups. Adaptive immune cells, including lung, lymph node, and thymic lymphocytes and lung CD4 cells expressing FoxP3, interferon (IFN)-γ, or IL-17, were variably prominent in LPS-exposed pups. Maternal inflammation modifies postnatal immunity and augments systemic inflammatory responses to viral lung infection in an age-specific manner. We speculate that inflammatory modulation of the developing immune system contributes to chronic morbidity and mortality in preterm infants.

  14. Biology and Mucosal Immunity to Myxozoans

    PubMed Central

    Gómez, Daniela; Bartholomew, Jerri; Sunyer, J. Oriol

    2014-01-01

    Myxozoans are among the most abundant parasites in nature. Their life cycles involve two hosts: an invertebrate, usually an annelid, and a vertebrate, usually a fish. They affect fish species in their natural habitats but also constitute a menace for fish aquaculture. Using different strategies they are able to parasitize and cause damage in multiple organs, including mucosal tissues, which they use also as portals of entry. In fish, the main mucosal sites include the intestine, skin and gills. Recently the finding of a specific mucosal immunoglobulin in teleost (IgT), analogous to mammalian IgA, and the capacity of fish to develop a specific mucosal immune response against different pathogens, has highlighted the importance of studying immune responses at mucosal sites. In this review, we describe the major biological characteristics of myxozoan parasites and present the data available regarding immune responses for species that infect mucosal sites. As models for mucosal immunity we review the responses to Enteromyxum spp. and Ceratomyxa shasta, both of which parasitize the intestine. The immune response at the skin and gills is also described, as these mucosal tissues are used by myxozoans as attaching surfaces and portal of entry, and some species also parasitize these sites. Finally, the development of immunoprophylactic strategies is discussed. PMID:23994774

  15. Immune Responses in Cattle Inoculated with Mycobacterium bovis, Mycobacterium tuberculosis, or Mycobacterium kansasii

    USDA-ARS?s Scientific Manuscript database

    Cattle were inoculated with Mycobacterium bovis, Mycobacterium tuberculosis, or Mycobacterium kansasii to compare antigen-specific immune responses to varied patterns of mycobacterial disease. Disease expression ranged from colonization with associated pathology (M. bovis), colonization without path...

  16. DNA and modified vaccinia virus Ankara vaccines encoding multiple cytotoxic and helper T-lymphocyte epitopes of human immunodeficiency virus type 1 (HIV-1) are safe but weakly immunogenic in HIV-1-uninfected, vaccinia virus-naive adults.

    PubMed

    Gorse, Geoffrey J; Newman, Mark J; deCamp, Allan; Hay, Christine Mhorag; De Rosa, Stephen C; Noonan, Elizabeth; Livingston, Brian D; Fuchs, Jonathan D; Kalams, Spyros A; Cassis-Ghavami, Farah L

    2012-05-01

    We evaluated a DNA plasmid-vectored vaccine and a recombinant modified vaccinia virus Ankara vaccine (MVA-mBN32), each encoding cytotoxic and helper T-lymphocyte epitopes of human immunodeficiency virus type 1 (HIV-1) in a randomized, double-blinded, placebo-controlled trial in 36 HIV-1-uninfected adults using a heterologous prime-boost schedule. HIV-1-specific cellular immune responses, measured as interleukin-2 and/or gamma interferon production, were induced in 1 (4%) of 28 subjects after the first MVA-mBN32 immunization and in 3 (12%) of 25 subjects after the second MVA-mBN32 immunization. Among these responders, polyfunctional T-cell responses, including the production of tumor necrosis factor alpha and perforin, were detected. Vaccinia virus-specific antibodies were induced to the MVA vector in 27 (93%) of 29 and 26 (93%) of 28 subjects after the first and second immunizations with MVA-mBN32. These peptide-based vaccines were safe but were ineffective at inducing HIV-1-specific immune responses and induced much weaker responses than MVA vaccines expressing the entire open reading frames of HIV-1 proteins.

  17. Functional analysis of HPV-like particle-activated Langerhans cells in vitro.

    PubMed

    Yan, Lisa; Woodham, Andrew W; Da Silva, Diane M; Kast, W Martin

    2015-01-01

    Langerhans cells (LCs) are antigen-presenting cells responsible for initiating an immune response against human papillomaviruses (HPVs) entering the epithelial layer in vivo as they are the first immune cell that HPV comes into contact with. LCs become activated in response to foreign antigens, which causes internal signaling resulting in the increased expression of co-stimulatory molecules and the secretion of inflammatory cytokines. Functionally activated LCs are then capable of migrating to the lymph nodes where they interact with antigen-specific T cells and initiate an adaptive T-cell response in vivo. However, HPV has evolved in a manner that suppresses LC function, and thus the induction of antigen-specific T cells is hindered. While many methods exist to monitor the activity of LCs in vitro, the migration and induction of cytotoxic T cells is ultimately indicative of a functional immune response. Here, methods in analyzing functional migration and induction of antigen-specific T cells after stimulation of LCs with HPV virus-like particles in vitro are described.

  18. Photodynamic therapy for cancer and activation of immune response

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.

    2010-02-01

    Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.

  19. Oral candidosis in relation to oral immunity.

    PubMed

    Feller, L; Khammissa, R A G; Chandran, R; Altini, M; Lemmer, J

    2014-09-01

    Symptomatic oral infection with Candida albicans is characterized by invasion of the oral epithelium by virulent hyphae that cause tissue damage releasing the inflammatory mediators that initiate and sustain local inflammation. Candida albicans triggers pattern-recognition receptors of keratinocytes, macrophages, monocytes and dendritic cells, stimulating the production of IL-1β, IL-6 and IL-23. These cytokines induce the differentiation of Th17 cells and the generation of IL-17- and/or IL-22-mediated antifungal protective immuno-inflammatory responses in infected mucosa. Some immune cells including NKT cells, γδ T cells and lymphoid cells that are innate to the oral mucosa have the capacity to produce large quantities of IL-17 in response to C. albicans, sufficient to mediate effective protective immunity against C. albicans. On the other hand, molecular structures of commensal C. albicans blastoconidia, although detected by pattern-recognition receptors, are avirulent, do not invade the oral epithelium, do not elicit inflammatory responses in a healthy host, but induce regulatory immune responses that maintain tissue tolerance to the commensal fungi. The type, specificity and sensitivity of the protective immune response towards C. albicans is determined by the outcome of the integrated interactions between the intracellular signalling pathways of specific combinations of activated pattern-recognition receptors (TLR2, TLR4, Dectin-1 and Dectin-2). IL-17-mediated protective immune response is essential for oral mucosal immunity to C. albicans infection. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Cytokines and their STATs in cutaneous and visceral leishmaniasis.

    PubMed

    Cummings, Hannah E; Tuladhar, Rashmi; Satoskar, Abhay R

    2010-01-01

    Cytokines play a critical role in shaping the host immune response to Leishmania infection and directing the development of protective and non-protective immunities during infection. Cytokines exert their biological activities through the activation and translocation of transcription factors into the nucleus whether they drive the expression of specific cytokine-responsive genes. Signal transducer and activator of transcription (STATs) are transcription factors which play a critical role in mediating signaling downstream of cytokine receptors and are important for shaping the host immune response during Leishmania infection. Here we discuss the signature cytokines and their associated STATs involved in the host immune response during cutaneous and visceral leishmaniasis.

  1. Antitumor immune responses mediated by dendritic cells

    PubMed Central

    Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne

    2013-01-01

    Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744

  2. Machine-learning algorithms define pathogen-specific local immune fingerprints in peritoneal dialysis patients with bacterial infections.

    PubMed

    Zhang, Jingjing; Friberg, Ida M; Kift-Morgan, Ann; Parekh, Gita; Morgan, Matt P; Liuzzi, Anna Rita; Lin, Chan-Yu; Donovan, Kieron L; Colmont, Chantal S; Morgan, Peter H; Davis, Paul; Weeks, Ian; Fraser, Donald J; Topley, Nicholas; Eberl, Matthias

    2017-07-01

    The immune system has evolved to sense invading pathogens, control infection, and restore tissue integrity. Despite symptomatic variability in patients, unequivocal evidence that an individual's immune system distinguishes between different organisms and mounts an appropriate response is lacking. We here used a systematic approach to characterize responses to microbiologically well-defined infection in a total of 83 peritoneal dialysis patients on the day of presentation with acute peritonitis. A broad range of cellular and soluble parameters was determined in peritoneal effluents, covering the majority of local immune cells, inflammatory and regulatory cytokines and chemokines as well as tissue damage-related factors. Our analyses, utilizing machine-learning algorithms, demonstrate that different groups of bacteria induce qualitatively distinct local immune fingerprints, with specific biomarker signatures associated with Gram-negative and Gram-positive organisms, and with culture-negative episodes of unclear etiology. Even more, within the Gram-positive group, unique immune biomarker combinations identified streptococcal and non-streptococcal species including coagulase-negative Staphylococcus spp. These findings have diagnostic and prognostic implications by informing patient management and treatment choice at the point of care. Thus, our data establish the power of non-linear mathematical models to analyze complex biomedical datasets and highlight key pathways involved in pathogen-specific immune responses. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  3. Correlates of Vaccine-Induced Protection against Mycobacterium tuberculosis Revealed in Comparative Analyses of Lymphocyte Populations

    PubMed Central

    Kurtz, Sherry L.

    2015-01-01

    A critical hindrance to the development of a novel vaccine against Mycobacterium tuberculosis is a lack of understanding of protective correlates of immunity and of host factors involved in a successful adaptive immune response. Studies from our group and others have used a mouse-based in vitro model system to assess correlates of protection. Here, using this coculture system and a panel of whole-cell vaccines with varied efficacy, we developed a comprehensive approach to understand correlates of protection. We compared the gene and protein expression profiles of vaccine-generated immune peripheral blood lymphocytes (PBLs) to the profiles found in immune splenocytes. PBLs not only represent a clinically relevant cell population, but comparing the expression in these populations gave insight into compartmentally specific mechanisms of protection. Additionally, we performed a direct comparison of host responses induced when immune cells were cocultured with either the vaccine strain Mycobacterium bovis BCG or virulent M. tuberculosis. These comparisons revealed host-specific and bacterium-specific factors involved in protection against virulent M. tuberculosis. Most significantly, we identified a set of 13 core molecules induced in the most protective vaccines under all of the conditions tested. Further validation of this panel of mediators as a predictor of vaccine efficacy will facilitate vaccine development, and determining how each promotes adaptive immunity will advance our understanding of antimycobacterial immune responses. PMID:26269537

  4. Transcriptomics of the Vaccine Immune Response: Priming With Adjuvant Modulates Recall Innate Responses After Boosting.

    PubMed

    Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata

    2018-01-01

    Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream adaptive response.

  5. Impaired cellular immune response to tetanus toxoid but not to cytomegalovirus in effectively HAART-treated HIV-infected children.

    PubMed

    Alsina, Laia; Noguera-Julian, Antoni; Fortuny, Clàudia

    2013-05-07

    Despite of highly active antiretroviral therapy, the response to vaccines in HIV-infected children is poor and short-lived, probably due to a defect in cellular immune responses. We compared the cellular immune response (assessed in terms of IFN-γ production) to tetanus toxoid and to cytomegalovirus in a series of 13 HIV-perinatally-infected children and adolescents with optimal immunovirological response to first line antiretroviral therapy, implemented during chronic infection. A stronger cellular response to cytomegalovirus (11 out of 13 patients) was observed, as compared to tetanus toxoid (1 out of 13; p=0.003). These results suggest that the repeated exposition to CMV, as opposed to the past exposition to TT, is able to maintain an effective antigen-specific immune response in stable HIV-infected pediatric patients and strengthen current recommendations on immunization practices in these children. Copyright © 2013. Published by Elsevier Ltd.

  6. Detection of herpes simplex virus type 2 (HSV-2) -specific cell-mediated immune responses in guinea pigs during latent HSV-2 genital infection.

    PubMed

    Perry, Clarice L; Banasik, Brianne N; Gorder, Summer R; Xia, Jingya; Auclair, Sarah; Bourne, Nigel; Milligan, Gregg N

    2016-12-01

    Genital infections with herpes simplex virus type 2 (HSV-2) are a source of considerable morbidity and are a health concern for newborns exposed to virus during vaginal delivery. Additionally, HSV-2 infection diminishes the integrity of the vaginal epithelium resulting in increased susceptibility of individuals to infection with other sexually transmitted pathogens. Understanding immune protection against HSV-2 primary infection and immune modulation of virus shedding events following reactivation of the virus from latency is important for the development of effective prophylactic and therapeutic vaccines. Although the murine model of HSV-2 infection is useful for understanding immunity following immunization, it is limited by the lack of spontaneous reactivation of HSV-2 from latency. Genital infection of guinea pigs with HSV-2 accurately models the disease of humans including the spontaneous reactivation of HSV-2 from latency and provides a unique opportunity to examine virus-host interactions during latency. Although the guinea pig represents an accurate model of many human infections, relatively few reagents are available to study the immunological response to infection. To analyze the cell-mediated immune response of guinea pigs at extended periods of time after establishment of HSV-2 latency, we have modified flow-cytometry based proliferation assays and IFN-γ ELISPOT assays to detect and quantify HSV-specific cell-mediated responses during latent infection of guinea pigs. Here we demonstrate that a combination of proliferation and ELISPOT assays can be used to quantify and characterize effecter function of virus-specific immune memory responses during HSV-latency. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Risk factors for increased immune reconstitution in response to Mycobacterium tuberculosis antigens in tuberculosis HIV-infected, antiretroviral-naïve patients.

    PubMed

    da Silva, Tatiana Pereira; Giacoia-Gripp, Carmem Beatriz Wagner; Schmaltz, Carolina A; Sant'Anna, Flavia Marinho; Saad, Maria Helena; Matos, Juliana Arruda de; de Lima E Silva, Julio Castro Alves; Rolla, Valeria Cavalcanti; Morgado, Mariza Gonçalves

    2017-09-06

    Little is known regarding the restoration of the specific immune response after combined antiretroviral therapy (cART) and anti-tuberculosis (TB) therapy introduction among TB-HIV patients. In this study, we examined the immune response of TB-HIV patients to Mycobacterium tuberculosis (Mtb) antigens to evaluate the response dynamics to different antigens over time. Moreover, we also evaluated the influence of two different doses of efavirenz and the factors associated with immune reconstitution. This is a longitudinal study nested in a clinical trial, where cART was initiated during the baseline visit (D0), which occurred 30 ± 10 days after the introduction of anti-TB therapy. Follow-up visits were performed at 30, 60, 90 and 180 days after cART initiation. The production of IFN-γ upon in vitro stimulation with Mtb antigens purified protein derivative (PPD), ESAT-6 and 38 kDa/CFP-10 using ELISpot was examined at baseline and follow-up visits. Sixty-one patients, all ART-naïve, were selected and included in the immune reconstitution analysis; seven (11.5%) developed Immune Reconstitution Inflammatory Syndrome (IRIS). The Mtb specific immune response was higher for the PPD antigen followed by 38 kDa/CFP-10 and increased in the first 60 days after cART initiation. In multivariate analysis, the variables independently associated with increased IFN-γ production in response to PPD antigen were CD4 + T cell counts <200 cells/mm 3 at baseline, age, site of tuberculosis, 800 mg efavirenz dose and follow-up CD4 + T cell counts. Moreover, the factors associated with the production of IFN-γ in response to 38 kDa/CFP-10 were detectable HIV viral load (VL) and CD4 + T cell counts at follow-up visits of ≥200 cells/mm 3 . These findings highlight the differences in immune response according to the specificity of the Mtb antigen, which contributes to a better understanding of TB-HIV immunopathogenesis. IFN-γ production elicited by PPD and 38 kDa/CFP-10 antigens have a greater magnitude compared to ESAT-6 and are associated with different factors. The low response to ESAT-6, even during immune restoration, suggests that this antigen is not adequate to assess the immune response of immunosuppressed TB-HIV patients.

  8. Modelling and Simulation of the Dynamics of the Antigen-Specific T Cell Response Using Variable Structure Control Theory.

    PubMed

    Anelone, Anet J N; Spurgeon, Sarah K

    2016-01-01

    Experimental and mathematical studies in immunology have revealed that the dynamics of the programmed T cell response to vigorous infection can be conveniently modelled using a sigmoidal or a discontinuous immune response function. This paper hypothesizes strong synergies between this existing work and the dynamical behaviour of engineering systems with a variable structure control (VSC) law. These findings motivate the interpretation of the immune system as a variable structure control system. It is shown that dynamical properties as well as conditions to analytically assess the transition from health to disease can be developed for the specific T cell response from the theory of variable structure control. In particular, it is shown that the robustness properties of the specific T cell response as observed in experiments can be explained analytically using a VSC perspective. Further, the predictive capacity of the VSC framework to determine the T cell help required to overcome chronic Lymphocytic Choriomeningitis Virus (LCMV) infection is demonstrated. The findings demonstrate that studying the immune system using variable structure control theory provides a new framework for evaluating immunological dynamics and experimental observations. A modelling and simulation tool results with predictive capacity to determine how to modify the immune response to achieve healthy outcomes which may have application in drug development and vaccine design.

  9. Histocompatibility type and immune responsiveness in random bred Hartley strain guinea pigs.

    PubMed

    Martin, W J; Ellman, L; Green, I; Benacerraf, B

    1970-12-01

    Outbred Hartley strain guinea pigs capable of responding immunologically to 2,4-dinitrophenylated poly-L-lysine were shown to display a histocompatibility specificity in common with inbred strain 2 guinea pigs. This histocompatibility specificity was not detected in guinea pigs unable to respond immunologically to DNP-PLL. The result suggests that the poly-L-lysine specific immune response gene is very closely linked or even identical with a gene determining a major histocompatibility antigen in guinea pigs.

  10. A protective role of murine langerin+ cells in immune responses to cutaneous vaccination with microneedle patches

    PubMed Central

    Pulit-Penaloza, Joanna A.; Esser, E. Stein; Vassilieva, Elena V.; Lee, Jeong Woo; Taherbhai, Misha T.; Pollack, Brian P.; Prausnitz, Mark R.; Compans, Richard W.; Skountzou, Ioanna

    2014-01-01

    Cutaneous vaccination with microneedle patches offers several advantages over more frequently used approaches for vaccine delivery, including improved protective immunity. However, the involvement of specific APC subsets and their contribution to the induction of immunity following cutaneous vaccine delivery is not well understood. A better understanding of the functions of individual APC subsets in the skin will allow us to target specific skin cell populations in order to further enhance vaccine efficacy. Here we use a Langerin-EGFP-DTR knock-in mouse model to determine the contribution of langerin+ subsets of skin APCs in the induction of adaptive immune responses following cutaneous microneedle delivery of influenza vaccine. Depletion of langerin+ cells prior to vaccination resulted in substantial impairment of both Th1 and Th2 responses, and decreased post-challenge survival rates, in mice vaccinated cutaneously but not in those vaccinated via the intramuscular route or in non-depleted control mice. Our results indicate that langerin+ cells contribute significantly to the induction of protective immune responses following cutaneous vaccination with a subunit influenza vaccine. PMID:25130187

  11. Exposure, infection, systemic cytokine levels and antibody responses in young children concurrently exposed to schistosomiasis and malaria

    PubMed Central

    IMAI, NATSUKO; RUJENI, NADINE; NAUSCH, NORMAN; BOURKE, CLAIRE D.; APPLEBY, LAURA J.; COWAN, GRAEME; GWISAI, REGGIS; MIDZI, NICHOLAS; CAVANAGH, DAVID; MDULUZA, TAKAFIRA; TAYLOR, DAVID; MUTAPI, FRANCISCA

    2011-01-01

    SUMMARY Despite the overlapping distribution of Schistosoma haematobium and Plasmodium falciparum infections, few studies have investigated early immune responses to both parasites in young children resident in areas co-endemic for the parasites. This study measures infection levels of both parasites and relates them to exposure and immune responses in young children. Levels of IgM, IgE, IgG4 directed against schistosome cercariae, egg and adult worm and IgM, IgG directed against P. falciparum schizonts and the merozoite surface proteins 1 and 2 together with the cytokines IFN-γ, IL-4, IL-5, IL-10 and TNF-α were measured by ELISA in 95 Zimbabwean children aged 1–5 years. Schistosome infection prevalence was 14·7% and that of Plasmodium infection was 0% in the children. 43. 4% of the children showed immunological evidence of exposure to schistosome parasites and 13% showed immunological evidence of exposure to Plasmodium parasites. Schistosome–specific responses, indicative of exposure to parasite antigens, were positively associated with cercariae-specific IgE responses, while Plasmodium-specific responses, indicative of exposure to parasite antigens, were negatively associated with responses associated with protective immunity against Plasmodium. There was no significant association between schistosome-specific and Plasmodium-specific responses. Systemic cytokine levels rose with age as well as with schistosome infection and exposure. Overall the results show that (1) significantly more children are exposed to schistosome and Plasmodium infection than those currently infected and; (2) the development of protective acquired immunity commences in early childhood, although its effects on infection levels and pathology may take many years to become apparent. PMID:21813042

  12. Immune responses to Mycoplasma bovis vaccination and experimental infection in the bovine mammary gland.

    PubMed Central

    Boothby, J T; Schore, C E; Jasper, D E; Osburn, B I; Thomas, C B

    1988-01-01

    This study characterized the immune responses in four vaccinated and four control cows in response to vaccination and experimental intramammary inoculation with Mycoplasma bovis. Specific antibody responses occurred in serum and milk in response to vaccination and experimental infection. Lymphocytes from peripheral blood, but not from the mammary gland of vaccinated cows had increased responsiveness to mitogens. No lymphocytes tested were responsive to M. bovis antigen. Both vaccination and experimental infection resulted in skin test reactivity. These results imply that vaccination results in immune responses which may alter the course of experimental M. bovis mastitis, but may contribute to cellular inflammation. PMID:3167718

  13. Deletion of the Vaccinia Virus Gene A46R, Encoding for an Inhibitor of TLR Signalling, Is an Effective Approach to Enhance the Immunogenicity in Mice of the HIV/AIDS Vaccine Candidate NYVAC-C

    PubMed Central

    Perdiguero, Beatriz; Gómez, Carmen Elena; Di Pilato, Mauro; Sorzano, Carlos Oscar S.; Delaloye, Julie; Roger, Thierry; Calandra, Thierry; Pantaleo, Giuseppe; Esteban, Mariano

    2013-01-01

    Viruses have developed strategies to counteract signalling through Toll-like receptors (TLRs) that are involved in the detection of viruses and induction of proinflammatory cytokines and IFNs. Vaccinia virus (VACV) encodes A46 protein which disrupts TLR signalling by interfering with TLR: adaptor interactions. Since the innate immune response to viruses is critical to induce protective immunity, we studied whether deletion of A46R gene in a NYVAC vector expressing HIV-1 Env, Gag, Pol and Nef antigens (NYVAC-C) improves immune responses against HIV-1 antigens. This question was examined in human macrophages and in mice infected with a single A46R deletion mutant of the vaccine candidate NYVAC-C (NYVAC-C-ΔA46R). The viral gene A46R is not required for virus replication in primary chicken embryo fibroblast (CEF) cells and its deletion in NYVAC-C markedly increases TNF, IL-6 and IL-8 secretion by human macrophages. Analysis of the immune responses elicited in BALB/c mice after DNA prime/NYVAC boost immunization shows that deletion of A46R improves the magnitude of the HIV-1-specific CD4 and CD8 T cell immune responses during adaptive and memory phases, maintains the functional profile observed with the parental NYVAC-C and enhances anti-gp120 humoral response during the memory phase. These findings establish the immunological role of VACV A46R on innate immune responses of macrophages in vitro and antigen-specific T and B cell immune responses in vivo and suggest that deletion of viral inhibitors of TLR signalling is a useful approach for the improvement of poxvirus-based vaccine candidates. PMID:24069354

  14. The biological and practical significance of antigenic variability in protective T cell responses against Theileria parva.

    PubMed

    Morrison, W I

    2007-08-19

    The evolution of antigenically distinct pathogen strains that fail to cross-protect is well documented for pathogens controlled primarily by humoral immune responses. Unlike antibodies, which recognise native proteins, protective T cells can potentially recognise epitopes in a variety of proteins that are not necessarily displayed on the pathogen surface. Moreover, individual hosts of different MHC genotypes generally respond to different sets of epitopes. It is therefore less easy to envisage how strain restricted immunity can arise for pathogens controlled by T cell responses, particularly in antigenically complex parasites. Nevertheless, strain restricted immunity is clearly a feature of a number of parasitic infections, where immunity is known to be mediated by T cell responses. One such parasite is Theileria parva which induces potent CD8 T cell responses that play an important role in immunity. CD8 T cells specific for parasitized lymphoblasts exhibit strain specificity, which appears to correlate with the ability of parasite strains to cross-protect. Studies using recently identified T. parva antigens recognised by CD8 T cells have shown that the strain restricted nature of immunity is a consequence of the CD8 T cell response in individual animals being focused on a limited number of dominant polymorphic antigenic determinants. Responses in animals of different MHC genotypes are often directed to different parasite antigens, indicating that, at the host population level, a larger number of parasite proteins can serve as targets for the protective T cell response. Nevertheless, the finding that parasite strains show overlapping antigenic profiles, probably as a consequence of sexual recombination, suggests that induction of responses to an extended but limited set of antigens in individual animals may overcome the strain restricted nature of immunity.

  15. Sex-dependent genetic effects on immune responses to a parasitic nematode.

    PubMed

    Hayes, Kelly S; Hager, Reinmar; Grencis, Richard K

    2014-03-14

    Many disease aetiologies have sex specific effects, which have important implications for disease management. It is now becoming increasingly evident that such effects are the result of the differential expression of autosomal genes rather than sex-specific genes. Such sex-specific variation in the response to Trichuris muris, a murine parasitic nematode infection and model for the human parasitic nematode T. trichiura, has been well documented, however, the underlying genetic causes of these differences have been largely neglected. We used the BXD mouse set of recombinant inbred strains to identify sex-specific loci that contribute to immune phenotypes in T. muris infection. Response phenotypes to T. muris infection were found to be highly variable between different lines of BXD mice. A significant QTL on chromosome 5 (TM5) associated with IFN-γ production was found in male mice but not in female mice. This QTL was in the same location as a suggestive QTL for TNF-α and IL-6 production in male mice suggesting a common control of these pro-inflammatory cytokines. A second QTL was identified on chromosome 4 (TM4) affecting worm burden in both male and female cohorts. We have identified several genes as potential candidates for modifying responses to T. muris infection. We have used the largest mammalian genetic model system, the BXD mouse population, to identify candidate genes with sex-specific effects in immune responses to T. muris infection. Some of these genes may be differentially expressed in male and female mice leading to the difference in immune response between the sexes reported in previous studies. Our study further highlights the importance of considering sex as an important factor in investigations of immune response at the genome-wide level, in particular the bias that can be introduced when generalizing results obtained from only one sex or a mixed sex population. Rather, analyses of interaction effects between sex and genotype should be part of future studies.

  16. Hemagglutinating virus of Japan envelope (HVJ-E) can enhance the immune responses of swine immunized with killed PRRSV vaccine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dai, Zhihong; China Institute of Veterinary Drug Control, Beijing 100081; Zhang, Quan

    Highlights: Black-Right-Pointing-Pointer We investigated the immunoadjuvant effects of HVJ-E on killed PRRSV vaccine. Black-Right-Pointing-Pointer HVJ-E enhanced the humoral and cellular responses of the piglets to PRRSV. Black-Right-Pointing-Pointer It is suggested that HVJ-E could be developed as a new-type adjuvant for mammals. -- Abstract: Porcine reproductive and respiratory syndrome virus (PRRSV) is an economically detrimental pig pathogen that causes significant losses for the pig industry. The immunostimulatory effects of hemagglutinating virus of Japan envelope (HVJ-E) in cancer therapy and the adjuvant efficacy of HVJ-E have been previously evaluated. The objective of this study was to investigate the adjuvant effects of HVJ-Emore » on immunization with killed PRRSV vaccine, and to evaluate the protective effects of this immunization strategy against virulent PRRSV infection in piglets. Next, the PRRSV-specific antibody response, lymphocyte proliferation, PRRSV-specific IL-2, IL-10 and IFN-{gamma} production, and the overall protection efficacy were evaluated to assess the immune responses of the piglets. The results showed that the piglets inoculated simultaneously with killed PRRSV vaccine and HVJ-E had a significantly stronger immune response than those inoculated with killed PRRSV vaccine alone. Our results suggest that HVJ-E could be employed as an effective adjuvant to enhance the humoral and cellular responses of piglets to PRRSV.« less

  17. Human Cytomegalovirus (HCMV)-Specific CD4+ T Cells Are Polyfunctional and Can Respond to HCMV-Infected Dendritic Cells In Vitro

    PubMed Central

    Sedikides, George X.; Mason, Gavin M.; Okecha, Georgina

    2017-01-01

    ABSTRACT Human cytomegalovirus (HCMV) infection and periodic reactivation are generally well controlled by the HCMV-specific T cell response in healthy people. While the CD8+ T cell response to HCMV has been extensively studied, the HCMV-specific CD4+ T cell effector response is not as well understood, especially in the context of direct interactions with HCMV-infected cells. We screened the gamma interferon (IFN-γ) and interleukin-10 (IL-10) responses to 6 HCMV peptide pools (pp65, pp71, IE1, IE2, gB, and US3, selected because they were the peptides most frequently responded to in our previous studies) in 84 donors aged 23 to 74 years. The HCMV-specific CD4+ T cell response to pp65, IE1, IE2, and gB was predominantly Th1 biased, with neither the loss nor the accumulation of these responses occurring with increasing age. A larger proportion of donors produced an IL-10 response to pp71 and US3, but the IFN-γ response was still dominant. CD4+ T cells specific to the HCMV proteins studied were predominantly effector memory cells and produced both cytotoxic (CD107a expression) and cytokine (macrophage inflammatory protein 1β secretion) effector responses. Importantly, when we measured the CD4+ T cell response to cytomegalovirus (CMV)-infected dendritic cells in vitro, we observed that the CD4+ T cells produced a range of cytotoxic and secretory effector functions, despite the presence of CMV-encoded immune evasion molecules. CD4+ T cell responses to HCMV-infected dendritic cells were sufficient to control the dissemination of virus in an in vitro assay. Together, the results show that HCMV-specific CD4+ T cell responses, even those from elderly individuals, are highly functional and are directly antiviral. IMPORTANCE Human cytomegalovirus (HCMV) infection is carried for a lifetime and in healthy people is kept under control by the immune system. HCMV has evolved many mechanisms to evade the immune response, possibly explaining why the virus is never eliminated during the host's lifetime. The dysfunction of immune cells associated with the long-term carriage of HCMV has been linked with poor responses to new pathogens and vaccines when people are older. In this study, we investigated the response of a subset of immune cells (CD4+ T cells) to HCMV proteins in healthy donors of all ages, and we demonstrate that the functionality of CD4+ T cells is maintained. We also show that CD4+ T cells produce effector functions in response to HCMV-infected cells and can prevent virus spread. Our work demonstrates that these HCMV-specific immune cells retain many important functions and help to prevent deleterious HCMV disease in healthy older people. PMID:28053099

  18. Human Cytomegalovirus (HCMV)-Specific CD4+ T Cells Are Polyfunctional and Can Respond to HCMV-Infected Dendritic Cells In Vitro.

    PubMed

    Jackson, Sarah E; Sedikides, George X; Mason, Gavin M; Okecha, Georgina; Wills, Mark R

    2017-03-15

    Human cytomegalovirus (HCMV) infection and periodic reactivation are generally well controlled by the HCMV-specific T cell response in healthy people. While the CD8 + T cell response to HCMV has been extensively studied, the HCMV-specific CD4 + T cell effector response is not as well understood, especially in the context of direct interactions with HCMV-infected cells. We screened the gamma interferon (IFN-γ) and interleukin-10 (IL-10) responses to 6 HCMV peptide pools (pp65, pp71, IE1, IE2, gB, and US3, selected because they were the peptides most frequently responded to in our previous studies) in 84 donors aged 23 to 74 years. The HCMV-specific CD4 + T cell response to pp65, IE1, IE2, and gB was predominantly Th1 biased, with neither the loss nor the accumulation of these responses occurring with increasing age. A larger proportion of donors produced an IL-10 response to pp71 and US3, but the IFN-γ response was still dominant. CD4 + T cells specific to the HCMV proteins studied were predominantly effector memory cells and produced both cytotoxic (CD107a expression) and cytokine (macrophage inflammatory protein 1β secretion) effector responses. Importantly, when we measured the CD4 + T cell response to cytomegalovirus (CMV)-infected dendritic cells in vitro , we observed that the CD4 + T cells produced a range of cytotoxic and secretory effector functions, despite the presence of CMV-encoded immune evasion molecules. CD4 + T cell responses to HCMV-infected dendritic cells were sufficient to control the dissemination of virus in an in vitro assay. Together, the results show that HCMV-specific CD4 + T cell responses, even those from elderly individuals, are highly functional and are directly antiviral. IMPORTANCE Human cytomegalovirus (HCMV) infection is carried for a lifetime and in healthy people is kept under control by the immune system. HCMV has evolved many mechanisms to evade the immune response, possibly explaining why the virus is never eliminated during the host's lifetime. The dysfunction of immune cells associated with the long-term carriage of HCMV has been linked with poor responses to new pathogens and vaccines when people are older. In this study, we investigated the response of a subset of immune cells (CD4 + T cells) to HCMV proteins in healthy donors of all ages, and we demonstrate that the functionality of CD4 + T cells is maintained. We also show that CD4 + T cells produce effector functions in response to HCMV-infected cells and can prevent virus spread. Our work demonstrates that these HCMV-specific immune cells retain many important functions and help to prevent deleterious HCMV disease in healthy older people. Copyright © 2017 American Society for Microbiology.

  19. Migration of antigen-presenting B cells from peripheral to mucosal lymphoid tissues may induce intestinal antigen-specific IgA following parenteral immunization.

    PubMed

    Coffin, S E; Clark, S L; Bos, N A; Brubaker, J O; Offit, P A

    1999-09-15

    Parenterally administered immunizations have long been used to induce protection from mucosal pathogens such as Bordetella pertussis and influenza virus. We previously found that i.m. inoculation of mice with the intestinal pathogen, rotavirus, induced virus-specific Ab production by intestinal lymphocytes. We have now used adoptive transfer studies to identify the cell types responsible for the generation of virus-specific Ab production by gut-associated lymphoid tissue (GALT) after i.m. immunization. Three days after i.m. immunization with rotavirus, cells obtained from the draining peripheral lymph nodes of donor mice were transferred into naive recipient mice. We found that intestinal lymphocytes produced rotavirus-specific Igs (IgM, IgA, and IgG) 2 wk after transfer of either unfractionated cells, or unfractionated cells rendered incapable of cellular division by mitomycin C treatment. Additional studies demonstrated that rotavirus-specific IgA, but not IgG, was produced by intestinal lymphocytes after transfer of purified B cells. Ig allotype analysis revealed that rotavirus-specific IgA was produced by intestinal B cells of recipient origin, suggesting that migration of Ag-presenting B cells from peripheral lymphoid tissues to GALT may contribute to the generation of mucosal IgA responses after parenteral immunization. Strategies that promote Ag uptake and presentation by B cells may enhance mucosal IgA production following parenteral immunization.

  20. Cold exposure down-regulates immune response pathways in ferret aortic perivascular adipose tissue.

    PubMed

    Reynés, Bàrbara; van Schothorst, Evert M; García-Ruiz, Estefanía; Keijer, Jaap; Palou, Andreu; Oliver, Paula

    2017-05-03

    Perivascular adipose tissue (PVAT) surrounds blood vessels and releases paracrine factors, such as cytokines, which regulate local inflammation. The inflammatory state of PVAT has an important role in vascular disease; a pro-inflammatory state has been related with atherosclerosis development, whereas an anti-inflammatory one is protective. Cold exposure beneficially affects immune responses and, could thus impact the pathogenesis of cardiovascular diseases. In this study, we investigated the effects of one-week of cold exposure at 4°C of ferrets on aortic PVAT (aPVAT) versus subcutaneous adipose tissue. Ferrets were used because of the similarity of their adipose tissues to those of humans. A ferret-specific Agilent microarray was designed to cover the complete ferret genome and global gene expression analysis was performed. The data showed that cold exposure altered gene expression mainly in aPVAT. Most of the regulated genes were associated with cell cycle, immune response and gene expression regulation, and were mainly down-regulated. Regarding the effects on immune response, cold acclimation decreased the expression of genes involved in antigen recognition and presentation, cytokine signalling and immune system maturation and activation. This immunosuppressive gene expression pattern was depot-specific, as it was not observed in the inguinal subcutaneous depot. Interestingly, this depression in immune response related genes was also evident in peripheral blood mononuclear cells (PBMC). In conclusion, these results reveal that cold acclimation produces an inhibition of immune response-related pathways in aPVAT, reflected in PBMC, indicative of an anti-inflammatory response, which can potentially be exploited for the enhancement or maintenance of cardiovascular health.

  1. Staphylococcus aureus Colonization: Modulation of Host Immune Response and Impact on Human Vaccine Design

    PubMed Central

    Brown, Aisling F.; Leech, John M.; Rogers, Thomas R.; McLoughlin, Rachel M.

    2014-01-01

    In apparent contrast to its invasive potential Staphylococcus aureus colonizes the anterior nares of 20–80% of the human population. The relationship between host and microbe appears particularly individualized and colonization status seems somehow predetermined. After decolonization, persistent carriers often become re-colonized with their prior S. aureus strain, whereas non-carriers resist experimental colonization. Efforts to identify factors facilitating colonization have thus far largely focused on the microorganism rather than on the human host. The host responds to S. aureus nasal colonization via local expression of anti-microbial peptides, lipids, and cytokines. Interplay with the co-existing microbiota also influences colonization and immune regulation. Transient or persistent S. aureus colonization induces specific systemic immune responses. Humoral responses are the most studied of these and little is known of cellular responses induced by colonization. Intriguingly, colonized patients who develop bacteremia may have a lower S. aureus-attributable mortality than their non-colonized counterparts. This could imply a staphylococcal-specific immune “priming” or immunomodulation occurring as a consequence of colonization and impacting on the outcome of infection. This has yet to be fully explored. An effective vaccine remains elusive. Anti-S. aureus vaccine strategies may need to drive both humoral and cellular immune responses to confer efficient protection. Understanding the influence of colonization on adaptive response is essential to intelligent vaccine design, and may determine the efficacy of vaccine-mediated immunity. Clinical trials should consider colonization status and the resulting impact of this on individual patient responses. We urgently need an increased appreciation of colonization and its modulation of host immunity. PMID:24409186

  2. The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization

    PubMed Central

    Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M

    2014-01-01

    Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325

  3. Complex Immune Correlates of Protection in HIV-1 Vaccine Efficacy Trials

    PubMed Central

    Tomaras, Georgia D.; Plotkin, Stanley A.

    2016-01-01

    Summary Development of an efficacious HIV-1 vaccine is a major priority for improving human health worldwide. Vaccine mediated protection against human pathogens can be achieved through elicitation of protective innate, humoral, and cellular responses. Identification of specific immune responses responsible for pathogen protection enables vaccine development and provides insights into host defenses against pathogens and the immunological mechanisms that most effectively fight infection. Defining immunological correlates of transmission risk in preclinical and clinical HIV-1 vaccine trials has moved the HIV-1 vaccine development field forward and directed new candidate vaccine development. Immune correlate studies are providing novel hypotheses about immunological mechanisms that may be responsible for preventing HIV-1 acquisition. Recent results from HIV-1 immune correlates work has demonstrated that there are multiple types of immune responses that together, comprise an immune correlate—thus implicating polyfunctional immune control of HIV-1 transmission. An in depth understanding of these complex immunological mechanisms of protection against HIV-1 will accelerate the development of an efficacious HIV-1 vaccine. PMID:28133811

  4. Multimodality vaccination against clade C SHIV: partial protection against mucosal challenges with a heterologous tier 2 virus.

    PubMed

    Lakhashe, Samir K; Byrareddy, Siddappa N; Zhou, Mingkui; Bachler, Barbara C; Hemashettar, Girish; Hu, Shiu-Lok; Villinger, Francois; Else, James G; Stock, Shannon; Lee, Sandra J; Vargas-Inchaustegui, Diego A; Cofano, Egidio Brocca; Robert-Guroff, Marjorie; Johnson, Welkin E; Polonis, Victoria R; Forthal, Donald N; Loret, Erwann P; Rasmussen, Robert A; Ruprecht, Ruth M

    2014-11-12

    We sought to test whether vaccine-induced immune responses could protect rhesus macaques (RMs) against upfront heterologous challenges with an R5 simian-human immunodeficiency virus, SHIV-2873Nip. This SHIV strain exhibits many properties of transmitted HIV-1, such as tier 2 phenotype (relatively difficult to neutralize), exclusive CCR5 tropism, and gradual disease progression in infected RMs. Since no human AIDS vaccine recipient is likely to encounter an HIV-1 strain that exactly matches the immunogens, we immunized the RMs with recombinant Env proteins heterologous to the challenge virus. For induction of immune responses against Gag, Tat, and Nef, we explored a strategy of immunization with overlapping synthetic peptides (OSP). The immune responses against Gag and Tat were finally boosted with recombinant proteins. The vaccinees and a group of ten control animals were given five low-dose intrarectal (i.r.) challenges with SHIV-2873Nip. All controls and seven out of eight vaccinees became systemically infected; there was no significant difference in viremia levels of vaccinees vs. controls. Prevention of viremia was observed in one vaccinee which showed strong boosting of virus-specific cellular immunity during virus exposures. The protected animal showed no challenge virus-specific neutralizing antibodies in the TZM-bl or A3R5 cell-based assays and had low-level ADCC activity after the virus exposures. Microarray data strongly supported a role for cellular immunity in the protected animal. Our study represents a case of protection against heterologous tier 2 SHIV-C by vaccine-induced, virus-specific cellular immune responses. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Lytic and Latent Antigens of the Human Gammaherpesviruses Kaposi's Sarcoma-Associated Herpesvirus and Epstein-Barr Virus Induce T-Cell Responses with Similar Functional Properties and Memory Phenotypes▿

    PubMed Central

    Bihl, Florian; Narayan, Murli; Chisholm, John V.; Henry, Leah M.; Suscovich, Todd J.; Brown, Elizabeth E.; Welzel, Tania M.; Kaufmann, Daniel E.; Zaman, Tauheed M.; Dollard, Sheila; Martin, Jeff N.; Wang, Fred; Scadden, David T.; Kaye, Kenneth M.; Brander, Christian

    2007-01-01

    The cellular immunity against Kaposi's sarcoma-associated herpesvirus (KSHV) is poorly characterized and has not been compared to T-cell responses against other human herpesviruses. Here, novel and dominant targets of KSHV-specific cellular immunity are identified and compared to T cells specific for lytic and latent antigens in a second human gammaherpesvirus, Epstein-Barr virus. The data identify a novel HLA-B57- and HLA-B58-restricted epitope in the Orf57 protein and show consistently close parallels in immune phenotypes and functional response patterns between cells targeting lytic or latent KSHV- and EBV-encoded antigens, suggesting common mechanisms in the induction of these responses. PMID:17329344

  6. Imaging Polarized Secretory Traffic at the Immune Synapse in Living T Lymphocytes.

    PubMed

    Calvo, Víctor; Izquierdo, Manuel

    2018-01-01

    Immune synapse (IS) formation by T lymphocytes constitutes a crucial event involved in antigen-specific, cellular and humoral immune responses. After IS formation by T lymphocytes and antigen-presenting cells, the convergence of secretory vesicles toward the microtubule-organizing center (MTOC) and MTOC polarization to the IS are involved in polarized secretion at the synaptic cleft. This specialized mechanism appears to specifically provide the immune system with a fine strategy to increase the efficiency of crucial secretory effector functions of T lymphocytes, while minimizing non-specific, cytokine-mediated stimulation of bystander cells, target cell killing and activation-induced cell death. The molecular bases involved in the polarized secretory traffic toward the IS in T lymphocytes have been the focus of interest, thus different models and several imaging strategies have been developed to gain insights into the mechanisms governing directional secretory traffic. In this review, we deal with the most widely used, state-of-the-art approaches to address the molecular mechanisms underlying this crucial, immune secretory response.

  7. Human leukocyte antigens and cellular immune responses to anthrax vaccine adsorbed.

    PubMed

    Ovsyannikova, Inna G; Pankratz, V Shane; Vierkant, Robert A; Pajewski, Nicholas M; Quinn, Conrad P; Kaslow, Richard A; Jacobson, Robert M; Poland, Gregory A

    2013-07-01

    Interindividual variations in vaccine-induced immune responses are in part due to host genetic polymorphisms in the human leukocyte antigen (HLA) and other gene families. This study examined associations between HLA genotypes, haplotypes, and homozygosity and protective antigen (PA)-specific cellular immune responses in healthy subjects following immunization with Anthrax Vaccine Adsorbed (AVA). While limited associations were observed between individual HLA alleles or haplotypes and variable lymphocyte proliferative (LP) responses to AVA, analyses of homozygosity supported the hypothesis of a "heterozygote advantage." Individuals who were homozygous for any HLA locus demonstrated significantly lower PA-specific LP than subjects who were heterozygous at all eight loci (median stimulation indices [SI], 1.84 versus 2.95, P = 0.009). Similarly, we found that class I (HLA-A) and class II (HLA-DQA1 and HLA-DQB1) homozygosity was significantly associated with an overall decrease in LP compared with heterozygosity at those three loci. Specifically, individuals who were homozygous at these loci had significantly lower PA-specific LP than subjects heterozygous for HLA-A (median SI, 1.48 versus 2.13, P = 0.005), HLA-DQA1 (median SI, 1.75 versus 2.11, P = 0.007), and HLA-DQB1 (median SI, 1.48 versus 2.13, P = 0.002) loci, respectively. Finally, homozygosity at an increasing number (≥ 4) of HLA loci was significantly correlated with a reduction in LP response (P < 0.001) in a dose-dependent manner. Additional studies are needed to reproduce these findings and determine whether HLA-heterozygous individuals generate stronger cellular immune response to other virulence factors (Bacillus anthracis LF and EF) than HLA-homozygous subjects.

  8. IFNAR1-Signalling Obstructs ICOS-mediated Humoral Immunity during Non-lethal Blood-Stage Plasmodium Infection

    PubMed Central

    Sebina, Ismail; James, Kylie R.; Soon, Megan S. F.; Best, Shannon E.; Montes de Oca, Marcela; Amante, Fiona H.; Thomas, Bryce S.; Beattie, Lynette; Souza-Fonseca-Guimaraes, Fernando; Smyth, Mark J.; Hertzog, Paul J.; Hill, Geoffrey R.; Engwerda, Christian R.

    2016-01-01

    Parasite-specific antibodies protect against blood-stage Plasmodium infection. However, in malaria-endemic regions, it takes many months for naturally-exposed individuals to develop robust humoral immunity. Explanations for this have focused on antigenic variation by Plasmodium, but have considered less whether host production of parasite-specific antibody is sub-optimal. In particular, it is unclear whether host immune factors might limit antibody responses. Here, we explored the effect of Type I Interferon signalling via IFNAR1 on CD4+ T-cell and B-cell responses in two non-lethal murine models of malaria, P. chabaudi chabaudi AS (PcAS) and P. yoelii 17XNL (Py17XNL) infection. Firstly, we demonstrated that CD4+ T-cells and ICOS-signalling were crucial for generating germinal centre (GC) B-cells, plasmablasts and parasite-specific antibodies, and likewise that T follicular helper (Tfh) cell responses relied on B cells. Next, we found that IFNAR1-signalling impeded the resolution of non-lethal blood-stage infection, which was associated with impaired production of parasite-specific IgM and several IgG sub-classes. Consistent with this, GC B-cell formation, Ig-class switching, plasmablast and Tfh differentiation were all impaired by IFNAR1-signalling. IFNAR1-signalling proceeded via conventional dendritic cells, and acted early by limiting activation, proliferation and ICOS expression by CD4+ T-cells, by restricting the localization of activated CD4+ T-cells adjacent to and within B-cell areas of the spleen, and by simultaneously suppressing Th1 and Tfh responses. Finally, IFNAR1-deficiency accelerated humoral immune responses and parasite control by boosting ICOS-signalling. Thus, we provide evidence of a host innate cytokine response that impedes the onset of humoral immunity during experimental malaria. PMID:27812214

  9. Immunomodulating activity of Pidotimod in children with Down syndrome.

    PubMed

    Zuccotti, G V; Mameli, C; Trabattoni, D; Beretta, S; Biasin, M; Guazzarotti, L; Clerici, M

    2013-01-01

    Acute respiratory tract infections (ARTIs) are the most frequent illnesses in pediatric age, frequently experienced in children with Down Syndrome (DS) due to the associated immune defects of both specific and non-specific immunity. Pidotimod, a synthetic immunostimulant, was shown to reduce the rates of ARTIs in children with DS, however the mechanisms associated with this effect is currently unknown. We analyzed immune parameters in DS children who received the seasonal 2011–2012 virosomal-adjuvanted influenza vaccine. Eighteen children aged 3-10 years (mean age 7.1+/-2.6 years) were randomly assigned (1:1 ratio) to receive Pidotimod 400 mg, administered orally once a day for 90 days or placebo. At the recruitment (T0) all children received a single dose of virosomal-adjuvanted influenza vaccine (Flu). Blood samples were collected at T0 and 3 months after the recruitment (T3) in order to evaluate innate and adaptative immune responses pathway. Flu-specific IgG1 and IgG3 levels in plasma samples were determined at pre-vaccination (T0), and 1 (T1) and 3 months (T3) post-vaccination. The use of Pidotimod was associated with the upregulation of a number of genes involved in the activation of innate immune responses and in antimicrobial activity. Interestingly the ratio of Flu-specific IgG1/IgG3 was skewed in pidotimod-treated individuals, suggesting a preferential activation of complement-dependent effector mechanisms. Although preliminary these data suggest that Pidotimod can potentiate the beneficial effect of immunization, possibly resulting in a stronger activity of both innate and adaptive immune responses.

  10. Atheroprotective immunization with malondialdehyde-modified LDL is hapten specific and dependent on advanced MDA adducts: implications for development of an atheroprotective vaccine1[S

    PubMed Central

    Gonen, Ayelet; Hansen, Lotte F.; Turner, William W.; Montano, Erica N.; Que, Xuchu; Rafia, Apaїs; Chou, Meng-Yun; Wiesner, Philipp; Tsiantoulas, Dimitrios; Corr, Maripat; VanNieuwenhze, Michael S.; Tsimikas, Sotirios; Binder, Christoph J.; Witztum, Joseph L.; Hartvigsen, Karsten

    2014-01-01

    Immunization with homologous malondialdehyde (MDA)-modified LDL (MDA-LDL) leads to atheroprotection in experimental models supporting the concept that a vaccine to oxidation-specific epitopes (OSEs) of oxidized LDL could limit atherogenesis. However, modification of human LDL with OSE to use as an immunogen would be impractical for generalized use. Furthermore, when MDA is used to modify LDL, a wide variety of related MDA adducts are formed, both simple and more complex. To define the relevant epitopes that would reproduce the atheroprotective effects of immunization with MDA-LDL, we sought to determine the responsible immunodominant and atheroprotective adducts. We now demonstrate that fluorescent adducts of MDA involving the condensation of two or more MDA molecules with lysine to form malondialdehyde-acetaldehyde (MAA)-type adducts generate immunodominant epitopes that lead to atheroprotective responses. We further demonstrate that a T helper (Th) 2-biased hapten-specific humoral and cellular response is sufficient, and thus, MAA-modified homologous albumin is an equally effective immunogen. We further show that such Th2-biased humoral responses per se are not atheroprotective if they do not target relevant antigens. These data demonstrate the feasibility of development of a small-molecule immunogen that could stimulate MAA-specific immune responses, which could be used to develop a vaccine approach to retard or prevent atherogenesis. PMID:25143462

  11. A novel role for adiponectin in regulating the immune responses in chronic hepatitis C virus infection.

    PubMed

    Palmer, Clovis; Hampartzoumian, Taline; Lloyd, Andrew; Zekry, Amany

    2008-08-01

    Adipose tissue releases pro-inflammatory and anti-inflammatory mediators, including adiponectin, which elicit a broad range of metabolic and immunological effects. The study aim was to determine in subjects infected with chronic hepatitis C virus (HCV) the effects of total adiponectin and its high-molecular-weight (HMW) and low-molecular-weight isoforms on HCV-specific immune responses. Serum levels of total adiponectin and its isoforms were determined by immunoassay. The ex vivo effect of adiponectin on the HCV-specific T-cell response was examined by interferon gamma (IFN-gamma) enzyme-linked immunosorbent spot and enzyme-linked immunosorbent assay cytokine assays. The role of the mitogen-activated protein kinase (MAPK) signaling pathway in mediating the adiponectin effect on T cells was also evaluated. We found that serum levels of total and HMW adiponectin were significantly decreased in subjects with chronic HCV and increased body mass index (BMI) compared with HCV-infected lean subjects. The presence of an anti-HCV specific immune response was strongly associated with lower BMI (P = 0.004) and higher serum total (P = 0.01) and HMW (P = 0.02) adiponectin. In ex vivo assays, total adiponectin and the HMW adiponectin isoform enhanced HCV-specific IFN-gamma production (P = 0.02 and 0.03, respectively). Adiponectin-R1 receptors were expressed on T cells and monocytes. In depletion experiments, the IFN-gamma response to adiponectin was entirely dependent on the simultaneous presence of both CD4 and CD8 T cells, and to a lesser extent, natural killer cells. Selective inhibition of p38MAPK activity by SB203580 abrogated the IFN-gamma response to adiponectin, whereas extracellular signal-regulated kinase 1/2 inhibition by PD98059 did not affect the response. In chronic HCV, a reciprocal association exists between BMI, adiponectin, and the anti-HCV immune responses, emphasizing the important role played by adiposity in regulating the immune response in HCV infection.

  12. Immune response to oligopeptide permease A (OppA) protein in pigs naturally and experimentally infected with Haemophilus parasuis.

    PubMed

    Macedo, Nubia; Oliveira, Simone; Torremorell, Montserrat; Rovira, Albert

    2016-08-01

    Haemophilus parasuis is an important swine pathogen that causes Glasser's disease, characterized by pneumonia, polyserositis and meningitis. Protection against H. parasuis infection is associated with the presence of homologous antibodies in serum. However, a H. parasuis antigen that can elicit a protective immune response against all H. parasuis strains has yet to be found. A novel immunogenic and species-specific H. parasuis protein was identified by screening H. parasuis whole cell proteins using swine convalescent sera. One protein of 52kDa was clearly immunodominant and conserved among different H. parasuis strains. This protein was further identified as an oligopeptide permease A (OppA). Because OppA elicited a specific antibody response in pigs that recovered from H. parasuis infection, we investigated its potential role in diagnostics and protective immunity. An ELISA test using recombinant OppA (rOppA) as its coating antigen was further developed and tested. H. parasuis specific antibodies to rOppA were detected in serum from convalescent pigs but not in serum from specific pathogen free (SPF) or conventional pigs. Pigs immunized with rOppA protein had robust serological responses. However, the antibodies were not protective against challenge infection. We conclude that OppA is a universal species-specific H. parasuis immunogen, and a good marker for previous systemic infection with H. parasuis. Copyright © 2016. Published by Elsevier Ltd.

  13. T-Cell Warriors—Equipped to Kill Cancer Cells | Center for Cancer Research

    Cancer.gov

    When the body recognizes tumor cells as foreign, a natural immune response arises to attack them. Unfortunately, tumors have ways to evade immune surveillance systems and antitumor responses are often too weak to defeat the disease. Rather than relying on the body’s natural response, scientists can now manipulate a patient’s own immune cells so that they latch on to tumor cells by recognizing specific proteins on their surface. A type of immune cell that has been explored for this purpose is the killer (cytotoxic) T cell, which eliminates cells infected by viruses, damaged cells, and tumor cells.

  14. Noncoding RNAs and immune checkpoints-clinical implications as cancer therapeutics.

    PubMed

    Smolle, Maria A; Calin, Horatiu N; Pichler, Martin; Calin, George A

    2017-07-01

    A major mechanism of tumor development and progression is silencing of the patient's immune response to cancer-specific antigens. Defects in the so-called cancer immunity cycle may occur at any stage of tumor development. Within the tumor microenvironment, aberrant expression of immune checkpoint molecules with activating or inhibitory effects on T lymphocytes induces immune tolerance and cellular immune escape. Targeting immune checkpoint molecules such as programmed cell death protein 1 (PD-1) and its ligand PD-L1 with specific antibodies has proven to be a major advance in the treatment of several types of cancer. Another way to therapeutically influence the tumor microenvironment is by modulating the levels of microRNAs (miRNAs), small noncoding RNAs that shuttle bidirectionally between malignant and tumor microenvironmental cells. These small RNA transcripts have two features: (a) their expression is quite specific to distinct tumors, and (b) they are involved in early regulation of immune responses. Consequently, miRNAs may be ideal molecules for use in cancer therapy. Many miRNAs are aberrantly expressed in human cancer cells, opening new opportunities for cancer therapy, but the exact functions of these miRNAs and their interactions with immune checkpoint molecules have yet to be investigated. This review summarizes recently reported findings about miRNAs as modulators of immune checkpoint molecules and their potential application as cancer therapeutics in clinical practice. © 2017 Federation of European Biochemical Societies.

  15. Placental restriction of fetal growth reduces cutaneous responses to antigen after sensitization in sheep.

    PubMed

    Wooldridge, Amy L; Bischof, Robert J; Meeusen, Els N; Liu, Hong; Heinemann, Gary K; Hunter, Damien S; Giles, Lynne C; Kind, Karen L; Owens, Julie A; Clifton, Vicki L; Gatford, Kathryn L

    2014-04-01

    Prenatal and early childhood exposures are implicated as causes of allergy, but the effects of intrauterine growth restriction on immune function and allergy are poorly defined. We therefore evaluated effects of experimental restriction of fetal growth on immune function and allergic sensitization in adolescent sheep. Immune function (circulating total red and white blood cells, neutrophils, lymphocytes, monocytes, eosinophils, and basophils, and the antibody response to Clostridial vaccination) and responses to house dust mite (HDM) allergen and ovalbumin (OVA) antigen sensitization (specific total Ig, IgG1, and IgE antibodies, and cutaneous hypersensitivity) were investigated in adolescent sheep from placentally restricted (PR, n = 23) and control (n = 40) pregnancies. Increases in circulating HDM-specific IgE (P = 0.007) and OVA-specific IgE (P = 0.038) were greater in PR than control progeny. PR did not alter total Ig, IgG1, or IgM responses to either antigen. PR increased OVA-specific but not HDM-specific IgA responses in females only (P = 0.023). Multiple birth increased Ig responses to OVA in a sex-specific manner. PR decreased the proportion of positive cutaneous hypersensitivity responders to OVA at 24 h (P = 0.030) but had no effect on cutaneous responses to HDM. Acute wheal responses to intradermal histamine correlated positively with birth weight in singletons (P = 0.023). Intrauterine growth restriction may suppress inflammatory responses in skin downstream of IgE induction, without impairment in antibody responses to a nonpolysaccharide vaccine. Discord between cutaneous and IgE responses following sensitization suggests new mechanisms for prenatal allergy programming.

  16. Yersinia pestis IS1541 transposition provides for escape from plague immunity.

    PubMed

    Cornelius, Claire A; Quenee, Lauriane E; Elli, Derek; Ciletti, Nancy A; Schneewind, Olaf

    2009-05-01

    Yersinia pestis is perhaps the most feared infectious agent due to its ability to cause epidemic outbreaks of plague disease in animals and humans with high mortality. Plague infections elicit strong humoral immune responses against the capsular antigen (fraction 1 [F1]) of Y. pestis, and F1-specific antibodies provide protective immunity. Here we asked whether Y. pestis generates mutations that enable bacterial escape from protective immunity and isolated a variant with an IS1541 insertion in caf1A encoding the F1 outer membrane usher. The caf1A::IS1541 insertion prevented assembly of F1 pili and provided escape from plague immunity via F1-specific antibodies without a reduction in virulence in mouse models of bubonic or pneumonic plague. F1-specific antibodies interfere with Y. pestis type III transport of effector proteins into host cells, an inhibitory effect that was overcome by the caf1A::IS1541 insertion. These findings suggest a model in which IS1541 insertion into caf1A provides for reversible changes in envelope structure, enabling Y. pestis to escape from adaptive immune responses and plague immunity.

  17. Deletion of Specific Immune-Modulatory Genes from Modified Vaccinia Virus Ankara-Based HIV Vaccines Engenders Improved Immunogenicity in Rhesus Macaques

    PubMed Central

    O'Mara, Leigh A.; Gangadhara, Sailaja; McQuoid, Monica; Zhang, Xiugen; Zheng, Rui; Gill, Kiran; Verma, Meena; Yu, Tianwei; Johnson, Brent; Li, Bing; Derdeyn, Cynthia A.; Ibegbu, Chris; Altman, John D.; Hunter, Eric; Feinberg, Mark B.

    2012-01-01

    Modified vaccinia virus Ankara (MVA) is a safe, attenuated orthopoxvirus that is being developed as a vaccine vector but has demonstrated limited immunogenicity in several early-phase clinical trials. Our objective was to rationally improve the immunogenicity of MVA-based HIV/AIDS vaccines via the targeted deletion of specific poxvirus immune-modulatory genes. Vaccines expressing codon-optimized HIV subtype C consensus Env and Gag antigens were generated from MVA vector backbones that (i) harbor simultaneous deletions of four viral immune-modulatory genes, encoding an interleukin-18 (IL-18) binding protein, an IL-1β receptor, a dominant negative Toll/IL-1 signaling adapter, and CC-chemokine binding protein (MVAΔ4-HIV); (ii) harbor a deletion of an additional (fifth) viral gene, encoding uracil-DNA glycosylase (MVAΔ5-HIV); or (iii) represent the parental MVA backbone as a control (MVA-HIV). We performed head-to-head comparisons of the cellular and humoral immune responses that were elicited by these vectors during homologous prime-boost immunization regimens utilizing either high-dose (2 × 108 PFU) or low-dose (1 × 107 PFU) intramuscular immunization of rhesus macaques. At all time points, a majority of the HIV-specific T cell responses, elicited by all vectors, were directed against Env, rather than Gag, determinants, as previously observed with other vector systems. Both modified vectors elicited up to 6-fold-higher frequencies of HIV-specific CD8 and CD4 T cell responses and up to 25-fold-higher titers of Env (gp120)-specific binding (nonneutralizing) antibody responses that were relatively transient in nature. While the correlates of protection against HIV infection remain incompletely defined, our results indicate that the rational deletion of specific genes from MVA vectors can positively alter their cellular and humoral immunogenicity profiles in nonhuman primates. PMID:22973033

  18. An inducible transgenic mouse breast cancer model for the analysis of tumor antigen specific CD8+ T-cell responses

    PubMed Central

    Bruns, Michael; Wanger, Jara; Utermöhlen, Olaf; Deppert, Wolfgang

    2015-01-01

    In Simian virus 40 (SV40) transgenic BALB/c WAP-T mice tumor development and progression is driven by SV40 tumor antigens encoded by inducible transgenes. WAP-T mice constitute a well characterized mouse model for breast cancer with strong similarities to the corresponding human disease. BALB/c mice mount only a weak cellular immune response against SV40 T-antigen (T-Ag). For studying tumor antigen specific CD8+ T-cell responses against transgene expressing cells, we created WAP-TNP mice, in which the transgene additionally codes for the NP118–126-epitope contained within the nucleoprotein of lymphocytic choriomeningitis virus (LCMV), the immune-dominant T-cell epitope in BALB/c mice. We then investigated in WAP-TNP mice the immune responses against SV40 tumor antigens and the NP-epitope within the chimeric T-Ag/NP protein (T-AgNP). Analysis of the immune-reactivity against T-Ag in WAP-T and of T-AgNP in WAP-TNP mice revealed that, in contrast to wild type (wt) BALB/c mice, WAP-T and WAP-TNP mice were non-reactive against T-Ag. However, like wtBALB/c mice, WAP-T as well as WAP-TNP mice were highly reactive against the immune-dominant LCMV NP-epitope, thereby allowing the analysis of NP-epitope specific cellular immune responses in WAP-TNP mice. LCMV infection of WAP-TNP mice induced a strong, LCMV NP-epitope specific CD8+ T-cell response, which was able to specifically eliminate T-AgNP expressing mammary epithelial cells both prior to tumor formation (i.e. in cells of lactating mammary glands), as well as in invasive tumors. Elimination of tumor cells, however, was only transient, even after repeated LCMV infections. Further studies showed that already non-infected WAP-TNP tumor mice contained LCMV NP-epitope specific CD8+ T-cells, albeit with strongly reduced, though measurable activity. Functional impairment of these ‘endogenous’ NP-epitope specific T-cells seems to be caused by expression of the programmed death-1 protein (PD1), as anti-PD1 treatment of splenocytes from WAP-TNP tumor mice restored their activity. These characteristics are similar to those found in many tumor patients and render WAP-TNP mice a suitable model for analyzing parameters to overcome the blockade of immune checkpoints in tumor patients. PMID:26513294

  19. Co-delivery of PSA and PSMA DNA vaccines with electroporation induces potent immune responses.

    PubMed

    Ferraro, Bernadette; Cisper, Neil J; Talbott, Kendra T; Philipson-Weiner, Lindsey; Lucke, Colleen E; Khan, Amir S; Sardesai, Niranjan Y; Weiner, David B

    2011-01-01

    Prostate cancer (PCa) remains a significant public health problem. Current treatment modalities for PCa can be useful, but may be accompanied by deleterious side effects and often do not confer long-term control. Accordingly, additional modalities, such as immunotherapy, may represent an important approach for PCa treatment. The identification of tissue-specific antigens engenders PCa an attractive target for immunotherapeutic approaches. Delivery of DNA vaccines with electroporation has shown promising results for prophylactic and therapeutic targets in a variety of species including humans. Application of this technology for PCa immunotherapy strategies has been limited to single antigen and epitope targets. We sought to test the hypothesis that a broader collection of antigens would improve the breadth and effectiveness of a PCa immune therapy approach. We therefore developed highly optimized DNA vaccines encoding prostate-specific antigen (PSA) and prostate-specific membrane antigen (PSMA) as a dual antigen approach to immune therapy of PCa. PSA-and PSMA-specific cellular immunogenicity was evaluated in a mouse model for co-delivery and single antigen vaccination. Mice received 2 immunizations spaced 2 weeks apart and immunogenicity was evaluated 1 week after the second vaccination. Both the PSA and PSMA vaccines induced robust antigen-specific IFNγ responses by ELISpot. Further characterization of cellular immunogenicity by flow cytometry indicated strong antigen-specific TNFα production by CD4+ T cells and IFNγ and IL-2 secretion by both CD4+ and CD8+ T cells. There was also a strong humoral response as determined by PSA-specific seroconversion. These data support further study of this novel approach to immune therapy of PCa.

  20. Long term protection after immunization with P. berghei sporozoites correlates with sustained IFNγ responses of hepatic CD8+ memory T cells.

    PubMed

    Nganou-Makamdop, Krystelle; van Gemert, Geert-Jan; Arens, Theo; Hermsen, Cornelus C; Sauerwein, Robert W

    2012-01-01

    Protection against P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS) arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS), resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (T(EM)) CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected naïve mice, we found high sporozoite-specific IFNγ ex vivo responses that associated with induced levels of in vivo CD8+ T(EM) cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFNγ responses in RAS and CPS mice that significantly correlated with loss of protection (r(2) = 0.60, p<0.0001). The reducing IFNγ response by hepatic memory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFNγ producing CD8+ memory T cells.

  1. Mathematical models of immune effector responses to viral infections: Virus control versus the development of pathology

    NASA Astrophysics Data System (ADS)

    Wodarz, Dominik

    2005-12-01

    This article reviews mathematical models which have investigated the importance of lytic and non-lytic immune responses for the control of viral infections. Lytic immune responses fight the virus by killing infected cells, while non-lytic immune responses fight the virus by inhibiting viral replication while leaving the infected cell alive. The models suggest which types or combinations of immune responses are required to resolve infections which vary in their characteristics, such as the rate of viral replication and the rate of virus-induced target cell death. This framework is then applied to persistent infections and viral evolution. It is investigated how viral evolution and antigenic escape can influence the relative balance of lytic and non-lytic responses over time, and how this might correlate with the transition from an asymptomatic infection to pathology. This is discussed in the specific context of hepatitis C virus infection.

  2. Induction of humoral responses to BHV-1 glycoprotein D expressed by HSV-1 amplicon vectors

    PubMed Central

    Blanc, Andrea Maria; Berois, Mabel Beatriz; Tomé, Lorena Magalí; Epstein, Alberto L.

    2012-01-01

    Herpes simplex virus type-1 (HSV-1) amplicon vectors are versatile and useful tools for transferring genes into cells that are capable of stimulating a specific immune response to their expressed antigens. In this work, two HSV-1-derived amplicon vectors were generated. One of these expressed the full-length glycoprotein D (gD) of bovine herpesvirus 1 while the second expressed the truncated form of gD (gDtr) which lacked the trans-membrane region. After evaluating gD expression in the infected cells, the ability of both vectors to induce a specific gD immune response was tested in BALB/c mice that were intramuscularly immunized. Specific serum antibody responses were detected in mice inoculated with both vectors, and the response against truncated gD was higher than the response against full-length gD. These results reinforce previous findings that HSV-1 amplicon vectors can potentially deliver antigens to animals and highlight the prospective use of these vectors for treating infectious bovine rhinotracheitis disease. PMID:22437537

  3. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response

    PubMed Central

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-01-01

    Objective To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. Design We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis (Pg), Fusobacterium nucleatum and Prevotella intermedia. The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Results Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. Conclusions We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. PMID:26838600

  4. The AIDS resistance of naturally SIV-infected sooty mangabeys is independent of cellular immunity to the virus

    PubMed Central

    Dunham, Richard; Pagliardini, Paola; Gordon, Shari; Sumpter, Beth; Engram, Jessica; Moanna, Abeer; Paiardini, Mirko; Mandl, Judith N.; Lawson, Benton; Garg, Seema; McClure, Harold M.; Xu, Yong-Xian; Ibegbu, Chris; Easley, Kirk; Katz, Nathalia; Pandrea, Ivona; Apetrei, Cristian; Sodora, Donald L.; Staprans, Silvija I.; Feinberg, Mark B.; Silvestri, Guido

    2006-01-01

    In contrast to human immunodeficiency virus (HIV)-infected humans, natural hosts for simian immunodeficiency virus (SIV) very rarely progress to acquired immunodeficiency syndrome (AIDS). While the mechanisms underlying this disease resistance are still poorly understood, a consistent feature of natural SIV infection is the absence of the generalized immune activation associated with HIV infection. To investigate the immunologic mechanisms underlying the absence of AIDS in SIV-infected sooty mangabeys (SMs), a natural host species, we performed a detailed analysis of the SIV-specific cellular immune responses in 110 SIV-infected SMs. We found that while SIV-specific T-cell responses are detectable in the majority of animals, their magnitude and breadth are, in fact, lower than what has been described in HIV-infected humans, both in terms of cytokine production (ie, IFN-γ, TNF-α, and IL-2) and degranulation (ie, CD107a expression). Of importance, SIV-specific T-cell responses were similarly low when either SIVmac239-derived peptides or autologous SIVsmm peptides were used as stimuli. No correlation was found between SIV-specific T-cell responses and either viral load or CD4+ T-cell count, or between these responses and markers of T-cell activation and proliferation. These findings indicate that the absence of AIDS in naturally SIV-infected sooty mangabeys is independent of a strong cellular immune response to the virus. (Blood. 2006;108:209-217) PMID:16522814

  5. Potential Suppressive Effects of Two C60 Fullerene Derivatives on Acquired Immunity

    NASA Astrophysics Data System (ADS)

    Hirai, Toshiro; Yoshioka, Yasuo; Udaka, Asako; Uemura, Eiichiro; Ohe, Tomoyuki; Aoshima, Hisae; Gao, Jian-Qing; Kokubo, Ken; Oshima, Takumi; Nagano, Kazuya; Higashisaka, Kazuma; Mashino, Tadahiko; Tsutsumi, Yasuo

    2016-10-01

    The therapeutic effects of fullerene derivatives on many models of inflammatory disease have been demonstrated. The anti-inflammatory mechanisms of these nanoparticles remain to be elucidated, though their beneficial roles in allergy and autoimmune diseases suggest their suppressive potential in acquired immunity. Here, we evaluated the effects of C60 pyrrolidine tris-acid (C60-P) and polyhydroxylated fullerene (C60(OH)36) on the acquired immune response in vitro and in vivo. In vitro, both C60 derivatives had dose-dependent suppressive effects on T cell receptor-mediated activation of T cells and antibody production by B cells under anti-CD40/IL-4 stimulation, similar to the actions of the antioxidant N-acetylcysteine. In addition, C60-P suppressed ovalbumin-specific antibody production and ovalbumin-specific T cell responses in vivo, although T cell-independent antibodies responses were not affected by C60-P. Together, our data suggest that fullerene derivatives can suppress acquired immune responses that require T cells.

  6. Pulmonary Regnase-1 orchestrates the interplay of epithelium and adaptive immune systems to protect against pneumonia.

    PubMed

    Nakatsuka, Yoshinari; Vandenbon, Alexis; Mino, Takashi; Yoshinaga, Masanori; Uehata, Takuya; Cui, Xiaotong; Sato, Ayuko; Tsujimura, Tohru; Suzuki, Yutaka; Sato, Atsuyasu; Handa, Tomohiro; Chin, Kazuo; Sawa, Teiji; Hirai, Toyohiro; Takeuchi, Osamu

    2018-04-25

    Inhaled pathogens including Pseudomonas aeruginosa initially encounter airway epithelial cells (AECs), which are poised to evoke cell-intrinsic innate defense, affecting second tier of hematopoietic cell-mediated immune reaction. However, it is largely unknown how pulmonary immune responses mediated by a variety of immune cells are coordinated. Here we show that Regnase-1, an endoribonuclease expressed in AECs and immune cells, plays an essential role in coordinating innate responses and adaptive immunity against P. aeruginosa infection. Intratracheal treatment of mice with heat-killed P. aeruginosa resulted in prolonged disappearance of Regnase-1 consistent with sustained expression of Regnase-1 target inflammatory genes, whereas the transcription factor NF-κB was only transiently activated. AEC-specific deletion of Regnase-1 not only augmented innate defenses against P. aeruginosa but also enhanced secretion of Pseudomonas-specific IgA and Th17 accumulation in the lung, culminating in conferring significant resistance against P. aeruginosa re-infection in vivo. Although Regnase-1 directly controls distinct sets of genes in each of AECs and T cells, degradation of Regnase-1 in both cell types is beneficial for maximizing acquired immune responses. Collectively, these results demonstrate that Regnase-1 orchestrates AEC-mediated and immune cell-mediated host defense against pulmonary bacterial infection.

  7. Mast cell: an emerging partner in immune interaction.

    PubMed

    Gri, Giorgia; Frossi, Barbara; D'Inca, Federica; Danelli, Luca; Betto, Elena; Mion, Francesca; Sibilano, Riccardo; Pucillo, Carlo

    2012-01-01

    Mast cells (MCs) are currently recognized as effector cells in many settings of the immune response, including host defense, immune regulation, allergy, chronic inflammation, and autoimmune diseases. MC pleiotropic functions reflect their ability to secrete a wide spectrum of preformed or newly synthesized biologically active products with pro-inflammatory, anti-inflammatory and/or immunosuppressive properties, in response to multiple signals. Moreover, the modulation of MC effector phenotypes relies on the interaction of a wide variety of membrane molecules involved in cell-cell or cell-extracellular-matrix interaction. The delivery of co-stimulatory signals allows MC to specifically communicate with immune cells belonging to both innate and acquired immunity, as well as with non-immune tissue-specific cell types. This article reviews and discusses the evidence that MC membrane-expressed molecules play a central role in regulating MC priming and activation and in the modulation of innate and adaptive immune response not only against host injury, but also in peripheral tolerance and tumor-surveillance or -escape. The complex expression of MC surface molecules may be regarded as a measure of connectivity, with altered patterns of cell-cell interaction representing functionally distinct MC states. We will focalize our attention on roles and functions of recently discovered molecules involved in the cross-talk of MCs with other immune partners.

  8. Mast Cell: An Emerging Partner in Immune Interaction

    PubMed Central

    Gri, Giorgia; Frossi, Barbara; D’Inca, Federica; Danelli, Luca; Betto, Elena; Mion, Francesca; Sibilano, Riccardo; Pucillo, Carlo

    2012-01-01

    Mast cells (MCs) are currently recognized as effector cells in many settings of the immune response, including host defense, immune regulation, allergy, chronic inflammation, and autoimmune diseases. MC pleiotropic functions reflect their ability to secrete a wide spectrum of preformed or newly synthesized biologically active products with pro-inflammatory, anti-inflammatory and/or immunosuppressive properties, in response to multiple signals. Moreover, the modulation of MC effector phenotypes relies on the interaction of a wide variety of membrane molecules involved in cell–cell or cell-extracellular-matrix interaction. The delivery of co-stimulatory signals allows MC to specifically communicate with immune cells belonging to both innate and acquired immunity, as well as with non-immune tissue-specific cell types. This article reviews and discusses the evidence that MC membrane-expressed molecules play a central role in regulating MC priming and activation and in the modulation of innate and adaptive immune response not only against host injury, but also in peripheral tolerance and tumor-surveillance or -escape. The complex expression of MC surface molecules may be regarded as a measure of connectivity, with altered patterns of cell–cell interaction representing functionally distinct MC states. We will focalize our attention on roles and functions of recently discovered molecules involved in the cross-talk of MCs with other immune partners. PMID:22654879

  9. The sickle-cell trait modifies the intensity and specificity of the immune response against P. falciparum malaria and leads to acquired protective immunity.

    PubMed

    Bayoumi, R A

    1987-03-01

    It is proposed that the in vivo mechanism of protection against falciparum malaria in individuals of the Hb AS genotype is not due solely to the adverse influence of Hb AS erythrocytes on the intraerythrocytic growth and development of P. falciparum. Instead, the simple physiological effect of Hb S on parasite growth appears to trigger an in vivo process of enhancement of the intensity and/or specificity of the host immune response, leading to acquired protective immunity, in a process simulating vaccination. Testing the hypothesis may lead to the identification of plasmodial antigens that induce protective responses in the human host and distinguish them from non-protective, immunosuppressive or decoy antigens that promote parasite survival. This may ultimately help in the selection of candidate antigens for a malaria blood-stage vaccine.

  10. Increased concentration of Pseudomonas aeruginosa and Staphylococcus sp. in small animals exposed to aerospace environments

    NASA Technical Reports Server (NTRS)

    Guthrie, R. K.

    1976-01-01

    The effects of increased concentrations of PSEUDOMONAS AERUGINOSA AND STAPHYLOCOCCUS in the total bacterial flora of small animals exposed to simulated spacecraft environments were evaluated. Tests to detect changes in infectivity, effects of antibiotic treatments, immune responses to bacterial antigens, and effectiveness of immune responses in the experimental environment were conducted. The most significant results appear to be the differences in immune responses at simulated altitudes and the production of infection in the presence of a specific antibody.

  11. Specific memory B cell response and participation of CD4+ central and effector memory T cells in mice immunized with liposome encapsulated recombinant NE protein based Hepatitis E vaccine candidate.

    PubMed

    Kulkarni, Shruti P; Thanapati, Subrat; Arankalle, Vidya A; Tripathy, Anuradha S

    2016-11-21

    Liposome encapsulated neutralizing epitope protein of Hepatitis E virus (HEV), rNEp, our Hepatitis E vaccine candidate, was shown to be immunogenic and safe in pregnant and non-pregnant mice and yielded sterilizing immunity in rhesus monkeys. The current study in Balb/c mice assessed the levels and persistence of anti-HEV IgG antibodies by ELISA, frequencies of B, memory B, T and memory T cells by flow cytometry and HEV-specific IgG secreting memory B cells by ELISPOT till 420days post immunization (PI) with 5?g rNEp encapsulated in liposome based adjuvant (2 doses, 4weeks apart). Mice immunized with a lower dose (1?g) were assessed only for anamnestic response post booster dose. Vaccine candidate immunized mice (5?g dose) elicited strong anti-HEV IgG response that was estimated to persist for lifetime. At day 120 PI, frequency of memory B cells was higher in immunized mice than those receiving adjuvant alone. Anti-HEV IgG titers were lower in mice immunized with 1?g dose. A booster dose yielded a heightened antibody response in mice with both high (>800GMT, 5?g) and low (?100GMT, 1?g) anti-HEV IgG titers. At day 6th post booster dose, HEV-specific antibody secreting plasma cells (ASCs) were detected in 100% and 50% of mice with high and low anti-HEV IgG titers, respectively, whereas the frequencies of CD4 + central and effector memory T cells were high in mice with high anti-HEV IgG titers only. Taken together, the vaccine candidate effectively generates persistent and anamnestic antibody response, elicits participation of CD4 + memory T cells and triggers memory B cells to differentiate into ASCs upon boosting. This approach of assessing the immunogenicity of vaccine candidate could be useful to explore the longevity of HEV-specific memory response in future HEV vaccine trials in human. Copyright © 2016. Published by Elsevier Ltd.

  12. Attenuated Phenotype and Immunogenic Characteristics of a Mutated Herpes Simplex Virus 1 Strain in the Rhesus Macaque.

    PubMed

    Fan, Shengtao; Xu, Xingli; Liao, Yun; Wang, Yongrong; Wang, Jianbin; Feng, Min; Wang, Lichun; Zhang, Ying; He, Zhanlong; Yang, Fengmei; Fraser, Nigel W; Li, Qihan

    2018-05-02

    Herpes simplex virus type 1(HSV-1) presents a conundrum to public health worldwide because of its specific pathogenicity and clinical features. Some experimental vaccines, such as the recombinant viral glycoproteins, exhibit the viral immunogenicity of a host-specific immune response, but none of these has achieved a valid epidemiological protective efficacy in the human population. In the present study, we constructed an attenuated HSV-1 strain M3 through the partial deletion of UL7, UL41 , and the latency-associated transcript ( LAT ) using the CRISPR/Cas9 system. The mutant strain exhibited lowered infectivity and virulence in macaques. Neutralization testing and ELISpot detection of the specific T-cell responses confirmed the specific immunity induced by M3 immunization and this immunity defended against the challenges of the wild-type strain and restricted the entry of the wild-type strain into the trigeminal ganglion. These results in rhesus macaques demonstrated the potential of the attenuated vaccine for the prevention of HSV-1 in humans.

  13. T follicular helper and T follicular regulatory cells have different TCR specificity

    PubMed Central

    Maceiras, Ana Raquel; Almeida, Silvia Cristina Paiva; Mariotti-Ferrandiz, Encarnita; Chaara, Wahiba; Jebbawi, Fadi; Six, Adrien; Hori, Shohei; Klatzmann, David; Faro, Jose; Graca, Luis

    2017-01-01

    Immunization leads to the formation of germinal centres (GCs) that contain both T follicular helper (Tfh) and T follicular regulatory (Tfr) cells. Whether T-cell receptor (TCR) specificity defines the differential functions of Tfh and Tfr cells is unclear. Here we show that antigen-specific T cells after immunization are preferentially recruited to the GC to become Tfh cells, but not Tfr cells. Tfh cells, but not Tfr cells, also proliferate efficiently on restimulation with the same immunizing antigen in vitro. Ex vivo TCR repertoire analysis shows that immunization induces oligoclonal expansion of Tfh cells. By contrast, the Tfr pool has a TCR repertoire that more closely resembles that of regulatory T (Treg) cells. Our data thus indicate that the GC Tfh and Tfr pools are generated from distinct TCR repertoires, with Tfh cells expressing antigen-responsive TCRs to promote antibody responses, and Tfr cells expressing potentially autoreactive TCRs to suppress autoimmunity. PMID:28429709

  14. Virus-like nanostructures for tuning immune response

    NASA Astrophysics Data System (ADS)

    Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

    2015-11-01

    Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.

  15. Use of a Guinea Pig-Specific Transcriptome Array for Evaluation of Protective Immunity against Genital Chlamydial Infection following Intranasal Vaccination in Guinea Pigs.

    DTIC Science & Technology

    2014-12-11

    modulation in several innate immunity markers particularly associated with NK cells and Th1/Th2 specific cytokines and chemokines in immunized guinea pigs...reduced antigen-specific activation (IL-12 and IFN-c production) of CD4+ T cells isolated from lymphoid tissues and genital tract, and an associated...CD4+ T cells [12, 13]. However, due to differences in immunological responses [23, 24, 25, 26], and chlamydial strain susceptibilities between mice

  16. Effects of engineered nanoparticles on the innate immune system.

    PubMed

    Liu, Yuanchang; Hardie, Joseph; Zhang, Xianzhi; Rotello, Vincent M

    2017-12-01

    Engineered nanoparticles (NPs) have broad applications in industry and nanomedicine. When NPs enter the body, interactions with the immune system are unavoidable. The innate immune system, a non-specific first line of defense against potential threats to the host, immediately interacts with introduced NPs and generates complicated immune responses. Depending on their physicochemical properties, NPs can interact with cells and proteins to stimulate or suppress the innate immune response, and similarly activate or avoid the complement system. NPs size, shape, hydrophobicity and surface modification are the main factors that influence the interactions between NPs and the innate immune system. In this review, we will focus on recent reports about the relationship between the physicochemical properties of NPs and their innate immune response, and their applications in immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Enhanced humoral and HLA-A2-restricted dengue virus-specific T-cell responses in humanized BLT NSG mice

    PubMed Central

    Jaiswal, Smita; Pazoles, Pamela; Woda, Marcia; Shultz, Leonard D; Greiner, Dale L; Brehm, Michael A; Mathew, Anuja

    2012-01-01

    Dengue is a mosquito-borne viral disease of humans, and animal models that recapitulate human immune responses or dengue pathogenesis are needed to understand the pathogenesis of the disease. We recently described an animal model for dengue virus (DENV) infection using humanized NOD-scid IL2rγnull mice (NSG) engrafted with cord blood haematopoietic stem cells. We sought to further improve this model by co-transplantation of human fetal thymus and liver tissues into NSG (BLT-NSG) mice. Enhanced DENV-specific antibody titres were found in the sera of BLT-NSG mice compared with human cord blood haematopoietic stem cell-engrafted NSG mice. Furthermore, B cells generated during the acute phase and in memory from splenocytes of immunized BLT-NSG mice secreted DENV-specific IgM antibodies with neutralizing activity. Human T cells in engrafted BLT-NSG mice secreted interferon-γ in response to overlapping DENV peptide pools and HLA-A2 restricted peptides. The BLT-NSG mice will allow assessment of human immune responses to DENV vaccines and the effects of previous immunity on subsequent DENV infections. PMID:22384859

  18. Engineering HIV-Specific Immunity with Chimeric Antigen Receptors.

    PubMed

    Kitchen, Scott G; Zack, Jerome A

    2016-12-01

    HIV remains a highly important public health and clinical issue despite many recent advances in attempting to develop a cure, which has remained elusive for most people infected with HIV. HIV disease can be controlled with pharmacologic therapies; however, these treatments are expensive, may have severe side effects, and are not curative. Consequently, an improved means to control or eliminate HIV replication is needed. Cytotoxic T lymphocytes (CTLs) play a critical role in controlling viral replication and are an important part in the ability of the immune response to eradicate most viral infections. There are considerable efforts to enhance CTL responses in HIV-infected individuals in hopes of providing the immune response with armaments to more effectively control viral replication. In this review, we discuss some of these efforts and focus on the development of a gene therapy-based approach to engineer hematopoietic stem cells with an HIV-1-specific chimeric antigen receptor, which seeks to provide an inexhaustible source of HIV-1-specific immune cells that are MHC unrestricted and superior to natural antiviral T cell responses. These efforts provide the basis for further development of T cell functional enhancement to target and treat chronic HIV infection in hopes of eradicating the virus from the body.

  19. Long-term immunogenicity and safety of an investigational herpes zoster subunit vaccine in older adults.

    PubMed

    Chlibek, Roman; Pauksens, Karlis; Rombo, Lars; van Rijckevorsel, Gini; Richardus, Jan H; Plassmann, Georg; Schwarz, Tino F; Catteau, Grégory; Lal, Himal; Heineman, Thomas C

    2016-02-03

    An investigational subunit vaccine containing the varicella-zoster virus (VZV) glycoprotein E (gE) and the AS01B adjuvant system is being evaluated for the prevention of herpes zoster (HZ) in older adults. A phase II trial evaluating different formulations of this vaccine (containing 25μg, 50μg, or 100μg gE) was conducted in adults ≥60 years of age and showed that all formulations elicited robust cellular and humoral immune responses for up to 3 years after vaccination. In this follow-up study in subjects who received two doses of the 50μg gE/AS01B formulation (HZ/su), we assessed the persistence of the immune responses for up to 6 years after vaccination. This phase II, open-label, multicenter, single-group trial conducted in the Czech Republic, Germany, Sweden, and the Netherlands followed 129 subjects who had received two doses (2 months apart) of HZ/su during the initial trial. Vaccine-induced immune responses (frequencies of gE-specific CD4(+) T cells expressing ≥2 activation markers and serum anti-gE antibody concentrations) were evaluated at 48, 60, and 72 months after the first HZ/su dose. Six years after vaccination with HZ/su, gE-specific cell-mediated immune responses and anti-gE antibody concentrations had decreased by 20-25% from month 36, but remained higher than the prevaccination values. At month 72, the gE-specific cell-mediated immune response was 3.8 times higher than the prevaccination value (477.3 vs. 119.4 activated gE-specific CD4(+) T cells per 10(6) cells), and the anti-gE antibody concentration was 7.3 times higher than the prevaccination value (8159.0 vs. 1121.3mIU/mL). No vaccine-related serious adverse events were reported between months 36 and 72. gE-specific cellular and humoral immune responses persisted for 6 years after two-dose vaccination with HZ/su in healthy older adults. No safety concerns were identified. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Immunization with the conjugate vaccine Vi-CRM₁₉₇ against Salmonella typhi induces Vi-specific mucosal and systemic immune responses in mice.

    PubMed

    Fiorino, Fabio; Ciabattini, Annalisa; Rondini, Simona; Pozzi, Gianni; Martin, Laura B; Medaglini, Donata

    2012-09-21

    Typhoid fever is a public health problem, especially among young children in developing countries. To address this need, a glycoconjugate vaccine Vi-CRM₁₉₇, composed of the polysaccharide antigen Vi covalently conjugated to the non-toxic mutant of diphtheria toxin CRM₁₉₇, is under development. Here, we assessed the antibody and cellular responses, both local and systemic, following subcutaneous injection of Vi-CRM₁₉₇. The glycoconjugate elicited Vi-specific serum IgG titers significantly higher than unconjugated Vi, with prevalence of IgG1 that persisted for at least 60 days after immunization. Vi-specific IgG, but not IgA, were present in intestinal washes. Lymphocytes proliferation after restimulation with Vi-CRM₁₉₇ was observed in spleen and mesenteric lymph nodes. These data confirm the immunogenicity of Vi-CRM₁₉₇ and demonstrate that the vaccine-specific antibody and cellular immune responses are present also in the intestinal tract, thus strengthening the suitability of Vi-CRM₁₉₇ as a promising candidate vaccine against Salmonella Typhi. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Effects of pre-existing orthopoxvirus-specific immunity on the performance of Modified Vaccinia virus Ankara-based influenza vaccines.

    PubMed

    Altenburg, Arwen F; van Trierum, Stella E; de Bruin, Erwin; de Meulder, Dennis; van de Sandt, Carolien E; van der Klis, Fiona R M; Fouchier, Ron A M; Koopmans, Marion P G; Rimmelzwaan, Guus F; de Vries, Rory D

    2018-04-24

    The replication-deficient orthopoxvirus modified vaccinia virus Ankara (MVA) is a promising vaccine vector against various pathogens and has an excellent safety record. However, pre-existing vector-specific immunity is frequently suggested to be a drawback of MVA-based vaccines. To address this issue, mice were vaccinated with MVA-based influenza vaccines in the presence or absence of orthopoxvirus-specific immunity. Importantly, protective efficacy of an MVA-based influenza vaccine against a homologous challenge was not impaired in the presence of orthopoxvirus-specific pre-existing immunity. Nonetheless, orthopoxvirus-specific pre-existing immunity reduced the induction of antigen-specific antibodies under specific conditions and completely prevented induction of antigen-specific T cell responses by rMVA-based vaccination. Notably, antibodies induced by vaccinia virus vaccination, both in mice and humans, were not capable of neutralizing MVA. Thus, when using rMVA-based vaccines it is important to consider the main correlate of protection induced by the vaccine, the vaccine dose and the orthopoxvirus immune status of vaccine recipients.

  2. Identifying Regulators of the Immune Response to Dying Cells | Center for Cancer Research

    Cancer.gov

    Cytotoxic T cells are responsible for carrying out antigen-mediated immune responses against virally-infected and malignant cells. In both cases, cytotoxic T cells are stimulated by interacting with antigen presenting cells, such as dendritic cells (DCs). Infected cells produce virus-specific antigens and pathogen associated molecular patterns, which are recognized by DCs and

  3. Cremophor EL as an adjuvant affecting immunoglobulin class switch in the immune response to the thymus-independent antigen alpha(1- greater than 3) dextran B 1355 S.

    PubMed Central

    Austrup, F; Kucharzik, T; Kölsch, E

    1991-01-01

    The humoral immune response to the so-called thymus independent antigen dextran B 1355 S in conventionally raised BALB/c mice consists solely of IgM antibodies. Expression of IgG anti-Dex antibodies in these mice is prevented by pre- or perinatally activated idiotype-specific T-suppressor lymphocytes. IgG B-memory cells nevertheless develop during the course of immunization, but are arrested in an anergic state. In the presence of Cremophor EL the induction of this anergic state is inhibited and the immune response shifts fully to an IgG anti-Dex response. Images Figure 1 PMID:1717371

  4. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route.

    PubMed

    Carey, John B; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V S; Draper, Simon J; Moore, Anne C

    2014-08-21

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP1₄₂, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP1₄₂ also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP1₄₂ using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies.

  5. Cathepsin-mediated Necrosis Controls the Adaptive Immune Response by Th2 (T helper type 2)-associated Adjuvants*

    PubMed Central

    Jacobson, Lee S.; Lima, Heriberto; Goldberg, Michael F.; Gocheva, Vasilena; Tsiperson, Vladislav; Sutterwala, Fayyaz S.; Joyce, Johanna A.; Gapp, Bianca V.; Blomen, Vincent A.; Chandran, Kartik; Brummelkamp, Thijn R.; Diaz-Griffero, Felipe; Brojatsch, Jürgen

    2013-01-01

    Immunologic adjuvants are critical components of vaccines, but it remains unclear how prototypical adjuvants enhance the adaptive immune response. Recent studies have shown that necrotic cells could trigger an immune response. Although most adjuvants have been shown to be cytotoxic, this activity has traditionally been considered a side effect. We set out to test the role of adjuvant-mediated cell death in immunity and found that alum, the most commonly used adjuvant worldwide, triggers a novel form of cell death in myeloid leukocytes characterized by cathepsin-dependent lysosome-disruption. We demonstrated that direct lysosome-permeabilization with a soluble peptide, Leu-Leu-OMe, mimics the alum-like form of necrotic cell death in terms of cathepsin dependence and cell-type specificity. Using a combination of a haploid genetic screen and cathepsin-deficient cells, we identified specific cathepsins that control lysosome-mediated necrosis. We identified cathepsin C as critical for Leu-Leu-OMe-induced cell death, whereas cathepsins B and S were required for alum-mediated necrosis. Consistent with a role of necrotic cell death in adjuvant effects, Leu-Leu-OMe replicated an alum-like immune response in vivo, characterized by dendritic cell activation, granulocyte recruitment, and production of Th2-associated antibodies. Strikingly, cathepsin C deficiency not only blocked Leu-Leu-OMe-mediated necrosis but also impaired Leu-Leu-OMe-enhanced immunity. Together our findings suggest that necrotic cell death is a powerful mediator of a Th2-associated immune response. PMID:23297415

  6. A prime-boost vaccination strategy using attenuated Salmonella typhimurium and a replication-deficient recombinant adenovirus vector elicits protective immunity against human respiratory syncytial virus.

    PubMed

    Fu, Yuan-Hui; He, Jin-Sheng; Wang, Xiao-Bo; Zheng, Xian-Xian; Wu, Qiang; Xie, Can; Zhang, Mei; Wei, Wei; Tang, Qian; Song, Jing-Dong; Qu, Jian-Guo; Hong, Tao

    2010-04-23

    Human respiratory syncytial virus (RSV), for which no clinically approved vaccine is available yet, is globally a serious pediatric pathogen of the lower respiratory tract. Several approaches have been used to develop vaccines against RSV, but none of these have been approved for use in humans. An efficient vaccine-enhancing strategy for RSV is still urgently needed. We found previously that oral SL7207/pcDNA3.1/F and intranasal FGAd/F were able to induce an effective protective immune response against RSV. The heterologous prime-boost immunization regime has been reported recently to be an efficient vaccine-enhancing strategy. Therefore, we investigated the ability of an oral SL7207/pcDNA3.1/F prime and intranasal (i.n.) FGAd/F boost regimen to generate immune responses to RSV. The SL7207/pcDNA3.1/F prime-FGAd/F boost regimen generated stronger RSV-specific humoral and mucosal immune responses in BALB/c mice than the oral SL7207/pcDNA3.1/F regimen alone, and stronger specific cellular immune responses than the i.n. FGAd/F regimen alone. Histopathological analysis showed an increased efficacy against RSV challenge by the heterologous prime-boost regimen. These results suggest that such a heterologous prime-boost strategy can enhance the efficacy of either the SL7207 or the FGAd vector regimen in generating immune responses in BALB/c mice. 2010 Elsevier Inc. All rights reserved.

  7. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route

    PubMed Central

    Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.

    2014-01-01

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP142 also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP142 using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies. PMID:25142082

  8. Detection of novel cancer-testis antigen-specific T-cell responses in TIL, regional lymph nodes, and PBL in patients with esophageal squamous cell carcinoma.

    PubMed

    Mizukami, Yoshiki; Kono, Koji; Daigo, Yataro; Takano, Atsushi; Tsunoda, Takuya; Kawaguchi, Yoshihiko; Nakamura, Yusuke; Fujii, Hideki

    2008-07-01

    We recently identified three HLA-A2402-restricted epitope peptides derived from cancer-testis antigens (CTA), TTK protein kinase (TTK), lymphocyte antigen 6 complex locus K (LY6K), and insulin-like growth factor (IGF)-II mRNA binding protein 3 (IMP-3) for the development of immunotherapies against esophageal squamous cell carcinoma (ESCC). In order to evaluate their immunotherapeutic potential in ESCC patients, we estimated by ELISPOT assay the TTK-, LY6K-, or IMP-3-specific T-cell immune responses in tumor-infiltrating lymphocytes (TIL), regional lymph node lymphocytes (RLNL), and peripheral blood lymphocytes (PBL) expanded from 20HLA-A2402 (+) ESCC patients, and correlated their immune activity with the expression levels of TTK, LY6K, and IMP-3, and MHC class I in the tumors. Induction of TTK-antigen specific T-cell response in TIL to the peptide-pulsed target cells was detected in 14 out of 20 (70%) cases, while LY6K or IMP-3 specific T-cell activity was observed in 11 of 20 (55%) or in eight of 20 (40%) cases, respectively. Furthermore, T-cell activity in RLNL and PBL was detectable in the similar proportion of the 20 ESCC patients. Interestingly, CTA-specific T-cell immune response was found in 13 of 14 (93%) TIL obtained from ESCC tumors with strong MHC class I expression, while it could be observed only in two of six (33%) TIL from ESCC tumors with weak MHC class I expression. These results strongly suggest the pre-existence of specific T-cell responses to HLA-A24-restricted epitope peptides from TTK, LY6K, and IMP-3 in ESCC patients. Monitoring antigen-specific T-cell responses, as well as the expression levels of MHC class I and epitope CTA in tumors, should be a selection index for application of cancer vaccine therapies to the patients who are likely to show good immune response.

  9. Animal model of respiratory syncytial virus: CD8+ T cells cause a cytokine storm that is chemically tractable by sphingosine-1-phosphate 1 receptor agonist therapy.

    PubMed

    Walsh, Kevin B; Teijaro, John R; Brock, Linda G; Fremgen, Daniel M; Collins, Peter L; Rosen, Hugh; Oldstone, Michael B A

    2014-06-01

    The cytokine storm is an intensified, dysregulated, tissue-injurious inflammatory response driven by cytokine and immune cell components. The cytokine storm during influenza virus infection, whereby the amplified innate immune response is primarily responsible for pulmonary damage, has been well characterized. Now we describe a novel event where virus-specific T cells induce a cytokine storm. The paramyxovirus pneumonia virus of mice (PVM) is a model of human respiratory syncytial virus (hRSV). Unexpectedly, when C57BL/6 mice were infected with PVM, the innate inflammatory response was undetectable until day 5 postinfection, at which time CD8(+) T cells infiltrated into the lung, initiating a cytokine storm by their production of gamma interferon (IFN-γ) and tumor necrosis factor alpha (TNF-α). Administration of an immunomodulatory sphingosine-1-phosphate (S1P) receptor 1 (S1P1R) agonist significantly inhibited PVM-elicited cytokine storm by blunting the PVM-specific CD8(+) T cell response, resulting in diminished pulmonary disease and enhanced survival. A dysregulated overly exuberant immune response, termed a "cytokine storm," accompanies virus-induced acute respiratory diseases (VARV), is primarily responsible for the accompanying high morbidity and mortality, and can be controlled therapeutically in influenza virus infection of mice and ferrets by administration of sphingosine-1-phosphate 1 receptor (S1P1R) agonists. Here, two novel findings are recorded. First, in contrast to influenza infection, where the cytokine storm is initiated early by the innate immune system, for pneumonia virus of mice (PVM), a model of RSV, the cytokine storm is initiated late in infection by the adaptive immune response: specifically, by virus-specific CD8 T cells via their release of IFN-γ and TNF-α. Blockading these cytokines with neutralizing antibodies blunts the cytokine storm and protects the host. Second, PVM infection is controlled by administration of an S1P1R agonist.

  10. Costimulatory Effects of an Immunodominant Parasite Antigen Paradoxically Prevent Induction of Optimal CD8 T Cell Protective Immunity.

    PubMed

    Eickhoff, Christopher S; Zhang, Xiuli; Vasconcelos, Jose R; Motz, R Geoffrey; Sullivan, Nicole L; O'Shea, Kelly; Pozzi, Nicola; Gohara, David W; Blase, Jennifer R; Di Cera, Enrico; Hoft, Daniel F

    2016-09-01

    Trypanosoma cruzi infection is controlled but not eliminated by host immunity. The T. cruzi trans-sialidase (TS) gene superfamily encodes immunodominant protective antigens, but expression of altered peptide ligands by different TS genes has been hypothesized to promote immunoevasion. We molecularly defined TS epitopes to determine their importance for protection versus parasite persistence. Peptide-pulsed dendritic cell vaccination experiments demonstrated that one pair of immunodominant CD4+ and CD8+ TS peptides alone can induce protective immunity (100% survival post-lethal parasite challenge). TS DNA vaccines have been shown by us (and others) to protect BALB/c mice against T. cruzi challenge. We generated a new TS vaccine in which the immunodominant TS CD8+ epitope MHC anchoring positions were mutated, rendering the mutant TS vaccine incapable of inducing immunity to the immunodominant CD8 epitope. Immunization of mice with wild type (WT) and mutant TS vaccines demonstrated that vaccines encoding enzymatically active protein and the immunodominant CD8+ T cell epitope enhance subdominant pathogen-specific CD8+ T cell responses. More specifically, CD8+ T cells from WT TS DNA vaccinated mice were responsive to 14 predicted CD8+ TS epitopes, while T cells from mutant TS DNA vaccinated mice were responsive to just one of these 14 predicted TS epitopes. Molecular and structural biology studies revealed that this novel costimulatory mechanism involves CD45 signaling triggered by enzymatically active TS. This enhancing effect on subdominant T cells negatively regulates protective immunity. Using peptide-pulsed DC vaccination experiments, we have shown that vaccines inducing both immunodominant and subdominant epitope responses were significantly less protective than vaccines inducing only immunodominant-specific responses. These results have important implications for T. cruzi vaccine development. Of broader significance, we demonstrate that increasing breadth of T cell epitope responses induced by vaccination is not always advantageous for host immunity.

  11. Assessment of humoral and cellular-mediated immune response in chickens treated with tilmicosin, florfenicol, or enrofloxacin at the time of Newcastle disease vaccination.

    PubMed

    Khalifeh, M S; Amawi, M M; Abu-Basha, E A; Yonis, I Bani

    2009-10-01

    The effect of tilmicosin, florfenicol, or enrofloxacin on humoral and cell-mediated immune response induced by Newcastle disease (ND) vaccination was evaluated in 20-wk-old specific-pathogen-free layer chickens. Humoral immunity was measured by detection of ND virus (NDV) antibody titer and anti-NDV IgG response using the hemagglutination inhibition (HI) test and ELISA, respectively, whereas cell-mediated immunity was evaluated by measurement of chicken interferon gamma (ChIFN-gamma) produced in splenocytes cell culture stimulated with concanavalin A, inactivated NDV antigen, or live attenuated La Sota strain using ELISA. Florfenicol hampered the ND antibody production measured by both HI and ELISA. Tilmicosin and enrofloxacin reduced the production of ND antibody in the first 3 wk after the last ND vaccination measured by HI test, which suggests that these antibiotics exert their effect mainly on the IgM isotype. The ND-vaccinated, but not treated group, showed an increase in ChIFN-gamma production after NDV antigen-specific stimulation above the nonstimulated cell culture, whereas this effect was masked in all the antibiotic-treated groups due to the stronger ChIFN-gamma production background value reported in the nonstimulated cell culture. In conclusion, our results showed, for the first time, that tilmicosin, florfenicol, or enrofloxacin reduced the humoral immune response and had beneficial effects on the cell-mediated immune response. In addition, we demonstrated that the combination of both inactivated and attenuated ND vaccine gave a strong immune response at both the humoral and cellular level.

  12. Induction of mucosal IgA by a novel jet delivery technique for HIV-1 DNA.

    PubMed

    Lundholm, P; Asakura, Y; Hinkula, J; Lucht, E; Wahren, B

    1999-04-09

    Novel ways of delivering plasmid DNA to elicit humoral IgA, IgG and cell-mediated immune responses in mice were investigated. Intraoral administration of DNA in the cheek, using a jet immunization technique, elicited the highest IgA mucosal responses. Intranasal immunization gave strong mucosal IgA responses and persistent systemic IgG. Immunoglobulin isotype analysis revealed an IgG1 profile for intramuscular tongue and gene gun immunizations and an IgG2a profile following oral jet injection and intranasal application. The route of delivery was of importance for the characteristics and quality of the mucosal immune response following DNA immunization. For DNA vaccine delivery, the intraoral jet injection technique has the advantages of being a simple and rapid way of administering the DNA in solution and of provoking specific mucosal IgA when administered in the mucosal associated lymphoid tissue.

  13. Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

    PubMed

    McCluskie, M J; Krieg, A M

    2006-01-01

    The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

  14. Innate immunity against HIV-1 infection.

    PubMed

    Altfeld, Marcus; Gale, Michael

    2015-06-01

    During acute HIV-1 infection, viral pathogen-associated molecular patterns are recognized by pathogen-recognition receptors (PRRs) of infected cells, which triggers a signaling cascade that initiates innate intracellular antiviral defenses aimed at restricting the replication and spread of the virus. This cell-intrinsic response propagates outward via the action of secreted factors such as cytokines and chemokines that activate innate immune cells and attract them to the site of infection and to local lymphatic tissue. Antiviral innate effector cells can subsequently contribute to the control of viremia and modulate the quality of the adaptive immune response to HIV-1. The concerted actions of PRR signaling, specific viral-restriction factors, innate immune cells, innate-adaptive immune crosstalk and viral evasion strategies determine the outcome of HIV-1 infection and immune responses.

  15. Innate immune memory: implications for development of pediatric immunomodulatory agents and adjuvanted vaccines

    PubMed Central

    Levy, Ofer; Netea, Mihai G.

    2014-01-01

    Unique features of immunity early in life include a distinct immune system particularly reliant on innate immunity, with weak T helper (Th)1-polarizing immune responses, and impaired responses to certain vaccines leading to a heightened susceptibility to infection. To these important aspects, we now add an increasingly appreciated concept that the innate immune system displays epigenetic memory of an earlier infection or vaccination, a phenomenon that has been named “trained immunity”. Exposure of neonatal leukocytes in vitro or neonatal animals or humans in vivo to specific innate immune stimuli results in an altered innate immune set point. Given the particular importance of innate immunity early in life, trained immunity to early life infection and/or immunization may play an important role in modulating both acute and chronic diseases. PMID:24352476

  16. The association of allergic sensitization in mother and child in breast-fed and formula-fed infants.

    PubMed

    Wright, A L; Stern, D A; Halonen, M

    2001-01-01

    Human milk contains immunologically active substances potentially capable of altering infant immune response. As part of the prospective Children's Respiratory Study, we assessed whether the association between maternal allergic status and allergic status of the child was altered by breast-feeding. Skin-prick tests for 7 common allergens were administered to 702 6-year-old children and their mothers. The percentage of children sensitized to specific allergens, maternal skin test response to that allergen, and whether or not the child was ever breast-fed was determined. Findings indicated that specific sensitization in the mother was associated with specific sensitization in the child only if the child was breast-fed. This indirectly supports the hypothesis that contents of milk differ with maternal allergic status, and appear to affect allergic status in the child. These results suggest that milk from allergic mothers either promotes a Th2 type immune response or suppresses Th1 immune response in the child.

  17. The influence of innate and adaptative immune responses on the differential clinical outcomes of leprosy.

    PubMed

    Fonseca, Adriana Barbosa de Lima; Simon, Marise do Vale; Cazzaniga, Rodrigo Anselmo; de Moura, Tatiana Rodrigues; de Almeida, Roque Pacheco; Duthie, Malcolm S; Reed, Steven G; de Jesus, Amelia Ribeiro

    2017-02-06

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. According to official reports from 121 countries across five WHO regions, there were 213 899 newly diagnosed cases in 2014. Although leprosy affects the skin and peripheral nerves, it can present across a spectrum of clinical and histopathological forms that are strongly influenced by the immune response of the infected individuals. These forms comprise the extremes of tuberculoid leprosy (TT), with a M. leprae-specific Th1, but also a Th17, response that limits M. leprae multiplication, through to lepromatous leprosy (LL), with M. leprae-specific Th2 and T regulatory responses that do not control M. leprae replication but rather allow bacterial dissemination. The interpolar borderline clinical forms present with similar, but less extreme, immune biases. Acute inflammatory episodes, known as leprosy reactions, are complications that may occur before, during or after treatment, and cause further neurological damages that can cause irreversible chronic disabilities. This review discusses the innate and adaptive immune responses, and their interactions, that are known to affect pathogenesis and influence the clinical outcome of leprosy.

  18. Simultaneous approach using systemic, mucosal and transcutaneous routes of immunization for development of protective HIV-1 vaccines.

    PubMed

    Belyakov, I M; Ahlers, J D

    2011-01-01

    Mucosal tissues are major sites of HIV entry and initial infection. Induction of a local mucosal cytotoxic T lymphocyte response is considered an important goal in developing an effective HIV vaccine. In addition, activation and recruitment of memory CD4(+) and CD8(+) T cells in systemic lymphoid circulation to mucosal effector sites might provide the firewall needed to prevent virus spread. Therefore a vaccine that generates CD4(+) and CD8(+) responses in both mucosal and systemic tissues might be required for protection against HIV. However, optimal routes and number of vaccinations required for the generation of long lasting CD4(+) and CD8(+) CTL effector and memory responses are not well understood especially for mucosal T cells. A number of studies looking at protective immune responses against diverse mucosal pathogens have shown that mucosal vaccination is necessary to induce a compartmentalized immune response including maximum levels of mucosal high-avidity CD8(+) CTL, antigen specific mucosal antibodies titers (especially sIgA), as well as induction of innate anti-viral factors in mucosa tissue. Immune responses are detectable at mucosal sites after systemic delivery of vaccine, and prime boost regimens can amplify the magnitude of immune responses in mucosal sites and in systemic lymphoid tissues. We believe that the most optimal mucosal and systemic HIV/SIV specific protective immune responses and innate factors might best be achieved by simultaneous mucosal and systemic prime and boost vaccinations. Similar principals of vaccination may be applied for vaccine development against cancer and highly invasive pathogens that lead to chronic infection.

  19. Interleukin-Encoding Adenoviral Vectors as Genetic Adjuvant for Vaccination against Retroviral Infection

    PubMed Central

    Ohs, Inga; Windmann, Sonja; Wildner, Oliver; Dittmer, Ulf; Bayer, Wibke

    2013-01-01

    Interleukins (IL) are cytokines with stimulatory and modulatory functions in the immune system. In this study, we have chosen interleukins which are involved in the enhancement of TH2 responses and B cell functions to analyze their potential to improve a prophylactic adenovirus-based anti-retroviral vaccine with regard to antibody and virus-specific CD4+ T cell responses. Mice were vaccinated with an adenoviral vector which encodes and displays the Friend Virus (FV) surface envelope protein gp70 (Ad.pIXgp70) in combination with adenoviral vectors encoding the interleukins IL4, IL5, IL6, IL7 or IL23. Co-application of Ad.pIXgp70 with Ad.IL5, Ad.IL6 or Ad.IL23 resulted in improved protection with high control over FV-induced splenomegaly and reduced viral loads. Mice co-immunized with adenoviral vectors encoding IL5 or IL23 showed increased neutralizing antibody responses while mice co-immunized with Ad.IL6 or Ad.IL23 showed improved FV-specific CD4+ T cell responses compared to mice immunized with Ad.pIXgp70 alone. We show that the co-application of adenoviral vectors encoding specific interleukins is suitable to improve the vaccination efficacy of an anti-retroviral vaccine. Improved protection correlated with improved CD4+ T cell responses and especially with higher neutralizing antibody titers. The co-application of selected interleukin-encoding adenoviral vectors is a valuable tool for vaccination with regard to enhancement of antibody mediated immunity. PMID:24349306

  20. Assessment of Different Strategies to Determine MAP-specific Cellular Immune Responses in Cattle

    USDA-ARS?s Scientific Manuscript database

    Assessment of cellular immunity in cattle against Mycobacterium avium ssp. paratuberculosis (MAP) by established methods remains unsatisfactory for diagnostic purposes. Recent studies conclude that analysis of T-cell subset responsiveness may improve diagnostic outcome. Aim of this study was to iden...

  1. Bovine response to lipoarabinomannan vaccination and challenge with Mycobacterium paratuberculosis.

    PubMed

    Jolly, Ana; Morsella, Claudia; Bass, Laura; Fiorentino, María Andrea; Paolicchi, Fernando Alberto; Mundo, Silvia Leonor

    2013-01-01

    This study aimed to evaluate the immune response in bovines following immunization with a mycobaterial Lipoarabinomannan extract (LAMe) and the effect of Map challenge. LAMe vaccine induced specific antibody levels that diminished after the challenge and affected Map excretion at least for 100 days thereafter.

  2. Identification and Characterization of Novel Immunomodulatory Bursal-derived Pentapeptide-II (BPP-II)*

    PubMed Central

    Feng, Xiu-Li; Liu, Qing-Tao; Cao, Rui-Bing; Zhou, Bin; Ma, Zhi-Yong; Deng, Wen-Lei; Wei, Jian-Chao; Qiu, Ya-Feng; Wang, Fang-Quan; Gu, Jin-Yan; Wang, Feng-Juan; Zheng, Qi-Sheng; Ishag, Hassan; Chen, Pu-Yan

    2012-01-01

    The bursa of Fabricius, the acknowledged central humoral immune organ, plays a vital role in B lymphocyte differentiation. However, there are few reports of the molecular basis of the mechanism on immune induction and potential antitumor activity of bursal-derived peptides. In this paper, a novel bursal-derived pentapeptide-II (BPP-II, MTLTG) was isolated and exerted immunomodulatory functions on antibody responses in vitro. Gene microarray analyses demonstrated that BPP-II regulated expression of 2478 genes in a mouse-derived hybridoma cell line. Immune-related gene ontology functional procedures were employed for further functional analysis. Furthermore, the majority of BPP-II-regulated pathways were associated with immune responses and tumor processes. Moreover, BPP-II exhibited immunomodulatory effects on antigen-specific immune responses in vivo, including enhancement of avian influenza virus (H9N2 subtype)-specific antibody and cytokine production and modification of T cell immunophenotypes and lymphocyte proliferation. Finally, BPP-II triggered p53 expression and stabilization and selectively inhibited tumor cell proliferation. These data identified the multifunctional factor, BPP-II, as a novel biomaterial representing an important linking between the humoral central immune system and immune induction, including antitumor. Information generated in this study elucidates further the mechanisms involved in humoral immune system and represents the potential basis of effective immunotherapeutic strategies for treating human tumors and immune improvement. PMID:22184121

  3. Identification and characterization of novel immunomodulatory bursal-derived pentapeptide-II (BPP-II).

    PubMed

    Feng, Xiu-Li; Liu, Qing-Tao; Cao, Rui-Bing; Zhou, Bin; Ma, Zhi-Yong; Deng, Wen-Lei; Wei, Jian-Chao; Qiu, Ya-Feng; Wang, Fang-Quan; Gu, Jin-Yan; Wang, Feng-Juan; Zheng, Qi-Sheng; Ishag, Hassan; Chen, Pu-Yan

    2012-02-03

    The bursa of Fabricius, the acknowledged central humoral immune organ, plays a vital role in B lymphocyte differentiation. However, there are few reports of the molecular basis of the mechanism on immune induction and potential antitumor activity of bursal-derived peptides. In this paper, a novel bursal-derived pentapeptide-II (BPP-II, MTLTG) was isolated and exerted immunomodulatory functions on antibody responses in vitro. Gene microarray analyses demonstrated that BPP-II regulated expression of 2478 genes in a mouse-derived hybridoma cell line. Immune-related gene ontology functional procedures were employed for further functional analysis. Furthermore, the majority of BPP-II-regulated pathways were associated with immune responses and tumor processes. Moreover, BPP-II exhibited immunomodulatory effects on antigen-specific immune responses in vivo, including enhancement of avian influenza virus (H9N2 subtype)-specific antibody and cytokine production and modification of T cell immunophenotypes and lymphocyte proliferation. Finally, BPP-II triggered p53 expression and stabilization and selectively inhibited tumor cell proliferation. These data identified the multifunctional factor, BPP-II, as a novel biomaterial representing an important linking between the humoral central immune system and immune induction, including antitumor. Information generated in this study elucidates further the mechanisms involved in humoral immune system and represents the potential basis of effective immunotherapeutic strategies for treating human tumors and immune improvement.

  4. Innate Immunity to Respiratory Infection in Early Life

    PubMed Central

    Lambert, Laura; Culley, Fiona J.

    2017-01-01

    Early life is a period of particular susceptibility to respiratory infections and symptoms are frequently more severe in infants than in adults. The neonatal immune system is generally held to be deficient in most compartments; responses to innate stimuli are weak, antigen-presenting cells have poor immunostimulatory activity and adaptive lymphocyte responses are limited, leading to poor immune memory and ineffective vaccine responses. For mucosal surfaces such as the lung, which is continuously exposed to airborne antigen and to potential pathogenic invasion, the ability to discriminate between harmless and potentially dangerous antigens is essential, to prevent inflammation that could lead to loss of gaseous exchange and damage to the developing lung tissue. We have only recently begun to define the differences in respiratory immunity in early life and its environmental and developmental influences. The innate immune system may be of relatively greater importance than the adaptive immune system in the neonatal and infant period than later in life, as it does not require specific antigenic experience. A better understanding of what constitutes protective innate immunity in the respiratory tract in this age group and the factors that influence its development should allow us to predict why certain infants are vulnerable to severe respiratory infections, design treatments to accelerate the development of protective immunity, and design age specific adjuvants to better boost immunity to infection in the lung. PMID:29184555

  5. Aryl hydrocarbon receptor signaling modulates antiviral immune responses: ligand metabolism rather than chemical source is the stronger predictor of outcome.

    PubMed

    Boule, Lisbeth A; Burke, Catherine G; Jin, Guang-Bi; Lawrence, B Paige

    2018-01-29

    The aryl hydrocarbon receptor (AHR) offers a compelling target to modulate the immune system. AHR agonists alter adaptive immune responses, but the consequences differ across studies. We report here the comparison of four agents representing different sources of AHR ligands in mice infected with influenza A virus (IAV): TCDD, prototype exogenous AHR agonist; PCB126, pollutant with documented human exposure; ITE, novel pharmaceutical; and FICZ, degradation product of tryptophan. All four compounds diminished virus-specific IgM levels and increased the proportion of regulatory T cells. TCDD, PCB126 and ITE, but not FICZ, reduced virus-specific IgG levels and CD8 + T cell responses. Similarly, ITE, PCB126, and TCDD reduced Th1 and Tfh cells, whereas FICZ increased their frequency. In Cyp1a1-deficient mice, all compounds, including FICZ, reduced the response to IAV. Conditional Ahr knockout mice revealed that all four compounds require AHR within hematopoietic cells. Thus, differences in the immune response to IAV likely reflect variances in quality, magnitude, and duration of AHR signaling. This indicates that binding affinity and metabolism may be stronger predictors of immune effects than a compound's source of origin, and that harnessing AHR will require finding a balance between dampening immune-mediated pathologies and maintaining sufficient host defenses against infection.

  6. INFLUENCE OF GENETIC FACTORS ON THE MAGNITUDE AND THE HETEROGENEITY OF THE IMMUNE RESPONSE IN THE RABBIT

    PubMed Central

    Eichmann, Klaus; Braun, Dietmar G.; Krause, Richard M.

    1971-01-01

    Selective breeding of rabbits immunized with Group C and Group A streptococcal vaccines was employed to reveal genetic influences on the magnitude and on the restriction in heterogeneity of the immune response to the group-specific carbohydrates. After two generations of selective breeding, complete segregation was achieved between a high-response population (>18 mg precipitins/ml serum, average 33 mg/ml) and a low-response population (<13 mg precipitins/ml serum, average 7.5 mg/ml) to Group C carbohydrate. This suggests that a limited number of genes controls the magnitude of the immune response to this antigen. Selective breeding of rabbits which were representative of heterogeneous, restricted, and monoclonal responses revealed that the degree of antibody heterogeneity in the parental rabbits is reflected in the offspring. More than 95% of the offspring derived from rabbits which had a heterogeneous immune response developed heterogeneous antibodies. 33% of the offspring derived from rabbits which had restricted and monoclonal immune responses developed monoclonal antibodies. This suggests that the degree of heterogeneity of the antibody response to the streptococcal carbohydrates is under genetic control. The degree of heterogeneity and the magnitude of the immune response appear to be independent variables. PMID:5558071

  7. Clinical Outcomes of Specific Immunotherapy in Advanced Pancreatic Cancer: A Systematic Review and Meta-Analysis

    PubMed Central

    Qi, Xing-Shun

    2017-01-01

    Specific immunotherapies, including vaccines with autologous tumor cells and tumor antigen-specific monoclonal antibodies, are important treatments for PC patients. To evaluate the clinical outcomes of PC-specific immunotherapy, we performed a systematic review and meta-analysis of the relevant published clinical trials. The effects of specific immunotherapy were compared with those of nonspecific immunotherapy and the meta-analysis was executed with results regarding the overall survival (OS), immune responses data, and serum cancer markers data. The pooled analysis was performed by using the random-effects model. We found that significantly improved OS was noted for PC patients utilizing specific immunotherapy and an improved immune response was also observed. In conclusion, specific immunotherapy was superior in prolonging the survival time and enhancing immunological responses in PC patients. PMID:28265583

  8. Tomatine adjuvantation of protective immunity to a major pre-erythrocytic vaccine candidate of malaria is mediated via CD8+ T cell release of IFN-gamma.

    PubMed

    Heal, Karen G; Taylor-Robinson, Andrew W

    2010-01-01

    The glycoalkaloid tomatine, derived from the wild tomato, can act as a powerful adjuvant to elicit an antigen-specific cell-mediated immune response to the circumsporozoite (CS) protein, a major pre-erythrocytic stage malaria vaccine candidate antigen. Using a defined MHC-class-I-restricted CS epitope in a Plasmodium berghei rodent model, antigen-specific cytotoxic T lymphocyte activity and IFN-gamma secretion ex vivo were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunized mice. Further, through lymphocyte depletion it is demonstrated that antigen-specific IFN-gamma is produced exclusively by the CD8(+) T cell subset. We conclude that the processing of the P. berghei CS peptide as an exogenous antigen and its presentation via MHC class I molecules to CD8(+) T cells leads to an immune response that is an in vitro correlate of protection against pre-erythrocytic malaria. Further characterization of tomatine as an adjuvant in malaria vaccine development is indicated.

  9. Effects of traditional medical herbs "minor bupleurum decoction" on the non-specific immune responses of white shrimp (Litopenaeus vannamei).

    PubMed

    Wu, Yu-Sheng; Lee, Meng-Chou; Huang, Cheng-Ting; Kung, Tzu-Chi; Huang, Chih-Yang; Nan, Fan-Hua

    2017-05-01

    This study is investigating the effect of minor bupleurum decoction (Xiao-Chai-Hu decoction) on the non-specific immune response of white shrimp (Litopenaeus vannamei). To determine prophenoloxidase activity (proPO), reactive oxygen species production (ROS), superoxide anion production (O 2 - ), nitric oxide production (NO), phagocytic rate (PR), phagocytic index (PI), superoxide dismutase activity (SOD), total haemocyte count (THC) and differential haemocyte count (DHC). In this experiment, treating with different dosages (0, 0.25, 0.5 and, 1%) of minor bupleurum decoction to detect immune parameters on day 0, 1, 2, 4, 7, 14, 21 and 28. Result is shown that 0.25% treatment significantly enhanced the superoxide dismutase (SOD) activity and, 0.25 and 1% treatment significantly increased the ROS production, nitric oxide (NO) production and phagocytic rate (PR) moreover, 0.5 and 1% treatment induced the proPO activity and superoxide anion (O 2 - ) production. Evidence exactly indicated that minor bupleurum decoction is able to enhance the non-specific immunity responses of white shrimp via in vivo examination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Clathrin-mediated endocytosis and transcytosis of enterotoxigenic Escherichia coli F4 fimbriae in porcine intestinal epithelial cells.

    PubMed

    Rasschaert, Kristien; Devriendt, Bert; Favoreel, Herman; Goddeeris, Bruno M; Cox, Eric

    2010-10-15

    Enterotoxigenic Escherichia coli (ETEC) cause severe diarrhea in neonatal and recently weaned piglets. Previously, we demonstrated that oral immunization of F4 receptor positive piglets with purified F4 fimbriae induces a protective F4-specific intestinal immune response. However, in F4 receptor negative animals no F4-specific immune response can be elicited, indicating that the induction of an F4-specific mucosal immune response upon oral immunisation is receptor-dependent. Although F4 fimbriae undergo transcytosis across the intestinal epithelium in vivo, the endocytosis pathways used remain unknown. In the present study, we characterized the internalization of F4 fimbriae in the porcine intestinal epithelial cell line IPEC-J2. The results in the present study demonstrate that F4 fimbriae are internalized through a clathrin-dependent pathway. Furthermore, our results suggest that F4 fimbriae are transcytosed across differentiated IPEC-J2 cells. This receptor-dependent transcytosis of F4 fimbriae may explain the immunogenicity of these fimbriae upon oral administration in vivo. (c) 2010 Elsevier B.V. All rights reserved.

  11. The immune complex CTA1-DD/IgG adjuvant specifically targets connective tissue mast cells through FcγRIIIA and augments anti-HPV immunity after nasal immunization.

    PubMed

    Fang, Y; Zhang, T; Lidell, L; Xu, X; Lycke, N; Xiang, Z

    2013-11-01

    We have previously reported that CTA1-DD/IgG immune complexes augment antibody responses in a mast cell-dependent manner following intranasal (IN) immunizations. However, from a safety perspective, mast cell activation could preclude clinical use. Therefore, we have extended these studies and demonstrate that CTA1-DD/IgG immune complexes administered IN did not trigger an anaphylactic reaction. Importantly, CTA1-DD/IgE immune complexes did not activate mast cells. Interestingly, only connective tissue, but not mucosal, mast cells could be activated by CTA1-DD/IgG immune complexes. This effect was mediated by FcγRIIIA, only expressed on connective tissue mast cells, and found in the nasal submucosa. FcγRIIIA-deficient mice had compromised responses to immunization adjuvanted by CTA1-DD/IgG. Proof-of-concept studies revealed that IN immunized mice with human papillomavirus (HPV) type 16 L1 virus-like particles (VLP) and CTA1-DD/IgG immune complexes demonstrated strong and sustained specific antibody titers in serum and vaginal secretions. From a mast cell perspective, CTA1-DD/IgG immune complexes appear to be safe and effective mucosal adjuvants.

  12. A novel vaccination strategy mediating the induction of lung-resident memory CD8 T cells confers heterosubtypic immunity against future pandemic influenza virus

    PubMed Central

    Lee, Yu-Na; Lee, Young-Tae; Kim, Min-Chul; Gewirtz, Andrew T.; Kang, Sang-Moo

    2016-01-01

    The currently used vaccine strategy to combat influenza A virus (IAV) aims to provide highly specific immunity to circulating seasonal IAV strains. However, the outbreak of 2009 influenza pandemic highlights the danger in this strategy. Here, we tested the hypothesis that universal vaccination that offers broader but weaker protection would result in cross protective T-cell responses after primary IAV infection, which would subsequently provide protective immunity against future pandemic strains. Specifically, we used tandem repeat M2e epitopes on virus-like particles (M2e5x VLP) that induced heterosubtypic immunity by eliciting antibodies to a conserved M2e epitope. M2e5x VLP was found to be superior to strain-specific current split vaccine in conferring heterosubtypic cross protection and in equipping the host with cross-protective lung-resident nucleoprotein-specific memory CD8+ T cell responses to a subsequent secondary infection with a new pandemic potential strain. Immune correlates for subsequent heterosubtypic immunity by M2e5x VLP vaccination were found to be virus-specific CD8+ T cells secreting IFN-γ and expressing lung-resident memory phenotypic markers CD69+ and CD103+ as well as M2e antibodies. Hence, vaccination with M2e5x VLP may be developable as a new strategy to combat future pandemic outbreaks. PMID:26864033

  13. [Dendritic cell-based therapeutic cancer vaccines].

    PubMed

    Rizzo, Manglio; Alaniz, Laura; Mazzolini, Guillermo D

    In recent years immunotherapy has revolutionized the treatment of patients with advanced cancer. The increased knowledge in the tumor immune-biology has allowed developing rational treatments by manipulation of the immune system with significant clinical impact. This rapid development has significantly changed the prognosis of many tumors without treatment options up to date. Other strategies have explored the use of therapeutic vaccines based on dendritic cells (DC) by inducing antitumor immunity. DC are cells of hematopoietic origin, constitutively expressing molecules capable to present antigens, that are functionally the most potent inducers of the activation and proliferation of antigen specific T lymphocytes. The CD8+ T cells proliferate and acquire cytotoxic capacity after recognizing their specific antigen presented on the surface of DC, although only some types of DC can present antigens internalized from outside the cell to precursors of cytotoxic T lymphocytes (this function is called cross-presentation) requiring translocation mechanisms of complex antigens. The induction of an effective adaptive immune response is considered a good option given its specificity, and prolonged duration of response. The DC, thanks to its particular ability of antigen presentation and lymphocyte stimulation, are able to reverse the poor antitumor immune response experienced by patients with cancer. The DC can be obtained from various sources, using different protocols to generate differentiation and maturation, and are administered by various routes such as subcutaneous, intravenous or intranodal. The wide variety of protocols resulted in heterogeneous clinical responses.

  14. Genetic Polymorphisms Associated with Rubella Virus-Specific Cellular Immunity Following MMR Vaccination

    PubMed Central

    Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Lambert, Nathaniel D.; Pankratz, V. Shane; Poland, Gregory A.

    2014-01-01

    Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single dose seroconversion rates ~95%. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects ages 11–22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (ages 18–40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination. PMID:25098560

  15. Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

    PubMed

    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A

    2014-11-01

    Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

  16. Employing Escherichia coli-derived outer membrane vesicles as an antigen delivery platform elicits protective immunity against Acinetobacter baumannii infection

    NASA Astrophysics Data System (ADS)

    Huang, Weiwei; Wang, Shijie; Yao, Yufeng; Xia, Ye; Yang, Xu; Li, Kui; Sun, Pengyan; Liu, Cunbao; Sun, Wenjia; Bai, Hongmei; Chu, Xiaojie; Li, Yang; Ma, Yanbing

    2016-11-01

    Outer membrane vesicles (OMVs) have proven to be highly immunogenic and induced an immune response against bacterial infection in human clinics and animal models. We sought to investigate whether engineered OMVs can be a feasible antigen-delivery platform for efficiently inducing specific antibody responses. In this study, Omp22 (an outer membrane protein of A. baumannii) was displayed on E. coli DH5α-derived OMVs (Omp22-OMVs) using recombinant gene technology. The morphological features of Omp22-OMVs were similar to those of wild-type OMVs (wtOMVs). Immunization with Omp22-OMVs induced high titers of Omp22-specific antibodies. In a murine sepsis model, Omp22-OMV immunization significantly protected mice from lethal challenge with a clinically isolated A. baumannii strain, which was evidenced by the increased survival rate of the mice, the reduced bacterial burdens in the lung, spleen, liver, kidney, and blood, and the suppressed serum levels of inflammatory cytokines. In vitro opsonophagocytosis assays showed that antiserum collected from Omp22-OMV-immunized mice had bactericidal activity against clinical isolates, which was partly specific antibody-dependent. These results strongly indicated that engineered OMVs could display a whole heterologous protein (~22 kDa) on the surface and effectively induce specific antibody responses, and thus OMVs have the potential to be a feasible vaccine platform.

  17. Inability To Detect Cross-Reactive Memory T Cells Challenges the Frequency of Heterologous Immunity among Common Viruses.

    PubMed

    Rowntree, Louise C; Nguyen, Thi H O; Halim, Hanim; Purcell, Anthony W; Rossjohn, Jamie; Gras, Stephanie; Kotsimbos, Tom C; Mifsud, Nicole A

    2018-06-15

    Human memory T cells that cross-react with epitopes from unrelated viruses can potentially modulate immune responses to subsequent infections by a phenomenon termed heterologous immunity. However, it is unclear whether similarities in structure rather than sequence underpin heterologous T cell cross-reactivity. In this study, we aimed to explore the mechanism of heterologous immunity involving immunodominant epitopes derived from common viruses restricted to high-frequency HLA allotypes (HLA-A*02:01, -B*07:02, and -B*08:01). We examined EBV-specific memory T cells for their ability to cross-react with CMV or influenza A virus-derived epitopes. Following T cell immunoassays to determine phenotype and function, complemented with biophysical and structural investigations of peptide/HLA complexes, we did not detect cross-reactivity of EBV-specific memory T cells toward either CMV or influenza A virus epitopes presented by any of the selected HLA allomorphs. Thus, despite the ubiquitous nature of these human viruses and the dominant immune response directed toward the selected epitopes, heterologous virus-specific T cell cross-reactivity was not detected. This suggests that either heterologous immunity is not as common as previously reported, or that it requires a very specific biological context to develop and be clinically relevant. Copyright © 2018 by The American Association of Immunologists, Inc.

  18. Differentiation of F4 receptor profiles in pigs based on their mucin 4 polymorphism, responsiveness to oral F4 immunization and in vitro binding of F4 to villi.

    PubMed

    Nguyen, V U; Goetstouwers, T; Coddens, A; Van Poucke, M; Peelman, L; Deforce, D; Melkebeek, V; Cox, E

    2013-03-15

    F4(+) enterotoxigenic Escherichia coli (F4(+) ETEC) are an important cause of diarrhoea and mortality in piglets. F4(+) ETEC use their F4 fimbriae to adhere to specific receptors (F4Rs) on small intestinal brush borders, resulting in colonization of the small intestine. To prevent pigs from post-weaning diarrhoea, pigs should be vaccinated during the suckling period. Previously, we demonstrated that F4acR(+), but not F4acR(-) piglets could be orally immunized with purified F4 fimbriae resulting in a protective immunity against F4(+) ETEC infections, indicating that this immune response was F4R dependent. Recently, aminopeptidase N has been identified as a glycoprotein receptor important for this oral immune response. However, in some oral immunization experiments, a few F4acR(+) piglets did not show an antibody response upon oral immunization, suggesting additional receptors. Therefore, the binding profile of F4 to brush border membrane (glyco)proteins was determined for pigs differing in F4-specific antibody response upon oral immunization, in in vitro adhesion of F4(+)E. coli to small intestinal villi, and in Muc4 genotype. Six groups of pigs could be identified. Only two groups positive in all three assays showed two high molecular weight (MW) glycoprotein bands (>250kDa) suggesting that these high MW bands are linked to the MUC4 susceptible genotype. The fact that these bands were absent in the MUC4 resistant group which showed a positive immune response against F4 and was positive in the adhesion test confirm that at least one or perhaps more other F4Rs exist. Interestingly, two pigs that were positive in the villous adhesion assay did not show an immune response against F4 fimbriae. This suggests that a third receptor category might exist which allows the bacteria to adhere but does not allow effective immunization with soluble F4 fimbriae. Future research will be necessary to confirm or reveal the identity of these receptors. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Murine Polyomavirus Virus-Like Particles Carrying Full-Length Human PSA Protect BALB/c Mice from Outgrowth of a PSA Expressing Tumor

    PubMed Central

    Eriksson, Mathilda; Andreasson, Kalle; Weidmann, Joachim; Lundberg, Kajsa; Tegerstedt, Karin

    2011-01-01

    Virus-like particles (VLPs) consist of capsid proteins from viruses and have been shown to be usable as carriers of protein and peptide antigens for immune therapy. In this study, we have produced and assayed murine polyomavirus (MPyV) VLPs carrying the entire human Prostate Specific Antigen (PSA) (PSA-MPyVLPs) for their potential use for immune therapy in a mouse model system. BALB/c mice immunized with PSA-MPyVLPs were only marginally protected against outgrowth of a PSA-expressing tumor. To improve protection, PSA-MPyVLPs were co-injected with adjuvant CpG, either alone or loaded onto murine dendritic cells (DCs). Immunization with PSA-MPyVLPs loaded onto DCs in the presence of CpG was shown to efficiently protect mice from tumor outgrowth. In addition, cellular and humoral immune responses after immunization were examined. PSA-specific CD4+ and CD8+ cells were demonstrated, but no PSA-specific IgG antibodies. Vaccination with DCs loaded with PSA-MPyVLPs induced an eight-fold lower titre of anti-VLP antibodies than vaccination with PSA-MPyVLPs alone. In conclusion, immunization of BALB/c mice with PSA-MPyVLPs, loaded onto DCs and co-injected with CpG, induces an efficient PSA-specific tumor protective immune response, including both CD4+ and CD8+ cells with a low induction of anti-VLP antibodies. PMID:21858228

  20. The Immunomodulatory Role of Adjuvants in Vaccines Formulated with the Recombinant Antigens Ov-103 and Ov-RAL-2 against Onchocerca volvulus in Mice.

    PubMed

    Hess, Jessica A; Zhan, Bin; Torigian, April R; Patton, John B; Petrovsky, Nikolai; Zhan, Tingting; Bottazzi, Maria Elena; Hotez, Peter J; Klei, Thomas R; Lustigman, Sara; Abraham, David

    2016-07-01

    In some regions in Africa, elimination of onchocerciasis may be possible with mass drug administration, although there is concern based on several factors that onchocerciasis cannot be eliminated solely through this approach. A vaccine against Onchocerca volvulus would provide a critical tool for the ultimate elimination of this infection. Previous studies have demonstrated that immunization of mice with Ov-103 and Ov-RAL-2, when formulated with alum, induced protective immunity. It was hypothesized that the levels of protective immunity induced with the two recombinant antigens formulated with alum would be improved by formulation with other adjuvants known to enhance different types of antigen-specific immune responses. Immunizing mice with Ov-103 and Ov-RAL-2 in conjunction with alum, Advax 2 and MF59 induced significant levels of larval killing and host protection. The immune response was biased towards Th2 with all three of the adjuvants, with IgG1 the dominant antibody. Improved larval killing and host protection was observed in mice immunized with co-administered Ov-103 and Ov-RAL-2 in conjunction with each of the three adjuvants as compared to single immunizations. Antigen-specific antibody titers were significantly increased in mice immunized concurrently with the two antigens. Based on chemokine levels, it appears that neutrophils and eosinophils participate in the protective immune response induced by Ov-103, and macrophages and neutrophils participate in immunity induced by Ov-RAL-2. The mechanism of protective immunity induced by Ov-103 and Ov-RAL-2, with the adjuvants alum, Advax 2 and MF59, appears to be multifactorial with roles for cytokines, chemokines, antibody and specific effector cells. The vaccines developed in this study have the potential of reducing the morbidity associated with onchocerciasis in humans.

  1. Potential use of local and systemic humoral immune response parameters to forecast Mycoplasma hyopneumoniae associated lung lesions.

    PubMed

    Garcia-Morante, Beatriz; Segalés, Joaquim; Fraile, Lorenzo; Llardén, Gemma; Coll, Teresa; Sibila, Marina

    2017-01-01

    Immunopathological events are key for the development of enzootic pneumonia (EP), which is macroscopically observed as cranioventral pulmonary consolidation (CVPC). This study aimed to investigate the putative association between the humoral immune response against Mycoplasma hyopneumoniae (M. hyopneumoniae) and prevalence and extension of CVPC in 1) experimentally infected pigs, 2) slaughtered pigs and 3) sequentially necropsied pigs in a longitudinal study. CVPC was scored by means of the European Pharmacopoeia recommended methodology. Specific IgG, IgG1 and IgG2 antibodies were assessed in serum. In addition, mucosal IgG and IgA antibodies were analyzed in broncho-alveolar lavage fluid (BALF) from experimentally challenged pigs. The systemic humoral immune response in experimentally infected pigs was delayed in onset whereas humoral respiratory mucosal immune response appeared more rapidly but declined earlier. Although low, BALF IgG antibodies showed the highest correlation with CVPC scores (r = 0.49, p<0.05). In slaughter-aged pigs, both percentage of lungs with CVPC and mean lung lesion score were significantly higher in M. hyopneumoniae seropositive farms compared to the seronegative ones (p<0.001). Similarly, seropositive sequentially necropsied pigs showed more severe CVPC than seronegative ones. Overall, mean serological values might help to forecast prevalence and severity of EP-like lung lesions using a population based approach. Remarkably, the specific systemic humoral immune response was found to be predominated by the IgG2 subclass, suggesting a dominant Th1-mediated immune response to M. hyopneumoniae.

  2. Nanocage-Therapeutics Prevailing Phagocytosis and Immunogenic Cell Death Awakens Immunity against Cancer.

    PubMed

    Lee, Eun Jung; Nam, Gi-Hoon; Lee, Na Kyeong; Kih, Minwoo; Koh, Eunee; Kim, Yoon Kyoung; Hong, Yeonsun; Kim, Soyoun; Park, Seung-Yoon; Jeong, Cherlhyun; Yang, Yoosoo; Kim, In-San

    2018-03-01

    A growing appreciation of the relationship between the immune system and the tumorigenesis has led to the development of strategies aimed at "re-editing" the immune system to kill tumors. Here, a novel tactic is reported for overcoming the activation-energy threshold of the immunosuppressive tumor microenvironment and mediating the delivery and presentation of tumor neoantigens to the host's immune system. This nature-derived nanocage not only efficiently presents ligands that enhance cancer cell phagocytosis, but also delivers drugs that induce immunogenic cancer cell death. The designed nanocage-therapeutics induce the release of neoantigens and danger signals in dying tumor cells, and leads to enhancement of tumor cell phagocytosis and cross-priming of tumor specific T cells by neoantigen peptide-loaded antigen-presenting cells. Potent inhibition of tumor growth and complete eradication of tumors is observed through systemic tumor-specific T cell responses in tumor draining lymph nodes and the spleen and further, infiltration of CD8+ T cells into the tumor site. Remarkably, after removal of the primary tumor, all mice treated with this nanocage-therapeutics are protected against subsequent challenge with the same tumor cells, suggesting development of lasting, tumor-specific responses. This designed nanocage-therapeutics "awakens" the host's immune system and provokes a durable systemic immune response against cancer. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Modular Design Features of a Peptide Amphiphile Micelle Vaccine Platform and Their Impact on an Immune Response

    NASA Astrophysics Data System (ADS)

    Barrett, John Christopher

    Inducing a strong and specific immune response is the hallmark of a successful vaccine. Nanoparticles have emerged as promising vaccine delivery devices to discover and elicit immune responses. Modular platforms are attractive for their engineerability and broad potential applications. Fine-tuning a nanoparticle vaccine to create an immune response with specific antibody and other cellular responses is influenced by many factors such as shape, size and composition. Peptide amphiphile micelles are a unique biomaterials platform that can function as a modular vaccine delivery system, enabling control over many of these important factors. Peptide amphiphiles (PAs) consist of a hydrophilic peptide antigen conjugated to a hydrophobic lipid tail. The PAs then self-assemble into micelles, with the micelle characteristics determined by the chemical composition of the PA and micelle preparation methods. PA micelles contain a large design space, so it is important to have a basic understanding of how each design feature can affect the platform's interaction with the immune system. In this dissertation, the structure, composition, and biodistribution properties of PA micelles are evaluated for their ability to impact an immune response against a Group A Streptococcus B cell antigen (J8). Through structural design and physical characterization, micelles are shown to self-assemble into either short rod-like or long cylindrical shapes. Analyzing these shape effects on the immune response showed that cylindrical micelles induced higher antibody titers than rod-like micelles, providing evidence that the cylindrical micelle shape is important to induce immune responses and a possible mechanism of action. Shape was also seen to impact the activation profile of dendritic cells, B cells and T cells. Assembly into cylindrical micelles also stabilizes the secondary structure of peptide antigens, which may impact the immune response raised. In composition, the hydrophobic/hydrophilic interface of PA micelles enabled the precise entrapment of amphiphilic adjuvants which were found to not alter micelle formation or shape. These heterogeneous micelles significantly enhanced murine antibody responses when compared to animals vaccinated with non-adjuvanted micelles or soluble J8 peptide supplemented with a classical adjuvant. PAs were also shown to traffic more efficiently to the lymph node than free peptide. Characterization of these design features and their impact on an immune response provides a valuable foundation of knowledge to apply when expanding the peptide amphiphile micelle platform to other vaccine applications.

  4. Staphylococcus aureus innate immune evasion is lineage-specific: a bioinfomatics study.

    PubMed

    McCarthy, Alex J; Lindsay, Jodi A

    2013-10-01

    Staphylococcus aureus is a major human pathogen, and is targeted by the host innate immune system. In response, S. aureus genomes encode dozens of secreted proteins that inhibit complement, chemotaxis and neutrophil activation resulting in successful evasion of innate immune responses. These proteins include immune evasion cluster proteins (IEC; Chp, Sak, Scn), staphylococcal superantigen-like proteins (SSLs), phenol soluble modulins (PSMs) and several leukocidins. Biochemical studies have indicated that genetic variants of these proteins can have unique functions. To ascertain the scale of genetic variation in secreted immune evasion proteins, whole genome sequences of 88 S. aureus isolates, representing 25 clonal complex (CC) lineages, in the public domain were analysed across 43 genes encoding 38 secreted innate immune evasion protein complexes. Twenty-three genes were variable, with between 2 and 15 variants, and the variants had lineage-specific distributions. They include genes encoding Eap, Ecb, Efb, Flipr/Flipr-like, Hla, Hld, Hlg, Sbi, Scin-B/C and 13 SSLs. Most of these protein complexes inhibit complement, chemotaxis and neutrophil activation suggesting that isolates from each S. aureus lineage respond to the innate immune system differently. In contrast, protein complexes that lyse neutrophils (LukSF-PVL, LukMF, LukED and PSMs) were highly conserved, but can be carried on mobile genetic elements (MGEs). MGEs also encode proteins with narrow host-specificities arguing that their acquisition has important roles in host/environmental adaptation. In conclusion, this data suggests that each lineage of S. aureus evades host immune responses differently, and that isolates can adapt to new host environments by acquiring MGEs and the immune evasion protein complexes that they encode. Cocktail therapeutics that targets multiple variant proteins may be the most appropriate strategy for controlling S. aureus infections. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Integrative proteomics, genomics, and translational immunology approaches reveal mutated forms of Proteolipid Protein 1 (PLP1) and mutant-specific immune response in multiple sclerosis.

    PubMed

    Qendro, Veneta; Bugos, Grace A; Lundgren, Debbie H; Glynn, John; Han, May H; Han, David K

    2017-03-01

    In order to gain mechanistic insights into multiple sclerosis (MS) pathogenesis, we utilized a multi-dimensional approach to test the hypothesis that mutations in myelin proteins lead to immune activation and central nervous system autoimmunity in MS. Mass spectrometry-based proteomic analysis of human MS brain lesions revealed seven unique mutations of PLP1; a key myelin protein that is known to be destroyed in MS. Surprisingly, in-depth genomic analysis of two MS patients at the genomic DNA and mRNA confirmed mutated PLP1 in RNA, but not in the genomic DNA. Quantification of wild type and mutant PLP RNA levels by qPCR further validated the presence of mutant PLP RNA in the MS patients. To seek evidence linking mutations in abundant myelin proteins and immune-mediated destruction of myelin, specific immune response against mutant PLP1 in MS patients was examined. Thus, we have designed paired, wild type and mutant peptide microarrays, and examined antibody response to multiple mutated PLP1 in sera from MS patients. Consistent with the idea of different patients exhibiting unique mutation profiles, we found that 13 out of 20 MS patients showed antibody responses against specific but not against all the mutant-PLP1 peptides. Interestingly, we found mutant PLP-directed antibody response against specific mutant peptides in the sera of pre-MS controls. The results from integrative proteomic, genomic, and immune analyses reveal a possible mechanism of mutation-driven pathogenesis in human MS. The study also highlights the need for integrative genomic and proteomic analyses for uncovering pathogenic mechanisms of human diseases. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Nod2 is required for antigen-specific humoral responses against antigens orally delivered using a recombinant Lactobacillus vaccine platform

    PubMed Central

    Bumgardner, Sara A.; Zhang, Lin; LaVoy, Alora S.; Frank, Chad B.; Kajikawa, Akinobu; Klaenhammer, Todd R.

    2018-01-01

    Safe and efficacious orally-delivered mucosal vaccine platforms are desperately needed to combat the plethora of mucosally transmitted pathogens. Lactobacillus spp. have emerged as attractive candidates to meet this need and are known to activate the host innate immune response in a species- and strain-specific manner. For selected bacterial isolates and mutants, we investigated the role of key innate immune pathways required for induction of innate and subsequent adaptive immune responses. Co-culture of murine macrophages with L. gasseri (strain NCK1785), L. acidophilus (strain NCFM), or NCFM-derived mutants—NCK2025 and NCK2031—elicited an M2b-like phenotype associated with TH2 skewing and immune regulatory function. For NCFM, this M2b phenotype was dependent on expression of lipoteichoic acid and S layer proteins. Through the use of macrophage genetic knockouts, we identified Toll-like receptor 2 (TLR2), the cytosolic nucleotide-binding oligomerization domain containing 2 (NOD2) receptor, and the inflammasome-associated caspase-1 as contributors to macrophage activation, with NOD2 cooperating with caspase-1 to induce inflammasome derived interleukin (IL)-1β in a pyroptosis-independent fashion. Finally, utilizing an NCFM-based mucosal vaccine platform with surface expression of human immunodeficiency virus type 1 (HIV-1) Gag or membrane proximal external region (MPER), we demonstrated that NOD2 signaling is required for antigen-specific mucosal and systemic humoral responses. We show that lactobacilli differentially utilize innate immune pathways and highlight NOD2 as a key mediator of macrophage function and antigen-specific humoral responses to a Lactobacillus acidophilus mucosal vaccine platform. PMID:29734365

  7. Vaccination with OVA-bound nanoparticles encapsulating IL-7 inhibits the growth of OVA-expressing E.G7 tumor cells in vivo.

    PubMed

    Toyota, Hiroko; Yanase, Noriko; Yoshimoto, Takayuki; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

    2015-01-01

    Immunotherapy has gained special attention due to its specific effects on tumor cells and systemic action to block metastasis. We recently demonstrated that ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA‑NPs) can manipulate humoral immune responses. In the present study, we aimed to ascertain whether vaccination with OVA-NPs entrapping IL-7 (OVA-NPs-IL-7) are able to induce antitumor immune responses in vivo. Pretreatment with a subcutaneous inoculation of OVA-NPs delayed the growth of thymic lymphoma cells expressing a model tumor antigen OVA (E.G7-OVA), and OVA-NPs-IL-7 substantially blocked the growth of E.G7-OVA tumor cells, although NPs-IL-7 alone had a meager effect, as assessed by the mean tumor size and the percentage of tumor-free mice. However, pretreatment with OVA-NPs-IL-7 failed to reduce the growth of parental thymic tumor cells, suggesting that the antitumor effect was antigen-specific. A tetramer assay revealed that vaccination with OVA-NPs-IL-7 tended to enhance the proportion of cytotoxic T cells (CTLs) specific for OVA. When the tumor-free mice inoculated with OVA-NPs-IL-7 plus EG.7 cells were rechallenged with E.G7-OVA cells, they demonstrated reduced growth compared with that in the control mice. Thus, a single subcutaneous injection of OVA-NPs-IL-7 into mice induced tumor-specific and also memory-like immune responses, resulting in regression of tumor cells. Antigens on NPs entrapping IL-7 would be a promising carrier to develop and enhance immune responses, including humoral and cellular immunity as well as a method of drug delivery to a specific target of interest.

  8. (Neuro)transmitter systems in circulating immune cells: a target of immunopharmacological interventions?

    PubMed

    Tayebati, Seyed Khosrow; Amenta, Francesco

    2008-01-01

    Increasing evidence indicates the existence of an association between nervous and immune systems. The two systems communicate with each-other to maintain immune homeostasis. Activated immune cells secrete cytokines that influence central nervous system activity. Nervous system, through its peripheral and/or autonomic divisions activates output regulating levels of immune cell activity and the subsequent magnitude of an immune response. On the other hand, neurotransmitters, which represent the main substances involved in nerve cell communications, can influence immune function. Immune organs and circulating immune cells express several (neuro)transmitter systems that can be involved in regulating their activity. The expression of neurotransmitter systems by different subsets of circulating immune cells was reviewed. The regulatory role of different families of (neuro)transmitters (catecholamines, 5-hydroxytryptamine, acetylcholine, histamine and neuropeptides) in modulating levels of immune mediators or specific immune responses is discussed.

  9. Exploring a regulatory role for mast cells: 'MCregs'?

    PubMed

    Frossi, Barbara; Gri, Giorgia; Tripodo, Claudio; Pucillo, Carlo

    2010-03-01

    Regulatory cells can mould the fate of the immune response by direct suppression of specific subsets of effector cells, or by redirecting effectors against invading pathogens and infected or neoplastic cells. These functions have been classically, although not exclusively, ascribed to different subsets of T cells. Recently, mast cells have been shown to regulate physiological and pathological immune responses, and thus to act at the interface between innate and adaptive immunity assuming different functions and behaviors at discrete stages of the immune response. Here, we focus on these poorly defined, and sometimes apparently conflicting, functions of mast cells. Copyright 2010 Elsevier Ltd. All rights reserved.

  10. Immune-Specific Expression and Estrogenic Regulation of the Four Estrogen Receptor Isoforms in Female Rainbow Trout (Oncorhynchus mykiss).

    PubMed

    Casanova-Nakayama, Ayako; Wernicke von Siebenthal, Elena; Kropf, Christian; Oldenberg, Elisabeth; Segner, Helmut

    2018-03-21

    Genomic actions of estrogens in vertebrates are exerted via two intracellular estrogen receptor (ER) subtypes, ERα and ERβ, which show cell- and tissue-specific expression profiles. Mammalian immune cells express ERs and are responsive to estrogens. More recently, evidence became available that ERs are also present in the immune organs and cells of teleost fish, suggesting that the immunomodulatory function of estrogens has been conserved throughout vertebrate evolution. For a better understanding of the sensitivity and the responsiveness of the fish immune system to estrogens, more insight is needed on the abundance of ERs in the fish immune system, the cellular ratios of the ER subtypes, and their autoregulation by estrogens. Consequently, the aims of the present study were (i) to determine the absolute mRNA copy numbers of the four ER isoforms in the immune organs and cells of rainbow trout, Oncorhynchus mykiss , and to compare them to the hepatic ER numbers; (ii) to analyse the ER mRNA isoform ratios in the immune system; and, (iii) finally, to examine the alterations of immune ER mRNA expression levels in sexually immature trout exposed to 17β-estradiol (E2), as well as the alterations of immune ER mRNA expression levels in sexually mature trout during the reproductive cycle. All four ER isoforms were present in immune organs-head kidney, spleen-and immune cells from head kidney and blood of rainbow trout, but their mRNA levels were substantially lower than in the liver. The ER isoform ratios were tissue- and cell-specific, both within the immune system, but also between the immune system and the liver. Short-term administration of E2 to juvenile female trout altered the ER mRNA levels in the liver, but the ERs of the immune organs and cells were not responsive. Changes of ER gene transcript numbers in immune organs and cells occurred during the reproductive cycle of mature female trout, but the changes in the immune ER profiles differed from those in the liver and gonads. The correlation between ER gene transcript numbers and serum E2 concentrations was only moderate to low. In conclusion, the low mRNA numbers of nuclear ER in the trout immune system, together with their limited estrogen-responsiveness, suggest that the known estrogen actions on trout immunity may be not primarily mediated through genomic actions, but may involve other mechanisms, such as non-genomic pathways or indirect effects.

  11. Outer membrane vesicles of Gallibacterium anatis induce protective immunity in egg-laying hens.

    PubMed

    Pors, Susanne E; Pedersen, Ida J; Skjerning, Ragnhild Bager; Thøfner, Ida C N; Persson, Gry; Bojesen, Anders M

    2016-11-15

    Gallibacterium anatis causes infections in the reproductive tract of egg-laying hens and induce increased mortality and decreased egg production. New prophylactic measures are needed in order to improve animal welfare and production efficiency. Bacterial outer membrane vesicles (OMVs) have previously shown promising results in protection against infections and we hypothesized that OMVs could serve as an immunogen to protect egg-laying hens against G. anatis. To investigate the immunogenic potential of G. anatis OMVs, two in vivo studies in egg-laying hens were made. The trials assessedthe degree of protection provided by immunization with G. anatis OMV against challenge and the IgY responses in serum after immunization and challenge, respectively. A total of 64 egg-laying hens were included in the trials. OMVs for immunization were produced and purified from a high-producing G. anatis ΔtolR mutant. Challenge was done with G. anatis 12656-12 and evaluated by scoring lesions and bacterial re-isolation rates from peritoneum. Finally, levels of OMV-specific IgY in sera were assayed by ELISA. Immunization with OMVs decreased the lesions scores significantly, while the bacterial re-isolation remained unchanged. Furthermore, a high OMV-specific IgY response was induced by immunization and subsequent challenge of the hens. The results strongly indicate that immunization with G. anatis OMVs provides significant protection against G. anatis challenge and induces specific antibody responses with high titers of OMV-specific IgY in serum. The results therefore show great promise for OMV based vaccines aiming at providing protecting against G. anatis in egg-laying hens. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Zinc in Infection and Inflammation

    PubMed Central

    Gammoh, Nour Zahi; Rink, Lothar

    2017-01-01

    Micronutrient homeostasis is a key factor in maintaining a healthy immune system. Zinc is an essential micronutrient that is involved in the regulation of the innate and adaptive immune responses. The main cause of zinc deficiency is malnutrition. Zinc deficiency leads to cell-mediated immune dysfunctions among other manifestations. Consequently, such dysfunctions lead to a worse outcome in the response towards bacterial infection and sepsis. For instance, zinc is an essential component of the pathogen-eliminating signal transduction pathways leading to neutrophil extracellular traps (NET) formation, as well as inducing cell-mediated immunity over humoral immunity by regulating specific factors of differentiation. Additionally, zinc deficiency plays a role in inflammation, mainly elevating inflammatory response as well as damage to host tissue. Zinc is involved in the modulation of the proinflammatory response by targeting Nuclear Factor Kappa B (NF-κB), a transcription factor that is the master regulator of proinflammatory responses. It is also involved in controlling oxidative stress and regulating inflammatory cytokines. Zinc plays an intricate function during an immune response and its homeostasis is critical for sustaining proper immune function. This review will summarize the latest findings concerning the role of this micronutrient during the course of infections and inflammatory response and how the immune system modulates zinc depending on different stimuli. PMID:28629136

  13. Microbial Degradation of Cellular Kinases Impairs Innate Immune Signaling and Paracrine TNFα Responses

    PubMed Central

    Barth, Kenneth; Genco, Caroline Attardo

    2016-01-01

    The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456

  14. Zinc in Infection and Inflammation.

    PubMed

    Gammoh, Nour Zahi; Rink, Lothar

    2017-06-17

    Micronutrient homeostasis is a key factor in maintaining a healthy immune system. Zinc is an essential micronutrient that is involved in the regulation of the innate and adaptive immune responses. The main cause of zinc deficiency is malnutrition. Zinc deficiency leads to cell-mediated immune dysfunctions among other manifestations. Consequently, such dysfunctions lead to a worse outcome in the response towards bacterial infection and sepsis. For instance, zinc is an essential component of the pathogen-eliminating signal transduction pathways leading to neutrophil extracellular traps (NET) formation, as well as inducing cell-mediated immunity over humoral immunity by regulating specific factors of differentiation. Additionally, zinc deficiency plays a role in inflammation, mainly elevating inflammatory response as well as damage to host tissue. Zinc is involved in the modulation of the proinflammatory response by targeting Nuclear Factor Kappa B (NF-κB), a transcription factor that is the master regulator of proinflammatory responses. It is also involved in controlling oxidative stress and regulating inflammatory cytokines. Zinc plays an intricate function during an immune response and its homeostasis is critical for sustaining proper immune function. This review will summarize the latest findings concerning the role of this micronutrient during the course of infections and inflammatory response and how the immune system modulates zinc depending on different stimuli.

  15. Dietary supplementation with white button mushroom augments the protective immune response to Salmonella vaccine in mice

    USDA-ARS?s Scientific Manuscript database

    We previously showed that dietary white button mushrooms (WBM) enhanced natural killer cell activity and that in vitro WBM supplementation promotes maturation and function of dendritic cells (DC). The current study investigated whether WBM consumption would enhance pathogen-specific immune response ...

  16. Bovine response to lipoarabinomannan vaccination and challenge with Mycobacterium paratuberculosis

    PubMed Central

    Jolly, Ana; Morsella, Claudia; Bass, Laura; Fiorentino, María Andrea; Paolicchi, Fernando Alberto; Mundo, Silvia Leonor

    2013-01-01

    This study aimed to evaluate the immune response in bovines following immunization with a mycobaterial Lipoarabinomannan extract (LAMe) and the effect of Map challenge. LAMe vaccine induced specific antibody levels that diminished after the challenge and affected Map excretion at least for 100 days thereafter. PMID:24294248

  17. Antibody Secreting Cell Responses following Vaccination with Bivalent Oral Cholera Vaccine among Haitian Adults.

    PubMed

    Matias, Wilfredo R; Falkard, Brie; Charles, Richelle C; Mayo-Smith, Leslie M; Teng, Jessica E; Xu, Peng; Kováč, Pavol; Ryan, Edward T; Qadri, Firdausi; Franke, Molly F; Ivers, Louise C; Harris, Jason B

    2016-06-01

    The bivalent whole-cell (BivWC) oral cholera vaccine (Shanchol) is effective in preventing cholera. However, evaluations of immune responses following vaccination with BivWC have been limited. To determine whether BivWC induces significant mucosal immune responses, we measured V. cholerae O1 antigen-specific antibody secreting cell (ASC) responses following vaccination. We enrolled 24 Haitian adults in this study, and administered doses of oral BivWC vaccine 14 days apart (day 0 and day 14). We drew blood at baseline, and 7 days following each vaccine dose (day 7 and 21). Peripheral blood mononuclear cells (PBMCs) were isolated, and ASCs were enumerated using an ELISPOT assay. Significant increases in Ogawa (6.9 cells per million PBMCs) and Inaba (9.5 cells per million PBMCs) OSP-specific IgA ASCs were detected 7 days following the first dose (P < 0.001), but not the second dose. The magnitude of V. cholerae-specific ASC responses did not appear to be associated with recent exposure to cholera. ASC responses measured against the whole lipolysaccharide (LPS) antigen and the OSP moiety of LPS were equivalent, suggesting that all or nearly all of the LPS response targets the OSP moiety. Immunization with the BivWC oral cholera vaccine induced ASC responses among a cohort of healthy adults in Haiti after a single dose. The second dose of vaccine resulted in minimal ASC responses over baseline, suggesting that the current dosing schedule may not be optimal for boosting mucosal immune responses to V. cholerae antigens for adults in a cholera-endemic area.

  18. Exosomal pMHC-I complex targets T cell-based vaccine to directly stimulate CTL responses leading to antitumor immunity in transgenic FVBneuN and HLA-A2/HER2 mice and eradicating trastuzumab-resistant tumor in athymic nude mice.

    PubMed

    Wang, Lu; Xie, Yufeng; Ahmed, Khawaja Ashfaque; Ahmed, Shahid; Sami, Amer; Chibbar, Rajni; Xu, Qingyong; Kane, Susan E; Hao, Siguo; Mulligan, Sean J; Xiang, Jim

    2013-07-01

    One of the major obstacles in human epidermal growth factor receptor 2 (HER2)-specific trastuzumab antibody immunotherapy of HER2-positive breast cancer is the development of trastuzumab resistance, warranting the search for other therapeutic strategies. Using mouse models, we previously demonstrated that ovalbumin (OVA)-specific dendritic cell (DC)-released exosome (EXOOVA)-targeted CD4(+) T cell-based (OVA-TEXO) vaccine stimulates efficient cytotoxic T lymphocyte (CTL) responses via exosomal peptide/major histocompatibility complex (pMHC)-I, exosomal CD80 and endogenous IL-2 signaling; and long-term CTL memory by means of via endogenous CD40L signaling. In this study, using two-photon microscopy, we provide the first visual evidence on targeting OVA-TEXO to cognate CD8(+) T cells in vivo via exosomal pMHC-I complex. We prepared HER2/neu-specific Neu-TEXO and HER2-TEXO vaccines using adenoviral vector (AdVneu and AdVHER2)-transfected DC (DCneu and DCHER2)-released EXOs (EXOneu and EXOHER2), and assessed their stimulatory effects on HER2/neu-specific CTL responses and antitumor immunity. We demonstrate that Neu-TEXO vaccine is capable of stimulating efficient neu-specific CTL responses, leading to protective immunity against neu-expressing Tg1-1 breast cancer in all 6/6 transgenic (Tg) FVBneuN mice with neu-specific self-immune tolerance. We also demonstrate that HER2-TEXO vaccine is capable of inducing HER2-specific CTL responses and protective immunity against transgene HLA-A2(+)HER2(+) BL6-10A2/HER2 B16 melanoma in 2/8 double Tg HLA-A2/HER2 mice with HER2-specific self-immune tolerance. The remaining 6/8 mice had significantly prolonged survival. Furthermore, we demonstrate that HER2-TEXO vaccine stimulates responses of CD8(+) T cells capable of not only inducing killing activity to HLA-A2(+)HER2(+) BL6-10A2/HER2 melanoma and trastuzumab-resistant BT474A2 breast cancer cells in vitro but also eradicating 6-day palpable HER2(+) BT474A2 breast cancer (3-4 mm in diameter) in athymic nude mice. Therefore, the novel T cell-based HER2-TEXO vaccine may provide a new therapeutic alternative for women with HER2(+) breast cancer, especially for trastuzumab-resistant HER2(+) breast cancer patients.

  19. Immunity to airborne challenge with Venezuelan equine encephalitis virus develops rapidly after immunization with the attenuated vaccine strain TC-83.

    PubMed

    Phillpotts, R J

    1999-05-14

    Mice vaccinated subcutaneously with the attenuated vaccine strain of Venezuelan equine encephalitis virus (VEEV) rapidly develop immunity to subcutaneous or airborne challenge with virulent VEEV. The specificity of this immune response was demonstrated by challenge with a heterologous virus (St. Louis encephalitis virus). Examination of the levels of VEEV-specific antibody classes in serum and respiratory secretions suggested that the rapid development of immunity was coincident with the appearance of specific IgM and IgG (but not IgA) in the respiratory tract. In order to confirm the role of respiratory tract antibody, mice were passively immunised either intraperitoneally or intranasally with polyclonal VEEV-specific IgG. Intranasal administration of specific IgG significantly enhanced protection against airborne challenge. These results confirm the need to emphasise local antibody production in the development of improved VEEV vaccines.

  20. Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).

    PubMed

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis

    2007-03-07

    The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.

  1. Humoral Immune Response against Neural Antigens and Its Effects on Cognition in Lung Cancer Patients.

    PubMed

    Rybacka-Mossakowska, J; Ramlau, R; Gazdulska, J; Gołda-Gocka, I; Kozubski, W; Michalak, S

    2016-01-01

    Cognitive impairment develops as a clinical manifestation of immune-mediated indirect effects of malignancy in lung cancer patients. This study aimed to evaluate the effects of humoral immune response on cognition in lung cancer patients. Fifty-one lung cancer patients were subjected to neurological examination: Mini Mental State Examination (MMSE), Trail Making Test (TMT), and Hamilton scale. The Psychology Experiment Building Language software was used for the evaluation of digit span, simple reaction time (SRT), and choice reaction time (CRT) tests. Serum samples were tested for the presence of onconeuronal antibodies and antineural antibodies. The results demonstrate that autoantibodies were found in 31 % patients. MMSE scores were lower (26.7 ± 2.7) in seropositive patients than in seronegative subjects (28.7 ± 1.2; p = 0.013). Executive functions were also influenced by the presence of autoantibodies. The humoral immune response in lung cancer patients affected both SRT and CRT. We conclude that the humoral immune response in lung cancer patients is associated with cognitive impairment. Cognitive impairment is associated with both specific reactions against onconeuronal or antineural antigens and non-organ specific reactions against nucleosome antigens.

  2. Gap junctions in cells of the immune system: structure, regulation and possible functional roles.

    PubMed

    Sáez, J C; Brañes, M C; Corvalán, L A; Eugenín, E A; González, H; Martínez, A D; Palisson, F

    2000-04-01

    Gap junction channels are sites of cytoplasmic communication between contacting cells. In vertebrates, they consist of protein subunits denoted connexins (Cxs) which are encoded by a gene family. According to their Cx composition, gap junction channels show different gating and permeability properties that define which ions and small molecules permeate them. Differences in Cx primary sequences suggest that channels composed of different Cxs are regulated differentially by intracellular pathways under specific physiological conditions. Functional roles of gap junction channels could be defined by the relative importance of permeant substances, resulting in coordination of electrical and/or metabolic cellular responses. Cells of the native and specific immune systems establish transient homo- and heterocellular contacts at various steps of the immune response. Morphological and functional studies reported during the last three decades have revealed that many intercellular contacts between cells in the immune response present gap junctions or "gap junction-like" structures. Partial characterization of the molecular composition of some of these plasma membrane structures and regulatory mechanisms that control them have been published recently. Studies designed to elucidate their physiological roles suggest that they might permit coordination of cellular events which favor the effective and timely response of the immune system.

  3. Passive Antibody Administration (Immediate Immunity) as a Specific Defense Against Biological Weapons

    PubMed Central

    2002-01-01

    The potential threat of biological warfare with a specific agent is proportional to the susceptibility of the population to that agent. Preventing disease after exposure to a biological agent is partially a function of the immunity of the exposed individual. The only available countermeasure that can provide immediate immunity against a biological agent is passive antibody. Unlike vaccines, which require time to induce protective immunity and depend on the host’s ability to mount an immune response, passive antibody can theoretically confer protection regardless of the immune status of the host. Passive antibody therapy has substantial advantages over antimicrobial agents and other measures for postexposure prophylaxis, including low toxicity and high specific activity. Specific antibodies are active against the major agents of bioterrorism, including anthrax, smallpox, botulinum toxin, tularemia, and plague. This article proposes a biological defense initiative based on developing, producing, and stockpiling specific antibody reagents that can be used to protect the population against biological warfare threats. PMID:12141970

  4. Immune modulation with high-dose heat-shock protein gp96: therapy of murine autoimmune diabetes and encephalomyelitis.

    PubMed

    Chandawarkar, Rajiv Y; Wagh, Mihir S; Kovalchin, Joseph T; Srivastava, Pramod

    2004-04-01

    Immunization with heat-shock protein (HSP) gp96 elicits protective immunity to the cancer or virus-infected cells from which it is derived. Low doses of gp96 generate immunity, while doses 10 times the immunizing dose do not. We show here that injection of high doses of gp96 generates CD4(+) T cells that down-regulate a variety of ongoing immune responses. Immunization with high doses of gp96 prevents myelin basic protein- or proteolipid protein-induced autoimmune encephalomyelitis in SJL mice and the onset of diabetes in non-obese diabetic mice. The suppression of immune response can be adoptively transferred with CD4(+) cells and does not partition with the CD25 phenotype. The immunomodulatory properties of gp96 (and possibly other HSP) may be used for antigen-specific activation or suppression of cellular immune responses. The latter may form the basis for novel immunotherapies for autoimmune diseases.

  5. Immune Responses of a Native and an Invasive Bird to Buggy Creek Virus (Togaviridae: Alphavirus) and Its Arthropod Vector, the Swallow Bug (Oeciacus vicarius)

    PubMed Central

    Fassbinder-Orth, Carol A.; Barak, Virginia A.; Brown, Charles R.

    2013-01-01

    Invasive species often display different patterns of parasite burden and virulence compared to their native counterparts. These differences may be the result of variability in host-parasite co-evolutionary relationships, the occurrence of novel host-parasite encounters, or possibly innate differences in physiological responses to infection between invasive and native hosts. Here we examine the adaptive, humoral immune responses of a resistant, native bird and a susceptible, invasive bird to an arbovirus (Buggy Creek virus; Togaviridae: Alphavirus) and its ectoparasitic arthropod vector (the swallow bug; Oeciacus vicarius). Swallow bugs parasitize the native, colonially nesting cliff swallow (Petrochelidon pyrrhonota) and the introduced house sparrow (Passer domesticus) that occupies nests in cliff swallow colonies. We measured levels of BCRV-specific and swallow bug-specific IgY levels before nesting (prior to swallow bug exposure) and after nesting (after swallow bug exposure) in house sparrows and cliff swallows in western Nebraska. Levels of BCRV-specific IgY increased significantly following nesting in the house sparrow but not in the cliff swallow. Additionally, house sparrows displayed consistently higher levels of swallow bug-specific antibodies both before and after nesting compared to cliff swallows. The higher levels of BCRV and swallow bug specific antibodies detected in house sparrows may be reflective of significant differences in both antiviral and anti-ectoparasite immune responses that exist between these two avian species. To our knowledge, this is the first study to compare the macro- and microparasite-specific immune responses of an invasive and a native avian host exposed to the same parasites. PMID:23460922

  6. Enhanced Antibody Responses in a Novel NOG Transgenic Mouse with Restored Lymph Node Organogenesis

    PubMed Central

    Takahashi, Takeshi; Katano, Ikumi; Ito, Ryoji; Goto, Motohito; Abe, Hayato; Mizuno, Seiya; Kawai, Kenji; Sugiyama, Fumihiro; Ito, Mamoru

    2018-01-01

    Lymph nodes (LNs) are at the center of adaptive immune responses. Various exogenous substances are transported into LNs and a series of immune responses ensue after recognition by antigen–specific lymphocytes. Although humanized mice have been used to reconstitute the human immune system, most lack LNs due to deficiency of the interleukin (IL)-2Rγ gene (cytokine common γ chain, γc). In this study, we established a transgenic strain, NOG-pRORγt-γc, in the NOD/shi-scid-IL-2Rγnull (NOG) background, in which the γc gene was expressed in a lymph-tissue inducer (LTi) lineage by the endogenous promoter of RORγt. In this strain, LN organogenesis was normalized and the number of human T cells substantially increased in the periphery after reconstitution of the human immune system by human hematopoietic stem cell transplantation. The distribution of human T cells differed between NOG-pRORγt-γc Tg and NOG-non Tg mice. About 40% of human T cells resided in LNs, primarily the mesenteric LNs. The LN-complemented humanized mice exhibited antigen-specific immunoglobulin G responses together and an increased number of IL-21+–producing CD4+ T cells in LNs. This novel mouse strain will facilitate recapitulation of human immune responses. PMID:29387068

  7. Immune-driven recombination and loss of control after HIV superinfection.

    PubMed

    Streeck, Hendrik; Li, Bin; Poon, Art F Y; Schneidewind, Arne; Gladden, Adrianne D; Power, Karen A; Daskalakis, Demetre; Bazner, Suzane; Zuniga, Rosario; Brander, Christian; Rosenberg, Eric S; Frost, Simon D W; Altfeld, Marcus; Allen, Todd M

    2008-08-04

    After acute HIV infection, CD8(+) T cells are able to control viral replication to a set point. This control is often lost after superinfection, although the mechanism behind this remains unclear. In this study, we illustrate in an HLA-B27(+) subject that loss of viral control after HIV superinfection coincides with rapid recombination events within two narrow regions of Gag and Env. Screening for CD8(+) T cell responses revealed that each of these recombination sites (approximately 50 aa) encompassed distinct regions containing two immunodominant CD8 epitopes (B27-KK10 in Gag and Cw1-CL9 in Env). Viral escape and the subsequent development of variant-specific de novo CD8(+) T cell responses against both epitopes were illustrative of the significant immune selection pressures exerted by both responses. Comprehensive analysis of the kinetics of CD8 responses and viral evolution indicated that the recombination events quickly facilitated viral escape from both dominant WT- and variant-specific responses. These data suggest that the ability of a superinfecting strain of HIV to overcome preexisting immune control may be related to its ability to rapidly recombine in critical regions under immune selection pressure. These data also support a role for cellular immune pressures in driving the selection of new recombinant forms of HIV.

  8. Serum Antibody Response to Koala Retrovirus Antigens Varies in Free-Ranging Koalas ( Phascolarctos cinereus ) in Australia: Implications for Vaccine Design.

    PubMed

    Waugh, Courtney; Gillett, Amber; Polkinghorne, Adam; Timms, Peter

    2016-04-28

    Little is known about the immune response in the koala ( Phascolarctos cinereus ) to its retroviruses. Koala retroviruses (KoRVs) have been linked to neoplasia in wild and captive koalas, but there is no treatment available. We tested the KoRV-specific serum immunoglobulin G antibody response in nonimmunized and immunized koalas.

  9. B-Cell Responses to Pregnancy-Restricted and -Unrestricted Plasmodium falciparum Erythrocyte Membrane Protein 1 Antigens in Ghanaian Women Naturally Exposed to Malaria Parasites

    PubMed Central

    Ampomah, Paulina; Stevenson, Liz; Ofori, Michael F.; Barfod, Lea

    2014-01-01

    Protective immunity to Plasmodium falciparum malaria acquired after natural exposure is largely antibody mediated. IgG-specific P. falciparum EMP1 (PfEMP1) proteins on the infected erythrocyte surface are particularly important. The transient antibody responses and the slowly acquired protective immunity probably reflect the clonal antigenic variation and allelic polymorphism of PfEMP1. However, it is likely that other immune-evasive mechanisms are also involved, such as interference with formation and maintenance of immunological memory. We measured PfEMP1-specific antibody levels by enzyme-linked immunosorbent assay (ELISA) and memory B-cell frequencies by enzyme-linked immunosorbent spot (ELISPOT) assay in a cohort of P. falciparum-exposed nonpregnant Ghanaian women. The antigens used were a VAR2CSA-type PfEMP1 (IT4VAR04) with expression restricted to parasites infecting the placenta, as well as two commonly recognized PfEMP1 proteins (HB3VAR06 and IT4VAR60) implicated in rosetting and not pregnancy restricted. This enabled, for the first time, a direct comparison in the same individuals of immune responses specific for a clinically important parasite antigen expressed only during well-defined periods (pregnancy) to responses specific for comparable antigens expressed independent of pregnancy. Our data indicate that PfEMP1-specific B-cell memory is adequately acquired even when antigen exposure is infrequent (e.g., VAR2CSA-type PfEMP1). Furthermore, immunological memory specific for VAR2CSA-type PfEMP1 can be maintained for many years without antigen reexposure and after circulating antigen-specific IgG has disappeared. The study provides evidence that natural exposure to P. falciparum leads to formation of durable B-cell immunity to clinically important PfEMP1 antigens. This has encouraging implications for current efforts to develop PfEMP1-based vaccines. PMID:24566620

  10. The Effect of Differentially Designed Fusion Proteins to Elicit Efficient Anti-human Thyroid Stimulating Hormone Immune Responses.

    PubMed

    Mard-Soltani, Maysam; Rasaee, Mohamad Javad; Khalili, Saeed; Sheikhi, Abdol-Karim; Hedayati, Mehdi; Ghaderi-Zefrehi, Hossein; Alasvand, Milad

    2018-04-01

    The production of human thyroid stimulating hormone (hTSH) immunoassays requires specific antibodies against hTSH which is a cumbersome process. Therefore, producing specific polyclonal antibodies against engineered recombinant fusion hTSH antigens would be of great significance. The best immunogenic region of the hTSH was selected based on in silico analyses and equipped with two different fusions. Standard methods were used for protein expression, purification, verification, structural evaluation, and immunizations of the white New Zealand rabbits. Ultimately, immunized serums were used for antibody titration, purification and characterization (specificity, sensitivity and cross reactivity). The desired antigens were successfully designed, sub-cloned, expressed, confirmed and used for in vivo immunization. Structural analyses indicated that only the bigger antigen has showed changed 2 dimensional (2D) and 3D structural properties in comparison to the smaller antigen. The raised polyclonal antibodies were capable of specific and sensitive hTSH detection, while the cross reactivity with the other members of the glycoprotein hormone family was minimum and negligible. The fusion which was solely composed of the tetanus toxin epitopes led to better protein folding and was capable of immunizing the host animals resulting into high titer antibody. Therefore, the minimal fusion sequences seem to be more effective in eliciting specific antibody responses.

  11. Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease

    NASA Astrophysics Data System (ADS)

    Sun, Jun; Deem, Michael

    2006-03-01

    The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.

  12. Different mechanisms for Arabidopsis thaliana hybrid necrosis cases inferred from temperature responses.

    PubMed

    Muralidharan, S; Box, M S; Sedivy, E L; Wigge, P A; Weigel, D; Rowan, B A

    2014-11-01

    Temperature is a major determinant of plant growth, development and success. Understanding how plants respond to temperature is particularly relevant in a warming climate. Plant immune responses are often suppressed above species-specific critical temperatures. This is also true for intraspecific hybrids of Arabidopsis thaliana that express hybrid necrosis due to inappropriate activation of the immune system caused by epistatic interactions between alleles from different genomes. The relationship between temperature and defence is unclear, largely due to a lack of studies that assess immune activation over a wide range of temperatures. To test whether the temperature-based suppression of ectopic immune activation in hybrids exhibits a linear or non-linear relationship, we characterised the molecular and morphological phenotypes of two different necrotic A. thaliana hybrids over a range of ecologically relevant temperatures. We found both linear and non-linear responses for expression of immunity markers and for morphological defects depending on the underlying genetic cause. This suggests that the influence of temperature on the trade-off between immunity and growth depends on the specific defence components involved. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  13. Immunoprotection of recombinant Eg.P29 against Echinococcus granulosus in sheep.

    PubMed

    Wang, Hao; Li, Zihua; Gao, Fu; Zhao, Jiaqing; Zhu, Mingxing; He, Xin; Niu, Nan; Zhao, Wei

    2016-06-01

    This study aims to investigate the immunoprotection of recombinant Eg.P29 (rEg.P29) vaccine and analyze the underlying mechanism in sheep. Three groups of male sheep were immunized subcutaneously with rEg.P29 and PBS, Freund's complete adjuvant as controls, respectively. After prime-boost vaccination, the sheep were challenged with encapsulated Echinococcus granulosus eggs. The percentage of protection in sheep was determined 36 weeks after the infection. Humoral immune response was analyzed for specific IgG, IgG1, IgG2, IgM and IgE levels. Moreover, cytokines including interferon (IFN)-γ, interleukin (IL)-2, IL-4,and IL-10 were also evaluated. Immunization with rEg.P29 induced protective immune responses up to 94.5 %, compared with immunoadjuvant group. The levels of specific IgG, IgG1, IgG2, and IgE as well as IFN-γ, IL-2, and IL-4 significantly increased after two immunizations (P < 0.05); however, the levels of IgM and IL-10 did not show difference. rEg.P29 showed Immunoprotection and induced Th1 and Th2 immune responses; hence, rEg.P29 is a potential vaccine for E. granulosus infection.

  14. Tricking the balance: NK cells in anti-cancer immunity.

    PubMed

    Pahl, Jens; Cerwenka, Adelheid

    2017-01-01

    Natural Killer (NK) cells are classically considered innate immune effector cells involved in the first line of defense against infected and malignant cells. More recently, NK cells have emerged to acquire properties of adaptive immunity in response to certain viral infections such as expansion of specific NK cell subsets and long-lasting virus-specific responses to secondary challenges. NK cells distinguish healthy cells from abnormal cells by measuring the net input of activating and inhibitory signals perceived from target cells through NK cell surface receptors. Acquisition of activating ligands in combination with reduced expression of MHC class I molecules on virus-infected and cancer cells activates NK cell cytotoxicity and release of immunostimulatory cytokines like IFN-γ. In the cancer microenvironment however, NK cells become functionally impaired by inhibitory factors produced by immunosuppressive immune cells and cancer cells. Here we review recent progress on the role of NK cells in cancer immunity. We describe regulatory factors of the tumor microenvironment on NK cell function which determine cancer cell destruction or escape from immune recognition. Finally, recent strategies that focus on exploiting NK cell anti-cancer responses for immunotherapeutic approaches are outlined. Copyright © 2015 Elsevier GmbH. All rights reserved.

  15. Development of a novel, guinea pig-specific IFN-γ ELISPOT assay and characterization of guinea pig cytomegalovirus GP83-specific cellular immune responses following immunization with a modified vaccinia virus Ankara (MVA)-vectored GP83 vaccine.

    PubMed

    Gillis, Peter A; Hernandez-Alvarado, Nelmary; Gnanandarajah, Josephine S; Wussow, Felix; Diamond, Don J; Schleiss, Mark R

    2014-06-30

    The guinea pig (Cavia porcellus) provides a useful animal model for studying the pathogenesis of many infectious diseases, and for preclinical evaluation of vaccines. However, guinea pig models are limited by the lack of immunological reagents required for characterization and quantification of antigen-specific T cell responses. To address this deficiency, an enzyme-linked immunospot (ELISPOT) assay for guinea pig interferon (IFN)-γ was developed to measure antigen/epitope-specific T cell responses to guinea pig cytomegalovirus (GPCMV) vaccines. Using splenocytes harvested from animals vaccinated with a modified vaccinia virus Ankara (MVA) vector encoding the GPCMV GP83 (homolog of human CMV pp65 [gpUL83]) protein, we were able to enumerate and map antigen-specific responses, both in vaccinated as well as GPCMV-infected animals, using a panel of GP83-specific peptides. Several potential immunodominant GP83-specific peptides were identified, including one epitope, LGIVHFFDN, that was noted in all guinea pigs that had a detectable CD8+ response to GP83. Development of a guinea pig IFN-γ ELISPOT should be useful in characterization of additional T cell-specific responses to GPCMV, as well as other pathogens. This information in turn can help focus future experimental evaluation of immunization strategies, both for GPCMV as well as for other vaccine-preventable illnesses studied in the guinea pig model. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Increased long-term immunity to Bacillus anthracis protective antigen in mice immunized with a CIA06B-adjuvanted anthrax vaccine.

    PubMed

    Wui, Seo Ri; Han, Ji Eun; Kim, Yeon Hee; Rhie, Gi-eun; Lee, Na Gyong

    2013-04-01

    Anthrax is an acute infectious disease caused by Bacillus anthracis. We previously reported that the adjuvant CIA06B, which consists of TLR4 agonist CIA05 and aluminum hydroxide (alum), enhanced the immune response to anthrax protective antigen (PA) in mice. This study was carried out to determine whether CIA06B can enhance long-term immune responses to PA in mice. BALB/c mice were immunized intramuscularly three times at 2-week intervals with recombinant PA alone or PA combined with alum or CIA06B. At 8 and 24 weeks post-immunization, the immunological responses including serum anti-PA IgG antibody titer, toxin-neutralizing antibody titer, splenic cytokine secretion and the frequency of PA-specific memory B cells were assessed. Compared with mice injected with PA alone or PA plus alum, mice injected with PA plus CIA06B had higher titers of serum anti-PA IgG antibodies, and higher frequencies of PA-specific memory B cells and interferon-γ secreting cells. Furthermore, anti-PA antibodies induced by CIA06B were more effective in neutralizing anthrax toxin. These results demonstrated that CIA06B is capable of providing long-term immunity when used as an adjuvant in a PA-based anthrax vaccine.

  17. Immunosuppressive activity of tilmicosin on the immune responses in mice.

    PubMed

    Guan, Shuang; Song, Yu; Guo, Weixiao; Chu, Xiao; Zhang, Xiaozhe; Wang, Dacheng; Lu, Jing; Deng, Xuming

    2011-06-01

    Tilmicosin, a semi-synthetic macrolide antibiotic that is only used in the veterinary clinic, was evaluated for its immunosuppressive activity on the immune responses to ovalbumin (OVA) in mice. Tilmicosin suppressed concanavalin A (Con A)- and lipopolysaccharide (LPS)-stimulated splenocyte proliferation in vitro. BALB/c mice were immunized subcutaneously with OVA on day 1 and 4. Beginning on the day of boosting immunization, the mice were administered intraperitoneally with tilmicosin at a single dose of 10, 30, and 90 mg/kg for 10 consecutive days. On day 14, blood samples were collected for measuring specific total-immunoglobulin G (total-IgG), IgG1, IgG2b, and splenocytes were harvested for determining lymphocyte proliferation and interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4 production. The results demonstrated that tilmicosin could significantly suppress Con A-induced splenocyte proliferation in a dose-dependent manner, decrease LPS-and OVA-induced splenocyte proliferation only at high concentration, produced less IL-2, IL-4, and IFN-γ as compared to the control in the OVA-immunized mice. Moreover, the OVA-specific IgG, IgG1, and IgG2b levels in the OVA-immunized mice were reduced by tilmicosin. These results suggest that tilmicosin could suppress the cellular and humoral immune response in mice.

  18. Acquired immunity to amyloodiniosis is associated with an antibody response.

    PubMed

    Cobb, C S; Levy, M G; Noga, E J

    1998-10-08

    The dinoflagellate Amyloodinium ocellatum, which causes amyloodiniosis or 'marine velvet disease', is one of the most serious ectoparasitic diseases plaguing warmwater marine fish culture worldwide. We report that tomato clownfish Amphiprion frenatus develop strong immunity to Amyloodinium ocellatum infection following repeated nonlethal challenges and that specific antibodies are associated with this response. Reaction of immune fish antisera against dinospore and trophont-derived antigens in Western blots indicated both shared and stage-specific antibody-antigen reactions. A mannan-binding-protein affinity column was used to isolate IgM-like antibody from A. frenatus serum. The reduced Ig consisted of one 70 kD heavy chain and one 32 kD light chain with an estimated molecular weight of 816 kD for the native molecule. Immunoglobulin (Ig) isolated from immune but not non-immune fish serum significantly inhibited parasite infectivity in vitro. An enzyme-linked immunosorbent assay (ELISA) was developed using polyclonal rabbit antibody produced against affinity-purified A. frenatus Ig. Anti-Amyloodinium serum antibody was not always detectable in immune fish, although serum antibody titers in immune fish increased after repeated exposure to the parasite. These results suggest that there may be a localized antibody response in skin/gill epithelial tissue, although antibody was rarely detected in skin mucus.

  19. Protective Cellular Immunity Against Influenza Virus Induced by Plasmid Inoculation of Newborn Mice

    PubMed Central

    Bot, Adrian; Bot, Simona; García-Sastre, Adolfo

    1998-01-01

    Neonate organisms display an intrinsic disability to mount effective immune responses to infectious agents or conventional vaccines. Whereas low. doses of antigens trigger a suboptimal response, higher doses are frequently associated with tolerance induction. We investigated the ability of a plasmid-expressing nucleoprotein of influenza virus to prime a specific cellular immune response when administered to newborn mice. We found that persistent exposure to antigen following plasmid inoculation of neonates leads to a vigorous priming of specific CTLs rather than tolerance induction. The CTLs were cross-reactive against multiple strains of type A influenza viruses and produced IFNγ but no IL-4. The immunity triggered by plasmid inoculation of neonates was protective in terms of pulmonary virus clearance as well as survival rate following lethal challenge with influenza virus. Whereas the persistence of the plasmid at the site of injection was readily demonstrable in adult mice at 3 months after inoculation, mice immunized as newborns displayed no plasmid at 3 months and very little at 1 month after injection. Thus, DNA-based immunization of neonates may prove an effective and safe vaccination strategy for induction of cellular immunity against microbes that cause serious infectious diseases in the early period of life. PMID:9851359

  20. Enhanced mucosal and systemic immune response with intranasal immunization of mice with HIV peptides entrapped in PLG microparticles in combination with Ulex Europaeus-I lectin as M cell target.

    PubMed

    Manocha, Monika; Pal, Pramod Chandra; Chitralekha, K T; Thomas, Beena Elizabeth; Tripathi, Vinita; Gupta, Siddhartha Dutta; Paranjape, Ramesh; Kulkarni, Smita; Rao, D Nageswara

    2005-12-01

    The predominant route of HIV infection is through the sexual transmission via M cells. Most of the peptide and protein vaccines show poor transport across the epithelial barrier and are commonly administered by parenteral route. In the present study four HIV peptides from envelope (gp 41-LZ (leucine zipper), gp 41-FD (fusion domain) and gp120-C2) and regulatory (Nef) region in poly lactic-co-glycolide (PLG) micro-particle delivery were evaluated in mice of outbred and with different genetic background to compare immune response versus MHC restriction. Out of the combinational and single routes of immunization attempted, the single route maintained the IgG, IgA and sIgA in sera and washes for longer duration as compared to combinational routes in which the response was declined. The study demonstrated that single intranasal immunization offered significantly higher immune response (p<0.05) over oral and rectal mucosal routes in terms of inducing systemic as well as mucosal response. Also, the specific activity measurement of IgA and IgG in sera and sIgA in washes were correlating to the antibody titers. However, the intramuscular route of immunization generated systemic response only. The entrapment of plant lectin UEA-1 a ligand specific for M cells in micro-particle further enhanced the immune response in all the mucosal routes. The IgG isotypes generated were of IgG1 and IgG2a/2b in sera for all the peptides. The T cell proliferation response study with and without UEA-1 lectin in micro-particles showed significantly high (p<0.05) stimulation index (SI) with intranasal immunization for all the peptides from cells collected from spleen (SP), peyer's patches (PP) and lamina propria (LP) with SI in the order LP cells>PP>or=SP. The cytokine measurement profile of IL-2, IFN-gamma and IL-6 and low levels of IL-4 in the cultural supernatants of SP, PP and LP showed mixed CD4(+) Th1 and Th2 immune response. The p24 assay showed high percent inhibition of HIV-IIIB virus with sera and washes obtained from intranasal route. Thus, overall the study highlighted the combination of UEA-1 lectin with HIV peptides in micro-particles through intranasal immunization generated systemic as well as mucosal immune response.

  1. Study Design to Test the Hypothesis That Long-Term Space Travel Harms the Human and Animal Immune Systems

    NASA Technical Reports Server (NTRS)

    Shearer, William T.; Lugg, Desmond J.; Ochs, H. D.; Pierson, Duane L.; Reuben, James M.; Rosenblatt, Howard M.; Sams, Clarence; Smith, C. Wayne; Smith, E. Obrian; Smolen, James E.

    1999-01-01

    The potential threat of immunosuppression and abnormal inflammatory responses in long-term space travel, leading to unusual predilection for opportunistic infections, malignancy, and death, is of ma or concern to the National Aeronautics and Space Administration (NASA) Program. This application has been devised to seek answers to questions of altered immunity in space travel raised by previous investigations spanning 30-plus years. We propose to do this with the help of knowledge gained by the discovery of the molecular basis of many primary and secondary immunodeficiency diseases and by application of molecular and genetic technology not previously available. Two areas of immunity that previously received little attention in space travel research will be emphasized: specific antibody responses and non-specific inflammation and adhesion. Both of these areas of research will not only add to the growing body of information on the potential effects of space travel on the immune system, but be able to delineate any functional alterations in systems important for antigen presentation, specific immune memory, and cell:cell and cell:endothelium interactions. By more precisely defining molecular dysfunction of components of the immune system, it is hoped that targeted methods of prevention of immune damage in space could be devised.

  2. Protective antitumor activity through dendritic cell immunization is mediated by NK cell as well as CTL activation.

    PubMed

    Kim, K D; Kim, J K; Kim, S J; Choe, I S; Chung, T H; Choe, Y K; Lim, J S

    1999-08-01

    Dendritic cells (DCs) are potent professional antigen-presenting cells (APC) capable of inducing the primary T cell response to antigen. Although tumor cells express target antigens, they are incapable of stimulating a tumor-specific immune response due to a defect in the costimulatory signal that is required for optimal activation of T cells. In this work, we describe a new approach using tumor-DC coculture to improve the antigen presenting capacity of tumor cells, which does not require a source of tumor-associated antigen. Immunization of a weakly immunogenic and progressive tumor cocultured with bone marrow-derived DCs generated an effective tumor vaccine. Immunization with the cocultured DCs was able to induce complete protective immunity against tumor challenges and was effective for the induction of tumor-specific CTL (cytotoxic T lymphocyte) activity. Furthermore, high NK cell activity was observed in mice in which tumors were rejected. In addition, immunization with tumor-pulsed DCs induced delayed tumor growth, but not tumor eradication in tumor-bearing mice. Our results demonstrate that coculture of DCs with tumors generated antitumor immunity due to the NK cell activation as well as tumor-specific T cell. This approach would be useful for designing tumor vaccines using DCs when the information about tumor antigens is limited.

  3. Innate lymphoid cells in tissue homeostasis and diseases.

    PubMed

    Ignacio, Aline; Breda, Cristiane Naffah Souza; Camara, Niels Olsen Saraiva

    2017-08-18

    Innate lymphoid cells (ILCs) are the most recently discovered family of innate immune cells. They are a part of the innate immune system, but develop from the lymphoid lineage. They lack pattern-recognition receptors and rearranged receptors, and therefore cannot directly mediate antigen specific responses. The progenitors specifically associated with the ILCs lineage have been uncovered, enabling the distinction between ILCs and natural killer cells. Based on the requirement of specific transcription factors and their patterns of cytokine production, ILCs are categorized into three subsets (ILC1, ILC2 and ILC3). First observed in mucosal surfaces, these cell populations interact with hematopoietic and non-hematopoietic cells throughout the body during homeostasis and diseases, promoting immunity, commensal microbiota tolerance, tissue repair and inflammation. Over the last 8 years, ILCs came into the spotlight as an essential cell type able to integrate diverse host immune responses. Recently, it became known that ILC subsets play a key role in immune responses at barrier surfaces, interacting with the microbiota, nutrients and metabolites. Since the liver receives the venous blood directly from the intestinal vein, the intestine and liver are essential to maintain tolerance and can rapidly respond to infections or tissue damage. Therefore, in this review, we discuss recent findings regarding ILC functions in homeostasis and disease, with a focus on the intestine and liver.

  4. Active antitumor immunity elicited by vaccine based on recombinant form of epidermal growth factor receptor.

    PubMed

    Hu, Bing; Wei, Yuquan; Tian, Ling; Zhao, Xia; Lu, You; Wu, Yang; Yao, Bing; Liu, Jiyan; Niu, Ting; Wen, Yanjun; He, Qiuming; Su, Jingmei; Huang, Meijuan; Lou, Yanyan; Luo, Yan; Kan, Bing

    2005-01-01

    Active immunotherapy targeting epidermal growth factor receptor (EGFR) should be another attractive approach to the treatment of EGFR-positive tumors. To test this concept, the authors evaluated the potential immune responses and antitumor activities elicited by dendritic cells pulsed with recombinant ectodomain of mouse EGFR (DC-edMER). Spleen cells isolated from DC-edMER-vaccinated mice showed a high quantity of EGFR-specific antibody-producing cells. EGFR-reactive antibody in sera isolated from vaccinated mice was identified and shown to be effective against tumors in vitro and in vivo by adoptive transfer. DC-edMER vaccine also elicited cytotoxic T-lymphocyte responses that could mediate antitumor effects in vitro and adoptive transfer in vivo. In addition, EGFR-specific cytokines responses were elicited by DC-edMER vaccine. Immunization with DC-edMER resulted in tumor regression and prolonged survival in mice challenged with Lewis lung carcinomas and mammary cancer models. Depletion of CD4+ T lymphocytes could completely abrogate the antitumor activity and EGFR-specific antibody responses, whereas the depletion of CD8+ T lymphocytes showed partial abrogation of the antitumor activity but antibody was still detected. Furthermore, tumor-induced angiogenesis was suppressed in DC-edMER-vaccinated mice or mice treated with antibody adoptive transfer. Taken together, these findings suggest the antitumor immunity could be induced by DC-edMER, which may involve both humoral and cellular immunity, and may provide insight into the treatment of EGFR-positive tumors through the induction of active immunity against EGFR.

  5. Synergistic inhibition of PARP-1 and NF-κB signaling downregulates immune response against recombinant AAV2 vectors during hepatic gene therapy.

    PubMed

    Hareendran, Sangeetha; Ramakrishna, Banumathi; Jayandharan, Giridhara R

    2016-01-01

    Host immune response remains a key obstacle to widespread application of adeno-associated virus (AAV) based gene therapy. Thus, targeted inhibition of the signaling pathways that trigger such immune responses will be beneficial. Previous studies have reported that DNA damage response proteins such as poly(ADP-ribose) polymerase-1 (PARP-1) negatively affect the integration of AAV in the host genome. However, the role of PARP-1 in regulating AAV transduction and the immune response against these vectors has not been elucidated. In this study, we demonstrate that repression of PARP-1 improves the transduction of single-stranded AAV vectors both in vitro (∼174%) and in vivo (two- to 3.4-fold). Inhibition of PARP-1, also significantly downregulated the expression of several proinflammatory and cytokine markers such as TLRs, ILs, NF-κB subunit proteins associated with the host innate response against self-complementary AAV2 vectors. The suppression of the inflammatory response targeted against these vectors was more effective upon combined inhibition of PARP-1 and NF-κB signaling. This strategy also effectively attenuated the AAV capsid-specific cytotoxic T-cell response, with minimal effect on vector transduction, as demonstrated in normal C57BL/6 and hemophilia B mice. These data suggest that targeting specific host cellular proteins could be useful to attenuate the immune barriers to AAV-mediated gene therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. The impact of eicosanoids on the crosstalk between innate and adaptive immunity: the key roles of dendritic cells.

    PubMed

    Harizi, H; Gualde, N

    2005-06-01

    The innate immune response is essentially the first line of defense against an invading pathogen. Through specialized receptors, known as pattern recognition receptors, especially Toll-like receptors, specialized cells of myeloid origin, including macrophages and dendritic cells (DCs) are able to phagocytose microorganisms and induce an innate inflammatory response. Although B and T lymphocytes recognize tissue antigens with high specificity, they are unable to initiate immune responses. The decision to activate an appropriate immune response is made by unique DC, the most professional antigen-presenting cells (APCs) which control the responses of several types of lymphocytes and play central role in the transition between innate and adaptive immunity. Increased secretion of inflammatory endogenous mediators such as cytokines and arachidonic acid-derived lipid mediators, also termed eicosanoids, can activate APC, particularly DC, which in turn induce an adaptive immune response. There is an increasing evidence that eicosanoids play an important role in connecting innate and adaptive immunity by acting on cells of both systems. Prostanoids, a major class of eicosanoids, have a great impact on inflammatory and immune responses. PGE(2) is one of the best known and most well-characterized prostanoids in terms of immunomodulation. Although cytokines are known as key regulators of immunity, eicosanoids, including PGE(2), PGD(2), LTB(4), and LTC(4), may also affect cells of immune system by modulating cytokine release, cell differentiation, survival, migration, antigen presentation, and apoptosis. By acting on various aspects of immune and inflammatory reactions, these lipid mediators emerge as key regulators of the crosstalk between innate and adaptive immunity.

  7. Blockade of tumour necrosis factor-α in experimental autoimmune encephalomyelitis reveals differential effects on the antigen-specific immune response and central nervous system histopathology.

    PubMed

    Batoulis, H; Recks, M S; Holland, F O; Thomalla, F; Williams, R O; Kuerten, S

    2014-01-01

    In various autoimmune diseases, anti-tumour necrosis factor (TNF)-α treatment has been shown to reduce both clinical disease severity and T helper type 1 (Th1)1/Th17 responses. In experimental autoimmune encephalomyelitis (EAE), however, the role of TNF-α has remained unclear. Here, C57BL/6 mice were immunized with myelin oligodendrocyte glycoprotein (MOG) peptide 35-55 and treated with anti-TNF-α, control antibody or vehicle. The clinical disease course, incidence and severity were assessed. On day 20 after immunization the antigen-specific Th1/Th17 response was evaluated by enzyme-linked immunospot (ELISPOT) in spleen and central nervous system (CNS). Also, the extent of spinal cord histopathology was analysed on semi- and ultrathin sections. Our results demonstrate that anti-TNF-α treatment reduced the incidence and delayed the onset of EAE, but had no effect on disease severity once EAE had been established. Whereas anti-TNF-α treatment induced an increase in splenic Th1/Th17 responses, there was no effect on the number of antigen-specific Th1/Th17 cells in the spinal cord. Accordingly, the degree of CNS histopathology was comparable in control and anti-TNF-α-treated mice. In conclusion, while the anti-TNF-α treatment had neither immunosuppressive effects on the Th1/Th17 response in the CNS nor histoprotective properties in EAE, it enhanced the myelin-specific T cell response in the immune periphery. © 2013 British Society for Immunology.

  8. Vaccine specific immune response to an inactivated oral cholera vaccine and EPI vaccines in a high and low arsenic area in Bangladeshi children.

    PubMed

    Saha, Amit; Chowdhury, Mohiul I; Nazim, Mohammad; Alam, Mohammad Murshid; Ahmed, Tanvir; Hossain, Mohammad Bakhtiar; Hore, Samar Kumar; Sultana, Gazi Nurun Nahar; Svennerholm, Ann-Mari; Qadri, Firdausi

    2013-01-11

    Immune responses to the inactivated oral whole cell cholera toxin B (CTB) subunit cholera vaccine, Dukoral(®), as well as three childhood vaccines in the national immunization system were compared in children living in high and low arsenic contaminated areas in Bangladesh. In addition, serum complement factors C3 and C4 levels were evaluated among children in the two areas. VACCINATIONS: Toddlers (2-5 years) were orally immunized with two doses of Dukoral 14 days apart. Study participants had also received diphtheria, tetanus and measles vaccines according to the Expanded Program on Immunization (EPI) in Bangladesh. The mean level of arsenic in the urine specimens in the children of the high arsenic area (HAA, Shahrasti, Chandpur) was 291.8μg/L while the level was 6.60μg/L in the low arsenic area (LAA, Mirpur, Dhaka). Cholera specific vibriocidal antibody responses were significantly increased in the HAA (87%, P<0.001) and the LAA (75%, P<0.001) children after vaccination with Dukoral, but no differences were found between the two groups. Levels of CTB specific IgA and IgG antibodies were comparable between the two groups, whereas LPS specific IgA and IgG were higher in the LAA group, although response rates were comparable. Diphtheria and tetanus vaccine specific IgG responses were significantly higher in the HAA compared to the LAA group (P<0.001, P=0.048 respectively), whereas there were no differences in the measles specific IgG responses between the groups. Complement C3 and C4 levels in sera were higher in participants from the HAA than the LAA groups (P<0.001, P=0.049 respectively). The study demonstrates that the oral cholera vaccine as well as the EPI vaccines studied are immunogenic in children in high and low arsenic areas in Bangladesh. The results are encouraging for the potential use of cholera vaccines as well as the EPI vaccines in arsenic endemic areas. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

    PubMed Central

    Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

    2015-01-01

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

  10. The TAM family receptor tyrosine kinase TYRO3 is a negative regulator of type 2 immunity

    PubMed Central

    Chan, Pamela Y.; Carrera Silva, Eugenio A.; De Kouchkovsky, Dimitri; Joannas, Leonel D.; Hao, Liming; Hu, Donglei; Huntsman, Scott; Eng, Celeste; Licona-Limón, Paula; Weinstein, Jason S.; Herbert, De’Broski R.; Craft, Joseph E.; Flavell, Richard A.; Repetto, Silvia; Correale, Jorge; Burchard, Esteban G.; Torgerson, Dara G.; Ghosh, Sourav; Rothlin, Carla V.

    2016-01-01

    Host responses against metazoan parasites or an array of environmental substances elicit type 2 immunity. Despite its protective function, type 2 immunity also drives allergic diseases. The mechanisms that regulate the magnitude of the type 2 response remain largely unknown. Here, we show that genetic ablation of a receptor tyrosine kinase encoded by Tyro3 in mice or the functional neutralization of its ortholog in human dendritic cells resulted in enhanced type 2 immunity. Furthermore, the TYRO3 agonist PROS1 was induced in T cells by the quintessential type 2 cytokine, interleukin-4. T cell–specific Pros1 knockouts phenocopied the loss of Tyro3. Thus, a PROS1-mediated feedback from adaptive immunity engages a rheostat, TYRO3, on innate immune cells to limit the intensity of type 2 responses. PMID:27034374

  11. An adjuvant-modulated vaccine response in human whole blood

    PubMed Central

    Hakimi, Jalil; Azizi, Ali; Ausar, Salvador F.; Todryk, Stephen M.; Rahman, Nausheen; Brookes, Roger H.

    2017-01-01

    ABSTRACT The restimulation of an immune memory response by in vitro culture of blood cells with a specific antigen has been used as a way to gauge immunity to vaccines for decades. In this commentary we discuss a less appreciated application to support vaccine process development. We report that human whole blood from pre-primed subjects can generate a profound adjuvant-modulated, antigen-specific response to several different vaccine formulations. The response is able to differentiate subtle changes in the quality of an immune memory response to vaccine formulations and can be used to select optimal conditions relating to a particular manufacture process step. While questions relating to closeness to in vivo vaccination remain, the approach is another big step nearer to the more relevant human response. It has special importance for new adjuvant development, complementing other preclinical in vivo and in vitro approaches to considerably de-risk progression of novel vaccines before and throughout early clinical development. Broader implications of the approach are discussed. PMID:28605295

  12. STAT4 Deficiency Fails To Induce Lung Th2 or Th17 Immunity following Primary or Secondary Respiratory Syncytial Virus (RSV) Challenge but Enhances the Lung RSV-Specific CD8+ T Cell Immune Response to Secondary Challenge

    PubMed Central

    Dulek, Daniel E.; Newcomb, Dawn C.; Toki, Shinji; Goliniewska, Kasia; Cephus, Jacqueline; Reiss, Sara; Bates, John T.; Crowe, James E.; Boyd, Kelli L.; Moore, Martin L.; Zhou, Weisong

    2014-01-01

    ABSTRACT Immune-mediated lung injury is a hallmark of lower respiratory tract illness caused by respiratory syncytial virus (RSV). STAT4 plays a critical role in CD4+ Th1 lineage differentiation and gamma interferon (IFN-γ) protein expression by CD4+ T cells. As CD4+ Th1 differentiation is associated with negative regulation of CD4+ Th2 and Th17 differentiation, we hypothesized that RSV infection of STAT4−/− mice would result in enhanced lung Th2 and Th17 inflammation and impaired lung Th1 inflammation compared to wild-type (WT) mice. We performed primary and secondary RSV challenges in WT and STAT4−/− mice and used STAT1−/− mice as a positive control for the development of RSV-specific lung Th2 and Th17 inflammation during primary challenge. Primary RSV challenge of STAT4−/− mice resulted in decreased T-bet and IFN-γ expression levels in CD4+ T cells compared to those of WT mice. Lung Th2 and Th17 inflammation did not develop in primary RSV-challenged STAT4−/− mice. Decreased IFN-γ expression by NK cells, CD4+ T cells, and CD8+ T cells was associated with attenuated weight loss and enhanced viral clearance with primary challenge in STAT4−/− mice compared to WT mice. Following secondary challenge, WT and STAT4−/− mice also did not develop lung Th2 or Th17 inflammation. In contrast to primary challenge, secondary RSV challenge of STAT4−/− mice resulted in enhanced weight loss, an increased lung IFN-γ expression level, and an increased lung RSV-specific CD8+ T cell response compared to those of WT mice. These data demonstrate that STAT4 regulates the RSV-specific CD8+ T cell response to secondary infection but does not independently regulate lung Th2 or Th17 immune responses to RSV challenge. IMPORTANCE STAT4 is a protein critical for both innate and adaptive immune responses to viral infection. Our results show that STAT4 regulates the immune response to primary and secondary challenge with RSV but does not restrain RSV-induced lung Th2 or Th17 immune responses. These findings suggest that STAT4 expression may influence lung immunity and severity of illness following primary and secondary RSV infections. PMID:24920804

  13. HIV-1 vaccine-specific responses induced by Listeria vector vaccines are maintained in mice subsequently infected with a model helminth parasite, Schistosoma mansoni.

    PubMed

    Shollenberger, Lisa M; Bui, Cac T; Paterson, Yvonne; Nyhoff, Lindsay; Harn, Donald A

    2013-11-19

    In areas co-endemic for helminth parasites and HIV/AIDS, infants are often administered vaccines prior to infection with immune modulatory helminth parasites. Systemic Th2 biasing and immune suppression caused by helminth infection reduces cell-mediated responses to vaccines such as tetanus toxoid and BCG. Therefore, we asked if infection with helminthes post-vaccination, alters already established vaccine induced immune responses. In our model, mice are vaccinated against HIV-1 Gag using a Listeria vaccine vector (Lm-Gag) in a prime-boost manner, then infected with the human helminth parasite Schistosoma mansoni. This allows us to determine if established vaccine responses are maintained or altered after helminth infection. Our second objective asked if helminth infection post-vaccination alters the recipient's ability to respond to a second boost. Here we compared responses between uninfected mice, schistosome infected mice, and infected mice that were given an anthelminthic, which occurred coincident with the boost or four weeks prior, as well as comparing to un-boosted mice. We report that HIV-1 vaccine-specific responses generated by Listeria vector HIV-1 vaccines are maintained following subsequent chronic schistosome infection, providing further evidence that Listeria vector vaccines induce potent vaccine-specific responses that can withstand helminth infection. We also were able to demonstrate that administration of a second Listeria boost, which markedly enhanced the immune response, was minimally impacted by schistosome infection, or anthelminthic therapy. Surprisingly, we also observed enhanced antibody responses to HIV Gag in vaccinated mice subsequently infected with schistosomes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Dominant-negative TLR5 polymorphism reduces adaptive immune response to flagellin and negatively associates with Crohn's disease.

    PubMed

    Gewirtz, Andrew T; Vijay-Kumar, Matam; Brant, Steven R; Duerr, Richard H; Nicolae, Dan L; Cho, Judy H

    2006-06-01

    Crohn's disease (CD) is associated with elevated adaptive immunity to commensal microbes, with flagellin being a dominant antigen. In light of heightened awareness of the importance of innate immunity in regulating adaptive immunity and ambiguity as to the role of CD-associated immune responses in CD pathophysiology, we sought to determine whether natural acquisition of immune responses to flagellin were regulated by the innate immune flagellin receptor toll-like receptor 5 (TLR5) and determine whether persons carrying a recently defined common dominant-negative TLR5 polymorphism (TLR5-stop) might be protected from developing CD. Carriage rates of a recently defined dominant-negative TLR5 polymorphism (TLR5-stop) and levels of serum immunoreactivity to bacterial products were measured in inflammatory bowel disease patients, first-degree relatives, and unrelated controls. We observed that, in healthy subjects, persons carrying TLR5-stop had significantly lower levels of flagellin-specific IgG and IgA but had similar levels of total and LPS-specific Ig. Moreover, we observed that, among Jewish subjects, the carriage rate of TLR5-stop (in heterozygous state) was significantly less in CD patients, but not ulcerative colitis (UC) patients, compared with unaffected relatives and unrelated controls (5.4, 0.9, 6.0, and 6.5% for unaffected relatives, CD, UC, and unrelated Jewish controls, respectively, n = 296, 215, 185, and 416, respectively; P = 0.037 by likelihood calculation for CD vs. controls), indicating that TLR5-stop can protect persons of Jewish ethnicity against CD. We did not observe a significant association of TLR5-stop with CD in a non-Jewish cohort (11.1, 10.4, and 11.7% for unaffected relatives, CD, and UC, respectively; n = 841, 543, and 300 for unaffected relatives, respectively). These results demonstrate that natural acquisition of immune responses to flagellin are regulated by TLR5 and suggest that immune responses to flagellin are not merely associated with CD but rather promote the pathogenic response.

  15. Mycobacterium tuberculosis Rv1987 induces Th2 immune responses and enhances Mycobacterium smegmatis survival in mice.

    PubMed

    Sha, Shanshan; Shi, Xiaoxia; Deng, Guoying; Chen, Lina; Xin, Yi; Ma, Yufang

    2017-04-01

    Mycobacterium tuberculosis can interfere with host immune response and escape clearance through its specific antigens. M. tuberculosis Rv1987 encoded by region of difference (RD)-2 gene is a secretory protein with immunogenic potency. Here, we investigated the impact of Rv1987 on host cytokine responses and T cell polarization in mouse aerosol model. A recombinant M. smegmatis mc 2 155 strain that overexpressed Rv1987 protein (named MS1987) was constructed and used to infect C57BL/6 mice. The mc 2 155 harbored the empty vector (named MSVec) was as a control. The results showed that MS1987 challenged mice promoted Th2-biased cytokine responses with lower secretion of IFN-γ but higher production of IL-4 and Rv1987-specific IgG antibody compared to MSVec infected mice. Neutrophilic inflammation and high bacterial burden were observed in the lung tissues of MS1987 infected mice probably own to the failed Th1 cell immunity. Besides, subcutaneous injection of Rv1987 protein could mediate the Th1 cytokine responses caused by M. bovis BCG in mice. These results indicated that M. tuberculosis Rv1987 protein could modulate host immune response towards Th2 profile, which probably contributed to the immune evasion of bacteria from host elimination. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. Role of Microbiota in Sexually Dimorphic Immunity.

    PubMed

    Elderman, Marlies; de Vos, Paul; Faas, Marijke

    2018-01-01

    Sex differences in peripheral immune responses are well recognized. This is associated with sex differences in many immunological diseases. As the intestinal microbiota is known to influence the immune system, such sex differences in immune responses may be a consequence of sex-specific microbiota. Therefore, this mini-review discusses sex differences in intestinal microbiota and the possible role of microbiota in shaping sexually dimorphic immunity. Sex differences in microbiota composition are clearly found in mice studies and also in human studies. However, the lack of standardization in human studies may mask the sexual dimorphism in microbiota composition in human studies, since many factors such as age, genetic background, BMI, diet, and sex hormones appear to interfere with the sexual dimorphism in microbiota composition. Only a few mice studies found that differences in gut microbiota composition are causative for some aspects of sexually dimorphic immunity. Therefore, future studies should focus on a causal relationship between sexually dimorphic immunity and microbiota, considering the abovementioned interfering confounding factors. This would benefit the development of more sex-specific effective treatment options for immunological diseases.

  17. Activation of Intrinsic Immune Responses and Microglial Phagocytosis in an Ex Vivo Spinal Cord Slice Culture Model of West Nile Virus Infection

    PubMed Central

    Quick, Eamon D.; Leser, J. Smith; Tyler, Kenneth L.

    2014-01-01

    ABSTRACT West Nile virus (WNV) is a neurotropic flavivirus that causes significant neuroinvasive disease involving the brain and/or spinal cord. Experimental mouse models of WNV infection have established the importance of innate and adaptive immune responses in controlling the extent and severity of central nervous system (CNS) disease. However, differentiating between immune responses that are intrinsic to the CNS and those that are dependent on infiltrating inflammatory cells has proven difficult. We used a murine ex vivo spinal cord slice culture (SCSC) model to determine the innate immune processes specific to the CNS during WNV infections. By 7 days after ex vivo infection of SCSCs, the majority of neurons and a substantial percentage of astrocytes were infected with WNV, resulting in apoptotic cell death and astrogliosis. Microglia, the resident immune cells of the CNS, were activated by WNV infection, as exemplified by their amoeboid morphology, the development of filopodia and lamellipodia, and phagocytosis of WNV-infected cells and debris. Microglial cell activation was concomitant with increased expression of proinflammatory cytokines and chemokines, including CXCL10, CXCL1, CCL5, CCL3, CCL2, tumor necrosis factor alpha (TNF-α), TNF-related apoptosis-inducing ligand (TRAIL), and interleukin-6 (IL-6). The application of minocycline, an inhibitor of neuroinflammation, altered the WNV-induced proinflammatory cytokine/chemokine expression profile, with inhibited production of CCL5, CCL2, and IL-6. Our findings establish that CNS-resident cells have the capacity to initiate a robust innate immune response against WNV infection in the absence of infiltrating inflammatory cells and systemic immune responses. IMPORTANCE There are no specific treatments of proven efficacy available for WNV neuroinvasive disease. A better understanding of the pathogenesis of WNV CNS infection is crucial for the rational development of novel therapies. Development of a spinal cord slice culture (SCSC) model facilitates the study of WNV pathogenesis and allows investigation of the intrinsic immune responses of the CNS. Our studies demonstrate that robust CNS innate immune responses, including microglial activation and proinflammatory cytokine/chemokine production, develop independently of contributions from the peripheral immune system and CNS-infiltrating inflammatory cells. PMID:25165111

  18. Autologous Stem Cell Transplantation Disrupts Adaptive Immune Responses during Rebound Simian/Human Immunodeficiency Virus Viremia.

    PubMed

    Reeves, Daniel B; Peterson, Christopher W; Kiem, Hans-Peter; Schiffer, Joshua T

    2017-07-01

    Primary HIV-1 infection induces a virus-specific adaptive/cytolytic immune response that impacts the plasma viral load set point and the rate of progression to AIDS. Combination antiretroviral therapy (cART) suppresses plasma viremia to undetectable levels that rebound upon cART treatment interruption. Following cART withdrawal, the memory component of the virus-specific adaptive immune response may improve viral control compared to primary infection. Here, using primary infection and treatment interruption data from macaques infected with simian/human immunodeficiency virus (SHIV), we observe a lower peak viral load but an unchanged viral set point during viral rebound. The addition of an autologous stem cell transplant before cART withdrawal alters viral dynamics: we found a higher rebound set point but similar peak viral loads compared to the primary infection. Mathematical modeling of the data that accounts for fundamental immune parameters achieves excellent fit to heterogeneous viral loads. Analysis of model output suggests that the rapid memory immune response following treatment interruption does not ultimately lead to better viral containment. Transplantation decreases the durability of the adaptive immune response following cART withdrawal and viral rebound. Our model's results highlight the impact of the endogenous adaptive immune response during primary SHIV infection. Moreover, because we capture adaptive immune memory and the impact of transplantation, this model will provide insight into further studies of cure strategies inspired by the Berlin patient. IMPORTANCE HIV patients who interrupt combination antiretroviral therapy (cART) eventually experience viral rebound, the return of viral loads to pretreatment levels. However, the "Berlin patient" remained free of HIV rebound over a decade after stopping cART. His cure is attributed to leukemia treatment that included an HIV-resistant stem cell transplant. Inspired by this case, we studied the impact of stem cell transplantation in a macaque simian/HIV (SHIV) system. Using a mechanistic mathematical model, we found that while primary infection generates an adaptive immune memory response, stem cell transplantation disrupts this learned immunity. The results have implications for HIV cure regimens based on stem cell transplantation. Copyright © 2017 American Society for Microbiology.

  19. Autologous Stem Cell Transplantation Disrupts Adaptive Immune Responses during Rebound Simian/Human Immunodeficiency Virus Viremia

    PubMed Central

    Peterson, Christopher W.; Kiem, Hans-Peter

    2017-01-01

    ABSTRACT Primary HIV-1 infection induces a virus-specific adaptive/cytolytic immune response that impacts the plasma viral load set point and the rate of progression to AIDS. Combination antiretroviral therapy (cART) suppresses plasma viremia to undetectable levels that rebound upon cART treatment interruption. Following cART withdrawal, the memory component of the virus-specific adaptive immune response may improve viral control compared to primary infection. Here, using primary infection and treatment interruption data from macaques infected with simian/human immunodeficiency virus (SHIV), we observe a lower peak viral load but an unchanged viral set point during viral rebound. The addition of an autologous stem cell transplant before cART withdrawal alters viral dynamics: we found a higher rebound set point but similar peak viral loads compared to the primary infection. Mathematical modeling of the data that accounts for fundamental immune parameters achieves excellent fit to heterogeneous viral loads. Analysis of model output suggests that the rapid memory immune response following treatment interruption does not ultimately lead to better viral containment. Transplantation decreases the durability of the adaptive immune response following cART withdrawal and viral rebound. Our model's results highlight the impact of the endogenous adaptive immune response during primary SHIV infection. Moreover, because we capture adaptive immune memory and the impact of transplantation, this model will provide insight into further studies of cure strategies inspired by the Berlin patient. IMPORTANCE HIV patients who interrupt combination antiretroviral therapy (cART) eventually experience viral rebound, the return of viral loads to pretreatment levels. However, the “Berlin patient” remained free of HIV rebound over a decade after stopping cART. His cure is attributed to leukemia treatment that included an HIV-resistant stem cell transplant. Inspired by this case, we studied the impact of stem cell transplantation in a macaque simian/HIV (SHIV) system. Using a mechanistic mathematical model, we found that while primary infection generates an adaptive immune memory response, stem cell transplantation disrupts this learned immunity. The results have implications for HIV cure regimens based on stem cell transplantation. PMID:28404854

  20. Alcohol exposure differentially effects anti-tumor immunity in females by altering dendritic cell function.

    PubMed

    Thompson, Matthew G; Navarro, Flor; Chitsike, Lennox; Ramirez, Luis; Kovacs, Elizabeth J; Watkins, Stephanie K

    2016-12-01

    Dendritic cells (DCs) are a critical component of anti-tumor immunity due to their ability to induce a robust immune response to antigen (Ag). Alcohol was previously shown to reduce DC ability to present foreign Ag and promote pro-inflammatory responses in situations of infection and trauma. However the impact of alcohol exposure on generation of an anti-tumor response, especially in the context of generation of an immune vaccine has not been examined. In the clinic, DC vaccines are typically generated from autologous blood, therefore prior exposure to substances such as alcohol may be a critical factor to consider regarding the effectiveness in generating an immune response. In this study, we demonstrate for the first time that ethanol differentially affects DC and tumor Ag-specific T cell responses depending on sex. Signaling pathways were found to be differentially regulated in DC in females compared to males and these differences were exacerbated by ethanol treatment. DC from female mice treated with ethanol were unable to activate Ag-specific cytotoxic T cells (CTL) as shown by reduced expression of CD44, CD69, and decreased production of granzyme B and IFNγ. Furthermore, although FOXO3, an immune suppressive mediator of DC function, was found to be upregulated in DC from female mice, ethanol related suppression was independent of FOXO3. These findings demonstrate for the first time differential impacts of alcohol on the immune system of females compared to males and may be a critical consideration for determining the effectiveness of an immune based therapy for cancer in patients that consume alcohol. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Sexual dimorphism in immune function changes during the annual cycle in house sparrows

    NASA Astrophysics Data System (ADS)

    Pap, Péter László; Czirják, Gábor Árpád; Vágási, Csongor István; Barta, Zoltán; Hasselquist, Dennis

    2010-10-01

    Difference between sexes in parasitism is a common phenomenon among birds, which may be related to differences between males and females in their investment into immune functions or as a consequence of differential exposure to parasites. Because life-history strategies change sex specifically during the annual cycle, immunological responses of the host aiming to reduce the impact of parasites may be sexually dimorphic. Despite the great complexity of the immune system, studies on immunoecology generally characterise the immune status through a few variables, often overlooking potentially important seasonal and gender effects. However, because of the differences in physiological and defence mechanisms among different arms of the immune system, we expect divergent responses of immune components to environmental seasonality. In male and female house sparrows ( Passer domesticus), we measured the major components of the immune system (innate, acquired, cellular and humoral) during four important life-history stages across the year: (1) mating, (2) breeding, (3) moulting and (4) during the winter capture and also following introduction to captivity in aviary. Different individuals were sampled from the same population during the four life cycle stages. We found that three out of eight immune variables showed a significant life cycle stage × sex interaction. The difference in immune response between the sexes was significant in five immune variables during the mating stage, when females had consistently stronger immune function than males, while variables varied generally non-significantly with sex during the remaining three life cycle stages. Our results show that the immune system is highly variable between life cycle stages and sexes, highlighting the potential fine tuning of the immune system to specific physiological states and environmental conditions.

  2. Anti-Donor Immune Responses Elicited by Allogeneic Mesenchymal Stem Cells and Their Extracellular Vesicles: Are We Still Learning?

    PubMed Central

    Lohan, Paul; Treacy, Oliver; Griffin, Matthew D.; Ritter, Thomas; Ryan, Aideen E.

    2017-01-01

    Mesenchymal stromal cells (MSC) have been used to treat a broad range of disease indications such as acute and chronic inflammatory disorders, autoimmune diseases, and transplant rejection due to their potent immunosuppressive/anti-inflammatory properties. The breadth of their usage is due in no small part to the vast quantity of published studies showing their ability to modulate multiple immune cell types of both the innate and adaptive immune response. While patient-derived (autologous) MSC may be the safer choice in terms of avoiding unwanted immune responses, factors including donor comorbidities may preclude these cells from use. In these situations, allogeneic MSC derived from genetically unrelated individuals must be used. While allogeneic MSC were initially believed to be immune-privileged, substantial evidence now exists to prove otherwise with multiple studies documenting specific cellular and humoral immune responses against donor antigens following administration of these cells. In this article, we will review recent published studies using non-manipulated, inflammatory molecule-activated (licensed) and differentiated allogeneic MSC, as well as MSC extracellular vesicles focusing on the immune responses to these cells and whether or not such responses have an impact on allogeneic MSC-mediated safety and efficacy. PMID:29225601

  3. Still waiting for the toll?

    PubMed

    Cooper, E L; Kvell, K; Engelmann, P; Nemeth, P

    2006-04-15

    Multicellular organisms including invertebrates and vertebrates live in various habitats that may be aquatic or terrestrial where they are constantly exposed to deleterious pathogens. These include viruses, bacteria, fungi, and parasites. They have evolved various immunodefense mechanisms that may protect them from infection by these microorganisms. These include cellular and humoral responses and the level of differentiation of the response parallels the evolutionary development of the species. The first line of innate immunity in earthworms is the body wall that prevents the entrance of microbes into the coelomic cavity that contains fluid in which there are numerous leukocyte effectors of immune responses. When this first barrier is broken, a series of host responses is set into motion activating the leukocytes and the coelomic fluid. The responses are classified as innate, natural, non-specific, non-anticipatory, non-clonal (germ line) in contrast to the vertebrate capacity that is considered adaptive, induced, specific, anticipatory and clonal (somatic). Specific memory is associated with the vertebrate response and there is information that the innate response of invertebrates may under certain conditions possess specific memory. The invertebrate system when challenged affects phagocytosis, encapsulation, agglutination, opsonization, clotting and lysis. At least two major leukocytes, small and large mediate lytic reactions against several tumor cell targets. Destruction of tumor cells in vitro shows that phagocytosis and natural killer cell responses are distinct properties of these leukocytes. This has prompted newer searches for immune function and regulation in other systems. The innate immune system of the earthworm has been analyzed for more than 40 years with every aspect examined. However, there are no known entire sequences of the earthworm as exists in these other invertebrates. Because the earthworm lives in soil and has been utilized as a successful monitor for pollution, there are studies that reveal up and down regulation of responses in the immune system after exposure to a variety of environmental pollutants. Moreover, there are partial sequences that appear in earthworms after exposure to environmental pollutants such as cadmium and copper. There are now attempts to define the AHR receptor crucial for intracellular signaling after exposure to pollutants, but without linking the signals to changes in the immune system. There are several pathways for signal transduction, including JAK/STAT, TOLL, TRAF PIP3, known in invertebrates and vertebrates. For resistance to pathogens, conserved signal transduction components are required and these include a Toll/IL-1 receptor domain adaptor protein that functions upstream of a conserved p38 MAP kinase pathway. This pathway may be an ancestral innate immune signaling pathway found in a putative common ancestor of nematodes, arthropods and even vertebrates. It could also help us to link pollution, innate immunity and transduction in earthworms.

  4. Antigen-specific T cell responses to BK polyomavirus antigens identify functional anti-viral immunity and may help to guide immunosuppression following renal transplantation

    PubMed Central

    Chakera, A; Bennett, S; Lawrence, S; Morteau, O; Mason, P D; O'Callaghan, C A; Cornall, R J

    2011-01-01

    Infection with the polyoma virus BK (BKV) is a major cause of morbidity following renal transplantation. Limited understanding of the anti-viral immune response has prevented the design of a strategy that balances treatment with the preservation of graft function. The proven utility of interferon-gamma enzyme-linked immunospot (ELISPOT) assays to measure T cell responses in immunocompetent hosts was the basis for trying to develop a rational approach to the management of BKV following renal transplantation. In a sample of transplant recipients and healthy controls, comparisons were made between T cell responses to the complete panel of BKV antigens, the Epstein–Barr virus (EBV) antigens, BZLF1 and EBNA1, and the mitogen phytohaemagglutinin (PHA). Correlations between responses to individual antigens and immunosuppressive regimens were also analysed. Antigen-specific T cell responses were a specific indicator of recent or ongoing recovery from BKV infection (P < 0·05), with responses to different BKV antigens being highly heterogeneous. Significant BKV immunity was undetectable in transplant patients with persistent viral replication or no history of BKV reactivation. Responses to EBV antigens and mitogen were reduced in patients with BKV reactivation, but these differences were not statistically significant. The T cell response to BKV antigens is a useful and specific guide to recovery from BKV reactivation in renal transplant recipients, provided that the full range of antigenic responses is measured. PMID:21671906

  5. Characterization of Specific Immune Responses to Different Aspergillus Antigens during the Course of Invasive Aspergillosis in Hematologic Patients

    PubMed Central

    Beauvais, Anne; Beau, Remi; Candoni, Anna; Maertens, Johan; Rossi, Giulio; Morselli, Monica; Zanetti, Eleonora; Quadrelli, Chiara; Codeluppi, Mauro; Guaraldi, Giovanni; Pagano, Livio; Caira, Morena; Giovane, Cinzia Del; Maccaferri, Monica; Stefani, Alessandro; Morandi, Uliano; Tazzioli, Giovanni; Girardis, Massimo; Delia, Mario; Specchia, Giorgina; Longo, Giuseppe; Marasca, Roberto; Narni, Franco; Merli, Francesco; Imovilli, Annalisa; Apolone, Giovanni; Carvalho, Agostinho; Comoli, Patrizia; Romani, Luigina; Latgè, Jean Paul; Luppi, Mario

    2013-01-01

    Several studies in mouse model of invasive aspergillosis (IA) and in healthy donors have shown that different Aspergillus antigens may stimulate different adaptive immune responses. However, the occurrence of Aspergillus-specific T cells have not yet been reported in patients with the disease. In patients with IA, we have investigated during the infection: a) whether and how specific T-cell responses to different Aspergillus antigens occur and develop; b) which antigens elicit the highest frequencies of protective immune responses and, c) whether such protective T cells could be expanded ex-vivo. Forty hematologic patients have been studied, including 22 patients with IA and 18 controls. Specific T cells producing IL-10, IFN-γ, IL-4 and IL-17A have been characterized through enzyme linked immunospot and cytokine secretion assays on 88 peripheral blood (PB) samples, by using the following recombinant antigens: GEL1p, CRF1p, PEP1p, SOD1p, α1–3glucan, β1–3glucan, galactomannan. Specific T cells were expanded through short term culture. Aspergillus-specific T cells producing non-protective interleukin-10 (IL-10) and protective interferon-gamma (IFN-γ) have been detected to all the antigens only in IA patients. Lower numbers of specific T cells producing IL-4 and IL-17A have also been shown. Protective T cells targeted predominantly Aspergillus cell wall antigens, tended to increase during the IA course and to be associated with a better clinical outcome. Aspergillus-specific T cells could be successfully generated from the PB of 8 out of 8 patients with IA and included cytotoxic subsets able to lyse Aspergillus hyphae. Aspergillus specific T-cell responses contribute to the clearance of the pathogen in immunosuppressed patients with IA and Aspergillus cell wall antigens are those mainly targeted by protective immune responses. Cytotoxic specific T cells can be expanded from immunosuppressed patients even during the infection by using the above mentioned antigens. These findings may be exploited for immunotherapeutic purposes in patients with IA. PMID:24023936

  6. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    PubMed Central

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  7. A pilot study of an autologous tumor-derived autophagosome vaccine with docetaxel in patients with stage IV non-small cell lung cancer.

    PubMed

    Sanborn, Rachel E; Ross, Helen J; Aung, Sandra; Acheson, Anupama; Moudgil, Tarsem; Puri, Sachin; Hilton, Traci; Fisher, Brenda; Coffey, Todd; Paustian, Christopher; Neuberger, Michael; Walker, Edwin; Hu, Hong-Ming; Urba, Walter J; Fox, Bernard A

    2017-12-19

    Tumor-derived autophagosome vaccines (DRibbles) have the potential to broaden immune response to poorly immunogenic tumors. Autologous vaccine generated from tumor cells harvested from pleural effusions was administered to patients with advanced NSCLC with the objectives of assessing safety and immune response. Four patients were vaccinated and evaluable for immune response; each received two to four doses of vaccine. Study therapy included two cycles of docetaxel 75 mg/m 2 on days 1 and 29 to treat the tumor, release hidden antigens and produce lymphopenia. DRibbles were to be administered intradermally on days 14, 43, 57, 71, and 85, together with GM-CSF (50 μg/d x 6d, administered via SQ mini pump). Peripheral blood was tested for immune parameters at baseline and at each vaccination. Three of four patients had tumor cells available for testing. Autologous tumor-specific immune response was seen in two of the three, manifested by IL-5 (1 patient after 3 doses), and IFN-γ, TNF-α, IL-5, IL-10 (after 4 doses in one patient). All 4 patients had evidence of specific antibody responses against potential tumor antigens. All patients came off study after 4 or fewer vaccine treatments due to progression of disease. No significant immune toxicities were seen during the course of the study. DRibble vaccine given with GM-CSF appeared safe and capable of inducing an immune response against tumor cells in this small, pilot study. There was no evidence of efficacy in this small poor-prognosis patient population, with treatment not feasible. Trial registration NCT00850785, initial registration date February 23, 2009.

  8. Development of Safe and Effective RSV Vaccine by Modified CD4 Epitope in G Protein Core Fragment (Gcf)

    PubMed Central

    Park, Sung-Moo; Choi, Youngjoo; Jang, Ji Eun; Jung, Dae Im; Kim, Jae-Ouk; Chang, Jun; Yun, Cheol-Heui; Song, Man Ki

    2014-01-01

    Respiratory syncytial virus (RSV) is a major cause of respiratory tract infection in infants and young children worldwide, but currently no safe and effective vaccine is available. The RSV G glycoprotein (RSVG), a major attachment protein, is an important target for the induction of protective immune responses during RSV infection. However, it has been thought that a CD4+ T cell epitope (a.a. 183–195) within RSVG is associated with pathogenic pulmonary eosinophilia. To develop safe and effective RSV vaccine using RSV G protein core fragment (Gcf), several Gcf variants resulting from modification to CD4+ T cell epitope were constructed. Mice were immunized with each variant Gcf, and the levels of RSV-specific serum IgG were measured. At day 4 post-challenge with RSV subtype A or B, lung viral titers and pulmonary eosinophilia were determined and changes in body weight were monitored. With wild type Gcf derived from RSV A2 (wtAGcf), although RSV A subtype-specific immune responses were induced, vaccine-enhanced disease characterized by excessive pulmonary eosinophil recruitment and body weight loss were evident, whereas wtGcf from RSV B1 (wtBGcf) induced RSV B subtype-specific immune responses without the signs of vaccine-enhanced disease. Mice immunized with Th-mGcf, a fusion protein consisting CD4+ T cell epitope from RSV F (F51–66) conjugated to mGcf that contains alanine substitutions at a.a. position 185 and 188, showed higher levels of RSV-specific IgG response than mice immunized with mGcf. Both wtAGcf and Th-mGcf provided complete protection against RSV A2 and partial protection against RSV B. Importantly, mice immunized with Th-mGcf did not develop vaccine-enhanced disease following RSV challenge. Immunization of Th-mGcf provided protection against RSV infection without the symptom of vaccine-enhanced disease. Our study provides a novel strategy to develop a safe and effective mucosal RSV vaccine by manipulating the CD4+ T cell epitope within RSV G protein. PMID:24736750

  9. Immunosuppression in Early Postnatal Days Induces Persistent and Allergen-Specific Immune Tolerance to Asthma in Adult Mice

    PubMed Central

    Chen, Yan; Zhang, Jin; Lu, Yong; Wang, Libo

    2015-01-01

    Bronchial asthma is a chronic airway inflammatory condition with high morbidity, and effective treatments for asthma are limited. Allergen-specific immunotherapy can only induce peripheral immune tolerance and is not sustainable. Exploring new therapeutic strategies is of great clinical importance. Recombinant adenovirus (rAdV) was used as a vector to make cells expressing cytotoxic T lymphocyte-associated antigen-4-immunoglobulin (CTLA4Ig) a soluble CTLA4 immunoglobulin fusion protein. Dendritic cells (DCs) were modified using the rAdVs together with allergens. Then these modified DCs were transplanted to mice before allergen sensitization. The persistence and specificity of immune tolerance were evaluated in mice challenged with asthma allergens at 3 and 7 months. DCs modified by CTLA4Ig showed increased IL-10 secretion, decreased IL-12 secretion, and T cell stimulation in vitro. Mice treated with these DCs in the early neonatal period developed tolerance against the allergens that were used to induce asthma in the adult stage. Asthma symptoms, lung damage, airway reactivity, and inflammatory response all improved. Humoral immunity indices showed that this therapeutic strategy strongly suppressed mice immune responses and was maintained for as long as 7 months. Furthermore, allergen cross-sensitization and challenge experiments demonstrated that this immune tolerance was allergen-specific. Treatment with CTLA4Ig modified DCs in the early neonatal period, inducing persistent and allergen-specific immune tolerance to asthma in adult mice. Our results suggest that it may be possible to develop a vaccine for asthma. PMID:25860995

  10. Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

    PubMed Central

    1994-01-01

    Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have implications for understanding the pathogenesis of ANAs in SLE. In particular, our results imply that autoimmunity can be initiated by a "hit and run" mechanism in which the binding of a viral antigen to a self protein triggers an immune response that subsequently can be perpetuated by self antigen. PMID:8145041

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takahashi, Takeshi, E-mail: takeshi-takahashi@ciea.or.jp; Katano, Ikumi; Ito, Ryoji

    Highlights: • β-Lactoglobulin (BLG) specific TCR genes were introduced to human HSC by retrovirus. • Human HSC with BLG-specific TCR were transplanted into NOG-HLA-DR4 I-A{sup −/−} mice. • BLG-specific TCR induced positive selection of thymocytes. • BLG-specific TCR positive CD4{sup +} T cells mediated immune responses in humanized mice. - Abstract: The development of severe immunodeficient mouse strains containing various human genes, including cytokines or HLA, has enabled the reconstitution of functional human immune systems after transplantation of human hematopoietic stem cells (HSC). Accumulating evidence has suggested that HLA-restricted antigen-specific human T-cell responses can be generated in these humanized mice.more » To directly monitor immune responses of human CD4{sup +} T cells, we introduced β-lactoglobulin (BLG)-specific T cell receptor (TCR) genes derived from CD4{sup +} T-cell clones of cow-milk allergy patients into HSCs, and subsequently transplanted them into NOG-HLA-DR4 transgenic/I-Aβ deficient mice (NOG-DR4/I-A{sup o}). In the thymus, thymocytes with BLG-specific TCR preferentially differentiated into CD4{sup +}CD8{sup −} single-positive cells. Adoptive transfer of mature CD4{sup +} T cells expressing the TCR into recipient NOG-DR4/I-A{sup o} mice demonstrated that human CD4{sup +} T cells proliferated in response to antigenic stimulation and produced IFN-γ in vivo, suggesting that functional T-cell reactions (especially Th1-skewed responses) were induced in humanized mice.« less

  12. Varicella-Zoster Virus-Specific Cellular Immune Responses to the Live Attenuated Zoster Vaccine in Young and Older Adults.

    PubMed

    Weinberg, Adriana; Canniff, Jennifer; Rouphael, Nadine; Mehta, Aneesh; Mulligan, Mark; Whitaker, Jennifer A; Levin, Myron J

    2017-07-15

    The incidence and severity of herpes zoster (HZ) increases with age. The live attenuated zoster vaccine generates immune responses similar to HZ. We compared the immune responses to zoster vaccine in young and older to adults to increase our understanding of the immune characteristics that may contribute to the increased susceptibility to HZ in older adults. Young (25-40 y; n = 25) and older (60-80 y; n = 33) adults had similar magnitude memory responses to varicella-zoster virus (VZV) ex vivo restimulation measured by responder cell-frequency and flow cytometry, but the responses were delayed in older compared with young adults. Only young adults had an increase in dual-function VZV-specific CD4 + and CD8 + T cell effectors defined by coexpression of IFN-γ, IL-2, and CD107a after vaccination. In contrast, older adults showed marginal increases in VZV-specific CD8 + CD57 + senescent T cells after vaccination, which were already higher than those of young adults before vaccination. An increase in VZV-stimulated CD4 + CD69 + CD57 + PD1 + and CD8 + CD69 + CD57 + PD1 + T cells from baseline to postvaccination was associated with concurrent decreased VZV-memory and CD8 + effector responses, respectively, in older adults. Blocking the PD1 pathway during ex vivo VZV restimulation increased the CD4 + and CD8 + proliferation, but not the effector cytokine production, which modestly increased with TIM-3 blockade. We conclude that high proportions of senescent and exhausted VZV-specific T cells in the older adults contribute to their poor effector responses to a VZV challenge. This may underlie their inability to contain VZV reactivation and prevent the development of HZ. Copyright © 2017 by The American Association of Immunologists, Inc.

  13. A surgeons' guide to renal transplant immunopathology, immunology, and immunosuppression.

    PubMed

    Gaber, Lillian W; Knight, Richard J; Patel, Samir J

    2013-12-01

    The response to allografting involves adaptive and innate immune mechanisms. In the adaptive system, activated T cells differentiate to cytotoxic effectors that attack the graft and trigger B cells to differentiation to plasma cells that produce anti-HLA antibodies. The innate immune system recognizes antigens in a non-specific manner and recruits immune cells to the graft through the productions of chemotactic factors, and activation of cytokines and the complement cascade. In the kidney the tubules and the endothelium are the targets of the rejection response. Immune suppression is effective in modulating the adaptive immune system effect on graft histology. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza

    PubMed Central

    Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom

    2015-01-01

    The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761

  15. Systemic and mucosal immunization with Candida albicans hsp90 elicits hsp90-specific humoral response in vaginal mucosa which is further enhanced during experimental vaginal candidiasis.

    PubMed

    Raska, Milan; Belakova, Jana; Horynova, Milada; Krupka, Michal; Novotny, Jiri; Sebestova, Martina; Weigl, Evzen

    2008-08-01

    The Candida albicans heat shock protein 90 kDa (hsp90-CA) is an important target for protective antibodies in disseminated candidiasis of experimental mice and humans. Hsp90-CA is present in the cell wall of Candida pseudohyphae or hyphae--typical pathogenic morphotypes in both mucosal and systemic Candida infections. However, the potential protective effects of hsp90-CA-specific antibodies in vaginal candidiasis has not yet been reported. In the present study we used various vaccine formulations (recombinant hsp90-CA protein and hsp90-CA-encoding DNA vaccine) and routes of administration (intradermal, intranasal, and intravenous) to induce both hsp90-CA-specific systemic and vaginal mucosa immune responses in experimental BALB/c mice. The results showed that intradermal recombinant hsp90-CA protein priming, followed by intranasal or intradermal recombinant hsp90-CA protein boosting induced significant increases in both serum and vaginal hsp90-CA-specific IgG and IgA antibodies compared to the control group, as well as enhanced hsp90-CA-specific splenocyte responses in vitro. In the intradermally boosted group, subsequent experimental vaginal Candida infection induced additional increases in the hsp90-CA specific IgG isotype, suggesting that Candida has the ability to induce a local hsp90-specific antibody (IgG) response during vulvovaginal candidiasis. Further work is required to elucidate the importance of immunity to highly conserved antigens during infection of the human female reproductive tract where a balance between immunity to and tolerance for commonly antigens such as hsp90 is necessary for the maintenance of fertility.

  16. Chemical modification of birch allergen extract leads to a reduction in allergenicity as well as immunogenicity.

    PubMed

    Würtzen, Peter Adler; Lund, Lise; Lund, Gitte; Holm, Jens; Millner, Anders; Henmar, Helene

    2007-01-01

    In Europe, specific immunotherapy is currently conducted with vaccines containing allergen preparations based on intact extracts. In addition to this, chemically modified allergen extracts (allergoids) are used for specific allergy treatment. Reduced allergenicity and thereby reduced risk of side effects in combination with retained ability to activate T cells and induce protective allergen-specific antibody responses has been claimed for allergoids. In the current study, we compared intact allergen extracts and allergoids with respect to allergenicity and immunogenicity. The immunological response to birch allergen extract, alum-adsorbed extract, birch allergoid and alum-adsorbed allergoid was investigated in vitro in human basophil histamine release assay and by stimulation of human allergen-specific T cell lines. In vivo, Bet v 1-specific IgG titers in mice were determined after repetitive immunizations. In all patients tested (n = 8), allergoid stimulations led to reduced histamine release compared to the intact allergen extract. However, the allergoid preparations were not recognized by Bet v 1-specific T cell lines (n = 7), which responded strongly to the intact allergen extract. Mouse immunizations showed a clearly reduced IgG induction by allergoids and a strongly potentiating effect of the alum adjuvant. Optimal IgG titers were obtained after 3 immunizations with intact allergen extracts, while 5 immunizations were needed to obtain maximal response to the allergoid. The reduced histamine release observed for allergoid preparations may be at the expense of immunological efficacy because the chemical modifications lead to a clear reduction in T cell activation and the ability to induce allergen-specific IgG antibody responses. Copyright 2007 S. Karger AG, Basel.

  17. Recognition of Core- and Polymerase-derived immunogenic peptides included in novel therapeutic vaccine by T cells from Chinese chronic hepatitis B patients.

    PubMed

    Huang, D; Sansas, B; Jiang, J H; Gong, Q M; Jin, G D; Calais, V; Yu, D M; Zhu, M Y; Wei, D; Zhang, D H; Inchauspé, G; Zhang, X X; Zhu, R

    2017-11-01

    Chronic hepatitis B (CHB) is one of the major public health challenges in the world. Due to a strong interplay between specific T-cell immunity and elimination of hepatitis B virus (HBV), efforts to develop novel immunotherapeutics are gaining attention. TG1050, a novel immunotherapy, has shown efficacy in an animal study. To support the clinical development of TG1050 in China, specific immunity to the fusion antigens of TG1050 was assessed in Chinese patients. One hundred and thirty subjects were divided into three groups as CHB patients, HBV spontaneous resolvers, and CHB patients with HBsAg loss after antiviral treatment. HBV-specific T-cell responses to pools of HBV Core or Polymerase genotype D peptides included in TG1050 were evaluated. HBV Core- or Polymerase-specific cells were detected in peripheral blood mononuclear cells (PBMCs) from the different cohorts. The frequencies and intensities of HBV Core-specific immune responses were significantly lower in CHB patients than in HBsAg loss subjects. In CHB patients, a dominant pool derived from Polymerase (Pol1) was the most immunogenic. CHB patients with low viral loads (<10 6 IU/mL) were more likely to have a positive response specific to the Core peptide pool. Overall, genotype D-derived peptides included in TG1050 could raise broad and functional T-cell responses in PBMCs from Chinese CHB patients infected with genotype B/C isolates. Core-specific immunogenic domains appeared as "hot spots" with the capacity to differentiate between CHB vs HBsAg loss subjects. These observations support the extended application and associated immune monitoring of TG1050 in China. © 2017 The Authors. Journal of Viral Hepatitis Published by John Wiley & Sons Ltd.

  18. c-di-GMP enhances protective innate immunity in a murine model of pertussis.

    PubMed

    Elahi, Shokrollah; Van Kessel, Jill; Kiros, Tedele G; Strom, Stacy; Hayakawa, Yoshihiro; Hyodo, Mamoru; Babiuk, Lorne A; Gerdts, Volker

    2014-01-01

    Innate immunity represents the first line of defense against invading pathogens in the respiratory tract. Innate immune cells such as monocytes, macrophages, dendritic cells, NK cells, and granulocytes contain specific pathogen-recognition molecules which induce the production of cytokines and subsequently activate the adaptive immune response. c-di-GMP is a ubiquitous second messenger that stimulates innate immunity and regulates biofilm formation, motility and virulence in a diverse range of bacterial species with potent immunomodulatory properties. In the present study, c-di-GMP was used to enhance the innate immune response against pertussis, a respiratory infection mainly caused by Bordetella pertussis. Intranasal treatment with c-di-GMP resulted in the induction of robust innate immune responses to infection with B. pertussis characterized by enhanced recruitment of neutrophils, macrophages, natural killer cells and dendritic cells. The immune responses were associated with an earlier and more vigorous expression of Th1-type cytokines, as well as an increase in the induction of nitric oxide in the lungs of treated animals, resulting in significant reduction of bacterial numbers in the lungs of infected mice. These results demonstrate that c-di-GMP is a potent innate immune stimulatory molecule that can be used to enhance protection against bacterial respiratory infections. In addition, our data suggest that priming of the innate immune system by c-di-GMP could further skew the immune response towards a Th1 type phenotype during subsequent infection. Thus, our data suggest that c-di-GMP might be useful as an adjuvant for the next generation of acellular pertussis vaccine to mount a more protective Th1 phenotype immune response, and also in other systems where a Th1 type immune response is required.

  19. c-di-GMP Enhances Protective Innate Immunity in a Murine Model of Pertussis

    PubMed Central

    Elahi, Shokrollah; Van Kessel, Jill; Kiros, Tedele G.; Strom, Stacy; Hayakawa, Yoshihiro; Hyodo, Mamoru; Babiuk, Lorne A.; Gerdts, Volker

    2014-01-01

    Innate immunity represents the first line of defense against invading pathogens in the respiratory tract. Innate immune cells such as monocytes, macrophages, dendritic cells, NK cells, and granulocytes contain specific pathogen-recognition molecules which induce the production of cytokines and subsequently activate the adaptive immune response. c-di-GMP is a ubiquitous second messenger that stimulates innate immunity and regulates biofilm formation, motility and virulence in a diverse range of bacterial species with potent immunomodulatory properties. In the present study, c-di-GMP was used to enhance the innate immune response against pertussis, a respiratory infection mainly caused by Bordetella pertussis. Intranasal treatment with c-di-GMP resulted in the induction of robust innate immune responses to infection with B. pertussis characterized by enhanced recruitment of neutrophils, macrophages, natural killer cells and dendritic cells. The immune responses were associated with an earlier and more vigorous expression of Th1-type cytokines, as well as an increase in the induction of nitric oxide in the lungs of treated animals, resulting in significant reduction of bacterial numbers in the lungs of infected mice. These results demonstrate that c-di-GMP is a potent innate immune stimulatory molecule that can be used to enhance protection against bacterial respiratory infections. In addition, our data suggest that priming of the innate immune system by c-di-GMP could further skew the immune response towards a Th1 type phenotype during subsequent infection. Thus, our data suggest that c-di-GMP might be useful as an adjuvant for the next generation of acellular pertussis vaccine to mount a more protective Th1 phenotype immune response, and also in other systems where a Th1 type immune response is required. PMID:25333720

  20. Shark immunity bites back: affinity maturation and memory response in the nurse shark, Ginglymostoma cirratum.

    PubMed

    Dooley, Helen; Flajnik, Martin F

    2005-03-01

    The cartilaginous fish are the oldest phylogenetic group in which all of the molecular components of the adaptive immune system have been found. Although early studies clearly showed that sharks could produce an IgM-based response following immunization, evidence for memory, affinity maturation and roles for the other isotypes (notably IgNAR) in this group remained inconclusive. The data presented here illustrate that the nurse shark (Ginglymostoma cirratum) is able to produce not only an IgM response, but we also show for the first time a highly antigen-specific IgNAR response. Additionally, under appropriate conditions, a memory response for both isotypes can be elicited. Analysis of the response shows differential expression of pentameric and monomeric IgM. Pentameric IgM provides the 'first line of defense' through high-avidity, low-affinity interaction with antigen. In contrast, monomeric IgM and IgNAR seem responsible for the specific, antigen-driven response. We propose the presence of distinct lineages of B cells in sharks. As there is no conventional isotype switching, each lineage seems pre-determined to express a single isotype (IgM versus IgNAR). However, our data suggest that there may also be specific lineages for the different forms (pentameric versus monomeric) of the IgM isotype.

  1. The immunology of smallpox vaccines

    PubMed Central

    Kennedy, Richard B; Ovsyannikova, Inna G; Jacobson, Robert M; Poland, Gregory A

    2010-01-01

    In spite of the eradication of smallpox over 30 years ago; orthopox viruses such as smallpox and monkeypox remain serious public health threats both through the possibility of bioterrorism and the intentional release of smallpox and through natural outbreaks of emerging infectious diseases such as monkeypox. The eradication effort was largely made possible by the availability of an effective vaccine based on the immunologically cross-protective vaccinia virus. Although the concept of vaccination dates back to the late 1800s with Edward Jenner, it is only in the past decade that modern immunologic tools have been applied toward deciphering poxvirus immunity. Smallpox vaccines containing vaccinia virus elicit strong humoral and cellular immune responses that confer cross-protective immunity against variola virus for decades after immunization. Recent studies have focused on: establishing the longevity of poxvirus-specific immunity, defining key immune epitopes targeted by T and B cells, developing subunit-based vaccines, and developing genotypic and phenotypic immune response profiles that predict either vaccine response or adverse events following immunization. PMID:19524427

  2. Direct Lymph Node Vaccination of Lentivector/Prostate-Specific Antigen is Safe and Generates Tissue-Specific Responses in Rhesus Macaques.

    PubMed

    Au, Bryan C; Lee, Chyan-Jang; Lopez-Perez, Orlay; Foltz, Warren; Felizardo, Tania C; Wang, James C M; Huang, Ju; Fan, Xin; Madden, Melissa; Goldstein, Alyssa; Jaffray, David A; Moloo, Badru; McCart, J Andrea; Medin, Jeffrey A

    2016-02-19

    Anti-cancer immunotherapy is emerging from a nadir and demonstrating tangible benefits to patients. A variety of approaches are now employed. We are invoking antigen (Ag)-specific responses through direct injections of recombinant lentivectors (LVs) that encode sequences for tumor-associated antigens into multiple lymph nodes to optimize immune presentation/stimulation. Here we first demonstrate the effectiveness and antigen-specificity of this approach in mice challenged with prostate-specific antigen (PSA)-expressing tumor cells. Next we tested the safety and efficacy of this approach in two cohorts of rhesus macaques as a prelude to a clinical trial application. Our vector encodes the cDNA for rhesus macaque PSA and a rhesus macaque cell surface marker to facilitate vector titering and tracking. We utilized two independent injection schemas demarcated by the timing of LV administration. In both cohorts we observed marked tissue-specific responses as measured by clinical evaluations and magnetic resonance imaging of the prostate gland. Tissue-specific responses were sustained for up to six months-the end-point of the study. Control animals immunized against an irrelevant Ag were unaffected. We did not observe vector spread in test or control animals or perturbations of systemic immune parameters. This approach thus offers an "off-the-shelf" anti-cancer vaccine that could be made at large scale and injected into patients-even on an out-patient basis.

  3. Profiling Humoral Immune Responses to Clostridium difficile-Specific Antigens by Protein Microarray Analysis.

    PubMed

    Negm, Ola H; Hamed, Mohamed R; Dilnot, Elizabeth M; Shone, Clifford C; Marszalowska, Izabela; Lynch, Mark; Loscher, Christine E; Edwards, Laura J; Tighe, Patrick J; Wilcox, Mark H; Monaghan, Tanya M

    2015-09-01

    Clostridium difficile is an anaerobic, Gram-positive, and spore-forming bacterium that is the leading worldwide infective cause of hospital-acquired and antibiotic-associated diarrhea. Several studies have reported associations between humoral immunity and the clinical course of C. difficile infection (CDI). Host humoral immune responses are determined using conventional enzyme-linked immunosorbent assay (ELISA) techniques. Herein, we report the first use of a novel protein microarray assay to determine systemic IgG antibody responses against a panel of highly purified C. difficile-specific antigens, including native toxins A and B (TcdA and TcdB, respectively), recombinant fragments of toxins A and B (TxA4 and TxB4, respectively), ribotype-specific surface layer proteins (SLPs; 001, 002, 027), and control proteins (tetanus toxoid and Candida albicans). Microarrays were probed with sera from a total of 327 individuals with CDI, cystic fibrosis without diarrhea, and healthy controls. For all antigens, precision profiles demonstrated <10% coefficient of variation (CV). Significant correlation was observed between microarray and ELISA in the quantification of antitoxin A and antitoxin B IgG. These results indicate that microarray is a suitable assay for defining humoral immune responses to C. difficile protein antigens and may have potential advantages in throughput, convenience, and cost. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Profiling Humoral Immune Responses to Clostridium difficile-Specific Antigens by Protein Microarray Analysis

    PubMed Central

    Negm, Ola H.; Hamed, Mohamed R.; Dilnot, Elizabeth M.; Shone, Clifford C.; Marszalowska, Izabela; Lynch, Mark; Loscher, Christine E.; Edwards, Laura J.; Tighe, Patrick J.; Wilcox, Mark H.

    2015-01-01

    Clostridium difficile is an anaerobic, Gram-positive, and spore-forming bacterium that is the leading worldwide infective cause of hospital-acquired and antibiotic-associated diarrhea. Several studies have reported associations between humoral immunity and the clinical course of C. difficile infection (CDI). Host humoral immune responses are determined using conventional enzyme-linked immunosorbent assay (ELISA) techniques. Herein, we report the first use of a novel protein microarray assay to determine systemic IgG antibody responses against a panel of highly purified C. difficile-specific antigens, including native toxins A and B (TcdA and TcdB, respectively), recombinant fragments of toxins A and B (TxA4 and TxB4, respectively), ribotype-specific surface layer proteins (SLPs; 001, 002, 027), and control proteins (tetanus toxoid and Candida albicans). Microarrays were probed with sera from a total of 327 individuals with CDI, cystic fibrosis without diarrhea, and healthy controls. For all antigens, precision profiles demonstrated <10% coefficient of variation (CV). Significant correlation was observed between microarray and ELISA in the quantification of antitoxin A and antitoxin B IgG. These results indicate that microarray is a suitable assay for defining humoral immune responses to C. difficile protein antigens and may have potential advantages in throughput, convenience, and cost. PMID:26178385

  5. Petri Net computational modelling of Langerhans cell Interferon Regulatory Factor Network predicts their role in T cell activation.

    PubMed

    Polak, Marta E; Ung, Chuin Ying; Masapust, Joanna; Freeman, Tom C; Ardern-Jones, Michael R

    2017-04-06

    Langerhans cells (LCs) are able to orchestrate adaptive immune responses in the skin by interpreting the microenvironmental context in which they encounter foreign substances, but the regulatory basis for this has not been established. Utilising systems immunology approaches combining in silico modelling of a reconstructed gene regulatory network (GRN) with in vitro validation of the predictions, we sought to determine the mechanisms of regulation of immune responses in human primary LCs. The key role of Interferon regulatory factors (IRFs) as controllers of the human Langerhans cell response to epidermal cytokines was revealed by whole transcriptome analysis. Applying Boolean logic we assembled a Petri net-based model of the IRF-GRN which provides molecular pathway predictions for the induction of different transcriptional programmes in LCs. In silico simulations performed after model parameterisation with transcription factor expression values predicted that human LC activation of antigen-specific CD8 T cells would be differentially regulated by epidermal cytokine induction of specific IRF-controlled pathways. This was confirmed by in vitro measurement of IFN-γ production by activated T cells. As a proof of concept, this approach shows that stochastic modelling of a specific immune networks renders transcriptome data valuable for the prediction of functional outcomes of immune responses.

  6. Malnutrition: Modulator of Immune Responses in Tuberculosis

    PubMed Central

    Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth

    2017-01-01

    Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710

  7. Polysaccharides from marine macroalga, Padina gymnospora improve the nonspecific and specific immune responses of Cyprinus carpio and protect it from different pathogens.

    PubMed

    Rajendran, Priyatharsini; Subramani, Parasuraman Aiya; Michael, Dinakaran

    2016-11-01

    Immunostimulation by plant-derived compounds presents a fascinating alternative to vaccines and antibiotics in aquaculture. Fish farmers are longing for immunostimulants that activate both specific and nonspecific immune responses of fish and protect fishes from all possible infections. In this study, we observed that polysaccharide fraction from marine macroalga, Padina gymnospora stimulated the immune response of common carp Cyprinus carpio (Filed for patent, Indian patent no. 201641027311 dated:10-Aug-2016). Our results indicate that fish fed with polysaccharides as feed supplement improved all the immune parameters tested which include serum lysozyme, myeloperoxidase activities and antibody response. Further, polysaccharide fraction protected the fish from its common bacterial pathogens namely Aeromonas hydrophila and Edwardsiella tarda with relative percent survival (RPS) values of 80 and 60 respectively. Gene expression studies, indicate that the immunostimulation by P. gymnospora might be at least in part due to the upregulation of the cytokine interleukin-1β (IL-1β) and antimicrobial peptide lysozyme-C. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. A short history of research on immunity to infectious diseases in fish.

    PubMed

    Van Muiswinkel, Willem B; Nakao, Miki

    2014-04-01

    This review describes the history of research on immunity to infectious diseases of fish in the period between 1965 and today. Special attention is paid to those studies, which are dealing with the interaction between immune system and invading pathogens in bony fish. Moreover, additional biographic information will be provided of people involved. In the 1960s and 1970s the focus of most studies was on humoral (Ig, B-cell) responses. Thorough studies on specific cellular (T-cell) responses and innate immunity (lectins, lysozyme, interferon, phagocytic cells) became available later. In the period between 1980 and today an overwhelming amount of data on regulation (e.g. cell cooperation, cytokines) and cell surface receptors (e.g. T-cell receptor; MHC) was published. It became also clear, that innate responses were often interacting with the acquired immune responses. Fish turned out to be vertebrates like all others with a sophisticated immune system showing specificity and memory. These basic data on the immune system could be applied in vaccination or in selection of disease resistant fish. Successful vaccines against bacterial diseases became available in the 1970s and 1980s. Effective anti-viral vaccines appeared from the 1980s onwards. There is no doubt, that Fish Immunology has become a flourishing science by the end of the 20th century and has contributed to our understanding of fish diseases as well as the success of aquaculture. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Immunobiography and the Heterogeneity of Immune Responses in the Elderly: A Focus on Inflammaging and Trained Immunity

    PubMed Central

    Franceschi, Claudio; Salvioli, Stefano; Garagnani, Paolo; de Eguileor, Magda; Monti, Daniela; Capri, Miriam

    2017-01-01

    Owing to its memory and plasticity, the immune system (IS) is capable of recording all the immunological experiences and stimuli it was exposed to. The combination of type, dose, intensity, and temporal sequence of antigenic stimuli that each individual is exposed to has been named “immunobiography.” This immunological history induces a lifelong continuous adaptation of the IS, which is responsible for the capability to mount strong, weak or no response to specific antigens, thus determining the large heterogeneity of immunological responses. In the last years, it is becoming clear that memory is not solely a feature of adaptive immunity, as it has been observed that also innate immune cells are provided with a sort of memory, dubbed “trained immunity.” In this review, we discuss the main characteristics of trained immunity as a possible contributor to inflammaging within the perspective of immunobiography, with particular attention to the phenotypic changes of the cell populations known to be involved in trained immunity. In conclusion, immunobiography emerges as a pervasive and comprehensive concept that could help in understanding and interpret the individual heterogeneity of immune responses (to infections and vaccinations) that becomes particularly evident at old age and could affect immunosenescence and inflammaging. PMID:28861086

  10. A mechanism for the induction of type 2 immune responses by a protease allergen in the genital tract.

    PubMed

    Oh, Ji Eun; Oh, Dong Sun; Jung, Hi Eun; Lee, Heung Kyu

    2017-02-14

    The genital mucosa is a barrier that is constantly exposed to a variety of pathogens, allergens, and external stimuli. Although both allergen exposure and parasite infections frequently occur in the genital area, the mechanism by which immune responses-particularly type 2 immunity-are induced has rarely been studied in the genital mucosa. Here, we demonstrate the induction of T helper type 2 (Th2) immunity in the genital mucosa in response to a model allergen, the protease papain. Intravaginal papain immunization induced type 2 immunity in a manner that was dependent on protease activity and the estrous phase of the mice. In addition, IL-33 was released from the vaginal epithelia after intravaginal papain immunization, leading to the activation of type 2 innate lymphoid cells (ILC2s). Moreover, the IL-33-MyD88 (myeloid differentiation primary response gene 88) signaling pathway was critical for the induction of type 2 immunity. We also found that Th2 differentiation in response to intravaginal papain treatment requires a specific dendritic cell (DC) subset that is controlled by interferon regulatory factor 4 (IRF4). These findings suggest that type 2 immunity is induced by a unique mechanism in the genital tract, which is an important, but often overlooked, barrier surface.

  11. CMV-Specific CD8 T Cell Differentiation and Localization: Implications for Adoptive Therapies.

    PubMed

    Smith, Corinne J; Quinn, Michael; Snyder, Christopher M

    2016-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous virus that causes chronic infection and, thus, is one of the most common infectious complications of immune suppression. Adoptive transfer of HCMV-specific T cells has emerged as an effective method to reduce the risk for HCMV infection and/or reactivation by restoring immunity in transplant recipients. However, the CMV-specific CD8 + T cell response is comprised of a heterogenous mixture of subsets with distinct functions and localization, and it is not clear if current adoptive immunotherapy protocols can reconstitute the full spectrum of CD8 + T cell immunity. The aim of this review is to briefly summarize the role of these T cell subsets in CMV immunity and to describe how current adoptive immunotherapy practices might affect their reconstitution in patients. The bulk of the CMV-specific CD8 + T cell population is made up of terminally differentiated effector T cells with immediate effector function and a short life span. Self-renewing memory T cells within the CMV-specific population retain the capacity to expand and differentiate upon challenge and are important for the long-term persistence of the CD8 + T cell response. Finally, mucosal organs, which are frequent sites of CMV reactivation, are primarily inhabited by tissue-resident memory T cells, which do not recirculate. Future work on adoptive transfer strategies may need to focus on striking a balance between the formation of these subsets to ensure the development of long lasting and protective immune responses that can access the organs affected by CMV disease.

  12. Specific serum antibody responses in channel catfish (Ictalurus punctatus) provide limited protection against Streptococcus ictaluri challenge

    USDA-ARS?s Scientific Manuscript database

    Passive immunization has been shown to provide a spectrum of protection against certain piscine pathogens, and studies were conducted to determine the role of specific antibodies in immunity to Streptococcus ictaluri. Adult Nile tilapia (Oreochromis niloticus) were injected i.p. with tryptic soy br...

  13. Evidence of a pro-apoptotic effect of specific antibodies in a bovine macrophage model of infection with Mycobacterium avium subsp. paratuberculosis.

    PubMed

    Jolly, Ana; Lompardía, Silvina; Hajos, Silvia E; Mundo, Silvia L

    2016-01-01

    Mycobacterium avium subspecies paratuberculosis (MAP) is the causative agent of Johne's disease (JD), a chronic granulomatous enteritis in ruminants. Understanding the protective immune response following infection is crucial to improve the diagnosis and the development of vaccines against this disease. The goal of this work was to assess whether specific antibodies were able to modulate the macrophage response to MAP infection by evaluating apoptosis and TNF-α secretion in an in vitro model. Sera from healthy (n=2), MAP-infected (n=3) and lipoarabinomannan (LAM)-immunized (n=3) bovines were evaluated. LAM was chosen as immunogen due to its relevant role in mycobacterial pathogenesis. We demonstrated by two different techniques (Acridine Orange/Ethidium Bromide microscopy and Annexin V/7-Amino-Actinomycin D flow cytometry) that the immune sera from both, MAP-infected and LAM-immunized bovines, significantly increased macrophage apoptosis in infected cultures. Comparable levels of apoptosis were detected when MAP was pre-incubated with purified specific antibodies instead of whole serum. Furthermore, this effect was accompanied by a significantly higher secretion of TNF-α. These results strongly suggest that specific antibodies could limit the impact of MAP on the apoptosis of bovine cells. This work would contribute to elucidate the role of the specific antibody response in bovine JD and its prevention. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Toll-like receptor-5 agonist, entolimod, suppresses metastasis and induces immunity by stimulating an NK-dendritic-CD8+ T-cell axis

    PubMed Central

    Brackett, Craig M.; Kojouharov, Bojidar; Veith, Jean; Greene, Kellee F.; Burdelya, Lyudmila G.; Gollnick, Sandra O.; Abrams, Scott I.; Gudkov, Andrei V.

    2016-01-01

    Activation of an anticancer innate immune response is highly desirable because of its inherent ability to generate an adaptive antitumor T-cell response. However, insufficient safety of innate immune modulators limits clinical use to topical applications. Toll-like receptor 5 (TLR5) agonists are favorably positioned as potential systemic immunotherapeutic agents because of unusual tissue specificity of expression, uniquely safe profile of induced cytokines, and antitumor efficacy demonstrated in a number of animal models. Here, we decipher the molecular and cellular events underlying the metastasis suppressive activity of entolimod, a clinical stage TLR5 agonist that activates NF-κB–, AP-1–, and STAT3–driven immunomodulatory signaling pathways specifically within the liver. Used as a single agent in murine colon and mammary metastatic cancer models, entolimod rapidly induces CXCL9 and -10 that support homing of blood-borne CXCR3-expressing NK cells to the liver predominantly through an IFN-γ signaling independent mechanism. NK cell-dependent activation of dendritic cells is followed by stimulation of a CD8+ T-cell response, which exert both antimetastatic effect of entolimod and establishment of tumor-specific and durable immune memory. These results define systemically administered TLR5 agonists as organ-specific immunoadjuvants, enabling efficient antitumor vaccination that does not depend on identification of tumor-specific antigens. PMID:26831100

  15. Fungal mediated innate immune memory, what have we learned?

    PubMed

    Quintin, Jessica

    2018-05-30

    The binary classification of mammalian immune memory is now obsolete. Innate immune cells carry memory characteristics. The overall capacity of innate immune cells to remember and alter their responses is referred as innate immune memory and the induction of a non-specific memory resulting in an enhanced immune status is termed "trained immunity". Historically, trained immunity was first described as triggered by the human fungal pathogen Candida albicans. Since, numerous studies have accumulated and deciphered the main characteristics of trained immunity mediated by fungi and fungal components. This review aims at presenting the newly described aspect of memory in innate immunity with an emphasis on the historically fungal mediated one, covering the known molecular mechanisms associated with training. In addition, the review uncovers the numerous non-specific effect that β-glucans trigger in the context of infectious diseases and septicaemia, inflammatory diseases and cancer. Copyright © 2018. Published by Elsevier Ltd.

  16. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

    PubMed

    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

    2005-08-01

    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  17. No long-term evidence of hyporesponsiveness after use of pneumococcal conjugate vaccine in children previously immunized with pneumococcal polysaccharide vaccine.

    PubMed

    Licciardi, Paul V; Toh, Zheng Quan; Clutterbuck, Elizabeth A; Balloch, Anne; Marimla, Rachel A; Tikkanen, Leena; Lamb, Karen E; Bright, Kathryn J; Rabuatoka, Uraia; Tikoduadua, Lisi; Boelsen, Laura K; Dunne, Eileen M; Satzke, Catherine; Cheung, Yin Bun; Pollard, Andrew J; Russell, Fiona M; Mulholland, Edward K

    2016-06-01

    A randomized controlled trial in Fiji examined the immunogenicity and effect on nasopharyngeal carriage after 0, 1, 2, or 3 doses of 7-valent pneumococcal conjugate vaccine (PCV7; Prevnar) in infancy followed by 23-valent pneumococcal polysaccharide vaccine (23vPPV; Pneumovax) at 12 months of age. At 18 months of age, children given 23vPPV exhibited immune hyporesponsiveness to a micro-23vPPV (20%) challenge dose in terms of serotype-specific IgG and opsonophagocytosis, while 23vPPV had no effect on vaccine-type carriage. This follow-up study examined the long-term effect of the 12-month 23vPPV dose by evaluating the immune response to 13-valent pneumococcal conjugate vaccine (PCV13) administration 4 to 5 years later. Blood samples from 194 children (now 5-7 years old) were taken before and 28 days after PCV13 booster immunization. Nasopharyngeal swabs were taken before PCV13 immunization. We measured levels of serotype-specific IgG to all 13 vaccine serotypes, opsonophagocytosis for 8 vaccine serotypes, and memory B-cell responses for 18 serotypes before and after PCV13 immunization. Paired samples were obtained from 185 children. There were no significant differences in the serotype-specific IgG, opsonophagocytosis, or memory B-cell response at either time point between children who did or did not receive 23vPPV at 12 months of age. Nasopharyngeal carriage of PCV7 and 23vPPV serotypes was similar among the groups. Priming with 1, 2, or 3 PCV7 doses during infancy did not affect serotype-specific immunity or carriage. Immune hyporesponsiveness induced by 23vPPV in toddlers does not appear to be sustained among preschool children in this context and does not affect the pneumococcal carriage rate in this age group. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  18. Let’s Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse

    PubMed Central

    Bennett, Kaila M.; Rooijakkers, Suzan H. M.; Gorham, Ronald D.

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement. PMID:28197139

  19. Let's Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse.

    PubMed

    Bennett, Kaila M; Rooijakkers, Suzan H M; Gorham, Ronald D

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement.

  20. Strain-specific protective immunity following vaccination against experimental Trypanosoma cruzi infection.

    PubMed

    Haolla, Filipe A; Claser, Carla; de Alencar, Bruna C G; Tzelepis, Fanny; de Vasconcelos, José Ronnie; de Oliveira, Gabriel; Silvério, Jaline C; Machado, Alexandre V; Lannes-Vieira, Joseli; Bruna-Romero, Oscar; Gazzinelli, Ricardo T; dos Santos, Ricardo Ribeiro; Soares, Milena B P; Rodrigues, Mauricio M

    2009-09-18

    Immunisation with Amastigote Surface Protein 2 (asp-2) and trans-sialidase (ts) genes induces protective immunity in highly susceptible A/Sn mice, against infection with parasites of the Y strain of Trypanosoma cruzi. Based on immunological and biological strain variations in T. cruzi parasites, our goal was to validate our vaccination results using different parasite strains. Due to the importance of the CD8(+) T cells in protective immunity, we initially determined which strains expressed the immunodominant H-2K(k)-restricted epitope TEWETGQI. We tested eight strains, four of which elicited immune responses to this epitope (Y, G, Colombian and Colombia). We selected the Colombian and Colombia strains for our studies. A/Sn mice were immunised with different regimens using both T. cruzi genes (asp-2 and ts) simultaneously and subsequently challenged with blood trypomastigotes. Immune responses before the challenge were confirmed by the presence of specific antibodies and peptide-specific T cells. Genetic vaccination did not confer protective immunity against acute infection with a lethal dose of the Colombian strain. In contrast, we observed a drastic reduction in parasitemia and a significant increase in survival, following challenge with an otherwise lethal dose of the Colombia strain. In many surviving animals with late-stage chronic infection, we observed alterations in the heart's electrical conductivity, compared to naive mice. In summary, we concluded that immunity against T. cruzi antigens, similar to viruses and bacteria, may be strain-specific and have a negative impact on vaccine development.

Top