Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Simultaneous Amplicon Sequencing to Explore Co-Occurrence Patterns of Bacterial, Archaeal and Eukaryotic Microorganisms in Rumen Microbial Communities

PubMed Central

Kittelmann, Sandra; Seedorf, Henning; Walters, William A.; Clemente, Jose C.; Knight, Rob; Gordon, Jeffrey I.; Janssen, Peter H.

2013-01-01

Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats. PMID:23408926

Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities.

PubMed

Kittelmann, Sandra; Seedorf, Henning; Walters, William A; Clemente, Jose C; Knight, Rob; Gordon, Jeffrey I; Janssen, Peter H

2013-01-01

Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats.

Thinopyrum 7Ai-1-derived small chromatin with Barley Yellow Dwarf Virus (BYDV) resistance gene integrated into the wheat genome with retrotransposon.

PubMed

Ma, Y-Z; Tomita, M

2013-01-01

Thinopyrum intermedium is a useful source of resistance genes for Barley Yellow Dwarf Virus (BYDV), one of the most damaging wheat diseases. In this study, wheat/Th. intermedium translocation lines with a BYDV resistance gene were developed using the Th. intermedium 7Ai- 1 chromosome. Genomic in situ hybridization (GISH), using a Th. intermedium total genomic DNA probe, enabled detection of 7Ai-1-derived small chromatins containing a BYDV resistance gene, which were translocated onto the end of wheat chromosomes in the lines Y95011 and Y960843. Random amplified polymorphic DNA (RAPD) analyses using 120 random 10-mer primers were conducted to compare the BYDV-resistant translocation lines with susceptible lines. Two primers amplified the DNA fragments specific to the resistant line that would be useful as molecular markers to identify 7Ai-1-derived BYDV resistance chromatin in the wheat genome. Additionally, the isolated Th. intermedium-specific retrotransposon-like sequence pTi28 can be used to identify Th. intermedium chromatin transferred to the wheat genome.

Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

PubMed

Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

2018-01-01

Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

PubMed Central

2012-01-01

Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

PubMed Central

Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

2006-01-01

PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

PubMed Central

Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

2016-01-01

Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

A novel non-sequencing approach for rapid authentication of Testudinis Carapax et Plastrum and Trionycis Carapax by species-specific primers

PubMed Central

Yu, Pingtian; Lu, Yi; Jiao, Zhaoqun; Chen, Liqun; Zhou, Ying; Shen, Yuping; Jia, Xiaobin

2018-01-01

A novel non-sequencing approach was developed to detect short DNA fragments (ca 100 bp) for rapid authentication of two natural products, namely Testudinis Carapax et Plastrum and Trionycis Carapax, based on the difference in mitochondrial genome. Five specifically designed primer reactions were established to target species for reliable identification of their commercial products. They were confirmed to have a high level of inter-species-specificity and good intra-species stability. The limit of detection was estimated to be 1 ng of genomes for all of five assays. Also, the validation results demonstrated that the raw materials and processed products in addition to some of the highly processed products can be conveniently authenticated with good sensitivity and precision by this newly proposed approach. Especially, when reference sample mixtures were assayed, these primer sets have still performed well but not the prevailing COI barcoding technology. These could assist in the discrimination and identification of other animal-derived medicines for their form of raw material, the pulverized and the complex. PMID:29765667

In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

PubMed

Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

2003-03-01

SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

Multiprimer PCR system for differential identification of mycobacteria in clinical samples.

PubMed Central

Del Portillo, P; Thomas, M C; Martínez, E; Marañón, C; Valladares, B; Patarroyo, M E; Carlos López, M

1996-01-01

A novel multiprimer PCR method with the potential to identify mycobacteria in clinical samples is presented. The assay relies on the simultaneous amplification of three bacterial DNA genomic fragments by using different sets of oligonucleotide primers. The first set of primers amplifies a 506-bp fragment from the gene for the 32-kDa antigen of Mycobacterium tuberculosis, which is present in most of the species belonging to the genus Mycobacterium. The second set of primers amplifies a 984-bp fragment from the IS6110 insertion sequence of the bacteria belonging to the M. tuberculosis complex. The third set of primers, derived from an M. tuberculosis species-specific sequence named MTP40, amplifies a 396-bp genomic fragment. Thus, while the multiprimer system would render three amplification fragments from the M. tuberculosis genome and two fragments from the Mycobacterium bovis genome, a unique amplification fragment would be obtained from nontuberculous mycobacteria. The results obtained, using reference mycobacterial strains and typed clinical isolates, show that the multiprimer PCR method may be a rapid, sensitive, and specific tool for the differential identification of various mycobacterial strains in a single-step assay. PMID:8789008

Development of Fluorescent Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) using Quenching Probes for the Detection of the Middle East Respiratory Syndrome Coronavirus.

PubMed

Shirato, Kazuya; Semba, Shohei; El-Kafrawy, Sherif A; Hassan, Ahmed M; Tolah, Ahmed M; Takayama, Ikuyo; Kageyama, Tsutomu; Notomi, Tsugunori; Kamitani, Wataru; Matsuyama, Shutoku; Azhar, Esam Ibraheem

2018-05-12

Clinical detection of Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV) in patients is achieved using genetic diagnostic methods, such as real-time RT-PCR assay. Previously, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of MERS-CoV [Virol J. 2014. 11:139]. Generally, amplification of RT-LAMP is monitored by the turbidity induced by precipitation of magnesium pyrophosphate with newly synthesized DNA. However, this mechanism cannot completely exclude the possibility of unexpected reactions. Therefore, in this study, fluorescent RT-LAMP assays using quenching probes (QProbes) were developed specifically to monitor only primer-derived signals. Two primer sets (targeting nucleocapsid and ORF1a sequences) were constructed to confirm MERS cases by RT-LAMP assay only. Our data indicate that both primer sets were capable of detecting MERS-CoV RNA to the same level as existing genetic diagnostic methods, and that both were highly specific with no cross-reactivity observed with other respiratory viruses. These primer sets were highly efficient in amplifying target sequences derived from different MERS-CoV strains, including camel MERS-CoV. In addition, the detection efficacy of QProbe RT-LAMP was comparable to that of real-time RT-PCR assay using clinical specimens from patients in Saudi Arabia. Altogether, these results indicate that QProbe RT-LAMP assays described here can be used as powerful diagnostic tools for rapid detection and surveillance of MERS-CoV infections. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

PubMed

Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

2000-06-15

Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

[Isolation and identification of specific sequences correlated to cytoplasmic male sterility and fertile maintenance in cauliflower (Brassica oleracea var. botrytis)].

PubMed

Wang, Chun Guo; Chen, Xiao Qiang; Li, Hui; Zhao, Qian Cheng; Sun, De Ling; Song, Wen Qin

2008-02-01

Analysis of ISSR (Inter-Simple Sequence Repeat) and DDRT-PCR (Differential Display Reverse Transcriptase Polymerase Chain Reaction) was performed between cytoplasmic male sterility cauliflower ogura-A and its corresponding maintainer line ogura-B. Totally, 306 detectable bands were obtained by ISSR using thirty oligonucleotide primers. Commonly, six to twelve bands were produced per primer. Among all these primers only the amplification of primer ISSR3 was polymorphic, an 1100 bp specific band was only detected in maintainer line, named ISSR3(1100). Analysis of this sequence indicated that ISSR3(1100) was high homologous with the corresponding sequences of mitochondrial genome in Brassica napus and Arabidopsis thaliana,which suggested that ISSR3(1100) may derive from mitochondrial genome in cauliflower. To carry out DDRT-PCR analysis, three anchor primers and fifteen random primers were selected to combine. Totally, 1122 bands from 1 000 bp to 50 bp were detected. However, only four bands, named ogura-A 205, ogura-A383, ogura-B307 and ogura-B352, were confirmed to be different display in both lines. This result was further identified by reverse Northern dot blotting analysis. Among these four bands, ogura-A205 and ogura-A383 only express in cytoplasmic male sterility line, while ogura-B307 and ogura-B352 were only detected in maintainer line. Analysis of these sequences indicated that it was the first time that these four sequences were reported in cauliflower. Interestingly, ogura-A205 and ogura-B307 did not exhibit any similarities to other reported sequences in other species, more investigations were required to obtain further information. ogura-A383 and ogura-B352 were also two new sequences, they showed high similarities to corresponding chloroplast sequences of Arabidopsis thaliana and Brassica rapa subsp. pekinensis. So we speculated that these two sequences may derive from chloroplast genome. All these results obtained in this study offer new and significant information to investigate the molecular mechanism of cytoplasmic male sterility and fertile maintenance in cauliflower.

The significance of gtf genes in caries expression: a rapid identification of Streptococcus mutans from dental plaque of child patients.

PubMed

Mishra, Apurva; Pandey, Ramesh K; Manickam, Natesan

2015-01-01

Rapid phylogenetic and functional gene (gtfB) identification of S. mutans from the dental plaque derived from children. Dental plaque collected from fifteen patients of age group 7-12 underwent centrifugation followed by genomic DNA extraction for S. mutans. Genomic DNA was processed with S. mutans specific primers in suitable PCR condtions for phylogenetic and functional gene (gtfB) identification. The yield and results were confirmed by agarose gel electrophoresis. 1% agarose gel electrophoresis depicts the positive PCR amplification at 1,485 bp when compared with standard 1 kbp indicating the presence of S. mutans in the test sample. Another PCR reaction was set using gtfB primers specific for S. mutans for functional gene identification. 1.2% agarose gel electrophoresis was done and a positive amplication was observed at 192 bp when compared to 100 bp standards. With the advancement in molecular biology techniques, PCR based identification and quantification of the bacterial load can be done within hours using species-specific primers and DNA probes. Thus, this technique may reduce the laboratory time spend in conventional culture methods, reduces the possibility of colony identification errors and is more sensitive to culture techniques.

Characterization of EST-derived and non-EST simple sequence repeats in an F₁ hybrid population of Vitis vinifera L.

PubMed

Kayesh, E; Bilkish, N; Liu, G S; Chen, W; Leng, X P; Fang, J G

2014-03-31

Among different classes of molecular markers, expressed sequence tags (ESTs) are a new resource for developing simple sequence repeat (SSR) functional markers for genotyping and genetic mapping in F1 hybrid populations of Vitis vinifera L. Recently, because of the availability of an enormous amount of data for ESTs in the public domain, the emphasis has shifted from genomic SSRs to EST-SSRs, which belong to transcribed regions of the genome and may have a role in gene expression or function. The objective of this study was to assess the polymorphisms among 94 F1 hybrids from "Early Rose" and "Red Globe" using 25 EST-derived and 25 non-EST SSR markers. A total collection of 362,375 grape ESTs that were retrieved from the National Center for Biotechnology Information (NCBI) and 2522 EST-SSR sequences were identified. From them, 205 primer pairs were randomly selected, including 176 pairs that were EST-derived and 29 non-EST SSR primer pairs, for polymerase chain reaction amplification. A total of 131 alleles were amplified using 50 pairs of primers; 78 alleles were amplified using EST-derived SSR primers and 53 were from non-EST SSR primers. At most, 6 and 5 alleles were amplified by EST-derived and non-EST SSR primers, respectively. The EST-derived SSR markers showed a maximum polymorphic information content (PIC) value of 1 and a minimum of 0.33 while non-EST SSR markers had maximum and minimum PIC values of 1 and 0.25, respectively. The average PIC value was 0.56 for EST-derived SSR markers and 0.45 for non-EST SSR markers.

Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

PubMed Central

Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

2005-01-01

Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

PubMed

Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

2017-04-01

The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

PubMed Central

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

PubMed

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

PubMed

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

[A new variant of the simian T-lymphotropic retrovirus type I (STLV-IF) in the Sukhumi colony of hamadryas baboons].

PubMed

Chikobaeva, M G; Schatzl, H; Rose, D; Bush, U; Iakovleva, L A; Deinhardt, F; Helm, K; Lapin, B A

1993-01-01

Polymerase chain reaction (PCR) was developed for the detection of simian T-lymphotropic virus type 1 (STLV-1) infection of P. hamadryas and direct sequencing using oligo-nucleotide primer pairs specific for the tax and env regions of the related human T-lymphotropic virus type 1 (HTLV-1). Excellent specificity was shown in the detection of STLV-1 provirus in infected baboons by PCR using HTLV-1-derived primers. The nucleotide sequences of env 467bp and tax 159bp of the proviral genome (env position 5700-6137, tax position 7373-7498 HTLV-1, according to Seiki et al., 1983) derived from STLV-1-infected P. hamadryas were analysed using PCR and direct sequencing techniques. Two STLV-1 isolates from different sources (Sukhumi main-SuTLV-1 and forest stocks-STLV-1F) were compared. Two variants of STLV-1 among P. hamadryas with different level of homology to HTLV-1 were wound (83.8% and 95.2%, respectively). A possible role of nucleotide changes in env and tax sequenced fragments and oncogenicity of STLV-1 variants is discussed.

Assay Design Affects the Interpretation of T-Cell Receptor Gamma Gene Rearrangements

PubMed Central

Cushman-Vokoun, Allison M.; Connealy, Solomon; Greiner, Timothy C.

2010-01-01

Interpretation of capillary electrophoresis results derived from multiplexed fluorochrome-labeled primer sets can be complicated by small peaks, which may be incorrectly interpreted as clonal T-cell receptor-γ gene rearrangements. In this report, different assay designs were used to illustrate how design may adversely affect specificity. Ten clinical cases, with subclonal peaks containing one of the two infrequently used joining genes, were identified with a tri-color, one-tube assay. The DNA was amplified with the same NED fluorochrome on all three joining primers, first combined (one-color assay) and then amplified separately using a single NED-labeled joining primer. The single primer assay design shows how insignificant peaks could easily be wrongly interpreted as clonal T-cell receptor-γ gene rearrangements. Next, the performance of the one-tube assay was compared with the two-tube BIOMED-2-based TCRG Gene Clonality Assay in a series of 44 cases. Whereas sensitivity was similar between the two methods (92.9% vs. 96.4%; P = 0.55), specificity was significantly less in the BIOMED-2 assay (87.5% vs. 56.3%; P = 0.049) when a 2× ratio was used to define clonality. Specificity was improved to 81.3% by the use of a 5× peak height ratio (P = 0.626). These findings illustrate how extra caution is needed in interpreting a design with multiple, separate distributions, which is more difficult to interpret than a single distribution assay. PMID:20959612

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

PubMed

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Design of primers and probes for quantitative real-time PCR methods.

PubMed

Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

2015-01-01

Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

PubMed Central

Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

1996-01-01

In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

URPD: a specific product primer design tool

PubMed Central

2012-01-01

Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

URPD: a specific product primer design tool.

PubMed

Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

2012-06-19

Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

Development of a rapid HRM genotyping method for detection of dog-derived Giardia lamblia.

PubMed

Tan, Liping; Yu, Xingang; Abdullahi, Auwalu Yusuf; Wu, Sheng; Zheng, Guochao; Hu, Wei; Song, Meiran; Wang, Zhen; Jiang, Biao; Li, Guoqing

2015-11-01

Giardia lamblia is a zoonotic flagellate protozoan in the intestine of human and many mammals including dogs. To assess a threat of dog-derived G. lamblia to humans, the common dog-derived G. lamblia assemblages A, C, and D were genotyped by high-resolution melting (HRM) technology. According to β-giardin gene sequence, the qPCR-HRM primers BG5 and BG7 were designed. A series of experiments on the stability, sensitivity, and accuracy of the HRM method were also tested. Results showed that the primers BG5 and BG7 could distinguish among three assemblages A, C, and D, which Tm value differences were about 1 °C to each other. The melting curves of intra-assay reproducibility were almost coincided, and those of inter-assay reproducibility were much the same shape. The lowest detection concentration was about 5 × 10(-6)-ng/μL sample. The genotyping results from 21 G. lamblia samples by the HRM method were in complete accordance with sequencing results. It is concluded that the HRM genotyping method is rapid, stable, specific, highly sensitive, and suitable for clinical detection and molecular epidemiological survey of dog-derived G. lamblia.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

PubMed

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Multiplex PCR for the Detection of Lactobacillus pontis and Two Related Species in a Sourdough Fermentation

PubMed Central

Müller, Martin R. A.; Ehrmann, Matthias A.; Vogel, Rudi F.

2000-01-01

A specific multiplex PCR assay based on the amplification of parts of the 16S rRNA molecule was designed. Primers derived from variable regions of the 16S rRNA provided a means of easily differentiating the species Lactobacillus pontis and Lactobacillus panis. They could be clearly discriminated from the phylogenetically related species Lactobacillus vaginalis, Lactobacillus oris, and Lactobacillus reuteri and from other lactobacilli commonly known to be present in sourdough. Other strains isolated together with L. pontis from an industrial sourdough fermentation could be clearly separated from these species by comparative sequence analysis and construction of a specific PCR primer. For a fast identification a DNA isolation protocol based on the ultrasonic lysis of cells from single colonies was developed. To demonstrate the potential of such techniques for tracking these organisms in a laboratory-scale fermentation, we combined the specific PCR assay with direct DNA extraction from the organisms in the sourdough without previous cultivation. PMID:10788389

Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

PubMed

Lee, Chang Soo; Lee, Jiyoung

2010-09-01

A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae)

PubMed Central

2010-01-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

PubMed

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

PubMed Central

Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C.; Chorianopoulos, Nikos

2015-01-01

Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry. PMID:26506345

Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

PubMed

Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

2015-10-22

Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

The problems and promise of DNA barcodes for species diagnosis of primate biomaterials

PubMed Central

Lorenz, Joseph G; Jackson, Whitney E; Beck, Jeanne C; Hanner, Robert

2005-01-01

The Integrated Primate Biomaterials and Information Resource (www.IPBIR.org) provides essential research reagents to the scientific community by establishing, verifying, maintaining, and distributing DNA and RNA derived from primate cell cultures. The IPBIR uses mitochondrial cytochrome c oxidase subunit I sequences to verify the identity of samples for quality control purposes in the accession, cell culture, DNA extraction processes and prior to shipping to end users. As a result, IPBIR is accumulating a database of ‘DNA barcodes’ for many species of primates. However, this quality control process is complicated by taxon specific patterns of ‘universal primer’ failure, as well as the amplification or co-amplification of nuclear pseudogenes of mitochondrial origins. To overcome these difficulties, taxon specific primers have been developed, and reverse transcriptase PCR is utilized to exclude these extraneous sequences from amplification. DNA barcoding of primates has applications to conservation and law enforcement. Depositing barcode sequences in a public database, along with primer sequences, trace files and associated quality scores, makes this species identification technique widely accessible. Reference DNA barcode sequences should be derived from, and linked to, specimens of known provenance in web-accessible collections in order to validate this system of molecular diagnostics. PMID:16214744

Translesion synthesis past equine estrogen-derived 2'-deoxycytidine DNA adducts by human DNA polymerases eta and kappa.

PubMed

Suzuki, Naomi; Yasui, Manabu; Santosh Laxmi, Y R; Ohmori, Haruo; Hanaoka, Fumio; Shibutani, Shinya

2004-09-07

Estrogen replacement therapy (ERT), composed of equilenin, is associated with increased risk of breast, ovarian, and endometrial cancers. Several diastereoisomers of unique dC and dA DNA adducts were derived from 4-hydroxyequilenin (4-OHEN), a metabolite of equilenin, and have been detected in women receiving ERT. To explore the miscoding property of 4-OHEN-dC adduct, site-specifically modified oligodeoxynucleotides (Pk-1, Pk-2, Pk-3, and Pk-4) containing a single diastereoisomer of 4-OHEN-dC were prepared by a postsynthetic method. Among them, major 4-OHEN-dC-modified oligodeoxynucleotides (Pk-3 and Pk-4) were used to prepare the templates for primer extension reactions catalyzed by DNA polymerase (pol) alpha, pol eta, and pol kappa. Primer extension was retarded one base prior to the lesion and opposite the lesion; stronger blockage was observed with pol alpha, while with human pol eta or pol kappa, a fraction of the primers was extended past the lesion. Steady-state kinetic studies showed that both pol kappa and pol eta inserted dCMP and dAMP opposite the 4-OHEN-dC and extended past the lesion. Never or less-frequently, dGMP, the correct base, was inserted opposite the lesion. The relative bypass frequency past the 4-OHEN-dC lesion with pol eta was at least 3 orders of magnitude higher than that for pol kappa, as observed for primer extension reactions. The bypass frequency past the dA.4-OHEN-dC adduct in Pk-4 was 2 orders of magnitude more efficient than that past the adduct in Pk-3. Thus, 4-OHEN-dC is a highly miscoding lesion capable of generating C --> T transitions and C --> G transversions. The miscoding frequency and specificity of 4-OHEN-dC were strikingly influenced by the adduct stereochemistry and DNA polymerase used.

A tool for design of primers for microRNA-specific quantitative RT-qPCR.

PubMed

Busk, Peter K

2014-01-28

MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

DOEpatents

McKinney, Nancy

2002-01-01

PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

PubMed

Villard, Pierre; Malausa, Thibaut

2013-07-01

SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

PubMed

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

PubMed Central

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.

PubMed

Khadhair, A H; Evans, I R; Choban, B

2002-01-01

In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.

Effects of soldier-derived terpenes on soldier caste differentiation in the termite Reticulitermes flavipes.

PubMed

Tarver, Matthew R; Schmelz, Eric A; Rocca, James R; Scharf, Michael E

2009-02-01

Primer pheromones play key roles in regulating division of labor, which is a fundamental and defining aspect of insect sociality. Primer pheromones are chemical messengers that transmit hormone-like messages among colony members; in recipients, these messages can either induce or suppress phenotypic caste differentiation. Here, we investigated soldier caste-derived chemicals as possible primer pheromones in the lower termite Reticulitermes flavipes, a species for which no primer pheromones have yet been identified. We determined that soldier head extracts (SHE), when provided to totipotent workers along with the insect morphogenetic juvenile hormone (JH), significantly enhanced soldier caste differentiation. When applied alone, however, SHE had no impacts on caste differentiation, survivorship, or any other aspect of worker biology. These findings support a function of soldier chemicals as primer pheromones that enhance the action of the endogenous JH. In accord with previous studies, gamma-cadinene and the corresponding aldehyde, gamma-cadinenal, were identified by gas chromatography-mass spectrometry and nuclear magnetic resonance analyses as the two most abundant components of R. flavipes SHE. Validative bioassays with commercially available cadinene confirmed activity. Several other terpenes, previously identified in R. flavipes soldiers, also were found to be active. These findings reveal a novel primer pheromone-like function for soldier-derived terpenes in termites and further suggest convergent evolution of terpene functions in enhancing JH-dependent soldier caste differentiation.

GSP: A web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

PubMed

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system

PubMed Central

2018-01-01

Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254

Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

PubMed

Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2011-01-01

A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

PubMed

Campos, Maria Jorge; Quesada, Alberto

2017-01-01

PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

PubMed

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

PubMed Central

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

PubMed

Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

2015-06-01

Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

PubMed Central

2009-01-01

Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

A Transcriptome Derived Female-Specific Marker from the Invasive Western Mosquitofish (Gambusia affinis)

PubMed Central

Lamatsch, Dunja K.; Adolfsson, Sofia; Senior, Alistair M.; Christiansen, Guntram; Pichler, Maria; Ozaki, Yuichi; Smeds, Linnea; Schartl, Manfred; Nakagawa, Shinichi

2015-01-01

Sex-specific markers are a prerequisite for understanding reproductive biology, genetic factors involved in sex differences, mechanisms of sex determination, and ultimately the evolution of sex chromosomes. The Western mosquitofish, Gambusia affinis, may be considered a model species for sex-chromosome evolution, as it displays female heterogamety (ZW/ZZ), and is also ecologically interesting as a worldwide invasive species. Here, de novo RNA-sequencing on the gonads of sexually mature G. affinis was used to identify contigs that were highly transcribed in females but not in males (i.e., transcripts with ovary-specific expression). Subsequently, 129 primer pairs spanning 79 contigs were tested by PCR to identify sex-specific transcripts. Of those primer pairs, one female-specific DNA marker was identified, Sanger sequenced and subsequently validated in 115 fish. Sequence analyses revealed a high similarity between the identified sex-specific marker and the 3´ UTR of the aminomethyl transferase (amt) gene of the closely related platyfish (Xiphophorus maculatus). This is the first time that RNA-seq has been used to successfully characterize a sex-specific marker in a fish species in the absence of a genome map. Additionally, the identified sex-specific marker represents one of only a handful of such markers in fishes. PMID:25707007

Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

PubMed

Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

2017-12-02

DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

PubMed Central

Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

2018-01-01

MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

Development of T m -shift genotyping method for detection of cat-derived Giardia lamblia.

PubMed

Pan, Weida; Fu, Yeqi; Abdullahi, Auwalu Yusuf; Wang, Mingwei; Shi, Xianli; Yang, Fang; Yu, Xingang; Yan, Xinxin; Zhang, Pan; Hang, Jianxiong; Li, Guoqing

2017-04-01

To develop T m -shift genotyping method for detection of cat-derived Giardia lamblia, two sets of primers with two GC-rich tails of unequal length attached to their 5'-end were designed according to two SNPs (BG434 and BG170) of β-giardin (bg) gene, and specific PCR products were identified by inspection of a melting curve on real-time PCR thermocycler. A series of experiments on the stability, sensitivity, and accuracy of T m -shift method was tested, and clinical samples were also detected. The results showed that two sets of primers based on SNP could distinguish accurately between assemblages A and F. Coefficient of variation of T m values of assemblage A and F was 0.14 and 0.07% in BG434 and 0.10 and 0.11% in BG170, respectively. The lowest detection concentration was 4.52 × 10 -5 and 4.88 × 10 -5  ng/μL samples of assemblage A and F standard plasmids. The T m -shift genotyping results of ten DNA samples from the cat-derived G. lamblia were consistent with their known genotypes. The detection rate of clinical samples by T m -shift was higher than that by microscopy, and their genotyping results were in complete accordance with sequencing results. It is concluded that the T m -shift genotyping method is rapid, specific, and sensitive and may provide a new technological mean for molecular detection and epidemiological investigation of the cat-derived G. lamblia.

Host-Feeding Preference of the Mosquito, Culex quinquefasciatus, in Yucatan State, Mexico

PubMed Central

Garcia-Rejon, Julian E.; Blitvich, Bradley J.; Farfan-Ale, Jose A.; Loroño-Pino, Maria A.; Chi Chim, Wilberth A.; Flores-Flores, Luis F.; Rosado-Paredes, Elsy; Baak-Baak, Carlos; Perez-Mutul, Jose; Suarez-Solis, Victor; Fernandez-Salas, Ildefonso; Beaty, Barry J.

2010-01-01

Studies were conducted to determine the host-feeding preference of Culex quinquefasciatus Say (Diptera: Culicidae) in relation to the availability of human and domestic animals in the city of Merida, Yucatan State, Mexico. Mosquitoes were collected in the backyards of houses using resting wooden boxes. Collections were made five times per week from January to December 2005. DNA was extracted from engorged females and tested by PCR using universal avian- and mammalian-specific primers. DNA extracted from avian-derived blood was further analyzed by PCR using primers that differentiate among the birds of three avian orders: Passeriformes, Columbiformes and Galliformes. PCR products obtained from mammalian-derived blood were subjected to restriction enzyme digestion to differentiate between human-, dog-, cat-, pig-, and horse-derived blood meals. Overall, 82% of engorged mosquitoes had fed on birds, and 18% had fed on mammals. The most frequent vertebrate hosts were Galliformes (47.1%), Passeriformes (23.8%), Columbiformes (11.2%) birds, and dogs (8.8%). The overall human blood index was 6.7%. The overall forage ratio for humans was 0.1, indicating that humans were not a preferred host for Cx. quinquefasciatus in Merida. PMID:20578953

Host-feeding preference of the mosquito, Culex quinquefasciatus, in Yucatan State, Mexico.

PubMed

Garcia-Rejon, Julian E; Blitvich, Bradley J; Farfan-Ale, Jose A; Loroño-Pino, Maria A; Chi Chim, Wilberth A; Flores-Flores, Luis F; Rosado-Paredes, Elsy; Baak-Baak, Carlos; Perez-Mutul, Jose; Suarez-Solis, Victor; Fernandez-Salas, Ildefonso; Beaty, Barry J

2010-01-01

Studies were conducted to determine the host-feeding preference of Culex quinquefasciatus Say (Diptera: Culicidae) in relation to the availability of human and domestic animals in the city of Merida, Yucatan State, Mexico. Mosquitoes were collected in the backyards of houses using resting wooden boxes. Collections were made five times per week from January to December 2005. DNA was extracted from engorged females and tested by PCR using universal avian- and mammalian-specific primers. DNA extracted from avian-derived blood was further analyzed by PCR using primers that differentiate among the birds of three avian orders: Passeriformes, Columbiformes and Galliformes. PCR products obtained from mammalian-derived blood were subjected to restriction enzyme digestion to differentiate between human-, dog-, cat-, pig-, and horse-derived blood meals. Overall, 82% of engorged mosquitoes had fed on birds, and 18% had fed on mammals. The most frequent vertebrate hosts were Galliformes (47.1%), Passeriformes (23.8%), Columbiformes (11.2%) birds, and dogs (8.8%). The overall human blood index was 6.7%. The overall forage ratio for humans was 0.1, indicating that humans were not a preferred host for Cx. quinquefasciatus in Merida.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, H.U.G.; Gray, J.W.

1995-06-27

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, Heinz-Ulrich G.; Gray, Joe W.

1995-01-01

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

PubMed

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Implementation of Novel Design Features for qPCR-Based eDNA Assessment

PubMed Central

Veldhoen, Nik; Hobbs, Jared; Ikonomou, Georgios; Hii, Michael; Lesperance, Mary; Helbing, Caren C.

2016-01-01

Environmental stewardship requires timely, accurate information related to the status of a given ecosystem and the species that occupy it. Recent advances in the application of the highly sensitive real-time quantitative polymerase chain reaction (qPCR) towards identification of constituents within environmental DNA (eDNA) now allow targeted detection of the presence of species-specific biological material within a localized geographic region. However, as with all molecular techniques predicated on the specificity and sensitivity of the PCR assay, careful validation of each eDNA qPCR assay in development must be performed both under controlled laboratory conditions and when challenged with field-derived eDNA samples. Such a step-wise approach forms the basis for incorporation of innovative qPCR design features that strengthen the implementation and interpretation of the eDNA assay. This includes empirical determination that the qPCR assay is refractory to the presence of human DNA and the use of a tripartite assay approach comprised of 1) a primer set targeting plant chloroplast that evaluates the presence of amplifiable DNA from field samples to increase confidence in a negative result, 2) an animal group primer set to increase confidence in the assay result, and 3) a species-specific primer set to assess presence of DNA from the target species. To demonstrate this methodology, we generated eDNA assays specific for the North American bullfrog (Lithobates (Rana) catesbeiana) and the Rocky Mountain tailed frog (Ascaphus montanus) and characterized each with respect to detection sensitivity and specificity with demonstrated performance in a field survey scenario. The qPCR design features presented herein address specific challenges of eDNA assays thereby increasing their interpretative power. PMID:27802293

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

USGS Publications Warehouse

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Hi-Plex for Simple, Accurate, and Cost-Effective Amplicon-based Targeted DNA Sequencing.

PubMed

Pope, Bernard J; Hammet, Fleur; Nguyen-Dumont, Tu; Park, Daniel J

2018-01-01

Hi-Plex is a suite of methods to enable simple, accurate, and cost-effective highly multiplex PCR-based targeted sequencing (Nguyen-Dumont et al., Biotechniques 58:33-36, 2015). At its core is the principle of using gene-specific primers (GSPs) to "seed" (or target) the reaction and universal primers to "drive" the majority of the reaction. In this manner, effects on amplification efficiencies across the target amplicons can, to a large extent, be restricted to early seeding cycles. Product sizes are defined within a relatively narrow range to enable high-specificity size selection, replication uniformity across target sites (including in the context of fragmented input DNA such as that derived from fixed tumor specimens (Nguyen-Dumont et al., Biotechniques 55:69-74, 2013; Nguyen-Dumont et al., Anal Biochem 470:48-51, 2015), and application of high-specificity genetic variant calling algorithms (Pope et al., Source Code Biol Med 9:3, 2014; Park et al., BMC Bioinformatics 17:165, 2016). Hi-Plex offers a streamlined workflow that is suitable for testing large numbers of specimens without the need for automation.

Fingerprinting and quantification of GMOs in the agro-food sector.

PubMed

Taverniers, I; Van Bockstaele, E; De Loose, M

2003-01-01

Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.

Rapid polymerase chain reaction screening of Helicobacter pylori chromosomal point mutations.

PubMed

Ge, Z; Taylor, D E

1997-09-01

Microdiversity (within individual genes) in the genomes of different Helicobacter pylori strains has been demonstrated to be more frequent than that seen in other prokaryotes. Point mutations in some genes, such as the vacA and 23S ribosomal RNA genes could result in the alteration of pathogenicity or antibiotic susceptibility of individual H. pylori strains. Development of a simple, rapid, and reliable screening method would be useful in the molecular characterization of genetic variation among different H. pylori strains. The copP gene from H. pylori UA802 was used as a model for developing a mutation screening method. Four point mutations were introduced into the copP gene by in vitro site-directed mutagenesis and were verified by DNA sequencing. The mutated copP gene replaced the wild-type locus by natural transformation and homologous recombination. The site-specific mutants were screened by polymerase chain reaction (PCR) using 3'-end mismatched primers. The origins of the PCR fragments were demonstrated by Southern hybridization with the copP-derived DNA probe. Three of these four mutations were characterized by PCR with the specific primers that contained the 3'-terminal nucleotide complementary only to the mutated nucleotide on both plasmid and chromosomal DNA templates. One mutation was able to be identified with the foregoing primer containing an additional wild-type nucleotide at its 3'-end. Point mutant screening with these specific primers offers 100% sensitivity in the aforementioned conditions. To achieve optimal screening, the concentration of magnesium and the annealing temperature have to be adjusted. The procedure reported in this study is a simple, economical, rapid, and efficient approach in the identification of site-specific mutations on both plasmids and chromosomal DNA. Although the method was developed by using a specified H. pylori gene, it can be extended easily to other genes of interest in H. pylori or other organisms.

PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

PubMed Central

O’Halloran, Damien M.

2016-01-01

Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

PubMed

Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

2014-01-01

Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

Molecular method for determining sex of walruses

USGS Publications Warehouse

Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

2008-01-01

We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

USGS Publications Warehouse

Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

2010-01-01

A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

A novel DANP-coupled hairpin RT-PCR for rapid detection of Chikungunya virus.

PubMed

Chen, Huixin; Takei, Fumie; Koay, Evelyn Siew-Chuan; Nakatani, Kazuhiko; Chu, Justin Jang Hann

2013-03-01

Chikungunya has re-emerged as an important arboviral infection of global health significance. Because of lack of a vaccine and effective treatment, rapid diagnosis plays an important role in early clinical management of patients. In this study, we have developed a novel molecular diagnostic platform that ensures a rapid and cost-effective one-step RT-PCR assay, with high sensitivity and specificity, for the early detection of the Chikungunya virus (CHIKV). It uses 2,7-diamino-1,8-naphthyridine derivative (DANP)-labeled cytosine-bulge hairpin primers to amplify the nsP2 region of the CHIKV genome, followed by measurement of the fluorescence emitted from DANP-primer complexes after PCRs. The detection limit of our assay was 0.01 plaque-forming units per reaction of CHIKV. Furthermore, the HP-nsP2 primers were highly specific in detecting CHIKV, without any cross-reactivity with the panel of RNA viruses validated in this study. The feasibility of the DANP-coupled hairpin RT-PCR for clinical diagnosis was evaluated using clinical serum samples from CHIKV-infected patients, and the specificity and sensitivity were 100% (95% CI, 80.0% to 100%) and 95.5% (95% CI, 75.1% to 99.8%), respectively. These findings confirmed its potential as a point-of-care clinical molecular diagnostic assay for CHIKV in acute-phase patient serum samples. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

PubMed

Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

2017-10-01

ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii

PubMed Central

Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon

2005-01-01

Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482

TipMT: Identification of PCR-based taxon-specific markers.

PubMed

Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C

2017-02-11

Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .

Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

PubMed Central

Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

2006-01-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

PubMed

Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

2006-12-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

PubMed

Gonzales, J L; Loza, A; Chacon, E

2006-03-15

There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

PubMed Central

Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

2013-01-01

We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

PubMed

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

PubMed

Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

2009-11-25

Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

PubMed

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

PubMed

Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

2008-08-01

A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

Alelle number and heterozigosity for microsatellite loci in different stingless bee species (Hymenoptera: Apidae, Meliponini).

PubMed

Francisco, Flávio de O; Brito, Rute M; Arias, Maria C

2006-01-01

In the present study we compare genetic characteristics (allele diversity and observed heterozygosity) of microsatellite loci, from three stingless bee species (Plebeia remota Holmberg, Partamona mulata Moure In Camargo and Partamona helleri Friese), amplified by using heterospecific primers originally designed for Melipona bicolor Lepeletier and Scaptotrigona postica Latreille. We analyzed 360 individuals of P. remota from 72 nests, 58 individuals of R. mulata from 58 nests, and 47 individuals of P. helleri from 47 nests. The three species studied showed low level of polymorphism for the loci amplified with primers derived from M. bicolor. However, for the loci amplified with primers derived from S. postica, only P. remota presented low level of polymorphism.

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

PubMed

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Identification of Lactobacillus alimentarius and Lactobacillus farciminis with 16S-23S rDNA intergenic spacer region polymorphism and PCR amplification using species-specific oligonucleotide.

PubMed

Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X

2003-01-01

The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

PubMed Central

David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

2017-01-01

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

Development of Species-Specific Primers for Agronomical Thrips and Multiplex Assay for Quarantine Identification of Western Flower Thrips.

PubMed

Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

2014-10-01

While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.

S-genotype identification based on allele-specific PCR in Japanese pear

PubMed Central

Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya

2015-01-01

Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617

A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

PubMed

van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

2008-09-01

To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

PubMed

Chen, Huaihai; Yu, Fangbo; Shi, Wei

2016-12-01

Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

PubMed

Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

1997-05-02

Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

PubMed

Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

2007-01-01

Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

Combination Antiangiogenic and Immunomodulatory Gene Therapy for Breast Cancer

DTIC Science & Technology

2002-06-01

Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a positive control. The samples were run on a...cultured cells and specific primers for Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a...positive control. Arrows indicate the 500 bp, 410 bp and 109 bp amplified products of Flk-1, endoglin and G3PDH , respectively. Fig 3. Viral replication

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

PubMed

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

Identification of root rot fungi in nursery seedlings by nested multiplex PCR.

PubMed Central

Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M

1996-01-01

The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993

Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

PubMed

Robertson, Amber L; Phillips, Allison R

2008-01-01

Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

PubMed Central

Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

2012-01-01

In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

PubMed

David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

2017-01-04

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

NASA Astrophysics Data System (ADS)

Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

2017-04-01

Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

NASA Astrophysics Data System (ADS)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

PubMed

Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

2017-08-01

Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

USGS Publications Warehouse

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

PubMed

Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

2014-11-01

To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Development of PCR protocols for specific identification of Clostridium spiroforme and detection of sas and sbs genes.

PubMed

Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio

2008-10-15

Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.

Primer vector theory and applications

NASA Technical Reports Server (NTRS)

Jezewski, D. J.

1975-01-01

A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

Origin and quantification of circulating DNA in mice with human colorectal cancer xenografts

PubMed Central

Thierry, Alain R.; Mouliere, Florent; Gongora, Celine; Ollier, Jeremy; Robert, Bruno; Ychou, Marc; Del Rio, Maguy; Molina, Franck

2010-01-01

Although circulating DNA (ctDNA) could be an attractive tool for early cancer detection, diagnosis, prognosis, monitoring or prediction of response to therapies, knowledge on its origin, form and rate of release is poor and often contradictory. Here, we describe an experimental system to systematically examine these aspects. Nude mice were xenografted with human HT29 or SW620 colorectal carcinoma (CRC) cells and ctDNA was analyzed by Q–PCR with highly specific and sensitive primer sets at different times post-graft. We could discriminate ctDNA from normal (murine) cells and from mutated and non-mutated tumor (human) cells by using species-specific KRAS or PSAT1 primers and by assessing the presence of the BRAF V600E mutation. The concentration of human (mutated and non-mutated) ctDNA increased significantly with tumor growth. Conversely, and differently from previous studies, low, constant level of mouse ctDNA was observed, thus facilitating the study of mutated and non-mutated tumor derived ctDNA. Finally, analysis of ctDNA fragmentation confirmed the predominance of low-size fragments among tumor ctDNA from mice with bigger tumors. Higher ctDNA fragmentation was also observed in plasma samples from three metastatic CRC patients in comparison to healthy individuals. Our data confirm the predominance of mononucleosome-derived fragments in plasma from xenografted animals and, as a consequence, of apoptosis as a source of ctDNA, in particular for tumor-derived ctDNA. Altogether, our results suggest that ctDNA features vary during CRC tumor development and our experimental system might be a useful tool to follow such variations. PMID:20494973

SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana).

PubMed

Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T

2016-09-01

To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.

MethPrimer: designing primers for methylation PCRs.

PubMed

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

NASA Astrophysics Data System (ADS)

Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

2013-11-01

This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

Development of a cost-efficient novel method for rapid, concurrent genotyping of five common single nucleotide polymorphisms of the brain derived neurotrophic factor (BDNF) gene by tetra-primer amplification refractory mutation system.

PubMed

Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M

2015-09-01

Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Population diversity of ammonium oxidizers investigated by specific PCR amplification

USGS Publications Warehouse

Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

1997-01-01

The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

PubMed

Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

2010-02-01

To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

MRPrimerV: a database of PCR primers for RNA virus detection

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

2017-01-01

Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene.

PubMed

Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee

2007-01-01

Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.

Authenticity analyses of Phyllanthus amarus using barcoding coupled with HRM analysis to control its quality for medicinal plant product.

PubMed

Buddhachat, Kittisak; Osathanunkul, Maslin; Madesis, Panagiotis; Chomdej, Siriwadee; Ongchai, Siriwan

2015-11-15

The Phyllanthus genus, a plant used in traditional Thai medicine, has according to several pharmacopeias hepatoprotective properties. Not only is the anatomical morphology of these species relatively similar but they also share the Thai common names Look-Tai-Bai (ลูกใต้ใบ) and Yah-Tai-Bai (หญ้าใต้ใบ), which might cause confusion for laypersons. This study attempted to develop a method for accurate identification of Phyllanthus species, especially Phyllanthus amarus, and to detect contaminants in P. amarus products by using DNA barcoding coupled with high resolution melting (HRM) analysis (bar-HRM). Two plastid loci (rbcL and trnL) were chosen for DNA barcoding to generate a suitable primer for distinguishing Phyllanthus species by HRM analysis. The five species of Phyllanthus were subjected to amplification for testing the specificity and discrimination power of the designed primers derived from rbcL and trnL regions. Sensitivity of the method (DNA barcoding conjugated with HRM) to detect adulterant in P. amarus samples was evaluated. The commercial P. amarus products obtained from a local market were authenticated. The primer pair derived from trnL DNA barcoding (PhylltrnL) had more specificity and power of discrimination for Phyllanthus species than that derived from rbcL DNA barcoding (PhyllrbcL). The result showed that Tm of P. amarus, Phyllanthus urinaria, Phyllanthus debilis, Phyllanthus airy-shawii, and Phyllanthus virgatus was 74.3±0.08, 73.04±0.07, 73.36±0.05, 72.21±0.06, 72.77±0.15°C, respectively. This method proved to be a very sensitive tool that can be used for rapid detection of contamination as low as 1% of other Phyllanthus species in P. amarus admixtures. All commercial products of P. amarus obtained from a local market in Thailand were found to contain pure raw materials of P. amarus without any substitution or contamination. Our results indicated that the use of DNA barcoding coupled with HRM was an efficient molecular tool for correct species identification. This molecular tool provides a noteworthy benefit for quality control of medicinal plants and industry plants for pharmacological prospects. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

PubMed Central

Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

PubMed

Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

Comparative analysis of detection limits and specificity of molecular diagnostic markers for three pathogens (Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus terrestris.

PubMed

Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G

2012-04-01

Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.

Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

PubMed Central

Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

1994-01-01

Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

PubMed Central

Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

2011-01-01

Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

PubMed

Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

2017-01-24

The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

Differential Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii by a Single-Round PCR Assay

PubMed Central

Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

2006-01-01

A single-round PCR assay was developed for detection and differential diagnosis of the three Entamoeba species found in humans, Entamoeba moshkovskii, Entamoeba histolytica, and Entamoeba dispar, that are morphologically identical as both cysts and trophozoites. A conserved forward primer was derived from the middle of the small-subunit rRNA gene, and reverse primers were designed from signature sequences specific to each of these three Entamoeba species. PCR generates a 166-bp product with E. histolytica DNA, a 752-bp product with E. dispar DNA, and a 580-bp product with E. moshkovskii DNA. Thirty clinical specimens were examined, and the species present were successfully detected and differentiated using this assay. It was possible to detect as little as 10 pg of E. moshkovskii and E. histolytica DNA, while for E. dispar the sensitivity was about 20 pg of DNA. Testing with DNA from different pathogens, including bacteria and other protozoa, confirmed the high specificity of the assay. We propose the use of this PCR assay as an accurate, rapid, and effective diagnostic method for the detection and discrimination of these three morphologically indistinguishable Entamoeba species in both routine diagnosis of amoebiasis and epidemiological surveys. PMID:16954247

Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

PubMed

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-11-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

PubMed Central

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-01-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

Genetic relationships among strains of Xanthomonas fragariae based on random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus PCR data and generation of multiplexed PCR primers useful for the identification of this phytopathogen.

PubMed Central

Pooler, M R; Ritchie, D F; Hartung, J S

1996-01-01

Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198

Nested PCR for ultrasensitive detection of the potato ring rot bacterium, Clavibacter michiganensis subsp. sepedonicus.

PubMed

Lee, I M; Bartoszyk, I M; Gundersen, D E; Mogen, B; Davis, R E

1997-07-01

Oligonucleotide primers derived from sequences of the 16S rRNA gene (CMR16F1, CMR16R1, CMR16F2, and CMR16R2) and insertion element IS1121 of Clavibacter michiganensis subsp. sepedonicus (CMSIF1, CMSIR1, CMSIF2, and CMISR2) were used in nested PCR to detect the potato ring rot bacterium C. michiganensis subsp. sepedonicus. Nested PCR with primer pair CMSIF1-CMSIR1 followed by primer pair CMSIF2-CMSIR2 specifically detected C. michiganensis subsp. sepedonicus, while nested PCR with CMR16F1-CMR16R1 followed by CMR16F2-CMR16R2 detected C. michiganensis subsp. sepedonicus and the other C. michiganensis subspecies. In the latter case, C. michiganensis subsp. sepedonicus can be differentiated from the other subspecies by restriction fragment length polymorphism (RFLP) analyses of the nested PCR products (16S rDNA sequences). The nested PCR assays developed in this work allow ultrasensitive detection of very low titers of C. michiganensis subsp. sepedonicus which may be present in symptomiess potato plants or tubers and which cannot be readily detected by direct PCR (single PCR amplification). RFLP analysis of PCR products provides for an unambiguous confirmation of the identify of C. michiganensis subsp. sepedonicus.

SINE sequences detect DNA fingerprints in salmonid fishes.

PubMed

Spruell, P; Thorgaard, G H

1996-04-01

DNA probes homologous to two previously described salmonid short interspersed nuclear elements (SINEs) detected DNA fingerprint patterns in 14 species of salmonid fishes. The probes showed more homology to some species than to others and little homology to three nonsalmonid fishes. The DNA fingerprint patterns derived from the SINE probes are individual-specific and inherited in a Mendelian manner. Probes derived from different regions of the same SINE detect only partially overlapping banding patterns, reflecting a more complex SINE structure than has been previously reported. Like the human Alu sequence, the SINEs found in salmonids could provide useful genetic markers and primer sites for PCR-based techniques. These elements may be more desirable for some applications than traditional DNA fingerprinting probes that detect tandemly repeated arrays.

Developing new microsatellite markers in walnut (Juglans regia L.) from Juglans nigra genomic GA enriched library

Treesearch

Hayat Topcu; Nergiz Coban; Keith Woeste; Mehmet Sutyemez; Salih Kafkas

2015-01-01

We attempted to develop new polymorphic SSR primer pairs in walnut using sequences derived from Juglans nigra L. genomic enriched library with GA repeat. The designed 94 SSR primer pairs were subjected to gradient PCR in 12 walnut cultivars to determine their optimum annealing temperatures and to determine whether they produce bands. Then, the...

Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

PubMed Central

Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru

2005-01-01

Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082

Efficacy of species-specific recA PCR tests in the identification of Burkholderia cepacia complex environmental isolates.

PubMed

Dalmastri, Claudia; Pirone, Luisa; Tabacchioni, Silvia; Bevivino, Annamaria; Chiarini, Luigi

2005-05-01

In this study, we evaluated if recA species-specific PCR assays could be successfully applied to identify environmental isolates of the widespread Burkholderia cepacia complex (Bcc) species. A total of 729 Bcc rhizosphere isolates collected in different samplings were assigned to the species B. cepacia genomovar I (61), B. cenocepacia recA lineage IIIB (514), B. ambifaria (124) and B. pyrrocinia (30), by means of recA (RFLP) analysis, and PCR tests were performed to assess sensitivity and specificity of recA species-specific primers pairs. B. cepacia genomovar I specific primers produced the expected amplicon with all isolates of the corresponding species (sensitivity, 100%), and cross-reacted with all B. pyrrocinia isolates. On the contrary, B. cenocepacia IIIB primers did not give the expected amplicon in 164 B. cenocepacia IIIB isolates (sensitivity, 68.1%), and isolates of distinct populations showed different sensitivity. B. ambifaria primers failed to amplify a recA-specific fragment only in a few isolates of this species (sensitivity, 93.5%). The absence of specific amplification in a high number of B. cenocepacia rhizosphere isolates indicates that recA specific PCR assays can lead to an underestimation of environmental microorganisms belonging to this bacterial species.

Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

PubMed

Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

2016-09-29

The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts

PubMed Central

Ealba, Erin L.; Schneider, Richard A.

2013-01-01

Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056

Worker honey bee pheromone regulation of foraging ontogeny

NASA Astrophysics Data System (ADS)

Pankiw, Tanya

The evolution of sociality has configured communication chemicals, called primer pheromones, which play key roles in regulating the organization of social life. Primer pheromones exert relatively slow effects that fundamentally alter developmental, physiological, and neural systems. Here, I demonstrate how substances extracted from the surface of foraging and young pre-foraging worker bees regulated age at onset of foraging, a developmental process. Hexane-extractable compounds washed from foraging workers increased foraging age compared with controls, whereas extracts of young pre-foraging workers decreased foraging age. This represents the first known direct demonstration of primer pheromone activity derived from adult worker bees.

Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

USDA-ARS?s Scientific Manuscript database

The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

GSP: a web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

A Novel Real-Time PCR Assay of microRNAs Using S-Poly(T), a Specific Oligo(dT) Reverse Transcription Primer with Excellent Sensitivity and Specificity

PubMed Central

Kang, Kang; Zhang, Xiaoying; Liu, Hongtao; Wang, Zhiwei; Zhong, Jiasheng; Huang, Zhenting; Peng, Xiao; Zeng, Yan; Wang, Yuna; Yang, Yi; Luo, Jun; Gou, Deming

2012-01-01

Background MicroRNAs (miRNAs) are small, non-coding RNAs capable of postranscriptionally regulating gene expression. Accurate expression profiling is crucial for understanding the biological roles of miRNAs, and exploring them as biomarkers of diseases. Methodology/Principal Findings A novel, highly sensitive, and reliable miRNA quantification approach,termed S-Poly(T) miRNA assay, is designed. In this assay, miRNAs are subjected to polyadenylation and reverse transcription with a S-Poly(T) primer that contains a universal reverse primer, a universal Taqman probe, an oligo(dT)11 sequence and six miRNA-specific bases. Individual miRNAs are then amplified by a specific forward primer and a universal reverse primer, and the PCR products are detected by a universal Taqman probe. The S-Poly(T) assay showed a minimum of 4-fold increase in sensitivity as compared with the stem-loop or poly(A)-based methods. A remarkable specificity in discriminating among miRNAs with high sequence similarity was also obtained with this approach. Using this method, we profiled miRNAs in human pulmonary arterial smooth muscle cells (HPASMC) and identified 9 differentially expressed miRNAs associated with hypoxia treatment. Due to its outstanding sensitivity, the number of circulating miRNAs from normal human serum was significantly expanded from 368 to 518. Conclusions/Significance With excellent sensitivity, specificity, and high-throughput, the S-Poly(T) method provides a powerful tool for miRNAs quantification and identification of tissue- or disease-specific miRNA biomarkers. PMID:23152780

Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

PubMed

Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

2018-02-01

The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

PubMed

Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

2014-11-01

In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

PubMed Central

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

2006-01-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

PubMed

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

2006-07-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

Poliovirus serotype-specific VP1 sequencing primers.

PubMed

Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

2011-06-01

The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

PubMed Central

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

PubMed Central

Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

2016-01-01

Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

Development of a molecular approach to describe the composition of Trichoderma communities.

PubMed

Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele

2010-01-01

Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.

Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR

PubMed Central

Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209

Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

PubMed Central

Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

2007-01-01

Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

Grapevine fleck virus-like viruses in Vitis.

PubMed

Sabanadzovic, S; Abou-Ghanem, N; Castellano, M A; Digiaro, M; Martelli, G P

2000-01-01

Two sets of degenerate primers for the specific amplification of 572-575 nt and 386 nt segments of the methyltransferase and RNA- dependent RNA polymerase cistrons of members of the genera Tymovirus and Marafivirus and of the unassigned virus Grapevine fleck virus (GFkV) were designed on the basis of available sequences. These primers were used for amplifying and subsequent cloning and sequencing part of the open reading frame 1 of the genome of GFkV, Grapevine asteroid mosaic-associated virus (GAMaV) and of another previously unreported virus, for which the name Grapevine red globe virus (GRGV) is proposed. Computer-assisted analysis of the amplified genome portions showed that the three grapevine viruses are phylogenetically related with one another and with sequenced tymoviruses and marafiviruses. The relationships with tymoviruses was confirmed by the type of ultrastructural modifications induced in the host cells. RdRp-specific degenerate primers were successfully used for the aspecific detection of the three viruses in crude grapevine sap extracts. Specific virus identification was obtained with RT-PCR using antisense virus-specific primers.

Identification and authentication of Rosa species through development of species-specific SCAR marker(s).

PubMed

Bashir, K M I; Awan, F S; Khan, I A; Khan, A I; Usman, M

2014-05-30

Roses (Rosa indica) belong to one of the most crucial groups of plants in the floriculture industry. Rosa species have special fragrances of interest to the perfume and pharmaceutical industries. The genetic diversity of plants based on morphological characteristics is difficult to measure under natural conditions due to the influence of environmental factors, which is why a reliable fingerprinting method was developed to overcome this problem. The development of molecular markers will enable the identification of Rosa species. In the present study, randomly amplified polymorphic DNA (RAPD) analysis was done on four Rosa species, Rosa gruss-an-teplitz (Surkha), Rosa bourboniana, Rosa centifolia, and Rosa damascena. A polymorphic RAPD fragment of 391 bp was detected in R. bourboniana, which was cloned, purified, sequenced, and used to design a pair of species-specific sequence-characterized amplified region (SCAR) primers (forward and reverse). These SCAR primers were used to amplify the specific regions of the rose genome. These PCR amplifications with specific primers are less sensitive to reaction conditions, and due to their high reproducibility, these species-specific SCAR primers can be used for marker-assisted selection and identification of Rosa species.

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

PubMed Central

2014-01-01

Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

Best Development Practices: A Primer for Smart Growth

EPA Pesticide Factsheets

Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

PubMed

Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

2007-10-01

Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

PubMed

Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

2014-07-01

In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

PubMed

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

PubMed Central

Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

2003-01-01

Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

PubMed

Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

2009-01-01

* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

First report of Hibiscus infecting Cilevirus in Citrus sinensis in Meta and Casanare, Colombia

USDA-ARS?s Scientific Manuscript database

In February 2015, two sweet orange samples with severe citrus leprosis (CiL) symptoms were collected from Meta and Casanare states in Colombia and assayed for Cilevirus, Dichorhavirus and Higrevirus associated with CiL disease. PCR primers specific for CiLV-C2, but not primers specific for CiLV-C, C...

Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone

DTIC Science & Technology

2013-10-01

and 5’‐GCC AAA TGC AGT TTA AGC TCT GCT‐3’ (antisense). The gene‐specific primers for mouse b‐actin were 5’‐GGC CGT ACC ACT GGC ATC GTG ATG‐ 3...cycles. The gene‐specific primers for CYP24A1 mRNA were 5’‐CGG GTG GAC CAT TTA CAA CTC GG‐3’ (sense) and 5’‐CTC AAC AGG CTC ATT GTC TGT GG‐3’ (antisense...The gene specific designing primers for b‐actinwere 5’‐ GTG CGT GAC ATC AAA GAG‐3’ (sense) and 5’‐GCC ACA GGA TTC CAT ACC‐3’ (antisense). The

Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

PubMed

Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

2011-05-01

A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

Development of the polymerase chain reaction for diagnosis of chancroid.

PubMed Central

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

PubMed

Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

2015-01-01

This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Use of a Hierarchical Oligonucleotide Primer Extension Approach for Multiplexed Relative Abundance Analysis of Methanogens in Anaerobic Digestion Systems

PubMed Central

Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu

2013-01-01

In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716

Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

PubMed

Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

2015-08-01

Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection

PubMed Central

Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

2016-01-01

A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE PAGES

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...

2016-07-15

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

PubMed

Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

2016-09-01

Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

PubMed

Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

2008-06-01

Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection.

PubMed

Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

2016-08-01

A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.

PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S. N.

2013-08-08

Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

PubMed Central

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

PubMed Central

Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

2012-01-01

We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

DAMe: a toolkit for the initial processing of datasets with PCR replicates of double-tagged amplicons for DNA metabarcoding analyses.

PubMed

Zepeda-Mendoza, Marie Lisandra; Bohmann, Kristine; Carmona Baez, Aldo; Gilbert, M Thomas P

2016-05-03

DNA metabarcoding is an approach for identifying multiple taxa in an environmental sample using specific genetic loci and taxa-specific primers. When combined with high-throughput sequencing it enables the taxonomic characterization of large numbers of samples in a relatively time- and cost-efficient manner. One recent laboratory development is the addition of 5'-nucleotide tags to both primers producing double-tagged amplicons and the use of multiple PCR replicates to filter erroneous sequences. However, there is currently no available toolkit for the straightforward analysis of datasets produced in this way. We present DAMe, a toolkit for the processing of datasets generated by double-tagged amplicons from multiple PCR replicates derived from an unlimited number of samples. Specifically, DAMe can be used to (i) sort amplicons by tag combination, (ii) evaluate PCR replicates dissimilarity, and (iii) filter sequences derived from sequencing/PCR errors, chimeras, and contamination. This is attained by calculating the following parameters: (i) sequence content similarity between the PCR replicates from each sample, (ii) reproducibility of each unique sequence across the PCR replicates, and (iii) copy number of the unique sequences in each PCR replicate. We showcase the insights that can be obtained using DAMe prior to taxonomic assignment, by applying it to two real datasets that vary in their complexity regarding number of samples, sequencing libraries, PCR replicates, and used tag combinations. Finally, we use a third mock dataset to demonstrate the impact and importance of filtering the sequences with DAMe. DAMe allows the user-friendly manipulation of amplicons derived from multiple samples with PCR replicates built in a single or multiple sequencing libraries. It allows the user to: (i) collapse amplicons into unique sequences and sort them by tag combination while retaining the sample identifier and copy number information, (ii) identify sequences carrying unused tag combinations, (iii) evaluate the comparability of PCR replicates of the same sample, and (iv) filter tagged amplicons from a number of PCR replicates using parameters of minimum length, copy number, and reproducibility across the PCR replicates. This enables an efficient analysis of complex datasets, and ultimately increases the ease of handling datasets from large-scale studies.

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

PubMed Central

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-01-01

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

Assessing the performance of a Loop Mediated Isothermal Amplification (LAMP) assay for the detection and subtyping of high-risk suptypes of Human Papilloma Virus (HPV) for Oropharyngeal Squamous Cell Carcinoma (OPSCC) without DNA purification.

PubMed

Rohatensky, Mitchell G; Livingstone, Devon M; Mintchev, Paul; Barnes, Heather K; Nakoneshny, Steven C; Demetrick, Douglas J; Dort, Joseph C; van Marle, Guido

2018-02-08

Oropharyngeal Squamous Cell Carcinoma (OPSCC) is increasing in incidence despite a decline in traditional risk factors. Human Papilloma Virus (HPV), specifically subtypes 16, 18, 31 and 35, has been implicated as the high-risk etiologic agent. HPV positive cancers have a significantly better prognosis than HPV negative cancers of comparable stage, and may benefit from different treatment regimens. Currently, HPV related carcinogenesis is established indirectly through Immunohistochemistry (IHC) staining for p16, a tumour suppressor gene, or polymerase chain reaction (PCR) that directly tests for HPV DNA in biopsied tissue. Loop mediated isothermal amplification (LAMP) is more accurate than IHC, more rapid than PCR and is significantly less costly. In previous work we showed that a subtype specific HPV LAMP assay performed similar to PCR on purified DNA. In this study we examined the performance of this LAMP assay without DNA purification. We used LAMP assays using established primers for HPV 16 and 18, and new primers for HPV 31 and 35. LAMP reaction conditions were tested on serial dilutions of plasmid HPV DNA to confirm minimum viral copy number detection thresholds. LAMP was then performed directly on different human cell line samples without DNA purification. Our LAMP assays could detect 10 5 , 10 3 , 10 4 , and 10 5 copies of plasmid DNA for HPV 16, 18, 31, and 35, respectively. All primer sets were subtype specific, with no cross-amplification. Our LAMP assays also reliably amplified subtype specific HPV DNA from samples without requiring DNA isolation and purification. The high risk OPSCC HPV subtype specific LAMP primer sets demonstrated, excellent clinically relevant, minimum copy number detection thresholds with an easy readout system. Amplification directly from samples without purification illustrated the robust nature of the assay, and the primers used. This lends further support HPV type specific LAMP assays, and these specific primer sets and assays can be further developed to test for HPV in OPSCC in resource and lab limited settings, or even bedside testing.

Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

PubMed

Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

2010-08-01

To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

Characterization and application of a quantitative DNA marker that discriminates sex in Chinook salmon (Oncorhynchus tshawytscha)

USGS Publications Warehouse

Clifton, D.R.; Rodriguez, R.J.

1997-01-01

A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

Characterization and application of a quantitative DNA marker that discriminates sex in chinook salmon (Oncorhynchus tshawytscha)

USGS Publications Warehouse

Clifton, D.R.; Rodriguez, R.J.

1997-01-01

A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

Identifying of meat species using polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-11-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Use of SCW4 gene primers in PCR methods for the identification of six medically important Aspergillus species.

PubMed

Arancia, Silvia; Sandini, Silvia; De Carolis, Elena; Vella, Antonietta; Sanguinetti, Maurizio; Norelli, Sandro; De Bernardis, Flavia

2016-10-01

Aspergillus species are the cause of invasive mold infections in immunocompromised patients: Aspergillus fumigatus, A. flavus and A. terreus account for most cases of invasive aspergillosis (IA). As certain species are associated with higher mortality and vary in their resistance to antifungal therapy, diagnosis requires increasingly rapid molecular methods that enable sensitive detection and species discrimination. We have developed PCR and Multiplex PCR assays for the detection of six medically important Aspergillus spp. species DNA in bronchoalveolar lavage (BAL) specimens from hematology and intensive care unit (ICU) patients at risk of IA, using different species and genus-specific PCR primers, selected within the SCW4 gene, encoding a cell wall glucanase of A. fumigatus, similar to mannoprotein Mp65 of Candida albicans. The genus-specific PCR primers were able to amplify only Aspergillus DNAs but not that belonging to other fungal genera tested. The species-specific PCR primers allowed differentiation of each Aspergillus species by the amplicon length produced. The methods described in this study are rapid (less than 4 h), reproducible, simple and specific and demonstrate potential application in the clinical laboratory.

Identifying of meat species using polymerase chain reaction (PCR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foong, Chow Ming; Sani, Norrakiah Abdullah

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

Detection of fumonisin producing Fusarium verticillioides in paddy (Oryza sativa L.) using polymerase chain reaction (PCR)

PubMed Central

Maheshwar, P.K.; Moharram, S. Ahmed; Janardhana, G.R.

2009-01-01

The study reports the occurrence of fumonisin producing Fusarium verticillioides in 90 samples of stored paddy (Oryza sativa L.) collected from different geographical regions of Karnataka, India. Fumonisin producing F. verticillioides was identified based on micromorphological characteristics and PCR using two sets of primers. One set of primers was F. verticillioides species specific, which selectively amplified the intergenic space region of rDNA. The other set of primers was specific to fumonisin producing F. verticillioides. Eight paddy samples were positive for F. verticillioides. Eleven isolates obtained from these samples were capable of producing fumonisin. PMID:24031332

Detection of two fungal biocontrol agents against root-knot nematodes by RAPD markers.

PubMed

Zhu, Ming Liang; Mo, Ming He; Xia, Zhen Yuan; Li, Yun Hua; Yang, Shu Jun; Li, Tian Fei; Zhang, Ke Qin

2006-05-01

The strain ZK7 of Pochonia chlamydosporia var. chlamydosporia and IPC of Paecilomyces lilacinus are highly effective in the biological control against root-knot nematodes infecting tobacco. When applied, they require a specific monitoring method to evaluate the colonization and dispersal in soil. In this work, the randomly amplified polymorphic DNA (RAPD) technique was used to differentiate between the two individual strains and 95 other isolates, including isolates of the same species and common soil fungi. This approach allowed the selection of specific fragments of 1.2 kb (Vc1200) and 2.0 kb (Vc2000) specific for ZK7, 1.4 kb (P1400) and 0.85 kb (P850) specific for IPC, using the random Primers OPL-02, OPD-05, OPD-05 and OPC-11, respectively. These fragments were cloned, sequenced, and used to design sequence-characterized amplification region (SCAR) primers specific for the two strains. In classical polymerase chain reaction (PCR), with serial dilution of ZK7 and IPC pure culture DNAs template, the detection limits of these oligonucleotide SCAR-PCR primers were found to be 10, 1000, 500, 100 pg, respectively. In the dot blotting, digoxigenin (DIG)-labeled amplicons from these four primers specifically recognized the corresponding fragments in the DNAs template of these two strains. The detection limit of these amplicons were 0.2, 0.2, 0.5, 0.5 mug, respectively.

Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

PubMed

Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

1999-01-01

A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

PubMed

Kokosková, B; Mráz, I; Fousek, J

2010-05-01

Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.

PubMed

Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L

2010-01-01

Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.

Plastid primers for angiosperm phylogenetics and phylogeography.

PubMed

Prince, Linda M

2015-06-01

PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Event-specific plasmid standards and real-time PCR methods for transgenic Bt11, Bt176, and GA21 maize and transgenic GT73 canola.

PubMed

Taverniers, Isabel; Windels, Pieter; Vaïtilingom, Marc; Milcamps, Anne; Van Bockstaele, Erik; Van den Eede, Guy; De Loose, Marc

2005-04-20

Since the 18th of April 2004, two new regulations, EC/1829/2003 on genetically modified food and feed products and EC/1830/2003 on traceability and labeling of GMOs, are in force in the EU. This new, comprehensive regulatory framework emphasizes the need of an adequate tracing system. Unique identifiers, such as the transgene genome junction region or a specific rearrangement within the transgene DNA, should form the basis of such a tracing system. In this study, we describe the development of event-specific tracing systems for transgenic maize lines Bt11, Bt176, and GA21 and for canola event GT73. Molecular characterization of the transgene loci enabled us to clone an event-specific sequence into a plasmid vector, to be used as a marker, and to develop line-specific primers. Primer specificity was tested through qualitative PCRs and dissociation curve analysis in SYBR Green I real-time PCRs. The primers were then combined with event-specific TaqMan probes in quantitative real-time PCRs. Calibration curves were set up both with genomic DNA samples and the newly synthesized plasmid DNA markers. It is shown that cloned plasmid GMO target sequences are perfectly suitable as unique identifiers and quantitative calibrators. Together with an event-specific primer pair and a highly specific TaqMan probe, the plasmid markers form crucial components of a unique and straighforward tracing system for Bt11, Bt176, and GA21 maize and GT73 canola events.

Translesion synthesis past equine estrogen-derived 2'-deoxyadenosine DNA adducts by human DNA polymerases eta and kappa.

PubMed

Yasui, Manabu; Laxmi, Y R Santosh; Ananthoju, Sreenivasa R; Suzuki, Naomi; Kim, Sung Yeon; Shibutani, Shinya

2006-05-16

Hormone replacement therapy (HRT) increases the risk of developing breast, ovarian, and endometrial cancers. Equilin and equilenin are the major components of the widely prescribed drug used for HRT. 4-Hydroxyequilenin (4-OHEN), a major metabolite of equilin and equilenin, promotes 4-OHEN-modified dC, dA, and dG DNA adducts. These DNA adducts were detected in breast tumor and adjacent normal tissues of several patients receiving HRT. We have recently found that the 4-OHEN-dC DNA adduct is a highly miscoding lesion generating C --> T transitions and C --> G transversions. To explore the mutagenic potential of another major 4-OHEN-dA adduct, site-specifically modified oligodeoxynucleotides containing a single diastereoisomer of 4-OHEN-dA (Pk-1, Pk-2, and Pk-3) were prepared by a postsynthetic method and used as DNA templates for primer extension reactions catalyzed by human DNA polymerase (pol) eta and kappa that are highly expressed in the reproductive organs. Primer extension catalyzed by pol eta or pol kappa occurred rapidly on the unmodified template to form fully extended products. With the major 4-OHEN-dA-modified templates (Pk-2 and Pk-3), primer extension was retarded prior to the lesion and opposite the lesion; a fraction of the primers was extended past the lesion. Steady-state kinetic studies with pol eta and pol kappa indicated that dTMP, the correct base, was preferentially incorporated opposite the 4-OHEN-dA lesion. In addition, pol eta and pol kappa bypassed the lesion by incorporating dAMP and dCMP, respectively, opposite the lesion and extended past the lesion. The relative bypass frequency past the 4-OHEN-dA lesion with pol eta was at least 2 orders of magnitude higher than that observed with pol kappa. The bypass frequency past Pk-2 was more efficient than that past Pk-3. Thus, 4-OHEN-dA is a miscoding lesion generating A --> T transversions and A --> G transitions. The miscoding frequency and specificity of 4-OHEN-dA varied depending on the stereoisomer of the 4-OHEN-dA adduct and DNA polymerase used.

Simple sequence repeat marker loci discovery using SSR primer.

PubMed

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Identification of hare meat by a species-specific marker of mitochondrial origin.

PubMed

Santos, Cristina G; Melo, Vitor S; Amaral, Joana S; Estevinho, Letícia; Oliveira, M Beatriz P P; Mafra, Isabel

2012-03-01

Meat species identification in food has gained increasing interest in recent years due to public health, economic and legal concerns. Following the consumer trend towards high quality products, game meat has earned much attention. The aim of the present work was to develop a DNA-based technique able to identify hare meat. Mitochondrial cytochrome b gene was used to design species-specific primers for hare detection. The new primers proved to be highly specific to Lepus species, allowing the detection of 0.01% of hare meat in pork meat by polymerase chain reaction (PCR). A real-time PCR assay with the new intercalating EvaGreen dye was further proposed as a specific and fast tool for hare identification with increased sensitivity (1pg) compared to end-point PCR (10pg). It can be concluded that the proposed new primers can be used by both species-specific end-point PCR or real-time PCR to accurately authenticate hare meat. Copyright © 2011 Elsevier Ltd. All rights reserved.

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

PubMed

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-11-16

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A 22-mer primer enhances discriminatory power of AP-PCR fingerprinting technique in characterization of leptospires.

PubMed

Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C

2004-11-01

To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.

800,000 year old mammoth DNA, modern elephant DNA or PCR artefact?

PubMed

Binladen, Jonas; Gilbert, M Thomas P; Willerslev, Eske

2007-02-22

Poulakakis and colleagues (Poulakakis et al. 2006: Biol. Lett. 2, 451-454), report the recovery of 'authentic' mammoth DNA from an 800,000-year-old fragment of bone excavated on the island of Crete. In light of results from other ancient DNA studies that indicate how DNA survival is unlikely in samples, which are recovered from warm environments and are relatively old (e.g. more than 100,000 years), these findings come as a great surprise. Here, we show that problems exist with the methodological approaches used in the study. First, the nested PCR technique as reported is nonsensical--one of the second round 'nested' primers falls outside the amplicon of the first round PCR. More worryingly, the binding region of one of the first round primers (Elcytb320R) falls within the short 43 base pair reported mammoth sequence, specifically covering two of the three reportedly diagnostic Elephas polymorphisms. Finally, we demonstrate using a simple BLAST search in GenBank that the claimed 'uniquely derived character state' for mammoths is in fact also found within modern elephants.

Two Multidrug-Resistant Clinical Isolates of Bacteroides fragilis Carry a Novel Metronidazole Resistance nim Gene (nimJ)

PubMed Central

Veeranagouda, Yaligara; Hsi, Justin; Meggersee, Rosemary; Abratt, Valerie; Wexler, Hannah M.

2013-01-01

Two multidrug-resistant Bacteroides fragilis clinical isolates contain and express a novel nim gene, nimJ, that is not recognized by the “universal” nim primers and can confer increased resistance to metronidazole when introduced into a susceptible strain on a multicopy plasmid. HMW615, an appendiceal isolate, contains at least two copies of nimJ on its genome, while HMW616, an isolate from a patient with sepsis, contains one genomic copy of nimJ. B. fragilis NimJ is phylogenetically closer to Prevotella baroniae NimI and Clostridium botulinum NimA than to the other known Bacteroides Nim proteins. The predicted protein structure of NimJ, based on fold recognition analysis, is consistent with the crystal structures derived for known Nim proteins, and specific amino acid residues important for substrate binding in the active site are conserved. This study demonstrates that the “universal” nim primers will not detect all nim genes with the ability to confer metronidazole resistance, but nimJ alone cannot account for the very high metronidazole MICs of these resistant clinical isolates. PMID:23716049

Fingerprinting of Cyanobacteria Based on PCR with Primers Derived from Short and Long Tandemly Repeated Repetitive Sequences

PubMed Central

Rasmussen, Ulla; Svenning, Mette M.

1998-01-01

The presence of repeated DNA (short tandemly repeated repetitive [STRR] and long tandemly repeated repetitive [LTRR]) sequences in the genome of cyanobacteria was used to generate a fingerprint method for symbiotic and free-living isolates. Primers corresponding to the STRR and LTRR sequences were used in the PCR, resulting in a method which generate specific fingerprints for individual isolates. The method was useful both with purified DNA and with intact cyanobacterial filaments or cells as templates for the PCR. Twenty-three Nostoc isolates from a total of 35 were symbiotic isolates from the angiosperm Gunnera species, including isolates from the same Gunnera species as well as from different species. The results show a genetic similarity among isolates from different Gunnera species as well as a genetic heterogeneity among isolates from the same Gunnera species. Isolates which have been postulated to be closely related or identical revealed similar results by the PCR method, indicating that the technique is useful for clustering of even closely related strains. The method was applied to nonheterocystus cyanobacteria from which a fingerprint pattern was obtained. PMID:16349487

[Design of primers to DNA of lactic acid bacteria].

PubMed

Lashchevskiĭ, V V; Kovalenko, N K

2003-01-01

Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

PubMed

Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

2013-03-01

Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers.

PubMed

Koester, Meike; Gergs, René

2017-10-05

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

PubMed

Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

2016-11-22

Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

PubMed

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Improving qPCR methodology for detection of foaming bacteria by analysis of broad-spectrum primers and a highly specific probe for quantification of Nocardia spp. in activated sludge.

PubMed

Asvapathanagul, P; Olson, B H

2017-01-01

To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.

High-Throughput Sequencing of 16S rRNA Gene Amplicons: Effects of Extraction Procedure, Primer Length and Annealing Temperature

PubMed Central

Sergeant, Martin J.; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W.; Pallen, Mark J.

2012-01-01

The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers. PMID:22666455

High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

PubMed

Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

2012-01-01

The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

A primer on thermodynamic-based models for deciphering transcriptional regulatory logic.

PubMed

Dresch, Jacqueline M; Richards, Megan; Ay, Ahmet

2013-09-01

A rigorous analysis of transcriptional regulation at the DNA level is crucial to the understanding of many biological systems. Mathematical modeling has offered researchers a new approach to understanding this central process. In particular, thermodynamic-based modeling represents the most biophysically informed approach aimed at connecting DNA level regulatory sequences to the expression of specific genes. The goal of this review is to give biologists a thorough description of the steps involved in building, analyzing, and implementing a thermodynamic-based model of transcriptional regulation. The data requirements for this modeling approach are described, the derivation for a specific regulatory region is shown, and the challenges and future directions for the quantitative modeling of gene regulation are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

PubMed Central

Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

2016-01-01

Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

Competitive amplification of differentially melting amplicons (CADMA) enables sensitive and direct detection of all mutation types by high-resolution melting analysis.

PubMed

Kristensen, Lasse S; Andersen, Gitte B; Hager, Henrik; Hansen, Lise Lotte

2012-01-01

Sensitive and specific mutation detection is of particular importance in cancer diagnostics, prognostics, and individualized patient treatment. However, the majority of molecular methodologies that have been developed with the aim of increasing the sensitivity of mutation testing have drawbacks in terms of specificity, convenience, or costs. Here, we have established a new method, Competitive Amplification of Differentially Melting Amplicons (CADMA), which allows very sensitive and specific detection of all mutation types. The principle of the method is to amplify wild-type and mutated sequences simultaneously using a three-primer system. A mutation-specific primer is designed to introduce melting temperature decreasing mutations in the resulting mutated amplicon, while a second overlapping primer is designed to amplify both wild-type and mutated sequences. When combined with a third common primer very sensitive mutation detection becomes possible, when using high-resolution melting (HRM) as detection platform. The introduction of melting temperature decreasing mutations in the mutated amplicon also allows for further mutation enrichment by fast coamplification at lower denaturation temperature PCR (COLD-PCR). For proof-of-concept, we have designed CADMA assays for clinically relevant BRAF, EGFR, KRAS, and PIK3CA mutations, which are sensitive to, between 0.025% and 0.25%, mutated alleles in a wild-type background. In conclusion, CADMA enables highly sensitive and specific mutation detection by HRM analysis. © 2011 Wiley Periodicals, Inc.

[Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].

PubMed

Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun

2009-10-01

To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.

Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

PubMed Central

2014-01-01

Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

PubMed

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE PAGES

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

2018-03-27

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

PubMed Central

Bokulich, Nicholas A.

2013-01-01

Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

PubMed

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

PubMed

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

PubMed

Winn-Deen

1998-12-01

Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.

Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

PubMed Central

Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

2016-01-01

The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

NASA Astrophysics Data System (ADS)

Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

2015-12-01

Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

PubMed

Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

2007-04-10

To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

[Mapping of seedlessness gene in grapes using SCAR markers].

PubMed

Yang, Ke-Qiang; Wang, Yue-Jin; Zhang, Jin-Jin; Wang, Xi-Ping; W A N, Yi-Zhen; Zhang, Jian-Xia

2005-03-01

Nine primers (including UBC-269 and GSLP1) were designed and synthesized based on DNA sequences of UBC-269(484) and GSLP1(569). The template DNA from Red Globe (seeded paternal parent) and Flame Seedless (seedless maternal parent) were screened using these primers. For Flame Seedless,GSLP1 yielded specific marker GSLP1(569); No. 39970524-5 primer yielded specific marker 39970524-5-564; and No. 6 primer yielded specific marker 39970524-6-1538 and 39970524-6-1200. GSLP1, No. 39970524-5, and No. 39970524-6 primers were used specifically to screen template DNA from the experimental plant materials. The results showed that the specific markers GSLP1(569), 39970524-5-564,39970524-6-1538 and 39970524-6-1200 were cosegregating with the major seedlessness gene. All these specific loci were also present in Thompson Seedless which was the initial donor of the seedlessness gene. It suggests that these SCAR markers are linked to a major grape seedlessness gene S. Markers order and map distance were estimated using the software 'QTXb17'. This showed that GSLP1(569), 39970524-5-564,39970524-6-1538 and 39970524-6-1200 were tightly linked to gene S. When P = 0.01,confidence limits for map distance ranged from 0.2 to 9.9; standard errors of map distance were from 0.6 to 1.9; LOD for linkage were from 32.7 to 46.4. These markers and the gene S were found to be in the same group. The markers were located on either side of gene S, covering 12.3 cM of the grape genome. The genetic distances between gene S and 39970524-5-564, GSLP1(569), 39970524-6-1538 and 39970524-6-1200 were 0.6 cM, 1.2 cM, 4.9 cM and 11.1 cM respectively.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Immunological properties of the primer-independent glucosyltransferase of Streptococcus mutans serotypes d and g.

PubMed

Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T

1988-05-01

Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.

Assessment of Equine Fecal Contamination: The Search for Alternative Bacterial Source-tracking Targets

EPA Science Inventory

16S rDNA clone libraries were evaluated for detection of fecal source-identifying bacteria from a collapsed equine manure pile. Libraries were constructed using universal eubacterial primers and Bacteroides-Prevotella group-specific primers. Eubacterial sequences indicat...

FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

EPA Science Inventory

Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.

PubMed

Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun

2007-10-01

Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.

Aerospace Non Chrome Corrosion Inhibiting Primer Systems

DTIC Science & Technology

2009-09-01

Meet all HSE specifications, TSCA, REACh, Akzo • Strippable • No weight increase over current system • Meet specification requirements for corrosion, not...Positive and negative controls • Primer only and topcoated samples Aerospace Coatings | Title 9 OEM CF Optimization/ Down Selects •Usual issues...found to be true • Good NSS ≠ Good filiform ≠ Good cure ≠ Good application properties • Down select process is to minimize ≠ and move to a balance of

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

PubMed Central

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

PubMed

Torriani, S; Zapparoli, G; Dellaglio, F

1999-10-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

Use of species-specific PCR for the identification of 10 sea cucumber species

NASA Astrophysics Data System (ADS)

Wen, Jing; Zeng, Ling

2014-11-01

We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

PubMed Central

Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

2013-01-01

Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

Improved Safety for Molecular Diagnosis of Classical Rabies Viruses by Use of a TaqMan Real-Time Reverse Transcription-PCR “Double Check” Strategy▿ †

PubMed Central

Hoffmann, B.; Freuling, C. M.; Wakeley, P. R.; Rasmussen, T. B.; Leech, S.; Fooks, A. R.; Beer, M.; Müller, T.

2010-01-01

To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome by a combined assay that detected all samples as positive. In addition, the introduction of labeled positive controls (LPC) increased the diagnostic safety of the single as well as the combined assay. Based on the newly developed, alternative assay for the detection of rabies virus and the application of LPCs, an improved diagnostic sensitivity and reliability can be ascertained for postmortem and intra vitam real-time RT-PCR analyses in rabies reference laboratories. PMID:20739489

3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

PubMed

Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

2004-01-01

The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

Improved safety for molecular diagnosis of classical rabies viruses by use of a TaqMan real-time reverse transcription-PCR "double check" strategy.

PubMed

Hoffmann, B; Freuling, C M; Wakeley, P R; Rasmussen, T B; Leech, S; Fooks, A R; Beer, M; Müller, T

2010-11-01

To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome by a combined assay that detected all samples as positive. In addition, the introduction of labeled positive controls (LPC) increased the diagnostic safety of the single as well as the combined assay. Based on the newly developed, alternative assay for the detection of rabies virus and the application of LPCs, an improved diagnostic sensitivity and reliability can be ascertained for postmortem and intra vitam real-time RT-PCR analyses in rabies reference laboratories.

Use of novel species-specific PCR primers targeted to DNA gyrase subunit B (gyrB) gene for species identification of the Cronobacter sakazakii and Cronobacter dublinensis.

PubMed

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina

2013-02-01

Cronobacter sakazakii and its phylogenetically closest species are considered to be an opportunistic pathogens associated with food-borne disease in neonates and infants. Neither phenotypic nor genotypic (16S ribosomal DNA sequence analysis) techniques can provide sufficient resolutions for accurately and rapidly identification of these species. The objective of this study was to develop species-specific PCR based on the gyrB gene sequence for direct species identification of the C. sakazakii and Cronobacter dublinensis within the C. sakazakii group. Two pair of species-specific primers were designed and used to specifically identify C. sakazakii and C. dublinensis, but none of the other C. sakazakii group strains. Our data indicate that the novel species-specific primers could be used to rapidly and accurately identify the species of C. sakazakii and C. dublinensis from C. sakazakii group by the PCR based assays. Copyright © 2012 Elsevier Ltd. All rights reserved.

Phylogenetic analysis of bacterial and archaeal species in symptomatic and asymptomatic endodontic infections.

PubMed

Vickerman, M M; Brossard, K A; Funk, D B; Jesionowski, A M; Gill, S R

2007-01-01

Phylogenetic analysis of bacterial and archaeal 16S rRNA was used to examine polymicrobial communities within infected root canals of 20 symptomatic and 14 asymptomatic patients. Nucleotide sequences from approximately 750 clones amplified from each patient group with universal bacterial primers were matched to the Ribosomal Database Project II database. Phylotypes from 37 genera representing Actinobacteria, Bacteroidetes, Firmicutes, Fusobacteria and Proteobacteria were identified. Results were compared to those obtained with species-specific primers designed to detect Prevotella intermedia, Porphyromonas gingivalis, Porphyromonas endodontalis, Peptostreptococcus micros, Enterococcus sp., Streptococcus sp., Fusobacterium nucleatum, Tannerella forsythensis and Treponema denticola. Since members of the domain Archaea have been implicated in the severity of periodontal disease, and a recent report confirms that archaea are present in endodontic infections, 16S archaeal primers were also used to detect which patients carried these prokaryotes, to determine if their presence correlated with severity of the clinical symptoms. A Methanobrevibacter oralis-like species was detected in one asymptomatic and one symptomatic patient. DNA from root canals of these two patients was further analysed using species-specific primers to determine bacterial cohabitants. Trep. denticola was detected in the asymptomatic but not the symptomatic patient. Conversely, Porph. endodontalis was found in the symptomatic but not the asymptomatic patient. All other species except enterococci were detected with the species-specific primers in both patients. These results confirm the presence of archaea in root canals and provide additional insights into the polymicrobial communities in endodontic infections associated with clinical symptoms.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Multiplex primer prediction software for divergent targets

PubMed Central

Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

2009-01-01

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

PubMed

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Development of Three PCR Assays for the Differentiation between Echinococcus shiquicus, E. granulosus (G1 genotype), and E. multilocularis DNA in the Co-Endemic Region of Qinghai-Tibet plateau, China

PubMed Central

Boufana, Belgees; Umhang, Gérald; Qiu, Jiamin; Chen, Xingwang; Lahmar, Samia; Boué, Franck; Jenkins, David; Craig, Philip

2013-01-01

To investigate echinococcosis in co-endemic regions, three polymerase chain reaction (PCR) assays based on the amplification of a fragment within the NADH dehydrogenase subunit 1 (ND1) mitochondrial gene were optimized for the detection of Echinococcus shiquicus, Echinococcus granulosus G1, and Echinococcus multilocularis DNA derived from parasite tissue or canid fecal samples. Specificity using parasite tissue-derived DNA was found to be 100% except for E. shiquicus primers that faintly detected E. equinus DNA. Sensitivity of the three assays for DNA detection was between 2 and 10 pg. Ethanol precipitation of negative PCR fecal samples was used to eliminate false negatives and served to increase sensitivity as exemplified by an increase in detection from 0% to 89% of E. shiquicus coproDNA using necropsy-positive fox samples. PMID:23438764

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

PubMed

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

PubMed Central

Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-01-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

PubMed

Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-08-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

PubMed

Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

2013-10-18

To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

Zoledronate and ion-releasing resins impair dentin collagen degradation.

PubMed

Tezvergil-Mutluay, A; Seseogullari-Dirihan, R; Feitosa, V P; Tay, F R; Watson, T F; Pashley, D H; Sauro, S

2014-10-01

This study analyzed the amounts of solubilized telopeptides cross-linked carboxyterminal telopeptide of type I collagen (ICTP) and C-terminal crosslinked telopeptide of type I collagen (CTX) derived from matrix-metalloproteinases (MMPs) and cysteine cathepsins (CTPs) subsequent to application of a filler-free (Res.A) or an ion-releasing resin (Res.B) to ethylenediaminetetraacetic acid (EDTA)-demineralized dentin with or without zoledronate-containing primer (Zol-primer) pre-treatment. The chemical modification induced following treatments and artificial saliva (AS) storage was also analyzed through attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR). Totally EDTA-demineralized specimens were infiltrated with Res.A or Res.B with or without Zol-primer pre-treatment, light-cured, and immersed in AS for up to 4 wk. ICTP release was reduced following infiltration with Res.B and further reduced when Res.B was used with Zol-primer; remarkable phosphate mineral uptake was attained after AS storage. CTX release was increased in Res.A- and Res.B-treated dentin. However, when Zol-primer was used with Res.A, the CTX release fell significantly compared to the other tested resin-infiltration methods. In conclusion, zoledronate offers an additional inhibitory effect to the ion-releasing resins in MMP-mediated collagen degradation. However, Zol-primer induces a modest reduction in CTX release only when used with resin-based systems containing no ion-releasing fillers. © International & American Associations for Dental Research.

Zoledronate and Ion-releasing Resins Impair Dentin Collagen Degradation

PubMed Central

Tezvergil-Mutluay, A.; Seseogullari-Dirihan, R.; Feitosa, V.P.; Tay, F.R.; Watson, T.F.; Pashley, D.H.; Sauro, S.

2014-01-01

This study analyzed the amounts of solubilized telopeptides cross-linked carboxyterminal telopeptide of type I collagen (ICTP) and C-terminal crosslinked telopeptide of type I collagen (CTX) derived from matrix-metalloproteinases (MMPs) and cysteine cathepsins (CTPs) subsequent to application of a filler-free (Res.A) or an ion-releasing resin (Res.B) to ethylenediaminetetraacetic acid (EDTA)-demineralized dentin with or without zoledronate-containing primer (Zol-primer) pre-treatment. The chemical modification induced following treatments and artificial saliva (AS) storage was also analyzed through attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR). Totally EDTA-demineralized specimens were infiltrated with Res.A or Res.B with or without Zol-primer pre-treatment, light-cured, and immersed in AS for up to 4 wk. ICTP release was reduced following infiltration with Res.B and further reduced when Res.B was used with Zol-primer; remarkable phosphate mineral uptake was attained after AS storage. CTX release was increased in Res.A- and Res.B-treated dentin. However, when Zol-primer was used with Res.A, the CTX release fell significantly compared to the other tested resin-infiltration methods. In conclusion, zoledronate offers an additional inhibitory effect to the ion-releasing resins in MMP-mediated collagen degradation. However, Zol-primer induces a modest reduction in CTX release only when used with resin-based systems containing no ion-releasing fillers. PMID:25074494

The removal of RNA primers from DNA synthesized by the reverse transcriptase of the retrotransposon Tf1 is stimulated by Tf1 integrase.

PubMed

Herzig, Eytan; Voronin, Nickolay; Hizi, Amnon

2012-06-01

The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process.

The Removal of RNA Primers from DNA Synthesized by the Reverse Transcriptase of the Retrotransposon Tf1 Is Stimulated by Tf1 Integrase

PubMed Central

Herzig, Eytan; Voronin, Nickolay

2012-01-01

The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process. PMID:22491446

Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

PubMed

Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

2018-03-09

Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Development of Species-Specific SCAR Markers, Based on a SCoT Analysis, to Authenticate Physalis (Solanaceae) Species

PubMed Central

Feng, Shangguo; Zhu, Yujia; Yu, Chenliang; Jiao, Kaili; Jiang, Mengying; Lu, Jiangjie; Shen, Chenjia; Ying, Qicai; Wang, Huizhong

2018-01-01

Physalis is an important genus in the Solanaceae family. It includes many species of significant medicinal value, edible value, and ornamental value. However, many Physalis species are easily confused because of their similar morphological traits, which hinder the utilization and protection of Physalis resources. Therefore, it is necessary to create fast, sensitive, and reliable methods for the Physalis species authentication. Intended for that, in this study, species-specific sequence-characterized amplified region (SCAR) markers were developed for accurate identification of the closely related Physalis species P. angulata, P. minima, P. pubescens, and P. alkekengi var. franchetii, based on a simple and novel marker system, start codon targeted (SCoT) marker. A total of 34 selected SCoT primers yielded 289 reliable SCoT loci, of which 265 were polymorphic. Four species-specific SCoT fragments (SCoT3-1404, SCoT3-1589, SCoT5-550, and SCoT36-520) from Physalis species were successfully identified, cloned, and sequenced. Based on these selected specific DNA fragments, four SCAR primers pairs were developed and named ST3KZ, ST3MSJ, ST5SJ, and ST36XSJ. PCR analysis of each of these primer pairs clearly demonstrated a specific amplified band in all samples of the target Physalis species, but no amplification was observed in other Physalis species. Therefore, the species-specific SCAR primer pairs developed in this study could be used as powerful tools that can rapidly, effectively, and reliably identify and differentiate Physalis species.

Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

PubMed Central

Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

2005-01-01

Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

Review of "A School Privatization Primer for Michigan School Officials, Media and Residents"

ERIC Educational Resources Information Center

Belfield, Clive

2008-01-01

Issued by the Mackinac Center for Public Policy, "A School Privatization Primer for Michigan School Officials, Media and Residents" examines the "contracting out" of public school support services--specifically food, transportation, and custodial services. The report describes the prevalence of contracting out and sets forth…

Expressed Sequence Reference Standards for Evaluating Stage-specific Gene Expression in Southern Green Lacewings, Chrysoperla rufilabris

USDA-ARS?s Scientific Manuscript database

Five developmental stages of Chrysoperla rufilabris were tested using nine primer pairs. Three sequences were highly expressed at all life stages and six were differentially expressed. These primer pairs may be used as standards to quantitate functional gene expression associated with physiological ...

Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

PubMed

Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

2009-01-01

PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

Isolation and characterization of novel microsatellite markers from the sika deer (Cervus nippon) genome.

PubMed

Li, Y M; Bai, C Y; Niu, W P; Yu, H; Yang, R J; Yan, S Q; Zhang, J Y; Zhang, M J; Zhao, Z H

2015-09-28

Microsatellite markers are widely and evenly distributed, and are highly polymorphic. Rapid and convenient detection through automated analysis means that microsatellite markers are widely used in the construction of plant and animal genetic maps, in quantitative trait loci localization, marker-assisted selection, identification of genetic relationships, and genetic diversity and phylogenetic tree construction. However, few microsatellite markers remain to be isolated. We used streptavidin magnetic beads to affinity-capture and construct a (CA)n microsatellite DNA-enriched library from sika deer. We selected sequences containing more than six repeats to design primers. Clear bands were selected, which were amplified using non-specific primers following PCR amplification to screen polymorphisms in a group of 65 unrelated sika deer. The positive clone rate reached 82.9% by constructing the enriched library, and we then selected positive clones for sequencing. There were 395 sequences with CA repeats, and the CA repeat number was 4-105. We selected sequences containing more than six repeats to design primers, of which 297 pairs were designed. We next selected clear bands and used non-specific primers to amplify following PCR amplification. In total, 245 pairs of primers were screened. We then selected 50 pairs of primers to randomly screen for polymorphisms. We detected 47 polymorphic and 3 monomorphic loci in 65 unrelated sika deer. These newly isolated and characterized microsatellite loci can be used to construct genetic maps and for lineage testing in deer. In addition, they can be used for comparative genomics between Cervidae species.

Evaluation of LSSP-PCR for identification of Leptospira spp. in urine samples of cattle with clinical suspicion of leptospirosis.

PubMed

Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota

2006-12-20

We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

PubMed Central

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

The Reverse Transcriptase of the Tf1 Retrotransposon Has a Specific Novel Activity for Generating the RNA Self-Primer That Is Functional in cDNA Synthesis▿

PubMed Central

Hizi, Amnon

2008-01-01

The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5′ end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3′ end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs. PMID:18753200

The reverse transcriptase of the Tf1 retrotransposon has a specific novel activity for generating the RNA self-primer that is functional in cDNA synthesis.

PubMed

Hizi, Amnon

2008-11-01

The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5' end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3' end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs.

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

PubMed

Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

2014-01-01

Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

Pathotypic characterization of Newcastle disease virus isolated from vaccinated chicken in West Java, Indonesia.

PubMed

Putri, Dwi Desmiyeni; Handharyani, Ekowati; Soejoedono, Retno Damajanti; Setiyono, Agus; Mayasari, Ni Luh Putu Ika; Poetri, Okti Nadia

2017-04-01

This research was conducted to differentiate and characterize eight Newcastle disease virus (NDV) isolates collected from vaccinated chicken at commercial flocks in West Java, Indonesia, in 2011, 2014 and 2015 by pathotype specific primers. A total of eight NDV isolates collected from clinical outbreaks among commercial vaccinated flocks in West Java, Indonesia, in 2011, 2014, and 2015 were used in this study. Reverse transcription-polymerase chain reaction was used to detect and differentiate virulence of NDV strains, using three sets of primers targeting their M and F gene. First primers were universal primers to detect NDV targeting matrix (M) gene. Other two sets of primers were specific for the fusion (F) gene cleavage site sequence of virulent and avirulent NDV strains. Our results showed that three isolates belong to NDV virulent strains, and other five isolates belong to NDV avirulent strains. The nucleotide sequence of the F protein cleavage site showed 112 K/R-R-Q/R-K-R/G-F 117 on NDV virulent strains and 112 G-K/R-Q-G-R-L 117 on NDV avirulent strain. Result from the current study suggested that NDV virulent strain were circulating among vaccinated chickens in West Java, Indonesia; this might possess a risk of causing ND outbreaks and causing economic losses within the poultry industry.

A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

PubMed

Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

2015-02-01

A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR

PubMed Central

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.

Comparison of three PCR primer sets for identification of vanB gene carriage in feces and correlation with carriage of vancomycin-resistant enterococci: interference by vanB-containing anaerobic bacilli.

PubMed

Ballard, S A; Grabsch, E A; Johnson, P D R; Grayson, M L

2005-01-01

We assessed the sensitivities and specificities of three previously described PCR primers on enrichment broth cultures of feces for the accurate detection of fecal carriage of vancomycin-resistant enterococci (VRE). In addition, we investigated specimens that were vanB PCR positive but VRE culture negative for the presence of other vanB-containing pathogens. Feces from 59 patients (12 patients carrying vanB Enterococcus faecium strains and 47 patients negative for VRE carriage) were cultured for 36 h in aerobic brain heart infusion (BHI) broth, anaerobic BHI (AnO(2)BHI) broth, or aerobic Enterococcosel (EC) broth. DNA was extracted from the cultures and tested for the presence of vanB by using the PCR primers of Dutka-Malen et al. (S. Dutka-Malen, S. Evers, and P. Courvalin, J. Clin. Microbiol. 33:24-27, 1995), Bell et al. (J. M. Bell, J. C. Paton, and J. Turnidge, J. Clin. Microbiol. 36:2187-2190, 1998), and Stinear et al. (T. P. Stinear, D. C. Olden, P. D. R. Johnson, J. K. Davies, and M. L. Grayson, Lancet 357:855-856, 2001). The sensitivity (specificity) of PCR compared with the results of culture on BHI, AnO(2)BHI, and EC broths were 67% (96%), 50% (94%), and 17% (100%), respectively, with the primers of Dutka-Malen et al.; 92% (60%), 92% (45%), and 92% (83%), respectively, with the primers of Bell et al.; and 92% (49%), 92% (43%), and 100% (51%) respectively, with the primers of Stinear et al. The primers of both Bell et al. and Stinear et al. were significantly more sensitive than those of Dutka-Malen et al. in EC broth (P = 0.001 and P < 0.001, respectively). The poor specificities for all primer pairs were due in part to the isolation and identification of six anaerobic gram-positive bacilli, Clostridium hathewayi (n = 3), a Clostridium innocuum-like organism (n = 1), Clostridium bolteae (n = 1), and Ruminococcus lactaris-like (n = 1), from five fecal specimens that were vanB positive but VRE culture negative. All six organisms were demonstrated to contain a vanB gene identical to that of VRE. VanB-containing bowel anaerobes may result in false-positive interpretation of PCR-positive fecal enrichment cultures as VRE, regardless of the primers and protocols used.

Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

PubMed

Panicker, Gitika; Bej, Asim K

2005-10-01

We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

PubMed

Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

2005-12-01

Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

PubMed

Kemp, S J; Maillard, J C; Teale, A J

1993-04-01

A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

Detecting in situ copepod diet diversity using molecular technique: development of a copepod/symbiotic ciliate-excluding eukaryote-inclusive PCR protocol.

PubMed

Hu, Simin; Guo, Zhiling; Li, Tao; Carpenter, Edward J; Liu, Sheng; Lin, Senjie

2014-01-01

Knowledge of in situ copepod diet diversity is crucial for accurately describing pelagic food web structure but is challenging to achieve due to lack of an easily applicable methodology. To enable analysis with whole copepod-derived DNAs, we developed a copepod-excluding 18S rDNA-based PCR protocol. Although it is effective in depressing amplification of copepod 18S rDNA, its applicability to detect diverse eukaryotes in both mono- and mixed-species has not been demonstrated. Besides, the protocol suffers from the problem that sequences from symbiotic ciliates are overrepresented in the retrieved 18S rDNA libraries. In this study, we designed a blocking primer to make a combined primer set (copepod/symbiotic ciliate-excluding eukaryote-common: CEEC) to depress PCR amplification of symbiotic ciliate sequences while maximizing the range of eukaryotes amplified. We firstly examined the specificity and efficacy of CEEC by PCR-amplifying DNAs from 16 copepod species, 37 representative organisms that are potential prey of copepods and a natural microplankton sample, and then evaluated the efficiency in reconstructing diet composition by detecting the food of both lab-reared and field-collected copepods. Our results showed that the CEEC primer set can successfully amplify 18S rDNA from a wide range of isolated species and mixed-species samples while depressing amplification of that from copepod and targeted symbiotic ciliate, indicating the universality of CEEC in specifically detecting prey of copepods. All the predetermined food offered to copepods in the laboratory were successfully retrieved, suggesting that the CEEC-based protocol can accurately reconstruct the diets of copepods without interference of copepods and their associated ciliates present in the DNA samples. Our initial application to analyzing the food composition of field-collected copepods uncovered diverse prey species, including those currently known, and those that are unsuspected, as copepod prey. While testing is required, this protocol provides a useful strategy for depicting in situ dietary composition of copepods.

Short interspersed elements (SINEs) of the Geomyoidea superfamily rodents.

PubMed

Gogolevsky, Konstantin P; Kramerov, Dmitri A

2006-05-24

A new short interspersed element (SINE) was isolated from the genome of desert kangaroo rat (Dipodomys deserti) using single-primer PCR. This SINE consists of two monomers: the left monomer (IDL) resembles rodent ID element and other tRNAAla(CGC)-derived SINEs, whereas the right one (Geo) shows no similarity with known SINE sequences. PCR and hybridization analyses demonstrated that IDL-Geo SINE is restricted to the rodent superfamily Geomyoidea (families Geomyidea and Heteromyidea). Isolation and analysis of IDL-Geo from California pocket mouse (Chaetodipus californicus) and Botta's pocket gopher (Thomomys bottae) revealed some species-specific features of this SINE family. The structure and evolution of known dimeric SINEs are discussed.

Molecular Identification of Sex in Phoenix dactylifera Using Inter Simple Sequence Repeat Markers.

PubMed

Al-Ameri, Abdulhafed A; Al-Qurainy, Fahad; Gaafar, Abdel-Rhman Z; Khan, Salim; Nadeem, M

2016-01-01

Early sex identification of Date Palm (Phoenix dactylifera L.) at seedling stage is an economically desirable objective, which will significantly increase the profits of seed based cultivation. The utilization of molecular markers at this stage for early and rapid identification of sex is important due to the lack of morphological markers. In this study, a total of two hundred Inter Simple Sequence Repeat (ISSR) primers were screened among male and female Date palm plants to identify putative sex-specific marker, out of which only two primers (IS_A02 and IS_A71) were found to be associated with sex. The primer IS_A02 produced a unique band of size 390 bp and was found clearly in all female plants, while it was absent in all male plants. Contrary to this, the primer IS_A71 produced a unique band of size 380 bp and was clearly found in all male plants, whereas it was absent in all the female plants. Subsequently, these specific fragments were excised, purified, and sequenced for the development of sequence specific markers further in future for the implementation on dioecious Date Palm for sex determination. These markers are efficient, highly reliable, and reproducible for sex identification at the early stage of seedling.

Technical note: development of a quantitative PCR method for monitoring strain dynamics during yogurt manufacture.

PubMed

Miller, D M; Dudley, E G; Roberts, R F

2012-09-01

Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Detection and identification of genetically modified EE-1 brinjal (Solanum melongena) by single, multiplex and SYBR® real-time PCR.

PubMed

Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R

2013-01-01

Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.

Putative Microsatellite DNA Marker-Based Wheat Genomic Resource for Varietal Improvement and Management.

PubMed

Jaiswal, Sarika; Sheoran, Sonia; Arora, Vasu; Angadi, Ulavappa B; Iquebal, Mir A; Raghav, Nishu; Aneja, Bharti; Kumar, Deepender; Singh, Rajender; Sharma, Pradeep; Singh, G P; Rai, Anil; Tiwari, Ratan; Kumar, Dinesh

2017-01-01

Wheat fulfills 20% of global caloric requirement. World needs 60% more wheat for 9 billion population by 2050 but climate change with increasing temperature is projected to affect wheat productivity adversely. Trait improvement and management of wheat germplasm requires genomic resource. Simple Sequence Repeats (SSRs) being highly polymorphic and ubiquitously distributed in the genome, can be a marker of choice but there is no structured marker database with options to generate primer pairs for genotyping on desired chromosome/physical location. Previously associated markers with different wheat trait are also not available in any database. Limitations of in vitro SSR discovery can be overcome by genome-wide in silico mining of SSR. Triticum aestivum SSR database ( TaSSRDb ) is an integrated online database with three-tier architecture, developed using PHP and MySQL and accessible at http://webtom.cabgrid.res.in/wheatssr/. For genotyping, Primer3 standalone code computes primers on user request. Chromosome-wise SSR calling for all the three sub genomes along with choice of motif types is provided in addition to the primer generation for desired marker. We report here a database of highest number of SSRs (476,169) from complex, hexaploid wheat genome (~17 GB) along with previously reported 268 SSR markers associated with 11 traits. Highest (116.93 SSRs/Mb) and lowest (74.57 SSRs/Mb) SSR densities were found on 2D and 3A chromosome, respectively. To obtain homozygous locus, e-PCR was done. Such 30 loci were randomly selected for PCR validation in panel of 18 wheat Advance Varietal Trial (AVT) lines. TaSSRDb can be a valuable genomic resource tool for linkage mapping, gene/QTL (Quantitative trait locus) discovery, diversity analysis, traceability and variety identification. Varietal specific profiling and differentiation can supplement DUS (Distinctiveness, Uniformity, and Stability) testing, EDV (Essentially Derived Variety)/IV (Initial Variety) disputes, seed purity and hybrid wheat testing. All these are required in germplasm management as well as also in the endeavor of wheat productivity.

Putative Microsatellite DNA Marker-Based Wheat Genomic Resource for Varietal Improvement and Management

PubMed Central

Jaiswal, Sarika; Sheoran, Sonia; Arora, Vasu; Angadi, Ulavappa B.; Iquebal, Mir A.; Raghav, Nishu; Aneja, Bharti; Kumar, Deepender; Singh, Rajender; Sharma, Pradeep; Singh, G. P.; Rai, Anil; Tiwari, Ratan; Kumar, Dinesh

2017-01-01

Wheat fulfills 20% of global caloric requirement. World needs 60% more wheat for 9 billion population by 2050 but climate change with increasing temperature is projected to affect wheat productivity adversely. Trait improvement and management of wheat germplasm requires genomic resource. Simple Sequence Repeats (SSRs) being highly polymorphic and ubiquitously distributed in the genome, can be a marker of choice but there is no structured marker database with options to generate primer pairs for genotyping on desired chromosome/physical location. Previously associated markers with different wheat trait are also not available in any database. Limitations of in vitro SSR discovery can be overcome by genome-wide in silico mining of SSR. Triticum aestivum SSR database (TaSSRDb) is an integrated online database with three-tier architecture, developed using PHP and MySQL and accessible at http://webtom.cabgrid.res.in/wheatssr/. For genotyping, Primer3 standalone code computes primers on user request. Chromosome-wise SSR calling for all the three sub genomes along with choice of motif types is provided in addition to the primer generation for desired marker. We report here a database of highest number of SSRs (476,169) from complex, hexaploid wheat genome (~17 GB) along with previously reported 268 SSR markers associated with 11 traits. Highest (116.93 SSRs/Mb) and lowest (74.57 SSRs/Mb) SSR densities were found on 2D and 3A chromosome, respectively. To obtain homozygous locus, e-PCR was done. Such 30 loci were randomly selected for PCR validation in panel of 18 wheat Advance Varietal Trial (AVT) lines. TaSSRDb can be a valuable genomic resource tool for linkage mapping, gene/QTL (Quantitative trait locus) discovery, diversity analysis, traceability and variety identification. Varietal specific profiling and differentiation can supplement DUS (Distinctiveness, Uniformity, and Stability) testing, EDV (Essentially Derived Variety)/IV (Initial Variety) disputes, seed purity and hybrid wheat testing. All these are required in germplasm management as well as also in the endeavor of wheat productivity. PMID:29234333

Two molecular markers based on mitochondrial genomes for varieties identification of the northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids.

PubMed

Xincheng, Zhang; Kunci, Chen; Xinping, Zhu; Jian, Zhao; Qing, Luo; Xiaoyou, Hong; Wei, Li; Fengfang, Xiao

2015-08-01

The northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids have played important roles in the Chinese freshwater aquaculture industry, with an annual production in China exceeding 400 thousand tons. While these are popular aquaculture breeds in China, it is not easy to identify northern snakehead, blotched snakehead, and their hybrids. Thus, a method should be developed to identify these varieties. To distinguish between the reciprocal hybrids (C. argus ♀ × C. maculata ♂ and C. maculata ♀ × C. argus ♂), the mitochondrial genome sequences of northern snakehead and blotched snakehead and their reciprocal hybrids were compared. Following the alignment and analysis of mtDNA sequences of northern snakehead, blotched snakehead and their hybrids, two pairs of specific primers were designed based on identified differences ranging from 12S rRNA to 16S rRNA gene. The BY1 primers amplified the same bands in the blotched snakehead and the hybrid (C. maculata ♀ × C. argus ♂), while producing no products in northern snakehead and the hybrid (C. argus ♀ × C. maculata ♂). Amplification with WY1 yielded the opposite results. Then, 30 individuals per fish were randomized to verify the primers, and the results showed that the primers were specific for breeds, as intended. The specific primers can not only simply distinguish between two kinds of hybrids, but also rapidly identify the two parents. This study provides a method of molecular marker identification to identify reciprocal hybrids.

Comparison of PCR primer-based strategies for characterization of ammonia oxidizer communities in environmental samples.

PubMed

Mahmood, Shahid; Freitag, Thomas E; Prosser, James I

2006-06-01

PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.

Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

USDA-ARS?s Scientific Manuscript database

Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

USDA-ARS?s Scientific Manuscript database

TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

Two methods for increased specificity and sensitivity in loop-mediated isothermal amplification

USDA-ARS?s Scientific Manuscript database

The technique of loop-mediated isothermal amplification (LAMP) utilizes 4 (or 6) primers targeting 6 (or 8) regions within a fairly small segment of a genome for amplification, with concentration higher than that used in traditional PCR methods. The high concentrations of primers used leads to an in...

Forest Interpreter's Primer on Fire Management.

ERIC Educational Resources Information Center

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

PubMed

Bisset, S A; Knight, J S; Bouchet, C L G

2014-02-24

A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.

Specific detection of bifidobacterium strains in a pharmaceutical probiotic product and in human feces by polymerase chain reaction.

PubMed

Brigidi, P; Vitali, B; Swennen, E; Altomare, L; Rossi, M; Matteuzzi, D

2000-10-01

For PCR specific detection of the strains Bifidobacterium longum Y 10, B. infantis Y 1 and B. breve Y 8 used in a new probiotic product (VSL-3), strains-specific rDNA primers have been developed. Spacer regions between the 16S and 23S rRNA genes (ITS) of the three strains were amplified by PCR with conserved primers and the nucleotide sequence of these ITSs were determined. On the basis of their comparison with the rDNA sequences retrieved from GenBank, we designed new primers which specifically recognize the species B. breve and the two strains B. infantis Y 1 and B. breve Y 8. Specificity of these primers was confirmed through the analysis of 60 bifidobacteria strains belonging to the more representative human species. The feasibility of this PCR method was investigated in commercial VSL-3 product and fecal samples collected from 4 patients affected by inflammatory bowel deseases and two healthy subjects before and after the VSL-3 administration. By PCR analysis of different VSL-3 commercial batches we were successful in differentiating and quantifying the strains B. longum Y 10, B. infantis Y 1 and B. breve Y 8. B. infantis Y 1 and B. breve Y 8 could be detected at high concentration in fecal specimens of both patients and subjects treated with the probiotic preparation, showing a different colonization behaviour. Seven days after the VSL-3 treatment suspension, no patients and subjects harbored B. infantis Y 1 and B. breve Y 8, indicating a transient presence of these exogenous strains.

Multiplex real-time PCR assay for Legionella species.

PubMed

Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

2015-12-01

Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.

PubMed

Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q

2007-01-01

Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.

Development of a polymerase chain reaction assay for the specific identification of Burkholderia mallei and differentiation from Burkholderia pseudomallei and other closely related Burkholderiaceae.

PubMed

Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David

2006-05-01

Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.

[Iditification of five imported cases of Plasmodium ovale wallikeri infection in Zhejiang Province].

PubMed

Zhang, Ling-ling; Ruan, Wei; Chen, Hua-liang; Lu, Qiao-yi; Yao, Li-nong

2014-10-01

To identify and analyze Plasmodium ovale wallikeri in 5 imported malaria cases, who were detected positive by microscopy and negative by conventional PCR. Epidemiological information and blood samples were collected from the five patients. The detection was conducted by microscopy, Rapid Diagnostic Test (RDT) and nested PCR with Plasmodium genus-specific, species-specific and Plasmodium ovale wallikeri-specific primers. The amplified products were sequenced and Blast analysis was performed on line in NCBI. The five patients returned from Africa, and all had a history of malaria. They were microscopically positive for Plasmodium sp., and two cases showed Pan positive RDT result. All blood samples were negative for four Plasmodium spp. by conventional nested PCR, but positive by nested PCR with Plasmodium ovale wallikeri-specific primers. Blast analysis showed that the amplified sequences of the five cases had complete homology with P. ovale wallikeri clone RSH10 18S ribosomal RNA gene (Accession No. KF219561.1). The five cases which classified as positive by microscopy while negative by conventional PCR have been confirmed as Plasmodium ovale wallikeri infection by nested PCR with P. ovale wallikeri-specific primers.

Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

PubMed Central

Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea

2017-01-01

Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

PubMed Central

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-01-01

Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974

[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

PubMed

Chen, Suiqing; Lu, Xiaolei; Wang, Lili

2011-05-01

To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

High-throughput detection of human papillomavirus-18 L1 gene methylation, a candidate biomarker for the progression of cervical neoplasia.

PubMed

Turan, Tolga; Kalantari, Mina; Cuschieri, Kate; Cubie, Heather A; Skomedal, Hanne; Bernard, Hans-Ulrich

2007-04-25

The L1 gene of human papillomavirus-18 (HPV-18) is consistently hypermethylated in cervical carcinomas, but frequently hypo- or unmethylated in exfoliated cells from asymptomatic patients. In precancerous lesions, L1 is sporadically hypermethylated, correlating with the severity of the neoplasia. In order to explore the potential of using L1 methylation as a workable biomarker for carcinogenic progression of HPV-18 infections in routinely taken samples, our aim was to develop methylation-detection techniques that were sensitive and rapid without being overly complex technically. Therein, we developed a methylation-specific PCR (MSP) through the design of primer sets that specifically amplify either methylated or unmethylated HPV-18 L1 DNA within bisulfite-modified sample DNA. Amplification of unmethylated and in vitro methylated HPV-18 DNA by MSP resulted in 2500 copies of either of the two L1 DNA species being detected, a satisfactory sensitivity considering that bisulfite treatment leads to the fragmentation of about 99% of sample DNA. The primers proved specific and did not generate false positive results at concentrations exceeding the lowest limit of detection by a factor of 400. DNA from carcinomas yielded PCR signals only with the methylation-specific primers, and not with primers specific for unmethylated L1 genes. The inverse result was obtained with DNA from precursor lesions that contained only hypomethylated DNA. High-grade precursor lesions and carcinomas that contained hyper- as well as hypomethylated L1 DNA yielded PCR signals with both primers. By developing a fluorescence based real-time PCR, we quantitatively analyzed samples with in vitro methylated and unmethylated L1 DNA, and could distinguish clinical samples with hyper- and hypomethylated DNA or mixtures of both DNAs. The methylation-specific and real-time PCR techniques permitted efficient HPV-18 L1 methylation analyses and open the door for larger-scale clinical studies where the utility of methylation status to predict the progression of HPV-18 infection and HPV-18 associated lesions is assessed.

Identification of duck plague virus by polymerase chain reaction.

PubMed

Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

1999-01-01

A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

Diagnosis and molecular characterization of Trichomonas vaginalis in sex workers in the Philippines

PubMed Central

Queza, Macario Ireneo P; Rivera, Windell L

2013-01-01

Trichomonas vaginalis is a pathogenic protozoon which causes the sexually transmitted infection, trichomoniasis. The absence or non-specificity of symptoms often leads to misdiagnosis of the infection. In this study, 969 samples consisting of vaginal swabs and urine were collected and screened from social hygiene clinics across the Philippines. Of the 969 samples, 216 were used for the comparative analysis of diagnostic tools such as wet mount microscopy, culture, and PCR utilizing universal trichomonad primers, TFR1/2 and species-specific primers, TVK3/7 and TV1/2. PCR demonstrated higher sensitivity of 100% compared to 77% of the wet mount. PCR primer set TVK3/7 and culture had the same and the best expected average performance [receiver-operating characteristic (ROC): 0.98]. Prevalence of infection in the sample population was 6.8%. PMID:23683368

Molecular diversity of poleroviruses infecting cucurbit crops in four countries reveals the presence of members of six distinct species.

PubMed

Knierim, D; Tsai, W S; Maiss, E; Kenyon, L

2014-06-01

When 66 cucurbit samples with yellowing symptoms from fields in Mali, the Philippines, Thailand and Uzbekistan were screened by RT-PCR using universal polerovirus primers, 21 were identified as harboring polerovirus RNA. When these 21 samples were screened with specific primers for the known cucurbit-infecting poleroviruses, suakwa aphid-borne yellows virus and a recombinant strain of cucurbit aphid-borne yellows virus were detected for the first time in the Philippines and Thailand. However, seven polerovirus-positive samples did not react with any of the known species-specific primers. Sequencing of 1.4-kb universal polerovirus RT-PCR products revealed the presence of two poleroviruses that had not been described previously. These viruses, from Mali and Thailand, were provisionally named pepo aphid-borne yellows virus and luffa aphid-borne yellows virus, respectively.

Halal authenticity of gelatin using species-specific PCR.

PubMed

Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud

2015-10-01

Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.

SMM-system: A mining tool to identify specific markers in Salmonella enterica.

PubMed

Yu, Shuijing; Liu, Weibing; Shi, Chunlei; Wang, Dapeng; Dan, Xianlong; Li, Xiao; Shi, Xianming

2011-03-01

This report presents SMM-system, a software package that implements various personalized pre- and post-BLASTN tasks for mining specific markers of microbial pathogens. The main functionalities of SMM-system are summarized as follows: (i) converting multi-FASTA file, (ii) cutting interesting genomic sequence, (iii) automatic high-throughput BLASTN searches, and (iv) screening target sequences. The utility of SMM-system was demonstrated by using it to identify 214 Salmonella enterica-specific protein-coding sequences (CDSs). Eighteen primer pairs were designed based on eighteen S. enterica-specific CDSs, respectively. Seven of these primer pairs were validated with PCR assay, which showed 100% inclusivity for the 101 S. enterica genomes and 100% exclusivity of 30 non-S. enterica genomes. Three specific primer pairs were chosen to develop a multiplex PCR assay, which generated specific amplicons with a size of 180bp (SC1286), 238bp (SC1598) and 405bp (SC4361), respectively. This study demonstrates that SMM-system is a high-throughput specific marker generation tool that can be used to identify genus-, species-, serogroup- and even serovar-specific DNA sequences of microbial pathogens, which has a potential to be applied in food industries, diagnostics and taxonomic studies. SMM-system is freely available and can be downloaded from http://foodsafety.sjtu.edu.cn/SMM-system.html. Copyright © 2011 Elsevier B.V. All rights reserved.

Validation and Application of a Real-time PCR Protocol for the Specific Detection and Quantification of Clavibacter michiganensis subsp. sepedonicus in Potato.

PubMed

Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk

2015-06-01

Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×10(2) copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10(-6) dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension.

Validation and Application of a Real-time PCR Protocol for the Specific Detection and Quantification of Clavibacter michiganensis subsp. sepedonicus in Potato

PubMed Central

Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk

2015-01-01

Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×102 copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10−6 dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension. PMID:26060431

Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms.

PubMed

Dinon, Andréia Z; Prins, Theo W; van Dijk, Jeroen P; Arisi, Ana Carolina M; Scholtens, Ingrid M J; Kok, Esther J

2011-05-01

Primers and probes were developed for the element-specific detection of cry1A.105 and cry2Ab2 genes, based on their DNA sequence as present in GM maize MON89034. Cry genes are present in many genetically modified (GM) plants and they are important targets for developing GMO element-specific detection methods. Element-specific methods can be of use to screen for the presence of GMOs in food and feed supply chains. Moreover, a combination of GMO elements may indicate the potential presence of unapproved GMOs (UGMs). Primer-probe combinations were evaluated in terms of specificity, efficiency and limit of detection. Except for specificity, the complete experiment was performed in 9 PCR runs, on 9 different days and by testing 8 DNA concentrations. The results showed a high specificity and efficiency for cry1A.105 and cry2Ab2 detection. The limit of detection was between 0.05 and 0.01 ng DNA per PCR reaction for both assays. These data confirm the applicability of these new primer-probe combinations for element detection that can contribute to the screening for GM and UGM crops in food and feed samples.

Rapid detection of the CYP2A6*12 hybrid allele by Pyrosequencing technology.

PubMed

Koontz, Deborah A; Huckins, Jacqueline J; Spencer, Antonina; Gallagher, Margaret L

2009-08-24

Identification of CYP2A6 alleles associated with reduced enzyme activity is important in the study of inter-individual differences in drug metabolism. CYP2A6*12 is a hybrid allele that results from unequal crossover between CYP2A6 and CYP2A7 genes. The 5' regulatory region and exons 1-2 are derived from CYP2A7, and exons 3-9 are derived from CYP2A6. Conventional methods for detection of CYP2A6*12 consist of two-step PCR protocols that are laborious and unsuitable for high-throughput genotyping. We developed a rapid and accurate method to detect the CYP2A6*12 allele by Pyrosequencing technology. A single set of PCR primers was designed to specifically amplify both the CYP2A6*1 wild-type allele and the CYP2A6*12 hybrid allele. An internal Pyrosequencing primer was used to generate allele-specific sequence information, which detected homozygous wild-type, heterozygous hybrid, and homozygous hybrid alleles. We first validated the assay on 104 DNA samples that were also genotyped by conventional two-step PCR and by cycle sequencing. CYP2A6*12 allele frequencies were then determined using the Pyrosequencing assay on 181 multi-ethnic DNA samples from subjects of African American, European Caucasian, Pacific Rim, and Hispanic descent. Finally, we streamlined the Pyrosequencing assay by integrating liquid handling robotics into the workflow. Pyrosequencing results demonstrated 100% concordance with conventional two-step PCR and cycle sequencing methods. Allele frequency data showed slightly higher prevalence of the CYP2A6*12 allele in European Caucasians and Hispanics. This Pyrosequencing assay proved to be a simple, rapid, and accurate alternative to conventional methods, which can be easily adapted to the needs of higher-throughput studies.

DNA barcoding amphibians and reptiles.

PubMed

Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

2012-01-01

Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

Key Concepts and Terminology in Online Instruction: A Primer for School Psychology Programs

ERIC Educational Resources Information Center

Moy, Gregory; Robbins, Stacey; Fischer, Aaron

2018-01-01

The aim of this article is to provide a primer on the key concepts and terminology of online instruction to faculty considering the adoption of online instructional practices to increase accessibility to graduate students. These concepts and terms are neither specific to school psychology training nor to graduate education. This article is second…

Transcriptional Analysis of In vivo Plasmodium yoelii Liver Stage Gene Expression

DTIC Science & Technology

2005-04-26

reaction was added to a PCR master mix with one of several oligonucleotide primer pairs (Table S6). The primers were designed and the specific conditions ...Koonin EV. Using the COG database to improve gene recognition in complete genomes. Genetica 2000;108:9–17. 26] Florens L, Washburn MP, Raine JD, et al

Species-specific AFLP markers for identification of Zingiber officinale, Z. montanum and Z. zerumbet (Zingiberaceae).

PubMed

Ghosh, S; Majumder, P B; Sen Mandi, S

2011-02-08

The Zingiber genus, which includes the herbs known as gingers, commonly used in cooking, is well known for its medicinal properties, as described in the Indian pharmacopoeia. Different members of this genus, although somewhat similar in morphology, differ widely in their pharmacological and therapeutic properties. The most important species of this genus, with maximal therapeutic properties, is Zingiber officinale (garden ginger), which is often adulterated with other less-potent Zingiber sp. There is an existing demand in the herbal drug industry for an authentication system for the Zingiber sp in order to facilitate their commercial use as genuine phytoceuticals. To this end, we used amplified fragment length polymorphism (AFLP) to produce DNA fingerprints for three Zingiber species. Sixteen collections (six of Z. officinale, five of Z. montanum, and five of Z. zerumbet) were used in the study. Seven selective primer pairs were found to be useful for all the accessions. A total of 837 fragments were produced by these primer pairs. Species-specific markers were identified for all three Zingiber species (91 for Z. officinale, 82 for Z. montanum, and 55 for Z. zerumbet). The dendogram analysis generated from AFLP patterns showed that Z. montanum and Z. zerumbet are phylogenetically closer to each other than to Z. officinale. The AFLP fingerprints of the Zingiber species could be used to authenticate Zingiber sp-derived drugs and to resolve adulteration-related problems faced by the commercial users of these herbs.

Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.

PubMed

Tirumalai, R S; Modak, M J

1991-07-02

We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.

Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

PubMed

Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

2009-08-01

Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

PubMed Central

Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

2006-01-01

RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

On the characteristics of optimal transfers

NASA Astrophysics Data System (ADS)

Iorfida, Elisabetta

In the past 50 years the scientists have been developing and analysing methods and new algorithms that optimise an interplanetary trajectory according to one or more objectives. Within this field, in 1963 Lawden derived, from Pontryagin's minimum principle, the so-called `primer vector theory'. The main goal of this thesis is to develop a theoretical understanding of Lawden's theory, getting an insight into the optimality of a trajectory when mid-course corrections need to be applied. The novelty of the research is represented by a different approach to the primer vector theory, which simplifies the structure of the problem.

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities.

PubMed

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-11-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities* #

PubMed Central

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-01-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789

Mechanism for priming DNA synthesis by yeast DNA Polymerase α

PubMed Central

Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca

2013-01-01

The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895

Molecular diagnosis of group B coltiviruses infections.

PubMed

Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X

1999-08-01

The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.

SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

PubMed Central

2013-01-01

Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

Identification of Aspergillus fumigatus and Related Species by Nested PCR Targeting Ribosomal DNA Internal Transcribed Spacer Regions

PubMed Central

Zhao, Jun; Kong, Fanrong; Li, Ruoyu; Wang, Xiaohong; Wan, Zhe; Wang, Duanli

2001-01-01

Aspergillus fumigatus is the most common species that causes invasive aspergillosis. In order to identify A. fumigatus, partial ribosomal DNA (rDNA) from two to six strains of five different Aspergillus species was sequenced. By comparing sequence data from GenBank, we designed specific primer pairs targeting rDNA internal transcribed spacer (ITS) regions of A. fumigatus. A nested PCR method for identification of other A. fumigatus-related species was established by using the primers. To evaluate the specificities and sensitivities of those primers, 24 isolates of A. fumigatus and variants, 8 isolates of Aspergillus nidulans, 7 isolates of Aspergillus flavus and variants, 8 isolates of Aspergillus terreus, 9 isolates of Aspergillus niger, 1 isolate each of Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus versicolor, Aspergillus wangduanlii, Aspergillus qizutongii, Aspergillus beijingensis, and Exophiala dermatitidis, 4 isolates of Candida, 4 isolates of bacteria, and human DNA were used. The nested PCR method specifically identified the A. fumigatus isolates and closely related species and showed a high degree of sensitivity. Additionally, four A. fumigatus strains that were recently isolated from our clinic were correctly identified by this method. Our results demonstrate that these primers are useful for the identification of A. fumigatus and closely related species in culture and suggest further studies for the identification of Aspergillus fumigatus species in clinical specimens. PMID:11376067

Identification of Aspergillus sections Flavi, Nigri, and Fumigati and their differentiation using specific primers.

PubMed

Ashtiani, Nafiseh Mohebbi; Kachuei, Reza; Yalfani, Roozbeh; Harchegani, Asghar Beigi; Nosratabadi, Mohsen

2017-06-01

Aspergillus species are important in medicine, agriculture and various industries. The sections Fumigati, Flavi, and Nigri are the most important members of the Aspergillus genus. This study intended to identify and separate these three Aspergillus sections and to differentiate among them using specific primers. A bioinformatics study was initially performed to analyse the sequences of five genes, namely, beta-tubulin, calmodulin, the pre-rRNA processing protein Tsr1, the DNA-replication licensing factor Mcm7, and RNA polymerase II second largest subunit (RPB2) in the three Aspergillus sections using MEGA6 software and the NCBI database. Primers were designed to select genes for each of the Aspergillus sections being analysed. A total of 134 environmental and clinical Aspergillus species were isolated, purified and initially identified by colony morphology.. Subsequently, DNA was extracted using the phenol-chloroform method, specific primers were synthesized, PCR was performed for DNA from all isolates, and the results were compared to morphological characteristics. Of the 134 isolates tested, 56 were Nigri, 32 were Fumigati, 32 were Flavi, and the rest (14 isolates) belonged to other sections. The beta-tubulin and calmodulin genes were found to be the most suitable for differentiating among these three groups; the beta-tubulin gene was used for molecular identification of Aspergillus section Fumigati, and the calmodulin gene for identifying sections Flavi and Nigri.

Studies on the inhibition of Moloney murine leukemia virus reverse transcriptase by N-tritylamino acids and N-tritylamino acid-nucleotide compounds.

PubMed

Hawtrey, Arthur; Pieterse, Anton; van Zyl, Johann; Van der Bijl, Pieter; Van der Merwe, Marichen; Nel, William; Ariatti, Mario

2008-09-01

N-Acylated derivatives of 8-(6-aminohexyl) amino-adenosine-5 '-phosphate were prepared and studied with regard to their effect on DNA synthesis by the Moloney leukemia virus reverse transcriptase. N-palmitoyl and N-nicotinyl derivatives and bis-8-(6-aminohexyl) amino-5'-AMP inhibited the enzyme partially using poly (rA).oligo d(pT)(16-18) as template-primer with [(3)H]dTTP. In order to increase hydrophobicity in the acyl component tethered to the 8-(6-aminohexyl) amino group on the adenine nucleotide, N-trityl-L-phenylalanine and the N-trityl derivatives of the o, m, and p-fluoro-DL-phenylalanine were initially examined for inhibition of the enzyme using the above template-primer system. The compounds all inhibited the reverse transcriptase with IC(50) values of approximately 60-80 microM. However, when N-trityl-m-fluoro-DL-phenylalanine was coupled to the nucleotide 8-(6-aminohexyl) amino-adenosine-5'-phosphate, the inhibitory activity of this compound increased significantly (IC(50) = 5 microM).

PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

PubMed Central

Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2014-01-01

Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the discovery of complex patterns in gene expression of soil fungal communities. PMID:25545363

Zooanthroponotic transmission of rotavirus in Haryana State of Northern India.

PubMed

Choudhary, P; Minakshi, P; Ranjan, K; Basanti, B

Rotaviruses are the major cause of severe gastroenteritis and mortality in young children and animals. Due to segmented nature of dsRNA genome and wide host range, vast genetic and antigenic diversity exists amongst different isolates of rotaviruses. A total of 230 fecal ovine and caprine samples collected from organized farms and villages in Haryana were screened for rotavirus detection. Samples were screened by latex agglutination test and RNA-PAGE followed by RT-PCR and nucleic acid sequencing. The latex agglutination test showed 25 newborn lamb and 4 kid fecal samples positive for rotavirus. However, RNA-PAGE showed only 9 lamb fecal samples positive for rotavirus. All the samples were subjected to RT-PCR employing vp4 and vp7 gene specific primers of group A rotavirus of ovine, bovine and human origin. Only two samples from lamb (Sheep18/Hisar/2013 and Sheep22/Hisar/2013) showed vp4 and vp7 gene specific amplification with human group A rotavirus (GAR) specific primer. However, they did not show any amplification with ovine and bovine rotavirus specific primers. The nucleotide as well as deduced amino acid sequence analysis of vp4 gene of these isolates showed >98/97% and vp7 gene >95/94% nt/aa identity with human GAR from different regions of the world. Based on nucleotide similarity search, Sheep18/Hisar/2013 and Sheep22/Hisar/2013 isolates were genotyped as G1P[8] and G1P[4]. Phylogenetic analysis also confirmed that these isolates were clustered closely with human rotaviruses from different regions of the world. Earlier, higher prevalence of human rotaviruses was reported from the sample collecting area. The amplification of ovine samples with human rotavirus gene specific primers, sequence identity and phylogenetic analysis strongly suggests the zoonotic transmission of human GAR to sheep.

Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

Competing factors of compost concentration and proximity to root affect the distribution of streptomycetes.

PubMed

Inbar, Ehud; Green, Stefan J; Hadar, Yitzhak; Minz, Dror

2005-07-01

Streptomycetes are important members of soil microbial communities and are particularly active in the degradation of recalcitrant macromolecules and have been implicated in biological control of plant disease. Using a streptomycetes-specific polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (PCR-DGGE) methodology coupled with band excision and sequence analysis, we examined the effect of grape marc compost amendment to soil on cucumber plant-associated streptomycetes community composition. We observed that both compost amendment and proximity to the root surface influenced the streptomycetes community composition. A strong root selection for a soil-derived Streptomycete, most closely related to Streptomyces thermotolerans, S. iakyrus, and S. thermocarboxydus, was independent of compost amendment rate. However, while the impact of compost amendment was mitigated with increasing proximity to the root, high levels of compost amendment resulted in the detection of compost-derived species on the root surface. Conversely, in rhizosphere and non-rhizosphere soils, the community composition of streptomycetes was affected strongly even by modest compost amendment. The application of a streptomycetes-specific PCR primer set combined with DGGE analysis provided a rapid means of examining the distribution and ecology of streptomycetes in soils and plant-associated environments.

Evaluation of the PCR method for identification of Bifidobacterium species.

PubMed

Youn, S Y; Seo, J M; Ji, G E

2008-01-01

Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

Detection of unculturable bacteria in periodontal health and disease by PCR.

PubMed

Harper-Owen, R; Dymock, D; Booth, V; Weightman, A J; Wade, W G

1999-05-01

Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease.

Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

PubMed

Wang, Deguo; Liu, Yanhong

2015-05-26

Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

PD5: a general purpose library for primer design software.

PubMed

Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

2013-01-01

Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

PubMed

Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

2010-05-01

A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

A blocking primer increases specificity in environmental DNA detection of bull trout (Salvelinus confluentus)

Treesearch

Taylor M. Wilcox; Michael K. Schwartz; Kevin S. McKelvey; Michael K. Young; Winsor H. Lowe

2014-01-01

Environmental DNA (eDNA) is increasingly applied as a highly sensitive way to detect aquatic animals non-invasively. However, distinguishing closely related taxa can be particularly challenging. Previous studies of ancient DNA and genetic diet analysis have used blocking primers to enrich target template in the presence of abundant, non-target DNA. Here we apply a...

Species identification and sex determination of the genus Nepenthes (Nepenthaceae).

PubMed

Mokkamul, Piya; Chaveerach, Arunrat; Sudmoon, Runglawan; Tanee, Tawatchai

2007-02-15

Nepenthes species are well known for their ornamentally attractive pitchers. The species diversity was randomly surveyed in some conservation areas of Thailand and three species were found, namely N. gracilis Korth., N. mirabilis Druce. and N. smilesii Hemsl. Young plants as unknown species from Chatuchak market were added in plant sampled set. Thirty two Inter Simple Sequence Repeat (ISSR) primers were screened and 13 successful primers were used to produce DNA banding patterns for constructing a dendrogram. The dendrogram is potentially power tool to identify unknown species from Chatuchak market, differentiate species population, population by geographical areas and sex determination. The geographical area of N. mirabilis was specified to Southern and Northeastern regions and finally, subdivided into exact areas according to province. Male and female plants of N. gracilis at Phu Wua Wildlife Sanctuary and N. mirabilis at Bung Khonglong non-hunting area were determined. Two unknown species from Chatuchak market were analyzed to be N. mirabilis with the genetic similarities (S) 77.2 to 84.7. Be more sex specific in all sample studied, 37 Random Amplified Polymorphic DNA (RAPD) primers were investigated. The result shows that only one RAPD primer show high resolution results at about 750 bp specific male-related marker.

Identification of novel serine proteinase gene transcripts in the midguts of two tropical insect pests, Scirpophaga incertulas (Wk.) and Helicoverpa armigera (Hb.).

PubMed

Mazumdar-Leighton, S; Babu, C R; Bennett, J

2000-01-01

We have used RT PCR and 3'RACE to identify diverse serine proteinase genes expressed in the midguts of the rice yellow stem borer (Scirpophaga incertulas) and Asian corn borer (Helicoverpa armigera). The RT-PCR primers encoded the conserved regions around the active site histidine57 and serine195 of Drosophila melanogaster alpha trypsin, including aspartate189 of the specificity pocket. These primers amplified three transcripts (SiP1-3) from midguts of S. incertulas, and two transcripts (HaP1-2) from midguts of H. armigera. The five RT PCR products were sequenced to permit design of gene-specific forward primers for use with anchored oligo dT primers in 3'RACE. Sequencing of the 3'RACE products indicated that SiP1, SiP2 and HaP1 encoded trypsin-like serine proteinases, while HaP2 encoded a chymotrypsin-like serine proteinases. The SiP3 transcript proved to be an abundant 960 nt mRNA encoding a trypsin-like protein in which the active site serine195 was replaced by aspartate. The possible functions of this unusual protein are discussed.

Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

PubMed

Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

2005-01-01

Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific, sensitive, and economic alternative to the current quantitative methods.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

PubMed

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

USGS Publications Warehouse

Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

2010-01-01

The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

Genetic diversity analysis of tree peony germplasm using iPBS markers.

PubMed

Duan, Y B; Guo, D L; Guo, L L; Wei, D F; Hou, X G

2015-07-06

We examined the genetic diversity of 10 wild species (populations) and 55 varieties of tree peony using inter-primer binding site (iPBS) markers. From a total of 36 iPBS primers, 16 were selected based on polymorphic amplification. The number of bands amplified by each primer ranged from 9 to 19, with an average of 12.88 bands per primer. The length of bands ranged from 100 to 2000 bp, concentrated at 200 to 1800 bp. Sixteen primers amplified 206 bands in total, of which 173 bands were polymorphic with a polymorphism ratio of 83.98%. Each primer amplified 10.81 polymorphic bands on average. The data were then used to construct a phylogenetic tree using unweighted pair group method with arithmetic mean methods. Clustering analysis showed that the genetic relationships among the varieties were not only related to the genetic background or geographic origin, but also to the flowering phase, flower color, and flower type. Our data also indicated that iPBS markers were useful tools for classifying tree peony germplasms and for tree peony breeding, and the specific bands were helpful for molecular identification of tree peony varieties.

A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

PubMed Central

Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

2015-01-01

High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

PubMed

Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

2018-02-07

We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

Rust transformation/rust compatible primers

NASA Technical Reports Server (NTRS)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

Hindering the illegal trade in dog and cat furs through a DNA-based protocol for species identification.

PubMed

Garofalo, Luisa; Mariacher, Alessia; Fanelli, Rita; Fico, Rosario; Lorenzini, Rita

2018-01-01

In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.

Fluorescence acquisition during hybridization phase in quantitative real-time PCR improves specificity and signal-to-noise ratio.

PubMed

Mehndiratta, Mohit; Palanichamy, Jayanth Kumar; Ramalingam, Pradeep; Pal, Arnab; Das, Prerna; Sinha, Subrata; Chattopadhyay, Parthaprasad

2008-12-01

Quantitative real-time PCR (qPCR) is a standard method used for quantification of specific gene expression. This utilizes either dsDNA binding dyes or probe based chemistry. While dsDNA binding dyes have the advantage of low cost and flexibility, fluorescence due to primer dimers also interferes with the fluorescence of the specific product. Sometimes it is difficult, if not impossible, to standardize conditions and redesign primers in such a way that only specific fluorescence of the products of test and reference genes are acquired. Normally, the fluorescence acquisition in qPCR using dsDNA binding dyes is done during the melting phase of the PCR at a temperature between the melting points of primer dimers and the specific product. We have modified the protocol to acquire fluorescence during the hybridization phase. This significantly increased the signal-to-noise ratio and enabled the use of dsDNA binding dyes for mRNA quantification in situations where it was not possible when measurement was done in the melting phase. We have demonstrated it for three mRNAs, E6, E7, and DNMT1 with beta-actin as the reference gene, and for two miRNAs. This modification broadens the scope of qPCR using dsDNA binding dyes.

Molecular detection of native and invasive marine invertebrate larvae present in ballast and open water environmental samples collected in Puget Sound

USGS Publications Warehouse

Harvey, J.B.J.; Hoy, M.S.; Rodriguez, R.J.

2009-01-01

Non-native marine species have been and continue to be introduced into Puget Sound via several vectors including ship's ballast water. Some non-native species become invasive and negatively impact native species or near shore habitats. We present a new methodology for the development and testing of taxon specific PCR primers designed to assess environmental samples of ocean water for the presence of native and non-native bivalves, crustaceans and algae. The intergenic spacer regions (IGS; ITS1, ITS2 and 5.8S) of the ribosomal DNA were sequenced for adult samples of each taxon studied. We used these data along with those available in Genbank to design taxon and group specific primers and tested their stringency against artificial populations of plasmid constructs containing the entire IGS region for each of the 25 taxa in our study, respectively. Taxon and group specific primer sets were then used to detect the presence or absence of native and non-native planktonic life-history stages (propagules) from environmental samples of ballast water and plankton tow net samples collected in Puget Sound. This methodology provides an inexpensive and efficient way to test the discriminatory ability of taxon specific oligonucleotides (PCR primers) before creating molecular probes or beacons for use in molecular ecological applications such as probe hybridizations or microarray analyses. This work addresses the current need to develop molecular tools capable of diagnosing the presence of planktonic life-history stages from non-native marine species (potential invaders) in ballast water and other environmental samples. ?? 2008 Elsevier B.V.

Development of loop-mediated isothermal amplification with Plasmodium falciparum unique genes for molecular diagnosis of human malaria.

PubMed

Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian

2017-07-01

In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a promising tool for diagnosis of P. falciparum infection.

Development and Validation of Broad-Range Qualitative and Clade-Specific Quantitative Molecular Probes for Assessing Mercury Methylation in the Environment.

PubMed

Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A

2016-10-01

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.

Comparison of Ribotyping, Randomly Amplified Polymorphic DNA Analysis, and Pulsed-Field Gel Electrophoresis in Typing of Lactobacillus rhamnosus and L. casei Strains

PubMed Central

Tynkkynen, Soile; Satokari, Reetta; Saarela, Maria; Mattila-Sandholm, Tiina; Saxelin, Maija

1999-01-01

A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 334, respectively, but did not give any signal with the recently revived species L. zeae, which contains the type strain ATCC 15820 and the strain ATCC 393, which was previously classified as L. casei. Our results are in accordance with the suggested new classification of the L. casei group. Altogether, 21 of the 24 strains studied were identified with the species-specific primers. In strain typing, PFGE was the most discriminatory method, revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD analysis yielded 15 and 12 genotypes, respectively. PMID:10473394

Comparison of ribotyping, randomly amplified polymorphic DNA analysis, and pulsed-field gel electrophoresis in typing of Lactobacillus rhamnosus and L. casei strains.

PubMed

Tynkkynen, S; Satokari, R; Saarela, M; Mattila-Sandholm, T; Saxelin, M

1999-09-01

A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 334, respectively, but did not give any signal with the recently revived species L. zeae, which contains the type strain ATCC 15820 and the strain ATCC 393, which was previously classified as L. casei. Our results are in accordance with the suggested new classification of the L. casei group. Altogether, 21 of the 24 strains studied were identified with the species-specific primers. In strain typing, PFGE was the most discriminatory method, revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD analysis yielded 15 and 12 genotypes, respectively.

Felis catus papillomavirus types 1 and 4 are rarely present in neoplastic and inflammatory oral lesions of cats.

PubMed

Munday, John S; French, Adrienne F

2015-06-01

Oral squamous cell carcinomas (OSCCs) are common feline cancers. Why OSCCs are so common in cats is unknown; however, 25% of human OSCCs are caused by papillomaviruses (PVs). Two feline oral PVs (FcaPV-1 and 4) are recognized. As PVs are highly host and location specific, if PVs do cause feline OSCCs, FcaPV-1 and 4 are the most likely etiological agents. PCR primers specific for FcaPV-1 amplified DNA from 1 of 36 feline OSCCs and 1 of 16 inflammatory oral lesions. No DNA was amplified by primers specific for FcaPV-4. PV DNA was not amplified from any additional sample using consensus primers. No PV cytopathology was visible in the OSCC that contained FcaPV-1 DNA, but viral cytopathology was present in a focus of epithelial hyperplasia in the non-neoplastic sample. This study does not support a PV etiology of feline OSCCs, but shows that FcaPV-1 can asymptomatically infect the mouth of cats. Copyright © 2015 Elsevier Ltd. All rights reserved.

Allelic inhibition of displacement activity: a simplified one tube allele-specific PCR for evaluation of ITPA polymorphisms.

PubMed

Galmozzi, E; Facchetti, F; Degasperi, E; Aghemo, A; Lampertico, P

2013-02-01

Recently, genome-wide association studies (GWAS) in patients with chronic hepatitis C virus (HCV) infection have identified two functional single nucleotide polymorphisms (SNPs) in the inosine triphosphatase (ITPA) gene, that are associated strongly and independently with hemolytic anemia in patients exposed to pegylated-interferon (Peg-IFN) plus ribavirin (RBV) combined therapy. Here has been developed a simplified allele discrimination polymerase chain reaction (PCR) assay named allelic inhibition of displacement activity (AIDA) for evaluation of ITPA polymorphisms. AIDA system relies on three unlabeled primers only, two outer common primers and one inner primer with allele-specific 3' terminus mismatch. DNA samples from 192 patients with chronic HCV infection were used to validate the AIDA system and results were compared with the gold standard TaqMan(®) SNP genotyping assay. Concordant data were obtained for all samples, granting for high specificity of the method. In conclusion, AIDA is a practical one-tube method to reproducibly and to assess accurately rs7270101 and rs1127354 ITPA SNPs. Copyright © 2012 Elsevier B.V. All rights reserved.

Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

PubMed Central

Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

2013-01-01

The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

Bacteria of an anaerobic 1,2-dichloropropane-dechlorinating mixed culture are phylogenetically related to those of other anaerobic dechlorinating consortia.

PubMed

Schlötelburg, C; von Wintzingerode, F; Hauck, R; Hegemann, W; Göbel, U B

2000-07-01

A 16S-rDNA-based molecular study was performed to determine the bacterial diversity of an anaerobic, 1,2-dichloropropane-dechlorinating bioreactor consortium derived from sediment of the River Saale, Germany. Total community DNA was extracted and bacterial 16S rRNA genes were subsequently amplified using conserved primers. A clone library was constructed and analysed by sequencing the 16S rDNA inserts of randomly chosen clones followed by dot blot hybridization with labelled polynucleotide probes. The phylogenetic analysis revealed significant sequence similarities of several as yet uncultured bacterial species in the bioreactor to those found in other reductively dechlorinating freshwater consortia. In contrast, no close relationship was obtained with as yet uncultured bacteria found in reductively dechlorinating consortia derived from marine habitats. One rDNA clone showed >97% sequence similarity to Dehalobacter species, known for reductive dechlorination of tri- and tetrachloroethene. These results suggest that reductive dechlorination in microbial freshwater habitats depends upon a specific bacterial community structure.

Preliminary study on applicability of microsatellite DNA primers from parasite protozoa Trypanosoma cruzi in free-living protozoa

NASA Astrophysics Data System (ADS)

Zhang, Wenjing; Yu, Yuhe; Shen, Yunfen; Miao, Wei; Feng, Weisong

2004-04-01

In this paper, we took the lead in studying on specificity of the microsatellite DNA loci and applicability of microsatellite DNA primers in protozoa. In order to study characters of microsatellites in free-living protozoa, eight microsatellite loci primers developed from Trypanosoma cruzi (MCLE01, SCLE10, MCLE08, SCLE11, MCLF10, MCLG10, MCL03, MCL05) were employed to amplify microsatellite in four free-living protozoa, including Bodo designis, Euglena gracilis FACHB848, Paramecium bruzise and Tetrahymena thermophila BF1. In the amplification systems of P. bruzise, four loci (SCLE10, SCLE11, MCLF10, MCL03) were amplified successfully, and four amplification fragments were in proper size. In genome of E. gracilis FACHB848, five of eight primers brought five clear amplification bands. In B. designis, three (No.4, 5 and 7) of eight loci produced clear and sharp products without stutter bands, whereas no bands appeared in T. thermophila BF1. Further, eight 300 500 bp amplification fragments were cloned and sequenced. Nevertheless, all sequenced products did not contain corresponding microsatellite sequence, although Bodo is in the same order and has the nearest phylogenetic relation with Trypanosoma among these four species. Thus, the microsatellite DNA primers can not be applied among order or more far taxa, and the specificity of microsatellite DNA is very high in protozoa. The results of this study will contribute to our understanding of microsatellite DNA in protozoa.

RAPD-SCAR marker and genetic relationship analysis of three Demodex species (Acari: Demodicidae).

PubMed

Zhao, Ya-E; Wu, Li-Ping

2012-06-01

For a long time, classification of Demodex mites has been mainly based on their hosts and phenotype characteristics. The study was the first to conduct molecular identification and genetic relationship analysis for six isolates of three Demodex species by random amplified polymorphic DNA (RAPD) and sequence-characterized amplified region (SCAR) marker. Totally, 239 DNA fragments were amplified from six Demodex isolates with 10 random primers in RAPD, of which 165 were polymorphic. Using a single primer, at least five fragments and at most 40 in the six isolates were amplified, whereas within a single isolate, a range of 35-49 fragments were amplified. DNA fingerprints of primers CZ 1-9 revealed intra- and interspecies difference in six Demodex isolates, whereas primer CZ 10 only revealed interspecies difference. The genetic distance and dendrogram showed the intraspecific genetic distances were closer than the interspecific genetic distances. The interspecific genetic distances of Demodex folliculorum and Demodex canis (0.7931-0.8140) were shorter than that of Demodex brevis and D. canis (0.8182-0.8987). The RAPD-SCAR marker displayed primer CZ 10 could be applied to identify the three Demodex species. The 479-bp fragment was specific for D. brevis, and the 261-bp fragment was specific for D. canis. The conclusion was that the RAPD-SCAR multi-marker was effective in molecular identification of three Demodex species. The genetic relationship between D. folliculorum and D. canis was nearer than that between D. folliculorum and D. brevis.

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

A new cultivation independent approach to detect and monitor common Trichoderma species in soils.

PubMed

Hagn, Alexandra; Wallisch, Stefanie; Radl, Viviane; Charles Munch, Jean; Schloter, Michael

2007-04-01

A set of primers was developed for the detection, identification and quantification of common Trichoderma species in soil samples. Based on a broad range master alignment primers were derived to amplify an approximate 540 bp fragment comprising the internal transcribed spacer region 1 (ITS 1), 5.8S rDNA and internal transcribed spacer region 2 (ITS 2) from all taxonomic Clades of the genus Trichoderma. The primer set was applied to test strains as well as community DNA isolated from arable and forest soil. For all tested isolates the corresponding internal transcribed spacer regions of Trichoderma spp. strains were amplified, but none of non-Trichoderma origin. PCR with community DNA from soil yielded products of the expected size. Analysis of a clone library established for an arable site showed that all amplified sequences originated exclusively from Trichoderma species mainly being representatives of the Clades Hamatum, Harzianum and Pachybasioides and comprising most of the species known for biocontrol ability. In a realtime PCR approach the primer set uTf/uTr also proved to be a suitable system to quantify DNA of Trichoderma spp. in soils.

Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.).

PubMed

Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A

2015-10-26

Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs.  Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.

Genes tagging and molecular diversity of red rot susceptible/tolerant sugarcane hybrids using c-DNA and unigene derived markers.

PubMed

Singh, R K; Singh, R B; Singh, S P; Sharma, M L

2012-04-01

Sugarcane is an important international commodity as a valuable agricultural crop especially in tropical and subtropical countries. Two bulked DNA used to screen polymorphic primers from commercial hybrids (varieties) with moderately resistant and highly susceptible to red rot disease. Among 145 simple sequence repeat and unigene primers screened, 37 (25%) were found to be highly robust and polymorphic with Polymorphism Information Content values ranging from 0.50 to 1.00 with the mean value of 0.82. Among these microsatellites, twenty one were used in the study of genetic relationships and marker identification in sugarcane varieties for red rot resistance. A total of 105 polymorphic DNA bands were identified, with their fragment size ranging from 54 to 1,280 bp. Jaccard's similarity coefficient value recorded between closely related hybrids was 0.986 while lowest coefficient value of 0.341 was detected with distantly related hybrids. The average similarity coefficient among these hybrids was 0.663. Cluster analysis resulted in a dendrogram with two major clusters separating the moderately resistant varieties from highly susceptible varieties. Three group specific fragments amplified by unigene Saccharum microsatellite primers viz; two markers UGSM316(850) and UGSM316(60) were closely associated with moderately resistant varieties by appearing bands in this region but the bands were absent in highly susceptible varieties. Similarly UGSM316(400) marker was tightly linked with highly susceptible varieties by amplifying uniformly in sugarcane varieties showing highly susceptible reaction to red rot but it was absent in moderately resistant varietal groups. Validation of red rot resistance/susceptibility associated markers on a group of different mapping populations for red rot resistant/susceptible traits is in progress.

In-silico mining, type and frequency analysis of genic microsatellites of finger millet (Eleusine coracana (L.) Gaertn.): a comparative genomic analysis of NBS-LRR regions of finger millet with rice.

PubMed

Kalyana Babu, B; Pandey, Dinesh; Agrawal, P K; Sood, Salej; Kumar, Anil

2014-05-01

In recent years, the increased availability of the DNA sequences has given the possibility to develop and explore the expressed sequence tags (ESTs) derived SSR markers. In the present study, a total of 1956 ESTs of finger millet were used to find the microsatellite type, distribution, frequency and developed a total of 545 primer pairs from the ESTs of finger millet. Thirty-two EST sequences had more than two microsatellites and 1357 sequences did not have any SSR repeats. The most frequent type of repeats was trimeric motif, however the second place was occupied by dimeric motif followed by tetra-, hexa- and penta repeat motifs. The most common dimer repeat motif was GA and in case of trimeric SSRs, it was CGG. The EST sequences of NBS-LRR region of finger millet and rice showed higher synteny and were found on nearly same positions on the rice chromosome map. A total of eight, out of 15 EST based SSR primers were polymorphic among the selected resistant and susceptible finger millet genotypes. The primer FMBLEST5 could able to differentiate them into resistant and susceptible genotypes. The alleles specific to the resistant and susceptible genotypes were sequenced using the ABI 3130XL genetic analyzer and found similarity to NBS-LRR regions of rice and finger millet and contained the characteristic kinase-2 and kinase 3a motifs of plant R-genes belonged to NBS-LRR region. The In-silico and comparative analysis showed that the genes responsible for blast resistance can be identified, mapped and further introgressed through molecular breeding approaches for enhancing the blast resistance in finger millet.

A biogeochemical and genetic survey of acetylene fermentation by environmental samples and bacterial isolates

USGS Publications Warehouse

Miller, Laurence G.; Baesman, Shaun M.; Kirshtein, Julie; Voytek, Mary A.; Oremland, Ronald S.

2013-01-01

Anoxic samples (sediment and groundwater) from 13 chemically diverse field sites were assayed for their ability to consume acetylene (C2H2). Over incubation periods ranging from ˜ 10 to 80 days, selected samples from 7 of the 13 tested sites displayed significant C2H2 removal. No significant formation of ethylene was noted in these incubations; therefore, C2H2 consumption could be attributed to acetylene hydratase (AH) rather than nitrogenase activity. This putative AH (PAH) activity was observed in only 21% of the total of assayed samples, while amplification of AH genes from extracted DNA using degenerate primers derived from Pelobacter acetylenicus occurred in even fewer (9.8%) samples. Acetylene-fermenting bacteria were isolated as a pure culture from the sediments of a tidal mudflat in San Francisco Bay (SFB93) and as an enrichment culture from freshwater Searsville Lake (SV7). Comparison of 16S rDNA clone libraries revealed that SFB93 was closely related to P. carbolinicus, while SV7 consisted of several unrelated bacteria. AH gene was amplified from SFB93 but not SV7. The inability of the primers to generate amplicons in the SV7 enrichment, as well as from several of the environmental samples that displayed PAH activity, implied that either the primers were too highly constrained in their specificity or that there was a different type of AH gene in these environmental samples than occurs in P. acetylenicus. The significance of this work with regard to the search for life in the outer Solar System, where C2HL2 is abundant, is discussed.

Data in support of qPCR primer design and verification in a Pink1 -/- rat model of Parkinson disease.

PubMed

Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R

2016-09-01

Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 – 30 November 2011

PubMed Central

ABREU, ALUANA G.; ALBAINA, A.; ALPERMANN, TILMAN J.; APKENAS, VANESSA E.; BANKHEAD-DRONNET, S.; BERGEK, SARA; BERUMEN, MICHAEL L.; CHO, CHANG-HUNG; CLOBERT, JEAN; COULON, AURÉLIE; DE FERAUDY, D.; ESTONBA, A.; HANKELN, THOMAS; HOCHKIRCH, AXEL; HSU, TSAI-WEN; HUANG, TSURNG-JUHN; IRIGOIEN, X.; IRIONDO, M.; KAY, KATHLEEN M.; KINITZ, TIM; KOTHERA, LINDA; LE HÉNANFF, MAXIME; LIEUTIER, F.; LOURDAIS, OLIVIER; MACRINI, CAMILA M. T.; MANZANO, C.; MARTIN, C.; MORRIS, VERONICA R. F.; NANNINGA, GERRIT; PARDO, M. A.; PLIESKE, JÖRG; POINTEAU, S.; PRESTEGAARD, TORE; QUACK, MARKUS; RICHARD, MURIELLE; SAVAGE, HARRY M.; SCHWARCZ, KAISER D.; SHADE, JESSICA; SIMMS, ELLEN L.; SOLFERINI, VERA N.; STEVENS, VIRGINIE M.; VEITH, MICHAEL; WEN, MEI-JUAN; WICKER, FLORIAN; YOST, JENNIFER M.; ZARRAONAINDIA, I.

2017-01-01

This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. PMID:22296658

ISSR markers for gender identification and genetic diagnosis of Hippophae rhamnoides ssp. turkestanica growing at high altitudes in Ladakh region (Jammu and Kashmir).

PubMed

Das, Kamal; Ganie, Showkat Hussain; Mangla, Yash; Dar, Tanvir-Ul-Hassan; Chaudhary, Manju; Thakur, Rakesh Kumar; Tandon, Rajesh; Raina, S N; Goel, Shailendra

2017-03-01

Hippophae rhamnoides L. ssp. turkestanica (Elaeagnaceae) is a predominantly dioecious and wind-pollinated medicinal plant species. The mature fruits of the species possess antioxidative, anti-inflammatory, antimicrobial, anticancerous, and antistimulatory properties that are believed to improve the immune system. The identification of male and female plants in H. rhamnoides ssp. turkestanica is quite difficult until flowering which usually takes 3-4 years or more. A sex-linked marker can be helpful in establishing the orchards through identification of genders at an early stage of development. Therefore, we studied the genetic diversity of populations in Ladakh with the aim to identify a gender-specific marker using ISSR markers. Fifty-eight ISSR primers were used to characterize the genome of H. rhamnoides ssp. turkestanica, of which eight primers generated 12 sex-specific fragments specific to one or more populations. The ISSR primer (P-45) produced a fragment which faithfully segregates all the males from the female plants across all the three valleys surveyed. This male-specific locus was converted into a SCAR. Forward and reverse primers designed from this fragment amplified a 750-bp sequence in males only, thus specifying it as an informative male-specific sex-linked marker. This SCAR marker was further validated for its capability to differentiate gender on an additional collection of plants, representing three geographically isolated valleys (Nubra, Suru, and Indus) from Ladakh region of India. The results confirmed sex-linked specificity of the marker suggesting that this conserved sequence at the Y chromosome is well preserved through the populations in Ladakh region. At present, there are no reliable markers which can differentiate male from female plants across all the three valleys of Ladakh region at an early stage of plant development. It is therefore envisaged that the developed SCAR marker shall provide a reliable molecular tool for early identification of the sex in this commercial crop. The genetic diversity of populations as surveyed by ISSR primers revealed 85.71 % polymorphism at the population level. The dendrogram obtained divided the genotypes into three different clusters, and the distribution of male and female genotypes in all the clusters was random. The Nei's genetic similarity index was in the range of 0.63-0.96.

Detection of infectious bronchitis virus strains similar to Japan in Taiwan.

PubMed

Tsai, Cheng-Ta; Tsai, Hsin-Fu; Wang, Ching-Ho

2016-06-01

A total of 1,320 tracheal samples from 66 broiler flocks sent to slaughterhouses and 42 tracheal samples from 42 flocks of local chickens in the field were collected for infectious bronchitis virus (IBV) gene detection by reverse transcription polymerase chain reaction using nucleocapsid-specific primers and spike-specific primers. Prevalence in broiler flocks was 39.4% (26/66) and in local chicken flocks was 11.9% (5/42). Several IBVs similar to Japan were detected in Taiwan. One-direction neutralization revealed that the reference antisera did not offer protection against the IBVs similar to those from Japan.

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1990-01-30

bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

Single nucleotide primer extension (SNuPE) analysis of the G6PD gene in somatic cells and oocytes of a kangaroo (Macropus robustus).

PubMed

Watson, D; Jacombs, A S; Loebel, D A; Robinson, E S; Johnston, P G

2000-06-01

cDNA sequence analysis of the X-linked glucose-6-phosphate dehydrogenase (G6PD) gene has shown a base difference between two subspecies of the kangaroo, Macropus robustus robustus (wallaroo) and M. r. erubescens (euro). A thymine residue in the wallaroo at position 358 in exon 5 has been replaced by a cytosine residue in the euro, which accounts for the previously reported electrophoretic difference between the two subspecies. This base difference allowed use of the Single Nucleotide Primer Extension (SNuPE) technique to study allele-specific expression of G6PD at the transcriptional level. We began by examining G6PD expression in somatic cells and observed complete paternal X inactivation in all somatic tissues of adult female heterozygotes, whereas we found partial paternal allele activity in cultured fibroblasts, thus confirming previous allozyme electrophoresis studies. In late dictyate oocytes from an adult heterozygote, the assay also detected expression of both the maternal and paternal alleles at the G6PD locus, with the maternal allele showing preferential expression. Thus reactivation of the inactive paternally derived X chromosome occurs during oogenesis in M. robustus, although the exact timing of reactivation remains to be determined.

XX/XY Sex Chromosomes in the South American Dwarf Gecko (Gonatodes humeralis).

PubMed

Gamble, Tony; McKenna, Erin; Meyer, Wyatt; Nielsen, Stuart V; Pinto, Brendan J; Scantlebury, Daniel P; Higham, Timothy E

2018-05-11

Sex-specific genetic markers identified using restriction site-associated DNA sequencing, or RADseq, permits the recognition of a species' sex chromosome system in cases where standard cytogenetic methods fail. Thus, species with male-specific RAD markers have an XX/XY sex chromosome system (male heterogamety) while species with female-specific RAD markers have a ZZ/ZW sex chromosome (female heterogamety). Here, we use RADseq data from 5 male and 5 female South American dwarf geckos (Gonatodes humeralis) to identify an XX/XY sex chromosome system. This is the first confidently known sex chromosome system in a Gonatodes species. We used a low-coverage de novo G. humeralis genome assembly to design PCR primers to validate the male-specificity of a subset of the sex-specific RADseq markers and describe how even modest genome assemblies can facilitate the design of sex-specific PCR primers in species with diverse sex chromosome systems.

Transfers between libration-point orbits in the elliptic restricted problem

NASA Astrophysics Data System (ADS)

Hiday, L. A.; Howell, K. C.

The present time-fixed impulsive transfers between 3D libration point orbits in the vicinity of the interior L(1) libration point of the sun-earth-moon barycenter system are 'optimal' in that the total characteristic velocity required for implementation of the transfer exhibits a local minimum. The conditions necessary for a time-fixed, two-impulse transfer trajectory to be optimal are stated in terms of the primer vector, and the conditions necessary for satisfying the local optimality of a transfer trajectory containing additional impulses are addressed by requiring continuity of the Hamiltonian and the derivative of the primer vector at all interior impulses.

Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

PubMed

Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

2006-01-01

A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

Molecular mimicry of human tRNALys anti-codon domain by HIV-1 RNA genome facilitates tRNA primer annealing.

PubMed

Jones, Christopher P; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin

2013-02-01

The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNA(Lys3). Host cell tRNA(Lys) is selectively packaged into HIV-1 through a specific interaction between the major tRNA(Lys)-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNA(Lys3) is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNA(Lys) and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNA(Lys3) in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNA(Lys) to increase the efficiency of tRNA(Lys3) annealing to viral RNA.

Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

PubMed

Vela, J; Vitorica, J; Ruano, D

2001-12-01

We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

Molecular mimicry of human tRNALys anti-codon domain by HIV-1 RNA genome facilitates tRNA primer annealing

PubMed Central

Jones, Christopher P.; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin

2013-01-01

The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNALys3. Host cell tRNALys is selectively packaged into HIV-1 through a specific interaction between the major tRNALys-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNALys3 is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNALys and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNALys3 in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNALys to increase the efficiency of tRNALys3 annealing to viral RNA. PMID:23264568

Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

PubMed

Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

2007-08-31

Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

PubMed

Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

2016-07-01

The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

Properties of an unusual DNA primase from an archaeal plasmid

PubMed Central

Beck, Kirsten; Lipps, Georg

2007-01-01

Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343

Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

PubMed

Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

2010-03-01

The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

PubMed Central

Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

2012-01-01

The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

DNA sequence divergence among derivatives of Escherichia coli K-12 detected by arbitrary primer PCR (random amplified polymorphic DNA) fingerprinting.

PubMed Central

Brikun, I; Suziedelis, K; Berg, D E

1994-01-01

Derivatives of Escherichia coli K-12 of known ancestry were characterized by random amplified polymorphic DNA (RAPD) fingerprinting to better understand genome evolution in this family of closely related strains. This sensitive method entails PCR amplification with arbitrary primers at low stringency and yields arrays of anonymous DNA fragments that are strain specific. Among 150 fragments scored, eight were polymorphic in that they were produced from some but not all strains. Seven polymorphic bands were chromosomal, and one was from the F-factor plasmid. Five of the six mapped polymorphic chromosomal bands came from just 7% of the genome, a 340-kb segment that includes the terminus of replication. Two of these were from the cryptic Rac prophage, and the inability to amplify them from strains was attributable to deletion (excision) or to rearrangement of Rac. Two other terminus-region segments that resulted in polymorphic bands appeared to have sustained point mutations that affected the ability to amplify them. Control experiments showed that RAPD bands from the 340-kb terminus-region segment and also from two plasmids (P1 and F) were represented in approximate proportion to their size. Optimization experiments showed that the concentration of thermostable polymerase strongly affected the arrays of RAPD products obtained. Comparison of RAPD polymorphisms and positions of strains exhibiting them in the pedigree suggests that many sequence changes occurred in these historic E. coli strains during their storage. We propose that the clustering of such mutations near the terminus reflects errors during completion of chromosome replication, possibly during slow growth in the stab cultures that were often used to store E. coli strains in the early years of bacterial genetics. Images PMID:8132463

Diversity and stratification of archaea in a hypersaline microbial mat.

PubMed

Robertson, Charles E; Spear, John R; Harris, J Kirk; Pace, Norman R

2009-04-01

The Guerrero Negro (GN) hypersaline microbial mats have become one focus for biogeochemical studies of stratified ecosystems. The GN mats are found beneath several of a series of ponds of increasing salinity that make up a solar saltern fed from Pacific Ocean water pumped from the Laguna Ojo de Liebre near GN, Baja California Sur, Mexico. Molecular surveys of the laminated photosynthetic microbial mat below the fourth pond in the series identified an enormous diversity of bacteria in the mat, but archaea have received little attention. To determine the bulk contribution of archaeal phylotypes to the pond 4 study site, we determined the phylogenetic distribution of archaeal rRNA gene sequences in PCR libraries based on nominally universal primers. The ratios of bacterial/archaeal/eukaryotic rRNA genes, 90%/9%/1%, suggest that the archaeal contribution to the metabolic activities of the mat may be significant. To explore the distribution of archaea in the mat, sequences derived using archaeon-specific PCR primers were surveyed in 10 strata of the 6-cm-thick mat. The diversity of archaea overall was substantial albeit less than the diversity observed previously for bacteria. Archaeal diversity, mainly euryarchaeotes, was highest in the uppermost 2 to 3 mm of the mat and decreased rapidly with depth, where crenarchaeotes dominated. Only 3% of the sequences were specifically related to known organisms including methanogens. While some mat archaeal clades corresponded with known chemical gradients, others did not, which is likely explained by heretofore-unrecognized gradients. Some clades did not segregate by depth in the mat, indicating broad metabolic repertoires, undersampling, or both.

Detection of Theileria annulata in blood samples of carrier cattle by PCR.

PubMed Central

d'Oliveira, C; van der Weide, M; Habela, M A; Jacquiet, P; Jongejan, F

1995-01-01

We report the detection of Theileria annulata, the causative agent of tropical theileriosis, by PCR in blood samples obtained from carrier cattle. The assay employs primers specific for the gene encoding the 30-kDa major merozoite surface antigen of T. annulata. A 721-bp fragment was amplified from blood samples taken monthly from calves experimentally infected with one of four different stocks of T. annulata originating in either Mauritania, Portugal, Spain, or Turkey. At the end of the experiment, five animals carried the infection for 12 months and two animals remained infected for 15 months. DNAs from six other Theileria species, T. parva, T. mutans, T. sergenti, T. buffeli, T. velifera, and T. taurotragi, were not amplified. Moreover, DNAs from four other hemoparasites (Anaplasma centrale, Anaplasma marginale, Babesia bovis, and Babesia bigemina) were also not amplified. As a control, primers derived from the small subunit rRNA gene of Theileria spp. amplified a 1.1-kb DNA fragment from all Theileria species examined but not from the other four hemoparasites. As few as two to three parasites per microliter of infected blood in a 50-microliters sample volume were detected by Southern or microplate hybridization with a T. annulata-specific cDNA probe. In addition, 92 field samples obtained from cattle in Spain were tested; 22% were positive in blood smears, 40% were positive by immunofluorescent antibody test, and 75% were positive for T. annulata by PCR. The method provides a useful diagnostic tool for detecting T. annulata carrier cattle. PMID:8567902

PCR-based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS-specific primers

Treesearch

M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga

2004-01-01

The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...

Development of SCoT-Based SCAR Marker for Rapid Authentication of Taxus Media.

PubMed

Hao, Juan; Jiao, Kaili; Yu, Chenliang; Guo, Hong; Zhu, Yujia; Yang, Xiao; Zhang, Siyang; Zhang, Lei; Feng, Shangguo; Song, Yaobin; Dong, Ming; Wang, Huizhong; Shen, Chenjia

2018-06-01

Taxus media is an important species in the family Taxaceae with high medicinal and commercial value. Overexploitation and illegal trade have led T. media to a severe threat of extinction. In addition, T. media and other Taxus species have similar morphological traits and are easily misidentified, particularly during the seedling stage. The purpose of this study is to develop a species-specific marker for T. media. Through a screening of 36 start codon targeted (SCoT) polymorphism primers, among 15 individuals of 4 Taxus species (T. media, T. chinensis, T. cuspidate and T. fuana), a clear species-specific DNA fragment (amplified by primer SCoT3) for T. media was identified. After isolation and sequencing, a DNA sequence with 530 bp was obtained. Based on this DNA fragment, a primer pair for the sequence-characterized amplified region marker was designed and named MHSF/MHSR. PCR analysis with primer pair MHSF/MHSR revealed a clear amplified band for all individuals of T. media but not for T. chinensis, T. cuspidate and T. fuana. Therefore, this marker can be used as a quick, efficient and reliable tool to identify T. media among other related Taxus species. The results of this study will lay an important foundation for the protection and management of T. media as a natural resource.

Identification of Erwinia species isolated from apples and pears by differential PCR.

PubMed

Gehring, I; Geider, K

2012-04-01

Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera. Copyright © 2012 Elsevier B.V. All rights reserved.

[Validation of PCR as a tool for the detection of Leishmania (Vianna) spp. parasites in the Lutzomyia (Diptera: Psychodidae) vector].

PubMed

Santamaría, Erika; Ponce, Nubia; Puerta, Concepción; Ferro, Cristina

2005-06-01

The applicability of the polymerase chain reaction (PCR) was evaluated for the detection and identification of parasites in sand fly vectors and thereby precluding the necessity of dissecting them. DNA was extracted from individual, laboratory infected sand flies, and subjected to PCR amplification using specific B1 and B2 primers for parasites of the Leishmania (Viannia) subgenus. The sensitivity and specificity of the PCR primers were defined by means of serial dilutions of a Leishmania culture. Pooled samples of 1 to 5 sandflies were examined in association with the parasite dilutions to determine the point at which sensitivity became reduced. Experimentally infected sand flies were used to compare the sensitivity of the PCR with sand fly dissection and searching for flagellated parasites by microscopic examination. As few as a single parasite was detected, and the sensitivity remained unaltered up to 3 female sand flies per pool. Detection rates were 33% for the traditional technique and 33.3% for PCR. The B1 and B2 primers were confirmed as specific for Leishmania (Viannia) parasites. The demonstrably high sensitivity and specificity of PCR warrant the use of PCR in assessing natural infection rates of Leishmania (Viannia) in field populations of sand fly vectors.

Species-Specific Detection of Mycosphaerella polygoni-cuspidati as a Biological Control Agent for Fallopia japonica by PCR Assay.

PubMed

Kurose, Daisuke; Furuya, Naruto; Saeki, Tetsuya; Tsuchiya, Kenichi; Tsushima, Seiya; Seier, Marion K

2016-10-01

The ascomycete fungus Mycosphaerella polygoni-cuspidati has been undergoing evaluation as a potential classical biological control agent for the invasive weed Fallopia japonica (Japanese knotweed), which has become troublesome in Europe and North America. In advance of the potential release of a biocontrol agent into a new environment, it is crucial to develop an effective monitoring system to enable the evaluation of agent establishment and dispersal within the target host population, as well as any potential attacks on non-target species. Therefore, a primer pair was designed for direct, rapid, and specific detection of the Japanese knotweed pathogen M. polygoni-cuspidati based on the sequences of the internal transcribed spacer regions including the 5.8S rDNA. A PCR product of approximately 298 bp was obtained only when the DNA extracted from mycelial fragments of M. polygoni-cuspidati was used. The lower limit of detection of the PCR method was 100 fg of genomic DNA. Using the specific primer pair, M. polygoni-cuspidati could be detected from both naturally and artificially infected Japanese knotweed plants. No amplification was observed for other Mycosphaerella spp. or fungal endophytes isolated from F. japonica. The designed primer pair is thus effective for the specific detection of M. polygoni-cuspidati in planta.

Specific detection and identification of [Actinobacillus] muris by PCR using primers targeting the 16S-23S rRNA internal transcribed spacer regions.

PubMed

Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin

2013-08-01

[Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.

Identification on commercialized products of AFLP markers able to discriminate slow- from fast-growing chicken strains.

PubMed

Fumière, Olivier; Dubois, Marc; Grégoire, Dimitrie; Théwis, André; Berben, Gilbert

2003-02-26

The European chicken meat market is characterized by numerous quality marks: "Label de Qualité Wallon" in Belgium, "Label Rouge" in France, denominations of geographical origin, organic agriculture, etc. Most of those certified productions have specifications requiring the use of slow-growing chicken strains. The amplified fragment length polymorphism (AFLP) technique has been used to search molecular markers able to discriminate slow-growing chicken strains from fast-growing ones and to authenticate certified products. Two pairs of restriction enzymes (EcoRI/MseI and EcoRI/TaqI) and 121 selective primer combinations were tested on individual DNA samples from chicken products essentially in carcass form that were ascribed as belonging to either slow- or fast-growing strains. Within the resulting fingerprints, two fragments were identified as type-strains specific markers. One primer combination gives a band (333 bp) that is specific for slow-growing chickens, and another primer pair generates a band (372 bp) that was found to be characteristic of fast-growing chickens. The two markers were isolated, cloned, and sequenced. The effectiveness and the specificity of the two interesting determinants were assessed on individuals of two well-known strains (ISA 657 and Cobb 500) and on commercialized products coming from various origins.

Molecular beacon probes-base multiplex NASBA Real-time for detection of HIV-1 and HCV.

PubMed

Mohammadi-Yeganeh, S; Paryan, M; Mirab Samiee, S; Kia, V; Rezvan, H

2012-06-01

Developed in 1991, nucleic acid sequence-based amplification (NASBA) has been introduced as a rapid molecular diagnostic technique, where it has been shown to give quicker results than PCR, and it can also be more sensitive. This paper describes the development of a molecular beacon-based multiplex NASBA assay for simultaneous detection of HIV-1 and HCV in plasma samples. A well-conserved region in the HIV-1 pol gene and 5'-NCR of HCV genome were used for primers and molecular beacon design. The performance features of HCV/HIV-1 multiplex NASBA assay including analytical sensitivity and specificity, clinical sensitivity and clinical specificity were evaluated. The analysis of scalar concentrations of the samples indicated that the limit of quantification of the assay was <1000 copies/ml for HIV-1 and <500 copies/ml for HCV with 95% confidence interval. Multiplex NASBA assay showed a 98% sensitivity and 100% specificity. The analytical specificity study with BLAST software demonstrated that the primers do not attach to any other sequences except for that of HIV-1 or HCV. The primers and molecular beacon probes detected all HCV genotypes and all major variants of HIV-1. This method may represent a relatively inexpensive isothermal method for detection of HIV-1/HCV co-infection in monitoring of patients.

Development of a multiplex RT-PCR assay for the identification of recombination types at different genomic regions of vaccine-derived polioviruses.

PubMed

Dimitriou, T G; Kyriakopoulou, Z; Tsakogiannis, D; Fikatas, A; Gartzonika, C; Levidiotou-Stefanou, S; Markoulatos, P

2016-08-01

Polioviruses (PVs) are the causal agents of acute paralytic poliomyelitis. Since the 1960s, poliomyelitis has been effectively controlled by the use of two vaccines containing all three serotypes of PVs, the inactivated poliovirus vaccine and the live attenuated oral poliovirus vaccine (OPV). Despite the success of OPV in polio eradication programme, a significant disadvantage was revealed: the emergence of vaccine-associated paralytic poliomyelitis (VAPP). VAPP is the result of accumulated mutations and putative recombination events located at the genome of attenuated vaccine Sabin strains. In the present study, ten Sabin isolates derived from OPV vaccinees and environmental samples were studied in order to identify recombination types located from VP1 to 3D genomic regions of virus genome. The experimental procedure that was followed was virus RNA extraction, reverse transcription to convert the virus genome into cDNA, PCR and multiplex-PCR using specific designed primers able to localize and identify each recombination following agarose gel electrophoresis. This multiplex RT-PCR assay allows for the immediate detection and identification of multiple recombination types located at the viral genome of OPV derivatives. After the eradication of wild PVs, the remaining sources of poliovirus infection worldwide would be the OPV derivatives. As a consequence, the immediate detection and molecular characterization of recombinant derivatives are important to avoid epidemics due to the circulation of neurovirulent viral strains.

Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

PubMed Central

Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

2006-01-01

Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

A tailing genome walking method suitable for genomes with high local GC content.

PubMed

Liu, Taian; Fang, Yongxiang; Yao, Wenjuan; Guan, Qisai; Bai, Gang; Jing, Zhizhong

2013-10-15

The tailing genome walking strategies are simple and efficient. However, they sometimes can be restricted due to the low stringency of homo-oligomeric primers. Here we modified their conventional tailing step by adding polythymidine and polyguanine to the target single-stranded DNA (ssDNA). The tailed ssDNA was then amplified exponentially with a specific primer in the known region and a primer comprising 5' polycytosine and 3' polyadenosine. The successful application of this novel method for identifying integration sites mediated by φC31 integrase in goat genome indicates that the method is more suitable for genomes with high complexity and local GC content. Copyright © 2013 Elsevier Inc. All rights reserved.

Detection of Unculturable Bacteria in Periodontal Health and Disease by PCR

PubMed Central

Harper-Owen, R.; Dymock, D.; Booth, V.; Weightman, A. J.; Wade, W. G.

1999-01-01

Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease. PMID:10203507

RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

PubMed

Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

2008-06-15

A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

PubMed

Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

1999-07-01

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

Detection of spotted fever group (SFG) rickettsiae in Dermacentor reticulatus (Acari: Ixodidae) in Poland.

PubMed

Stańczak, Joanna

2006-05-01

Dermacentor reticulatus ticks from Poland were investigated by molecular methods for the presence of rickettsiae. During 2003/2004, a total of 285 adult ticks was assayed using primers RpCS.877 and RpCS.1258 derived from the citrate synthase (gltA) gene, and 116 samples (40.7%) were positive for rickettsial DNA. Ten out of these positive samples were further assayed using SLO1F and SLO1R primers derived form the rOmpA-encoding gene to confirm that detected rickettsiae belong to the spotted fever group (SFG). The obtained sequence of a fragment of the gltA gene of Rickettsia sp. isolated from Polish D. reticulatus demonstrated 96-98% similarities to Rickettsia slovaca, Rickettsia sibirica, Rickettsia honei, and other SFG rickettsiae. The nucleotide sequences of the amplified fragments of the ompA gene were 98% homologous to RpA4 Rickettsia sp. reported from ticks collected in territories of the former Soviet Union.

Use of RAPD technique in evolution studies of four species in the family Canidae.

PubMed

Stepniak, Ewa; Zagalska, Maria M; Switoński, Marek

2002-01-01

The RAPD-PCR technique was applied to identify genetic markers able to distinguish between four canid species: the arctic fox (Alopex lagopus), red fox (Vulpes vulpes), Chinese raccoon dog (Nyctereutes procyonoides procyonoides) and six breeds of the domestic dog (Canis familiaris). A total of 29 ten-nucleotide arbitrary primers were screened for their potential use in the differentiation of these species. Ten primers amplified RAPD profiles that made it possible to distinguish between the investigated taxa. A number of species-specific bands was scored within RAPD profiles produced by these primers: 35.6% of all the polymorphic bands were unique to the Chinese raccoon dog, 29.6% were unique to the domestic dog, 21.2% were diagnostic for the red fox and 13.6% for the arctic fox. No breed-specific fragments were amplified from canine DNA; however, three primers produced bands characteristic for the dog, but not present in all of the investigated breeds. A Neighbor-Joining tree constructed on the basis of the analysis of RAPD profiles amplified by six primers revealed that the phylogenetic distance between the dog and the arctic fox is larger than the distance between the dog and the red fox. The phylogenetic branch of the Chinese raccoon dog was the most distinct on the dendrogram, suggesting that this species belongs to a different phylogenetic lineage. Obtained results make it possible to conclude that RAPD analysis can be a powerful tool for developing molecular markers useful in distinguishing between species of the family Canidae and for studying their phylogenetic relations.

High-throughput gender identification of penguin species using melting curve analysis.

PubMed

Tseng, Chao-Neng; Chang, Yung-Ting; Chiu, Hui-Tzu; Chou, Yii-Cheng; Huang, Hurng-Wern; Cheng, Chien-Chung; Liao, Ming-Hui; Chang, Hsueh-Wei

2014-04-03

Most species of penguins are sexual monomorphic and therefore it is difficult to visually identify their genders for monitoring population stability in terms of sex ratio analysis. In this study, we evaluated the suitability using melting curve analysis (MCA) for high-throughput gender identification of penguins. Preliminary test indicated that the Griffiths's P2/P8 primers were not suitable for MCA analysis. Based on sequence alignment of Chromo-Helicase-DNA binding protein (CHD)-W and CHD-Z genes from four species of penguins (Pygoscelis papua, Aptenodytes patagonicus, Spheniscus magellanicus, and Eudyptes chrysocome), we redesigned forward primers for the CHD-W/CHD-Z-common region (PGU-ZW2) and the CHD-W-specific region (PGU-W2) to be used in combination with the reverse Griffiths's P2 primer. When tested with P. papua samples, PCR using P2/PGU-ZW2 and P2/PGU-W2 primer sets generated two amplicons of 148- and 356-bp, respectively, which were easily resolved in 1.5% agarose gels. MCA analysis indicated the melting temperature (Tm) values for P2/PGU-ZW2 and P2/PGU-W2 amplicons of P. papua samples were 79.75°C-80.5°C and 81.0°C-81.5°C, respectively. Females displayed both ZW-common and W-specific Tm peaks, whereas male was positive only for ZW-common peak. Taken together, our redesigned primers coupled with MCA analysis allows precise high throughput gender identification for P. papua, and potentially for other penguin species such as A. patagonicus, S. magellanicus, and E. chrysocome as well.

Short communication: development and characterization of novel transcriptome-derived microsatellites for genetic analysis of persimmon.

PubMed

Luo, C; Zhang, Q L; Luo, Z R

2014-04-16

Oriental persimmon (Diospyros kaki Thunb.) (2n = 6x = 90) is a major commercial and deciduous fruit tree that is believed to have originated in China. However, rare transcriptomic and genomic information on persimmon is available. Using Roche 454 sequencing technology, the transcriptome from RNA of the flowers of D. kaki was analyzed. A total of 1,250,893 reads were generated and 83,898 unigenes were assembled. A total of 42,711 SSR loci were identified from 23,494 unigenes and 289 polymerase chain reaction primer pairs were designed. Of these 289 primers, 155 (53.6%) showed robust PCR amplification and 98 revealed polymorphism between 15 persimmon genotypes, indicating a polymorphic rate of 63.23% of the productive primers for characterization and genotyping of the genus Diospyros. Transcriptome sequence data generated from next-generation sequencing technology to identify microsatellite loci appears to be rapid and cost-efficient, particularly for species with no genomic sequence information available.

DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan.

PubMed

Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro

2016-10-11

Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.

Development of loop-mediated isothermal amplification (LAMP) assays for the rapid detection of allergic peanut in processed food.

PubMed

Sheu, Shyang-Chwen; Tsou, Po-Chuan; Lien, Yi-Yang; Lee, Meng-Shiou

2018-08-15

Peanut is a widely and common used in many cuisines around the world. However, peanut is also one of the most important food allergen for causing anaphylactic reaction. To prevent allergic reaction, the best way is to avoid the food allergen or food containing allergic ingredient such as peanut before food consuming. Thus, to efficient and precisely detect the allergic ingredient, peanut or related product, is essential and required for maintain consumer's health or their interest. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of allergic peanut using specifically designed primer sets. Two sets of the specific LAMP primers respectively targeted the internal transcribed sequence 1 (ITS1) of nuclear ribosomal DNA sequence regions and the ara h1 gene sequence of Arachia hypogeae (peanut) were used to address the application of LAMP for detecting peanut in processed food or diet. The results demonstrated that the identification of peanut using the newly designed primers for ITS 1 sequence is more sensitive rather than primers for sequence of Ara h1 gene when performing LAMP assay. Besides, the sensitivity of LAMP for detecting peanut is also higher than the traditional PCR method. These LAMP primers sets showed high specificity for the identification of the peanut and had no cross-reaction to other species of nut including walnut, hazelnut, almonds, cashew and macadamia nut. Moreover, when minimal 0.1% peanuts were mixed with other nuts ingredients at different ratios, no any cross-reactivity was evident during performing LAMP. Finally, genomic DNAs extracted from boiled and steamed peanut were used as templates; the detection of peanut by LAMP was not affected and reproducible. As to this established LAMP herein, not only can peanut ingredients be detected but commercial foods containing peanut can also be identified. This assay will be useful and potential for the rapid detection of peanut in practical food markets. Copyright © 2018 Elsevier Ltd. All rights reserved.

Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay

PubMed Central

Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

2016-01-01

For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. PMID:27044566

Identification of fraud (with pig stuffs) in chicken-processed meat through information of mitochondrial cytochrome b.

PubMed

Yacoub, Haitham A; Sadek, Mahmoud A

2017-11-01

This study was conducted to find out the fraud in chicken-processed meat ingredients to protect consumers from commercial adulteration and authentication through a reliable way: direct amplification of conserved segment of cytochrome b gene of mitochondrial DNA, in addition, using species-specific primer assay for a certain cytochrome b. The results reported that chicken-processed meats were identified as a chicken meat based on amplification of conserved cytochrome b gene of mtDNA, while different fragments sizes were produced after the application of species-specific primer as follows: 227, 157, 274, 331, 389 and 439 bp for raw meat of chicken, goat, cattle, sheep, pig and horse, respectively. The results revealed that all chicken meat products are produced with 227 bp in size. While, an adulteration with pork stuffs was observed in some of the chicken meat products using a species-specific primer of cytochrome b gene, namely, chicken luncheon and chicken burger. This study represents a reliable technique that could be used to provide a promising solution for identifying the commercial adulteration and substitutions in processed meat in retail markets.

Development of loop-mediated isothermal amplification assay for specific and rapid detection of differential goat pox virus and sheep pox virus.

PubMed

Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang

2014-01-17

Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.

Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology.

PubMed

Daher, Rana K; Stewart, Gale; Boissinot, Maurice; Boudreau, Dominique K; Bergeron, Michel G

2015-04-01

Recombinase polymerase amplification (RPA) technology relies on three major proteins, recombinase proteins, single-strand binding proteins, and polymerases, to specifically amplify nucleic acid sequences in an isothermal format. The performance of RPA with respect to sequence mismatches of closely-related non-target molecules is not well documented and the influence of the number and distribution of mismatches in DNA sequences on RPA amplification reaction is not well understood. We investigated the specificity of RPA by testing closely-related species bearing naturally occurring mismatches for the tuf gene sequence of Pseudomonas aeruginosa and/or Mycobacterium tuberculosis and for the cfb gene sequence of Streptococcus agalactiae. In addition, the impact of the number and distribution of mismatches on RPA efficiency was assessed by synthetically generating 14 types of mismatched forward primers for detecting five bacterial species of high diagnostic relevance such as Clostridium difficile, Staphylococcus aureus, S. agalactiae, P. aeruginosa, and M. tuberculosis as well as Bacillus atropheus subsp. globigii for which we use the spores as internal control in diagnostic assays. A total of 87 mismatched primers were tested in this study. We observed that target specific RPA primers with mismatches (n > 1) at their 3'extrimity hampered RPA reaction. In addition, 3 mismatches covering both extremities and the center of the primer sequence negatively affected RPA yield. We demonstrated that the specificity of RPA was multifactorial. Therefore its application in clinical settings must be selected and validated a priori. We recommend that the selection of a target gene must consider the presence of closely-related non-target genes. It is advisable to choose target regions with a high number of mismatches (≥36%, relative to the size of amplicon) with respect to closely-related species and the best case scenario would be by choosing a unique target gene. Copyright © 2014 Elsevier Ltd. All rights reserved.

[Genotyping of the Chinese isolates of coltivirus].

PubMed

Xu, Li-hong; Tao, San-ju; Cao, Yu-xi; Wang, Huan-qin; Yang, Dong-rong; He, Ying; Liu, Qin-zhi; Chen, Bo-quan

2003-12-01

To classify the Chinese isolates of Coltiviruses. Three sets of primers were selected among them two were specific to the 9th and 12th segments of subgroup B2, and one was for the 12th segment of subgroup B1-All the Chinese isolates of Coltivirus selected in the experiment were classified according to the lengths of different amplicons of the reverse transcriptase-polymerase Chain reaction (RT-PCR). The homogenicity of the nucleic acids of the isolates BJ95-75 and YN-6 was also compared with other Coltivirus strains belonging to subgroup B2. With the primers 12-854-S/12-B2-R, which were specific to the 12th segment of Coltivirus subgroup B2-850 bp amplicons were obtained from Beijing isolate BJ95-75 and all the Yunnan isolates such as YN-6, -67-1, -68-1, -69, -70-1, -70-2, -90, -92-2, -93 of Coltivirus 492 bp DNA fragments were also amplified from all of them with the segment 9th specific primers 9-JKT-S/9-JKT-R. However no positive results were obtained from Northeast isolates NE97-12, NE97-31 and control viruses YN-99(Orbivirus),YN-151-1(JEV) with the same two sets of primers. With 12-B1-S/12-B1R primers specific to the 12th segment of subgroup B1, no amplicons of right length were obtained from any of the Chinese isolates of Coltivirus and the control viruses. When compared the nucleic acid sequences of BJ95-75 and YN-6 with other Coltivirus strains such as Bannavirus, JKT6423, JKT6969, JKT7043, the amplicons from segment 12th of these two strains had more than 89.4% homology with the other strains, especially to the earlier Chinese isolate Bannavirus, the homolog was more then 98.9%. Nearly 96.5% and 99.2% of the nucleic acids of the amplicons from segment 9th of the two strains were being homologous to Bannavirus and about 84.0% to JKT6423, which had been classified into type B2a. But the maximal homogenicity was about 53% when compared with the other two coltivirus strains. JKT6969 and JKT7043 which had been classified into type B2b. Genotyping the recent Chinese isolates of coltivirus for the first time in our country. Most of the Chinese isolates belong to subgroup B2, more exactly type B2a. The Northeast isolates NE97-12 and NE97-31 were not correctly grouped with the available primers.

Molecular diagnostic development for begomovirus-betasatellite complexes undergoing diversification: A case study.

PubMed

Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad

2017-09-15

At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.

Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

PubMed

Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

2015-03-01

A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

PubMed Central

Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

2010-01-01

A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

PubMed

Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

2009-06-15

DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

PubMed

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

2012-10-01

To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

The Choice of PCR Primers Has Great Impact on Assessments of Bacterial Community Diversity and Dynamics in a Wastewater Treatment Plant

PubMed Central

Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie

2013-01-01

Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498

Asexual Recombinants of Plasmopara halstedii Pathotypes from Dual Infection of Sunflower

PubMed Central

Spring, Otmar; Zipper, Reinhard

2016-01-01

Genetically homogenous strains of Plasmopara halstedii differing in host specificity and fungicide tolerance were used to test the hypothesis that asexual genetic recombination occurs and may account for the high genotype diversity of this homothallic reproducing oomycete, which causes downy mildew in sunflower. Dual inoculation of sunflower seedlings with single zoospore strains of complementary infection characteristics caused sporulation under conditions where inoculation with each strain alone failed to infect. PCR-based investigation with strain-specific primers proved the presence of genetic traits from both progenitors in single sporangia collected from sporangiophores of such infections. Sister zoospores released from these sporangia revealed the genotype of the one or the other parental strain thus indicating heterokaryology of sporangia. Moreover, some zoospores showed amplification products of both parents, which suggests that the generally mononucleic spores derived from genetic recombination. The possibility of parasexual genetic exchange in the host-independent stage of infection and the evolutionary consequences are discussed. PMID:27907026

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

PubMed

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Event-specific real-time detection and quantification of genetically modified Roundup Ready soybean.

PubMed

Huang, Chia-Chia; Pan, Tzu-Ming

2005-05-18

The event-specific real-time detection and quantification of Roundup Ready soybean (RRS) using an ABI PRISM 7700 sequence detection system with light upon extension (LUX) primer was developed in this study. The event-specific primers were designed, targeting the junction of the RRS 5' integration site and the endogenous gene lectin1. Then, a standard reference plasmid was constructed that carried both of the targeted sequences for quantitative analysis. The detection limit of the LUX real-time PCR system was 0.05 ng of 100% RRS genomic DNA, which was equal to 20.5 copies. The range of quantification was from 0.1 to 100%. The sensitivity and range of quantification successfully met the requirement of the labeling rules in the European Union and Taiwan.

Case Study of the Distribution of Mucosa-Associated Bifidobacterium Species, Lactobacillus Species, and Other Lactic Acid Bacteria in the Human Colon

PubMed Central

Nielsen, D. S.; Møller, P. L.; Rosenfeldt, V.; Pærregaard, A.; Michaelsen, K. F.; Jakobsen, M.

2003-01-01

The distribution of mucosa-associated bacteria, bifidobacteria and lactobacilli and closely related lactic acid bacteria, in biopsy samples from the ascending, transverse, and descending parts of the colon from four individuals was investigated by denaturing gradient gel electrophoresis (DGGE). Bifidobacterial genus-specific, Lactobacillus group-specific, and universal bacterial primers were used in a nested PCR approach to amplify a fragment of the 16S rRNA gene. DGGE profiles of the bifidobacterial community were relatively simple, with one or two amplicons detected at most sampling sites in the colon. DGGE profiles obtained with Lactobacillus group-specific primers were complex and varied with host and sampling site in the colon. The overall bacterial community varied with host but not sampling site. PMID:14660412

Sex identification of four penguin species using locus-specific PCR.

PubMed

Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

2013-01-01

Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

PubMed

Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

2015-07-01

Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Satellite scheduling considering maximum observation coverage time and minimum orbital transfer fuel cost

NASA Astrophysics Data System (ADS)

Zhu, Kai-Jian; Li, Jun-Feng; Baoyin, He-Xi

2010-01-01

In case of an emergency like the Wenchuan earthquake, it is impossible to observe a given target on earth by immediately launching new satellites. There is an urgent need for efficient satellite scheduling within a limited time period, so we must find a way to reasonably utilize the existing satellites to rapidly image the affected area during a short time period. Generally, the main consideration in orbit design is satellite coverage with the subsatellite nadir point as a standard of reference. Two factors must be taken into consideration simultaneously in orbit design, i.e., the maximum observation coverage time and the minimum orbital transfer fuel cost. The local time of visiting the given observation sites must satisfy the solar radiation requirement. When calculating the operational orbit elements as optimal parameters to be evaluated, we obtain the minimum objective function by comparing the results derived from the primer vector theory with those derived from the Hohmann transfer because the operational orbit for observing the disaster area with impulse maneuvers is considered in this paper. The primer vector theory is utilized to optimize the transfer trajectory with three impulses and the Hohmann transfer is utilized for coplanar and small inclination of non-coplanar cases. Finally, we applied this method in a simulation of the rescue mission at Wenchuan city. The results of optimizing orbit design with a hybrid PSO and DE algorithm show that the primer vector and Hohmann transfer theory proved to be effective methods for multi-object orbit optimization.

Characterization of Biofilm Community Structure by Ribosomal RNA sequences

DTIC Science & Technology

1989-12-01

for strains of Fibrobacter, 2) Desulfobacter genus-specific probe, 3) Desulfosarcina genus-specific probe, 4) archaebacterial kingdom -specific probes...and 5) eubacterial kingdom -specific probes 5) eukaryote kingdom -specific probe and 6) a general probe encompassing all characterized sulfate-reducing...sets have been fabricated. The group-specific primer sets selectively amplify either sulfate-reducing bacteria or archaebacteria . The SRB-specific

DNA fingerprinting of jute germplasm by RAPD.

PubMed

Hossain, Mohammad Belayat; Haque, Samiul; Khan, Haseena

2002-07-31

The genotype characteristic of cultivars was investigated, along with varieties of both of the jute species, Corchorus olitorius and Corchorus capsularis, in the germplasm collection at the Bangladesh Jute Research Institute (BJRI). DNA fingerprinting was generated for 9 different varieties and 12 accessions of jute cultivars by using random amplified polymorphic DNA (RAPD). A total of 29 arbitrary oligonucleotide primers were screened. Seven primers gave polymorphism within the varieties, and 6 primers detected polymorphism within the accessions that were tested. A dendrogram was engendered from these data, and this gave a distinct clustering of the cultivated species of jute. Therefore, we generated RAPD markers, which are species-specific. These primers can distinguish between C. olitorius and C. capsularis. From the dendrogram that we generated between the various members of these two species, we found the existing genetic classification that agrees with our molecular marking data. A different dendrogram showed that jute accessions could be clustered into three groups. These data will be invaluable in the conservation and utilization of the genetic pool in the germplasm collection.

Development of a loop-mediated isothermal amplification (LAMP) assay for rapid and specific detection of common genetically modified organisms (GMOs).

PubMed

Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu

2015-03-01

Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.

[Optimized application of nested PCR method for detection of malaria].

PubMed

Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

2017-04-28

Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P < 0.05). Conclusion The optimized PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

[Contamination with genetically modified maize MON863 of processed foods on the market].

PubMed

Ohgiya, Yoko; Sakai, Masaaki; Miyashita, Taeko; Yano, Koichi

2009-06-01

Genetically modified maize MON863 (MON863), which has passed a safety examination in Japan, is commercially cultivated in the United States as a food and a resource for fuel. Maize is an anemophilous flower, which easily hybridizes. However, an official method for quantifying the content of MON863 has not been provided yet in Japan. We here examined MON863 contamination in maize-processed foods that had no labeling indicating of the use of genetically modified maize.From March 2006 to July 2008, we purchased 20 frozen maize products, 8 maize powder products, 7 canned maize products and 4 other maize processed foods. Three primer pairs named MON 863 primer, MON863-1, and M3/M4 for MON863-specific integrated cassette were used for qualitative polymerase chain reaction (PCR). A primer pair "SSIIb-3" for starch synthase gene was used to confirm the quality of extracted DNA. The starch synthase gene was detected in all samples. In qualitative tests, the MON863-specific fragments were detected in 7 (18%) maize powder products out of the 39 processed foods with all the three primer pairs.We concluded that various maize processed foods on the market were contaminated with MON863. It is important to accumulate further information on MON863 contamination in maize-processed foods that have no label indication of the use of genetically modified maize.

Rapid Detection of Penicillin-Resistant Streptococcus pneumoniae in Cerebrospinal Fluid by a Seminested-PCR Strategy

PubMed Central

du Plessis, Mignon; Smith, Anthony M.; Klugman, Keith P.

1998-01-01

A seminested-PCR assay, based on the amplification of the pneumococcal penicillin-binding protein 2B gene (pbp2B), was developed for the detection of penicillin-resistant and -susceptible pneumococci in cerebrospinal fluid (CSF) specimens. Species-specific primers (P5 and P6) which amplified a 682-bp conserved region of the transpeptidase-encoding region of the pbp2B gene were used. Four “resistance” primers were designed to bind to altered areas of the pbp2B gene identified in penicillin-resistant South African wild-type strains. Together with the downstream primer P6, the upstream resistance primers amplified fragments which were used to detect the presence of penicillin resistance. This system identified all 35 of the S. pneumoniae isolates evaluated, including strains of 11 different serotypes and a range of penicillin-resistant and -susceptible strains. The specificity of the assay was demonstrated by its inability to amplify DNA from other bacterial species which commonly cause meningitis. It was possible to detect pneumococcal DNA from culture-negative CSF inoculated with 2.5 pg of purified DNA or 18 CFU. Analysis of 285 CSF specimens showed that PCR detected the pneumococcus in 18 samples positive by culture, including the identification of four penicillin-resistant isolates. The positive predictive value and the negative predictive value of the assay were each 100%. PMID:9466757

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

PubMed

Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

2003-06-01

A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

PubMed

Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

2017-08-01

The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

Loop-Mediated Isothermal Amplification Label-Based Gold Nanoparticles Lateral Flow Biosensor for Detection of Enterococcus faecalis and Staphylococcus aureus

PubMed Central

Wang, Yi; Li, Hui; Wang, Yan; Zhang, Lu; Xu, Jianguo; Ye, Changyun

2017-01-01

The report describes a simple, rapid and sensitive assay for visual and multiplex detection of Enterococcus faecalis and Staphylococcus aureus based on multiple loop-mediated isothermal amplification (mLAMP) and lateral flow biosensor (LFB). Detection and differentiation of the Ef0027 gene (E. faecalis-specific gene) and nuc gene (S. aureus-specific gene) were determined using fluorescein (FITC)-and digoxin-modified primers in the mLAMP process. In the presence of biotin- and FITC-/digoxin-modified primers, the mLAMP yielded numerous biotin- and FITC-/digoxin-attached duplex products, which were detected by LFB through biotin/streptavidin interaction (biotin on the duplex and streptavidin on the gold nanoparticle) and immunoreactions (FITC/digoxin on the duplex and anti-FITC/digoxin on the LFB test line). The accumulation of gold nanoparticles generated a characteristic red line, enabling visual and multiplex detection of target pathogens without instrumentation. The limit of detection (LoD), analytical specificity and feasibility of LAMP-LFB technique were successfully examined in pure culture and blood samples. The entire procedure, including specimen (blood samples) processing (30 min), isothermal reaction (40 min) and result reporting (within 2 min), could be completed within 75 min. Thus, this assay offers a simple, rapid, sensitive and specific test for multiplex detection of E. faecalis and S. aureus strains. Furthermore, the LAMP-LFB strategy is a universal technique, which can be extended to detect various target sequences by re-designing the specific LAMP primers. PMID:28239371

Design of new genome- and gene-sourced primers and identification of QTL for seed oil content in a specially high-oil Brassica napus cultivar.

PubMed

Sun, Meiyu; Hua, Wei; Liu, Jing; Huang, Shunmou; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

2012-01-01

Rapeseed (Brassica napus L.) is one of most important oilseed crops in the world. There are now various rapeseed cultivars in nature that differ in their seed oil content because they vary in oil-content alleles and there are high-oil alleles among the high-oil rapeseed cultivars. For these experiments, we generated doubled haploid (DH) lines derived from the cross between the specially high-oil cultivar zy036 whose seed oil content is approximately 50% and the specially low-oil cultivar 51070 whose seed oil content is approximately 36%. First, to address the deficiency in polymorphic markers, we designed 5944 pairs of newly developed genome-sourced primers and 443 pairs of newly developed primers related to oil-content genes to complement the 2244 pairs of publicly available primers. Second, we constructed a new DH genetic linkage map using 527 molecular markers, consisting of 181 publicly available markers, 298 newly developed genome-sourced markers and 48 newly developed markers related to oil-content genes. The map contained 19 linkage groups, covering a total length of 2,265.54 cM with an average distance between markers of 4.30 cM. Third, we identified quantitative trait loci (QTL) for seed oil content using field data collected at three sites over 3 years, and found a total of 12 QTL. Of the 12 QTL associated with seed oil content identified, 9 were high-oil QTL which derived from the specially high-oil cultivar zy036. Two high-oil QTL on chromosomes A2 and C9 co-localized in two out of three trials. By QTL mapping for seed oil content, we found four candidate genes for seed oil content related to four gene markers: GSNP39, GSSR161, GIFLP106 and GIFLP046. This information will be useful for cloning functional genes correlated with seed oil content in the future.

Design of New Genome- and Gene-Sourced Primers and Identification of QTL for Seed Oil Content in a Specially High-Oil Brassica napus Cultivar

PubMed Central

Liu, Jing; Huang, Shunmou; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

2012-01-01

Rapeseed (Brassica napus L.) is one of most important oilseed crops in the world. There are now various rapeseed cultivars in nature that differ in their seed oil content because they vary in oil-content alleles and there are high-oil alleles among the high-oil rapeseed cultivars. For these experiments, we generated doubled haploid (DH) lines derived from the cross between the specially high-oil cultivar zy036 whose seed oil content is approximately 50% and the specially low-oil cultivar 51070 whose seed oil content is approximately 36%. First, to address the deficiency in polymorphic markers, we designed 5944 pairs of newly developed genome-sourced primers and 443 pairs of newly developed primers related to oil-content genes to complement the 2244 pairs of publicly available primers. Second, we constructed a new DH genetic linkage map using 527 molecular markers, consisting of 181 publicly available markers, 298 newly developed genome-sourced markers and 48 newly developed markers related to oil-content genes. The map contained 19 linkage groups, covering a total length of 2,265.54 cM with an average distance between markers of 4.30 cM. Third, we identified quantitative trait loci (QTL) for seed oil content using field data collected at three sites over 3 years, and found a total of 12 QTL. Of the 12 QTL associated with seed oil content identified, 9 were high-oil QTL which derived from the specially high-oil cultivar zy036. Two high-oil QTL on chromosomes A2 and C9 co-localized in two out of three trials. By QTL mapping for seed oil content, we found four candidate genes for seed oil content related to four gene markers: GSNP39, GSSR161, GIFLP106 and GIFLP046. This information will be useful for cloning functional genes correlated with seed oil content in the future. PMID:23077542

Structural and functional properties of the HIV-1 RNA-tRNA(Lys)3 primer complex annealed by the nucleocapsid protein: comparison with the heat-annealed complex.

PubMed Central

Brulé, Fabienne; Marquet, Roland; Rong, Liwei; Wainberg, Mark A; Roques, Bernard P; Le Grice, Stuart F J; Ehresmann, Bernard; Ehresmann, Chantal

2002-01-01

The conversion of the single-stranded RNA genome into double-stranded DNA by virus-coded reverse transcriptase (RT) is an essential step of the retrovirus life cycle. In human immunodeficiency virus type 1 (HIV-1), RT uses the cellular tRNA(Lys)3 to initiate the (-) strand DNA synthesis. Placement of the primer tRNA(Lys)3 involves binding of its 3'-terminal 18 nt to a complementary region of genomic RNA termed PBS. However, the PBS sequence is not the unique determinant of primer usage and additional contacts are important. This placement is believed to be achieved in vivo by the nucleocapsid domain of Gag or by the mature protein NCp. Up to now, structural information essentially arose from heat-annealed primer-template complexes (Isel et al., J Mol Biol, 1995, 247:236-250; Isel et al., EMBO J, 1999, 18:1038-1048). Here, we investigated the formation of the primer-template complex mediated by NCp and compared structural and functional properties of heat- and NCp-annealed complexes. We showed that both heat- and NCp-mediated procedures allow comparable high yields of annealing. Then, we investigated structural features of both kinds of complexes by enzymatic probing, and we compared their relative efficiency in (-) strong stop DNA synthesis. We did not find any significant differences between these complexes, suggesting that information derived from the heat-annealed complex can be transposed to the NCp-mediated complex and most likely to complexes formed in vivo. PMID:11873759

Development of molecular method for sex identification in date palm (Phoenix dactylifera L.) plantlets using novel sex-linked microsatellite markers.

PubMed

Maryam; Jaskani, Muhammad Jafar; Awan, Faisal Saeed; Ahmad, Saeed; Khan, Iqrar A

2016-06-01

Microsatellite markers containing simple sequence repeats (SSRs) are a valuable tool for genetic analysis. Date palm is a dioecious and slow flowering and is very difficult to identify the gender of the trees until it reaches the reproductive age (5-10 years). A total of 12 microsatellite primers were used with 30 date palm samples, 14 parents (8 male + 6 females) and 16 progeny (developed from parents breeding) which showed that microsatellites were highly polymorphic, having a great number of alleles. A total of 124 alleles were characterized in 12 SSR loci. On average, there are 9.08 alleles per locus, with a range from 5 to 16 alleles, for primers mpdCIR15 and mpdCIR57, respectively. These primers produced 15 polymorphic loci specifically in male date palm samples and the seedlings harboring the unique fragments were further characterized as male plants. Increasingly, 38.46 % of these loci were scored as homozygous alleles while 61.53 % heterozygous allelic loci were determined. Primer mpdCIR48 produced a specific locus (250/250) in all male samples whereas the same locus was absent in female samples. Similarly, a locus of 300/310 bp reoccurred in 5 date palm male samples using marker DP-168 which indicated that these are the promising candidate marker to detect the sex in date palm seedlings at early stage. The data resulted from combination of 12 primers enabled the 16 seedling samples progeny (developed from parents breeding) of date palm cultivars to divide into two groups i.e., male and female regarding their sex expression comparative to the parents (male + female) using the principle coordinate analysis.

Development of a rapid, sensitive and specific diagnostic assay for fish Aquareovirus based on RT-PCR.

PubMed

Seng, E K; Fang, Q; Lam, T J; Sin, Y M

2004-06-15

A rapid, sensitive and highly specific detection method for Aquareovirus based on reverse-transcription polymerase chain reaction (RT-PCR) was developed. Based on multiple sequence alignment of the cloned sequences of a local isolates, the Threadfin reovirus (TFV) and Guppy reovirus (GPV) with Grass carp reovirus (GCRV), a pair of degenerate primers was selected carefully and synthesized. Using this primer combination, only one specific product, approximately 450 bp in length was obtained when RT-PCR was carried out using the genomic double-stranded RNA (dsRNA) of TFV, GPV and GCRV. Similar results were also obtained when Chum salmon reovirus (CSRV) and Striped bass reovirus (SBRV) dsRNA were used as templates. No products were observed when nucleic acids other than the dsRNA of the aquareoviruses described above were used as RT-PCR templates. This technique could detect not only TFV but also GPV and GCRV in low titer virus-infected cell cultured cells. Furthermore, this method has also been shown to be able to diagnose GPV-infected guppy (Poecilia reticulata) that exhibit clinical symptoms as well as GPV-carrier guppy. Collectively, these results showed that the RT-PCR amplification method using specific degenerate primers described below is very useful for rapid and accurate detection of a variety of aquareovirus strains isolated from different host species and origin.

Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

PubMed

Pegels, N; González, I; Fernández, S; García, T; Martín, R

2012-01-01

A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

Cascade Signal Amplification Based on Copper Nanoparticle-Reported Rolling Circle Amplification for Ultrasensitive Electrochemical Detection of the Prostate Cancer Biomarker.

PubMed

Zhu, Ye; Wang, Huijuan; Wang, Lin; Zhu, Jing; Jiang, Wei

2016-02-03

An ultrasensitive and highly selective electrochemical assay was first attempted by combining the rolling circle amplification (RCA) reaction with poly(thymine)-templated copper nanoparticles (CuNPs) for cascade signal amplification. As proof of concept, prostate specific antigen (PSA) was selected as a model target. Using a gold nanoparticle (AuNP) as a carrier, we synthesized the primer-AuNP-aptamer bioconjugate for signal amplification by increasing the primer/aptamer ratio. The specific construction of primer-AuNP-aptamer/PSA/anti-PSA sandwich structure triggered the effective RCA reaction, in which thousands of tandem poly(thymine) repeats were generated and directly served as the specific templates for the subsequent CuNP formation. The signal readout was easily achieved by dissolving the RCA product-templated CuNPs and detecting the released copper ions with differential pulse stripping voltammetry. Because of the designed cascade signal amplification strategy, the newly developed method achieved a linear range of 0.05-500 fg/mL, with a remarkable detection limit of 0.020 ± 0.001 fg/mL PSA. Finally, the feasibility of the developed method for practical application was investigated by analyzing PSA in the real clinical human serum samples. The ultrasensitivity, specificity, convenience, and capability for analyzing the clinical samples demonstrate that this method has great potential for practical disease diagnosis applications.

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowman, Stephen M

2008-09-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

Quantification of Trichothecene-Producing Fusarium Species in Harvested Grain by Competitive PCR To Determine Efficacies of Fungicides against Fusarium Head Blight of Winter Wheat

PubMed Central

Edwards, S. G.; Pirgozliev, S. R.; Hare, M. C.; Jenkinson, P.

2001-01-01

We developed a PCR-based assay to quantify trichothecene-producing Fusarium based on primers derived from the trichodiene synthase gene (Tri5). The primers were tested against a range of fusarium head blight (FHB) (also known as scab) pathogens and found to amplify specifically a 260-bp product from 25 isolates belonging to six trichothecene-producing Fusarium species. Amounts of the trichothecene-producing Fusarium and the trichothecene mycotoxin deoxynivalenol (DON) in harvested grain from a field trial designed to test the efficacies of the fungicides metconazole, azoxystrobin, and tebuconazole to control FHB were quantified. No correlation was found between FHB severity and DON in harvested grain, but a good correlation existed between the amount of trichothecene-producing Fusarium and DON present within grain. Azoxystrobin did not affect levels of trichothecene-producing Fusarium compared with those of untreated controls. Metconazole and tebuconazole significantly reduced the amount of trichothecene-producing Fusarium in harvested grain. We hypothesize that the fungicides affected the relationship between FHB severity and the amount of DON in harvested grain by altering the proportion of trichothecene-producing Fusarium within the FHB disease complex and not by altering the rate of DON production. The Tri5 quantitative PCR assay will aid research directed towards reducing amounts of trichothecene mycotoxins in food and animal feed. PMID:11282607

Detection of Food Allergens by Taqman Real-Time PCR Methodology.

PubMed

García, Aina; Madrid, Raquel; García, Teresa; Martín, Rosario; González, Isabel

2017-01-01

Real-time PCR (polymerase chain reaction) has shown to be a very effective technology for the detection of food allergens. The protocol described herein consists on a real-time PCR assay targeting the plant ITS (Internal Transcribed Spacer) region, using species-specific primers and hydrolysis probes (Taqman) dual labeled with a reporter fluorophore at the 5' end (6-carboxyfluorescein, FAM) and a quencher fluorophore at the 3' end (Blackberry, BBQ). The species-specific real-time PCR systems (primers/probe) described in this work allowed the detection of different nuts (peanut, hazelnut, pistachio, almond, cashew, macadamia, walnut and pecan), common allergens present in commercial food products, with a detection limit of 0.1 mg/kg.

Kinetoplast DNA minicircles of phloem-restricted Phytomonas associated with wilt diseases of coconut and oil palms have a two-domain structure.

PubMed

Dollet, M; Sturm, N R; Ahomadegbe, J C; Campbell, D A

2001-11-27

We report the cloning and sequencing of the first minicircle from a phloem-restricted, pathogenic Phytomonas sp. (Hart 1) isolated from a coconut palm with hartrot disease. The minicircle possessed a two-domain structure of two conserved regions, each containing three conserved sequence blocks (CSB). Based on the sequence around CSB 3 from Hart 1, PCR primers were designed to allow specific amplification of Phytomonas minicircles. This primer pair demonstrated specificity for at least six groups of plant trypanosomatids and did not amplify from insect trypanosomatids. The PCR results were consistent with a two-domain structure for other plant trypanosomatids.

A multiplex PCR for detection of six viruses in ducks.

PubMed

Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

2017-10-01

In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.

PubMed

Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L

2003-11-01

Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.

Isolation of a sex-linked DNA sequence in cranes.

PubMed

Duan, W; Fuerst, P A

2001-01-01

A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

Specific PCR primers directed to identify cryI and cryIII genes within a Bacillus thuringiensis strain collection.

PubMed Central

Cerón, J; Ortíz, A; Quintero, R; Güereca, L; Bravo, A

1995-01-01

In this paper we describe a PCR strategy that can be used to rapidly identify Bacillus thuringiensis strains that harbor any of the known cryI or cryIII genes. Four general PCR primers which amplify DNA fragments from the known cryI or cryIII genes were selected from conserved regions. Once a strain was identified as an organism that contains a particular type of cry gene, it could be easily characterized by performing additional PCR with specific cryI and cryIII primers selected from variable regions. The method described in this paper can be used to identify the 10 different cryI genes and the five different cryIII genes. One feature of this screening method is that each cry gene is expected to produce a PCR product having a precise molecular weight. The genes which produce PCR products having different sizes probably represent strains that harbor a potentially novel cry gene. Finally, we present evidence that novel crystal genes can be identified by the method described in this paper. PMID:8526493

Diagnosis of Carrion’s Disease by Direct Blood PCR in Thin Blood Smear Negative Samples

PubMed Central

Tinco Valdez, Carmen; Pons, Maria J.; del Valle, Luis J.; Oré, Verónica Casabona; Michelena, Denisse Champin; Mayra, Jorge Bazán; Gavidea, Víctor Zavaleta; Vargas, Martha; Ruiz, Joaquim

2014-01-01

Bartonella bacilliformis is the etiologic agent of Carrion's disease. This disease has two well established phases, the most relevant being the so called Oroya Fever, in which B. bacilliformis infect the erythrocytes resulting in severe anemia and transient immunosuppression, with a high lethality in the absence of adequate antibiotic treatment. The presence of B. bacilliformis was studied in 113 blood samples suspected of Carrion’s disease based on clinical criteria, despite the absence of a positive thin blood smear, by two different PCR techniques (using Bartonella-specific and universal 16S rRNA gene primers), and by bacterial culture. The specific 16S rRNA gene primers revealed the presence of 21 B. bacilliformis and 1 Bartonella elizabethae, while universal primers showed both the presence of 3 coinfections in which a concomitant pathogen was detected plus Bartonella, in addition to the presence of infections by other microorganisms such as Agrobacterium or Bacillus firmus. These data support the need to implement molecular tools to diagnose Carrion’s disease. PMID:24651298

PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.

PubMed

Prevost, S; Andre, S; Remize, F

2010-12-01

Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.

[Molecular identification and detection of moon jellyfish (Aurelia sp.) based on partial sequencing of mitochondrial 16S rDNA and COI].

PubMed

Wang, Jian-Yan; Zhen, Yu; Wang, Guo-shan; Mi, Tie-Zhu; Yu, Zhi-gang

2013-03-01

Taking the moon jellyfish Aurelia sp. commonly found in our coastal sea areas as test object, its genome DNA was extracted, the partial sequences of mt-16S rDNA (650 bp) and mt-COI (709 bp) were PCR-amplified, and, after purification, cloning, and sequencing, the sequences obtained were BLASTn-analyzed. The sequences of greater difference with those of the other jellyfish were chosen, and eight specific primers for the mt-16S rDNA and mt-COI of Aurelia sp. were designed, respectively. The specificity test indicated that the primer AS3 for the mt-16S rDNA and the primer AC3 for the mt-COI were excellent in rapidly detecting the target jellyfish from Rhopilema esculentum, Nemopilema nomurai, Cyanea nozakii, Acromitus sp., and Aurelia sp., and thus, the techniques for the molecular identification and detection of moon jellyfish were preliminarily established, which could get rid of the limitations in classical morphological identification of Aurelia sp. , being able to find the Aurelia sp. in the samples more quickly and accurately.

Identification of Staphylococcus spp. using (GTG)₅-PCR fingerprinting.

PubMed

Svec, Pavel; Pantůček, Roman; Petráš, Petr; Sedláček, Ivo; Nováková, Dana

2010-12-01

A group of 212 type and reference strains deposited in the Czech Collection of Microorganisms (Brno, Czech Republic) and covering 41 Staphylococcus species comprising 21 subspecies was characterised using rep-PCR fingerprinting with the (GTG)₅ primer in order to evaluate this method for identification of staphylococci. All strains were typeable using the (GTG)₅ primer and generated PCR products ranging from 200 to 4500 bp. Numerical analysis of the obtained fingerprints revealed (sub)species-specific clustering corresponding with the taxonomic position of analysed strains. Taxonomic position of selected strains representing the (sub)species that were distributed over multiple rep-PCR clusters was verified and confirmed by the partial rpoB gene sequencing. Staphylococcus caprae, Staphylococcus equorum, Staphylococcus sciuri, Staphylococcus piscifermentans, Staphylococcus xylosus, and Staphylococcus saprophyticus revealed heterogeneous fingerprints and each (sub)species was distributed over several clusters. However, representatives of the remaining Staphylococcus spp. were clearly separated in single (sub)species-specific clusters. These results showed rep-PCR with the (GTG)₅ primer as a fast and reliable method applicable for differentiation and straightforward identification of majority of Staphylococcus spp. Copyright © 2010 Elsevier GmbH. All rights reserved.

Development of a rapid assay to detect the jellyfish Cyanea nozakii using a loop-mediated isothermal amplification method.

PubMed

Liu, Zhongyuan; Dong, Zhijun; Liu, Dongyan

2016-07-01

Blooms of the harmful jellyfish Cyanea nozakii, which are a severe nuisance to fisheries and tourisms, frequently occur in the northern East China Sea, Yellow Sea, and Bohai Sea. To provide early warning of this species, a simple and effective molecular method for identifying C. nozakii was developed using the loop-mediated isothermal amplification method (LAMP). The LAMP assay is highly specific and uses a set of four primers that target six different regions on the mitochondrial cytochrome c oxidase subunit I (COI) gene of C. nozakii. The amplification conditions, including the dNTP and betaine concentrations, the inner primer to outer primer concentration ratio, reaction time and temperature, were optimized. The LAMP assay amplified DNA extracted from tissue samples of C. nozakii but did not amplify DNA from other common scyphozoans and hydrozoans collected in the same region. In addition, the LAMP assay was more sensitive than conventional PCR. Therefore, the established LAMP assay is a sensitive, specific, fast, and easily performed method for detection of C. nozakii at different stages in their life cycle.

A novel cohabitation between two diazotrophic cyanobacteria in the oligotrophic ocean

PubMed Central

Momper, Lily M; Reese, Brandi Kiel; Carvalho, Gustavo; Lee, Patrick; Webb, Eric A

2015-01-01

The cyanobacterial genus Trichodesmium is biogeochemically significant because of its dual role in nitrogen and carbon fixation in the oligotrophic ocean. Trichodesmium species form colonies that can be easily enriched from the water column and used for shipboard rate measurements to estimate their contribution to oceanic carbon and nitrogen budgets. During a July 2010 cruise near the Hawaiian Islands in the oligotrophic North Pacific Subtropical Gyre, a specific morphology of Trichodesmium puff-form colonies were examined under epifluorescent microscopy and found to harbor a colonial endobiont, morphologically identified as the heterocystous diazotrophic cyanobacterium Calothrix. Using unialgal enrichments obtained from this cruise, we show that these Calothrix-like heterocystous cyanobionts (hetDA for ‘Trichodesmium-associated heterocystous diazotroph') fix nitrogen on a diurnal cycle (maximally in the middle of the light cycle with a detectable minimum in the dark). Gene sequencing of nifH from the enrichments revealed that this genus was likely not quantified using currently described quantitative PCR (qPCR) primers. Guided by the sequence from the isolate, new hetDA-specific primers were designed and subsequent qPCR of environmental samples detected this diazotroph from surface water to a depth of 150 m, reaching densities up to ∼9 × 103 l−1. Based on phylogenetic relatedness of nifH and 16S rRNA gene sequences, it is predicted that the distribution of this cyanobiont is not limited to subtropical North Pacific but likely reaches to the South Pacific and Atlantic Oceans. Therefore, this previously unrecognized cohabitation, if it reaches beyond the oligotrophic North Pacific, could potentially influence Trichodesmium-derived nitrogen fixation budgets in the world ocean. PMID:25343510

A novel cohabitation between two diazotrophic cyanobacteria in the oligotrophic ocean.

PubMed

Momper, Lily M; Reese, Brandi Kiel; Carvalho, Gustavo; Lee, Patrick; Webb, Eric A

2015-03-17

The cyanobacterial genus Trichodesmium is biogeochemically significant because of its dual role in nitrogen and carbon fixation in the oligotrophic ocean. Trichodesmium species form colonies that can be easily enriched from the water column and used for shipboard rate measurements to estimate their contribution to oceanic carbon and nitrogen budgets. During a July 2010 cruise near the Hawaiian Islands in the oligotrophic North Pacific Subtropical Gyre, a specific morphology of Trichodesmium puff-form colonies were examined under epifluorescent microscopy and found to harbor a colonial endobiont, morphologically identified as the heterocystous diazotrophic cyanobacterium Calothrix. Using unialgal enrichments obtained from this cruise, we show that these Calothrix-like heterocystous cyanobionts (hetDA for 'Trichodesmium-associated heterocystous diazotroph') fix nitrogen on a diurnal cycle (maximally in the middle of the light cycle with a detectable minimum in the dark). Gene sequencing of nifH from the enrichments revealed that this genus was likely not quantified using currently described quantitative PCR (qPCR) primers. Guided by the sequence from the isolate, new hetDA-specific primers were designed and subsequent qPCR of environmental samples detected this diazotroph from surface water to a depth of 150 m, reaching densities up to ∼ 9 × 10(3) l(-1). Based on phylogenetic relatedness of nifH and 16S rRNA gene sequences, it is predicted that the distribution of this cyanobiont is not limited to subtropical North Pacific but likely reaches to the South Pacific and Atlantic Oceans. Therefore, this previously unrecognized cohabitation, if it reaches beyond the oligotrophic North Pacific, could potentially influence Trichodesmium-derived nitrogen fixation budgets in the world ocean.

Two EST-derived marker systems for cultivar identification in tree peony.

PubMed

Zhang, J J; Shu, Q Y; Liu, Z A; Ren, H X; Wang, L S; De Keyser, E

2012-02-01

Tree peony (Paeonia suffruticosa Andrews), a woody deciduous shrub, belongs to the section Moutan DC. in the genus of Paeonia of the Paeoniaceae family. To increase the efficiency of breeding, two EST-derived marker systems were developed based on a tree peony expressed sequence tag (EST) database. Using target region amplification polymorphism (TRAP), 19 of 39 primer pairs showed good amplification for 56 accessions with amplicons ranging from 120 to 3,000 bp long, among which 99.3% were polymorphic. In contrast, 7 of 21 primer pairs demonstrated adequate amplification with clear bands for simple sequence repeats (SSRs) developed from ESTs, and a total of 33 alleles were found in 56 accessions. The similarity matrices generated by TRAP and EST-SSR markers were compared, and the Mantel test (r = 0.57778, P = 0.0020) showed a moderate correlation between the two types of molecular markers. TRAP markers were suitable for DNA fingerprinting and EST-SSR markers were more appropriate for discriminating synonyms (the same cultivars with different names due to limited information exchanged among different geographic areas). The two sets of EST-derived markers will be used further for genetic linkage map construction and quantitative trait locus detection in tree peony.

Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

PubMed

Boehm; Gibson; Lubzens

2000-01-01

This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

Characterization of Aspergillus flavus strains from Brazilian Brazil nuts and cashew by RAPD and ribosomal DNA analysis.

PubMed

Midorikawa, G E O; Pinheiro, M R R; Vidigal, B S; Arruda, M C; Costa, F F; Pappas, G J; Ribeiro, S G; Freire, F; Miller, R N G

2008-07-01

The aim of this study was to determine the genetic variability in Aspergillus flavus populations from Brazil nut and cashew and develop a polymerase chain reaction (PCR) detection method. Chomatography analysis of 48 isolates identified 36 as aflatoxigenic (75%). One hundred and forty-one DNA bands were generated with 11 random amplified polymorphic DNA (RAPD) primers and analysed via unweighted pair group analysis, using arithmetic means (UPGMA). Isolates grouped according to host, with differentiation of those from A. occidentale also according to geographical origin. Aspergillus flavus-specific PCR primers ASPITSF2 and ASPITSR3 were designed from ribosomal DNA internal transcribed spacers (ITS 1 and 2), and an internal amplification control was developed, to prevent false negative results. Specificity to only A. flavus was confirmed against DNA from additional aspergilli and other fungi. RAPD-based characterization differentiated isolates according to plant host. The PCR primer pair developed showed specificity to A. flavus, with a detection limit of 10 fg. Genetic variability observed in A. flavus isolates from two Brazilian agroecosystems suggested reproductive isolation. The PCR detection method developed for A. flavus represents progress towards multiplex PCR detection of aflatoxigenic and nonaflatoxigenic strains in Hazard Analysis Critical Control Point systems.

Exploring target-specific primer extension in combination with a bead-based suspension array for multiplexed detection and typing using Streptococcus suis as a model pathogen

PubMed Central

van der Wal, Fimme J.; Achterberg, René P.; van Solt-Smits, Conny; Bergervoet, Jan H. W.; de Weerdt, Marjanne; Wisselink, Henk J.

2017-01-01

We investigated the feasibility of an assay based on target-specific primer extension, combined with a suspension array, for the multiplexed detection and typing of a veterinary pathogen in animal samples, using Streptococcus suis as a model pathogen. A procedure was established for simultaneous detection of 6 S. suis targets in pig tonsil samples (i.e., 4 genes associated with serotype 1, 2, 7, or 9, the generic S. suis glutamate dehydrogenase gene [gdh], and the gene encoding the extracellular protein factor [epf]). The procedure was set up as a combination of protocols: DNA isolation from porcine tonsils, a multiplex PCR, a multiplex target-specific primer extension, and finally a suspension array as the readout. The resulting assay was compared with a panel of conventional PCR assays. The proposed multiplex assay can correctly identify the serotype of isolates and is capable of simultaneous detection of multiple targets in porcine tonsillar samples. The assay is not as sensitive as the current conventional PCR assays, but with the correct sampling strategy, the assay can be useful for screening pig herds to establish which S. suis serotypes are circulating in a pig population. PMID:28980519

Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea

PubMed Central

Kurosaki, Yohei; Magassouba, N’Faly; Oloniniyi, Olamide K.; Cherif, Mahamoud S.; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro

2016-01-01

Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure. PMID:26900929

Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay.

PubMed

Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

2016-06-01

For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. © The American Society of Tropical Medicine and Hygiene.

Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea.

PubMed

Kurosaki, Yohei; Magassouba, N'Faly; Oloniniyi, Olamide K; Cherif, Mahamoud S; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro

2016-02-01

Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure.