Sample records for specific primers designed

  1. Design of primers and probes for quantitative real-time PCR methods.

    PubMed

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  2. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

    PubMed Central

    2012-01-01

    Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

  3. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  4. URPD: a specific product primer design tool.

    PubMed

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2012-06-19

    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  5. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

  6. A tool for design of primers for microRNA-specific quantitative RT-qPCR.

    PubMed

    Busk, Peter K

    2014-01-28

    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  7. GSP: A web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  8. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

    PubMed Central

    2009-01-01

    Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

  9. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    PubMed

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

  10. miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

    PubMed Central

    Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

    2018-01-01

    MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

  11. PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

    PubMed Central

    Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

    2006-01-01

    PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

  12. WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

    PubMed Central

    Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

    2007-01-01

    Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

  13. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  14. Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

    PubMed Central

    Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

  15. Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

    PubMed

    Robertson, Amber L; Phillips, Allison R

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

  16. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  17. MethPrimer: designing primers for methylation PCRs.

    PubMed

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  18. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  19. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    NASA Astrophysics Data System (ADS)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  20. FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

    PubMed Central

    Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

    2013-01-01

    The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

  1. TipMT: Identification of PCR-based taxon-specific markers.

    PubMed

    Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C

    2017-02-11

    Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .

  2. An innovative SNP genotyping method adapting to multiple platforms and throughputs.

    PubMed

    Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

    2017-03-01

    An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

  3. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    PubMed

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  4. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

    PubMed Central

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

  5. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    PubMed

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  7. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    PubMed

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  8. Molecular Tools for the Detection of Nitrogen Cycling Archaea

    PubMed Central

    Rusch, Antje

    2013-01-01

    Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

  9. Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

    PubMed

    Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

    2014-11-01

    To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  10. GSP: a web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

  11. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    PubMed

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  12. SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

    PubMed Central

    Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

    2006-01-01

    Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

  13. SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

    PubMed

    Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

    2006-07-01

    Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

  14. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

    PubMed Central

    Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

    1996-01-01

    In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

  15. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  16. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  17. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae)

    PubMed Central

    2010-01-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499

  18. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

    PubMed

    Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

    2010-04-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  19. S-genotype identification based on allele-specific PCR in Japanese pear

    PubMed Central

    Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya

    2015-01-01

    Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617

  20. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

    PubMed

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-06-01

    Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

  1. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    PubMed

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. A PCR primer bank for quantitative gene expression analysis.

    PubMed

    Wang, Xiaowei; Seed, Brian

    2003-12-15

    Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

  3. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    NASA Astrophysics Data System (ADS)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  4. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    PubMed

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  5. Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

    PubMed

    Campos, Maria Jorge; Quesada, Alberto

    2017-01-01

    PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

  6. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    NASA Astrophysics Data System (ADS)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  7. Development of Species-Specific Primers for Agronomical Thrips and Multiplex Assay for Quarantine Identification of Western Flower Thrips.

    PubMed

    Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

    2014-10-01

    While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.

  8. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  9. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  10. Identification of Lactobacillus alimentarius and Lactobacillus farciminis with 16S-23S rDNA intergenic spacer region polymorphism and PCR amplification using species-specific oligonucleotide.

    PubMed

    Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X

    2003-01-01

    The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.

  11. Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

    PubMed Central

    2014-01-01

    Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

  12. Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

    PubMed Central

    Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

    2006-01-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

  13. Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

    PubMed

    Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

    2006-12-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

  14. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

    PubMed

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-09-29

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

  15. PD5: a general purpose library for primer design software.

    PubMed

    Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

  16. Simple sequence repeat marker loci discovery using SSR primer.

    PubMed

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  17. Development of PCR protocols for specific identification of Clostridium spiroforme and detection of sas and sbs genes.

    PubMed

    Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio

    2008-10-15

    Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.

  18. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    PubMed

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  19. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  20. Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii

    PubMed Central

    Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon

    2005-01-01

    Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482

  1. Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.

    PubMed

    Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun

    2007-10-01

    Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.

  2. Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

    PubMed

    Lee, Chang Soo; Lee, Jiyoung

    2010-09-01

    A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

  3. Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

    USDA-ARS?s Scientific Manuscript database

    Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

  4. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  5. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE PAGES

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

    2014-01-01

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  6. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

    PubMed

    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

    2008-08-01

    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

  7. Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

    PubMed

    Gonzales, J L; Loza, A; Chacon, E

    2006-03-15

    There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

  8. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

    PubMed

    Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

    2007-01-01

    Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

  10. DNA authentication of animal-derived concentrated Chinese medicine granules.

    PubMed

    Jiang, Li-Li; Lo, Yat-Tung; Chen, Wei-Ting; Shaw, Pang-Chui

    2016-09-10

    Concentrated Chinese medicine granules (CCMG) offer patients a convenient option for traditional therapy. However with morphological and microscopic characteristics lost, it is difficult to authenticate and control the quality of these medicinal products. This study is the first to examine the feasibility of using DNA techniques to authenticate animal-derived CCMG, which has so far lacking of effective means for authentication. Primers targeting amplicons of different sizes were designed to determine the presence of PCR-amplifiable DNA fragments in two types of CCMG, namely Zaocys and Scorpio. Species-specific primers were designed to differentiate the genuine drugs from their adulterants. The specificity of the designed primers was evaluated in crude drugs (including genuine and adulterant) and CCMG. Results showed that by using species-specific primers, DNA fragments of less than 200bp could be isolated from the CCMG and the concerned source materials. This study demonstrated the presence of small size DNA in animal-derived CCMG and the DNA is effective in species identification. The work has extended the application of DNA techniques in herbal medicine and this approach may be further developed for quality control and regulatory compliance in the CCMG industry. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Competitive amplification of differentially melting amplicons (CADMA) enables sensitive and direct detection of all mutation types by high-resolution melting analysis.

    PubMed

    Kristensen, Lasse S; Andersen, Gitte B; Hager, Henrik; Hansen, Lise Lotte

    2012-01-01

    Sensitive and specific mutation detection is of particular importance in cancer diagnostics, prognostics, and individualized patient treatment. However, the majority of molecular methodologies that have been developed with the aim of increasing the sensitivity of mutation testing have drawbacks in terms of specificity, convenience, or costs. Here, we have established a new method, Competitive Amplification of Differentially Melting Amplicons (CADMA), which allows very sensitive and specific detection of all mutation types. The principle of the method is to amplify wild-type and mutated sequences simultaneously using a three-primer system. A mutation-specific primer is designed to introduce melting temperature decreasing mutations in the resulting mutated amplicon, while a second overlapping primer is designed to amplify both wild-type and mutated sequences. When combined with a third common primer very sensitive mutation detection becomes possible, when using high-resolution melting (HRM) as detection platform. The introduction of melting temperature decreasing mutations in the mutated amplicon also allows for further mutation enrichment by fast coamplification at lower denaturation temperature PCR (COLD-PCR). For proof-of-concept, we have designed CADMA assays for clinically relevant BRAF, EGFR, KRAS, and PIK3CA mutations, which are sensitive to, between 0.025% and 0.25%, mutated alleles in a wild-type background. In conclusion, CADMA enables highly sensitive and specific mutation detection by HRM analysis. © 2011 Wiley Periodicals, Inc.

  12. DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

    PubMed

    Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

    2009-01-01

    * At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

  13. Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.

    PubMed

    Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo

    2017-05-28

    Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.

  14. Data in support of qPCR primer design and verification in a Pink1 -/- rat model of Parkinson disease.

    PubMed

    Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R

    2016-09-01

    Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].

  15. A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

    PubMed

    van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

    2008-09-01

    To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

  16. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    PubMed Central

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  17. Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

    PubMed

    Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

    2018-02-01

    The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

  18. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

    PubMed Central

    David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

    2017-01-01

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

  19. Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

    PubMed

    Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

    2014-01-01

    Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

  20. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  1. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

    PubMed Central

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-01-01

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

  2. [A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

    PubMed

    Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

    2013-10-18

    To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

  3. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    PubMed

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Assay Design Affects the Interpretation of T-Cell Receptor Gamma Gene Rearrangements

    PubMed Central

    Cushman-Vokoun, Allison M.; Connealy, Solomon; Greiner, Timothy C.

    2010-01-01

    Interpretation of capillary electrophoresis results derived from multiplexed fluorochrome-labeled primer sets can be complicated by small peaks, which may be incorrectly interpreted as clonal T-cell receptor-γ gene rearrangements. In this report, different assay designs were used to illustrate how design may adversely affect specificity. Ten clinical cases, with subclonal peaks containing one of the two infrequently used joining genes, were identified with a tri-color, one-tube assay. The DNA was amplified with the same NED fluorochrome on all three joining primers, first combined (one-color assay) and then amplified separately using a single NED-labeled joining primer. The single primer assay design shows how insignificant peaks could easily be wrongly interpreted as clonal T-cell receptor-γ gene rearrangements. Next, the performance of the one-tube assay was compared with the two-tube BIOMED-2-based TCRG Gene Clonality Assay in a series of 44 cases. Whereas sensitivity was similar between the two methods (92.9% vs. 96.4%; P = 0.55), specificity was significantly less in the BIOMED-2 assay (87.5% vs. 56.3%; P = 0.049) when a 2× ratio was used to define clonality. Specificity was improved to 81.3% by the use of a 5× peak height ratio (P = 0.626). These findings illustrate how extra caution is needed in interpreting a design with multiple, separate distributions, which is more difficult to interpret than a single distribution assay. PMID:20959612

  5. Technical note: development of a quantitative PCR method for monitoring strain dynamics during yogurt manufacture.

    PubMed

    Miller, D M; Dudley, E G; Roberts, R F

    2012-09-01

    Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. Isolation and characterization of novel microsatellite markers from the sika deer (Cervus nippon) genome.

    PubMed

    Li, Y M; Bai, C Y; Niu, W P; Yu, H; Yang, R J; Yan, S Q; Zhang, J Y; Zhang, M J; Zhao, Z H

    2015-09-28

    Microsatellite markers are widely and evenly distributed, and are highly polymorphic. Rapid and convenient detection through automated analysis means that microsatellite markers are widely used in the construction of plant and animal genetic maps, in quantitative trait loci localization, marker-assisted selection, identification of genetic relationships, and genetic diversity and phylogenetic tree construction. However, few microsatellite markers remain to be isolated. We used streptavidin magnetic beads to affinity-capture and construct a (CA)n microsatellite DNA-enriched library from sika deer. We selected sequences containing more than six repeats to design primers. Clear bands were selected, which were amplified using non-specific primers following PCR amplification to screen polymorphisms in a group of 65 unrelated sika deer. The positive clone rate reached 82.9% by constructing the enriched library, and we then selected positive clones for sequencing. There were 395 sequences with CA repeats, and the CA repeat number was 4-105. We selected sequences containing more than six repeats to design primers, of which 297 pairs were designed. We next selected clear bands and used non-specific primers to amplify following PCR amplification. In total, 245 pairs of primers were screened. We then selected 50 pairs of primers to randomly screen for polymorphisms. We detected 47 polymorphic and 3 monomorphic loci in 65 unrelated sika deer. These newly isolated and characterized microsatellite loci can be used to construct genetic maps and for lineage testing in deer. In addition, they can be used for comparative genomics between Cervidae species.

  7. Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

    PubMed Central

    2014-01-01

    Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

  8. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  9. Multiplex primer prediction software for divergent targets

    PubMed Central

    Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

    2009-01-01

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

  10. Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

    PubMed

    Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

    2013-11-01

    The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

  11. Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

    PubMed Central

    Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

    2013-01-01

    The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

  12. Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

    PubMed Central

    Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

    2005-01-01

    A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

  13. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

    PubMed

    David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

    2017-01-04

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

    PubMed

    Chen, Huaihai; Yu, Fangbo; Shi, Wei

    2016-12-01

    Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  15. [Design of primers to DNA of lactic acid bacteria].

    PubMed

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  16. Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone

    DTIC Science & Technology

    2013-10-01

    and 5’‐GCC AAA TGC AGT TTA AGC TCT GCT‐3’ (antisense). The gene‐specific primers for mouse b‐actin were 5’‐GGC CGT ACC ACT GGC ATC GTG ATG‐ 3...cycles. The gene‐specific primers for CYP24A1 mRNA were 5’‐CGG GTG GAC CAT TTA CAA CTC GG‐3’ (sense) and 5’‐CTC AAC AGG CTC ATT GTC TGT GG‐3’ (antisense...The gene specific designing primers for b‐actinwere 5’‐ GTG CGT GAC ATC AAA GAG‐3’ (sense) and 5’‐GCC ACA GGA TTC CAT ACC‐3’ (antisense). The

  17. Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene.

    PubMed

    Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee

    2007-01-01

    Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.

  18. Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

    PubMed

    Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

    2018-01-01

    Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  19. Identification of root rot fungi in nursery seedlings by nested multiplex PCR.

    PubMed Central

    Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M

    1996-01-01

    The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993

  20. Molecular diagnostic development for begomovirus-betasatellite complexes undergoing diversification: A case study.

    PubMed

    Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad

    2017-09-15

    At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    PubMed

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  2. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

    PubMed

    Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

    2011-05-01

    A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

  3. PrimerZ: streamlined primer design for promoters, exons and human SNPs.

    PubMed

    Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

    2007-07-01

    PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

  4. Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

    PubMed Central

    Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

    2005-01-01

    Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

  5. A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts

    PubMed Central

    Ealba, Erin L.; Schneider, Richard A.

    2013-01-01

    Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056

  6. SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana).

    PubMed

    Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T

    2016-09-01

    To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.

  7. Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

    PubMed

    Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

    2007-10-01

    Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

  8. Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

    PubMed

    Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

    2014-07-01

    In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Detection and identification of genetically modified EE-1 brinjal (Solanum melongena) by single, multiplex and SYBR® real-time PCR.

    PubMed

    Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R

    2013-01-01

    Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.

  10. A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

    NASA Astrophysics Data System (ADS)

    Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

    2015-12-01

    Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

  11. Grapevine fleck virus-like viruses in Vitis.

    PubMed

    Sabanadzovic, S; Abou-Ghanem, N; Castellano, M A; Digiaro, M; Martelli, G P

    2000-01-01

    Two sets of degenerate primers for the specific amplification of 572-575 nt and 386 nt segments of the methyltransferase and RNA- dependent RNA polymerase cistrons of members of the genera Tymovirus and Marafivirus and of the unassigned virus Grapevine fleck virus (GFkV) were designed on the basis of available sequences. These primers were used for amplifying and subsequent cloning and sequencing part of the open reading frame 1 of the genome of GFkV, Grapevine asteroid mosaic-associated virus (GAMaV) and of another previously unreported virus, for which the name Grapevine red globe virus (GRGV) is proposed. Computer-assisted analysis of the amplified genome portions showed that the three grapevine viruses are phylogenetically related with one another and with sequenced tymoviruses and marafiviruses. The relationships with tymoviruses was confirmed by the type of ultrastructural modifications induced in the host cells. RdRp-specific degenerate primers were successfully used for the aspecific detection of the three viruses in crude grapevine sap extracts. Specific virus identification was obtained with RT-PCR using antisense virus-specific primers.

  12. Transcriptional Analysis of In vivo Plasmodium yoelii Liver Stage Gene Expression

    DTIC Science & Technology

    2005-04-26

    reaction was added to a PCR master mix with one of several oligonucleotide primer pairs (Table S6). The primers were designed and the specific conditions ...Koonin EV. Using the COG database to improve gene recognition in complete genomes. Genetica 2000;108:9–17. 26] Florens L, Washburn MP, Raine JD, et al

  13. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    PubMed

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  14. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    PubMed Central

    2012-01-01

    Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

  15. XX/XY Sex Chromosomes in the South American Dwarf Gecko (Gonatodes humeralis).

    PubMed

    Gamble, Tony; McKenna, Erin; Meyer, Wyatt; Nielsen, Stuart V; Pinto, Brendan J; Scantlebury, Daniel P; Higham, Timothy E

    2018-05-11

    Sex-specific genetic markers identified using restriction site-associated DNA sequencing, or RADseq, permits the recognition of a species' sex chromosome system in cases where standard cytogenetic methods fail. Thus, species with male-specific RAD markers have an XX/XY sex chromosome system (male heterogamety) while species with female-specific RAD markers have a ZZ/ZW sex chromosome (female heterogamety). Here, we use RADseq data from 5 male and 5 female South American dwarf geckos (Gonatodes humeralis) to identify an XX/XY sex chromosome system. This is the first confidently known sex chromosome system in a Gonatodes species. We used a low-coverage de novo G. humeralis genome assembly to design PCR primers to validate the male-specificity of a subset of the sex-specific RADseq markers and describe how even modest genome assemblies can facilitate the design of sex-specific PCR primers in species with diverse sex chromosome systems.

  16. Development of a molecular approach to describe the composition of Trichoderma communities.

    PubMed

    Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele

    2010-01-01

    Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.

  17. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    PubMed Central

    Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru

    2005-01-01

    Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082

  18. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  19. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  20. Identification and authentication of Rosa species through development of species-specific SCAR marker(s).

    PubMed

    Bashir, K M I; Awan, F S; Khan, I A; Khan, A I; Usman, M

    2014-05-30

    Roses (Rosa indica) belong to one of the most crucial groups of plants in the floriculture industry. Rosa species have special fragrances of interest to the perfume and pharmaceutical industries. The genetic diversity of plants based on morphological characteristics is difficult to measure under natural conditions due to the influence of environmental factors, which is why a reliable fingerprinting method was developed to overcome this problem. The development of molecular markers will enable the identification of Rosa species. In the present study, randomly amplified polymorphic DNA (RAPD) analysis was done on four Rosa species, Rosa gruss-an-teplitz (Surkha), Rosa bourboniana, Rosa centifolia, and Rosa damascena. A polymorphic RAPD fragment of 391 bp was detected in R. bourboniana, which was cloned, purified, sequenced, and used to design a pair of species-specific sequence-characterized amplified region (SCAR) primers (forward and reverse). These SCAR primers were used to amplify the specific regions of the rose genome. These PCR amplifications with specific primers are less sensitive to reaction conditions, and due to their high reproducibility, these species-specific SCAR primers can be used for marker-assisted selection and identification of Rosa species.

  1. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

    PubMed

    Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

    2012-01-01

    An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.

  2. Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.

    PubMed

    Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam

    2013-01-01

    There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.

  3. Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

    PubMed

    Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

    2017-08-01

    Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

  4. Use of species-specific PCR for the identification of 10 sea cucumber species

    NASA Astrophysics Data System (ADS)

    Wen, Jing; Zeng, Ling

    2014-11-01

    We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

  5. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  6. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    PubMed Central

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  7. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  8. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    PubMed

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  9. A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

    PubMed

    Kemp, S J; Maillard, J C; Teale, A J

    1993-04-01

    A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

  10. Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

    PubMed Central

    Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

    2013-01-01

    Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

  11. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    PubMed

    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

  12. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

  13. Identification of hare meat by a species-specific marker of mitochondrial origin.

    PubMed

    Santos, Cristina G; Melo, Vitor S; Amaral, Joana S; Estevinho, Letícia; Oliveira, M Beatriz P P; Mafra, Isabel

    2012-03-01

    Meat species identification in food has gained increasing interest in recent years due to public health, economic and legal concerns. Following the consumer trend towards high quality products, game meat has earned much attention. The aim of the present work was to develop a DNA-based technique able to identify hare meat. Mitochondrial cytochrome b gene was used to design species-specific primers for hare detection. The new primers proved to be highly specific to Lepus species, allowing the detection of 0.01% of hare meat in pork meat by polymerase chain reaction (PCR). A real-time PCR assay with the new intercalating EvaGreen dye was further proposed as a specific and fast tool for hare identification with increased sensitivity (1pg) compared to end-point PCR (10pg). It can be concluded that the proposed new primers can be used by both species-specific end-point PCR or real-time PCR to accurately authenticate hare meat. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. A Novel Real-Time PCR Assay of microRNAs Using S-Poly(T), a Specific Oligo(dT) Reverse Transcription Primer with Excellent Sensitivity and Specificity

    PubMed Central

    Kang, Kang; Zhang, Xiaoying; Liu, Hongtao; Wang, Zhiwei; Zhong, Jiasheng; Huang, Zhenting; Peng, Xiao; Zeng, Yan; Wang, Yuna; Yang, Yi; Luo, Jun; Gou, Deming

    2012-01-01

    Background MicroRNAs (miRNAs) are small, non-coding RNAs capable of postranscriptionally regulating gene expression. Accurate expression profiling is crucial for understanding the biological roles of miRNAs, and exploring them as biomarkers of diseases. Methodology/Principal Findings A novel, highly sensitive, and reliable miRNA quantification approach,termed S-Poly(T) miRNA assay, is designed. In this assay, miRNAs are subjected to polyadenylation and reverse transcription with a S-Poly(T) primer that contains a universal reverse primer, a universal Taqman probe, an oligo(dT)11 sequence and six miRNA-specific bases. Individual miRNAs are then amplified by a specific forward primer and a universal reverse primer, and the PCR products are detected by a universal Taqman probe. The S-Poly(T) assay showed a minimum of 4-fold increase in sensitivity as compared with the stem-loop or poly(A)-based methods. A remarkable specificity in discriminating among miRNAs with high sequence similarity was also obtained with this approach. Using this method, we profiled miRNAs in human pulmonary arterial smooth muscle cells (HPASMC) and identified 9 differentially expressed miRNAs associated with hypoxia treatment. Due to its outstanding sensitivity, the number of circulating miRNAs from normal human serum was significantly expanded from 368 to 518. Conclusions/Significance With excellent sensitivity, specificity, and high-throughput, the S-Poly(T) method provides a powerful tool for miRNAs quantification and identification of tissue- or disease-specific miRNA biomarkers. PMID:23152780

  15. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

    PubMed Central

    2013-01-01

    Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

  16. Plastid primers for angiosperm phylogenetics and phylogeography.

    PubMed

    Prince, Linda M

    2015-06-01

    PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

  17. Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

    DTIC Science & Technology

    1990-01-30

    bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

  18. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

    PubMed Central

    Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

    2016-01-01

    Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

  20. Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR

    PubMed Central

    Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam

    2013-01-01

    There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209

  1. Primer3_masker: integrating masking of template sequence with primer design software.

    PubMed

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  2. Development and Validation of Broad-Range Qualitative and Clade-Specific Quantitative Molecular Probes for Assessing Mercury Methylation in the Environment.

    PubMed

    Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A

    2016-10-01

    Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.

  3. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    PubMed Central

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  4. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    PubMed

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  5. Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

    PubMed

    Kokosková, B; Mráz, I; Fousek, J

    2010-05-01

    Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

  6. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  7. Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities.

    PubMed

    Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

    2014-11-01

    Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.

  8. Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities* #

    PubMed Central

    Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

    2014-01-01

    Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789

  9. Molecular detection of native and invasive marine invertebrate larvae present in ballast and open water environmental samples collected in Puget Sound

    USGS Publications Warehouse

    Harvey, J.B.J.; Hoy, M.S.; Rodriguez, R.J.

    2009-01-01

    Non-native marine species have been and continue to be introduced into Puget Sound via several vectors including ship's ballast water. Some non-native species become invasive and negatively impact native species or near shore habitats. We present a new methodology for the development and testing of taxon specific PCR primers designed to assess environmental samples of ocean water for the presence of native and non-native bivalves, crustaceans and algae. The intergenic spacer regions (IGS; ITS1, ITS2 and 5.8S) of the ribosomal DNA were sequenced for adult samples of each taxon studied. We used these data along with those available in Genbank to design taxon and group specific primers and tested their stringency against artificial populations of plasmid constructs containing the entire IGS region for each of the 25 taxa in our study, respectively. Taxon and group specific primer sets were then used to detect the presence or absence of native and non-native planktonic life-history stages (propagules) from environmental samples of ballast water and plankton tow net samples collected in Puget Sound. This methodology provides an inexpensive and efficient way to test the discriminatory ability of taxon specific oligonucleotides (PCR primers) before creating molecular probes or beacons for use in molecular ecological applications such as probe hybridizations or microarray analyses. This work addresses the current need to develop molecular tools capable of diagnosing the presence of planktonic life-history stages from non-native marine species (potential invaders) in ballast water and other environmental samples. ?? 2008 Elsevier B.V.

  10. Alignment-Free Design of Highly Discriminatory Diagnostic Primer Sets for Escherichia coli O104:H4 Outbreak Strains

    PubMed Central

    Bielaszewska, Martina; Karch, Helge; Toth, Ian K.

    2012-01-01

    Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact. PMID:22496820

  11. Species-Specific Detection of Mycosphaerella polygoni-cuspidati as a Biological Control Agent for Fallopia japonica by PCR Assay.

    PubMed

    Kurose, Daisuke; Furuya, Naruto; Saeki, Tetsuya; Tsuchiya, Kenichi; Tsushima, Seiya; Seier, Marion K

    2016-10-01

    The ascomycete fungus Mycosphaerella polygoni-cuspidati has been undergoing evaluation as a potential classical biological control agent for the invasive weed Fallopia japonica (Japanese knotweed), which has become troublesome in Europe and North America. In advance of the potential release of a biocontrol agent into a new environment, it is crucial to develop an effective monitoring system to enable the evaluation of agent establishment and dispersal within the target host population, as well as any potential attacks on non-target species. Therefore, a primer pair was designed for direct, rapid, and specific detection of the Japanese knotweed pathogen M. polygoni-cuspidati based on the sequences of the internal transcribed spacer regions including the 5.8S rDNA. A PCR product of approximately 298 bp was obtained only when the DNA extracted from mycelial fragments of M. polygoni-cuspidati was used. The lower limit of detection of the PCR method was 100 fg of genomic DNA. Using the specific primer pair, M. polygoni-cuspidati could be detected from both naturally and artificially infected Japanese knotweed plants. No amplification was observed for other Mycosphaerella spp. or fungal endophytes isolated from F. japonica. The designed primer pair is thus effective for the specific detection of M. polygoni-cuspidati in planta.

  12. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    PubMed

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  13. Detection of two fungal biocontrol agents against root-knot nematodes by RAPD markers.

    PubMed

    Zhu, Ming Liang; Mo, Ming He; Xia, Zhen Yuan; Li, Yun Hua; Yang, Shu Jun; Li, Tian Fei; Zhang, Ke Qin

    2006-05-01

    The strain ZK7 of Pochonia chlamydosporia var. chlamydosporia and IPC of Paecilomyces lilacinus are highly effective in the biological control against root-knot nematodes infecting tobacco. When applied, they require a specific monitoring method to evaluate the colonization and dispersal in soil. In this work, the randomly amplified polymorphic DNA (RAPD) technique was used to differentiate between the two individual strains and 95 other isolates, including isolates of the same species and common soil fungi. This approach allowed the selection of specific fragments of 1.2 kb (Vc1200) and 2.0 kb (Vc2000) specific for ZK7, 1.4 kb (P1400) and 0.85 kb (P850) specific for IPC, using the random Primers OPL-02, OPD-05, OPD-05 and OPC-11, respectively. These fragments were cloned, sequenced, and used to design sequence-characterized amplification region (SCAR) primers specific for the two strains. In classical polymerase chain reaction (PCR), with serial dilution of ZK7 and IPC pure culture DNAs template, the detection limits of these oligonucleotide SCAR-PCR primers were found to be 10, 1000, 500, 100 pg, respectively. In the dot blotting, digoxigenin (DIG)-labeled amplicons from these four primers specifically recognized the corresponding fragments in the DNAs template of these two strains. The detection limit of these amplicons were 0.2, 0.2, 0.5, 0.5 mug, respectively.

  14. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    PubMed

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  15. Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

    PubMed

    Boehm; Gibson; Lubzens

    2000-01-01

    This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

  16. Use of novel species-specific PCR primers targeted to DNA gyrase subunit B (gyrB) gene for species identification of the Cronobacter sakazakii and Cronobacter dublinensis.

    PubMed

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina

    2013-02-01

    Cronobacter sakazakii and its phylogenetically closest species are considered to be an opportunistic pathogens associated with food-borne disease in neonates and infants. Neither phenotypic nor genotypic (16S ribosomal DNA sequence analysis) techniques can provide sufficient resolutions for accurately and rapidly identification of these species. The objective of this study was to develop species-specific PCR based on the gyrB gene sequence for direct species identification of the C. sakazakii and Cronobacter dublinensis within the C. sakazakii group. Two pair of species-specific primers were designed and used to specifically identify C. sakazakii and C. dublinensis, but none of the other C. sakazakii group strains. Our data indicate that the novel species-specific primers could be used to rapidly and accurately identify the species of C. sakazakii and C. dublinensis from C. sakazakii group by the PCR based assays. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

    PubMed Central

    Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

    2005-01-01

    Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

  18. Consensus-Degenerate Hybrid Oligonucleotide Primers for Amplification of Priming Glycosyltransferase Genes of the Exopolysaccharide Locus in Strains of the Lactobacillus casei Group

    PubMed Central

    Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis

    2003-01-01

    A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729

  19. Use of a Hierarchical Oligonucleotide Primer Extension Approach for Multiplexed Relative Abundance Analysis of Methanogens in Anaerobic Digestion Systems

    PubMed Central

    Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu

    2013-01-01

    In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716

  20. Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

    PubMed

    Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

    2015-08-01

    Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.

    Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

  2. Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

    DOE PAGES

    Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...

    2016-07-15

    Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

  3. Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

    PubMed

    Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

    2016-09-01

    Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

  4. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-01-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  5. Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

    PubMed

    Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

    2015-08-14

    In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.

  6. [Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].

    PubMed

    Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun

    2009-10-01

    To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.

  7. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

    PubMed Central

    Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-01-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  8. PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

    PubMed Central

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the discovery of complex patterns in gene expression of soil fungal communities. PMID:25545363

  9. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    PubMed

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  10. Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers

    PubMed Central

    Levin, Joshua D.; Fiala, Dean; Samala, Meinrado F.; Kahn, Jason D.; Peterson, Raymond J.

    2006-01-01

    Genomes are becoming heavily annotated with important features. Analysis of these features often employs oligonucleotides that hybridize at defined locations. When the defined location lies in a poor sequence context, traditional design strategies may fail. Locked Nucleic Acid (LNA) can enhance oligonucleotide affinity and specificity. Though LNA has been used in many applications, formal design rules are still being defined. To further this effort we have investigated the effect of LNA on the performance of sequencing and PCR primers in AT-rich regions, where short primers yield poor sequencing reads or PCR yields. LNA was used in three positional patterns: near the 5′ end (LNA-5′), near the 3′ end (LNA-3′) and distributed throughout (LNA-Even). Quantitative measures of sequencing read length (Phred Q30 count) and real-time PCR signal (cycle threshold, CT) were characterized using two-way ANOVA. LNA-5′ increased the average Phred Q30 score by 60% and it was never observed to decrease performance. LNA-5′ generated cycle thresholds in quantitative PCR that were comparable to high-yielding conventional primers. In contrast, LNA-3′ and LNA-Even did not improve read lengths or CT. ANOVA demonstrated the statistical significance of these results and identified significant interaction between the positional design rule and primer sequence. PMID:17071964

  11. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

    PubMed Central

    Bokulich, Nicholas A.

    2013-01-01

    Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

  12. A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

    PubMed

    Bisset, S A; Knight, J S; Bouchet, C L G

    2014-02-24

    A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    PubMed

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  14. Designer proton-channel transgenic algae for photobiological hydrogen production

    DOEpatents

    Lee, James Weifu [Knoxville, TN

    2011-04-26

    A designer proton-channel transgenic alga for photobiological hydrogen production that is specifically designed for production of molecular hydrogen (H.sub.2) through photosynthetic water splitting. The designer transgenic alga includes proton-conductive channels that are expressed to produce such uncoupler proteins in an amount sufficient to increase the algal H.sub.2 productivity. In one embodiment the designer proton-channel transgene is a nucleic acid construct (300) including a PCR forward primer (302), an externally inducible promoter (304), a transit targeting sequence (306), a designer proton-channel encoding sequence (308), a transcription and translation terminator (310), and a PCR reverse primer (312). In various embodiments, the designer proton-channel transgenic algae are used with a gas-separation system (500) and a gas-products-separation and utilization system (600) for photobiological H.sub.2 production.

  15. Implementation of Novel Design Features for qPCR-Based eDNA Assessment

    PubMed Central

    Veldhoen, Nik; Hobbs, Jared; Ikonomou, Georgios; Hii, Michael; Lesperance, Mary; Helbing, Caren C.

    2016-01-01

    Environmental stewardship requires timely, accurate information related to the status of a given ecosystem and the species that occupy it. Recent advances in the application of the highly sensitive real-time quantitative polymerase chain reaction (qPCR) towards identification of constituents within environmental DNA (eDNA) now allow targeted detection of the presence of species-specific biological material within a localized geographic region. However, as with all molecular techniques predicated on the specificity and sensitivity of the PCR assay, careful validation of each eDNA qPCR assay in development must be performed both under controlled laboratory conditions and when challenged with field-derived eDNA samples. Such a step-wise approach forms the basis for incorporation of innovative qPCR design features that strengthen the implementation and interpretation of the eDNA assay. This includes empirical determination that the qPCR assay is refractory to the presence of human DNA and the use of a tripartite assay approach comprised of 1) a primer set targeting plant chloroplast that evaluates the presence of amplifiable DNA from field samples to increase confidence in a negative result, 2) an animal group primer set to increase confidence in the assay result, and 3) a species-specific primer set to assess presence of DNA from the target species. To demonstrate this methodology, we generated eDNA assays specific for the North American bullfrog (Lithobates (Rana) catesbeiana) and the Rocky Mountain tailed frog (Ascaphus montanus) and characterized each with respect to detection sensitivity and specificity with demonstrated performance in a field survey scenario. The qPCR design features presented herein address specific challenges of eDNA assays thereby increasing their interpretative power. PMID:27802293

  16. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    PubMed

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-08

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    PubMed

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Multiplex real-time PCR assay for Legionella species.

    PubMed

    Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

    2015-12-01

    Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.

    PubMed

    Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q

    2007-01-01

    Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.

  20. Development of a polymerase chain reaction assay for the specific identification of Burkholderia mallei and differentiation from Burkholderia pseudomallei and other closely related Burkholderiaceae.

    PubMed

    Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David

    2006-05-01

    Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.

  1. Feed-in Tariffs: Good Practices and Design Considerations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cox, Sadie; Esterly, Sean

    2016-01-02

    In recent years, feed-in tariff (FIT) activity has focused primarily on revisions to current policies, underscoring the need for stable and predictable, yet flexible, policy environments. This policy brief provides a primer on key FIT design elements, lessons from country experience, and support resources to enable more detailed and country-specific FIT policy design.

  2. Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes.

    PubMed

    Treder, Krzysztof; Chołuj, Joanna; Zacharzewska, Bogumiła; Babujee, Lavanya; Mielczarek, Mateusz; Burzyński, Adam; Rakotondrafara, Aurélie M

    2018-02-01

    Potato virus Y (PVY) infection has been a global challenge for potato production and the leading cause of downgrading and rejection of seed crops for certification. Accurate and timely diagnosis is a key for effective disease control. Here, we have optimized a reverse transcription loop-mediated amplification (RT-LAMP) assay to differentiate the PVY O and N serotypes. The RT-LAMP assay is based on isothermal autocyclic strand displacement during DNA synthesis. The high specificity of this method relies heavily on the primer sets designed for the amplification of the targeted regions. We designed specific primer sets targeting a region within the coat protein gene that contains nucleotide signatures typical for O and N coat protein types, and these primers differ in their annealing temperature. Combining this assay with total RNA extraction by magnetic capture, we have established a highly sensitive, simplified and shortened RT-LAMP procedure as an alternative to conventional nucleic acid assays for diagnosis. This optimized procedure for virus detection may be used as a preliminary test for identifying the viral serotype prior to investing time and effort in multiplex RT-PCR tests when a specific strain is needed.

  3. Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

    PubMed

    Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

    2013-03-01

    Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  4. Primer design for a prokaryotic differential display RT-PCR.

    PubMed Central

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-01-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

  5. Primer design for a prokaryotic differential display RT-PCR.

    PubMed

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  6. Evaluation of the PCR method for identification of Bifidobacterium species.

    PubMed

    Youn, S Y; Seo, J M; Ji, G E

    2008-01-01

    Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

  7. Detection of unculturable bacteria in periodontal health and disease by PCR.

    PubMed

    Harper-Owen, R; Dymock, D; Booth, V; Weightman, A J; Wade, W G

    1999-05-01

    Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease.

  8. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  9. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    PubMed Central

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-01-01

    Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974

  10. A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.

    PubMed

    Murata, C; Ogura, G; Kuroiwa, A

    2011-03-01

    To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.

  11. Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR

    PubMed Central

    Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam

    2017-01-01

    Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824

  12. Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR.

    PubMed

    Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W

    2017-01-01

    Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.

  13. Molecular diagnosis of group B coltiviruses infections.

    PubMed

    Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X

    1999-08-01

    The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.

  14. SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

    PubMed Central

    2013-01-01

    Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

  15. Hindering the illegal trade in dog and cat furs through a DNA-based protocol for species identification.

    PubMed

    Garofalo, Luisa; Mariacher, Alessia; Fanelli, Rita; Fico, Rosario; Lorenzini, Rita

    2018-01-01

    In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.

  16. A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

    PubMed

    Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

    2015-07-01

    Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  17. PRISE2: software for designing sequence-selective PCR primers and probes.

    PubMed

    Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

    2014-09-25

    PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

  18. Phylogenetic analysis of bacterial and archaeal species in symptomatic and asymptomatic endodontic infections.

    PubMed

    Vickerman, M M; Brossard, K A; Funk, D B; Jesionowski, A M; Gill, S R

    2007-01-01

    Phylogenetic analysis of bacterial and archaeal 16S rRNA was used to examine polymicrobial communities within infected root canals of 20 symptomatic and 14 asymptomatic patients. Nucleotide sequences from approximately 750 clones amplified from each patient group with universal bacterial primers were matched to the Ribosomal Database Project II database. Phylotypes from 37 genera representing Actinobacteria, Bacteroidetes, Firmicutes, Fusobacteria and Proteobacteria were identified. Results were compared to those obtained with species-specific primers designed to detect Prevotella intermedia, Porphyromonas gingivalis, Porphyromonas endodontalis, Peptostreptococcus micros, Enterococcus sp., Streptococcus sp., Fusobacterium nucleatum, Tannerella forsythensis and Treponema denticola. Since members of the domain Archaea have been implicated in the severity of periodontal disease, and a recent report confirms that archaea are present in endodontic infections, 16S archaeal primers were also used to detect which patients carried these prokaryotes, to determine if their presence correlated with severity of the clinical symptoms. A Methanobrevibacter oralis-like species was detected in one asymptomatic and one symptomatic patient. DNA from root canals of these two patients was further analysed using species-specific primers to determine bacterial cohabitants. Trep. denticola was detected in the asymptomatic but not the symptomatic patient. Conversely, Porph. endodontalis was found in the symptomatic but not the asymptomatic patient. All other species except enterococci were detected with the species-specific primers in both patients. These results confirm the presence of archaea in root canals and provide additional insights into the polymicrobial communities in endodontic infections associated with clinical symptoms.

  19. Development of loop-mediated isothermal amplification with Plasmodium falciparum unique genes for molecular diagnosis of human malaria.

    PubMed

    Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian

    2017-07-01

    In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a promising tool for diagnosis of P. falciparum infection.

  20. Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

    PubMed

    Winn-Deen

    1998-12-01

    Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.

  1. Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

    PubMed

    Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

    2016-11-22

    Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

  2. DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan.

    PubMed

    Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro

    2016-10-11

    Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.

  3. Development of loop-mediated isothermal amplification (LAMP) assays for the rapid detection of allergic peanut in processed food.

    PubMed

    Sheu, Shyang-Chwen; Tsou, Po-Chuan; Lien, Yi-Yang; Lee, Meng-Shiou

    2018-08-15

    Peanut is a widely and common used in many cuisines around the world. However, peanut is also one of the most important food allergen for causing anaphylactic reaction. To prevent allergic reaction, the best way is to avoid the food allergen or food containing allergic ingredient such as peanut before food consuming. Thus, to efficient and precisely detect the allergic ingredient, peanut or related product, is essential and required for maintain consumer's health or their interest. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of allergic peanut using specifically designed primer sets. Two sets of the specific LAMP primers respectively targeted the internal transcribed sequence 1 (ITS1) of nuclear ribosomal DNA sequence regions and the ara h1 gene sequence of Arachia hypogeae (peanut) were used to address the application of LAMP for detecting peanut in processed food or diet. The results demonstrated that the identification of peanut using the newly designed primers for ITS 1 sequence is more sensitive rather than primers for sequence of Ara h1 gene when performing LAMP assay. Besides, the sensitivity of LAMP for detecting peanut is also higher than the traditional PCR method. These LAMP primers sets showed high specificity for the identification of the peanut and had no cross-reaction to other species of nut including walnut, hazelnut, almonds, cashew and macadamia nut. Moreover, when minimal 0.1% peanuts were mixed with other nuts ingredients at different ratios, no any cross-reactivity was evident during performing LAMP. Finally, genomic DNAs extracted from boiled and steamed peanut were used as templates; the detection of peanut by LAMP was not affected and reproducible. As to this established LAMP herein, not only can peanut ingredients be detected but commercial foods containing peanut can also be identified. This assay will be useful and potential for the rapid detection of peanut in practical food markets. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    PubMed

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  5. Evaluation of LSSP-PCR for identification of Leptospira spp. in urine samples of cattle with clinical suspicion of leptospirosis.

    PubMed

    Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota

    2006-12-20

    We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.

  6. Methylation-Sensitive High Resolution Melting (MS-HRM).

    PubMed

    Hussmann, Dianna; Hansen, Lise Lotte

    2018-01-01

    Methylation-Sensitive High Resolution Melting (MS-HRM) is an in-tube, PCR-based method to detect methylation levels at specific loci of interest. A unique primer design facilitates a high sensitivity of the assays enabling detection of down to 0.1-1% methylated alleles in an unmethylated background.Primers for MS-HRM assays are designed to be complementary to the methylated allele, and a specific annealing temperature enables these primers to anneal both to the methylated and the unmethylated alleles thereby increasing the sensitivity of the assays. Bisulfite treatment of the DNA prior to performing MS-HRM ensures a different base composition between methylated and unmethylated DNA, which is used to separate the resulting amplicons by high resolution melting.The high sensitivity of MS-HRM has proven useful for detecting cancer biomarkers in a noninvasive manner in urine from bladder cancer patients, in stool from colorectal cancer patients, and in buccal mucosa from breast cancer patients. MS-HRM is a fast method to diagnose imprinted diseases and to clinically validate results from whole-epigenome studies. The ability to detect few copies of methylated DNA makes MS-HRM a key player in the quest for establishing links between environmental exposure, epigenetic changes, and disease.

  7. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  8. Improving qPCR methodology for detection of foaming bacteria by analysis of broad-spectrum primers and a highly specific probe for quantification of Nocardia spp. in activated sludge.

    PubMed

    Asvapathanagul, P; Olson, B H

    2017-01-01

    To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.

  9. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    PubMed

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  10. Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

    PubMed Central

    Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

    2012-01-01

    A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

  11. Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

    PubMed

    Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

    2012-08-01

    A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

  12. [Mapping of seedlessness gene in grapes using SCAR markers].

    PubMed

    Yang, Ke-Qiang; Wang, Yue-Jin; Zhang, Jin-Jin; Wang, Xi-Ping; W A N, Yi-Zhen; Zhang, Jian-Xia

    2005-03-01

    Nine primers (including UBC-269 and GSLP1) were designed and synthesized based on DNA sequences of UBC-269(484) and GSLP1(569). The template DNA from Red Globe (seeded paternal parent) and Flame Seedless (seedless maternal parent) were screened using these primers. For Flame Seedless,GSLP1 yielded specific marker GSLP1(569); No. 39970524-5 primer yielded specific marker 39970524-5-564; and No. 6 primer yielded specific marker 39970524-6-1538 and 39970524-6-1200. GSLP1, No. 39970524-5, and No. 39970524-6 primers were used specifically to screen template DNA from the experimental plant materials. The results showed that the specific markers GSLP1(569), 39970524-5-564,39970524-6-1538 and 39970524-6-1200 were cosegregating with the major seedlessness gene. All these specific loci were also present in Thompson Seedless which was the initial donor of the seedlessness gene. It suggests that these SCAR markers are linked to a major grape seedlessness gene S. Markers order and map distance were estimated using the software 'QTXb17'. This showed that GSLP1(569), 39970524-5-564,39970524-6-1538 and 39970524-6-1200 were tightly linked to gene S. When P = 0.01,confidence limits for map distance ranged from 0.2 to 9.9; standard errors of map distance were from 0.6 to 1.9; LOD for linkage were from 32.7 to 46.4. These markers and the gene S were found to be in the same group. The markers were located on either side of gene S, covering 12.3 cM of the grape genome. The genetic distances between gene S and 39970524-5-564, GSLP1(569), 39970524-6-1538 and 39970524-6-1200 were 0.6 cM, 1.2 cM, 4.9 cM and 11.1 cM respectively.

  13. A novel non-sequencing approach for rapid authentication of Testudinis Carapax et Plastrum and Trionycis Carapax by species-specific primers

    PubMed Central

    Yu, Pingtian; Lu, Yi; Jiao, Zhaoqun; Chen, Liqun; Zhou, Ying; Shen, Yuping; Jia, Xiaobin

    2018-01-01

    A novel non-sequencing approach was developed to detect short DNA fragments (ca 100 bp) for rapid authentication of two natural products, namely Testudinis Carapax et Plastrum and Trionycis Carapax, based on the difference in mitochondrial genome. Five specifically designed primer reactions were established to target species for reliable identification of their commercial products. They were confirmed to have a high level of inter-species-specificity and good intra-species stability. The limit of detection was estimated to be 1 ng of genomes for all of five assays. Also, the validation results demonstrated that the raw materials and processed products in addition to some of the highly processed products can be conveniently authenticated with good sensitivity and precision by this newly proposed approach. Especially, when reference sample mixtures were assayed, these primer sets have still performed well but not the prevailing COI barcoding technology. These could assist in the discrimination and identification of other animal-derived medicines for their form of raw material, the pulverized and the complex. PMID:29765667

  14. Rapid and accurate identification of Mycobacterium tuberculosis complex and common non-tuberculous mycobacteria by multiplex real-time PCR targeting different housekeeping genes.

    PubMed

    Nasr Esfahani, Bahram; Rezaei Yazdi, Hadi; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Zarkesh Esfahani, Hamid

    2012-11-01

    Rapid and accurate identification of mycobacteria isolates from primary culture is important due to timely and appropriate antibiotic therapy. Conventional methods for identification of Mycobacterium species based on biochemical tests needs several weeks and may remain inconclusive. In this study, a novel multiplex real-time PCR was developed for rapid identification of Mycobacterium genus, Mycobacterium tuberculosis complex (MTC) and the most common non-tuberculosis mycobacteria species including M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and the M. gordonae in three reaction tubes but under same PCR condition. Genetic targets for primer designing included the 16S rDNA gene, the dnaJ gene, the gyrB gene and internal transcribed spacer (ITS). Multiplex real-time PCR was setup with reference Mycobacterium strains and was subsequently tested with 66 clinical isolates. Results of multiplex real-time PCR were analyzed with melting curves and melting temperature (T (m)) of Mycobacterium genus, MTC, and each of non-tuberculosis Mycobacterium species were determined. Multiplex real-time PCR results were compared with amplification and sequencing of 16S-23S rDNA ITS for identification of Mycobacterium species. Sensitivity and specificity of designed primers were each 100 % for MTC, M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and M. gordonae. Sensitivity and specificity of designed primer for genus Mycobacterium was 96 and 100 %, respectively. According to the obtained results, we conclude that this multiplex real-time PCR with melting curve analysis and these novel primers can be used for rapid and accurate identification of genus Mycobacterium, MTC, and the most common non-tuberculosis Mycobacterium species.

  15. Merlin: Computer-Aided Oligonucleotide Design for Large Scale Genome Engineering with MAGE.

    PubMed

    Quintin, Michael; Ma, Natalie J; Ahmed, Samir; Bhatia, Swapnil; Lewis, Aaron; Isaacs, Farren J; Densmore, Douglas

    2016-06-17

    Genome engineering technologies now enable precise manipulation of organism genotype, but can be limited in scalability by their design requirements. Here we describe Merlin ( http://merlincad.org ), an open-source web-based tool to assist biologists in designing experiments using multiplex automated genome engineering (MAGE). Merlin provides methods to generate pools of single-stranded DNA oligonucleotides (oligos) for MAGE experiments by performing free energy calculation and BLAST scoring on a sliding window spanning the targeted site. These oligos are designed not only to improve recombination efficiency, but also to minimize off-target interactions. The application further assists experiment planning by reporting predicted allelic replacement rates after multiple MAGE cycles, and enables rapid result validation by generating primer sequences for multiplexed allele-specific colony PCR. Here we describe the Merlin oligo and primer design procedures and validate their functionality compared to OptMAGE by eliminating seven AvrII restriction sites from the Escherichia coli genome.

  16. Kinetoplast DNA minicircles of phloem-restricted Phytomonas associated with wilt diseases of coconut and oil palms have a two-domain structure.

    PubMed

    Dollet, M; Sturm, N R; Ahomadegbe, J C; Campbell, D A

    2001-11-27

    We report the cloning and sequencing of the first minicircle from a phloem-restricted, pathogenic Phytomonas sp. (Hart 1) isolated from a coconut palm with hartrot disease. The minicircle possessed a two-domain structure of two conserved regions, each containing three conserved sequence blocks (CSB). Based on the sequence around CSB 3 from Hart 1, PCR primers were designed to allow specific amplification of Phytomonas minicircles. This primer pair demonstrated specificity for at least six groups of plant trypanosomatids and did not amplify from insect trypanosomatids. The PCR results were consistent with a two-domain structure for other plant trypanosomatids.

  17. Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

    PubMed

    Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

    2010-05-01

    A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

  18. Identification of novel serine proteinase gene transcripts in the midguts of two tropical insect pests, Scirpophaga incertulas (Wk.) and Helicoverpa armigera (Hb.).

    PubMed

    Mazumdar-Leighton, S; Babu, C R; Bennett, J

    2000-01-01

    We have used RT PCR and 3'RACE to identify diverse serine proteinase genes expressed in the midguts of the rice yellow stem borer (Scirpophaga incertulas) and Asian corn borer (Helicoverpa armigera). The RT-PCR primers encoded the conserved regions around the active site histidine57 and serine195 of Drosophila melanogaster alpha trypsin, including aspartate189 of the specificity pocket. These primers amplified three transcripts (SiP1-3) from midguts of S. incertulas, and two transcripts (HaP1-2) from midguts of H. armigera. The five RT PCR products were sequenced to permit design of gene-specific forward primers for use with anchored oligo dT primers in 3'RACE. Sequencing of the 3'RACE products indicated that SiP1, SiP2 and HaP1 encoded trypsin-like serine proteinases, while HaP2 encoded a chymotrypsin-like serine proteinases. The SiP3 transcript proved to be an abundant 960 nt mRNA encoding a trypsin-like protein in which the active site serine195 was replaced by aspartate. The possible functions of this unusual protein are discussed.

  19. Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

    PubMed

    Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

    2018-02-07

    We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

  20. RUCS: rapid identification of PCR primers for unique core sequences.

    PubMed

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

    2017-12-15

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  1. Identifying krill eggs in the central California current using novel multiplex PCR primers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Carrion, C. N.; Slesinger, E.; Marinovic, B.

    2016-02-01

    Euphausiids, otherwise known as krill, are an important link between primary producers and higher trophic levels within the central California current upwelling system. Euphausia pacifica and Thysanoessa spinifera, two of the most common euphausiid species along the central California coast, are both broadcast spawners and have some overlap in habitat, e.g. near marine life hotspots like the Monterey Bay and Gulf of Farallones. Species composition of euphausiid egg population within these regions is currently unknown. Distinct morphological differences between their eggs are lost once the egg dies or is preserved via formalin, alcohol, or freezing. In this project we designed genus specific DNA primers (mtCOI) for use in a multiplex PCR to distinguish among spawned euphausiid eggs of Euphausia spp. and Thysanoessa spp. in central California current surface waters. Effective and ineffective application of primers in a multiplex versus single-plex PCR is discussed, with an emphasis on primer design limitations in reference to the available barcoded regions of mitochondrial cytochrome oxidase subunit I (mtCOI) for each species in GenBank. This new protocol expands current monitoring efforts into sampling a non-swimming portion of the population which has the potential to improve euphausiid biomass estimates.

  2. Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

    PubMed

    Kho, S L; Chua, K H; George, E; Tan, J A M A

    2013-07-15

    Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

  3. SMM-system: A mining tool to identify specific markers in Salmonella enterica.

    PubMed

    Yu, Shuijing; Liu, Weibing; Shi, Chunlei; Wang, Dapeng; Dan, Xianlong; Li, Xiao; Shi, Xianming

    2011-03-01

    This report presents SMM-system, a software package that implements various personalized pre- and post-BLASTN tasks for mining specific markers of microbial pathogens. The main functionalities of SMM-system are summarized as follows: (i) converting multi-FASTA file, (ii) cutting interesting genomic sequence, (iii) automatic high-throughput BLASTN searches, and (iv) screening target sequences. The utility of SMM-system was demonstrated by using it to identify 214 Salmonella enterica-specific protein-coding sequences (CDSs). Eighteen primer pairs were designed based on eighteen S. enterica-specific CDSs, respectively. Seven of these primer pairs were validated with PCR assay, which showed 100% inclusivity for the 101 S. enterica genomes and 100% exclusivity of 30 non-S. enterica genomes. Three specific primer pairs were chosen to develop a multiplex PCR assay, which generated specific amplicons with a size of 180bp (SC1286), 238bp (SC1598) and 405bp (SC4361), respectively. This study demonstrates that SMM-system is a high-throughput specific marker generation tool that can be used to identify genus-, species-, serogroup- and even serovar-specific DNA sequences of microbial pathogens, which has a potential to be applied in food industries, diagnostics and taxonomic studies. SMM-system is freely available and can be downloaded from http://foodsafety.sjtu.edu.cn/SMM-system.html. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal.

    PubMed

    Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P

    2002-12-01

    The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at <10(5) CFU/g of cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

  5. Event-specific real-time detection and quantification of genetically modified Roundup Ready soybean.

    PubMed

    Huang, Chia-Chia; Pan, Tzu-Ming

    2005-05-18

    The event-specific real-time detection and quantification of Roundup Ready soybean (RRS) using an ABI PRISM 7700 sequence detection system with light upon extension (LUX) primer was developed in this study. The event-specific primers were designed, targeting the junction of the RRS 5' integration site and the endogenous gene lectin1. Then, a standard reference plasmid was constructed that carried both of the targeted sequences for quantitative analysis. The detection limit of the LUX real-time PCR system was 0.05 ng of 100% RRS genomic DNA, which was equal to 20.5 copies. The range of quantification was from 0.1 to 100%. The sensitivity and range of quantification successfully met the requirement of the labeling rules in the European Union and Taiwan.

  6. Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

    DOEpatents

    McKinney, Nancy

    2002-01-01

    PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

  7. DNA barcoding amphibians and reptiles.

    PubMed

    Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

    2012-01-01

    Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

  8. [SSR loci information analysis in transcriptome of Andrographis paniculata].

    PubMed

    Li, Jun-Ren; Chen, Xiu-Zhen; Tang, Xiao-Ting; He, Rui; Zhan, Ruo-Ting

    2018-06-01

    To study the SSR loci information and develop molecular markers, a total of 43 683 Unigenes in transcriptome of Andrographis paniculata were used to explore SSR. The distribution frequency of SSR and the basic characteristics of repeat motifs were analyzed using MicroSAtellite software, SSR primers were designed by Primer 3.0 software and then validated by PCR. Moreover, the gene function analysis of SSR Unigene was obtained by Blast. The results showed that 14 135 SSR loci were found in the transcriptome of A. paniculata, which distributed in 9 973 Unigenes with a distribution frequency of 32.36%. Di-nucleotide and Tri-nucleotide repeat were the main types, accounted for 75.54% of all SSRs. The repeat motifs of AT/AT and CCG/CGG were the predominant repeat types of Di-nucleotide and Tri-nucleotide, respectively. A total of 4 740 pairs of SSR primers with the potential to produce polymorphism were designed for maker development. Ten pairs of primers in 20 pairs of randomly picked primers produced fragments with expected molecular size. The gene function of Unigenes containing SSR were mostly related to the basic metabolism function of A. paniculata. The SSR markers in transcriptome of A. paniculata show rich type, strong specificity and high potential of polymorphism, which will benefit the candidate gene mining and marker-assisted breeding. Copyright© by the Chinese Pharmaceutical Association.

  9. Amplification of the Gp41 gene for detection of mutations conferring resistance to HIV-1 fusion inhibitors on genotypic assay

    NASA Astrophysics Data System (ADS)

    Tanumihardja, J.; Bela, B.

    2017-08-01

    Fusion inhibitors have potential for future use in HIV control programs in Indonesia, so the capacity to test resistance to such drugs needs to be developed. Resistance-detection with a genotypic assay began with amplification of the target gene, gp41. Based on the sequence of the two most common HIV subtypes in Indonesia, AE and B, a primer pair was designed. Plasma samples containing both subtypes were extracted to obtain HIV RNA. Using PCR, the primer pair was used to produce the amplification product, the identity of which was checked based on length under electrophoresis. Eleven plasma samples were included in this study. One-step PCR using the primer pair was able to amplify gp41 from 54.5% of the samples, and an unspecific amplification product was seen in 1.1% of the samples. Amplification failed in 36.4% of the samples, which may be due to an inappropriate primer sequence. It was also found that the optimal annealing temperature for producing the single expected band was 57.2 °C. With one-step PCR, the designed primer pair amplified the HIV-1 gp41 gene from subtypes AE and B. However, further research should be done to determine the conditions that will increase the sensitivity and specificity of the amplification process.

  10. Two molecular markers based on mitochondrial genomes for varieties identification of the northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids.

    PubMed

    Xincheng, Zhang; Kunci, Chen; Xinping, Zhu; Jian, Zhao; Qing, Luo; Xiaoyou, Hong; Wei, Li; Fengfang, Xiao

    2015-08-01

    The northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids have played important roles in the Chinese freshwater aquaculture industry, with an annual production in China exceeding 400 thousand tons. While these are popular aquaculture breeds in China, it is not easy to identify northern snakehead, blotched snakehead, and their hybrids. Thus, a method should be developed to identify these varieties. To distinguish between the reciprocal hybrids (C. argus ♀ × C. maculata ♂ and C. maculata ♀ × C. argus ♂), the mitochondrial genome sequences of northern snakehead and blotched snakehead and their reciprocal hybrids were compared. Following the alignment and analysis of mtDNA sequences of northern snakehead, blotched snakehead and their hybrids, two pairs of specific primers were designed based on identified differences ranging from 12S rRNA to 16S rRNA gene. The BY1 primers amplified the same bands in the blotched snakehead and the hybrid (C. maculata ♀ × C. argus ♂), while producing no products in northern snakehead and the hybrid (C. argus ♀ × C. maculata ♂). Amplification with WY1 yielded the opposite results. Then, 30 individuals per fish were randomized to verify the primers, and the results showed that the primers were specific for breeds, as intended. The specific primers can not only simply distinguish between two kinds of hybrids, but also rapidly identify the two parents. This study provides a method of molecular marker identification to identify reciprocal hybrids.

  11. CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

    PubMed Central

    Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

    2003-01-01

    We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

  12. Specific detection of bifidobacterium strains in a pharmaceutical probiotic product and in human feces by polymerase chain reaction.

    PubMed

    Brigidi, P; Vitali, B; Swennen, E; Altomare, L; Rossi, M; Matteuzzi, D

    2000-10-01

    For PCR specific detection of the strains Bifidobacterium longum Y 10, B. infantis Y 1 and B. breve Y 8 used in a new probiotic product (VSL-3), strains-specific rDNA primers have been developed. Spacer regions between the 16S and 23S rRNA genes (ITS) of the three strains were amplified by PCR with conserved primers and the nucleotide sequence of these ITSs were determined. On the basis of their comparison with the rDNA sequences retrieved from GenBank, we designed new primers which specifically recognize the species B. breve and the two strains B. infantis Y 1 and B. breve Y 8. Specificity of these primers was confirmed through the analysis of 60 bifidobacteria strains belonging to the more representative human species. The feasibility of this PCR method was investigated in commercial VSL-3 product and fecal samples collected from 4 patients affected by inflammatory bowel deseases and two healthy subjects before and after the VSL-3 administration. By PCR analysis of different VSL-3 commercial batches we were successful in differentiating and quantifying the strains B. longum Y 10, B. infantis Y 1 and B. breve Y 8. B. infantis Y 1 and B. breve Y 8 could be detected at high concentration in fecal specimens of both patients and subjects treated with the probiotic preparation, showing a different colonization behaviour. Seven days after the VSL-3 treatment suspension, no patients and subjects harbored B. infantis Y 1 and B. breve Y 8, indicating a transient presence of these exogenous strains.

  13. Detection of Unculturable Bacteria in Periodontal Health and Disease by PCR

    PubMed Central

    Harper-Owen, R.; Dymock, D.; Booth, V.; Weightman, A. J.; Wade, W. G.

    1999-01-01

    Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease. PMID:10203507

  14. RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

    PubMed

    Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

    2008-06-15

    A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

  15. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

    PubMed

    O'Halloran, Damien M

    2015-06-01

    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  16. Multiplex PCR for four Sclerotinia species

    USDA-ARS?s Scientific Manuscript database

    Sclerotinia homeocarpa, S. minor, S. sclerotiorum, and S. trifoliorum are common species within the genus Sclerotinia, where the morphological identification is challenging, especially when one crop hosts multiple species. The objective of this study was to design species specific primers compatibl...

  17. Identification of Aspergillus fumigatus and Related Species by Nested PCR Targeting Ribosomal DNA Internal Transcribed Spacer Regions

    PubMed Central

    Zhao, Jun; Kong, Fanrong; Li, Ruoyu; Wang, Xiaohong; Wan, Zhe; Wang, Duanli

    2001-01-01

    Aspergillus fumigatus is the most common species that causes invasive aspergillosis. In order to identify A. fumigatus, partial ribosomal DNA (rDNA) from two to six strains of five different Aspergillus species was sequenced. By comparing sequence data from GenBank, we designed specific primer pairs targeting rDNA internal transcribed spacer (ITS) regions of A. fumigatus. A nested PCR method for identification of other A. fumigatus-related species was established by using the primers. To evaluate the specificities and sensitivities of those primers, 24 isolates of A. fumigatus and variants, 8 isolates of Aspergillus nidulans, 7 isolates of Aspergillus flavus and variants, 8 isolates of Aspergillus terreus, 9 isolates of Aspergillus niger, 1 isolate each of Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus versicolor, Aspergillus wangduanlii, Aspergillus qizutongii, Aspergillus beijingensis, and Exophiala dermatitidis, 4 isolates of Candida, 4 isolates of bacteria, and human DNA were used. The nested PCR method specifically identified the A. fumigatus isolates and closely related species and showed a high degree of sensitivity. Additionally, four A. fumigatus strains that were recently isolated from our clinic were correctly identified by this method. Our results demonstrate that these primers are useful for the identification of A. fumigatus and closely related species in culture and suggest further studies for the identification of Aspergillus fumigatus species in clinical specimens. PMID:11376067

  18. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    PubMed

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  19. Identification of Aspergillus sections Flavi, Nigri, and Fumigati and their differentiation using specific primers.

    PubMed

    Ashtiani, Nafiseh Mohebbi; Kachuei, Reza; Yalfani, Roozbeh; Harchegani, Asghar Beigi; Nosratabadi, Mohsen

    2017-06-01

    Aspergillus species are important in medicine, agriculture and various industries. The sections Fumigati, Flavi, and Nigri are the most important members of the Aspergillus genus. This study intended to identify and separate these three Aspergillus sections and to differentiate among them using specific primers. A bioinformatics study was initially performed to analyse the sequences of five genes, namely, beta-tubulin, calmodulin, the pre-rRNA processing protein Tsr1, the DNA-replication licensing factor Mcm7, and RNA polymerase II second largest subunit (RPB2) in the three Aspergillus sections using MEGA6 software and the NCBI database. Primers were designed to select genes for each of the Aspergillus sections being analysed. A total of 134 environmental and clinical Aspergillus species were isolated, purified and initially identified by colony morphology.. Subsequently, DNA was extracted using the phenol-chloroform method, specific primers were synthesized, PCR was performed for DNA from all isolates, and the results were compared to morphological characteristics. Of the 134 isolates tested, 56 were Nigri, 32 were Fumigati, 32 were Flavi, and the rest (14 isolates) belonged to other sections. The beta-tubulin and calmodulin genes were found to be the most suitable for differentiating among these three groups; the beta-tubulin gene was used for molecular identification of Aspergillus section Fumigati, and the calmodulin gene for identifying sections Flavi and Nigri.

  20. Elimination of endogenous aberrant kappa chain transcripts from sp2/0-derived hybridoma cells by specific ribozyme cleavage: utility in genetic therapy of HIV-1 infections.

    PubMed Central

    Duan, L; Pomerantz, R J

    1994-01-01

    The pooled degenerate-primer polymerase chain reaction (PCR) technology is now widely used in the amplification and cloning of murine hybridoma-specific immunoglobulin gene cDNAs. The design of primers is mainly based on the highly conserved 5' terminus of immunoglobulin gene variable regions and the constant region in the 3' terminus. Of note, most murine hybridoma cell lines are derived from the Sp2/0 cell line, which is demonstrated to express endogenous aberrant kappa chains (abV kappa). This high-level endogenous abV kappa mixes with specific kappa chains in the hybridomas and interferes with the efficiency of the reverse transcriptase (RT)-PCR cloning strategy. In this report, during the cloning of murine anti-human immunodeficiency virus type I (HIV-1) hybridoma immunoglobulin cDNAs, a specific primer-PCR screening system was developed, based on the abV kappa complementarity-defining region (CDR), to eliminate abV kappa-carrying plasmids. Furthermore, an abV kappa sequence-specific derived ribozyme was developed and packaged in a retroviral expression vector system. This abV kappa ribozyme can be transduced into different murine hybridomas, and expressed intracellularly to potently eliminate endogenous abV kappa RNA. Images PMID:7816635

  1. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    PubMed Central

    Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

    2006-01-01

    Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

  2. Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

    PubMed

    Panicker, Gitika; Bej, Asim K

    2005-10-01

    We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

  3. Development of a loop-mediated isothermal amplification (LAMP) assay for rapid and specific detection of common genetically modified organisms (GMOs).

    PubMed

    Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu

    2015-03-01

    Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.

  4. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    PubMed

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  5. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    PubMed Central

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  6. Single-Case Experimental Designs for the Evaluation of Treatments for Self-Injurious and Suicidal Behaviors

    ERIC Educational Resources Information Center

    Rizvi, Shireen L.; Nock, Matthew K.

    2008-01-01

    Single-case experimental designs (SCEDs) provide a time- and cost-effective alternative to randomized clinical trials and offer significant advantages in terms of internal and external validity. A brief history and primer on SCEDs is provided, specifically for use in suicide intervention research. Various SCED methodologies, such as AB, ABAB,…

  7. Real-time PCR (qPCR) primer design using free online software.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  8. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food.

    PubMed

    Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K

    2015-09-08

    The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.

  9. The largest subunit of RNA polymerase II as a new marker gene to study assemblages of arbuscular mycorrhizal fungi in the field.

    PubMed

    Stockinger, Herbert; Peyret-Guzzon, Marine; Koegel, Sally; Bouffaud, Marie-Lara; Redecker, Dirk

    2014-01-01

    Due to the potential of arbuscular mycorrhizal fungi (AMF, Glomeromycota) to improve plant growth and soil quality, the influence of agricultural practice on their diversity continues to be an important research question. Up to now studies of community diversity in AMF have exclusively been based on nuclear ribosomal gene regions, which in AMF show high intra-organism polymorphism, seriously complicating interpretation of these data. We designed specific PCR primers for 454 sequencing of a region of the largest subunit of RNA polymerase II gene, and established a new reference dataset comprising all major AMF lineages. This gene is known to be monomorphic within fungal isolates but shows an excellent barcode gap between species. We designed a primer set to amplify all known lineages of AMF and demonstrated its applicability in combination with high-throughput sequencing in a long-term tillage experiment. The PCR primers showed a specificity of 99.94% for glomeromycotan sequences. We found evidence of significant shifts of the AMF communities caused by soil management and showed that tillage effects on different AMF taxa are clearly more complex than previously thought. The high resolving power of high-throughput sequencing highlights the need for quantitative measurements to efficiently detect these effects.

  10. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

    PubMed Central

    Kim, Kwang-Pyo; Singh, Atul K.; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K.

    2015-01-01

    The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL. PMID:26371000

  11. Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

    PubMed

    Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

    2015-07-01

    Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

  12. A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize.

    PubMed

    Matsuoka, T; Kuribara, H; Akiyama, H; Miura, H; Goda, Y; Kusakabe, Y; Isshiki, K; Toyoda, M; Hino, A

    2001-02-01

    Seven lines of genetically modified (GM) maize have been authorized in Japan as foods and feeds imported from the USA. We improved a multiplex PCR method described in the previous report in order to distinguish the five lines of GM maize. Genomic DNA was extracted from GM maize with a silica spin column kit, which could reduce experimental time and improve safety in the laboratory and potentially in the environment. We sequenced recombinant DNA (r-DNA) introduced into GM maize, and re-designed new primer pairs to increase the specificity of PCR to distinguish five lines of GM maize by multiplex PCR. A primer pair for the maize intrinsic zein gene (Ze1) was also designed to confirm the presence of amplifiable maize DNA. The lengths of PCR products using these six primer pairs were different. The Ze1 and the r-DNAs from the five lines of GM maize were qualitatively detected in one tube. The specific PCR bands were distinguishable from each other on the basis of the expected length. The r-DNA could be detected from maize samples containing 0.5% of each of the five lines of GM maize. The sensitivity would be acceptable to secure the verification of non-GMO materials and to monitor the reliability of the labeling system.

  13. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    PubMed

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  14. Dinucleotide repeat polymorphisms in waterfowl (family Anatidae): Characterization of a sex-linked (Z-specific) and 14 autosomal loci

    USGS Publications Warehouse

    Buchholz, W.G.; Pearce, J.M.; Pierson, B.J.; Scribner, K.T.

    1998-01-01

    Canada goose (Branta Canadensis) and harlequin duck (Histrionicus histrionicus) DNAs were digested with Sau3AI, and size selected (300-700 bp) fragments were ligated into BamHI-digested pBluscriptII KS+. The enrichment protocol of Ostrander et al.1 was followed. The resulting libraries were screened using a [ƴ-32P]ATP end-labelled (CA)20 oligonucleotides as a hybridization probe. Positive clones were sequenced using cycle-sequencing protocols (Epicentre Technologies, Madison, WI) and primers flanking the inserts. PCR primers were designed to amplify the repeat and yield amplification products of ≈100-200 bp. DNA  samples were screened for variation at these loci using [ƴ-32P]ATP end-labelled primers. The products were resolved using 6% denaturing polyacrylamide gels and autoradiography.

  15. HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

    PubMed

    Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

    2016-01-01

    Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

  16. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

  17. Real-Time PCR for the Detection and Quantification of Geodermatophilaceae from Stone Samples and Identification of New Members of the Genus Blastococcus†

    PubMed Central

    Salazar, Oscar; Valverde, Aranzazu; Genilloud, Olga

    2006-01-01

    Real-time PCR (RT-PCR) technology was used for the specific detection and quantification of members of the family Geodermatophilaceae in stone samples. Differences in the nucleotide sequences of the 16S rRNA gene region were used to design a pair of family-specific primers that were used to detect and quantify by RT-PCR DNA from members of this family in stone samples from different geographical origins in Spain. These primers were applied later to identify by PCR-specific amplification new members of the family Geodermatophilaceae isolated from the same stone samples. The diversity and taxonomic position of the wild-type strains identified from ribosomal sequence analysis suggest the presence of a new lineage within the genus Blastococcus. PMID:16391063

  18. Optimization of polymerase chain reaction for detection of Clostridium botulinum type C and D in bovine samples.

    PubMed

    Prévot, V; Tweepenninckx, F; Van Nerom, E; Linden, A; Content, J; Kimpe, A

    2007-01-01

    Botulism is a rare but serious paralytic illness caused by a nerve toxin that is produced by the bacterium Clostridium botulinum. The economic, medical and alimentary consequences can be catastrophic in case of an epizooty. A polymerase chain reaction (PCR)-based assay was developed for the detection of C. botulinum toxigenic strains type C and D in bovine samples. This assay has proved to be less expensive, faster and simpler to use than the mouse bioassay, the current reference method for diagnosis of C. botulinum toxigenic strains. Three pairs of primers were designed, one for global detection of C. botulinum types C and D (primer pair Y), and two strain-specific pairs specifically designed for types C (primer pair VC) and D (primer pair VD). The PCR amplification conditions were optimized and evaluated on 13 bovine and two duck samples that had been previously tested by the mouse bioassay. In order to assess the impact of sample treatment, both DNA extracted from crude samples and three different enrichment broths (TYG, CMM, CMM followed by TYG) were tested. A 100% sensitivity was observed when samples were enriched for 5 days in CMM followed by 1 day in TYG broth. False-negative results were encountered when C. botulinum was screened for in crude samples. These findings indicate that the current PCR is a reliable method for the detection of C. botulinum toxigenic strains type C and D in bovine samples but only after proper enrichment in CMM and TYG broth.

  19. UniPrime2: a web service providing easier Universal Primer design.

    PubMed

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  20. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, H.U.G.; Gray, J.W.

    1995-06-27

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

  1. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, Heinz-Ulrich G.; Gray, Joe W.

    1995-01-01

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

  2. Host-associated bacterial taxa from Chlorobi, Chloroflexi, GN02, Synergistetes, SR1, TM7, and WPS-2 Phyla/candidate divisions

    PubMed Central

    Camanocha, Anuj; Dewhirst, Floyd E.

    2014-01-01

    Background and objective In addition to the well-known phyla Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, Spirochaetes, Fusobacteria, Tenericutes, and Chylamydiae, the oral microbiomes of mammals contain species from the lesser-known phyla or candidate divisions, including Synergistetes, TM7, Chlorobi, Chloroflexi, GN02, SR1, and WPS-2. The objectives of this study were to create phyla-selective 16S rDNA PCR primer pairs, create selective 16S rDNA clone libraries, identify novel oral taxa, and update canine and human oral microbiome databases. Design 16S rRNA gene sequences for members of the lesser-known phyla were downloaded from GenBank and Greengenes databases and aligned with sequences in our RNA databases. Primers with potential phylum level selectivity were designed heuristically with the goal of producing nearly full-length 16S rDNA amplicons. The specificity of primer pairs was examined by making clone libraries from PCR amplicons and determining phyla identity by BLASTN analysis. Results Phylum-selective primer pairs were identified that allowed construction of clone libraries with 96–100% specificity for each of the lesser-known phyla. From these clone libraries, seven human and two canine novel oral taxa were identified and added to their respective taxonomic databases. For each phylum, genome sequences closest to human oral taxa were identified and added to the Human Oral Microbiome Database to facilitate metagenomic, transcriptomic, and proteomic studies that involve tiling sequences to the most closely related taxon. While examining ribosomal operons in lesser-known phyla from single-cell genomes and metagenomes, we identified a novel rRNA operon order (23S-5S-16S) in three SR1 genomes and the splitting of the 23S rRNA gene by an I-CeuI-like homing endonuclease in a WPS-2 genome. Conclusions This study developed useful primer pairs for making phylum-selective 16S rRNA clone libraries. Phylum-specific libraries were shown to be useful for identifying previously unrecognized taxa in lesser-known phyla and would be useful for future environmental and host-associated studies. PMID:25317252

  3. Development and use of polymerase chain reaction for the specific detection of Salmonella Typhimurium in stool and food samples.

    PubMed

    Lin, J S; Tsen, H Y

    1999-10-01

    Salmonella Typhimurium is one of the most important Salmonella serovars that may cause foodborne disease and human salmonellosis infection. Detection of this organism in the clinical samples of persons with gastroenteritis and the food samples associated with such persons may allow us to trace the cause of disease. Because malic acid dehydrogenase, an enzyme of the citric acid cycle, is common to organisms, the gene (mdh) coding for this enzyme was selected for the design of Salmonella Typhimurium-specific polymerase chain reaction (PCR) primers. By comparison of the mdh gene sequences of Salmonella Typhimurium and other Salmonella serotypes and of some isolates of other genera, two oligonucleotides were designed and used as PCR primers for the specific detection of Salmonella Typhimurium. The molecular weight of the PCR product was 261 bp as expected. Salmonella serovars other than Salmonella Typhimurium and isolates of other genera in the Enterobacteriaceae that is closely related to Salmonella did not generate any false-positive results. When this primer pair was used for the detection of Salmonella Typhimurium cells artificially inoculated into human stool specimens and food samples, such as milk and raw chicken meat, levels as low as 10(0) CFU per 0.1 g of stool specimen or per ml of milk or food homogenate could be detected if an 8- to 12-h preculture step using combined lactose-tetrathionate broth was performed prior to the PCR.

  4. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

    PubMed Central

    Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

    2018-01-01

    One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

  5. A novel archaeal group in the phylum Crenarchaeota found unexpectedly in an eukaryotic survey in the Cariaco Basin.

    PubMed

    Jeon, Sun-Ok; Ahn, Tae-Seok; Hong, Sun-Hee

    2008-02-01

    Archaea have been found in many more diverse habitats than previously believed due in part to modern molecular approaches to discovering microbial diversity. We report here an unexpected expansion of the habitat diversity of the Archaea in the Cariaco Basin we found using a primer set designed for 18S eukaryotic rDNA sequence analysis. The results presented here expand the originally identified 9 archaeal clones reported in this environment using bacterial/archaeal primers to 152 archaeal clones: 67 (18 OTU) of these clones were found at a depth of 900 m of station A while 71 (9 OTU) of them were at a depth of between 300 approximately 335 m of station B&C depending upon which location the samples were taken. We used three phylogenetic analysis methods and detected 20 phylotypes belonging to a single previously unreported group distantly related to the Crenarchaeota. Also, we determined that the original nine sequences did not fall into any of the known phyla of the Archaea suggesting that they may represent a novel group within the Kingdom Archaea. Thus, from these two studies, we suggest that Archaea in the Cariaco Basin could be unique; however, further studies using archaeal-specific primers and the design of new primers as well as the systematic use of several different primer combinations may improve the chances of understanding the archeal diversity in the Cariaco Basin.

  6. pelB gene in isolates of Colletotrichum gloeosporioides from several hosts.

    PubMed

    Medeiros, L V; Maciel, D B; Medeiros, V V; Houllou Kido, L M; Oliveira, N T

    2010-04-13

    Colletotrichum gloeosporioides is an important pathogen for a great number of economically important crops. During the necrotrophic phase of infection by Colletotrichum spp, the degradative enzymes of plant cell walls, such as pectate lyase, clearly increase. A gene pelB that expresses a pectate lyase was identified in isolates of C. gloeosporioides in avocado pathogens. Various molecular studies have identified a kind of specialization of C. gloeosporioides isolates with specific hosts; however, there have been no studies of this gene in isolates from hosts other than avocado. The same is true for other species of Colletotrichum. We examined genetic variability in order to design primers that would amplify pelB gene fragments and compared the products of this amplification in C. gloeosporioides isolates from different hosts. Genetic variability was assessed using ISSR primers; the resultant data were grouped based on the UPGMA clustering method. Primers for the pelB gene were designed from selected GenBank sequences using the Primer 3 program at an annealing temperature of 60 degrees C and product amplification of nearly 600 bp. The ISSR primers were efficient in demonstrating the genetic variability of the Colletotrichum isolates and in distinguishing C. gloeosporioides, C. acutatum and C. sublineolum species. The gene pelB was found in C. gloeosporioides, C. acutatum and C. sublineolum. Amplified restriction fragments using MspI did not reveal differences in pelB gene structure in isolates from the three different host species that we investigated.

  7. Development of SCoT-Based SCAR Marker for Rapid Authentication of Taxus Media.

    PubMed

    Hao, Juan; Jiao, Kaili; Yu, Chenliang; Guo, Hong; Zhu, Yujia; Yang, Xiao; Zhang, Siyang; Zhang, Lei; Feng, Shangguo; Song, Yaobin; Dong, Ming; Wang, Huizhong; Shen, Chenjia

    2018-06-01

    Taxus media is an important species in the family Taxaceae with high medicinal and commercial value. Overexploitation and illegal trade have led T. media to a severe threat of extinction. In addition, T. media and other Taxus species have similar morphological traits and are easily misidentified, particularly during the seedling stage. The purpose of this study is to develop a species-specific marker for T. media. Through a screening of 36 start codon targeted (SCoT) polymorphism primers, among 15 individuals of 4 Taxus species (T. media, T. chinensis, T. cuspidate and T. fuana), a clear species-specific DNA fragment (amplified by primer SCoT3) for T. media was identified. After isolation and sequencing, a DNA sequence with 530 bp was obtained. Based on this DNA fragment, a primer pair for the sequence-characterized amplified region marker was designed and named MHSF/MHSR. PCR analysis with primer pair MHSF/MHSR revealed a clear amplified band for all individuals of T. media but not for T. chinensis, T. cuspidate and T. fuana. Therefore, this marker can be used as a quick, efficient and reliable tool to identify T. media among other related Taxus species. The results of this study will lay an important foundation for the protection and management of T. media as a natural resource.

  8. Molecular beacon probes-base multiplex NASBA Real-time for detection of HIV-1 and HCV.

    PubMed

    Mohammadi-Yeganeh, S; Paryan, M; Mirab Samiee, S; Kia, V; Rezvan, H

    2012-06-01

    Developed in 1991, nucleic acid sequence-based amplification (NASBA) has been introduced as a rapid molecular diagnostic technique, where it has been shown to give quicker results than PCR, and it can also be more sensitive. This paper describes the development of a molecular beacon-based multiplex NASBA assay for simultaneous detection of HIV-1 and HCV in plasma samples. A well-conserved region in the HIV-1 pol gene and 5'-NCR of HCV genome were used for primers and molecular beacon design. The performance features of HCV/HIV-1 multiplex NASBA assay including analytical sensitivity and specificity, clinical sensitivity and clinical specificity were evaluated. The analysis of scalar concentrations of the samples indicated that the limit of quantification of the assay was <1000 copies/ml for HIV-1 and <500 copies/ml for HCV with 95% confidence interval. Multiplex NASBA assay showed a 98% sensitivity and 100% specificity. The analytical specificity study with BLAST software demonstrated that the primers do not attach to any other sequences except for that of HIV-1 or HCV. The primers and molecular beacon probes detected all HCV genotypes and all major variants of HIV-1. This method may represent a relatively inexpensive isothermal method for detection of HIV-1/HCV co-infection in monitoring of patients.

  9. In vitro selection using a dual RNA library that allows primerless selection

    PubMed Central

    Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

    2006-01-01

    High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

  10. New primers for the detection Leishmania species by multiplex polymerase chain reaction.

    PubMed

    Conter, Carolina Cella; Lonardoni, Maria Valdrinez Campana; Aristides, Sandra Mara Alessi; Cardoso, Rosilene Fressatti; Silveira, Thaís Gomes Verzignassi

    2018-02-01

    Leishmaniasis is caused by protozoa of the Leishmania genus, which is divided into subgenus Viannia and Leishmania. In humans, the course of infection largely depends on the host-parasite relationship and primarily of the infective species. The objective of the present study was to design specific primers to the identification of Leishmania species using multiplex PCR. Four primers were designed, based on the GenBank sequences of the kDNA minicircle, amplifying 127 bp for subgenus Viannia, 100 bp for L. amazonensis, and 60 bp for Leishmania donovani complex and L. major. None of the primers amplified Trypanosoma cruzi or L. mexicana. The limit of detection of multiplex PCR was 2 × 10 -5 parasites for L. braziliensis, 2 x 10 -3 parasites for L. amazonensis, and 1.4 × 10 -3 parasites for L. infantum. The high sensitivity of multiplex PCR was confirmed by the detection of parasites in different biological samples, including lesion scrapings, spleen imprinting of a hamster, sandflies, and blood. The multiplex PCR that was developed herein presented good performance with regard to detecting and identifying the parasite in different biological samples and may thus be useful for diagnosis, decision making with regard to the proper therapeutic approach, and determining the geographic distribution of Leishmania species.

  11. PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity.

    PubMed

    Dwivedi, Bhakti; Schmieder, Robert; Goldsmith, Dawn B; Edwards, Robert A; Breitbart, Mya

    2012-03-04

    Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution.

  12. PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity

    PubMed Central

    2012-01-01

    Background Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution. PMID:22385976

  13. Significant variance in genetic diversity among populations of Schistosoma haematobium detected using microsatellite DNA loci from a genome-wide database.

    PubMed

    Glenn, Travis C; Lance, Stacey L; McKee, Anna M; Webster, Bonnie L; Emery, Aidan M; Zerlotini, Adhemar; Oliveira, Guilherme; Rollinson, David; Faircloth, Brant C

    2013-10-17

    Urogenital schistosomiasis caused by Schistosoma haematobium is widely distributed across Africa and is increasingly being targeted for control. Genome sequences and population genetic parameters can give insight into the potential for population- or species-level drug resistance. Microsatellite DNA loci are genetic markers in wide use by Schistosoma researchers, but there are few primers available for S. haematobium. We sequenced 1,058,114 random DNA fragments from clonal cercariae collected from a snail infected with a single Schistosoma haematobium miracidium. We assembled and aligned the S. haematobium sequences to the genomes of S. mansoni and S. japonicum, identifying microsatellite DNA loci across all three species and designing primers to amplify the loci in S. haematobium. To validate our primers, we screened 32 randomly selected primer pairs with population samples of S. haematobium. We designed >13,790 primer pairs to amplify unique microsatellite loci in S. haematobium, (available at http://www.cebio.org/projetos/schistosoma-haematobium-genome). The three Schistosoma genomes contained similar overall frequencies of microsatellites, but the frequency and length distributions of specific motifs differed among species. We identified 15 primer pairs that amplified consistently and were easily scored. We genotyped these 15 loci in S. haematobium individuals from six locations: Zanzibar had the highest levels of diversity; Malawi, Mauritius, Nigeria, and Senegal were nearly as diverse; but the sample from South Africa was much less diverse. About half of the primers in the database of Schistosoma haematobium microsatellite DNA loci should yield amplifiable and easily scored polymorphic markers, thus providing thousands of potential markers. Sequence conservation among S. haematobium, S. japonicum, and S. mansoni is relatively high, thus it should now be possible to identify markers that are universal among Schistosoma species (i.e., using DNA sequences conserved among species), as well as other markers that are specific to species or species-groups (i.e., using DNA sequences that differ among species). Full genome-sequencing of additional species and specimens of S. haematobium, S. japonicum, and S. mansoni is desirable to better characterize differences within and among these species, to develop additional genetic markers, and to examine genes as well as conserved non-coding elements associated with drug resistance.

  14. Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

    PubMed

    Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-10-01

    Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

  15. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  16. Designing for transportation management and operations : a primer.

    DOT National Transportation Integrated Search

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  17. The "How To's" of Using Word Processors and Database Managers with Qualitative Data: A Primer for Professionals.

    ERIC Educational Resources Information Center

    Stuck, M. F.

    This guide provides an introduction to the use of microcomputers with qualitative data. It is deliberately non-specific and rudimentary in order to be of maximum benefit to the widest possible audience of beginning microcomputer users who wish to analyze their data using software that is not specifically designed for qualitative data analysis. The…

  18. A specific endogenous reference for genetically modified common bean (Phaseolus vulgaris L.) DNA quantification by real-time PCR targeting lectin gene.

    PubMed

    Venturelli, Gustavo L; Brod, Fábio C A; Rossi, Gabriela B; Zimmermann, Naíra F; Oliveira, Jaison P; Faria, Josias C; Arisi, Ana C M

    2014-11-01

    The Embrapa 5.1 genetically modified (GM) common bean was approved for commercialization in Brazil. Methods for the quantification of this new genetically modified organism (GMO) are necessary. The development of a suitable endogenous reference is essential for GMO quantification by real-time PCR. Based on this, a new taxon-specific endogenous reference quantification assay was developed for Phaseolus vulgaris L. Three genes encoding common bean proteins (phaseolin, arcelin, and lectin) were selected as candidates for endogenous reference. Primers targeting these candidate genes were designed and the detection was evaluated using the SYBR Green chemistry. The assay targeting lectin gene showed higher specificity than the remaining assays, and a hydrolysis probe was then designed. This assay showed high specificity for 50 common bean samples from two gene pools, Andean and Mesoamerican. For GM common bean varieties, the results were similar to those obtained for non-GM isogenic varieties with PCR efficiency values ranging from 92 to 101 %. Moreover, this assay presented a limit of detection of ten haploid genome copies. The primers and probe developed in this work are suitable to detect and quantify either GM or non-GM common bean.

  19. Genetic Analysis and Species Specific Amplification of the Artemisinin Resistance-Associated Kelch Propeller Domain in P. falciparum and P. vivax

    PubMed Central

    Talundzic, Eldin; Chenet, Stella M.; Goldman, Ira F.; Patel, Dhruviben S.; Nelson, Julia A.; Plucinski, Mateusz M.; Barnwell, John W.; Udhayakumar, Venkatachalam

    2015-01-01

    Plasmodium falciparum resistance to artemisinin has emerged in the Greater Mekong Subregion and now poses a threat to malaria control and prevention. Recent work has identified mutations in the kelch propeller domain of the P. falciparum K13 gene to be associated artemisinin resistance as defined by delayed parasite clearance and ex vivo ring stage survival assays. Species specific primers for the two most prevalent human malaria species, P. falciparum and P. vivax, were designed and tested on multiple parasite isolates including human, rodent, and non- humans primate Plasmodium species. The new protocol described here using the species specific primers only amplified their respective species, P. falciparum and P. vivax, and did not cross react with any of the other human malaria Plasmodium species. We provide an improved species specific PCR and sequencing protocol that could be effectively used in areas where both P. falciparum and P. vivax are circulating. To design this improved protocol, the kelch gene was analyzed and compared among different species of Plasmodium. The kelch propeller domain was found to be highly conserved across the mammalian Plasmodium species. PMID:26292024

  20. Genetic Analysis and Species Specific Amplification of the Artemisinin Resistance-Associated Kelch Propeller Domain in P. falciparum and P. vivax.

    PubMed

    Talundzic, Eldin; Chenet, Stella M; Goldman, Ira F; Patel, Dhruviben S; Nelson, Julia A; Plucinski, Mateusz M; Barnwell, John W; Udhayakumar, Venkatachalam

    2015-01-01

    Plasmodium falciparum resistance to artemisinin has emerged in the Greater Mekong Subregion and now poses a threat to malaria control and prevention. Recent work has identified mutations in the kelch propeller domain of the P. falciparum K13 gene to be associated artemisinin resistance as defined by delayed parasite clearance and ex vivo ring stage survival assays. Species specific primers for the two most prevalent human malaria species, P. falciparum and P. vivax, were designed and tested on multiple parasite isolates including human, rodent, and non- humans primate Plasmodium species. The new protocol described here using the species specific primers only amplified their respective species, P. falciparum and P. vivax, and did not cross react with any of the other human malaria Plasmodium species. We provide an improved species specific PCR and sequencing protocol that could be effectively used in areas where both P. falciparum and P. vivax are circulating. To design this improved protocol, the kelch gene was analyzed and compared among different species of Plasmodium. The kelch propeller domain was found to be highly conserved across the mammalian Plasmodium species.

  1. Sequence analysis of Chinese and Japanese Curcuma drugs on the 18S rRNA gene and trnK gene and the application of amplification-refractory mutation system analysis for their authentication.

    PubMed

    Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko

    2002-12-01

    The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.

  2. High-throughput detection of human papillomavirus-18 L1 gene methylation, a candidate biomarker for the progression of cervical neoplasia.

    PubMed

    Turan, Tolga; Kalantari, Mina; Cuschieri, Kate; Cubie, Heather A; Skomedal, Hanne; Bernard, Hans-Ulrich

    2007-04-25

    The L1 gene of human papillomavirus-18 (HPV-18) is consistently hypermethylated in cervical carcinomas, but frequently hypo- or unmethylated in exfoliated cells from asymptomatic patients. In precancerous lesions, L1 is sporadically hypermethylated, correlating with the severity of the neoplasia. In order to explore the potential of using L1 methylation as a workable biomarker for carcinogenic progression of HPV-18 infections in routinely taken samples, our aim was to develop methylation-detection techniques that were sensitive and rapid without being overly complex technically. Therein, we developed a methylation-specific PCR (MSP) through the design of primer sets that specifically amplify either methylated or unmethylated HPV-18 L1 DNA within bisulfite-modified sample DNA. Amplification of unmethylated and in vitro methylated HPV-18 DNA by MSP resulted in 2500 copies of either of the two L1 DNA species being detected, a satisfactory sensitivity considering that bisulfite treatment leads to the fragmentation of about 99% of sample DNA. The primers proved specific and did not generate false positive results at concentrations exceeding the lowest limit of detection by a factor of 400. DNA from carcinomas yielded PCR signals only with the methylation-specific primers, and not with primers specific for unmethylated L1 genes. The inverse result was obtained with DNA from precursor lesions that contained only hypomethylated DNA. High-grade precursor lesions and carcinomas that contained hyper- as well as hypomethylated L1 DNA yielded PCR signals with both primers. By developing a fluorescence based real-time PCR, we quantitatively analyzed samples with in vitro methylated and unmethylated L1 DNA, and could distinguish clinical samples with hyper- and hypomethylated DNA or mixtures of both DNAs. The methylation-specific and real-time PCR techniques permitted efficient HPV-18 L1 methylation analyses and open the door for larger-scale clinical studies where the utility of methylation status to predict the progression of HPV-18 infection and HPV-18 associated lesions is assessed.

  3. STITCHER 2.0: primer design for overlapping PCR applications

    PubMed Central

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-01-01

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

  4. STITCHER 2.0: primer design for overlapping PCR applications.

    PubMed

    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-03-30

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

  5. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    PubMed

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  6. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  7. Molecular method for determining sex of walruses

    USGS Publications Warehouse

    Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

    2008-01-01

    We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

  8. Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

    USGS Publications Warehouse

    Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

    2010-01-01

    A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

  9. Isolation of a sex-linked DNA sequence in cranes.

    PubMed

    Duan, W; Fuerst, P A

    2001-01-01

    A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

  10. PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.

    PubMed

    Prevost, S; Andre, S; Remize, F

    2010-12-01

    Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.

  11. [Molecular identification and detection of moon jellyfish (Aurelia sp.) based on partial sequencing of mitochondrial 16S rDNA and COI].

    PubMed

    Wang, Jian-Yan; Zhen, Yu; Wang, Guo-shan; Mi, Tie-Zhu; Yu, Zhi-gang

    2013-03-01

    Taking the moon jellyfish Aurelia sp. commonly found in our coastal sea areas as test object, its genome DNA was extracted, the partial sequences of mt-16S rDNA (650 bp) and mt-COI (709 bp) were PCR-amplified, and, after purification, cloning, and sequencing, the sequences obtained were BLASTn-analyzed. The sequences of greater difference with those of the other jellyfish were chosen, and eight specific primers for the mt-16S rDNA and mt-COI of Aurelia sp. were designed, respectively. The specificity test indicated that the primer AS3 for the mt-16S rDNA and the primer AC3 for the mt-COI were excellent in rapidly detecting the target jellyfish from Rhopilema esculentum, Nemopilema nomurai, Cyanea nozakii, Acromitus sp., and Aurelia sp., and thus, the techniques for the molecular identification and detection of moon jellyfish were preliminarily established, which could get rid of the limitations in classical morphological identification of Aurelia sp. , being able to find the Aurelia sp. in the samples more quickly and accurately.

  12. A rapid method for differentiating Saccharomyces sensu stricto strains from other yeast species in an enological environment.

    PubMed

    Nardi, Tiziana; Carlot, Milena; De Bortoli, Elena; Corich, Viviana; Giacomini, Alessio

    2006-11-01

    During programs for the selection of enological yeasts, several hundred natural isolates are usually screened. The scope of these operations is to isolate strains possessing good fermentative properties without necessarily arriving at a precise species designation: in other words, to detect strains belonging to the Saccharomyces sensu stricto complex. In the present study, a pair of primers, designed within the variable D1/D2 region of the 26S subunit of ribosomal yeast RNA, have been constructed. These generate an amplification fragment of 471 bp that is specific for the seven Saccharomyces sensu stricto species, while no signal was obtained for Saccharomyces sensu lato strains (17 species) or for another 18 selected species commonly found in enological environments. A second pair of primers was also constructed, within the 18S rRNA gene, composed of perfectly conserved sequences common for all 42 yeast species examined, which generate a 900 bp (c.) band for all strains. This was used as a positive experimental control in multiplex PCR analysis using all four primers.

  13. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

  14. Clear distinction between Burkholderia mallei and Burkholderia pseudomallei using fluorescent motB primers.

    PubMed

    Schmoock, Gernot; Elschner, Mandy; Sprague, Lisa D

    2015-03-07

    A frame-shift mutation in the flagellum motor gene motB coding for the chemotaxis MotB protein of Burkholderia mallei has been utilized to design a conventional duplex PCR assay with fluorescent labelled primers. Species specificity was tested with a panel of 13 Burkholderia type strains. A total of 41 B. mallei field strains, 36 B. pseudomallei field strains, and 1 B. thailandensis field strain from different geographic regions were tested and correctly identified. Testing of 55 non-Burkholderia bacterial species revealed 100% specificity of the assay. The minimum detection limit was 1 pg DNA or 160 GE for B. mallei and 130 GE for B. pseudomallei, respectively. This assay enables the clear distinction between B. mallei and B. pseudomallei/B. thailandensis.

  15. Development and validation of four one-step real-time RT-LAMP assays for specific detection of each dengue virus serotype

    PubMed Central

    Bekaert, Michaël; Bakheit, Mohammed; Frischmann, Sieghard; Patel, Pranav; Simon-Loriere, Etienne; Lambrechts, Louis; Duong, Veasna; Dussart, Philippe; Harold, Graham; Fall, Cheikh; Faye, Oumar; Sall, Amadou Alpha; Weidmann, Manfred

    2018-01-01

    Background 4 one-step, real-time, reverse transcription loop-mediated isothermal amplification (RT-LAMP) assays were developed for the detection of dengue virus (DENV) serotypes by considering 2,056 full genome DENV sequences. DENV1 and DENV2 RT-LAMP assays were validated with 31 blood and 11 serum samples from Tanzania, Senegal, Sudan and Mauritania. DENV3 and DENV4 RT-LAMP assays were validated with 25 serum samples from Cambodia Methodology/Principal findings 4 final reaction primer mixes were obtained by using a combination of Principal Component Analysis of the full DENV genome sequences, and LAMP primer design based on sequence alignments using the LAVA software. These mixes contained 14 (DENV1), 12 (DENV2), 8 (DENV3) and 3 (DENV4) LAMP primer sets. The assays were evaluated with an External Quality Assessment panel from Quality Control for Molecular Diagnostics. The assays were serotype-specific and did not cross-detect with other flaviviruses. The limits of detection, with 95% probability, were 22 (DENV1), 542 (DENV2), 197 (DENV3) and 641 (DENV4) RNA molecules, and 100% reproducibility in the assays was obtained with up to 102 (DENV1) and 103 RNA molecules (DENV2, DENV3 and DENV4). Validation of the DENV2 assay with blood samples from Tanzania resulted in 23 samples detected by RT-LAMP, demonstrating that the assay is 100% specific and 95.8% sensitive (positive predictive value of 100% and a negative predictive value of 85.7%). All serum samples from Senegal, Sudan and Mauritania were detected and 3 untyped as DENV1. The sensitivity of RT-LAMP for DENV4 samples from Cambodia did not quite match qRT-PCR. Conclusions/Significance We have shown a novel approach to design LAMP primers that makes use of fast growing sequence databases. The DENV1 and DENV2 assays were validated with viral RNA extracted clinical samples, showing very good performance parameters. PMID:29813062

  16. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  17. ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

    PubMed

    Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

    2017-10-01

    ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  18. Enhanced Reliability and Accuracy for Field Deployable Bioforensic Detection and Discrimination of Xylella fastidiosa subsp. pauca, Causal Agent of Citrus Variegated Chlorosis Using Razor Ex Technology and TaqMan Quantitative PCR

    PubMed Central

    Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

    2013-01-01

    A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333

  19. Exploring abundance, diversity and variation of a widespread antibiotic resistance gene in wastewater treatment plants.

    PubMed

    Wei, Ziyan; Feng, Kai; Li, Shuzhen; Zhang, Yu; Chen, Hongrui; Yin, Huaqun; Xu, Meiying; Deng, Ye

    2018-05-09

    An updated sul1 gene sequence database was constructed and new degenerate primers were designed to better investigate the abundance, diversity, and variation of a ubiquitous antibiotic resistance gene, sul1, with PCR-based methods in activated sludge from wastewater treatment plants (WWTPs). The newly designed degenerate primers showed high specificity and higher coverage in both in-silico evaluations and activated sludge samples compared to previous sul1 primers. Using the new primers, the abundance and diversity of sul1 gene, together with 16S rRNA gene, in activated sludge from five WWTPs in summer and winter were determined by quantitative PCR and MiSeq sequencing. The sul1 gene was found to be prevalent and displayed a comparable abundance (0.081 copies per bacterial cell in average) to the total bacteria across all samples. However, compared to the significant seasonal and geographical divergences in the quantity and diversity of bacterial communities in WWTPs, there were no significant seasonal or geographical variations of representative clusters of sul1 gene in most cases. Additionally, the representative sul1 clusters showed fairly close phylogeny and there was no obvious correlation between sul1 gene and the dominant bacterial genera, as well as the int1 gene, suggesting that bacterial hosts of sul1 gene is not stable, the sul1 gene may be carried by mobile genetic elements, sometimes integrated with class 1 integrons and sometimes not. Thus mobile genetic elements likely play a greater role than specific microbial taxa in determining the composition of sul1 gene in WWTPs. Copyright © 2018. Published by Elsevier Ltd.

  20. Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated chlorosis using razor ex technology and TaqMan quantitative PCR.

    PubMed

    Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

    2013-01-01

    A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.

  1. Design of a Percussion and Electric Primer Gun Firing Power Supply

    DTIC Science & Technology

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  2. Novel genomic tools for specific and real-time detection of biothreat and frequently encountered foodborne pathogens.

    PubMed

    Woubit, Abdela; Yehualaeshet, Teshome; Habtemariam, Tsegaye; Samuel, Temesgen

    2012-04-01

    The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia, and Francisella include important food safety and biothreat agents. By extensive mining of the whole genome and protein databases of diverse, closely and distantly related bacterial species and strains, we have identified novel genome regions, which we utilized to develop a rapid detection platform for these pathogens. The specific genomic targets we have identified to design the primers in Francisella tularensis subsp. tularensis, F. tularensis subsp. novicida, Shigella dysenteriae, Salmonella enterica serovar Typhimurium, Vibrio cholerae, Yersinia pestis, and Yersinia pseudotuberculosis contained either known genes or putative proteins. Primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in silico PCR against whole-genome sequences of different species, subspecies, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (Escherichia coli O157:H7 strain EDL 933, Shigella dysenteriae, S. enterica serovar Typhi, F. tularensis subsp. tularensis, V. cholerae, and Y. pestis) and six foodborne pathogens (Salmonella Typhimurium, Salmonella Saintpaul, Shigella sonnei, F. tularensis subsp. novicida, Vibrio parahaemolyticus, and Y. pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed with purified DNA showed the lowest detection limit of 128 fg of DNA/μl for F. tularensis subsp. tularensis. A preliminary test to detect Shigella organisms in a milk matrix also enabled the detection of 6 to 60 CFU/ml. These new tools could ultimately be used to develop platforms to simultaneously detect these pathogens.

  3. Molecular tools for the identification of Tuber melanosporum in agroindustry.

    PubMed

    Séjalon-Delmas, N; Roux, C; Martins, M; Kulifaj, M; Bécard, G; Dargent, R

    2000-06-01

    Tuber melanosporum Vitt., Tuber magnatum Pico, and Tuber uncinatum Chat. can be differentiated by their morphological characters. Fraud problems have arisen recently with the importation to Europe of truffles from China. T. melanosporum is morphologically very close, but distinct from the Chinese species [Tuber indicum (Cooke and Massee) and T. himalayense BC (Zhang and Winter)]. We have optimized molecular tools to unequivocally identify T. melanosporum. DNA extraction from ascocarps of black truffles is not straightforward. Problems to obtain pure DNA are due to high contents of phenolic compounds, melanine, and various polymers (proteins, polysaccharides, etc). These compounds coprecipitate with the DNA during extraction and strongly inhibit the PCR reaction. We have developed an efficient and reliable protocol for DNA extraction from truffle ascocarps. It was used successfully for DNA extraction from mycorrhizal root tips as well as from canned preparations of T. melanosporum. Several approaches to identify T. melanosporum by PCR were developed. Two specific primers for T. melanosporum were designed after comparison of the ITS region of this species with those of three Chinese fungi. They proved to be efficient to specifically detect the presence of T. melanosporum by PCR. The mycorrhizal status of trees inoculated with T. melanosporum but unable to produce truffles was confirmed in a single-step PCR reaction. A multiplex PCR approach was also developed with three sets of primers (including a specific one for Chinese truffles) to detect, in one PCR reaction, the presence of any other Tuber species mixed with T. melanosporum ascocarps. This optimized protocol, in association with the specific primers we designed, is applicable to quality control in the truffle industry from the production stages to final commercial products.

  4. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    PubMed

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  5. Simultaneous, specific and real-time detection of biothreat and frequently encountered food-borne pathogens

    PubMed Central

    Woubit, Abdela Salah; Yehualaeshet, Teshome; Habtemariam, Tsegaye; Samuel, Temesgen

    2012-01-01

    The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella include important food safety and biothreat agents causing food-related and other human illnesses worldwide. We aimed to develop rapid methods with the capability to simultaneously and differentially detect all six pathogens in one run. Our initial experiments to use previously reported sets of primers revealed non-specificity of some of the sequences when tested against a broader array of pathogens, or proved not optimal for simultaneous detection parameters. By extensive mining of the whole genome and protein databases of diverse closely and distantly related bacterial species and strains, we have identified unique genome regions, which we utilized to develop a detection platform. Twelve of the specific genomic targets we have identified to design the primers in F. tularensis ssp. tularensis, F. tularensis ssp. novicida, S. dysentriae, S. typhimurium, V. cholera, Y. pestis, and Y. pseudotuberculosis contained either hypothetical or putative proteins, the functions of which have not been clearly defined. Corresponding primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in-silico PCR against whole genome sequences of different species, sub-species, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (E.coli O157:H7 strain EDL 933, Shigella dysentriae, Salmonella typhi, Francisella tularensis ssp. tularensis, Vibrio cholera, and Yersinia pestis) and six foodborne pathogens (Salmonella typhimurium, Salmonella saintpaul, Shigella sonnei, Francisella novicida, Vibrio parahemolytica and Yersinia pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed using purified DNA showed the lowest detection limit of 640 fg DNA/µl for F. tularensis. A preliminary test done to detect Shigella organisms in a milk matrix showed that 6–60 colony forming units of the bacterium per milliliter of milk could be detected in about an hour. Therefore, we have developed a platform to simultaneously detect foodborne pathogen and biothreat agents specifically and in real-time. Such a platform could enable rapid detection or confirmation of contamination by these agents. PMID:22488053

  6. Sex identification of four penguin species using locus-specific PCR.

    PubMed

    Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

    2013-01-01

    Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

  7. Rapid and sensitive identification of the herbal tea ingredient Taraxacum formosanum using loop-mediated isothermal amplification.

    PubMed

    Lai, Guan-Hua; Chao, Jung; Lin, Ming-Kuem; Chang, Wen-Te; Peng, Wen-Huang; Sun, Fang-Chun; Lee, Meng-Shiunn; Lee, Meng-Shiou

    2015-01-09

    Taraxacum formosanum (TF) is a medicinal plant used as an important component of health drinks in Taiwan. In this study, a rapid, sensitive and specific loop-mediated isothermal amplification (LAMP) assay for authenticating TF was established. A set of four specific LAMP primers was designed based on the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA (nrDNA) of TF. LAMP amplicons were successfully amplified and detected when purified genomic DNA of TF was added in the LAMP reaction under isothermal condition (65 °C) within 45 min. These specific LAMP primers have high specificity and can accurately discriminate Taraxacum formosanum from other adulterant plants; 1 pg of genomic DNA was determined to be the detection limit of the LAMP assay. In conclusion, using this novel approach, TF and its misused plant samples obtained from herbal tea markets were easily identified and discriminated by LAMP assay for quality control.

  8. Rapid and Sensitive Identification of the Herbal Tea Ingredient Taraxacum formosanum Using Loop-Mediated Isothermal Amplification

    PubMed Central

    Lai, Guan-Hua; Chao, Jung; Lin, Ming-Kuem; Chang, Wen-Te; Peng, Wen-Huang; Sun, Fang-Chun; Lee, Meng-Shiunn; Lee, Meng-Shiou

    2015-01-01

    Taraxacum formosanum (TF) is a medicinal plant used as an important component of health drinks in Taiwan. In this study, a rapid, sensitive and specific loop-mediated isothermal amplification (LAMP) assay for authenticating TF was established. A set of four specific LAMP primers was designed based on the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA (nrDNA) of TF. LAMP amplicons were successfully amplified and detected when purified genomic DNA of TF was added in the LAMP reaction under isothermal condition (65 °C) within 45 min. These specific LAMP primers have high specificity and can accurately discriminate Taraxacum formosanum from other adulterant plants; 1 pg of genomic DNA was determined to be the detection limit of the LAMP assay. In conclusion, using this novel approach, TF and its misused plant samples obtained from herbal tea markets were easily identified and discriminated by LAMP assay for quality control. PMID:25584616

  9. Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

    PubMed

    Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

    2017-01-01

    This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

  10. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification.

    PubMed

    Murinda, Shelton E; Ibekwe, A Mark; Zulkaffly, Syaizul; Cruz, Andrew; Park, Stanley; Razak, Nur; Paudzai, Farah Md; Ab Samad, Liana; Baquir, Khairul; Muthaiyah, Kokilah; Santiago, Brenna; Rusli, Amirul; Balkcom, Sean

    2014-07-01

    Shiga toxin-producing Escherichia coli (STEC) are a major family of foodborne pathogens of public health, zoonotic, and economic significance in the United States and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal of this study was to assess the potential application of RPA in detection of STEC. This study focused on designing and evaluating RPA primers and fluorescent probes for isothermal (39°C) detection of STEC. Compatible sets of candidate primers and probes were designed for detection of Shiga toxin 1 and 2 (Stx1 and 2), respectively. The sets were evaluated for specificity and sensitivity against STEC (n=12) of various stx genotypes (stx1/stx2, stx1, or stx2, respectively), including non-Stx-producing E. coli (n=28) and other genera (n=7). The primers and probes that were designed targeted amplification of the subunit A moiety of stx1 and stx2. The assay detected STEC in real time (within 5-10 min at 39°C) with high sensitivity (93.5% vs. 90%; stx1 vs. stx2), specificity (99.1% vs. 100%; stx1 vs. stx2), and predictive value (97.9% for both stx1 vs. stx2). Limits of detection of ∼ 5-50 colony-forming units/mL were achieved in serially diluted cultures grown in brain heart infusion broth. This study successfully demonstrated for the first time that RPA can be used for isothermal real-time detection of STEC.

  11. Designing specific chloroplast markers for black walnut from a set of universal primers

    Treesearch

    Erin Victory; Rodney L. Robichaud; Keith Woeste

    2003-01-01

    Chloroplasts are a valuable source of genetic information because their sequence is highly conserved, they undergo little or no recombination, and they are uniparentally inherited. Chloroplast polymorphisms are powerful genetic tools for identifying matrilineal family groups, studying gene flow from seed versus pollen movement, reconstructing phylogeographic...

  12. DESIGN AND EVALUATION OF BACTEROIDES DNA PROBES FOR THE SPECIFIC DETECTION OF HUMAN FECAL POLLUTION

    EPA Science Inventory

    Because Bacteroides spp. are obligate anaerobes that dominate the human fecal flora, and because some species may live only in the human intestine, these bacteria might be useful to distinguish human from nonhuman sources of fecal pollution. To test this hypothesis, PCR primers s...

  13. Development of a SCAR marker for male gametophyte of Gracilariopsis lemaneiformis based on AFLP technique

    NASA Astrophysics Data System (ADS)

    Zhou, Wei; Ding, Hongye; Sui, Zhenghong; Wang, Zhongxia; Wang, Jinguo

    2014-05-01

    The red alga Gracilariopsis lemaneiformis (Bory) is an economically valuable macroalgae. As a means to identify the sex of immature Gracilariopsis lemaneiformis, the amplified fragment length polymorphism (AFLP) technique was used to search for possible sex- or phase-related markers in male gametophytes, female gametophytes, and tetrasporophytes, respectively. Seven AFLP selective amplification primers were used in this study. The primer combination E-TG/M-CCA detected a specific band linked to male gametophytes. The DNA fragment was recovered and a 402-bp fragment was sequenced. However, no DNA sequence match was found in public databases. Sequence characterized amplified region (SCAR) primers were designed from the sequence to test the repeatability of the relationship to the sex, using 69 male gametophytes, 139 female gametophytes, and 47 tetrasporophytes. The test results demonstrate a good linkage and repeatability of the SCAR marker to sex. The SCAR primers developed in this study could reduce the time required for sex identification of Gracilariopsis lemaneiformis by four to six months. This can reduce both the time investment and number of specimens required in breeding experiments.

  14. Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

    PubMed

    Cowan, Ashley F; Elkins, Kelly M

    2017-12-01

    Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

  15. Rapid Detection of Penicillin-Resistant Streptococcus pneumoniae in Cerebrospinal Fluid by a Seminested-PCR Strategy

    PubMed Central

    du Plessis, Mignon; Smith, Anthony M.; Klugman, Keith P.

    1998-01-01

    A seminested-PCR assay, based on the amplification of the pneumococcal penicillin-binding protein 2B gene (pbp2B), was developed for the detection of penicillin-resistant and -susceptible pneumococci in cerebrospinal fluid (CSF) specimens. Species-specific primers (P5 and P6) which amplified a 682-bp conserved region of the transpeptidase-encoding region of the pbp2B gene were used. Four “resistance” primers were designed to bind to altered areas of the pbp2B gene identified in penicillin-resistant South African wild-type strains. Together with the downstream primer P6, the upstream resistance primers amplified fragments which were used to detect the presence of penicillin resistance. This system identified all 35 of the S. pneumoniae isolates evaluated, including strains of 11 different serotypes and a range of penicillin-resistant and -susceptible strains. The specificity of the assay was demonstrated by its inability to amplify DNA from other bacterial species which commonly cause meningitis. It was possible to detect pneumococcal DNA from culture-negative CSF inoculated with 2.5 pg of purified DNA or 18 CFU. Analysis of 285 CSF specimens showed that PCR detected the pneumococcus in 18 samples positive by culture, including the identification of four penicillin-resistant isolates. The positive predictive value and the negative predictive value of the assay were each 100%. PMID:9466757

  16. The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

    PubMed

    Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

    2003-06-01

    A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

  17. Cascade Signal Amplification Based on Copper Nanoparticle-Reported Rolling Circle Amplification for Ultrasensitive Electrochemical Detection of the Prostate Cancer Biomarker.

    PubMed

    Zhu, Ye; Wang, Huijuan; Wang, Lin; Zhu, Jing; Jiang, Wei

    2016-02-03

    An ultrasensitive and highly selective electrochemical assay was first attempted by combining the rolling circle amplification (RCA) reaction with poly(thymine)-templated copper nanoparticles (CuNPs) for cascade signal amplification. As proof of concept, prostate specific antigen (PSA) was selected as a model target. Using a gold nanoparticle (AuNP) as a carrier, we synthesized the primer-AuNP-aptamer bioconjugate for signal amplification by increasing the primer/aptamer ratio. The specific construction of primer-AuNP-aptamer/PSA/anti-PSA sandwich structure triggered the effective RCA reaction, in which thousands of tandem poly(thymine) repeats were generated and directly served as the specific templates for the subsequent CuNP formation. The signal readout was easily achieved by dissolving the RCA product-templated CuNPs and detecting the released copper ions with differential pulse stripping voltammetry. Because of the designed cascade signal amplification strategy, the newly developed method achieved a linear range of 0.05-500 fg/mL, with a remarkable detection limit of 0.020 ± 0.001 fg/mL PSA. Finally, the feasibility of the developed method for practical application was investigated by analyzing PSA in the real clinical human serum samples. The ultrasensitivity, specificity, convenience, and capability for analyzing the clinical samples demonstrate that this method has great potential for practical disease diagnosis applications.

  18. Newly developed primers for complete YCF1 amplification in Pinus (Pinaceae) chloroplasts with possible family-wide utility

    Treesearch

    Matthew Parks; Aaron Liston; Rich Cronn

    2011-01-01

    Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...

  19. Characterization of Aspergillus flavus strains from Brazilian Brazil nuts and cashew by RAPD and ribosomal DNA analysis.

    PubMed

    Midorikawa, G E O; Pinheiro, M R R; Vidigal, B S; Arruda, M C; Costa, F F; Pappas, G J; Ribeiro, S G; Freire, F; Miller, R N G

    2008-07-01

    The aim of this study was to determine the genetic variability in Aspergillus flavus populations from Brazil nut and cashew and develop a polymerase chain reaction (PCR) detection method. Chomatography analysis of 48 isolates identified 36 as aflatoxigenic (75%). One hundred and forty-one DNA bands were generated with 11 random amplified polymorphic DNA (RAPD) primers and analysed via unweighted pair group analysis, using arithmetic means (UPGMA). Isolates grouped according to host, with differentiation of those from A. occidentale also according to geographical origin. Aspergillus flavus-specific PCR primers ASPITSF2 and ASPITSR3 were designed from ribosomal DNA internal transcribed spacers (ITS 1 and 2), and an internal amplification control was developed, to prevent false negative results. Specificity to only A. flavus was confirmed against DNA from additional aspergilli and other fungi. RAPD-based characterization differentiated isolates according to plant host. The PCR primer pair developed showed specificity to A. flavus, with a detection limit of 10 fg. Genetic variability observed in A. flavus isolates from two Brazilian agroecosystems suggested reproductive isolation. The PCR detection method developed for A. flavus represents progress towards multiplex PCR detection of aflatoxigenic and nonaflatoxigenic strains in Hazard Analysis Critical Control Point systems.

  20. Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

    PubMed

    Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

    2015-03-01

    A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

    PubMed Central

    Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

    2010-01-01

    A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

  2. Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

    PubMed

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

    2012-10-01

    To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

  3. Loop-Mediated Isothermal Amplification Label-Based Gold Nanoparticles Lateral Flow Biosensor for Detection of Enterococcus faecalis and Staphylococcus aureus

    PubMed Central

    Wang, Yi; Li, Hui; Wang, Yan; Zhang, Lu; Xu, Jianguo; Ye, Changyun

    2017-01-01

    The report describes a simple, rapid and sensitive assay for visual and multiplex detection of Enterococcus faecalis and Staphylococcus aureus based on multiple loop-mediated isothermal amplification (mLAMP) and lateral flow biosensor (LFB). Detection and differentiation of the Ef0027 gene (E. faecalis-specific gene) and nuc gene (S. aureus-specific gene) were determined using fluorescein (FITC)-and digoxin-modified primers in the mLAMP process. In the presence of biotin- and FITC-/digoxin-modified primers, the mLAMP yielded numerous biotin- and FITC-/digoxin-attached duplex products, which were detected by LFB through biotin/streptavidin interaction (biotin on the duplex and streptavidin on the gold nanoparticle) and immunoreactions (FITC/digoxin on the duplex and anti-FITC/digoxin on the LFB test line). The accumulation of gold nanoparticles generated a characteristic red line, enabling visual and multiplex detection of target pathogens without instrumentation. The limit of detection (LoD), analytical specificity and feasibility of LAMP-LFB technique were successfully examined in pure culture and blood samples. The entire procedure, including specimen (blood samples) processing (30 min), isothermal reaction (40 min) and result reporting (within 2 min), could be completed within 75 min. Thus, this assay offers a simple, rapid, sensitive and specific test for multiplex detection of E. faecalis and S. aureus strains. Furthermore, the LAMP-LFB strategy is a universal technique, which can be extended to detect various target sequences by re-designing the specific LAMP primers. PMID:28239371

  4. Rapid group-, serotype-, and vaccine strain-specific identification of poliovirus isolates by real-time reverse transcription-PCR using degenerate primers and probes containing deoxyinosine residues.

    PubMed

    Kilpatrick, David R; Yang, Chen-Fu; Ching, Karen; Vincent, Annelet; Iber, Jane; Campagnoli, Ray; Mandelbaum, Mark; De, Lina; Yang, Su-Ju; Nix, Allan; Kew, Olen M

    2009-06-01

    We have adapted our previously described poliovirus diagnostic reverse transcription-PCR (RT-PCR) assays to a real-time RT-PCR (rRT-PCR) format. Our highly specific assays and rRT-PCR reagents are designed for use in the WHO Global Polio Laboratory Network for rapid and large-scale identification of poliovirus field isolates.

  5. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    PubMed

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  6. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  7. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

    PubMed Central

    Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

    2014-01-01

    For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

  8. Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

    PubMed

    Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

    1997-05-02

    Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

  9. Combination Antiangiogenic and Immunomodulatory Gene Therapy for Breast Cancer

    DTIC Science & Technology

    2002-06-01

    Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a positive control. The samples were run on a...cultured cells and specific primers for Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a...positive control. Arrows indicate the 500 bp, 410 bp and 109 bp amplified products of Flk-1, endoglin and G3PDH , respectively. Fig 3. Viral replication

  10. ISSR markers for gender identification and genetic diagnosis of Hippophae rhamnoides ssp. turkestanica growing at high altitudes in Ladakh region (Jammu and Kashmir).

    PubMed

    Das, Kamal; Ganie, Showkat Hussain; Mangla, Yash; Dar, Tanvir-Ul-Hassan; Chaudhary, Manju; Thakur, Rakesh Kumar; Tandon, Rajesh; Raina, S N; Goel, Shailendra

    2017-03-01

    Hippophae rhamnoides L. ssp. turkestanica (Elaeagnaceae) is a predominantly dioecious and wind-pollinated medicinal plant species. The mature fruits of the species possess antioxidative, anti-inflammatory, antimicrobial, anticancerous, and antistimulatory properties that are believed to improve the immune system. The identification of male and female plants in H. rhamnoides ssp. turkestanica is quite difficult until flowering which usually takes 3-4 years or more. A sex-linked marker can be helpful in establishing the orchards through identification of genders at an early stage of development. Therefore, we studied the genetic diversity of populations in Ladakh with the aim to identify a gender-specific marker using ISSR markers. Fifty-eight ISSR primers were used to characterize the genome of H. rhamnoides ssp. turkestanica, of which eight primers generated 12 sex-specific fragments specific to one or more populations. The ISSR primer (P-45) produced a fragment which faithfully segregates all the males from the female plants across all the three valleys surveyed. This male-specific locus was converted into a SCAR. Forward and reverse primers designed from this fragment amplified a 750-bp sequence in males only, thus specifying it as an informative male-specific sex-linked marker. This SCAR marker was further validated for its capability to differentiate gender on an additional collection of plants, representing three geographically isolated valleys (Nubra, Suru, and Indus) from Ladakh region of India. The results confirmed sex-linked specificity of the marker suggesting that this conserved sequence at the Y chromosome is well preserved through the populations in Ladakh region. At present, there are no reliable markers which can differentiate male from female plants across all the three valleys of Ladakh region at an early stage of plant development. It is therefore envisaged that the developed SCAR marker shall provide a reliable molecular tool for early identification of the sex in this commercial crop. The genetic diversity of populations as surveyed by ISSR primers revealed 85.71 % polymorphism at the population level. The dendrogram obtained divided the genotypes into three different clusters, and the distribution of male and female genotypes in all the clusters was random. The Nei's genetic similarity index was in the range of 0.63-0.96.

  11. A multiplex PCR for detection of six viruses in ducks.

    PubMed

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  12. Calving traits of crossbred Brahman Cows are Associated with Heat Shock Protein 70 Genetic Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Objectives were to: 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 gene, and 2) evaluate associations between Hsp70 SNP and calving rates of Brahman-influenced cows. Specific primers were designed for PCR amplification of a 539 b...

  13. A novel agent (Endozoicomonas elysicola) responsible for epitheliocystis in cobia Rachycentrum canadum larvae.

    PubMed

    Mendoza, Mabel; Güiza, Linda; Martinez, Ximena; Caraballo, Xenia; Rojas, Jaime; Aranguren, Luis Fernando; Salazar, Marcela

    2013-09-24

    Aquaculture of cobia has gained popularity in the last decade, and this species is now farmed in several countries in Latin America and Asia. Despite recent improvement in production techniques that allowed the expansion of the industry, little is known about the diseases that affect cobia during the larviculture stage. In this article we investigated the cause of mass mortalities occurring 13-20 d post-hatching in 3 cycles of cobia larviculture. Wet mounts from diseased larvae gills revealed the presence of cyst-like basophilic inclusions. DNA from the cysts was extracted and PCR amplified using the 16S rRNA gene universal primers for prokaryotes. The amplified products were sequenced and analyzed using BLAST, finding a similarity of 99% with Endozoicomonas elysicola, a Gram-negative bacterium. Confirmation of E. elysicola was conducted by designing a specific probe for in situ hybridization. Specific primers were also designed for diagnostic purposes. This is the first report of epitheliocystis in cobia larvae and also the first report of E. elysicola as an epitheliocystis-causing agent.

  14. The design of strain-specific polymerase chain reactions for discrimination of the racoon rabies virus strain from indigenous rabies viruses of Ontario.

    PubMed

    Nadin-Davis, S A; Huang, W; Wandeler, A I

    1996-03-01

    Since its recognition as a discrete epizootic in Florida in the early 1950s, the raccoon strain of rabies virus (RV) has spread over almost the entire eastern seaboard of the US and now threatens to enter the southernmost regions of Canada. To characterise this RV strain in more detail, nucleotide sequencing of the N and G genes, encoding the nucleoprotein and glycoprotein, respectively, of representative isolates has been undertaken. This sequence information generated a conserved restriction map of the N gene, thereby permitting unequivocal identification of this strain by molecular techniques. Comparisons of the predicted nucleoprotein and glycoprotein products with those of other RV strains identified a number of amino acid sequence variations conserved only in the raccoon strain. This information was used to design strain-specific primers targeted to the N gene sequences encoding these residues. The incorporation of these primers into a multiplex polymerase chain reaction (PCR) protocol permitted easy and rapid discrimination between the raccoon RV strain and indigenous Ontario RVs.

  15. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    PubMed

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

  16. Development of loop-mediated isothermal amplification assay for specific and rapid detection of differential goat pox virus and sheep pox virus.

    PubMed

    Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang

    2014-01-17

    Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.

  17. [Optimized application of nested PCR method for detection of malaria].

    PubMed

    Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

    2017-04-28

    Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P < 0.05). Conclusion The optimized PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

  18. Quantitative phenotyping of X-disease resistance in chokecherry using real-time PCR.

    PubMed

    Huang, Danqiong; Walla, James A; Dai, Wenhao

    2014-03-01

    A quantitative real-time SYBR Green PCR (qPCR) assay has been developed to detect and quantify X-disease phytoplasmas in chokecherry. An X-disease phytoplasma-specific and high sensitivity primer pair was designed based on the 16S rRNA gene sequence of X-disease phytoplasmas. This primer pair was specific to the 16SrIII group (X-disease) phytoplasmas. The qPCR method can quantify phytoplasmas from a DNA mix (a mix of both chokecherry and X-disease phytoplasma DNA) at as low as 0.001 ng, 10-fold lower than conventional PCR using the same primer pair. A significant correlation between the copy number of phytoplasmas and visual phenotypic rating scores of X-disease resistance in chokecherry plants was observed. Disease resistant chokecherries had a significantly lower titer of X-disease phytoplasmas than susceptible plants. This suggests that the qPCR assay provides a more objective tool to phenotype phytoplasma disease severity, particularly for early evaluation of host resistance; therefore, this method will facilitate quantitative phenotyping of disease resistance and has great potential in enhancing plant breeding. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Carious Dentine Provides a Habitat for a Complex Array of Novel Prevotella-Like Bacteria

    PubMed Central

    Nadkarni, Mangala A.; Caldon, C. Elizabeth; Chhour, Kim-Ly; Fisher, Ilana P.; Martin, F. Elizabeth; Jacques, Nicholas A.; Hunter, Neil

    2004-01-01

    Previous analysis of the microbiology of advanced caries by culture and real-time PCR emphasized the high incidence and abundance of gram-negative anaerobic species, particularly Prevotella-like bacteria. The diversity of Prevotella-like bacteria was further explored by analyzing pooled bacterial DNA from lesions of carious dentine. This was achieved by amplification of a region of the 16S ribosomal DNA with a Prevotella genus-specific forward primer and a universal bacterial reverse primer, followed by cloning and sequencing. Cultured Prevotella species commonly associated with oral tissues constituted only 12% of the Prevotella clones isolated from advanced carious lesions. The remaining 88% consisted of a diverse range of phylotypes. These included five clusters of previously recognized but uncultured oral Prevotella spp. and a major cluster containing Prevotella-like bacteria most closely related to uncharacterized rumen bacteria. Cluster-specific primers were designed, and the numbers of bacteria within clusters were quantified by real-time PCR, confirming the abundance of these organisms. The data indicated that advanced dental caries provides a unique environment for a complex array of novel and uncultured Prevotella and Prevotella-like bacteria which, in some cases, may dominate the diverse polymicrobial community associated with the disease. PMID:15528720

  20. Cultivation-Independent Characterization of Methylobacterium Populations in the Plant Phyllosphere by Automated Ribosomal Intergenic Spacer Analysis▿ †

    PubMed Central

    Knief, Claudia; Frances, Lisa; Cantet, Franck; Vorholt, Julia A.

    2008-01-01

    Bacteria of the genus Methylobacterium are widespread in the environment, but their ecological role in ecosystems, such as the plant phyllosphere, is not very well understood. To gain better insight into the distribution of different Methylobacterium species in diverse ecosystems, a rapid and specific cultivation-independent method for detection of these organisms and analysis of their community structure is needed. Therefore, 16S rRNA gene-targeted primers specific for this genus were designed and evaluated. These primers were used in PCR in combination with a reverse primer that binds to the tRNAAla gene, which is located upstream of the 23S rRNA gene in the 16S-23S intergenic spacer (IGS). PCR products that were of different lengths were obtained due to the length heterogeneity of the IGS of different Methylobacterium species. This length variation allowed generation of fingerprints of Methylobacterium communities in environmental samples by automated ribosomal intergenic spacer analysis. The Methylobacterium communities on leaves of different plant species in a natural field were compared using this method. The new method allows rapid comparisons of Methylobacterium communities and is thus a useful tool to study Methylobacterium communities in different ecosystems. PMID:18263752

  1. A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the LightCycler.

    PubMed

    Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg

    2002-12-01

    The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.

  2. Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae subsp. dysgalactiae isolated from farmed fish.

    PubMed

    Nomoto, R; Kagawa, H; Yoshida, T

    2008-01-01

    To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.

  3. Ancient DNA analyses of museum specimens from selected Presbytis (primate: Colobinae) based on partial Cyt b sequences

    NASA Astrophysics Data System (ADS)

    Aifat, N. R.; Yaakop, S.; Md-Zain, B. M.

    2016-11-01

    The IUCN Red List of Threatened Species has categorized Malaysian primates from being data deficient to critically endanger. Thus, ancient DNA analyses hold great potential to understand phylogeny, phylogeography and population history of extinct and extant species. Museum samples are one of the alternatives to provide important sources of biological materials for a large proportion of ancient DNA studies. In this study, a total of six museum skin samples from species Presbytis hosei (4 samples) and Presbytis frontata (2 samples), aged between 43 and 124 years old were extracted to obtain the DNA. Extraction was done by using QIAGEN QIAamp DNA Investigator Kit and the ability of this kit to extract museum skin samples was tested by amplification of partial Cyt b sequence using species-specific designed primer. Two primer pairs were designed specifically for P. hosei and P. frontata, respectively. These primer pairs proved to be efficient in amplifying 200bp of the targeted species in the optimized PCR conditions. The performance of the sequences were tested to determine genetic distance of genus Presbytis in Malaysia. From the analyses, P. hosei is closely related to P. chrysomelas and P. frontata with the value of 0.095 and 0.106, respectively. Cyt b gave a clear data in determining relationships among Bornean species. Thus, with the optimized condition, museum specimens can be used for molecular systematic studies of the Malaysian primates.

  4. Development of a single-tube loop-mediated isothermal amplification assay for detection of four pathogens of bacterial meningitis.

    PubMed

    Huy, Nguyen Tien; Hang, Le Thi Thuy; Boamah, Daniel; Lan, Nguyen Thi Phuong; Van Thanh, Phan; Watanabe, Kiwao; Huong, Vu Thi Thu; Kikuchi, Mihoko; Ariyoshi, Koya; Morita, Kouichi; Hirayama, Kenji

    2012-12-01

    Several loop-mediated isothermal amplification (LAMP) assays have been developed to detect common causative pathogens of bacterial meningitis (BM). However, no LAMP assay is reported to detect Streptococcus agalactiae and Streptococcus suis, which are also among common pathogens of BM. Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial pathogen. Thus, we aimed to design and develop a single-tube LAMP assay capable of detecting multiple bacterial species, based on the nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide sequences of the 16S rRNA genes of main pathogens involved in BM were aligned to identify conserved regions, which were further used to design broad range specific LAMP assay primers. We successfully designed a set of broad range specific LAMP assay primers for simultaneous detection of four species including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity with other bacteria including Haemophilus influenzae, Neisseria meningitidis and Escherichia coli. The sensitivity of our LAMP assay was 100-1000 times higher compared with the conventional PCR assay. The bacterial species could be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  5. Development and optimization of an efficient qPCR system for olive authentication in edible oils.

    PubMed

    Alonso-Rebollo, Alba; Ramos-Gómez, Sonia; Busto, María D; Ortega, Natividad

    2017-10-01

    The applicability of qPCR in olive-oil authentication depends on the DNA obtained from the oils and the amplification primers. Therefore, four olive-specific amplification systems based on the trnL gene were designed (A-, B-, C- and D-trnL systems). The qPCR conditions, primer concentration and annealing temperature, were optimized. The systems were tested for efficiency and sensitivity to select the most suitable for olive oil authentication. The selected system (D-trnL) demonstrated specificity toward olive in contrast to other oleaginous species (canola, soybean, sunflower, maize, peanut and coconut) and showed high sensitivity in a broad linear dynamic range (LOD and LOQ: 500ng - 0.0625pg). This qPCR system enabled detection, with high sensitivity and specificity, of olive DNA isolated from oils processed in different ways, establishing it as an efficient method for the authentication of olive oil regardless of its category. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Multiplex PCR for the Detection of Lactobacillus pontis and Two Related Species in a Sourdough Fermentation

    PubMed Central

    Müller, Martin R. A.; Ehrmann, Matthias A.; Vogel, Rudi F.

    2000-01-01

    A specific multiplex PCR assay based on the amplification of parts of the 16S rRNA molecule was designed. Primers derived from variable regions of the 16S rRNA provided a means of easily differentiating the species Lactobacillus pontis and Lactobacillus panis. They could be clearly discriminated from the phylogenetically related species Lactobacillus vaginalis, Lactobacillus oris, and Lactobacillus reuteri and from other lactobacilli commonly known to be present in sourdough. Other strains isolated together with L. pontis from an industrial sourdough fermentation could be clearly separated from these species by comparative sequence analysis and construction of a specific PCR primer. For a fast identification a DNA isolation protocol based on the ultrasonic lysis of cells from single colonies was developed. To demonstrate the potential of such techniques for tracking these organisms in a laboratory-scale fermentation, we combined the specific PCR assay with direct DNA extraction from the organisms in the sourdough without previous cultivation. PMID:10788389

  7. A TaqMan real-time PCR-based assay for the identification of Fasciola spp.

    PubMed

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-30

    Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. DEVELOPMENT OF CRASSPHAGE-BASED QPCR ASSAYS ...

    EPA Pesticide Factsheets

    A newly discovered bacteriophage, “crAssphage”, is predicted to be both highlyabundant and predominantly human-associated, both ideal characteristics for a human-specific fecal indicator. A total of 384 end-point PCR primers were designed along the length of the crAssphage genome, eliminating regions suspected to be hypervariable or react with other animal sources. The primer pairs were rigorously tested in three rounds of screening for specificity, geographic variability, limit of detection, and environmental water performance. The two best performing assays, crAss056 and crAss064, were adapted to a qPCR platform and exhibited a specificity of 98.0% and 98.9%, respectively. The markers’ abundance was compared with two bacterial based assays and were found at concentrations at or above the bacterial based assays in wastewater influent and impacted environmental waters. This poster will present the methodology of the novel marker development and the potential uses for this technology in maintaining sustainable waterways in the future. To inform the public.

  9. Hepatitis C Virus RNA Real-Time Quantitative RT-PCR Method Based on a New Primer Design Strategy.

    PubMed

    Chen, Lida; Li, Wenli; Zhang, Kuo; Zhang, Rui; Lu, Tian; Hao, Mingju; Jia, Tingting; Sun, Yu; Lin, Guigao; Wang, Lunan; Li, Jinming

    2016-01-01

    Viral nucleic acids are unstable when improperly collected, handled, and stored, resulting in decreased sensitivity of currently available commercial quantitative nucleic acid testing kits. Using known unstable hepatitis C virus RNA, we developed a quantitative RT-PCR method based on a new primer design strategy to reduce the impact of nucleic acid instability on nucleic acid testing. The performance of the method was evaluated for linearity, limit of detection, precision, specificity, and agreement with commercial hepatitis C virus assays. Its clinical application was compared to that of two commercial kits--Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) and Kehua. The quantitative RT-PCR method delivered a good performance, with a linearity of R(2) = 0.99, a total limit of detection (genotypes 1 to 6) of 42.6 IU/mL (95% CI, 32.84 to 67.76 IU/mL), a CV of 1.06% to 3.34%, a specificity of 100%, and a high concordance with the CAP/CTM assay (R(2) = 0.97), with a means ± SD value of -0.06 ± 1.96 log IU/mL (range, -0.38 to 0.25 log IU/mL). The method was superior to commercial assays in detecting unstable hepatitis C virus RNA (P < 0.05). This quantitative RT-PCR method can effectively eliminate the influence of RNA instability on nucleic acid testing. The principle of primer design strategy may be applied to the detection of other RNA or DNA viruses. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  10. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    NASA Astrophysics Data System (ADS)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  11. Primer-optimized results and trends for circular phasing and other circle-to-circle impulsive coplanar rendezvous

    NASA Astrophysics Data System (ADS)

    Sandrik, Suzannah

    Optimal solutions to the impulsive circular phasing problem, a special class of orbital maneuver in which impulsive thrusts shift a vehicle's orbital position by a specified angle, are found using primer vector theory. The complexities of optimal circular phasing are identified and illustrated using specifically designed Matlab software tools. Information from these new visualizations is applied to explain discrepancies in locally optimal solutions found by previous researchers. Two non-phasing circle-to-circle impulsive rendezvous problems are also examined to show the applicability of the tools developed here to a broader class of problems and to show how optimizing these rendezvous problems differs from the circular phasing case.

  12. RuBisCO large-subunit gene primers for assessing the CO2-assimilating planktonic community structure in Jiaozhou Bay, China.

    PubMed

    Chi, Xiang-Qun; Wang, Long; Guo, Ruoyu; Zhao, Dexi; Li, Jia; Zhang, Yongyu; Jiao, Nianzhi

    2018-06-19

    The protein coding genes (rbcL/cbbL/cbbM) for RuBisCO large subunit, the most abundant protein on earth that drives biological CO2 fixation, were considered as useful marker genes in characterizing CO2-assimilating plankton. However, their community specificity has hindered comprehensive screening of genetic diversity. In this study, six different rbcL/cbbL/cbbM primers were employed to screen clone libraries to identify CO2-assimilating plankton in Jiaozhou Bay. The following community compositions were observed: the community components in Form I A/B rbcL/cbbL clone library mainly comprised Chlorophyta and Proteobacteria, Form ID2 and ID3 libraries consisted of Bacillariophyta, Form II cbbM library consisted of Proteobacteria and Alveolata, and both Form I green and red libraries included Proteobacteria, respectively. At the genus taxonomic level, no overlaps among these clone libraries were observed, except for ID2 and ID3. Overall, the phytoplankton in Jiaozhou Bay mainly consists of Bacillariophyta, Chlorophyta, Cryptophyta, Haptophyceae, and Alveolata. The CO2-assimilating prokaryotes mainly consist of Proteobacteria. Considering the high sequence specificities of these marker genes, we propose that the joint use of multiple primers may be utilized in unveiling the diversity of CO2-assimilating organisms. In addition, designing novel RuBisCO gene primers that generate longer amplicons and have broader phylogenetic coverage may be necessary in the future.

  13. A blackberry (Rubus L.) expressed sequence tag library for the development of simple sequence repeat markers

    PubMed Central

    Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P

    2008-01-01

    Background The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST) library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR), and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry. PMID:18570660

  14. Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

    PubMed

    Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

    2009-12-01

    The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

  15. Multiplex PCR assay to identify methicillin-resistant Staphylococcus haemolyticus.

    PubMed

    Schuenck, Ricardo P; Pereira, Eliezer M; Iorio, Natalia L P; Dos Santos, Kátia R N

    2008-04-01

    Staphylococcus haemolyticus is the most frequently coagulase-negative Staphylococcus species associated with antimicrobial resistance isolated from nosocomial infections. We developed an accurate and simple multiplex PCR assay to identify methicillin-resistant S. haemolyticus (MRSH) isolates. We designed species-specific primers of the mvaA gene that encodes a 3-hydroxy-3-methylglutaryl coenzyme A involved in the mevalonate pathway of the microorganism. Simultaneously, mecA gene primers of methicillin resistance were also used. The PCR assay was established using 16 strains of different reference Staphylococcus species and validated with a collection of 147 clinical staphylococcal isolates that were also phenotypically characterized. Reliable results for the detection of MRSH isolates were obtained for 100% of the strains evaluated, showing that this PCR assay can be used for the routine microbiology laboratories. This is the first report using species-specific multiplex PCR to detect a single segment of S. haemolyticus associated with a segment of mecA gene.

  16. Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

    PubMed

    Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

    2016-07-01

    This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step.

  17. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    USGS Publications Warehouse

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  18. Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis.

    PubMed

    Hallur, V; Sehgal, R; Khurana, S

    2015-01-01

    The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR) inhibitors thus, undermining the confidence of a laboratory physician. We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

  19. swga: a primer design toolkit for selective whole genome amplification.

    PubMed

    Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

    2017-07-15

    Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  20. A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

    PubMed

    Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

    2012-06-01

    The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

  1. Development and validation of a multiplex PCR for detection of Scedosporium spp. in respiratory tract specimens from patients with cystic fibrosis.

    PubMed

    Harun, Azian; Blyth, Christopher C; Gilgado, Felix; Middleton, Peter; Chen, Sharon C-A; Meyer, Wieland

    2011-04-01

    The emergence of Scedosporium infections in diverse groups of individuals, which are often treatment refractory, warrants timely and accurate laboratory diagnosis. Species- or group-specific primers based on internal transcribed spacer (ITS) sequence polymorphisms were designed for Scedosporium aurantiacum, Scedosporium dehoogii, Scedosporium prolificans, Pseudallescheria boydii species complex (former clade 5)/Pseudallescheria apiosperma (formerly classified as S. apiospermum sensu lato) and Pseudallescheria minutispora. Primers for S. aurantiacum, S. prolificans, and P. boydii species complex/P. apiosperma were incorporated into a multiplex PCR assay for the detection and identification of the three major clinically important Scedosporium species and validated using sputum specimens collected from patients seen at a major Australian cystic fibrosis clinic. The multiplex PCR assay showed 100% specificity in identifying the three major clinically relevant Scedosporium species from pure culture. When evaluated using DNA extracts from sputa, sensitivity and specificity of the multiplex PCR assay were 62.1% and 97.2%, respectively. This highly species-specific multiplex PCR assay offers a rapid and simple method of detection of the most clinically important Scedosporium species in respiratory tract specimens.

  2. A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

    PubMed

    Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

    2015-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

  3. The development and mapping of functional markers in Fragaria and their transferability and potential for mapping in other genera.

    PubMed

    Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R

    2007-01-01

    We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.

  4. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP) for Rapid Detection and Differentiation of Listeria monocytogenes.

    PubMed

    Wang, Yi; Wang, Yan; Ma, Aijing; Li, Dongxun; Luo, Lijuan; Liu, Dongxin; Hu, Shoukui; Jin, Dong; Liu, Kai; Ye, Changyun

    2015-12-03

    Here, a novel model of loop-mediated isothermal amplification (LAMP), termed multiple inner primers-LAMP (MIP-LAMP), was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD) of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD), or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  5. Improved PCR assay for the species-specific identification and quantitation of Legionella pneumophila in water.

    PubMed

    Cho, Min Seok; Ahn, Tae-Young; Joh, Kiseong; Lee, Eui Seok; Park, Dong Suk

    2015-11-01

    Legionellosis outbreak is a major global health care problem. However, current Legionella risk assessments may be compromised by uncertainties in Legionella detection methods, infectious dose, and strain infectivity. These limitations may place public health at significant risk, leading to significant monetary losses in health care. However, there are still unmet needs for its rapid identification and monitoring of legionellae in water systems. Therefore, in the present study, a primer set was designed based on a LysR-type transcriptional regulator (LTTR) family protein gene of Legionella pneumophila subsp. pneumophila str. Philadelphia 1 because it was found that this gene is structurally diverse among species through BLAST searches. The specificity of the primer set was evaluated using genomic DNA from 6 strains of L. pneumophila, 5 type strains of other related Legionella species, and other 29 reference pathogenic bacteria. The primer set used in the PCR assay amplified a 264-bp product for only targeted six strains of L. pneumophila. The assay was also able to detect at least 1.39 × 10(3) copies/μl of cloned amplified target DNA using purified DNA or 7.4 × 10(0) colony-forming unit per reaction when using calibrated cell suspension. In addition, the sensitivity and specificity of this assay were confirmed by successful detection of Legionella pneumophila in environmental water samples.

  6. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

    USGS Publications Warehouse

    Taylor, P.W.; Winton, J.R.

    2002-01-01

    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  7. Detection of a Novel Porcine Parvovirus in Chinese Swine Herds

    USDA-ARS?s Scientific Manuscript database

    To determine whether the recently reported novel porcine parvovirus type 4 (PPV4) is prevalent in China, a set of PPV4 specific primers were designed and used for the molecular survey of PPV4 among clinical samples. The results indicated a positive detection for PPV4 in Chinese swine herds of 1.84% ...

  8. Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

    PubMed

    Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

    2013-01-01

    Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

  9. GST-PRIME: an algorithm for genome-wide primer design.

    PubMed

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  10. Development and application of a rapid and visual loop-mediated isothermal amplification for the detection of Sporisorium scitamineum in sugarcane

    PubMed Central

    Su, Yachun; Yang, Yuting; Peng, Qiong; Zhou, Dinggang; Chen, Yun; Wang, Zhuqing; Xu, Liping; Que, Youxiong

    2016-01-01

    Smut is a fungal disease with widespread prevalence in sugarcane planting areas. Early detection and proper identification of Sporisorium scitamineum are essential in smut management practices. In the present study, four specific primers targeting the core effector Pep1 gene of S. scitamineum were designed. Optimal concentrations of Mg2+, primer and Bst DNA polymerase, the three important components of the loop-mediated isothermal amplification (LAMP) reaction system, were screened using a single factor experiment method and the L16(45) orthogonal experimental design. Hence, a LAMP system suitable for detection of S. scitamineum was established. High specificity of the LAMP method was confirmed by the assay of S. scitamineum, Fusarium moniliforme, Pestalotia ginkgo, Helminthospcrium sacchari, Fusarium oxysporum and endophytes of Yacheng05-179 and ROC22. The sensitivity of the LAMP method was equal to that of the conventional PCR targeting Pep1 gene and was 100 times higher than that of the conventional PCR assay targeting bE gene in S. scitamineum. The results suggest that this novel LAMP system has strong specificity and high sensitivity. This method not only provides technological support for the epidemic monitoring of sugarcane smut, but also provides a good case for development of similar detection technology for other plant pathogens. PMID:27035751

  11. Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

    PubMed

    Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

    2010-02-01

    To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

  12. Development of SCAR markers for sex determination in the dioecious shrub Aucuba japonica (Cornaceae).

    PubMed

    Maki, Masayuki

    2009-03-01

    Two sex-linked fragments were identified by RAPD analyses in the dioecious diploid shrub Aucuba japonica var. ovoidea and were converted into markers of male-specific sequence characterized amplified region (SCAR) markers. PCRs using the primers designed in this study correctly discriminated 24 flowering males and 24 flowering females at higher annealing temperatures (SCAR markers OPA10-424 at 55 degrees C and OPN11-1095 at 65 degrees C), although at relatively low annealing temperatures, the fragments were amplified in both males and females. These SCAR primers were also tested to see whether they were applicable to sex identification in the conspecific tetraploid Aucuba japonica var. japonica. One set pf SCAR primers could be used for sex identification even in this tetraploid variety, although the other failed. The SCAR markers developed in this study will provide a powerful tool in identifying the sex of immature plants of dioecious A. japonica, which is a commercially valuable shrub due to its conspicuous fruits.

  13. Pentaplex PCR as screening assay for jellyfish species identification in food products.

    PubMed

    Armani, Andrea; Giusti, Alice; Castigliego, Lorenzo; Rossi, Aurelio; Tinacci, Lara; Gianfaldoni, Daniela; Guidi, Alessandra

    2014-12-17

    Salted jellyfish, a traditional food in Asian Countries, is nowadays spreading on the Western markets. In this work, we developed a Pentaplex PCR for the identification of five edible species (Nemopilema nomurai, Rhopilema esculentum, Rhizostoma pulmo, Pelagia noctiluca, and Cotylorhiza tuberculata), which cannot be identified by a mere visual inspection in jellyfish products sold as food. A common degenerated forward primer and five specie-specific reverse primers were designed to amplify COI gene regions of different lengths. Another primer pair targeted the 28SrRNA gene and was intended as common positive reaction control. Considering the high level of degradation in the DNA extracted from acidified and salted products, the maximum length of the amplicons was set at 200 bp. The PCR was developed using 66 reference DNA samples. It gave successful amplifications in 85.4% of 48 ready to eat products (REs) and in 60% of 30 classical salted products (CPs) collected on the market.

  14. Design and Validation of Real-Time PCR: Quantitative Diagnosis of Common Leishmania Species in Iran.

    PubMed

    Fekri Soofi Abadi, Maryam; Dabiri, Shahriar; Fotouhi Ardakani, Reza; Fani Malaki, Lina; Amirpoor Rostami, Sahar; Ziasistani, Mahsa; Dabiri, Donya

    2016-07-01

    Design and validation of Real-time PCR on the protected gene region ITS2 to quantify the parasite load in common leishmania (L) species. Probe and primer were designed from the ITS2 region between the rRNA genes with minimum gene variation in three common leishmania species followed by a Real-time PCR using the Taq man probe method in the form of absolute quantification. A series of different concentrations of leishmania were analyzed. After the purified PCR product was successfully placed in a PTG19-T plasmid vector, specialized ITS2 region was cloned in this plasmid. In the last phase, the cloned gene was transferred to the Ecoli.Top10F bacteria. The standard plasmid was provided in 10(7) to 10(1) copies/rxn concentrations. The specification and clinical sensitivity of the data was analyzed using inter and intra scales. The probe and primer were designed using three species, including L. infantum, L. major, and L.tropica. Seven concentrations of purified parasite in culture media showed that the selected region for quantifying the parasite is suitable. Clinical and analytical specificity and sensitivity were both 100%, respectively. The Taq man method for the ITS2 region in leishmania is one the most sensitive diagnostic test for identifying the parasite load and is suggested as a tool for fast identification and quantification of species.

  15. Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†

    PubMed Central

    Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

    2000-01-01

    We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916

  16. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    PubMed Central

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  17. Population diversity of ammonium oxidizers investigated by specific PCR amplification

    USGS Publications Warehouse

    Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

    1997-01-01

    The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

  18. Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

    DTIC Science & Technology

    2015-08-01

    preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally

  19. Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

    PubMed

    Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M; McClean, Phillip E

    2014-01-01

    Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate.

  20. Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

    PubMed Central

    Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M.; McClean, Phillip E.

    2013-01-01

    Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate. PMID:24860578

  1. Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.

    PubMed

    Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn

    2015-03-20

    USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.

  2. Marker-assisted selection for recognizing wheat mutant genotypes carrying HMW glutenin alleles related to baking quality.

    PubMed

    Zamani, Mohammad Javad; Bihamta, Mohammad Reza; Naserian Khiabani, Behnam; Tahernezhad, Zahra; Hallajian, Mohammad Taher; Shamsi, Marzieh Varasteh

    2014-01-01

    Allelic diversity of HMW glutenin loci in several studies revealed that allelic combinations affect dough quality. Dx5 + Dy10 subunits are related to good baking quality and Dx2 + Dy12 are related to undesirable baking quality. One of the most regular methods to evaluate the baking quality is SDS-PAGE which is used to improve baking quality labs. Marker-assisted selection is the method which can recognize the alleles related to baking quality and this method is based on polymerase chain reaction. 10 pairs of specific primers related to Dx2, Dx2.1, Dx5, Dy10, and Dy12 subunits were used for recognizing baking quality of some wheat varieties and some mutant genotypes. Only 5 pairs of them could show the specific bands. All subunits were recognized by the primers except Dx2.1. Some of the primers were extracted from previous studies and the others were designed based on D genome subunits of wheat. SDS-PAGE method accomplished having confidence in these marker's results. To realize the effect of mutation, seed storage proteins were measured. It showed that mutation had effect on the amount of seed storage protein on the mutant seeds (which showed polymorphism).

  3. Polymerase Spiral Reaction (PSR): A novel isothermal nucleic acid amplification method.

    PubMed

    Liu, Wei; Dong, Derong; Yang, Zhan; Zou, Dayang; Chen, Zeliang; Yuan, Jing; Huang, Liuyu

    2015-07-29

    In this study, we report a novel isothermal nucleic acid amplification method only requires one pair of primers and one enzyme, termed Polymerase Spiral Reaction (PSR) with high specificity, efficiency, and rapidity under isothermal condition. The recombinant plasmid of blaNDM-1 was imported to Escherichia coli BL21, and selected as the microbial target. PSR method employs a Bst DNA polymerase and a pair of primers designed targeting the blaNDM-1 gene sequence. The forward and reverse Tab primer sequences are reverse to each other at their 5' end (Nr and N), whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The PSR method was performed at a constant temperature 61 °C-65 °C, yielding a complicated spiral structure. PSR assay was monitored continuously in a real-time turbidimeter instrument or visually detected with the aid of a fluorescent dye (SYBR Greenı), and could be finished within 1 h with a high accumulation of 10(9) copies of the target and a fine sensitivity of 6 CFU per reaction. Clinical evaluation was also conducted using PSR, showing high specificity of this method. The PSR technique provides a convenient and cost-effective alternative for clinical screening, on-site diagnosis and primary quarantine purposes.

  4. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

    PubMed

    Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

    2018-01-01

    Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

  5. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system

    PubMed Central

    2018-01-01

    Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254

  6. Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

    PubMed Central

    Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

    2003-01-01

    A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

  7. MRPrimerV: a database of PCR primers for RNA virus detection

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  8. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

  9. A multiplex PCR assay for determination of mating type in isolates of the honey bee fungal pathogen, Ascosphaera apis

    USDA-ARS?s Scientific Manuscript database

    In this study we developed a multiplex PCR for identification of mating type idiomorphs in the filamentous fungus, Ascosphaera apis, the causative agent of chalkbrood disease in the honey bee (Apis melliffera). A combination of gene-specific primers was designed to amplify Mat1-1 and Mat1-2 gene fra...

  10. Rapid and Sensitive Detection of sFAT-1 Transgenic Pigs by Visual Loop-Mediated Isothermal Amplification.

    PubMed

    Tao, Chenyu; Yang, Yalan; Li, Xunbi; Zheng, Xinmin; Ren, Hongyan; Li, Kui; Zhou, Rong

    2016-07-01

    Genetically modified (GM) livestock have the potential to contribute to improving the environment and human health, with consumption of fewer resources and reduced waste production. However, the transgene process also poses risks. The safety assessment and control of transgenic animal products have drawn wide attention, and the relevant regulations and technology are being developed. Quick testing technology plays a significant role in on-site and customs sampling. Nowadays, loop-mediated isothermal amplification (LAMP) was widely applied in nucleic acid analysis because of its simplicity, rapidity, high efficiency and specificity. In this study, a specific, sensitive detection system for detecting sFAT-1 transgenic pigs was designed. A set of six primers including two loop primers was designed for the target sequence. The DNA samples were amplified in less than 1 h at the optimized temperature and detecting by both Nephelometer LA-320c and unaided eyes directly adding calcein. The detection limit of sFAT-1 LAMP was as low as 1.26 ng/μL. Furthermore, blind tests of transgenic and non-transgenic DNA samples were all correctly detected. Hence, the results in this study demonstrated that LAMP is a very useful tool for transgenic detection.

  11. Rapid and sensitive detection of Curvularia lunata associated with maize leaf spot based on its Clg2p gene using semi-nested PCR.

    PubMed

    Hou, J M; Ma, B C; Zuo, Y H; Guo, L L; Gao, S G; Wang, Y Y; Liu, T

    2013-04-01

    Curvularia lunata (Wakker) Boed, the causative agent of Curvularia leaf spot in maize, was determined according to conidiophore and conidium morphology in a previous study. In the current study, a sensitive polymerase chain reaction assay was developed for the detection of C. lunata. Two specific forward (ClgD1/ClgD2) and one reverse primers (ClgD3) were designed based on a Ras-related (Clg2p) gene. Eight C. lunata isolates that represent different virulent strains in maize, six other Curvularia spp., and 22 fungal plant pathogens were used to test the specificity of the primers. PCR amplification using ClgD1/ClgD3 as the first-round primers resulted in an 870-bp band from the C. lunata isolates. The detection sensitivity using ClgD1/ClgD3 was 100 pg of genomic DNA. In the second round of PCR, a 1 : 50 dilution of the first-round PCR products was used as a template with the ClgD2/ClgD3 primer pair, which increased the detection sensitivity to 1 fg. This semi-nested PCR procedure could also be used to detect C. lunata from infected maize leaves. The proposed PCR-based assay may be used for diagnosing and monitoring maize Curvularia leaf spot. The semi-nested PCR assay may provide researchers and laboratory technologists a tool to rapidly detect C. lunata, which causes maize Curvularia leaf spot, compared with histological examination. © 2012 The Society for Applied Microbiology.

  12. Quantification of Endospore-Forming Firmicutes by Quantitative PCR with the Functional Gene spo0A

    PubMed Central

    Bueche, Matthieu; Wunderlin, Tina; Roussel-Delif, Ludovic; Junier, Thomas; Sauvain, Loic; Jeanneret, Nicole

    2013-01-01

    Bacterial endospores are highly specialized cellular forms that allow endospore-forming Firmicutes (EFF) to tolerate harsh environmental conditions. EFF are considered ubiquitous in natural environments, in particular, those subjected to stress conditions. In addition to natural habitats, EFF are often the cause of contamination problems in anthropogenic environments, such as industrial production plants or hospitals. It is therefore desirable to assess their prevalence in environmental and industrial fields. To this end, a high-sensitivity detection method is still needed. The aim of this study was to develop and evaluate an approach based on quantitative PCR (qPCR). For this, the suitability of functional genes specific for and common to all EFF were evaluated. Seven genes were considered, but only spo0A was retained to identify conserved regions for qPCR primer design. An approach based on multivariate analysis was developed for primer design. Two primer sets were obtained and evaluated with 16 pure cultures, including representatives of the genera Bacillus, Paenibacillus, Brevibacillus, Geobacillus, Alicyclobacillus, Sulfobacillus, Clostridium, and Desulfotomaculum, as well as with environmental samples. The primer sets developed gave a reliable quantification when tested on laboratory strains, with the exception of Sulfobacillus and Desulfotomaculum. A test using sediment samples with a diverse EFF community also gave a reliable quantification compared to 16S rRNA gene pyrosequencing. A detection limit of about 104 cells (or spores) per gram of initial material was calculated, indicating this method has a promising potential for the detection of EFF over a wide range of applications. PMID:23811505

  13. PCR method based on the ogdH gene for the detection of Salmonella spp. from chicken meat samples.

    PubMed

    Jin, Un-Ho; Cho, Sung-Hak; Kim, Min-Gon; Ha, Sang-Do; Kim, Keun-Sung; Lee, Kyu-Ho; Kim, Kwang-Yup; Chung, Duck Hwa; Lee, Young-Choon; Kim, Cheorl-Ho

    2004-09-01

    In a previous paper, the ogdH gene that encodes 2-oxoglutarate dehydrogenase was isolated from Salmonella typhimurium. The catalytic N-terminal region in the enzyme was found to be very specific for the Salmonella species. Therefore, the aim of the present study was to detect S. typhimurium in food sources using primers designed for OGDH-1 and OGDH-2 which were based on the salmonella-specific region of the ogdH gene. A simple polymerase chain reaction (PCR) detection method was developed to detect low numbers of S. typhimurium in a chicken meat microbial consortium. Using the ogdH-specific primers under stringent amplification conditions and for gene probe analysis, fewer than 100 colony-forming units (CFUs) were detectable when pure cultures were employed. When the PCR assay was run on S. typhimurium-contaminated meat contents, only the positive meat samples containing as few as 200 CFUs reacted to the assay. The method employed for sample processing is simple and it was determined to provide a sensitive means of detecting trace amounts of S. typhimurium-specific sequences in the presence of mixed meat microbial populations. When compared with six representative intestinal gram-negative bacterial strains in foods, including Vibrio parahaemolyticus, V. vulnificus, Enterobacter cloacae, E. coli O157:H7, Pseudomonas aeruginosa, and Proteus sp., S. typhimurium had a unique and distinct PCR product (796 bp). In conclusion, the two OGDH primers were found to be rapid and sensitive detectors of Salmonella spp for the PCR method. Copyright 2004 The Microbiological Society of Korea

  14. Comparative analysis of detection limits and specificity of molecular diagnostic markers for three pathogens (Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus terrestris.

    PubMed

    Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G

    2012-04-01

    Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.

  15. A qRT-PCR assay for the expression of all Mal d 1 isoallergen genes

    PubMed Central

    2013-01-01

    Background A considerable number of individuals suffer from oral allergy syndrome (OAS) to apple, resulting in the avoidance of apple consumption. Apple cultivars differ greatly in their allergenic properties, but knowledge of the causes for such differences is incomplete. Mal d 1 is considered the major apple allergen. For Mal d 1, a wide range of isoallergens and variants exist, and they are encoded by a large gene family. To identify the specific proteins/genes that are potentially involved in the allergy, we developed a PCR assay to monitor the expression of each individual Mal d 1 gene. Gene-specific primer pairs were designed for the exploitation of sequence differences among Mal d 1 genes. The specificity of these primers was validated using both in silico and in vitro techniques. Subsequently, this assay was applied to the peel and flesh of fruits from the two cultivars ‘Florina’ and ‘Gala’. Results We successfully developed gene-specific primer pairs for each of the 31 Mal d 1 genes and incorporated them into a qRT-PCR assay. The results from the application of the assay showed that 11 genes were not expressed in fruit. In addition, differential expression was observed among the Mal d 1 genes that were expressed in the fruit. Moreover, the expression levels were tissue and cultivar dependent. Conclusion The assay developed in this study facilitated the first characterisation of the expression levels of all known Mal d 1 genes in a gene-specific manner. Using this assay on different fruit tissues and cultivars, we obtained knowledge concerning gene relevance in allergenicity. This study provides new perspectives for research on both plant breeding and immunotherapy. PMID:23522122

  16. A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

    PubMed

    Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

    2015-06-01

    The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  17. Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

    PubMed Central

    Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

    1994-01-01

    Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

  18. Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

    PubMed Central

    Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

    2011-01-01

    Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

  19. Rapid and reliable diagnostic method to detect Zika virus by real-time fluorescence reverse transcription loop-mediated isothermal amplification.

    PubMed

    Guo, Xu-Guang; Zhou, Yong-Zhuo; Li, Qin; Wang, Wei; Wen, Jin-Zhou; Zheng, Lei; Wang, Qian

    2018-04-18

    To detect Zika virus more rapidly and accurately, we developed a novel method that utilized a real-time fluorescence reverse transcription loop-mediated isothermal amplification (LAMP) technique. The NS5 gene was amplified by a set of six specific primers that recognized six distinct sequences. The amplification process, including 60 min of thermostatic reaction with Bst DNA polymerase following real-time fluorescence reverse transcriptase using genomic Zika virus standard strain (MR766), was conducted through fluorescent signaling. Among the six pairs of primers that we designate here, NS5 was the most efficient with a high sensitivity of up to 3.3 ng/μl and reproducible specificity on eight pathogen samples that were used as negative controls. The real-time fluorescence reverse transcription LAMP detection process can be completed within 35 min. Our study demonstrated that real-time fluorescence reverse transcription LAMP could be highly beneficial and convenient clinical application to detect Zika virus due to its high specificity and stability.

  20. Method for rapid detection and identification of chaetomium and evaluation of resistance to peracetic acid.

    PubMed

    Nakayama, Motokazu; Hosoya, Kouichi; Tomiyama, Daisuke; Tsugukuni, Takashi; Matsuzawa, Tetsuhiro; Imanishi, Yumi; Yaguchi, Takashi

    2013-06-01

    In the beverage industry, peracetic acid has been increasingly used as a disinfectant for the filling machinery and environment due to merits of leaving no residue, it is safe for humans, and its antiseptic effect against fungi and endospores of bacteria. Recently, Chaetomium globosum and Chaetomium funicola were reported resistant to peracetic acid; however, little is known concerning the detail of peracetic acid resistance. Therefore, we assessed the peracetic acid resistance of the species of Chaetomium and related genera under identical conditions and made a thorough observation of the microstructure of their ascospores by transmission electron microscopy. The results of analyses revealed that C. globosum and C. funicola showed the high resistance to peracetic acid (a 1-D antiseptic effect after 900 s and 3-D antiseptic effect after 900 s) and had thick cell walls of ascospores that can impede the action mechanism of peracetic acid. We also developed specific primers to detect the C. globosum clade and identify C. funicola by using PCR to amplify the β-tubulin gene. PCR with the primer sets designed for C. globosum (Chae 4F/4R) and C. funicola (Cfu 2F/2R) amplified PCR products specific for the C. globosum clade and C. funicola, respectively. PCR with these two primer sets did not detect other fungi involved in food spoilage and environmental contamination. This detection and identification method is rapid and simple, with extremely high specificity.

  1. Specific Detection of Clavibacter michiganensis subsp. sepedonicus by Amplification of Three Unique DNA Sequences Isolated by Subtraction Hybridization.

    PubMed

    Mills, D; Russell, B W; Hanus, J W

    1997-08-01

    ABSTRACT Three single-copy, unique DNA fragments, designated Cms50, Cms72, and Cms85, were isolated from strain CS3 of Clavibacter michiganensis subsp. sepedonicus by subtraction hybridization using driver DNA from C. michiganensis subsp. insidiosus, C. michiganensis subsp. michiganensis, and Rhodococcus facians. Radio-labeled probes made of these fragments and used in Southern blot analysis revealed each to be absolutely specific to all North American C. michiganensis subsp. sepedonicus strains tested, including plasmidless and nonmucoid strains. The probes have no homology with genomic DNA from related C. michiganensis subspecies insidiosus, michiganensis, and tessellarius, nor with DNA from 11 additional bacterial species and three unidentified strains, some of which have been previously reported to display cross-reactivity with C. michiganensis subsp. sepedonicus-specific antisera. The three fragments shared no homology, and they appeared to be separated from each other by at least 20 kbp in the CS3 genome. Internal primer sets permitted amplification of each fragment by the polymerase chain reaction (PCR) only from C. michiganensis subsp. sepedonicus DNA. In a PCR-based sensitivity assay using a primer set that amplifies Cms85, the lowest level of detection of C. michiganensis subsp. sepedonicus was 100 CFU per milliliter when cells were added to potato core fluid. Erroneous results that may arise from PCR artifacts and mutational events are, therefore, minimized by the redundancy of the primer sets, and the products should be verifiable with unique capture probes in sequence-based detection systems.

  2. Discrimination of Spore-Forming Bacilli Using spoIVA

    NASA Technical Reports Server (NTRS)

    Venkateswaran, Kasthuri; LaDuc, Myron; Stuecker, Tara

    2009-01-01

    A method of discriminating between spore-forming and non-spore-forming bacteria is based on a combination of simultaneous sporulation-specific and non-sporulation-specific quantitative polymerase chain reactions (Q-PCRs). The method was invented partly in response to the observation that for the purposes of preventing or reducing biological contamination affecting many human endeavors, ultimately, only the spore-forming portions of bacterial populations are the ones that are problematic (or, at least, more problematic than are the non-spore-forming portions). In some environments, spore-forming bacteria constitute small fractions of the total bacterial populations. The use of sporulation-specific primers in Q-PCR affords the ability to assess the spore-forming fraction of a bacterial population present in an environment of interest. This assessment can provide a more thorough and accurate understanding of the bacterial contamination in the environment, thereby making it possible to focus contamination- testing, contamination-prevention, sterilization, and decontamination resources more economically and efficiently. The method includes the use of sporulation-specific primers in the form of designed, optimized deoxyribonucleic acid (DNA) oligonucleotides specific for the bacterial spoIVA gene (see table). [In "spoIVA," "IV" signifies Roman numeral four and the entire quoted name refers to gene A for the fourth stage of sporulation.] These primers are mixed into a PCR cocktail with a given sample of bacterial cells. A control PCR cocktail into which are mixed universal 16S rRNA primers is also prepared. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] Following several cycles of heating and cooling according to the PCR protocol to amplify amounts of DNA molecules, the amplification products can be analyzed to determine the types of bacterial cells present within the samples. If the amplification product is strong, relative to the product of a control PCR sequence, then it is concluded that the bacterial population in the sample consists predominantly of spore-forming cells. If the amplification product is weak or nonexistent, then it is concluded that the bacterial population in the sample consists predominantly or entirely of non-spore-forming cells.

  3. Isolation of a species-specific mitochondrial DNA sequence for identification of Tilletia indica, the Karnal bunt of wheat fungus.

    PubMed Central

    Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W

    1996-01-01

    Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716

  4. Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification.

    PubMed

    Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun

    2015-07-08

    We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.

  5. Comparative study of diagnostic accuracy of established PCR assays and in-house developed sdaA PCR method for detection of Mycobacterium tuberculosis in symptomatic patients with pulmonary tuberculosis.

    PubMed

    Nimesh, Manoj; Joon, Deepali; Pathak, Anil Kumar; Saluja, Daman

    2013-11-01

    Indian contribution to global burden of tuberculosis is about 26%. In the present study we have developed an in-house PCR assay using primers for sdaA gene of Mycobacterium tuberculosis and evaluated against already established primers devR, IS6110, MPB64, rpoB primers for diagnosis of pulmonary tuberculosis. Using universal sample preparation (USP) method, DNA was extracted from sputum specimens of 412 symptomatic patients from Delhi, India. The DNA so extracted was used as template for PCR amplification using primers targeting sdaA, devR, IS6110, MPB64 and rpoB genes. Out of 412, 149 specimens were considered positive based on composite reference standard (CRS) criteria. The in-house designed sdaA PCR showed high specificity (96.5%), the high positive likelihood ratio (28), the high sensitivity (95.9%), and the very low negative likelihood ratio (0.04) in comparison to CRS. Based on our results, the sdaA PCR assay can be considered as one of the most reliable diagnostic tests in comparison to other PCR based detection methods. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  6. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    PubMed Central

    2012-01-01

    Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984

  7. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia.

    PubMed

    Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed

    2012-08-10

    Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  8. Efficacy of species-specific recA PCR tests in the identification of Burkholderia cepacia complex environmental isolates.

    PubMed

    Dalmastri, Claudia; Pirone, Luisa; Tabacchioni, Silvia; Bevivino, Annamaria; Chiarini, Luigi

    2005-05-01

    In this study, we evaluated if recA species-specific PCR assays could be successfully applied to identify environmental isolates of the widespread Burkholderia cepacia complex (Bcc) species. A total of 729 Bcc rhizosphere isolates collected in different samplings were assigned to the species B. cepacia genomovar I (61), B. cenocepacia recA lineage IIIB (514), B. ambifaria (124) and B. pyrrocinia (30), by means of recA (RFLP) analysis, and PCR tests were performed to assess sensitivity and specificity of recA species-specific primers pairs. B. cepacia genomovar I specific primers produced the expected amplicon with all isolates of the corresponding species (sensitivity, 100%), and cross-reacted with all B. pyrrocinia isolates. On the contrary, B. cenocepacia IIIB primers did not give the expected amplicon in 164 B. cenocepacia IIIB isolates (sensitivity, 68.1%), and isolates of distinct populations showed different sensitivity. B. ambifaria primers failed to amplify a recA-specific fragment only in a few isolates of this species (sensitivity, 93.5%). The absence of specific amplification in a high number of B. cenocepacia rhizosphere isolates indicates that recA specific PCR assays can lead to an underestimation of environmental microorganisms belonging to this bacterial species.

  9. Primer Modification Improves Rapid and Sensitive In Vitro and Field-Deployable Assays for Detection of High Plains Virus Variants

    PubMed Central

    Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.

    2014-01-01

    A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574

  10. Identification of Pork Adulteration in Processed Meat Products Using the Developed Mitochondrial DNA-Based Primers

    PubMed Central

    Ha, Jimyeong; Kim, Sejeong; Lee, Jeeyeon; Lee, Soomin; Lee, Heeyoung; Choi, Yukyung; Oh, Hyemin; Yoon, Yohan

    2017-01-01

    The identification of pork in commercially processed meats is one of the most crucial issues in the food industry because of religious food ethics, medical purposes, and intentional adulteration to decrease production cost. This study therefore aimed to develop a method for the detection of pork adulteration in meat products using primers specific for pig mitochondrial DNA. Mitochondrial DNA sequences for pig, cattle, chicken, and sheep were obtained from GenBank and aligned. The 294-bp mitochondrial DNA D-loop region was selected as the pig target DNA sequence and appropriate primers were designed using the MUSCLE program. To evaluate primer sensitivity, pork-beef-chicken mixtures were prepared as follows: i) 0% pork-50% beef-50% chicken, ii) 1% pork-49.5% beef-49.5% chicken, iii) 2% pork-49% beef-49% chicken, iv) 5% pork-47.5% beef-47.5% chicken, v) 10% pork-45% beef-45% chicken, and vi) 100% pork-0% beef-0% chicken. In addition, a total of 35 commercially packaged products, including patties, nuggets, meatballs, and sausages containing processed chicken, beef, or a mixture of various meats, were purchased from commercial markets. The primers developed in our study were able to detect as little as 1% pork in the heat treated pork-beef-chicken mixtures. Of the 35 processed products, three samples were pork positive despite being labeled as beef or chicken only or as a beef-chicken mix. These results indicate that the developed primers could be used to detect pork adulteration in various processed meat products for application in safeguarding religious food ethics, detecting allergens, and preventing food adulteration. PMID:28747833

  11. Development and Validation of a Multiplex PCR for Detection of Scedosporium spp. in Respiratory Tract Specimens from Patients with Cystic Fibrosis▿

    PubMed Central

    Harun, Azian; Blyth, Christopher C.; Gilgado, Felix; Middleton, Peter; Chen, Sharon C.-A.; Meyer, Wieland

    2011-01-01

    The emergence of Scedosporium infections in diverse groups of individuals, which are often treatment refractory, warrants timely and accurate laboratory diagnosis. Species- or group-specific primers based on internal transcribed spacer (ITS) sequence polymorphisms were designed for Scedosporium aurantiacum, Scedosporium dehoogii, Scedosporium prolificans, Pseudallescheria boydii species complex (former clade 5)/Pseudallescheria apiosperma (formerly classified as S. apiospermum sensu lato) and Pseudallescheria minutispora. Primers for S. aurantiacum, S. prolificans, and P. boydii species complex/P. apiosperma were incorporated into a multiplex PCR assay for the detection and identification of the three major clinically important Scedosporium species and validated using sputum specimens collected from patients seen at a major Australian cystic fibrosis clinic. The multiplex PCR assay showed 100% specificity in identifying the three major clinically relevant Scedosporium species from pure culture. When evaluated using DNA extracts from sputa, sensitivity and specificity of the multiplex PCR assay were 62.1% and 97.2%, respectively. This highly species-specific multiplex PCR assay offers a rapid and simple method of detection of the most clinically important Scedosporium species in respiratory tract specimens. PMID:21325557

  12. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

    PubMed

    Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

    2009-01-01

    A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

  13. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  14. Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

    USDA-ARS?s Scientific Manuscript database

    The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

  15. A multiplex primer design algorithm for target amplification of continuous genomic regions.

    PubMed

    Ozturk, Ahmet Rasit; Can, Tolga

    2017-06-19

    Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.

  16. Reading Assessment: A Primer for Teachers and Tutors.

    ERIC Educational Resources Information Center

    Caldwell, JoAnne Schudt

    This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…

  17. Murrinh Nganki (Our Language), 1.

    ERIC Educational Resources Information Center

    Street, Chester; And Others

    This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…

  18. Phylogenetic and pathogenic characterization of novel adenoviruses from long-tailed ducks (Clangula hyemalis)

    USGS Publications Warehouse

    Counihan, Katrina; Skerratt, Lee; Franson, J. Christian; Hollmen, Tuula E.

    2015-01-01

    Novel adenoviruses were isolated from a long-tailed duck (Clangula hyemalis) mortality event near Prudhoe Bay, Alaska in 2000. The long-tailed duck adenovirus genome was approximately 27 kb. A 907 bp hexon gene segment was used to design primers specific for the long-tailed duck adenovirus. Nineteen isolates were phylogenetically characterized based on portions of their hexon gene and 12 were most closely related to Goose adenovirus A. The remaining 7 shared no hexon sequences with any known adenoviruses. Experimental infections of mallards with a long-tailed duck reference adenovirus caused mild lymphoid infiltration of the intestine and paint brush hemorrhages of the mucosa and dilation of the intestine. This study shows novel adenoviruses from long-tailed ducks are diverse and provides further evidence that they should be considered in cases of morbidity and mortality in sea ducks. Conserved and specific primers have been developed that will help screen sea ducks for adenoviral infections.

  19. Resistance gene homologues in Theobroma cacao as useful genetic markers.

    PubMed

    Kuhn, D N; Heath, M; Wisser, R J; Meerow, A; Brown, J S; Lopes, U; Schnell, R J

    2003-07-01

    Resistance gene homologue (RGH) sequences have been developed into useful genetic markers for marker-assisted selection (MAS) of disease resistant Theobroma cacao. A plasmid library of amplified fragments was created from seven different cultivars of cacao. Over 600 cloned recombinant amplicons were evaluated. From these, 74 unique RGHs were identified that could be placed into 11 categories based on sequence analysis. Primers specific to each category were designed. The primers specific for a single RGH category amplified fragments of equal length from the seven different cultivars used to create the library. However, these fragments exhibited single-strand conformational polymorphism (SSCP), which allowed us to map six of the RGH categories in an F(2) population of T. cacao. RGHs 1, 4 and 5 were in the same linkage group, with RGH 4 and 5 separated by less than 4 cM. As SSCP can be efficiently performed on our automated sequencer, we have developed a convenient and rapid high throughput assay for RGH alleles.

  20. Crystal structure and substrate specificity of the [beta]-ketoacyl-acyl carrier protein synthase III (FabH) from Staphylococcus aureus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qiu, Xiayang; Choudhry, Anthony E.; Janson, Cheryl A.

    {beta}-Ketoacyl-ACP synthase III (FabH), an essential enzyme for bacterial viability, catalyzes the initiation of fatty acid elongation by condensing malonyl-ACP with acetyl-CoA. We have determined the crystal structure of FabH from Staphylococcus aureus, a Gram-positive human pathogen, to 2 {angstrom} resolution. Although the overall structure of S. aureus FabH is similar to that of Escherichia coli FabH, the primer binding pocket in S. aureus FabH is significantly larger than that present in E. coli FabH. The structural differences, which agree with kinetic parameters, provide explanation for the observed varying substrate specificity for E. coli and S. aureus FabH. The rankmore » order of activity of S. aureus FabH with various acyl-CoA primers was as follows: isobutyryl- > hexanoyl- > butyryl- > isovaleryl- >> acetyl-CoA. The availability of crystal structure may aid in designing potent, selective inhibitors of S. aureus FabH.« less

  1. DNA-based identification of Brassica vegetable species for the juice industry.

    PubMed

    Etoh, Kazumi; Niijima, Noritaka; Yokoshita, Masahiko; Fukuoka, Shin-Ichi

    2003-10-01

    Since kale (Brassica oleracea var. acephala), a cruciferous vegetable with a high level of vitamins and functional compounds beneficial to health and wellness, has become widely used in the juice industry, a precise method for quality control of vegetable species is necessary. We describe here a DNA-based identification method to distinguish kale from cabbage (Brassica oleracea var. capitata), a closely related species, which can be inadvertently mixed with kale during the manufacturing process. Using genomic DNA from these vegetables and combinatory sets of nucleotide primers, we screened for random amplified polymorphic DNA (RAPD) fragments and found three cabbage-specific fragments. These RAPD fragments, with lengths of 1.4, 0.5, and 1.5 kb, were purified, subcloned, and sequenced. Based on sequence-tagged sites (STS), we designed sets of primers to detect cabbage-specific identification (CAI) DNA markers. Utilizing the CAI markers, we successfully distinguished more than 10 different local cabbage accessions from 20 kale accessions, and identified kale juices experimentally spiked with different amounts of cabbage.

  2. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  3. An immunomagnetic separation-real-time PCR system for the detection of Alicyclobacillus acidoterrestris in fruit products.

    PubMed

    Wang, Zhouli; Cai, Rui; Yuan, Yahong; Niu, Chen; Hu, Zhongqiu; Yue, Tianli

    2014-04-03

    Alicyclobacillus acidoterrestris is the most important spoilage species within the Alicyclobacillus genus and has become a major issue in the pasteurized fruit juice industry. The aim of this study was to develop a method combining immunomagnetic separation (IMS) with real-time PCR system (IMS-PCR) for rapid and specific detection of A. acidoterrestris in fruit products. A real-time PCR with the TaqMan system was designed to target the 16S rDNA genes with specific primer and probe set. The specificity of the assay was confirmed using 9 A. acidoterrestris strains and 21 non-A. acidoterrestris strains. The results indicated that no combination of the designed primers and probe was found in any Alicyclobacillus genus except A. acidoterrestris. The detection limit of the established IMS-PCR was less than 10CFU/mL and the testing process was accomplished in 2-3h. For the three types of samples (sterile water, apple juice and kiwi juice), the correlation coefficient of standard curves was greater than 0.991, and the calculated PCR efficiencies were from 108% to 109%. As compared with the standard culture method performed concurrently on the same set of samples, the sensitivity, specificity and accuracy of IMS-PCR for 196 naturally contaminated fruit products were 90.0%, 98.3% and 97.5%, respectively. The results exhibited that the proposed IMS-PCR method was effective for the rapid detection of A. acidoterrestris in fruit products. Copyright © 2014. Published by Elsevier B.V.

  4. Visual Detection of Canine Parvovirus Based on Loop-Mediated Isothermal Amplification Combined with Enzyme-Linked Immunosorbent Assay and with Lateral Flow Dipstick

    PubMed Central

    SUN, Yu-Ling; YEN, Chon-Ho; TU, Ching-Fu

    2013-01-01

    ABSTRACT Loop-mediated isothermal amplification (LAMP) combined with enzyme-linked immunosorbent assay (LAMP–ELISA) and with lateral flow dipstick (LAMP–LFD) are rapid, sensitive and specific methods for the visual detection of clinical pathogens. In this study, LAMP–ELISA and LAMP–LFD were developed for the visual detection of canine parvovirus (CPV). For LAMP, a set of four primers (biotin-labeled forward inner primers) was designed to specifically amplify a region of the VP2 gene of CPV. The optimum time and temperature for LAMP were 60 min and 65°C, respectively. The specific capture oligonucleotide probes, biotin-labeled CPV probe for LAMP–ELISA and fluorescein isothiocyanate-labeled CPV probe for LAMP–LFD were also designed for hybridization with LAMP amplicons on streptavidin-coated wells and LFD strips, respectively. For the comparison of detection sensitivity, conventional PCR and LAMP for CPV detection were also performed. The CPV detection limits by PCR, PCR–ELISA, LAMP, LAMP–ELISA and LAMP–LFD were 102, 102, 10−1, 10−1 and 10−1 TCID50/ml, respectively. In tests using artificially contaminated dog fecal samples, the samples with CPV inoculation levels of ≥1 TCID50/ml gave positive results by both LAMP–ELISA and LAMP–LFD. Our data indicated that both LAMP–ELISA and LAMP–LFD are promising as rapid, sensitive and specific methods for an efficient diagnosis of CPV infection. PMID:24334855

  5. Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

    PubMed

    Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

    2014-11-01

    In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

    PubMed Central

    2010-01-01

    Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid) obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used to reliably detect divergent regions via several scoring methods that provide different levels of selectivity. Its predictions have been verified by experimental means. Hence, it is expected that its usage will save researchers' time and ensure an objective selection of the best-possible divergent region when closely related sequences are analysed. AlignMiner is freely available at http://www.scbi.uma.es/alignminer. PMID:20525162

  7. Detection of Bovine and Porcine Adenoviruses for Tracing the Source of Fecal Contamination

    PubMed Central

    Maluquer de Motes, Carlos; Clemente-Casares, Pilar; Hundesa, Ayalkibet; Martín, Margarita; Girones, Rosina

    2004-01-01

    In this study, a molecular procedure for the detection of adenoviruses of animal origin was developed to evaluate the level of excretion of these viruses by swine and cattle and to design a test to facilitate the tracing of specific sources of environmental viral contamination. Two sets of oligonucleotides were designed, one to detect porcine adenoviruses and the other to detect bovine and ovine adenoviruses. The specificity of the assays was assessed in 31 fecal samples and 12 sewage samples that were collected monthly during a 1-year period. The data also provided information on the environmental prevalence of animal adenoviruses. Porcine adenoviruses were detected in 17 of 24 (70%) pools of swine samples studied, with most isolates being closely related to serotype 3. Bovine adenoviruses were present in 6 of 8 (75%) pools studied, with strains belonging to the genera Mastadenovirus and Atadenovirus and being similar to bovine adenoviruses of types 2, 4, and 7. These sets of primers produced negative results in nested PCR assays when human adenovirus controls and urban-sewage samples were tested. Likewise, the sets of primers previously designed for detection of human adenovirus also produced negative results with animal adenoviruses. These results indicate the importance of further studies to evaluate the usefulness of these tests to trace the source of fecal contamination in water and food and for environmental studies. PMID:15006765

  8. Detection of bovine and porcine adenoviruses for tracing the source of fecal contamination.

    PubMed

    Maluquer de Motes, Carlos; Clemente-Casares, Pilar; Hundesa, Ayalkibet; Martín, Margarita; Girones, Rosina

    2004-03-01

    In this study, a molecular procedure for the detection of adenoviruses of animal origin was developed to evaluate the level of excretion of these viruses by swine and cattle and to design a test to facilitate the tracing of specific sources of environmental viral contamination. Two sets of oligonucleotides were designed, one to detect porcine adenoviruses and the other to detect bovine and ovine adenoviruses. The specificity of the assays was assessed in 31 fecal samples and 12 sewage samples that were collected monthly during a 1-year period. The data also provided information on the environmental prevalence of animal adenoviruses. Porcine adenoviruses were detected in 17 of 24 (70%) pools of swine samples studied, with most isolates being closely related to serotype 3. Bovine adenoviruses were present in 6 of 8 (75%) pools studied, with strains belonging to the genera Mastadenovirus and Atadenovirus and being similar to bovine adenoviruses of types 2, 4, and 7. These sets of primers produced negative results in nested PCR assays when human adenovirus controls and urban-sewage samples were tested. Likewise, the sets of primers previously designed for detection of human adenovirus also produced negative results with animal adenoviruses. These results indicate the importance of further studies to evaluate the usefulness of these tests to trace the source of fecal contamination in water and food and for environmental studies.

  9. DNA polymerase preference determines PCR priming efficiency.

    PubMed

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

  10. Real-time PCR probe optimization using design of experiments approach.

    PubMed

    Wadle, S; Lehnert, M; Rubenwolf, S; Zengerle, R; von Stetten, F

    2016-03-01

    Primer and probe sequence designs are among the most critical input factors in real-time polymerase chain reaction (PCR) assay optimization. In this study, we present the use of statistical design of experiments (DOE) approach as a general guideline for probe optimization and more specifically focus on design optimization of label-free hydrolysis probes that are designated as mediator probes (MPs), which are used in reverse transcription MP PCR (RT-MP PCR). The effect of three input factors on assay performance was investigated: distance between primer and mediator probe cleavage site; dimer stability of MP and target sequence (influenza B virus); and dimer stability of the mediator and universal reporter (UR). The results indicated that the latter dimer stability had the greatest influence on assay performance, with RT-MP PCR efficiency increased by up to 10% with changes to this input factor. With an optimal design configuration, a detection limit of 3-14 target copies/10 μl reaction could be achieved. This improved detection limit was confirmed for another UR design and for a second target sequence, human metapneumovirus, with 7-11 copies/10 μl reaction detected in an optimum case. The DOE approach for improving oligonucleotide designs for real-time PCR not only produces excellent results but may also reduce the number of experiments that need to be performed, thus reducing costs and experimental times.

  11. Poliovirus serotype-specific VP1 sequencing primers.

    PubMed

    Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

    2011-06-01

    The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

  12. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  13. Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

    PubMed

    Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

    2011-01-01

    It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

  14. Modified telomeric repeat amplification protocol: a quantitative radioactive assay for telomerase without using electrophoresis.

    PubMed

    Szatmari, I; Tókés, S; Dunn, C B; Bardos, T J; Aradi, J

    2000-06-15

    A polymerase chain reaction (PCR)-based radioactive telomerase assay was developed in our laboratory which is quantitative and does not require electrophoretic evaluation (designated as TP-TRAP; it utilizes two reverse primers). The main steps of the assay include (1) extension of a 20-mer oligonucleotide substrate (MTS) by telomerase, (2) amplification of the telomerase products in the presence of [(3)H]dTTP using the substrate oligonucleotide and two reverse primers (RPC3, 38 mer; RP, 20 mer), (3) isolation of the amplified radioactive dsDNA by precipitation and filtration, (4) determination of the radioactivity of the acid-insoluble DNA. The length of the telomerase products does not increase on amplification. This valuable feature of the assay is achieved by utilization of the two reverse primers and a highly specific PCR protocol. The assay is linear, accurate, and suitable for cell-biological studies where slight quantitative differences in telomerase activity must be detected. The assay is also suitable for screening and characterization of telomerase inhibitors, as shown with a chemically modified oligonucleotide reverse transcriptase inhibitor [(s(4)dU)(35)]. Copyright 2000 Academic Press.

  15. Quantification of Azospirillum brasilense FP2 Bacteria in Wheat Roots by Strain-Specific Quantitative PCR.

    PubMed

    Stets, Maria Isabel; Alqueres, Sylvia Maria Campbell; Souza, Emanuel Maltempi; Pedrosa, Fábio de Oliveira; Schmid, Michael; Hartmann, Anton; Cruz, Leonardo Magalhães

    2015-10-01

    Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide. Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N2 fixation. However, one of the most important factors for achieving an increase in crop yield by plant growth-promoting rhizobacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to develop quantitative PCR protocols for the strain-specific quantification of A. brasilense FP2. A novel approach was applied to identify strain-specific DNA sequences based on a comparison of the genomic sequences within the same species. The draft genome sequences of A. brasilense FP2 and Sp245 were aligned, and FP2-specific regions were filtered and checked for other possible matches in public databases. Strain-specific regions were then selected to design and evaluate strain-specific primer pairs. The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were specific for the A. brasilense FP2 strain. These primer pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and nonsterile growth conditions. In addition, coinoculations with other plant growth-promoting bacteria in wheat were performed under nonsterile conditions. The results showed that A. brasilense FP2 inoculated into wheat roots is highly competitive and achieves high cell numbers (∼10(7) CFU/g [fresh weight] of root) in the rhizosphere even under nonsterile conditions and when coinoculated with other rhizobacteria, maintaining the population at rather stable levels for at least up to 13 days after inoculation. The strategy used here can be applied to other organisms whose genome sequences are available. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Quantification of Azospirillum brasilense FP2 Bacteria in Wheat Roots by Strain-Specific Quantitative PCR

    PubMed Central

    Stets, Maria Isabel; Alqueres, Sylvia Maria Campbell; Souza, Emanuel Maltempi; Pedrosa, Fábio de Oliveira; Schmid, Michael

    2015-01-01

    Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide. Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N2 fixation. However, one of the most important factors for achieving an increase in crop yield by plant growth-promoting rhizobacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to develop quantitative PCR protocols for the strain-specific quantification of A. brasilense FP2. A novel approach was applied to identify strain-specific DNA sequences based on a comparison of the genomic sequences within the same species. The draft genome sequences of A. brasilense FP2 and Sp245 were aligned, and FP2-specific regions were filtered and checked for other possible matches in public databases. Strain-specific regions were then selected to design and evaluate strain-specific primer pairs. The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were specific for the A. brasilense FP2 strain. These primer pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and nonsterile growth conditions. In addition, coinoculations with other plant growth-promoting bacteria in wheat were performed under nonsterile conditions. The results showed that A. brasilense FP2 inoculated into wheat roots is highly competitive and achieves high cell numbers (∼107 CFU/g [fresh weight] of root) in the rhizosphere even under nonsterile conditions and when coinoculated with other rhizobacteria, maintaining the population at rather stable levels for at least up to 13 days after inoculation. The strategy used here can be applied to other organisms whose genome sequences are available. PMID:26187960

  17. Analysis of the Type IV Fimbrial-Subunit Gene fimA of Xanthomonas hyacinthi: Application in PCR-Mediated Detection of Yellow Disease in Hyacinths

    PubMed Central

    van Doorn, J.; Hollinger, T. C.; Oudega, B.

    2001-01-01

    A sensitive and specific detection method was developed for Xanthomonas hyacinthi; this method was based on amplification of a subsequence of the type IV fimbrial-subunit gene fimA from strain S148. The fimA gene was amplified by PCR with degenerate DNA primers designed by using the N-terminal and C-terminal amino acid sequences of trypsin fragments of FimA. The nucleotide sequence of fimA was determined and compared with the nucleotide sequences coding for the fimbrial subunits in other type IV fimbria-producing bacteria, such as Xanthomonas campestris pv. vesicatoria, Neisseria gonorrhoeae, and Moraxella bovis. In a PCR internal primers JAAN and JARA, designed by using the nucleotide sequences of the variable central and C-terminal region of fimA, amplified a 226-bp DNA fragment in all X. hyacinthi isolates. This PCR was shown to be pathovar specific, as assessed by testing 71 Xanthomonas pathovars and bacterial isolates belonging to other genera, such as Erwinia and Pseudomonas. Southern hybridization experiments performed with the labelled 226-bp DNA amplicon as a probe suggested that there is only one structural type IV fimbrial-gene cluster in X. hyacinthi. Only two Xanthomonas translucens pathovars cross-reacted weakly in PCR. Primers amplifying a subsequence of the fimA gene of X. campestris pv. vesicatoria (T. Ojanen-Reuhs, N. Kalkkinen, B. Westerlund-Wikström, J. van Doorn, K. Haahtela, E.-L. Nurmiaho-Lassila, K. Wengelink, U. Bonas, and T. K. Korhonen, J. Bacteriol. 179: 1280–1290, 1997) were shown to be pathovar specific, indicating that the fimbrial-subunit sequences are more generally applicable in xanthomonads for detection purposes. Under laboratory conditions, approximately 1,000 CFU of X. hyacinthi per ml could be detected. In inoculated leaves of hyacinths the threshold was 5,000 CFU/ml. The results indicated that infected hyacinths with early symptoms could be successfully screened for X. hyacinthi with PCR. PMID:11157222

  18. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    PubMed Central

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  19. Typing of Intimin Genes in Human and Animal Enterohemorrhagic and Enteropathogenic Escherichia coli: Characterization of a New Intimin Variant

    PubMed Central

    Oswald, E.; Schmidt, H.; Morabito, S.; Karch, H.; Marchès, O.; Caprioli, A.

    2000-01-01

    Enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) produce the characteristic “attaching and effacing” (A/E) lesion of the brush border. Intimin, an outer membrane protein encoded by eae, is responsible for the tight association of both pathogens with the host cell. Several eae have been cloned from different EPEC and EHEC strains isolated from humans and animals. These sequences are conserved in the N-terminal region but highly variable in the last C-terminal 280 amino acids (aa), where the cell binding activity is localized. Based on these considerations, we developed a panel of specific primers to investigate the eae heterogeneity of the variable 3′ region by using PCR amplification. We then investigated the distribution of the known intimin types in a large collection of EPEC and EHEC strains isolated from humans and different animal species. The existence of a yet-unknown family of intimin was suspected because several EHEC strains, isolated from human and cattle, did not react with any of the specific primer pairs, although these strains were eae positive when primers amplifying the conserved 5′ end were used. We then cloned and sequenced the eae present in one of these strains (EHEC of serotype O103:H2) and subsequently designed a PCR primer that recognizes in a specific manner the variable 3′ region of this new intimin type. This intimin, referred to as “ɛ,” was present in human and bovine EHEC strains of serogroups O8, O11, O45, O103, O121, and O165. Intimin ɛ is the largest intimin cloned to date (948 aa) and shares the greatest overall sequence identity with intimin β, although analysis of the last C-terminal 280 aa suggests a greater similarity with intimins α and γ. PMID:10603369

  20. Detection of Naegleria Species in Environmental Samples from Peninsular Malaysia

    PubMed Central

    Ithoi, Init; Ahmad, Arine Fadzlun; Nissapatorn, Veeranoot; Lau, Yee Ling; Mahmud, Rohela; Mak, Joon Wah

    2011-01-01

    Background In Malaysia, researchers and medical practitioners are unfamiliar with Naegleria infections. Thus little is known about the existence of pathogenic Naegleria fowleri, and the resultant primary amoebic meningoencephalitis (PAM) is seldom included in the differential diagnosis of central nervous system infections. This study was conducted to detect the presence of Naegleria species in various environmental samples. Methods/Findings A total of 41 Naegleria-like isolates were isolated from water and dust samples. All these isolates were subjected to PCR using two primer sets designed from the ITS1-ITS2 regions. The N. fowleri species-specific primer set failed to produce the expected amplicon. The Naegleria genus-specific primers produced amplicons of 408 bp (35), 450 bp (2), 457 bp (2) or 381 bp (2) from all 41 isolates isolated from aquatic (33) and dust (8) samples. Analysis of the sequences from 10 representative isolates revealed that amplicons with fragments 408, 450 and 457 bp showed homology with non-pathogenic Naegleria species, and 381 bp showed homology with Vahlkampfia species. These results concurred with the morphological observation that all 39 isolates which exhibited flagella were Naegleria, while 2 isolates (AC7, JN034055 and AC8, JN034056) that did not exhibit flagella were Vahlkampfia species. Conclusion To date, pathogenic species of N. fowleri have not been isolated from Malaysia. All 39 isolates that produced amplicons (408, 450 and 457 bp) from the genus-specific primers were identified as being similar to nonpathogenic Naegleria. Amplicon 408 bp from 5 representative isolates showed 100% and 99.7% identity to Naegleria philippinensis isolate RJTM (AM167890) and is thus believed to be the most common species in our environment. Amplicons 450 bp and 457 bp were respectively believed to be from 2 new species of Naegleria, since representative isolates showed lower homology and had a longer base pair length when compared to the reference species in the Genbank, Naegleria schusteri (AJ566626) and Naegleria laresi (AJ566630), respectively. PMID:21915311

  1. Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

    PubMed Central

    Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

    2007-01-01

    Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

  2. The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

    ERIC Educational Resources Information Center

    Schubert, Sandra; Zelinsky, Benjamin

    Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

  3. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  4. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  5. Development of a one-step RT-PCR assay for detection of pancoronaviruses (α-, β-, γ-, and δ-coronaviruses) using newly designed degenerate primers for porcine and avian `fecal samples.

    PubMed

    Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N

    2018-06-01

    Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Development of duplex PCR for simultaneous detection of Theileria spp. and Anaplasma spp. in sheep and goats.

    PubMed

    Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen

    2017-05-01

    Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3  ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Occurrence of a Sequence in Marine Cyanophages Similar to That of T4 g20 and Its Application to PCR-Based Detection and Quantification Techniques†

    PubMed Central

    Fuller, Nicholas J.; Wilson, William H.; Joint, Ian R.; Mann, Nicholas H.

    1998-01-01

    Viruses are ubiquitous components of marine ecosystems and are known to infect unicellular phycoerythrin-containing cyanobacteria belonging to the genus Synechococcus. A conserved region from the cyanophage genome was identified in three genetically distinct cyanomyoviruses, and a sequence analysis revealed that this region exhibited significant similarity to a gene encoding a capsid assembly protein (gp20) from the enteric coliphage T4. The results of a comparison of gene 20 sequences from three cyanomyoviruses and T4 allowed us to design two degenerate PCR primers, CPS1 and CPS2, which specifically amplified a 165-bp region from the majority of cyanomyoviruses tested. A competitive PCR (cPCR) analysis revealed that cyanomyovirus strains could be accurately enumerated, and it was demonstrated that quantification was log-linear over ca. 3 orders of magnitude. Different calibration curves were obtained for each of the three cyanomyovirus strains tested; consequently, cPCR performed with primers CPS1 and CPS2 could lead to substantial inaccuracies in estimates of phage abundance in natural assemblages. Further sequence analysis of cyanomyovirus gene 20 homologs would be necessary in order to design primers which do not exhibit phage-to-phage variability in priming efficiency. It was demonstrated that PCR products of the correct size could be amplified from seawater samples following 100× concentration and even directly without any prior concentration. Hence, the use of degenerate primers in PCR analyses of cyanophage populations should provide valuable data on the diversity of cyanophages in natural assemblages. Further optimization of procedures may ultimately lead to a sensitive assay which can be used to analyze natural cyanophage populations both quantitatively (by cPCR) and qualitatively following phylogenetic analysis of amplified products. PMID:9603813

  8. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    PubMed

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  9. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    PubMed

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies result in inaccurate estimates of community structure. The extent to which amplification bias affects community representation and the accuracy with which different gene targets represent community structure are not known. As a result, there is no consensus on which region provides the most suitable representation of diversity for eukaryotes. This study determined the accuracy with which commonly used 18S rRNA gene primer sets represent community structure and identified particular biases related to PCR amplification and Illumina MiSeq sequencing in order to more accurately study eukaryotic microbial communities. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Simultaneous genotyping of HPA-17w to -21w by PCR-SSP in Chinese Cantonese.

    PubMed

    Zhou, Haojie; Ding, Haoqiang; Chen, Yangkai; Li, Xiaofan; Ye, Xin; Nie, Yongmei

    2015-01-01

    Studies have reported the polymorphism of human platelet antigen (HPA)-17w, -18w, -19w, -20w, and -21w. However, the distribution of these five antigens in Chinese Cantonese is still unknown. In this study, we designed new sequence-specific primers for HPA-19w to -21w and used published primers for HPA-17w and -18w to develop a polymerase chain reaction with the sequence-specific primers (PCR-SSP) method for simultaneously genotyping HPA-17w to -21w. A total of 820 unrelated Cantonese apheresis platelet donors in Guangzhou were involved in this study. Among the five HPAs, complete a/a homozygosity was observed for HPA-17w to -20w with an allele frequency of 1.0000. For HPA-21w, nine individuals (9/820, 1.10%) were found to be HPA-21a/bw heterozygous and the allele frequencies of HPA-21a and HPA-21bw were 0.9945 (1631/1640) and 0.0055 (9/1640), respectively. The reliability of the PCR-SSP method was determined by comparing with the genotyping results by DNA sequencing, and no inconsistencies were observed between the two methods. This study provides a reliable PCR-SSP method for simultaneously genotyping HPA-17w to -21w and could improve HPA-matched platelet transfusion in Chinese Cantonese.

  11. Rapid identification of the genus Dekkera/Brettanomyces, the Dekkera subgroup and all individual species.

    PubMed

    Hulin, M; Harrison, E; Stratford, M; Wheals, A E

    2014-09-18

    The genus Dekkera/Brettanomyces comprises five described species: Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. naardenensis and B. nanus. Some of them, especially D. bruxellensis, are important spoilage organisms, particularly in the wine and beverage industries. Because of their economic importance many different methods have been developed to identify members of the genus in general and D. bruxellensis in particular. These methods vary in their rapidity, complexity and cost but, partly because of confidentiality issues, it is unclear which methods are used, or how widely, in the relevant industries. Building on previous work with the genera Saccharomyces and Zygosaccharomyces, a suite of eight PCR primer pairs has been designed either on the D1-D2 region of the 26S rRNA gene or translation elongation factor TEF1-α. These primers can specifically identify the genus as a whole, only Dekkera species, each one of the five recognised species as well as a significant subgroup of D. bruxellensis represented by NCYC 3426. Multiplexing has also been tried and it has been shown to be possible with some combinations of genus or Dekkera-level and species-specific primers. Using direct colony PCR amplification followed by gel electrophoresis, a clear positive result can be obtained in less than 3h, thus providing a quick, reliable and inexpensive way to identify target species. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Development of Cross-Assembly Phage PCR-Based Methods ...

    EPA Pesticide Factsheets

    Technologies that can characterize human fecal pollution in environmental waters offer many advantages over traditional general indicator approaches. However, many human-associated methods cross-react with non-human animal sources and lack suitable sensitivity for fecal source identification applications. The genome of a newly discovered bacteriophage (~97 kbp), the Cross-Assembly phage or “crAssphage”, assembled from a human gut metagenome DNA sequence library is predicted to be both highly abundant and predominately occur in human feces suggesting that this double stranded DNA virus may be an ideal human fecal pollution indicator. We report the development of two human-associated crAssphage endpoint PCR methods (crAss056 and crAss064). A shotgun strategy was employed where 384 candidate primers were designed to cover ~41 kbp of the crAssphage genome deemed favorable for method development based on a series of bioinformatics analyses. Candidate primers were subjected to three rounds of testing to evaluate assay optimization, specificity, limit of detection (LOD95), geographic variability, and performance in environmental water samples. The top two performing candidate primer sets exhibited 100% specificity (n = 70 individual samples from 8 different animal species), >90% sensitivity (n = 10 raw sewage samples from different geographic locations), LOD95 of 0.01 ng/µL of total DNA per reaction, and successfully detected human fecal pollution in impaired envi

  13. Development of SCAR marker for discrimination of Artemisia princeps and A. argyi from other Artemisia herbs.

    PubMed

    Lee, Mi Young; Doh, Eui Jeong; Park, Chae Haeng; Kim, Young Hwa; Kim, Eung Soo; Ko, Byong Seob; Oh, Seung-Eun

    2006-04-01

    Some Artemisia herbs are used for medicinal purposes. In particular, A. princeps and A. argyi are classified as 'Aeyup' and are used as important medicinal material in traditional Korean medicine. On the other hand, A. capillaris and A. iwayomogi, which are classified as 'Injinho' and 'Haninjin', respectively, are used for other purposes distinct from those of 'Aeyup'. However, sometimes 'Aeyup' is not clearly discriminated from 'Injinho' and/or 'Haninjin'. Furthermore, Artemisia capillaris and/or A. iwayomogi have been used in place of A. princeps and A. argyi. In this study, we developed an efficient method to discriminate A. argyi and A. princeps from other Artemisia plants. The RAPD (random amplified polymorphic DNA) method efficiently discriminated various Artemisia herbs. In particular, non-specific primer 329 (5'-GCG AAC CTC C-3'), which shows polymorphism among Artemisia herbs, amplified 838 bp products, which are specific to A. princeps and A. argyi only. Based on nucleotide sequence of the primer 329 product, we designed a Fb (5'-CAT CAA CCA TGG CTT ATC CT-3') and R7 (5'-GCG AAC CTC CCC ATT CCA-3') primer-set to amplify a 254 bp sized SCAR (sequence characterized amplified regions) marker, through which A. princeps and A. argyi can be efficiently discriminated from other Artemisia herbs, particularly, A. capillaris and A. iwayomogi.

  14. Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of lymphocystis disease virus.

    PubMed

    Li, Qiong; Yue, Zhiqin; Liu, Hong; Liang, Chengzhu; Zheng, Xiaolong; Zhao, Yuran; Chen, Xiao; Xiao, Xizhi; Chen, Changfu

    2010-02-01

    A loop-mediated isothermal amplification (LAMP) assay was developed for the detection of lymphocystis disease virus (LCDV). A set of five specific primers, two inner and two outer primers and a loop primer, were designed on the basis of the major capsid protein gene of LCDV. The reaction time and temperatures were optimized for 60 min at 63 degrees C, respectively. LAMP amplification products were detected by a ladder-like appearance on agarose gel electrophoresis or a naked-eye inspection of a color change in the reaction tube by addition of SYBR Green I. The assay was specific for LCDV, and there was no cross-reactivity with white spot syndrome virus (WSSV) or six other Iridoviridae viruses (epizootic hematopoietic necrosis virus, EHNV; tiger frog virus, TFV; Bohle iridovirus, BIV; soft-shelled turtle iridovirus, STIV; infectious spleen and kidney necrosis virus, ISKNV; red sea bream iridovirus, RSIV). The detection limit of the LAMP assay was 15 fg, which was similar to that of real-time quantitative polymerase chain reaction (PCR) and 10-fold higher than the conventional PCR. The LAMP assay was evaluated using 109 clinical samples, and the results indicated the suitability and simplicity of the test as a rapid, field diagnostic tool for detection of LCDV. The LCDV LAMP assay has potential for early diagnosis of LCDV infection. 2009 Elsevier B.V. All rights reserved.

  15. Best Development Practices: A Primer for Smart Growth

    EPA Pesticide Factsheets

    Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

  16. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    PubMed Central

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  17. Panel of 23S rRNA Gene-Based Real-Time PCR Assays for Improved Universal and Group-Specific Detection of Phytoplasmas▿ †

    PubMed Central

    Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Dickinson, Matthew

    2009-01-01

    Primers and probes based on the 23S rRNA gene have been utilized to design a range of real-time PCR assays for routine phytoplasma diagnostics. These assays have been authenticated as phytoplasma specific and shown to be at least as sensitive as nested PCR. A universal assay to detect all phytoplasmas has been developed, along with a multiplex assay to discriminate 16SrI group phytoplasmas from members of all of the other 16Sr groups. Assays for the 16SrII, 16SrIV, and 16SrXII groups have also been developed to confirm that the 23S rRNA gene can be used to design group-specific assays. PMID:19270148

  18. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    PubMed

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  19. Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

    USGS Publications Warehouse

    Ostberg, C.O.; Rodriguez, R.J.

    2004-01-01

    Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

  20. Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

    PubMed

    Gell, I; Cubero, J; Melgarejo, P

    2007-12-01

    To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

  1. Application of Reverse Transcriptase -PCR (RT-PCR) for rapid detection of viable Escherichia coli in drinking water samples.

    PubMed

    Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah

    2015-01-01

    Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.

  2. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    PubMed

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.

  3. Genome-wide characterization and selection of expressed sequence tag simple sequence repeat primers for optimized marker distribution and reliability in peach

    USDA-ARS?s Scientific Manuscript database

    Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...

  4. BchY-based degenerate primers target all types of anoxygenic photosynthetic bacteria in a single PCR.

    PubMed

    Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded

    2009-12-01

    To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.

  5. Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

    PubMed

    Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

    2014-06-03

    Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

  6. A New Primer to Amplify pmoA Gene From NC10 Bacteria in the Sediments of Dongchang Lake and Dongping Lake.

    PubMed

    Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu

    2017-08-01

    Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.

  7. Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

    PubMed Central

    Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander

    2012-01-01

    The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135

  8. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars

    PubMed Central

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-01-01

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3′ sequences complementary to ASFV p72 gene sequence and 5′end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 102 copies per μl−1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV. PMID:28198455

  9. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars.

    PubMed

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-02-15

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3' sequences complementary to ASFV p72 gene sequence and 5'end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 10 2 copies per μl -1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV.

  10. Self-locked aptamer probe mediated cascade amplification strategy for highly sensitive and selective detection of protein and small molecule.

    PubMed

    Li, Wei; Jiang, Wei; Wang, Lei

    2016-10-12

    In this work, a novel self-locked aptamer probe mediated cascade amplification strategy has been constructed for highly sensitive and specific detection of protein. First, the self-locked aptamer probe was designed with three functions: one was specific molecular recognition attributed to the aptamer sequence, the second was signal transduction owing to the transduction sequence, and the third was self-locking through the hybridization of the transduction sequence and part of the aptamer sequence. Then, the aptamer sequence specific recognized the target and folded into a three-way helix junction, leading to the release of the transduction sequence. Next, the 3'-end of this three-way junction acted as primer to trigger the strand displacement amplification (SDA), yielding a large amount of primers. Finally, the primers initiated the dual-exponential rolling circle amplification (DE-RCA) and generated numerous G-quadruples sequences. By inserting the fluorescent dye N-methyl mesoporphyrin IX (NMM), enhanced fluorescence signal was achieved. In this strategy, the self-locked aptamer probe was more stable to reduce the interference signals generated by the uncontrollable folding in unbounded state. Through the cascade amplification of SDA and DE-RCA, the sensitivity was further improved with a detection limit of 3.8 × 10(-16) mol/L for protein detection. Furthermore, by changing the aptamer sequence of the probe, sensitive and selective detection of adenosine has been also achieved, suggesting that the proposed strategy has good versatility and can be widely used in sensitive and selective detection of biomolecules. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. First report of Hibiscus infecting Cilevirus in Citrus sinensis in Meta and Casanare, Colombia

    USDA-ARS?s Scientific Manuscript database

    In February 2015, two sweet orange samples with severe citrus leprosis (CiL) symptoms were collected from Meta and Casanare states in Colombia and assayed for Cilevirus, Dichorhavirus and Higrevirus associated with CiL disease. PCR primers specific for CiLV-C2, but not primers specific for CiLV-C, C...

  12. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  13. Development of the polymerase chain reaction for diagnosis of chancroid.

    PubMed Central

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

    1993-01-01

    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  14. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    ERIC Educational Resources Information Center

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  15. A multiplex PCR method for rapid identification of Brachionus rotifers.

    PubMed

    Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

    2009-01-01

    Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

  16. Molecular differentiation of Russian wild ginseng using mitochondrial nad7 intron 3 region.

    PubMed

    Li, Guisheng; Cui, Yan; Wang, Hongtao; Kwon, Woo-Saeng; Yang, Deok-Chun

    2017-07-01

    Cultivated ginseng is often introduced as a substitute and adulterant of Russian wild ginseng due to its lower cost or misidentification caused by similarity in appearance with wild ginseng. The aim of this study is to develop a simple and reliable method to differentiate Russian wild ginseng from cultivated ginseng. The mitochondrial NADH dehydrogenase subunit 7 ( nad 7) intron 3 regions of Russian wild ginseng and Chinese cultivated ginseng were analyzed. Based on the multiple sequence alignment result, a specific primer for Russian wild ginseng was designed by introducing additional mismatch and allele-specific polymerase chain reaction (PCR) was performed for identification of wild ginseng. Real-time allele-specific PCR with endpoint analysis was used for validation of the developed Russian wild ginseng single nucleotide polymorphism (SNP) marker. An SNP site specific to Russian wild ginseng was exploited by multiple alignments of mitochondrial nad 7 intron 3 regions of different ginseng samples. With the SNP-based specific primer, Russian wild ginseng was successfully discriminated from Chinese and Korean cultivated ginseng samples by allele-specific PCR. The reliability and specificity of the SNP marker was validated by checking 20 individuals of Russian wild ginseng samples with real-time allele-specific PCR assay. An effective DNA method for molecular discrimination of Russian wild ginseng from Chinese and Korean cultivated ginseng was developed. The established real-time allele-specific PCR was simple and reliable, and the present method should be a crucial complement of chemical analysis for authentication of Russian wild ginseng.

  17. Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification

    PubMed Central

    Guo, Xu-Guang; Zhou, Shan

    2014-01-01

    Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360

  18. Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

    PubMed

    Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

    2015-01-01

    This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  19. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection

    PubMed Central

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-01-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

  20. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection.

    PubMed

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-08-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.

  1. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    PubMed Central

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  2. PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

    PubMed Central

    Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

    2015-01-01

    The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

  3. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    PubMed Central

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  4. Assessing the performance of a Loop Mediated Isothermal Amplification (LAMP) assay for the detection and subtyping of high-risk suptypes of Human Papilloma Virus (HPV) for Oropharyngeal Squamous Cell Carcinoma (OPSCC) without DNA purification.

    PubMed

    Rohatensky, Mitchell G; Livingstone, Devon M; Mintchev, Paul; Barnes, Heather K; Nakoneshny, Steven C; Demetrick, Douglas J; Dort, Joseph C; van Marle, Guido

    2018-02-08

    Oropharyngeal Squamous Cell Carcinoma (OPSCC) is increasing in incidence despite a decline in traditional risk factors. Human Papilloma Virus (HPV), specifically subtypes 16, 18, 31 and 35, has been implicated as the high-risk etiologic agent. HPV positive cancers have a significantly better prognosis than HPV negative cancers of comparable stage, and may benefit from different treatment regimens. Currently, HPV related carcinogenesis is established indirectly through Immunohistochemistry (IHC) staining for p16, a tumour suppressor gene, or polymerase chain reaction (PCR) that directly tests for HPV DNA in biopsied tissue. Loop mediated isothermal amplification (LAMP) is more accurate than IHC, more rapid than PCR and is significantly less costly. In previous work we showed that a subtype specific HPV LAMP assay performed similar to PCR on purified DNA. In this study we examined the performance of this LAMP assay without DNA purification. We used LAMP assays using established primers for HPV 16 and 18, and new primers for HPV 31 and 35. LAMP reaction conditions were tested on serial dilutions of plasmid HPV DNA to confirm minimum viral copy number detection thresholds. LAMP was then performed directly on different human cell line samples without DNA purification. Our LAMP assays could detect 10 5 , 10 3 , 10 4 , and 10 5 copies of plasmid DNA for HPV 16, 18, 31, and 35, respectively. All primer sets were subtype specific, with no cross-amplification. Our LAMP assays also reliably amplified subtype specific HPV DNA from samples without requiring DNA isolation and purification. The high risk OPSCC HPV subtype specific LAMP primer sets demonstrated, excellent clinically relevant, minimum copy number detection thresholds with an easy readout system. Amplification directly from samples without purification illustrated the robust nature of the assay, and the primers used. This lends further support HPV type specific LAMP assays, and these specific primer sets and assays can be further developed to test for HPV in OPSCC in resource and lab limited settings, or even bedside testing.

  5. Detection of Alicyclobacillus spp. in Fruit Juice by Combination of Immunomagnetic Separation and a SYBR Green I Real-Time PCR Assay

    PubMed Central

    Yuan, Yahong; Liu, Bin; Wang, Ling; Yue, Tianli

    2015-01-01

    An approach based on immunomagnetic separation (IMS) and SYBR Green I real-time PCR (real-time PCR) with species-specific primers and melting curve analysis was proposed as a rapid and effective method for detecting Alicyclobacillus spp. in fruit juices. Specific primers targeting the 16S rDNA sequences of Alicyclobacillus spp. were designed and then confirmed by the amplification of DNA extracted from standard strains and isolates. Spiked samples containing known amounts of target bacteria were used to obtain standard curves; the correlation coefficient was greater than 0.986 and the real-time PCR amplification efficiencies were 98.9%- 101.8%. The detection limit of the testing system was 2.8×101 CFU/mL. The coefficient of variation for intra-assay and inter-assay variability were all within the acceptable limit of 5%. Besides, the performance of the IMS-real-time PCR assay was further investigated by detecting naturally contaminated kiwi fruit juice; the sensitivity, specificity and accuracy were 91.7%, 95.9% and 95.3%, respectively. The established IMS-real-time PCR procedure provides a new method for identification and quantitative detection of Alicyclobacillus spp. in fruit juice. PMID:26488469

  6. Building Information Modeling (BIM) Primer. Report 1: Facility Life-Cycle Process and Technology Innovation

    DTIC Science & Technology

    2012-08-01

    Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology Innovation In fo...is unlimited. ERDC/ITL TR-12-2 August 2012 Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology...and to enhance the quality of projects through the design, construction, and handover phases. Building Information Modeling ( BIM ) is a

  7. PCR-Based Method for the Detection of Toxic Mushrooms Causing Food-Poisoning Incidents.

    PubMed

    Nomura, Chie; Masayama, Atsushi; Yamaguchi, Mizuka; Sakuma, Daisuke; Kajimura, Keiji

    2017-01-01

    In this study, species-specific identification of five toxic mushrooms, Chlorophyllum molybdites, Gymnopilus junonius, Hypholoma fasciculare, Pleurocybella porrigens, and Tricholoma ustale, which have been involved in food-poisoning incidents in Japan, was investigated. Specific primer pairs targeting internal transcribed spacer (ITS) regions were designed for PCR detection. The specific amplicons were obtained from fresh, cooked, and simulated gastric fluid (SGF)-treated samples. No amplicons were detected from other mushrooms with similar morphology. Our method using one-step extraction of mushrooms allows rapid detection within 2.5 hr. It could be utilized for rapid identification or screening of toxic mushrooms.

  8. Characterization and application of a quantitative DNA marker that discriminates sex in Chinook salmon (Oncorhynchus tshawytscha)

    USGS Publications Warehouse

    Clifton, D.R.; Rodriguez, R.J.

    1997-01-01

    A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

  9. Characterization and application of a quantitative DNA marker that discriminates sex in chinook salmon (Oncorhynchus tshawytscha)

    USGS Publications Warehouse

    Clifton, D.R.; Rodriguez, R.J.

    1997-01-01

    A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

  10. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  11. Use of SCW4 gene primers in PCR methods for the identification of six medically important Aspergillus species.

    PubMed

    Arancia, Silvia; Sandini, Silvia; De Carolis, Elena; Vella, Antonietta; Sanguinetti, Maurizio; Norelli, Sandro; De Bernardis, Flavia

    2016-10-01

    Aspergillus species are the cause of invasive mold infections in immunocompromised patients: Aspergillus fumigatus, A. flavus and A. terreus account for most cases of invasive aspergillosis (IA). As certain species are associated with higher mortality and vary in their resistance to antifungal therapy, diagnosis requires increasingly rapid molecular methods that enable sensitive detection and species discrimination. We have developed PCR and Multiplex PCR assays for the detection of six medically important Aspergillus spp. species DNA in bronchoalveolar lavage (BAL) specimens from hematology and intensive care unit (ICU) patients at risk of IA, using different species and genus-specific PCR primers, selected within the SCW4 gene, encoding a cell wall glucanase of A. fumigatus, similar to mannoprotein Mp65 of Candida albicans. The genus-specific PCR primers were able to amplify only Aspergillus DNAs but not that belonging to other fungal genera tested. The species-specific PCR primers allowed differentiation of each Aspergillus species by the amplicon length produced. The methods described in this study are rapid (less than 4 h), reproducible, simple and specific and demonstrate potential application in the clinical laboratory.

  12. Identifying of meat species using polymerase chain reaction (PCR)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

  13. Detection of fumonisin producing Fusarium verticillioides in paddy (Oryza sativa L.) using polymerase chain reaction (PCR)

    PubMed Central

    Maheshwar, P.K.; Moharram, S. Ahmed; Janardhana, G.R.

    2009-01-01

    The study reports the occurrence of fumonisin producing Fusarium verticillioides in 90 samples of stored paddy (Oryza sativa L.) collected from different geographical regions of Karnataka, India. Fumonisin producing F. verticillioides was identified based on micromorphological characteristics and PCR using two sets of primers. One set of primers was F. verticillioides species specific, which selectively amplified the intergenic space region of rDNA. The other set of primers was specific to fumonisin producing F. verticillioides. Eight paddy samples were positive for F. verticillioides. Eleven isolates obtained from these samples were capable of producing fumonisin. PMID:24031332

  14. [Oligonucleotide microarray for subtyping avian influenza virus].

    PubMed

    Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

    2008-09-01

    Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

  15. Application of myostatin in sheep breeding programs: A review

    PubMed Central

    Miar, Younes; Salehi, Abdolreza; Kolbehdari, Davood; Aleyasin, Seyed Ahmad

    2014-01-01

    Plasma membrane H+-ATPase is a major integral membrane protein with a role in various physiological processes including abiotic stress response. To study the effect of NaCl on the expression pattern of a gene encoding the plasma membrane H+-ATPase, an experiment was carried out in a completely random design with three replications. A pair of specific primers was designed based on the sequence of the gene encoding plasma membrane H+-ATPase in Aeluropus littoralis to amplify a 259 bp fragment from the target gene by PCR. A gene encoding actin was used as reference gene to normalize the expression level of the target gene. A pair of specific primers was designed to amplify a 157 bp fragment from the actin gene by PCR. Plants were treated with different concentrations of NaCl, 0, 50, 100, 150, 200, 250, 500 and 1000 mM, for two days. Our results showed that the expression level of the plasma membrane H+-ATPase gene increased dramatically at 500 mM and then decreased with increasing concentrations of NaCl. The results also indicated that the leaves of plants, were treated with high concentrations of NaCl changed morphologically, but those grown under low concentrations of NaCl as well as the control plants did not show morphological changes in their leaves. Our results suggest a relation between morphological changes of treated plants and the expression level of the plasma membrane H+-ATPase gene in Aeluropus littoralis. PMID:27843975

  16. Development and clinical validation of a multiplex real-time PCR assay for herpes simplex and varicella zoster virus.

    PubMed

    Tan, Thean Yen; Zou, Hao; Ong, Danny Chee Tiong; Ker, Khor Jia; Chio, Martin Tze Wei; Teo, Rachael Yu Lin; Koh, Mark Jean Aan

    2013-12-01

    Herpes simplex virus (HSV) and varicella zoster virus (VZV) are related members of the Herpesviridae family and are well-documented human pathogens causing a spectrum of diseases, from mucocutaneous disease to infections of the central nervous system. This study was carried out to evaluate and validate the performance of a multiplex real-time polymerase chain reaction (PCR) assay in detecting and differentiating HSV1, HSV2, and VZV from clinical samples. Consensus PCR primers for HSV were designed from the UL30 component of the DNA polymerase gene of HSV, with 2 separate hydrolysis probes designed to differentiate HSV1 and HSV2. Separate primers and a probe were also designed against the DNA polymerase gene of VZV. A total of 104 clinical samples were available for testing by real-time PCR, conventional PCR, and viral culture. The sensitivity and specificity of the real-time assay was calculated by comparing the multiplex PCR result with that of a combined standard of virus culture and conventional PCR. The sensitivity of the real-time assay was 100%, with specificity ranging from 98% to 100% depending on the target gene. Both PCR methods detected more positive samples for HSV or VZV, compared with conventional virus culture. This multiplex PCR assay provides accurate and rapid diagnostic capabilities for the diagnosis and differentiation of HSV1, HSV2, and VZV infections, with the presence of an internal control to monitor for inhibition of the PCR reaction.

  17. Gemi: PCR Primers Prediction from Multiple Alignments

    PubMed Central

    Sobhy, Haitham; Colson, Philippe

    2012-01-01

    Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

  18. Generic and sequence-variant specific molecular assays for the detection of the highly variable Grapevine leafroll-associated virus 3.

    PubMed

    Chooi, Kar Mun; Cohen, Daniel; Pearson, Michael N

    2013-04-01

    Grapevine leafroll-associated virus 3 (GLRaV-3) is an economically important virus, which is found in all grapevine growing regions worldwide. Its accurate detection in nursery and field samples is of high importance for certification schemes and disease management programmes. To reduce false negatives that can be caused by sequence variability, a new universal primer pair was designed against a divergent sequence data set, targeting the open reading frame 4 (heat shock protein 70 homologue gene), and optimised for conventional one-step RT-PCR and one-step SYBR Green real-time RT-PCR assays. In addition, primer pairs for the simultaneous detection of specific GLRaV-3 variants from groups 1, 2, 6 (specifically NZ-1) and the outlier NZ2 variant, and the generic detection of variants from groups 1 to 5 were designed and optimised as a conventional one-step multiplex RT-PCR assay using the plant nad5 gene as an internal control (i.e. one-step hexaplex RT-PCR). Results showed that the generic and variant specific assays detected in vitro RNA transcripts from a range of 1×10(1)-1×10(8) copies of amplicon per μl diluted in healthy total RNA from Vitis vinifera cv. Cabernet Sauvignon. Furthermore, the assays were employed effectively to screen 157 germplasm and 159 commercial field samples. Thus results demonstrate that the GLRaV-3 generic and variant-specific assays are prospective tools that will be beneficial for certification schemes and disease management programmes, as well as biological and epidemiological studies of the divergent GLRaV-3 populations. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Cell of Origin: Exploring an Alternative Contributor to Ovarian Cancer

    DTIC Science & Technology

    2015-12-01

    of 60 mice). We previously reported that we conducted simple preliminary studies to assess the potential impact of the retroviral infections on...using primers designed to specifically detect exogenous TP53 gene expression. 12. Simple preliminary studies assessing the potential impact of exogenous...Award was ending and we were delinquent with respect to submission of the Closure report and no longer had access to the funds. Since there was such a

  20. New generic primer system targeting mucosal/genital and cutaneous human papillomaviruses leads to the characterization of HPV 115, a novel Beta-papillomavirus species 3

    PubMed Central

    Chouhy, Diego; Gorosito, Mario; Sánchez, Adriana; Serra, Esteban C; Bergero, Adriana; Bussy, Ramón Fernandez; Giri, Adriana A

    2009-01-01

    We explored the cutaneotropic HPV genetic diversity in 71 subjects from Argentina. New generic primers (CUT) targeting 88 mucosal/cutaneous HPV were designed and compared to FAP primers. Overall, 69 different HPV types/putative types were identified, being 17 of them novel putative types. Phylogenetic analysis of partial L1 sequences grouped 2 novel putative types in the Beta-PV, 14 in the Gamma-PV and 1 in the Mu-PV genera. CUT primers showed broader capacity than FAP primers in detecting different genera/species and novel putative types (p<0.01). Using overlapping PCR, the full-length genome of a Beta-PV putative type was amplified and cloned. The new virus, designated HPV 115, encodes 5 early genes and 2 late genes. Phylogenetic analysis indicated HPV 115 as the most divergent type within the genus Beta-PV species 3. This report is the first providing data on cutaneous HPVs circulating in South America and expands our knowledge of the Papillomaviridae family. PMID:19948351

Top