Sample records for specific single nucleotide

  1. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.

    PubMed

    Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A

    2010-08-01

    Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  3. Single nucleotide polymorphism analysis using different colored dye dimer probes

    NASA Astrophysics Data System (ADS)

    Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter

    2006-09-01

    Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

  4. Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

  5. Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

    PubMed Central

    Duellman, Tyler; Warren, Christopher; Yang, Jay

    2014-01-01

    Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

  6. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    PubMed

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  7. A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification

    PubMed Central

    Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.

    2016-01-01

    The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544

  8. Allele-specific locus binding and genome editing by CRISPR at the p16INK4a locus.

    PubMed

    Fujita, Toshitsugu; Yuno, Miyuki; Fujii, Hodaka

    2016-07-28

    The clustered regularly interspaced short palindromic repeats (CRISPR) system has been adopted for a wide range of biological applications including genome editing. In some cases, dissection of genome functions requires allele-specific genome editing, but the use of CRISPR for this purpose has not been studied in detail. In this study, using the p16INK4a gene in HCT116 as a model locus, we investigated whether chromatin states, such as CpG methylation, or a single-nucleotide gap form in a target site can be exploited for allele-specific locus binding and genome editing by CRISPR in vivo. First, we showed that allele-specific locus binding and genome editing could be achieved by targeting allele-specific CpG-methylated regions, which was successful for one, but not all guide RNAs. In this regard, molecular basis underlying the success remains elusive at this stage. Next, we demonstrated that an allele-specific single-nucleotide gap form could be employed for allele-specific locus binding and genome editing by CRISPR, although it was important to avoid CRISPR tolerance of a single nucleotide mismatch brought about by mismatched base skipping. Our results provide information that might be useful for applications of CRISPR in studies of allele-specific functions in the genomes.

  9. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    PubMed

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  10. Antibiotic Resistance and Single-Nucleotide Polymorphism Cluster Grouping Type in a Multinational Sample of Resistant Mycobacterium tuberculosis Isolates▿

    PubMed Central

    Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.

    2007-01-01

    A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140

  11. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    PubMed

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  12. Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

    PubMed

    Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

    2013-10-01

    Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

  13. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    NASA Astrophysics Data System (ADS)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  14. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

    PubMed

    Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

    2017-01-01

    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

  15. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    PubMed

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  16. Genome-scale engineering of Saccharomyces cerevisiae with single-nucleotide precision.

    PubMed

    Bao, Zehua; HamediRad, Mohammad; Xue, Pu; Xiao, Han; Tasan, Ipek; Chao, Ran; Liang, Jing; Zhao, Huimin

    2018-07-01

    We developed a CRISPR-Cas9- and homology-directed-repair-assisted genome-scale engineering method named CHAnGE that can rapidly output tens of thousands of specific genetic variants in yeast. More than 98% of target sequences were efficiently edited with an average frequency of 82%. We validate the single-nucleotide resolution genome-editing capability of this technology by creating a genome-wide gene disruption collection and apply our method to improve tolerance to growth inhibitors.

  17. Detection of single-nucleotide polymorphisms using gold nanoparticles and single-strand-specific nucleases.

    PubMed

    Chen, Yen-Ting; Hsu, Chiao-Ling; Hou, Shao-Yi

    2008-04-15

    The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.

  18. Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

    PubMed

    Shirasu, Naoto; Kuroki, Masahide

    2014-01-01

    We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

  19. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey

    PubMed Central

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-01-01

    Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596

  20. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey.

    PubMed

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-05-05

    Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.

  1. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    PubMed

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  2. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  3. Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

    PubMed

    Winterhagen, Patrick; Wünsche, Jens-Norbert

    2016-05-01

    Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

  4. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    PubMed Central

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

    2016-01-01

    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  5. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    PubMed

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Using of methods of speckle optics for Chlamydia trachomatis typing

    NASA Astrophysics Data System (ADS)

    Ulyanov, Sergey S.; Zaytsev, Sergey S.; Ulianova, Onega V.; Saltykov, Yury V.; Feodorova, Valentina A.

    2017-03-01

    Specific method of transformation of nucleotide of gene into speckle pattern is suggested. Reference speckle pattern of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci as well is generated. Perspectives of proposed technique in the gene identification and detection of natural genetic mutations as single nucleotide polymorphism (SNP) are demonstrated.

  7. Sequence specificity of the hammerhead ribozyme revisited; the NHH rule.

    PubMed Central

    Kore, A R; Vaish, N K; Kutzke, U; Eckstein, F

    1998-01-01

    The sequence specificity of hammerhead ribozyme cleavage has been re-evaluated with respect to the NUH rule. Contrary to previous reports it was found that substrates with GAC triplets were also cleaved. This was established in three different sequence contexts. The rate of cleavage under single turnover conditions was between 3 and 7% that of cleavage 3' of GUC. Specificity of cleavage of substrates containing a central A in the cleavable triplet can be described as NAH, where N can be any nucleotide and H any nucleotide but G. As cleavage 3' of NCH triplets has recently been described, the NUH rule can be reformulated to NHH. PMID:9722629

  8. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  9. Detecting Single-Nucleotide Substitutions Induced by Genome Editing.

    PubMed

    Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

    2016-08-01

    The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.

  10. Comparison of two PCR-based methods and automated DNA sequencing for prop-1 genotyping in Ames dwarf mice.

    PubMed

    Gerstner, Arpad; DeFord, James H; Papaconstantinou, John

    2003-07-25

    Ames dwarfism is caused by a homozygous single nucleotide mutation in the pituitary specific prop-1 gene, resulting in combined pituitary hormone deficiency, reduced growth and extended lifespan. Thus, these mice serve as an important model system for endocrinological, aging and longevity studies. Because the phenotype of wild type and heterozygous mice is undistinguishable, it is imperative for successful breeding to accurately genotype these animals. Here we report a novel, yet simple, approach for prop-1 genotyping using PCR-based allele-specific amplification (PCR-ASA). We also compare this method to other potential genotyping techniques, i.e. PCR-based restriction fragment length polymorphism analysis (PCR-RFLP) and fluorescence automated DNA sequencing. We demonstrate that the single-step PCR-ASA has several advantages over the classical PCR-RFLP because the procedure is simple, less expensive and rapid. To further increase the specificity and sensitivity of the PCR-ASA, we introduced a single-base mismatch at the 3' penultimate position of the mutant primer. Our results also reveal that the fluorescence automated DNA sequencing has limitations for detecting a single nucleotide polymorphism in the prop-1 gene, particularly in heterozygotes.

  11. Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.

    PubMed

    Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki

    2010-07-01

    Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.

  12. Defining the mRNA recognition signature of a bacterial toxin protein

    DOE PAGES

    Schureck, Marc A.; Dunkle, Jack A.; Maehigashi, Tatsuya; ...

    2015-10-27

    Bacteria contain multiple type II toxins that selectively degrade mRNAs bound to the ribosome to regulate translation and growth and facilitate survival during the stringent response. Ribosome-dependent toxins recognize a variety of three-nucleotide codons within the aminoacyl (A) site, but how these endonucleases achieve substrate specificity remains poorly understood. In this paper, we identify the critical features for how the host inhibition of growth B (HigB) toxin recognizes each of the three A-site nucleotides for cleavage. X-ray crystal structures of HigB bound to two different codons on the ribosome illustrate how HigB uses a microbial RNase-like nucleotide recognition loop tomore » recognize either cytosine or adenosine at the second A-site position. Strikingly, a single HigB residue and 16S rRNA residue C1054 form an adenosine-specific pocket at the third A-site nucleotide, in contrast to how tRNAs decode mRNA. Finally, our results demonstrate that the most important determinant for mRNA cleavage by ribosome-dependent toxins is interaction with the third A-site nucleotide.« less

  13. Defining the mRNA recognition signature of a bacterial toxin protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schureck, Marc A.; Dunkle, Jack A.; Maehigashi, Tatsuya

    Bacteria contain multiple type II toxins that selectively degrade mRNAs bound to the ribosome to regulate translation and growth and facilitate survival during the stringent response. Ribosome-dependent toxins recognize a variety of three-nucleotide codons within the aminoacyl (A) site, but how these endonucleases achieve substrate specificity remains poorly understood. In this paper, we identify the critical features for how the host inhibition of growth B (HigB) toxin recognizes each of the three A-site nucleotides for cleavage. X-ray crystal structures of HigB bound to two different codons on the ribosome illustrate how HigB uses a microbial RNase-like nucleotide recognition loop tomore » recognize either cytosine or adenosine at the second A-site position. Strikingly, a single HigB residue and 16S rRNA residue C1054 form an adenosine-specific pocket at the third A-site nucleotide, in contrast to how tRNAs decode mRNA. Finally, our results demonstrate that the most important determinant for mRNA cleavage by ribosome-dependent toxins is interaction with the third A-site nucleotide.« less

  14. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    PubMed

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  15. Uncovering drug-responsive regulatory elements

    PubMed Central

    Luizon, Marcelo R; Ahituv, Nadav

    2015-01-01

    Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224

  16. Development of a rapid serotyping method for Salmonella enterica using serotype-specific single-nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Salmonella enterica subsp. enterica serotype Enteriditis (S. Enteriditis) is the leading cause of salmonellosis worldwide, including the USA. Many S. enterica serotypes known to cause foodborne disease are associated with broiler meat contamination. While some serotypes are specific to birds (S. e...

  17. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c

  18. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    PubMed Central

    El-Sabrout, Karim; Aggag, Sarah A.

    2017-01-01

    Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

  19. Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.

    PubMed

    Wood-Bouwens, Christina M; Ji, Hanlee P

    2018-01-01

    Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.

  20. Classical Swine Fever Virus Glycoprotein Erns Is an Endoribonuclease with an Unusual Base Specificity

    PubMed Central

    Hausmann, Yvonne; Roman-Sosa, Gleyder; Thiel, Heinz-Jürgen; Rümenapf, Till

    2004-01-01

    The glycoprotein Erns of pestiviruses is a virion-associated and -secreted RNase that is involved in virulence. The requirements at the cleavage site in heteropolymeric RNA substrates were studied for Erns. Limited digestion of heteropolymeric RNA substrates indicated a cleavage 5′ of uridine residues irrespective of the preceding nucleotide (Np/U). To further study specificity radiolabeled RNA, molecules of 45 to 56 nucleotides in length were synthesized that contained no or a single Np/U cleavage site. Cleavage was only observed in substrates containing an ApU, CpU, GpU, or UpU dinucleotide and occurred in two steps, an initial NpU-specific and a consecutive unspecific degradation. The NpU-specific cleavage was resistant to 7 M urea while the second-order cleavage was sensitive to denaturation. Kinetic analyses revealed that Erns is a highly active endoribonuclease (kcat/Km = 2 × 106 to 10 × 106 M−1 s−1) with a strong affinity to NpU containing single-stranded RNA substrates (Km = 85 to 260 nM). PMID:15113930

  1. The nucleotide binding properties of human MSH2/MSH3 are lesion-dependent and distinct from those of human MSH2/MSH6

    PubMed Central

    Owen, Barbara A. L.; Lang, Walter; McMurray, Cynthia T.

    2010-01-01

    Summary Here, we report that MSH2/MSH3 maintains lesion specificity for small loops by a distinctly different mechanism than does MHSH2/MSH6 for single base mismatches. ADP and ATP have no preference for the subunits of hMSH2/MSH3. Upon lesion binding, however, hMSH2/MSH3 adopts a single “nucleotide signature” in which one ADP binds within the hMSH2 subunit and the hMSH3 subunit is empty. On the lesion, ADP-hMSH2/MSH3-empty binds and hydrolyzes ATP in the empty hMSH3 subunit, which reduces ADP affinity and increases ATP affinity for the hMSH2 subunit. ADP/ATP exchange converts (CA)4-loop-bound ADP-MSH2/MSH3-ATP into an ATP-hMSH2/MSH3-ADP intermediate in which ATP hydrolysis is inhibited in the hMSH2 subunit. We propose a model in which lesion binding converts hMSH2/MSH3 into a distinct nucleotide-bound form, and poises it to be a molecular sensor for lesion specificity. PMID:19377479

  2. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    PubMed

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

    PubMed

    Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

    2012-10-01

    To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

  4. Prediction of Adult Dyslipidemia Using Genetic and Childhood Clinical Risk Factors: The Cardiovascular Risk in Young Finns Study.

    PubMed

    Nuotio, Joel; Pitkänen, Niina; Magnussen, Costan G; Buscot, Marie-Jeanne; Venäläinen, Mikko S; Elo, Laura L; Jokinen, Eero; Laitinen, Tomi; Taittonen, Leena; Hutri-Kähönen, Nina; Lyytikäinen, Leo-Pekka; Lehtimäki, Terho; Viikari, Jorma S; Juonala, Markus; Raitakari, Olli T

    2017-06-01

    Dyslipidemia is a major modifiable risk factor for cardiovascular disease. We examined whether the addition of novel single-nucleotide polymorphisms for blood lipid levels enhances the prediction of adult dyslipidemia in comparison to childhood lipid measures. Two thousand four hundred and twenty-two participants of the Cardiovascular Risk in Young Finns Study who had participated in 2 surveys held during childhood (in 1980 when aged 3-18 years and in 1986) and at least once in a follow-up study in adulthood (2001, 2007, and 2011) were included. We examined whether inclusion of a lipid-specific weighted genetic risk score based on 58 single-nucleotide polymorphisms for low-density lipoprotein cholesterol, 71 single-nucleotide polymorphisms for high-density lipoprotein cholesterol, and 40 single-nucleotide polymorphisms for triglycerides improved the prediction of adult dyslipidemia compared with clinical childhood risk factors. Adjusting for age, sex, body mass index, physical activity, and smoking in childhood, childhood lipid levels, and weighted genetic risk scores were associated with an increased risk of adult dyslipidemia for all lipids. Risk assessment based on 2 childhood lipid measures and the lipid-specific weighted genetic risk scores improved the accuracy of predicting adult dyslipidemia compared with the approach using only childhood lipid measures for low-density lipoprotein cholesterol (area under the receiver-operating characteristic curve 0.806 versus 0.811; P =0.01) and triglycerides (area under the receiver-operating characteristic curve 0.740 versus area under the receiver-operating characteristic curve 0.758; P <0.01). The overall net reclassification improvement and integrated discrimination improvement were significant for all outcomes. The inclusion of weighted genetic risk scores to lipid-screening programs in childhood could modestly improve the identification of those at highest risk of dyslipidemia in adulthood. © 2017 American Heart Association, Inc.

  5. Single-cell mRNA sequencing identifies subclonal heterogeneity in anti-cancer drug responses of lung adenocarcinoma cells.

    PubMed

    Kim, Kyu-Tae; Lee, Hye Won; Lee, Hae-Ock; Kim, Sang Cheol; Seo, Yun Jee; Chung, Woosung; Eum, Hye Hyeon; Nam, Do-Hyun; Kim, Junhyong; Joo, Kyeung Min; Park, Woong-Yang

    2015-06-19

    Intra-tumoral genetic and functional heterogeneity correlates with cancer clinical prognoses. However, the mechanisms by which intra-tumoral heterogeneity impacts therapeutic outcome remain poorly understood. RNA sequencing (RNA-seq) of single tumor cells can provide comprehensive information about gene expression and single-nucleotide variations in individual tumor cells, which may allow for the translation of heterogeneous tumor cell functional responses into customized anti-cancer treatments. We isolated 34 patient-derived xenograft (PDX) tumor cells from a lung adenocarcinoma patient tumor xenograft. Individual tumor cells were subjected to single cell RNA-seq for gene expression profiling and expressed mutation profiling. Fifty tumor-specific single-nucleotide variations, including KRAS(G12D), were observed to be heterogeneous in individual PDX cells. Semi-supervised clustering, based on KRAS(G12D) mutant expression and a risk score representing expression of 69 lung adenocarcinoma-prognostic genes, classified PDX cells into four groups. PDX cells that survived in vitro anti-cancer drug treatment displayed transcriptome signatures consistent with the group characterized by KRAS(G12D) and low risk score. Single-cell RNA-seq on viable PDX cells identified a candidate tumor cell subgroup associated with anti-cancer drug resistance. Thus, single-cell RNA-seq is a powerful approach for identifying unique tumor cell-specific gene expression profiles which could facilitate the development of optimized clinical anti-cancer strategies.

  6. Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

    PubMed Central

    Parker, K A; Steitz, J A

    1987-01-01

    The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

  7. Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

    PubMed

    Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

    2007-08-31

    Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

  8. Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

    NASA Astrophysics Data System (ADS)

    Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

    2016-05-01

    We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

  9. Bayesian analysis of parent-specific transmission ratio distortion in seven Spanish beef cattle breeds.

    PubMed

    Casellas, J; Cañas-Álvarez, J J; González-Rodríguez, A; Puig-Oliveras, A; Fina, M; Piedrafita, J; Molina, A; Díaz, C; Baró, J A; Varona, L

    2017-02-01

    Transmission ratio distortion (TRD) is the departure from the expected Mendelian ratio in offspring, a poorly investigated biological phenomenon in livestock species. Given the current availability of specific parametric methods for the analysis of segregation data, this study focused on the screening of TRD in 602 402 single nucleotide polymorphisms covering all autosomal chromosomes in seven Spanish beef cattle breeds. On average, 0.13% (n = 786) and 0.01% (n = 29) of genetic markers evidenced sire- or dam-specific TRD respectively. There were no single nucleotide polymorphisms accounting for both sire- and dam-specific TRD at the same time, and only one marker (rs43147474) accounted for (sire-specific) TRD in all seven breeds. It must be noted that rs43147474 is located in the fourth intronic region of the GTP-binding protein 10 gene, and this locus has been previously linked to the maintenance of mitochondria and nucleolar architectures. Alternatively, other candidate genes surround this hot-spot for sire-specific TRD in the cattle genome, and they are related to embryonic and postnatal lethality as well as prostate cancer, among others. This research characterized the distribution of TRD in the bovine genome, highlighting heterogeneous results when comparing across breeds. © 2016 Stichting International Foundation for Animal Genetics.

  10. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

    PubMed

    Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

    2015-01-01

    Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

  11. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil.

    PubMed

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; Prata, Mara de Moura Gondim; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-02-01

    This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL.

  12. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil

    PubMed Central

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; de Moura Gondim Prata, Mara; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-01-01

    OBJECTIVE: This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. METHOD: A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. RESULTS: Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. CONCLUSIONS: These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL. PMID:26934237

  13. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  14. The origin of multiple clones in the parthenogenetic lizard species Darevskia rostombekowi.

    PubMed

    Ryskov, Alexey P; Osipov, Fedor A; Omelchenko, Andrey V; Semyenova, Seraphima K; Girnyk, Anastasiya E; Korchagin, Vitaly I; Vergun, Andrey A; Murphy, Robert W

    2017-01-01

    The all-female Caucasian rock lizard Darevskia rostombekowi and other unisexual species of this genus reproduce normally via true parthenogenesis. Typically, diploid parthenogenetic reptiles exhibit some amount of clonal diversity. However, allozyme data from D. rostombekowi have suggested that this species consists of a single clone. Herein, we test this hypothesis by evaluating variation at three variable microsatellite loci for 42 specimens of D. rostombekowi from four populations in Armenia. Analyses based on single nucleotide polymorphisms of each locus reveal five genotypes or presumptive clones in this species. All individuals are heterozygous at the loci. The major clone occurs in 24 individuals and involves three populations. Four rare clones involve one or several individuals from one or two populations. Most variation owes to parent-specific single nucleotide polymorphisms, which occur as heterozygotes. This result fails to reject the hypothesis of a single hybridization founder event that resulted in the initial formation of one major clone. The other clones appear to have originated via post-formation microsatellite mutations of the major clone.

  15. Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection

    PubMed Central

    KC, R.; Srivastava, A.; Wilkowski, J. M.; Richter, C. E.; Shavit, J. A.; Burke, D. T.; Bielas, S. L.

    2016-01-01

    CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703

  16. Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

    2010-01-01

    The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

  17. Functional analysis of regulatory single-nucleotide polymorphisms.

    PubMed

    Pampín, Sandra; Rodríguez-Rey, José C

    2007-04-01

    The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

  18. Determination of human DNA polymerase utilization for the repair of a model ionizing radiation-induced DNA strand break lesion in a defined vector substrate

    NASA Technical Reports Server (NTRS)

    Winters, T. A.; Russell, P. S.; Kohli, M.; Dar, M. E.; Neumann, R. D.; Jorgensen, T. J.

    1999-01-01

    Human DNA polymerase and DNA ligase utilization for the repair of a major class of ionizing radiation-induced DNA lesion [DNA single-strand breaks containing 3'-phosphoglycolate (3'-PG)] was examined using a novel, chemically defined vector substrate containing a single, site-specific 3'-PG single-strand break lesion. In addition, the major human AP endonuclease, HAP1 (also known as APE1, APEX, Ref-1), was tested to determine if it was involved in initiating repair of 3'-PG-containing single-strand break lesions. DNA polymerase beta was found to be the primary polymerase responsible for nucleotide incorporation at the lesion site following excision of the 3'-PG blocking group. However, DNA polymerase delta/straightepsilon was also capable of nucleotide incorporation at the lesion site following 3'-PG excision. In addition, repair reactions catalyzed by DNA polymerase beta were found to be most effective in the presence of DNA ligase III, while those catalyzed by DNA polymerase delta/straightepsilon appeared to be more effective in the presence of DNA ligase I. Also, it was demonstrated that the repair initiating 3'-PG excision reaction was not dependent upon HAP1 activity, as judged by inhibition of HAP1 with neutralizing HAP1-specific polyclonal antibody.

  19. Yeast ribonuclease III uses a network of multiple hydrogen bonds for RNA binding and cleavage.

    PubMed

    Lavoie, Mathieu; Abou Elela, Sherif

    2008-08-19

    Members of the bacterial RNase III family recognize a variety of short structured RNAs with few common features. It is not clear how this group of enzymes supports high cleavage fidelity while maintaining a broad base of substrates. Here we show that the yeast orthologue of RNase III (Rnt1p) uses a network of 2'-OH-dependent interactions to recognize substrates with different structures. We designed a series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate was engineered to carry a single or multiple 2'- O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Interestingly, introduction of 2'- O-methyl ribonucleotides near the cleavage site increased the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'- O-methyl ribonucleotides inhibited cleavage while single 2'-fluoro ribonucleotide substitutions did not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated. Strikingly, several nucleotide substitutions greatly increased the substrate dissociation constant with little or no effect on the Michaelis-Menten constant or rate of catalysis. Together, the results indicate that Rnt1p uses a network of nucleotide interactions to identify its substrate and support two distinct modes of binding. One mode is primarily mediated by the dsRNA binding domain and leads to the formation of stable RNA/protein complex, while the other requires the presence of the nuclease and N-terminal domains and leads to RNA cleavage.

  20. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    NASA Astrophysics Data System (ADS)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

    2016-04-01

    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  1. Structural characterization of Helicobacter pylori dethiobiotin synthetase reveals differences between family members

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Porebski, Przemyslaw J.; Klimecka, Maria; Chruszcz, Maksymilian

    2012-07-11

    Dethiobiotin synthetase (DTBS) is involved in the biosynthesis of biotin in bacteria, fungi, and plants. As humans lack this pathway, DTBS is a promising antimicrobial drug target. We determined structures of DTBS from Helicobacter pylori (hpDTBS) bound with cofactors and a substrate analog, and described its unique characteristics relative to other DTBS proteins. Comparison with bacterial DTBS orthologs revealed considerable structural differences in nucleotide recognition. The C-terminal region of DTBS proteins, which contains two nucleotide-recognition motifs, differs greatly among DTBS proteins from different species. The structure of hpDTBS revealed that this protein is unique and does not contain a C-terminalmore » region containing one of the motifs. The single nucleotide-binding motif in hpDTBS is similar to its counterpart in GTPases; however, isothermal titration calorimetry binding studies showed that hpDTBS has a strong preference for ATP. The structural determinants of ATP specificity were assessed with X-ray crystallographic studies of hpDTBS-ATP and hpDTBS-GTP complexes. The unique mode of nucleotide recognition in hpDTBS makes this protein a good target for H. pylori-specific inhibitors of the biotin synthesis pathway.« less

  2. The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

    PubMed

    Khoe, Clairine V; Chung, Long H; Murray, Vincent

    2018-06-01

    The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  3. Hepatitis C Virus Core Protein Promotes miR-122 Destabilization by Inhibiting GLD-2

    PubMed Central

    Kim, Geon-Woo; Lee, Seung-Hoon; Cho, Hee; Kim, Minwoo; Shin, Eui-Cheol; Oh, Jong-Won

    2016-01-01

    The liver-specific microRNA miR-122, which has essential roles in liver development and metabolism, is a key proviral factor for hepatitis C virus (HCV). Despite its crucial role in the liver and HCV life cycle, little is known about the molecular mechanism of miR-122 expression regulation by HCV infection. Here, we show that the HCV core protein downregulates the abundance of miR-122 by promoting its destabilization via the inhibition of GLD-2, a non-canonical cytoplasmic poly(A) polymerase. The decrease in miR-122 expression resulted in the dysregulation of the known functions of miR-122, including its proviral activity for HCV. By high-throughput sequencing of small RNAs from human liver biopsies, we found that the 22-nucleotide (nt) prototype miR-122 is modified at its 3′ end by 3′-terminal non-templated and templated nucleotide additions. Remarkably, the proportion of miR-122 isomers bearing a single nucleotide tail of any ribonucleotide decreased in liver specimens from patients with HCV. We found that these single-nucleotide-tailed miR-122 isomers display increased miRNA activity and stability over the 22-nt prototype miR-122 and that the 3′-terminal extension is catalyzed by the unique terminal nucleotidyl transferase activity of GLD-2, which is capable of adding any single ribonucleotide without preference of adenylate to the miR-122 3′ end. The HCV core protein specifically inhibited GLD-2, and its interaction with GLD-2 in the cytoplasm was found to be responsible for miR-122 downregulation. Collectively, our results provide new insights into the regulatory role of the HCV core protein in controlling viral RNA abundance and miR-122 functions through miR-122 stability modulation. PMID:27366906

  4. Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

    PubMed

    Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

    2017-04-01

    In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

  5. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  6. Population-Specific Patterns of Linkage Disequilibrium and SNP Variation in Spring and Winter Polyploid Wheat

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) are ideally suited for the construction of high-resolution genetic maps, studying population evolutionary history and performing genome-wide association mapping experiments. Here we used a genome-wide set of 1536 SNPs to study linkage disequilibrium (LD) and po...

  7. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    PubMed

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and reliable genotyping tool to assist hybrid cotton breeding.

  8. Genetic polymorphisms in ESR1 and ESR2 genes, and risk of hypospadias in a multiethnic study population.

    PubMed

    Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L

    2015-05-01

    Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  9. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    PubMed

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  10. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    NASA Astrophysics Data System (ADS)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  11. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  12. A new class of homogeneous nucleic acid probes based on specific displacement hybridization

    PubMed Central

    Li, Qingge; Luan, Guoyan; Guo, Qiuping; Liang, Jixuan

    2002-01-01

    We have developed a new class of probes for homogeneous nucleic acid detection based on the proposed displacement hybridization. Our probes consist of two complementary oligodeoxyribonucleotides of different length labeled with a fluorophore and a quencher in close proximity in the duplex. The probes on their own are quenched, but they become fluorescent upon displacement hybridization with the target. These probes display complete discrimination between a perfectly matched target and single nucleotide mismatch targets. A comparison of double-stranded probes with corresponding linear probes confirms that the presence of the complementary strand significantly enhances their specificity. Using four such probes labeled with different color fluorophores, each designed to recognize a different target, we have demonstrated that multiple targets can be distinguished in the same solution, even if they differ from one another by as little as a single nucleotide. Double-stranded probes were used in real-time nucleic acid amplifications as either probes or as primers. In addition to its extreme specificity and flexibility, the new class of probes is simple to design and synthesize, has low cost and high sensitivity and is accessible to a wide range of labels. This class of probes should find applications in a variety of areas wherever high specificity of nucleic acid hybridization is relevant. PMID:11788731

  13. Site-specific labeling of RNA at internal ribose hydroxyl groups: terbium-assisted deoxyribozymes at work.

    PubMed

    Büttner, Lea; Javadi-Zarnaghi, Fatemeh; Höbartner, Claudia

    2014-06-04

    A general and efficient single-step method was established for site-specific post-transcriptional labeling of RNA. Using Tb(3+) as accelerating cofactor for deoxyribozymes, various labeled guanosines were site-specifically attached to 2'-OH groups of internal adenosines in in vitro transcribed RNA. The DNA-catalyzed 2',5'-phosphodiester bond formation proceeded efficiently with fluorescent, spin-labeled, biotinylated, or cross-linker-modified guanosine triphosphates. The sequence context of the labeling site was systematically analyzed by mutating the nucleotides flanking the targeted adenosine. Labeling of adenosines in a purine-rich environment showed the fastest reactions and highest yields. Overall, practically useful yields >70% were obtained for 13 out of 16 possible nucleotide (nt) combinations. Using this approach, we demonstrate preparative labeling under mild conditions for up to ~160-nt-long RNAs, including spliceosomal U6 small nuclear RNA and a cyclic-di-AMP binding riboswitch RNA.

  14. In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies.

    PubMed

    Lipi, Farhana; Chen, Suxiang; Chakravarthy, Madhuri; Rakesh, Shilpa; Veedu, Rakesh N

    2016-12-01

    Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotide sequences that bind to a specific target molecule with high affinity and specificity through their ability to adopt 3-dimensional structure in solution. Aptamers have huge potential as targeted therapeutics, diagnostics, delivery agents and as biosensors. However, aptamers composed of natural nucleotide monomers are quickly degraded in vivo and show poor pharmacodynamic properties. To overcome this, chemically-modified nucleic acid aptamers are developed by incorporating modified nucleotides after or during the selection process by Systematic Evolution of Ligands by EXponential enrichment (SELEX). This review will discuss the development of chemically-modified aptamers and provide the pros and cons, and new insights on in vitro aptamer selection strategies by using chemically-modified nucleic acid libraries.

  15. In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies

    PubMed Central

    Chen, Suxiang; Chakravarthy, Madhuri; Rakesh, Shilpa; Veedu, Rakesh N.

    2016-01-01

    ABSTRACT Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotide sequences that bind to a specific target molecule with high affinity and specificity through their ability to adopt 3-dimensional structure in solution. Aptamers have huge potential as targeted therapeutics, diagnostics, delivery agents and as biosensors. However, aptamers composed of natural nucleotide monomers are quickly degraded in vivo and show poor pharmacodynamic properties. To overcome this, chemically-modified nucleic acid aptamers are developed by incorporating modified nucleotides after or during the selection process by Systematic Evolution of Ligands by EXponential enrichment (SELEX). This review will discuss the development of chemically-modified aptamers and provide the pros and cons, and new insights on in vitro aptamer selection strategies by using chemically-modified nucleic acid libraries. PMID:27715478

  16. Phenomenological Partial Specific Volumes for G-Quadruplex DNAs

    PubMed Central

    Hellman, Lance M.; Rodgers, David W.; Fried, Michael G.

    2009-01-01

    Accurate partial specific volume (ν̄) values are required for sedimentation velocity and sedimentation equilibrium analyses. For nucleic acids, the estimation of these values is complicated by the fact that ν̄ depends on base composition, secondary structure, solvation and the concentrations and identities of ions in the surrounding buffer. Here we describe sedimentation equilibrium measurements of the apparent isopotential partial specific volume φ′ for two G-quadruplex DNAs and a single-stranded DNA of similar molecular weight and base composition. The G-quadruplex DNAs are a 22 nucleotide fragment of the human telomere consensus sequence and a 27 nucleotide fragment from the human c-myc promoter. The single-stranded DNA is 26 nucleotides long and is designed to have low propensity to form secondary structures. Parallel measurements were made in buffers containing NaCl and in buffers containing KCl, spanning the range 0.09M ≤ [salt] ≤ 2.3M. Limiting values of φ′, extrapolated to [salt] = 0M, were: 22-mer (NaCl-form), 0.525 ± 0.004 mL/g; 22-mer (KCl-form), 0.531 ± 0.006 mL/g; 27-mer (NaCl-form), 0.548 ± 0.005 mL/g; 27-mer (KCl-form), 0.557 ± 0.006 mL/g; 26-mer (NaCl-form), 0.555 ± 0.004 mL/g; 26-mer (KCl-form), 0.564 ± 0.006 mL/g. Small changes in φ′ with [salt] suggest that large changes in counterion association or hydration are unlikely to take place over these concentration ranges. PMID:19238377

  17. CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.

    PubMed

    Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru

    2015-11-01

    Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.

  18. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  19. Using haplotypes to unravel the inheritance of Holstein coat color for a larger audience

    USDA-ARS?s Scientific Manuscript database

    Haplotype testing identifies single-nucleotide polymorphisms that bracket a group of alleles from several different genes located on a specific chromosomal section of DNA. For a trait with a limited number of genotypes and phenotypes, the rules of inheritance can be determined by matching up certain...

  20. Rapid molecular pathotyping of major salmonella enterica serotypes based on single-nucleotide polymorphisms (SNPs) in the adenylate cyclase (cyaA) gene

    USDA-ARS?s Scientific Manuscript database

    Introduction: Salmonella enterica subsp. enterica serotype Enteriditis (S. Enteriditis) is the leading cause of salmonellosis worldwide, including the USA. Many S. enterica serotypes known to cause foodborne disease are associated with broiler meat contamination. While some serotypes are specific...

  1. Calving traits of crossbred Brahman Cows are Associated with Heat Shock Protein 70 Genetic Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Objectives were to: 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 gene, and 2) evaluate associations between Hsp70 SNP and calving rates of Brahman-influenced cows. Specific primers were designed for PCR amplification of a 539 b...

  2. Using Single-nucleotide Polymorphisms and Genetic Mapping to find Candidate Genes that Influence Varroa-Specific Hygiene

    USDA-ARS?s Scientific Manuscript database

    Varroa-sensitive hygienic (VSH) behavior is one of two behaviors identified that are most important for controlling the growth of Varroa mite populations in bee hives. A study was conducted to map quantitative trait loci (QTL) that influence VSH so that resistance genes could be identified. Crosses ...

  3. The regulated secretory pathway and human disease: insights from gene variants and single nucleotide polymorphisms.

    PubMed

    Lin, Wei-Jye; Salton, Stephen R

    2013-01-01

    The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.

  4. The Regulated Secretory Pathway and Human Disease: Insights from Gene Variants and Single Nucleotide Polymorphisms

    PubMed Central

    Lin, Wei-Jye; Salton, Stephen R.

    2013-01-01

    The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired. PMID:23964269

  5. Mismatch cleavage by single-strand specific nucleases

    PubMed Central

    Till, Bradley J.; Burtner, Chris; Comai, Luca; Henikoff, Steven

    2004-01-01

    We have investigated the ability of single-strand specific (sss) nucleases from different sources to cleave single base pair mismatches in heteroduplex DNA templates used for mutation and single-nucleotide polymorphism analysis. The TILLING (Targeting Induced Local Lesions IN Genomes) mismatch cleavage protocol was used with the LI-COR gel detection system to assay cleavage of amplified heteroduplexes derived from a variety of induced mutations and naturally occurring polymorphisms. We found that purified nucleases derived from celery (CEL I), mung bean sprouts and Aspergillus (S1) were able to specifically cleave nearly all single base pair mismatches tested. Optimal nicking of heteroduplexes for mismatch detection was achieved using higher pH, temperature and divalent cation conditions than are routinely used for digestion of single-stranded DNA. Surprisingly, crude plant extracts performed as well as the highly purified preparations for this application. These observations suggest that diverse members of the S1 family of sss nucleases act similarly in cleaving non-specifically at bulges in heteroduplexes, and single-base mismatches are the least accessible because they present the smallest single-stranded region for enzyme binding. We conclude that a variety of sss nucleases and extracts can be effectively used for high-throughput mutation and polymorphism discovery. PMID:15141034

  6. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  7. Gold nanoparticle enhanced fluorescence anisotropy for the assay of single nucleotide polymorphisms (SNPs) based on toehold-mediated strand-displacement reaction.

    PubMed

    Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na

    2013-03-15

    We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

    PubMed Central

    Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

    2016-01-01

    Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

  9. The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

    PubMed

    Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

    2017-09-01

    Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.

    PubMed

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2017-04-01

    For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  11. Human leukocyte antigen and cytokine receptor gene polymorphisms associated with heterogeneous immune responses to mumps viral vaccine.

    PubMed

    Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A

    2008-05-01

    Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine-induced immune responses.

  12. Human Leukocyte Antigen and Cytokine Receptor Gene Polymorphisms Associated With Heterogeneous Immune Responses to Mumps Viral Vaccine

    PubMed Central

    Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.

    2009-01-01

    OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine–induced immune responses. PMID:18450852

  13. Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

    PubMed

    Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

    2016-04-11

    Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

  14. Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.

    PubMed

    Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L

    2017-10-06

    Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.

  15. Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

    PubMed

    Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

    2016-06-01

    We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  16. Prokaryotic Nucleotide Composition Is Shaped by Both Phylogeny and the Environment

    DOE PAGES

    Reichenberger, Erin R.; Rosen, Gail; Hershberg, Uri; ...

    2015-04-09

    Here, the causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences inmore » nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences—which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.« less

  17. A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

    PubMed Central

    Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

    2013-01-01

    In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

  18. Pneumonic Plague Outbreak, Northern Madagascar, 2011

    PubMed Central

    Richard, Vincent; Herindrainy, Perlinot; Soanandrasana, Rahelinirina; Ratsitoharina, Maherisoa; Rakotomanana, Fanjasoa; Andrianalimanana, Samuel; Scholz, Holger C.; Rajerison, Minoarisoa

    2015-01-01

    Yersinia pestis, the causative agent of plague, is endemic to Madagascar, particularly to the central highlands. Although plague has not been previously reported in northern Madagascar, an outbreak of pneumonic plague occurred in this remote area in 2011. Over a 27-day period, 17 suspected, 2 presumptive, and 3 confirmed human cases were identified, and all 15 untreated 20 patients died. Molecular typing of Y. pestis isolated from 2 survivors and 5 Rattus rattus rat samples identified the Madagascar-specific 1.ORI3-k single-nucleotide polymorphism genotype and 4 clustered regularly interspaced short palindromic repeat patterns. This outbreak had a case-fatality rate of 100% for nontreated patients. The Y. pestis 1.ORI3-k single-nucleotide polymorphism genotype might cause larger epidemics. Multidrug-resistant strains and persistence of the pathogen in natural foci near human settlements pose severe risks to populations in plague-endemic regions and require outbreak response strategies. PMID:25530466

  19. Host-Specific and Segment-Specific Evolutionary Dynamics of Avian and Human Influenza A Viruses: A Systematic Review.

    PubMed

    Kim, Kiyeon; Omori, Ryosuke; Ueno, Keisuke; Iida, Sayaka; Ito, Kimihito

    2016-01-01

    Understanding the evolutionary dynamics of influenza viruses is essential to control both avian and human influenza. Here, we analyze host-specific and segment-specific Tajima's D trends of influenza A virus through a systematic review using viral sequences registered in the National Center for Biotechnology Information. To avoid bias from viral population subdivision, viral sequences were stratified according to their sampling locations and sampling years. As a result, we obtained a total of 580 datasets each of which consists of nucleotide sequences of influenza A viruses isolated from a single population of hosts at a single sampling site within a single year. By analyzing nucleotide sequences in the datasets, we found that Tajima's D values of viral sequences were different depending on hosts and gene segments. Tajima's D values of viruses isolated from chicken and human samples showed negative, suggesting purifying selection or a rapid population growth of the viruses. The negative Tajima's D values in rapidly growing viral population were also observed in computer simulations. Tajima's D values of PB2, PB1, PA, NP, and M genes of the viruses circulating in wild mallards were close to zero, suggesting that these genes have undergone neutral selection in constant-sized population. On the other hand, Tajima's D values of HA and NA genes of these viruses were positive, indicating HA and NA have undergone balancing selection in wild mallards. Taken together, these results indicated the existence of unknown factors that maintain viral subtypes in wild mallards.

  20. dbWGFP: a database and web server of human whole-genome single nucleotide variants and their functional predictions.

    PubMed

    Wu, Jiaxin; Wu, Mengmeng; Li, Lianshuo; Liu, Zhuo; Zeng, Wanwen; Jiang, Rui

    2016-01-01

    The recent advancement of the next generation sequencing technology has enabled the fast and low-cost detection of all genetic variants spreading across the entire human genome, making the application of whole-genome sequencing a tendency in the study of disease-causing genetic variants. Nevertheless, there still lacks a repository that collects predictions of functionally damaging effects of human genetic variants, though it has been well recognized that such predictions play a central role in the analysis of whole-genome sequencing data. To fill this gap, we developed a database named dbWGFP (a database and web server of human whole-genome single nucleotide variants and their functional predictions) that contains functional predictions and annotations of nearly 8.58 billion possible human whole-genome single nucleotide variants. Specifically, this database integrates 48 functional predictions calculated by 17 popular computational methods and 44 valuable annotations obtained from various data sources. Standalone software, user-friendly query services and free downloads of this database are available at http://bioinfo.au.tsinghua.edu.cn/dbwgfp. dbWGFP provides a valuable resource for the analysis of whole-genome sequencing, exome sequencing and SNP array data, thereby complementing existing data sources and computational resources in deciphering genetic bases of human inherited diseases. © The Author(s) 2016. Published by Oxford University Press.

  1. Discriminating a Single Nucleotide Difference for Enhanced miRNA Detection Using Tunable Graphene and Oligonucleotide Nanodevices.

    PubMed

    Robertson, Neil M; Hizir, Mustafa Salih; Balcioglu, Mustafa; Wang, Rui; Yavuz, Mustafa Selman; Yumak, Hasan; Ozturk, Birol; Sheng, Jia; Yigit, Mehmet V

    2015-09-15

    In this study we have reported our efforts to address some of the challenges in the detection of miRNAs using water-soluble graphene oxide and DNA nanoassemblies. Purposefully inserting mismatches at specific positions in our DNA (probe) strands shows increasing specificity against our target miRNA, miR-10b, over miR-10a which varies by only a single nucleotide. This increased specificity came at a loss of signal intensity within the system, but we demonstrated that this could be addressed with the use of DNase I, an endonuclease capable of cleaving the DNA strands of the RNA/DNA heteroduplex and recycling the RNA target to hybridize to another probe strand. As we previously demonstrated, this enzymatic signal also comes with an inherent activity of the enzyme on the surface-adsorbed probe strands. To remove this activity of DNase I and the steady nonspecific increase in the fluorescence signal without compromising the recovered signal, we attached a thermoresponsive PEGMA polymer (poly(ethylene glycol) methyl ether methacrylate) to nGO. This smart polymer is able to shield the probes adsorbed on the nGO surface from the DNase I activity and is capable of tuning the detection capacity of the nGO nanoassembly with a thermoswitch at 39 °C. By utilizing probes with multiple mismatches, DNase I cleavage of the DNA probe strands, and the attachment of PEGMA polymers to graphene oxide to block undesired DNase I activity, we were able to detect miR-10b from liquid biopsy mimics and breast cancer cell lines. Overall we have reported our efforts to improve the specificity, increase the sensitivity, and eliminate the undesired enzymatic activity of DNase I on surface-adsorbed probes for miR-10b detection using water-soluble graphene nanodevices. Even though we have demonstrated only the discrimination of miR-10b from miR-10a, our approach can be extended to other short RNA molecules which differ by a single nucleotide.

  2. "SLC2A3" Single-Nucleotide Polymorphism and Duplication Influence Cognitive Processing and Population-Specific Risk for Attention-Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Merker, Sören; Reif, Andreas; Ziegler, Georg C.; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J.; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K.; Franke, Barbara; Lesch, Klaus-Peter

    2017-01-01

    Background: Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of…

  3. Isolation and characterization of naturally occurring hairpin structures in single-stranded DNA of coliphage M13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Mitra, S.

    With precise conditions of digestion with single-strand-specific nucleases, namely, endonuclease S1 of Aspergillus oryzae and exonuclease I of Escherichia coli, nuclease-resistant DNA cores can be obtained reproducibly from single-stranded M13 DNA. The DNA cores are composed almost exclusively of two sizes (60 and 44 nucleotides long). These have high (G + C)-contents relative to that of intact M13 DNA, and arise from restricted regions of the M13 genome. The resistance of these fragments to single-strand-specific nucleases and their nondenaturability strongly suggest the presence of double-stranded segments in these core pieces. That the core pieces are only partially double-stranded is shownmore » by their lack of complete base complementarity and their pattern of elution from hydroxyapatite.« less

  4. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    NASA Astrophysics Data System (ADS)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  5. A single amino acid limits the substrate specificity of Thermus thermophilus uridine-cytidine kinase to cytidine.

    PubMed

    Tomoike, Fumiaki; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2011-05-31

    The salvage pathways of nucleotide biosynthesis are more diverse and are less well understood as compared with de novo pathways. Uridine-cytidine kinase (UCK) is the rate-limiting enzyme in the pyrimidine-nucleotide salvage pathway. In this study, we have characterized a UCK homologue of Thermus thermophilus HB8 (ttCK) biochemically and structurally. Unlike other UCKs, ttCK had substrate specificity toward only cytidine and showed no inhibition by UTP, suggesting uridine does not bind to ttCK as substrate. Structural analysis revealed that the histidine residue located near the functional group at position 4 of cytidine or uridine in most UCKs is substituted with tyrosine, Tyr93, in ttCK. Replacement of Tyr93 by histidine or glutamine endowed ttCK with phosphorylation activity toward uridine. These results suggested that a single amino acid residue, Tyr93, gives cytidine-limited specificity to ttCK. However, replacement of Tyr93 by Phe or Leu did not change the substrate specificity of ttCK. Therefore, we conclude that a residue at this position is essential for the recognition of uridine by UCK. In addition, thymidine phosphorylase from T. thermophilus HB8 was equally active with thymidine and uridine, which indicates that this protein is the sole enzyme metabolizing uridine in T. Thermophilus HB8. On the basis of these results, we discuss the pyrimidine-salvage pathway in T. thermophilus HB8.

  6. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  7. IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

    PubMed

    Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

    2017-06-26

    Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  8. Genetic Factors Influencing Coagulation Factor XIII B-Subunit Contribute to Risk of Ischemic Stroke.

    PubMed

    Hanscombe, Ken B; Traylor, Matthew; Hysi, Pirro G; Bevan, Stephen; Dichgans, Martin; Rothwell, Peter M; Worrall, Bradford B; Seshadri, Sudha; Sudlow, Cathie; Williams, Frances M K; Markus, Hugh S; Lewis, Cathryn M

    2015-08-01

    Abnormal coagulation has been implicated in the pathogenesis of ischemic stroke, but how this association is mediated and whether it differs between ischemic stroke subtypes is unknown. We determined the shared genetic risk between 14 coagulation factors and ischemic stroke and its subtypes. Using genome-wide association study results for 14 coagulation factors from the population-based TwinsUK sample (N≈2000 for each factor), meta-analysis results from the METASTROKE consortium ischemic stroke genome-wide association study (12 389 cases, 62 004 controls), and genotype data for 9520 individuals from the WTCCC2 ischemic stroke study (3548 cases, 5972 controls-the largest METASTROKE subsample), we explored shared genetic risk for coagulation and stroke. We performed three analyses: (1) a test for excess concordance (or discordance) in single nucleotide polymorphism effect direction across coagulation and stroke, (2) an estimation of the joint effect of multiple coagulation-associated single nucleotide polymorphisms in stroke, and (3) an evaluation of common genetic risk between coagulation and stroke. One coagulation factor, factor XIII subunit B (FXIIIB), showed consistent effects in the concordance analysis, the estimation of polygenic risk, and the validation with genotype data, with associations specific to the cardioembolic stroke subtype. Effect directions for FXIIIB-associated single nucleotide polymorphisms were significantly discordant with cardioembolic disease (smallest P=5.7×10(-04)); the joint effect of FXIIIB-associated single nucleotide polymorphisms was significantly predictive of ischemic stroke (smallest P=1.8×10(-04)) and the cardioembolic subtype (smallest P=1.7×10(-04)). We found substantial negative genetic covariation between FXIIIB and ischemic stroke (rG=-0.71, P=0.01) and the cardioembolic subtype (rG=-0.80, P=0.03). Genetic markers associated with low FXIIIB levels increase risk of ischemic stroke cardioembolic subtype. © 2015 The Authors.

  9. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  10. Recent Sex Chromosome Divergence despite Ancient Dioecy in the Willow Salix viminalis

    PubMed Central

    Pucholt, Pascal; Wright, Alison E.; Conze, Lei Liu; Mank, Judith E.; Berlin, Sofia

    2017-01-01

    Abstract Sex chromosomes can evolve when recombination is halted between a pair of chromosomes, and this can lead to degeneration of the sex-limited chromosome. In the early stages of differentiation sex chromosomes are homomorphic, and even though homomorphic sex chromosomes are very common throughout animals and plants, we know little about the evolutionary forces shaping these types of sex chromosomes. We used DNA- and RNA-Seq data from females and males to explore the sex chromosomes in the female heterogametic willow, Salix viminalis, a species with ancient dioecy but with homomorphic sex chromosomes. We detected no major sex differences in read coverage in the sex determination (SD) region, indicating that the W region has not significantly degenerated. However, single nucleotide polymorphism densities in the SD region are higher in females compared with males, indicating very recent recombination suppression, followed by the accumulation of sex-specific single nucleotide polymorphisms. Interestingly, we identified two female-specific scaffolds that likely represent W-chromosome-specific sequence. We show that genes located in the SD region display a mild excess of male-biased expression in sex-specific tissue, and we use allele-specific gene expression analysis to show that this is the result of masculinization of expression on the Z chromosome rather than degeneration of female-expression on the W chromosome. Together, our results demonstrate that insertion of small DNA fragments and accumulation of sex-biased gene expression can occur before the detectable decay of the sex-limited chromosome. PMID:28453634

  11. Generation of DNA single-strand displacement by compromised nucleotide excision repair

    PubMed Central

    Godon, Camille; Mourgues, Sophie; Nonnekens, Julie; Mourcet, Amandine; Coin, Fréderic; Vermeulen, Wim; Mari, Pierre-Olivier; Giglia-Mari, Giuseppina

    2012-01-01

    Nucleotide excision repair (NER) is a precisely coordinated process essential to avoid DNA damage-induced cellular malfunction and mutagenesis. Here, we investigate the mechanistic details and effects of the NER machinery when it is compromised by a pathologically significant mutation in a subunit of the repair/transcription factor TFIIH, namely XPD. In contrast to previous studies, we find that no single- or double-strand DNA breaks are produced at early time points after UV irradiation of cells bearing a specific XPD mutation, despite the presence of a clear histone H2AX phosphorylation (γH2AX) signal in the UV-exposed areas. We show that the observed γH2AX signal can be explained by the presence of longer single-strand gaps possibly generated by strand displacement. Our in vivo measurements also indicate a strongly reduced TFIIH-XPG binding that could promote single-strand displacement at the site of UV lesions. This finding not only highlights the crucial role of XPG's interactions with TFIIH for proper NER, but also sheds new light on how a faulty DNA repair process can induce extreme genomic instability in human patients. PMID:22863773

  12. Electrochemical primer extension based on polyoxometalate electroactive labels for multiplexed detection of single nucleotide polymorphisms.

    PubMed

    Chahin, Nassif; Uribe, Laura A; Debela, Ahmed M; Thorimbert, Serge; Hasenknopf, Bernold; Ortiz, Mayreli; Katakis, Ioannis; O'Sullivan, Ciara K

    2018-06-07

    Polyoxymetalates (POMs) ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ) were used to modify dideoxynucleotides (ddNTPs) through amide bond formation, and applied to the multiplexed detection of single nucleotide polymorphisms (SNPs) in an electrochemical primer extension reaction. Each gold electrode of an array was functionalised with a short single stranded thiolated DNA probe, specifically designed to extend with the POM-ddNTP at the SNP site to be interrogated. The system was applied to the simultaneous detection of 4 SNPs within a single stranded 103-mer model target generated using asymmetric PCR, highlighting the potential of POM-ddNTPs for targeted, multiplexed SNP detection. The four DNA bases were successfully labelled with both ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ), and [SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- demonstrated to be the more suitable due to its single oxidation peak, which provides an unequivocal signal. The POM-ddNTP enzymatically incorporated to the DNA anchored to the surface was visualised by AFM using gold coated mica. The developed assay has been demonstrated to be highly reproducible, simple to carry out and with very low non-specific background signals. Future work will focus on applying the developed platform to the detection of SNPs associated with rifampicin resistance in real samples from patients suffering from tuberculosis. Copyright © 2018. Published by Elsevier B.V.

  13. Constitutional and functional genetics of human alcohol-related hepatocellular carcinoma.

    PubMed

    Nahon, Pierre; Nault, Jean-Charles

    2017-11-01

    Exploration of the constitutional genetics of hepatocellular carcinoma (HCC) has identified numerous variants associated with a higher risk of liver cancer in alcoholic cirrhotic patients. Although Genome-Wide Association studies have not been carried out in the field of alcohol-related HCC, common single nucleotide polymorphisms conferring a small increase in the risk of liver cancer risk have been identified and shown to modulate ethanol metabolism, inflammation, oxidative stress, iron or lipid metabolism. Specific patterns of gene mutations including CTNNB1, TERT, ARID1A and SMARCA2 exist in alcohol-related HCC. Moreover, a specific mutational process observed at the nucleotide level by next generation sequencing has revealed cooperation between alcohol and tobacco in the development of HCC. Combining this genetic information with epidemiological and clinical data that might define specific HCC risk classes and refine surveillance strategies needs to be assessed in large prospective cohorts of patients with alcoholic cirrhosis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

    PubMed

    Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

    2014-11-28

    We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

    PubMed

    Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

    2012-05-17

    The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit.

  16. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

    PubMed Central

    2012-01-01

    Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. Keywords: single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit PMID:22594601

  17. Analysis of IAV Replication and Co-infection Dynamics by a Versatile RNA Viral Genome Labeling Method.

    PubMed

    Dou, Dan; Hernández-Neuta, Iván; Wang, Hao; Östbye, Henrik; Qian, Xiaoyan; Thiele, Swantje; Resa-Infante, Patricia; Kouassi, Nancy Mounogou; Sender, Vicky; Hentrich, Karina; Mellroth, Peter; Henriques-Normark, Birgitta; Gabriel, Gülsah; Nilsson, Mats; Daniels, Robert

    2017-07-05

    Genome delivery to the proper cellular compartment for transcription and replication is a primary goal of viruses. However, methods for analyzing viral genome localization and differentiating genomes with high identity are lacking, making it difficult to investigate entry-related processes and co-examine heterogeneous RNA viral populations. Here, we present an RNA labeling approach for single-cell analysis of RNA viral replication and co-infection dynamics in situ, which uses the versatility of padlock probes. We applied this method to identify influenza A virus (IAV) infections in cells and lung tissue with single-nucleotide specificity and to classify entry and replication stages by gene segment localization. Extending the classification strategy to co-infections of IAVs with single-nucleotide variations, we found that the dependence on intracellular trafficking places a time restriction on secondary co-infections necessary for genome reassortment. Altogether, these data demonstrate how RNA viral genome labeling can help dissect entry and co-infections. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

    PubMed

    Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

    2011-01-01

    In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

  19. Identification of Forensically Important Calliphoridae and Sarcophagidae Species Collected in Korea Using SNaPshot Multiplex System Targeting the Cytochrome c Oxidase Subunit I Gene

    PubMed Central

    Park, Ji Hye

    2018-01-01

    Estimation of postmortem interval (PMI) is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin). The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI) nucleotide sequences. The molecular identification method commonly uses Sanger's nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger's nucleotide sequencing, single-nucleotide polymorphisms (SNPs) in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE) technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae) previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger's nucleotide sequencing. PMID:29682531

  20. PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

    PubMed

    Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

    2009-03-01

    The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

  1. Evaluation of the reliability of maize reference assays for GMO quantification.

    PubMed

    Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel

    2010-03-01

    A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.

  2. U2504 Determines the Species Specificity of the A-site Cleft Antibiotics: The sStructures of Tiamulin, Homoharringtonine and Bruceantin Bound to the Ribosome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gurel, G.; Blaha, G; Moore, P

    2009-01-01

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In themore » ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.« less

  3. U2504 Determines the Species Specificity of the A-Site Cleft Antibiotics: The Structures of Tiamulin, Homoharringtonine, and Bruceantin Bound to the Ribosome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gürel, Güliz; Blaha, Gregor; Moore, Peter B.

    2009-06-30

    Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the Asite cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In themore » ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.« less

  4. Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.

    PubMed

    Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth

    2015-04-09

    The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    PubMed Central

    He, Qiye; Johnston, Jeff; Zeitlinger, Julia

    2014-01-01

    Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

  6. CNG site-specific and methyl-sensitive endonuclease WEN1 from wheat seedlings.

    PubMed

    Fedoreyeva, L I; Vanyushin, B F

    2011-06-01

    Endonuclease WEN1 with apparent molecular mass about 27 kDa isolated from cytoplasmic vesicular fraction of aging coleoptiles of wheat seedlings has expressed site specificity action. This is a first detection and isolation of a site-specific endonuclease from higher eukaryotes, in general, and higher plants, in particular. The enzyme hydrolyzes deoxyribooligonucleotides of different composition on CNG (N is G, A, C, or T) sites by splitting the phosphodiester bond between C and N nucleotide residues in CNG sequence independent from neighbor nucleotide context except for CCCG. WEN1 prefers to hydrolyze methylated λ phage DNA and double-stranded deoxyribooligonucleotides containing 5-methylcytosine sites (m(5)CAG, m(5)CTG) compared with unmethylated substrates. The enzyme is also able to hydrolyze single-stranded substrates, but in this case it splits unmethylated substrates predominantly. Detection in wheat seedlings of WEN1 endonuclease that is site specific, sensitive to the substrate methylation status, and modulated with S-adenosyl-L-methionine indicates that in higher plants restriction--modification systems or some of their elements, at least, may exist.

  7. Denoising DNA deep sequencing data—high-throughput sequencing errors and their correction

    PubMed Central

    Laehnemann, David; Borkhardt, Arndt

    2016-01-01

    Characterizing the errors generated by common high-throughput sequencing platforms and telling true genetic variation from technical artefacts are two interdependent steps, essential to many analyses such as single nucleotide variant calling, haplotype inference, sequence assembly and evolutionary studies. Both random and systematic errors can show a specific occurrence profile for each of the six prominent sequencing platforms surveyed here: 454 pyrosequencing, Complete Genomics DNA nanoball sequencing, Illumina sequencing by synthesis, Ion Torrent semiconductor sequencing, Pacific Biosciences single-molecule real-time sequencing and Oxford Nanopore sequencing. There is a large variety of programs available for error removal in sequencing read data, which differ in the error models and statistical techniques they use, the features of the data they analyse, the parameters they determine from them and the data structures and algorithms they use. We highlight the assumptions they make and for which data types these hold, providing guidance which tools to consider for benchmarking with regard to the data properties. While no benchmarking results are included here, such specific benchmarks would greatly inform tool choices and future software development. The development of stand-alone error correctors, as well as single nucleotide variant and haplotype callers, could also benefit from using more of the knowledge about error profiles and from (re)combining ideas from the existing approaches presented here. PMID:26026159

  8. Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?

    USDA-ARS?s Scientific Manuscript database

    Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...

  9. Bitterness of the Non-nutritive Sweetener Acesulfame Potassium Varies With Polymorphisms in TAS2R9 and TAS2R31

    PubMed Central

    2013-01-01

    Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216

  10. Nucleotide cleaving agents and method

    DOEpatents

    Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

    2000-01-01

    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  11. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

    PubMed

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

    2018-01-01

    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  12. Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR) Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

    PubMed

    Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E

    2015-01-01

    The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

  13. Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

    PubMed

    Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

    2009-06-15

    DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

  14. The nucleotide binding dynamics of human MSH2-MSH3 are lesion dependent.

    PubMed

    Owen, Barbara A L; H Lang, Walter; McMurray, Cynthia T

    2009-05-01

    Here we report that the human DNA mismatch complex MSH2-MSH3 recognizes small loops by a mechanism different from that of MSH2-MSH6 for single-base mismatches. The subunits MSH2 and MSH3 can bind either ADP or ATP with similar affinities. Upon binding to a DNA loop, however, MSH2-MSH3 adopts a single 'nucleotide signature', in which the MSH2 subunit is occupied by an ADP molecule and the MSH3 subunit is empty. Subsequent ATP binding and hydrolysis in the MSH3 subunit promote ADP-ATP exchange in the MSH2 subunit to yield a hydrolysis-independent ATP-MSH2-MSH3-ADP intermediate. Human MSH2-MSH3 and yeast Msh2-Msh6 both undergo ADP-ATP exchange in the Msh2 subunit but, apparently, have opposite requirements for ATP hydrolysis: ADP release from DNA-bound Msh2-Msh6 requires ATP stabilization in the Msh6 subunit, whereas ADP release from DNA-bound MSH2-MSH3 requires ATP hydrolysis in the MSH3 subunit. We propose a model in which lesion binding converts MSH2-MSH3 into a distinct nucleotide-bound form that is poised to be a molecular sensor for lesion specificity.

  15. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    PubMed

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  16. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

    PubMed

    Li, Su-Xia

    2004-12-01

    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  17. A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  18. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    USDA-ARS?s Scientific Manuscript database

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  19. Detailed molecular analyses of the hexon loop-1 and fibers of fowl aviadenoviruses reveal new insights into the antigenic relationship and confirm that specific genotypes are involved in field outbreaks of inclusion body hepatitis.

    PubMed

    Schachner, Anna; Marek, Ana; Grafl, Beatrice; Hess, Michael

    2016-04-15

    Forty-eight fowl aviadenoviruses (FAdVs) isolated from recent IBH outbreaks across Europe were investigated, by utilizing for the first time the two major adenoviral antigenic domains, hexon loop-1 and fiber, for compound molecular characterization of IBH-associated FAdVs. Successful target gene amplification, following virus isolation in cell culture or from FTA-card samples, demonstrated presence of FAdVs in all cases indicative for IBH. Based on hexon loop-1 analysis, 31 European field isolates exhibited highest nucleotide identity (>97.2%) to reference strains FAdV-2 or -11 representing FAdV-D, while 16 and one European isolates shared >96.0% nucleotide identity with FAdV-8a and -8b, or FAdV-7, the prototype strains representing FAdV-E. These results extend recognition of specific FAdV-D and FAdV-E affiliate genotypes as causative agents of IBH to the European continent. In all isolates, species specificity determined by fiber gene analysis correlated with hexon-based typing. A threshold of 72.0% intraspecies nucleotide identity between fibers from investigated prototype and field strains corresponded with demarcation criteria proposed for hexon, suggesting fiber-based analysis as a complementary tool for molecular FAdV typing. A limited number of strains exhibited inconsistencies between hexon and fiber subclustering, indicating potential constraints for single-gene based typing of those FAdVs. Within FAdV-D, field isolate fibers shared a high degree of nucleotide (>96.7%) and aa (>95.8%) identity, while FAdV-E field isolate fibers displayed greater nucleotide divergence of up to 22.6%, resulting in lower aa identities of >81.7%. Furthermore, comparison with FAdVs from IBH outbreaks outside Europe revealed close genetic relationship in the fiber, independent of the strains' geographic origin. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.

    PubMed

    Cui, Chenghua; Shu, Wei; Li, Peining

    2016-01-01

    Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.

  1. Development of a single-tube loop-mediated isothermal amplification assay for detection of four pathogens of bacterial meningitis.

    PubMed

    Huy, Nguyen Tien; Hang, Le Thi Thuy; Boamah, Daniel; Lan, Nguyen Thi Phuong; Van Thanh, Phan; Watanabe, Kiwao; Huong, Vu Thi Thu; Kikuchi, Mihoko; Ariyoshi, Koya; Morita, Kouichi; Hirayama, Kenji

    2012-12-01

    Several loop-mediated isothermal amplification (LAMP) assays have been developed to detect common causative pathogens of bacterial meningitis (BM). However, no LAMP assay is reported to detect Streptococcus agalactiae and Streptococcus suis, which are also among common pathogens of BM. Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial pathogen. Thus, we aimed to design and develop a single-tube LAMP assay capable of detecting multiple bacterial species, based on the nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide sequences of the 16S rRNA genes of main pathogens involved in BM were aligned to identify conserved regions, which were further used to design broad range specific LAMP assay primers. We successfully designed a set of broad range specific LAMP assay primers for simultaneous detection of four species including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity with other bacteria including Haemophilus influenzae, Neisseria meningitidis and Escherichia coli. The sensitivity of our LAMP assay was 100-1000 times higher compared with the conventional PCR assay. The bacterial species could be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  2. [Efficiency of 27-plex single nucleotide polymorphism multiplex system for ancestry inference in different populations].

    PubMed

    Feng, Xing-Ling; Sun, Qi-Fan; Liu, Hong; Wei, Yi-Liang; DU, Wei-An; Li, Cai-Xia; Chen, Ling; Liu, Chao

    2016-04-20

    To validate the efficiency of 27-plex single nucleotide polymorphism (SNP) multiplex system for ancestry inference. The 27-plex SNP system was validated for its sensitivity and species specificity. A total of 533 samples were collected from African, Southern Chinese Han, China's ethic minorities (Yi, Hui, Miao, Tibet, and Uygur), European, Central Asian, Western Asian, Southern Asian, Southeast Asian and South American populations for clustering analysis of the genotypes by citing 3 representative continental ancestral groups [East Asia (CHB), Europe (CEU), and Africa (YRI)] from HapMap database. The system sensitivity is 0.125 ng. Twenty and six genotypes were detected in chimpanzee and monkeys, respectively. Except in rs10496971, no more products were found in other animals. The system was capable of differentiating intercontinental populations but not of distinguishing between East Asian and Southeast Asian population or between Southern Chinese Han population and Chinese Ethnic populations (Hui, Miao, Yi and Tibet). This system achieved a 100% accuracy for intercontinental population source inference for 46 blind test samples. 27-plex SNPs multiplex system has a high sensitivity and species specificity and can correctly differentiate the ancestry origins of individuals from African, European and East Asian for criminal case investigation. But this system is not capable of distinguishing subpopulation groups and more specific ancestry-informative markers are needed to improve its recognition of Southeast Asian and Chinese ethnic populations.

  3. Association of the rs7903146 single nucleotide polymorphism at the Transcription Factor 7-like 2 (TCF7L2) locus with type 2 diabetes in Brazilian subjects.

    PubMed

    Barra, Gustavo Barcelos; Dutra, Ludmila Alves Sanches; Watanabe, Sílvia Conde; Costa, Patrícia Godoy Garcia; Cruz, Patrícia Sales Marques da; Azevedo, Monalisa Ferreira; Amato, Angélica Amorim

    2012-11-01

    To investigate the association of the T allele of the single nucleotide polymorphism (SNP) rs7903146 of TCF7L2 with the occurrence of T2D in a sample of subjects followed up at the Brasilia University Hospital. The SNP rs7903146 of TCF7L2 was genotyped by allele-specific PCR in 113 patients with known T2D and in 139 non-diabetic controls in Brasilia, Brazil. We found that the T allele of the SNP rs7903146 of TCF7L2 was significantly associated with T2D risk (odds ratio of 3.92 for genotype TT in the recessive genetic model, p = 0.004 and 1.5 for T allele, p = 0.032). These results reinforce previous findings on the consistent association of this genetic factor and the risk of T2D in populations of diverse ethnic backgrounds.

  4. CGDSNPdb: a database resource for error-checked and imputed mouse SNPs.

    PubMed

    Hutchins, Lucie N; Ding, Yueming; Szatkiewicz, Jin P; Von Smith, Randy; Yang, Hyuna; de Villena, Fernando Pardo-Manuel; Churchill, Gary A; Graber, Joel H

    2010-07-06

    The Center for Genome Dynamics Single Nucleotide Polymorphism Database (CGDSNPdb) is an open-source value-added database with more than nine million mouse single nucleotide polymorphisms (SNPs), drawn from multiple sources, with genotypes assigned to multiple inbred strains of laboratory mice. All SNPs are checked for accuracy and annotated for properties specific to the SNP as well as those implied by changes to overlapping protein-coding genes. CGDSNPdb serves as the primary interface to two unique data sets, the 'imputed genotype resource' in which a Hidden Markov Model was used to assess local haplotypes and the most probable base assignment at several million genomic loci in tens of strains of mice, and the Affymetrix Mouse Diversity Genotyping Array, a high density microarray with over 600,000 SNPs and over 900,000 invariant genomic probes. CGDSNPdb is accessible online through either a web-based query tool or a MySQL public login. Database URL: http://cgd.jax.org/cgdsnpdb/

  5. A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

    PubMed

    Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

    2016-03-15

    In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Single nucleotide polymorphisms of TNF-Α gene in febrile seizures.

    PubMed

    Zare-Shahabadi, Ameneh; Ashrafi, Mahmoud Reza; Shahrokhi, Amin; Soltani, Samaneh; Zoghi, Samaneh; Soleimani, Farin; Vameghi, Roshanak; Badv, Reza Shervin; Rezaei, Nima

    2015-09-15

    Febrile seizures (FS) is the most common seizure disorder during childhood. This study was performed in 78 patients with FS and 137 control subjects to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence specific primers method. The highest positive allelic association that made the patients susceptible to FS was seen for TNF-α -238/G (p<0.0001). The GG genotype at TNF-α -238 was significantly higher in the patients with FS, compared to the controls (p=0.0001). Also, GA genotype at the same position was significantly lower in patients than in controls (P=0.0001). The GG haplotype had a significant positive association at TNF-α (308, 238) while GA haplotype showed a negative association (P<0.001). Our data support the idea that TNF-α single-nucleotide polymorphisms play a role in the pathogenesis of FS. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

    2009-02-24

    Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  8. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  9. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    NASA Astrophysics Data System (ADS)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  10. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    PubMed Central

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-01-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

  11. A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

    PubMed

    Kemp, S J; Maillard, J C; Teale, A J

    1993-04-01

    A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

  12. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  13. Recent Sex Chromosome Divergence despite Ancient Dioecy in the Willow Salix viminalis.

    PubMed

    Pucholt, Pascal; Wright, Alison E; Conze, Lei Liu; Mank, Judith E; Berlin, Sofia

    2017-08-01

    Sex chromosomes can evolve when recombination is halted between a pair of chromosomes, and this can lead to degeneration of the sex-limited chromosome. In the early stages of differentiation sex chromosomes are homomorphic, and even though homomorphic sex chromosomes are very common throughout animals and plants, we know little about the evolutionary forces shaping these types of sex chromosomes. We used DNA- and RNA-Seq data from females and males to explore the sex chromosomes in the female heterogametic willow, Salix viminalis, a species with ancient dioecy but with homomorphic sex chromosomes. We detected no major sex differences in read coverage in the sex determination (SD) region, indicating that the W region has not significantly degenerated. However, single nucleotide polymorphism densities in the SD region are higher in females compared with males, indicating very recent recombination suppression, followed by the accumulation of sex-specific single nucleotide polymorphisms. Interestingly, we identified two female-specific scaffolds that likely represent W-chromosome-specific sequence. We show that genes located in the SD region display a mild excess of male-biased expression in sex-specific tissue, and we use allele-specific gene expression analysis to show that this is the result of masculinization of expression on the Z chromosome rather than degeneration of female-expression on the W chromosome. Together, our results demonstrate that insertion of small DNA fragments and accumulation of sex-biased gene expression can occur before the detectable decay of the sex-limited chromosome. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

    USDA-ARS?s Scientific Manuscript database

    Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

  15. Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

  16. High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

    USDA-ARS?s Scientific Manuscript database

    Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

  17. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    USDA-ARS?s Scientific Manuscript database

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  18. Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

  19. Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

    USDA-ARS?s Scientific Manuscript database

    Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

  20. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    USDA-ARS?s Scientific Manuscript database

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  1. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  2. Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

    PubMed Central

    Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

    1982-01-01

    The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

  3. Statistical method to compare massive parallel sequencing pipelines.

    PubMed

    Elsensohn, M H; Leblay, N; Dimassi, S; Campan-Fournier, A; Labalme, A; Roucher-Boulez, F; Sanlaville, D; Lesca, G; Bardel, C; Roy, P

    2017-03-01

    Today, sequencing is frequently carried out by Massive Parallel Sequencing (MPS) that cuts drastically sequencing time and expenses. Nevertheless, Sanger sequencing remains the main validation method to confirm the presence of variants. The analysis of MPS data involves the development of several bioinformatic tools, academic or commercial. We present here a statistical method to compare MPS pipelines and test it in a comparison between an academic (BWA-GATK) and a commercial pipeline (TMAP-NextGENe®), with and without reference to a gold standard (here, Sanger sequencing), on a panel of 41 genes in 43 epileptic patients. This method used the number of variants to fit log-linear models for pairwise agreements between pipelines. To assess the heterogeneity of the margins and the odds ratios of agreement, four log-linear models were used: a full model, a homogeneous-margin model, a model with single odds ratio for all patients, and a model with single intercept. Then a log-linear mixed model was fitted considering the biological variability as a random effect. Among the 390,339 base-pairs sequenced, TMAP-NextGENe® and BWA-GATK found, on average, 2253.49 and 1857.14 variants (single nucleotide variants and indels), respectively. Against the gold standard, the pipelines had similar sensitivities (63.47% vs. 63.42%) and close but significantly different specificities (99.57% vs. 99.65%; p < 0.001). Same-trend results were obtained when only single nucleotide variants were considered (99.98% specificity and 76.81% sensitivity for both pipelines). The method allows thus pipeline comparison and selection. It is generalizable to all types of MPS data and all pipelines.

  4. Primate TNF Promoters Reveal Markers of Phylogeny and Evolution of Innate Immunity

    PubMed Central

    Baena, Andres; Ligeiro, Filipa; Diop, Ousmane M.; Brieva, Claudia; Gagneux, Pascal; O'Brien, Stephen J.; Ryder, Oliver A.; Goldfeld, Anne E.

    2007-01-01

    Background Tumor necrosis factor (TNF) is a critical cytokine in the immune response whose transcriptional activation is controlled by a proximal promoter region that is highly conserved in mammals and, in particular, primates. Specific single nucleotide polymorphisms (SNPs) upstream of the proximal human TNF promoter have been identified, which are markers of human ancestry. Methodology/Principal findings Using a comparative genomics approach we show that certain fixed genetic differences in the TNF promoter serve as markers of primate speciation. We also demonstrate that distinct alleles of most human TNF promoter SNPs are identical to fixed nucleotides in primate TNF promoters. Furthermore, we identify fixed genetic differences within the proximal TNF promoters of Asian apes that do not occur in African ape or human TNF promoters. Strikingly, protein-DNA binding assays and gene reporter assays comparing these Asian ape TNF promoters to African ape and human TNF promoters demonstrate that, unlike the fixed differences that we define that are associated with primate phylogeny, these Asian ape-specific fixed differences impair transcription factor binding at an Sp1 site and decrease TNF transcription induced by bacterial stimulation of macrophages. Conclusions/significance Here, we have presented the broadest interspecies comparison of a regulatory region of an innate immune response gene to date. We have characterized nucleotide positions in Asian ape TNF promoters that underlie functional changes in cell type- and stimulus-specific activation of the TNF gene. We have also identified ancestral TNF promoter nucleotide states in the primate lineage that correspond to human SNP alleles. These findings may reflect evolution of Asian and African apes under a distinct set of infectious disease pressures involving the innate immune response and TNF. PMID:17637837

  5. Asymmetric structure of five and six membered DNA hairpin loops

    NASA Technical Reports Server (NTRS)

    Baumann, U.; Chang, S.

    1995-01-01

    The tertiary structure of nucleic acid hairpins was elucidated by means of the accessibility of the single-strand-specific nuclease from mung bean. This molecular probe has proven especially useful in determining details of the structural arrangement of the nucleotides within a loop. In this study 3'-labeling is introduced to complement previously used 5'-labeling in order to assess and to exclude possible artifacts of the method. Both labeling procedures result in mutually consistent cleavage patterns. Therefore, methodological artifacts can be excluded and the potential of the nuclease as structural probe is increased. DNA hairpins with five and six membered loops reveal an asymmetric loop structure with a sharp bend of the phosphate-ribose backbone between the second and third nucleotide on the 3'-side of a loop. These hairpin structures differ from smaller loops with 3 or 4 members, which reveal this type of bend between the first and second 3' nucleotide, and resemble with respect to the asymmetry anticodon loops of tRNA.

  6. Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.

    PubMed

    Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

    2012-01-01

    Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

  7. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  8. Biological nanopore MspA for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Manrao, Elizabeth A.

    Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

  9. Variation of Cats under Domestication: Genetic Assignment of Domestic Cats to Breeds and Worldwide Random Bred Populations

    PubMed Central

    Kurushima, J. D.; Lipinski, M. J.; Gandolfi, B.; Froenicke, L.; Grahn, J. C.; Grahn, R. A.; Lyons, L. A.

    2012-01-01

    Summary Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40–50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (accuracy single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the mis-assigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multi-step assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, i.e. race. PMID:23171373

  10. Systematic, genome-wide, sex-specific linkage of cardiovascular traits in French Canadians.

    PubMed

    Seda, Ondrej; Tremblay, Johanne; Gaudet, Daniel; Brunelle, Pierre-Luc; Gurau, Alexandru; Merlo, Ettore; Pilote, Louise; Orlov, Sergei N; Boulva, Francis; Petrovich, Milan; Kotchen, Theodore A; Cowley, Allen W; Hamet, Pavel

    2008-04-01

    The sexual dimorphism of cardiovascular traits, as well as susceptibility to a variety of related diseases, has long been recognized, yet their sex-specific genomic determinants are largely unknown. We systematically assessed the sex-specific heritability and linkage of 539 hemodynamic, metabolic, anthropometric, and humoral traits in 120 French-Canadian families from the Saguenay-Lac-St-Jean region of Quebec, Canada. We performed multipoint linkage analysis using microsatellite markers followed by peak-wide linkage scan based on Affymetrix Human Mapping 50K Array Xba240 single nucleotide polymorphism genotypes in 3 settings, including the entire sample and then separately in men and women. Nearly one half of the traits were age and sex independent, one quarter were both age and sex dependent, and one eighth were exclusively age or sex dependent. Sex-specific phenotypes are most frequent in heart rate and blood pressure categories, whereas sex- and age-independent determinants are predominant among humoral and biochemical parameters. Twenty sex-specific loci passing multiple testing criteria were corroborated by 2-point single nucleotide polymorphism linkage. Several resting systolic blood pressure measurements showed significant genotype-by-sex interaction, eg, male-specific locus at chromosome 12 (male-female logarithm of odds difference: 4.16; interaction P=0.0002), which was undetectable in the entire population, even after adjustment for sex. Detailed interrogation of this locus revealed a 220-kb block overlapping parts of TAO-kinase 3 and SUDS3 genes. In summary, a large number of complex cardiovascular traits display significant sexual dimorphism, for which we have demonstrated genomic determinants at the haplotype level. Many of these would have been missed in a traditional, sex-adjusted setting.

  11. Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

    USDA-ARS?s Scientific Manuscript database

    The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

  12. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    USDA-ARS?s Scientific Manuscript database

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  13. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

    USDA-ARS?s Scientific Manuscript database

    Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

  14. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Treesearch

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  15. Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

    USDA-ARS?s Scientific Manuscript database

    Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

  16. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    USDA-ARS?s Scientific Manuscript database

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  17. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

    2007-02-06

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  18. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

    2009-02-24

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  19. Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

    PubMed

    Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

    2016-04-01

    Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

  20. Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

    NASA Astrophysics Data System (ADS)

    Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

    2014-03-01

    DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

  1. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

    PubMed

    Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-11-01

    Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  2. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

    PubMed Central

    Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-01-01

    Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

  3. Functional Analysis of a Novel Genome-Wide Association Study Signal in SMAD3 That Confers Protection From Coronary Artery Disease.

    PubMed

    Turner, Adam W; Martinuk, Amy; Silva, Anada; Lau, Paulina; Nikpay, Majid; Eriksson, Per; Folkersen, Lasse; Perisic, Ljubica; Hedin, Ulf; Soubeyrand, Sebastien; McPherson, Ruth

    2016-05-01

    A recent genome-wide association study meta-analysis identified an intronic single nucleotide polymorphism in SMAD3, rs56062135C>T, the minor allele (T) which associates with protection from coronary artery disease. Relevant to atherosclerosis, SMAD3 is a key contributor to transforming growth factor-β pathway signaling. Here, we seek to identify ≥1 causal coronary artery disease-associated single nucleotide polymorphisms at the SMAD3 locus and characterize mechanisms whereby the risk allele(s) contribute to coronary artery disease risk. By genetic and epigenetic fine mapping, we identified a candidate causal single nucleotide polymorphism rs17293632C>T (D', 0.97; r(2), 0.94 with rs56062135) in intron 1 of SMAD3 with predicted functional effects. We show that the sequence encompassing rs17293632 acts as a strong enhancer in human arterial smooth muscle cells. The common allele (C) preserves an activator protein (AP)-1 site and enhancer function, whereas the protective (T) allele disrupts the AP-1 site and significantly reduces enhancer activity (P<0.001). Pharmacological inhibition of AP-1 activity upstream demonstrates that this allele-specific enhancer effect is AP-1 dependent (P<0.001). Chromatin immunoprecipitation experiments reveal binding of several AP-1 component proteins with preferential binding to the (C) allele. We show that rs17293632 is an expression quantitative trait locus for SMAD3 in blood and atherosclerotic plaque with reduced expression of SMAD3 in carriers of the protective allele. Finally, siRNA knockdown of SMAD3 in human arterial smooth muscle cells increases cell viability, consistent with an antiproliferative role. The coronary artery disease-associated rs17293632C>T single nucleotide polymorphism represents a novel functional cis-acting element at the SMAD3 locus. The protective (T) allele of rs17293632 disrupts a consensus AP-1 binding site in a SMAD3 intron 1 enhancer, reduces enhancer activity and SMAD3 expression, altering human arterial smooth muscle cell proliferation. © 2016 American Heart Association, Inc.

  4. Method for nucleic acid hybridization using single-stranded DNA binding protein

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1996-01-01

    Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.

  5. Mismatch repair factor MSH2-MSH3 binds and alters the conformation of branched DNA structures predicted to form during genetic recombination.

    PubMed

    Surtees, Jennifer A; Alani, Eric

    2006-07-14

    Genetic studies in Saccharomyces cerevisiae predict that the mismatch repair (MMR) factor MSH2-MSH3 binds and stabilizes branched recombination intermediates that form during single strand annealing and gene conversion. To test this model, we constructed a series of DNA substrates that are predicted to form during these recombination events. We show in an electrophoretic mobility shift assay that S. cerevisiae MSH2-MSH3 specifically binds branched DNA substrates containing 3' single-stranded DNA and that ATP stimulates its release from these substrates. Chemical footprinting analyses indicate that MSH2-MSH3 specifically binds at the double-strand/single-strand junction of branched substrates, alters its conformation and opens up the junction. Therefore, MSH2-MSH3 binding to its substrates creates a unique nucleoprotein structure that may signal downstream steps in repair that include interactions with MMR and nucleotide excision repair factors.

  6. ADEPT, a dynamic next generation sequencing data error-detection program with trimming

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feng, Shihai; Lo, Chien-Chi; Li, Po-E

    Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less

  7. ADEPT, a dynamic next generation sequencing data error-detection program with trimming

    DOE PAGES

    Feng, Shihai; Lo, Chien-Chi; Li, Po-E; ...

    2016-02-29

    Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less

  8. Proline Scanning Mutagenesis Reveals a Role for the Flap Endonuclease-1 Helical Cap in Substrate Unpairing*

    PubMed Central

    Patel, Nikesh; Exell, Jack C.; Jardine, Emma; Ombler, Ben; Finger, L. David; Ciani, Barbara; Grasby, Jane A.

    2013-01-01

    The prototypical 5′-nuclease, flap endonuclease-1 (FEN1), catalyzes the essential removal of single-stranded flaps during DNA replication and repair. FEN1 hydrolyzes a specific phosphodiester bond one nucleotide into double-stranded DNA. This specificity arises from double nucleotide unpairing that places the scissile phosphate diester on active site divalent metal ions. Also related to FEN1 specificity is the helical arch, through which 5′-flaps, but not continuous DNAs, can thread. The arch contains basic residues (Lys-93 and Arg-100 in human FEN1 (hFEN1)) that are conserved by all 5′-nucleases and a cap region only present in enzymes that process DNAs with 5′ termini. Proline mutations (L97P, L111P, L130P) were introduced into the hFEN1 helical arch. Each mutation was severely detrimental to reaction. However, all proteins were at least as stable as wild-type (WT) hFEN1 and bound substrate with comparable affinity. Moreover, all mutants produced complexes with 5′-biotinylated substrate that, when captured with streptavidin, were resistant to challenge with competitor DNA. Removal of both conserved basic residues (K93A/R100A) was no more detrimental to reaction than the single mutation R100A, but much less severe than L97P. The ability of protein-Ca2+ to rearrange 2-aminopurine-containing substrates was monitored by low energy CD. Although L97P and K93A/R100A retained the ability to unpair substrates, the cap mutants L111P and L130P did not. Taken together, these data challenge current assumptions related to 5′-nuclease family mechanism. Conserved basic amino acids are not required for double nucleotide unpairing and appear to act cooperatively, whereas the helical cap plays an unexpected role in hFEN1-substrate rearrangement. PMID:24126913

  9. Polymorphisms in the microglial marker molecule CX3CR1 affect the blood volume of the human brain.

    PubMed

    Sakai, Mai; Takeuchi, Hikaru; Yu, Zhiqian; Kikuchi, Yoshie; Ono, Chiaki; Takahashi, Yuta; Ito, Fumiaki; Matsuoka, Hiroo; Tanabe, Osamu; Yasuda, Jun; Taki, Yasuyuki; Kawashima, Ryuta; Tomita, Hiroaki

    2018-06-01

    CX3CR1, a G-protein-coupled receptor, is involved in various inflammatory processes. Two non-synonymous single nucleotide polymorphisms, V249I (rs3732379) and T280M (rs3732378), are located in the sixth and seventh transmembrane domains of the CX3CR1 protein, respectively. Previous studies have indicated significant associations between T280M and leukocyte functional characteristics, including adhesion, signaling, and chemotaxis, while the function of V249I is unclear. In the brain, microglia are the only proven and widely accepted CX3CR1-expressing cells. This study aimed to specify whether there were specific brain regions on which these two single nucleotide polymorphisms exert their biological impacts through their functional effects on microglia. Associations between the single nucleotide polymorphisms and brain characteristics, including gray and white matter volumes, white matter integrity, resting arterial blood volume, and cerebral blood flow, were evaluated among 1300 healthy Japanese individuals. The major allele carriers (V249 and T280) were significantly associated with an increased total arterial blood volume of the whole brain, especially around the bilateral precuneus, left posterior cingulate cortex, and left posterior parietal cortex. There were no significant associations between the genotypes and other brain structural indicators. This finding suggests that the CX3CR1 variants may affect arterial structures in the brain, possibly via interactions between microglia and brain microvascular endothelial cells. © 2018 The Authors. Psychiatry and Clinical Neurosciences © 2018 Japanese Society of Psychiatry and Neurology.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan

    Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less

  11. Characterization of the 2′,3′ cyclic phosphodiesterase activities of Clostridium thermocellum polynucleotide kinase-phosphatase and bacteriophage λ phosphatase

    PubMed Central

    Keppetipola, Niroshika; Shuman, Stewart

    2007-01-01

    Clostridium thermocellum polynucleotide kinase-phosphatase (CthPnkp) catalyzes 5′ and 3′ end-healing reactions that prepare broken RNA termini for sealing by RNA ligase. The central phosphatase domain of CthPnkp belongs to the dinuclear metallophosphoesterase superfamily exemplified by bacteriophage λ phosphatase (λ-Pase). CthPnkp is a Ni2+/Mn2+-dependent phosphodiesterase-monoesterase, active on nucleotide and non-nucleotide substrates, that can be transformed toward narrower metal and substrate specificities via mutations of the active site. Here we characterize the Mn2+-dependent 2′,3′ cyclic nucleotide phosphodiesterase activity of CthPnkp, the reaction most relevant to RNA repair pathways. We find that CthPnkp prefers a 2′,3′ cyclic phosphate to a 3′,5′ cyclic phosphate. A single H189D mutation imposes strict specificity for a 2′,3′ cyclic phosphate, which is cleaved to form a single 2′-NMP product. Analysis of the cyclic phosphodiesterase activities of mutated CthPnkp enzymes illuminates the active site and the structural features that affect substrate affinity and kcat. We also characterize a previously unrecognized phosphodiesterase activity of λ-Pase, which catalyzes hydrolysis of bis-p-nitrophenyl phosphate. λ-Pase also has cyclic phosphodiesterase activity with nucleoside 2′,3′ cyclic phosphates, which it hydrolyzes to yield a mixture of 2′-NMP and 3′-NMP products. We discuss our results in light of available structural and functional data for other phosphodiesterase members of the binuclear metallophosphoesterase family and draw inferences about how differences in active site composition influence catalytic repertoire. PMID:17986465

  12. Kinetic parameters and renal clearances of plasma adenosine 3′,5′-monophosphate and guanosine 3′,5′-monophosphate in man

    PubMed Central

    Broadus, Arthur E.; Kaminsky, Neil I.; Hardman, Joel G.; Sutherland, Earl W.; Liddle, Grant W.

    1970-01-01

    Kinetic parameters and the renal clearances of plasma adenosine 3′,5′-monophosphate (cyclic AMP) and guanosine 3′,5′-monophosphate (cyclic GMP) were evaluated in normal subjects using tritium-labeled cyclic nucleotides. Each tracer was administered both by single, rapid intravenous injection and by constant intravenous infusion, and the specific activities of the cyclic nucleotides in plasma and urine were determined. Both cyclic AMP and cyclic GMP were cleared from plasma by glomerular filtration. The kidney was found to add a variable quantity of endogenous cyclic AMP to the tubular urine, amounting to an average of approximately one-third of the total level of cyclic AMP excreted. Plasma was the source of virtually all of the cyclic GMP excreted. Plasma levels of the cyclic nucleotides appeared to be in dynamic steady state. The apparent volumes of distribution of both nucleotides exceeded extracellular fluid volume, averaging 27 and 38% of body weight for cyclic AMP and cyclic GMP, respectively. Plasma production rates ranged from 9 to 17 nmoles/min for cyclic AMP and from 7 to 13 nmoles/min for cyclic GMP. Plasma clearance rates averaged 668 ml/min for cyclic AMP and 855 ml/min for cyclic GMP. Approximately 85% of the elimination of the cyclic nucleotides from the circulation was due to extrarenal clearance. PMID:5480849

  13. Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

    PubMed

    Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

    2016-04-19

    2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.

  14. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  15. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    USDA-ARS?s Scientific Manuscript database

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  16. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  17. An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

    USDA-ARS?s Scientific Manuscript database

    Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

  18. Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

    PubMed

    Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

    2012-05-01

    Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

  19. Sequence Variation of the tRNALeu Intron as a Marker for Genetic Diversity and Specificity of Symbiotic Cyanobacteria in Some Lichens

    PubMed Central

    Paulsrud, Per; Lindblad, Peter

    1998-01-01

    We examined the genetic diversity of Nostoc symbionts in some lichens by using the tRNALeu (UAA) intron as a genetic marker. The nucleotide sequence was analyzed in the context of the secondary structure of the transcribed intron. Cyanobacterial tRNALeu (UAA) introns were specifically amplified from freshly collected lichen samples without previous DNA extraction. The lichen species used in the present study were Nephroma arcticum, Peltigera aphthosa, P. membranacea, and P. canina. Introns with different sizes around 300 bp were consistently obtained. Multiple clones from single PCRs were screened by using their single-stranded conformational polymorphism pattern, and the nucleotide sequence was determined. No evidence for sample heterogenity was found. This implies that the symbiont in situ is not a diverse community of cyanobionts but, rather, one Nostoc strain. Furthermore, each lichen thallus contained only one intron type, indicating that each thallus is colonized only once or that there is a high degree of specificity. The same cyanobacterial intron sequence was also found in samples of one lichen species from different localities. In a phylogenetic analysis, the cyanobacterial lichen sequences grouped together with the sequences from two free-living Nostoc strains. The size differences in the intron were due to insertions and deletions in highly variable regions. The sequence data were used in discussions concerning specificity and biology of the lichen symbiosis. It is concluded that the tRNALeu (UAA) intron can be of great value when examining cyanobacterial diversity. PMID:9435083

  20. Polyoma virus small tumor antigen pre-mRNA splicing requires cooperation between two 3' splice sites.

    PubMed Central

    Ge, H; Noble, J; Colgan, J; Manley, J L

    1990-01-01

    We have studied splicing of the polyoma virus early region pre-mRNA in vitro. This RNA is alternatively spliced in vivo to produce mRNA encoding the large, middle-sized (MTAg), and small (StAg) tumor antigens. Our primary interest was to learn how the 48-nucleotide StAg intron is excised, because the length of this intron is significantly less than the apparent minimum established for mammalian introns. Although the products of all three splices are detected in vitro, characterization of the pathway and sequence requirements of StAg splicing suggests that splicing factors interact with the precursor RNA in an unexpected way to catalyze removal of this intron. Specifically, StAg splicing uses either of two lariat branch points, one of which is located only 4 nucleotides from the 3' splice site. Furthermore, the StAg splice absolutely requires that the alternative MTAg 3' splice site, located 14 nucleotides downstream of the StAg 3' splice site, be intact. Insertion mutations that increase or decrease the quality of the MTAg pyrimidine stretch enhance or repress StAg as well as MTAg splicing, and a single-base change in the MTAg AG splice acceptor totally blocks both splices. These results demonstrate the ability of two 3' splice sites to cooperate with each other to bring about removal of a single intron. Images PMID:2159146

  1. Allelic variation of the Waxy gene in foxtail millet [Setaria italica (L.) P. Beauv.] by single nucleotide polymorphisms.

    PubMed

    Van, K; Onoda, S; Kim, M Y; Kim, K D; Lee, S-H

    2008-03-01

    The Waxy (Wx) gene product controls the formation of a straight chain polymer of amylose in the starch pathway. Dominance/recessiveness of the Wx allele is associated with amylose content, leading to non-waxy/waxy phenotypes. For a total of 113 foxtail millet accessions, agronomic traits and the molecular differences of the Wx gene were surveyed to evaluate genetic diversities. Molecular types were associated with phenotypes determined by four specific primer sets (non-waxy, Type I; low amylose, Type VI; waxy, Type IV or V). Additionally, the insertion of transposable element in waxy was confirmed by ex1/TSI2R, TSI2F/ex2, ex2int2/TSI7R and TSI7F/ex4r. Seventeen single nucleotide polymorphims (SNPs) were observed from non-coding regions, while three SNPs from coding regions were non-synonymous. Interestingly, the phenotype of No. 88 was still non-waxy, although seven nucleotides (AATTGGT) insertion at 2,993 bp led to 78 amino acids shorter. The rapid decline of r (2) in the sequenced region (exon 1-intron 1-exon 2) suggested a low level of linkage disequilibrium and limited haplotype structure. K (s) values and estimation of evolutionary events indicate early divergence of S. italica among cereal crops. This study suggested the Wx gene was one of the targets in the selection process during domestication.

  2. High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

    PubMed Central

    Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

    2006-01-01

    Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

  3. A molecular platform for the diagnosis of multidrug-resistant and pre-extensively drug-resistant tuberculosis based on single nucleotide polymorphism mutations present in Colombian isolates of Mycobacterium tuberculosis.

    PubMed

    Martínez, Luz Maira Wintaco; Castro, Gloria Puerto; Guerrero, Martha Inírida

    2016-02-01

    Developing a fast, inexpensive, and specific test that reflects the mutations present in Mycobacterium tuberculosis isolates according to geographic region is the main challenge for drug-resistant tuberculosis (TB) control. The objective of this study was to develop a molecular platform to make a rapid diagnosis of multidrug-resistant (MDR) and extensively drug-resistant TB based on single nucleotide polymorphism (SNP) mutations present in therpoB, katG, inhA,ahpC, and gyrA genes from Colombian M. tuberculosis isolates. The amplification and sequencing of each target gene was performed. Capture oligonucleotides, which were tested before being used with isolates to assess the performance, were designed for wild type and mutated codons, and the platform was standardised based on the reverse hybridisation principle. This method was tested on DNA samples extracted from clinical isolates from 160 Colombian patients who were previously phenotypically and genotypically characterised as having susceptible or MDR M. tuberculosis. For our method, the kappa index of the sequencing results was 0,966, 0,825, 0,766, 0,740, and 0,625 forrpoB, katG, inhA,ahpC, and gyrA, respectively. Sensitivity and specificity were ranked between 90-100% compared with those of phenotypic drug susceptibility testing. Our assay helps to pave the way for implementation locally and for specifically adapted methods that can simultaneously detect drug resistance mutations to first and second-line drugs within a few hours.

  4. Rapid single nucleotide polymorphism based method for hematopoietic chimerism analysis and monitoring using high-speed droplet allele-specific PCR and allele-specific quantitative PCR.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Uehara, Masayuki; Sugano, Mitsutoshi; Okumura, Nobuo; Honda, Takayuki

    2015-05-20

    Chimerism analysis is important for the evaluation of engraftment and predicting relapse following hematopoietic stem cell transplantation (HSCT). We developed a chimerism analysis for single nucleotide polymorphisms (SNPs), including rapid screening of the discriminable donor/recipient alleles using droplet allele-specific PCR (droplet-AS-PCR) pre-HSCT and quantitation of recipient DNA using AS-quantitative PCR (AS-qPCR) following HSCT. SNP genotyping of 20 donor/recipient pairs via droplet-AS-PCR and the evaluation of the informativity of 5 SNP markers for chimerism analysis were performed. Samples from six follow-up patients were analyzed to assess the chimerism via AS-qPCR. These results were compared with that determined by short tandem repeat PCR (STR-PCR). Droplet-AS-PCR could determine genotypes within 8min. The total informativity using all 5 loci was 95% (19/20). AS-qPCR provided the percentage of recipient DNA in all 6 follow-up patients without influence of the stutter peak or the amplification efficacy, which affected the STR-PCR results. The droplet-AS-PCR had an advantage over STR-PCR in terms of rapidity and simplicity for screening before HSCT. Furthermore, AS-qPCR had better accuracy than STR-PCR for quantification of recipient DNA following HSCT. The present chimerism assay compensates for the disadvantages of STR-PCR and is readily performable in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Theory of single-molecule controlled rotation experiments, predictions, tests, and comparison with stalling experiments in F1-ATPase.

    PubMed

    Volkán-Kacsó, Sándor; Marcus, Rudolph A

    2016-10-25

    A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.

  6. Winnowing DNA for Rare Sequences: Highly Specific Sequence and Methylation Based Enrichment

    PubMed Central

    Thompson, Jason D.; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

    2012-01-01

    Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue. PMID:22355378

  7. Engineering Nucleotide Specificity of Succinyl-CoA Synthetase in Blastocystis: The Emerging Role of Gatekeeper Residues.

    PubMed

    Vashisht, Kapil; Verma, Sonia; Gupta, Sunita; Lynn, Andrew M; Dixit, Rajnikant; Mishra, Neelima; Valecha, Neena; Hamblin, Karleigh A; Maytum, Robin; Pandey, Kailash C; van der Giezen, Mark

    2017-01-24

    Charged, solvent-exposed residues at the entrance to the substrate binding site (gatekeeper residues) produce electrostatic dipole interactions with approaching substrates, and control their access by a novel mechanism called "electrostatic gatekeeper effect". This proof-of-concept study demonstrates that the nucleotide specificity can be engineered by altering the electrostatic properties of the gatekeeper residues outside the binding site. Using Blastocystis succinyl-CoA synthetase (SCS, EC 6.2.1.5), we demonstrated that the gatekeeper mutant (ED) resulted in ATP-specific SCS to show high GTP specificity. Moreover, nucleotide binding site mutant (LF) had no effect on GTP specificity and remained ATP-specific. However, via combination of the gatekeeper mutant with the nucleotide binding site mutant (ED+LF), a complete reversal of nucleotide specificity was obtained with GTP, but no detectable activity was obtained with ATP. This striking result of the combined mutant (ED+LF) was due to two changes; negatively charged gatekeeper residues (ED) favored GTP access, and nucleotide binding site residues (LF) altered ATP binding, which was consistent with the hypothesis of the "electrostatic gatekeeper effect". These results were further supported by molecular modeling and simulation studies. Hence, it is imperative to extend the strategy of the gatekeeper effect in a different range of crucial enzymes (synthetases, kinases, and transferases) to engineer substrate specificity for various industrial applications and substrate-based drug design.

  8. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  9. Analysis of single nucleotide polymorphisms in case-control studies.

    PubMed

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  10. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    PubMed

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  11. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    ERIC Educational Resources Information Center

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  12. The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

    USDA-ARS?s Scientific Manuscript database

    The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

  13. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    PubMed

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are complex, with internal promoters and terminators generating multiple transcription units and allowing differential gene expression within these operons. We discovered extensive antisense transcription that results from more than 500 operons, which fully overlap or extensively overlap adjacent divergent or convergent operons. The genomic regions corresponding to these antisense transcripts are highly conserved in E. coli (including Shigella species), although it remains to be proven whether or not they are functional. Our observations of features unearthed by single-nucleotide transcriptome mapping suggest that deeper layers of transcriptional regulation in bacteria are likely to be revealed in the future. Copyright © 2014 Conway et al.

  14. Experimental Review of DNA-Based Methods for Wine Traceability and Development of a Single-Nucleotide Polymorphism (SNP) Genotyping Assay for Quantitative Varietal Authentication.

    PubMed

    Catalano, Valentina; Moreno-Sanz, Paula; Lorenzi, Silvia; Grando, Maria Stella

    2016-09-21

    The genetic varietal authentication of wine was investigated according to DNA isolation procedures reported for enological matrices and also by testing 11 commercial extraction kits and various protocol modifications. Samples were collected at different stages of the winemaking process of renowned Italian wines Brunello di Montalcino, Lambruschi Modenesi, and Trento DOC. Results demonstrated not only that grape DNA loss is produced by the fermentation process but also that clarification and stabilization operations contribute to the reduction of double-stranded DNA content on wine. Despite the presence of inhibitors, downstream PCR genotyping yielded reliable nuclear and chloroplast SSR markers for must samples, whereas no amplification or inconsistent results were obtained at later stages of the vinification. In addition, a TaqMan genotyping assay based on cultivar-specific single-nucleotide polymorphisms (SNPs) was designed, which allowed assessment of grapevine DNA mixtures. Once the wine matrix limitations are overcome, this sensitive tool may be implemented for the relative quantification of cultivars used for blend wines or frauds.

  15. Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification

    PubMed Central

    Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu

    2018-01-01

    Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844

  16. Optimization of the Divergent method for genotyping single nucleotide variations using SYBR Green-based single-tube real-time PCR.

    PubMed

    Gentilini, Fabio; Turba, Maria E

    2014-01-01

    A novel technique, called Divergent, for single-tube real-time PCR genotyping of point mutations without the use of fluorescently labeled probes has recently been reported. This novel PCR technique utilizes a set of four primers and a particular denaturation temperature for simultaneously amplifying two different amplicons which extend in opposite directions from the point mutation. The two amplicons can readily be detected using the melt curve analysis downstream to a closed-tube real-time PCR. In the present study, some critical aspects of the original method were specifically addressed to further implement the technique for genotyping the DNM1 c.G767T mutation responsible for exercise-induced collapse in Labrador retriever dogs. The improved Divergent assay was easily set up using a standard two-step real-time PCR protocol. The melting temperature difference between the mutated and the wild-type amplicons was approximately 5°C which could be promptly detected by all the thermal cyclers. The upgraded assay yielded accurate results with 157pg of genomic DNA per reaction. This optimized technique represents a flexible and inexpensive alternative to the minor grove binder fluorescently labeled method and to high resolution melt analysis for high-throughput, robust and cheap genotyping of single nucleotide variations. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    PubMed

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  18. Intracellular nucleotide and nucleotide sugar contents of cultured CHO cells determined by a fast, sensitive, and high-resolution ion-pair RP-HPLC.

    PubMed

    Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L

    2006-01-15

    Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.

  19. Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

    NASA Astrophysics Data System (ADS)

    Baumann, Ulrich

    1987-09-01

    A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

  20. Solution to a gene divergence problem under arbitrary stable nucleotide transition probabilities

    NASA Technical Reports Server (NTRS)

    Holmquist, R.

    1976-01-01

    A nucleic acid chain, L nucleotides in length, with the specific base sequence B(1)B(2) ... B(L) is defined by the L-dimensional vector B = (B(1), B(2), ..., B(L)). For twelve given constant non-negative transition probabilities that, in a specified position, the base B is replaced by the base B' in a single step, an exact analytical expression is derived for the probability that the position goes from base B to B' in X steps. Assuming that each base mutates independently of the others, an exact expression is derived for the probability that the initial gene sequence B goes to a sequence B' = (B'(1), B'(2), ..., B'(L)) after X = (X(1), X(2), ..., X(L)) base replacements. The resulting equations allow a more precise accounting for the effects of Darwinian natural selection in molecular evolution than does the idealized (biologically less accurate) assumption that each of the four nucleotides is equally likely to mutate to and be fixed as one of the other three. Illustrative applications of the theory to some problems of biological evolution are given.

  1. Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dong Hongping; Zhang Bo; Shi Peiyong

    2008-11-10

    Genome cyclization is essential for flavivirus replication. We used RNases to probe the structures formed by the 5'-terminal 190 nucleotides and the 3'-terminal 111 nucleotides of the West Nile virus (WNV) genomic RNA. When analyzed individually, the two RNAs adopt stem-loop structures as predicted by the thermodynamic-folding program. However, when mixed together, the two RNAs form a duplex that is mediated through base-pairings of two sets of RNA elements (5'CS/3'CSI and 5'UAR/3'UAR). Formation of the RNA duplex facilitates a conformational change that leaves the 3'-terminal nucleotides of the genome (position - 8 to - 16) to be single-stranded. Viral NS5more » binds specifically to the 5'-terminal stem-loop (SL1) of the genomic RNA. The 5'SL1 RNA structure is essential for WNV replication. The study has provided further evidence to suggest that flavivirus genome cyclization and NS5/5'SL1 RNA interaction facilitate NS5 binding to the 3' end of the genome for the initiation of viral minus-strand RNA synthesis.« less

  2. QQ-SNV: single nucleotide variant detection at low frequency by comparing the quality quantiles.

    PubMed

    Van der Borght, Koen; Thys, Kim; Wetzels, Yves; Clement, Lieven; Verbist, Bie; Reumers, Joke; van Vlijmen, Herman; Aerssens, Jeroen

    2015-11-10

    Next generation sequencing enables studying heterogeneous populations of viral infections. When the sequencing is done at high coverage depth ("deep sequencing"), low frequency variants can be detected. Here we present QQ-SNV (http://sourceforge.net/projects/qqsnv), a logistic regression classifier model developed for the Illumina sequencing platforms that uses the quantiles of the quality scores, to distinguish true single nucleotide variants from sequencing errors based on the estimated SNV probability. To train the model, we created a dataset of an in silico mixture of five HIV-1 plasmids. Testing of our method in comparison to the existing methods LoFreq, ShoRAH, and V-Phaser 2 was performed on two HIV and four HCV plasmid mixture datasets and one influenza H1N1 clinical dataset. For default application of QQ-SNV, variants were called using a SNV probability cutoff of 0.5 (QQ-SNV(D)). To improve the sensitivity we used a SNV probability cutoff of 0.0001 (QQ-SNV(HS)). To also increase specificity, SNVs called were overruled when their frequency was below the 80(th) percentile calculated on the distribution of error frequencies (QQ-SNV(HS-P80)). When comparing QQ-SNV versus the other methods on the plasmid mixture test sets, QQ-SNV(D) performed similarly to the existing approaches. QQ-SNV(HS) was more sensitive on all test sets but with more false positives. QQ-SNV(HS-P80) was found to be the most accurate method over all test sets by balancing sensitivity and specificity. When applied to a paired-end HCV sequencing study, with lowest spiked-in true frequency of 0.5%, QQ-SNV(HS-P80) revealed a sensitivity of 100% (vs. 40-60% for the existing methods) and a specificity of 100% (vs. 98.0-99.7% for the existing methods). In addition, QQ-SNV required the least overall computation time to process the test sets. Finally, when testing on a clinical sample, four putative true variants with frequency below 0.5% were consistently detected by QQ-SNV(HS-P80) from different generations of Illumina sequencers. We developed and successfully evaluated a novel method, called QQ-SNV, for highly efficient single nucleotide variant calling on Illumina deep sequencing virology data.

  3. Energy efficiency trade-offs drive nucleotide usage in transcribed regions

    PubMed Central

    Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

    2016-01-01

    Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

  4. Analysis of the Highly Diverse Gene Borders in Ebola Virus Reveals a Distinct Mechanism of Transcriptional Regulation

    PubMed Central

    Brauburger, Kristina; Boehmann, Yannik; Tsuda, Yoshimi; Hoenen, Thomas; Olejnik, Judith; Schümann, Michael; Ebihara, Hideki

    2014-01-01

    ABSTRACT Ebola virus (EBOV) belongs to the group of nonsegmented negative-sense RNA viruses. The seven EBOV genes are separated by variable gene borders, including short (4- or 5-nucleotide) intergenic regions (IRs), a single long (144-nucleotide) IR, and gene overlaps, where the neighboring gene end and start signals share five conserved nucleotides. The unique structure of the gene overlaps and the presence of a single long IR are conserved among all filoviruses. Here, we sought to determine the impact of the EBOV gene borders during viral transcription. We show that readthrough mRNA synthesis occurs in EBOV-infected cells irrespective of the structure of the gene border, indicating that the gene overlaps do not promote recognition of the gene end signal. However, two consecutive gene end signals at the VP24 gene might improve termination at the VP24-L gene border, ensuring efficient L gene expression. We further demonstrate that the long IR is not essential for but regulates transcription reinitiation in a length-dependent but sequence-independent manner. Mutational analysis of bicistronic minigenomes and recombinant EBOVs showed no direct correlation between IR length and reinitiation rates but demonstrated that specific IR lengths not found naturally in filoviruses profoundly inhibit downstream gene expression. Intriguingly, although truncation of the 144-nucleotide-long IR to 5 nucleotides did not substantially affect EBOV transcription, it led to a significant reduction of viral growth. IMPORTANCE Our current understanding of EBOV transcription regulation is limited due to the requirement for high-containment conditions to study this highly pathogenic virus. EBOV is thought to share many mechanistic features with well-analyzed prototype nonsegmented negative-sense RNA viruses. A single polymerase entry site at the 3′ end of the genome determines that transcription of the genes is mainly controlled by gene order and cis-acting signals found at the gene borders. Here, we examined the regulatory role of the structurally unique EBOV gene borders during viral transcription. Our data suggest that transcriptional regulation in EBOV is highly complex and differs from that in prototype viruses and further the understanding of this most fundamental process in the filovirus replication cycle. Moreover, our results with recombinant EBOVs suggest a novel role of the long IR found in all filovirus genomes during the viral replication cycle. PMID:25142600

  5. Analysis of the highly diverse gene borders in Ebola virus reveals a distinct mechanism of transcriptional regulation.

    PubMed

    Brauburger, Kristina; Boehmann, Yannik; Tsuda, Yoshimi; Hoenen, Thomas; Olejnik, Judith; Schümann, Michael; Ebihara, Hideki; Mühlberger, Elke

    2014-11-01

    Ebola virus (EBOV) belongs to the group of nonsegmented negative-sense RNA viruses. The seven EBOV genes are separated by variable gene borders, including short (4- or 5-nucleotide) intergenic regions (IRs), a single long (144-nucleotide) IR, and gene overlaps, where the neighboring gene end and start signals share five conserved nucleotides. The unique structure of the gene overlaps and the presence of a single long IR are conserved among all filoviruses. Here, we sought to determine the impact of the EBOV gene borders during viral transcription. We show that readthrough mRNA synthesis occurs in EBOV-infected cells irrespective of the structure of the gene border, indicating that the gene overlaps do not promote recognition of the gene end signal. However, two consecutive gene end signals at the VP24 gene might improve termination at the VP24-L gene border, ensuring efficient L gene expression. We further demonstrate that the long IR is not essential for but regulates transcription reinitiation in a length-dependent but sequence-independent manner. Mutational analysis of bicistronic minigenomes and recombinant EBOVs showed no direct correlation between IR length and reinitiation rates but demonstrated that specific IR lengths not found naturally in filoviruses profoundly inhibit downstream gene expression. Intriguingly, although truncation of the 144-nucleotide-long IR to 5 nucleotides did not substantially affect EBOV transcription, it led to a significant reduction of viral growth. Our current understanding of EBOV transcription regulation is limited due to the requirement for high-containment conditions to study this highly pathogenic virus. EBOV is thought to share many mechanistic features with well-analyzed prototype nonsegmented negative-sense RNA viruses. A single polymerase entry site at the 3' end of the genome determines that transcription of the genes is mainly controlled by gene order and cis-acting signals found at the gene borders. Here, we examined the regulatory role of the structurally unique EBOV gene borders during viral transcription. Our data suggest that transcriptional regulation in EBOV is highly complex and differs from that in prototype viruses and further the understanding of this most fundamental process in the filovirus replication cycle. Moreover, our results with recombinant EBOVs suggest a novel role of the long IR found in all filovirus genomes during the viral replication cycle. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  6. Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

    USDA-ARS?s Scientific Manuscript database

    Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

  7. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  8. Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

    USDA-ARS?s Scientific Manuscript database

    The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

  9. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

    Treesearch

    Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

    2016-01-01

    Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

  10. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    ERIC Educational Resources Information Center

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  11. Atrial Fibrillation Genetic Risk and Ischemic Stroke Mechanisms.

    PubMed

    Lubitz, Steven A; Parsons, Owen E; Anderson, Christopher D; Benjamin, Emelia J; Malik, Rainer; Weng, Lu-Chen; Dichgans, Martin; Sudlow, Cathie L; Rothwell, Peter M; Rosand, Jonathan; Ellinor, Patrick T; Markus, Hugh S; Traylor, Matthew

    2017-06-01

    Atrial fibrillation (AF) is a leading cause of cardioembolic stroke, but the relationship between AF and noncardioembolic stroke subtypes are unclear. Because AF may be unrecognized, and because AF has a substantial genetic basis, we assessed for predisposition to AF across ischemic stroke subtypes. We examined associations between AF genetic risk and Trial of Org 10172 in Acute Stroke Treatment stroke subtypes in 2374 ambulatory individuals with ischemic stroke and 5175 without from the Wellcome Trust Case-Control Consortium 2 using logistic regression. We calculated AF genetic risk scores using single-nucleotide polymorphisms associated with AF in a previous independent analysis across a range of preselected significance thresholds. There were 460 (19.4%) individuals with cardioembolic stroke, 498 (21.0%) with large vessel, 474 (20.0%) with small vessel, and 814 (32.3%) individuals with strokes of undetermined cause. Most AF genetic risk scores were associated with stroke, with the strongest association ( P =6×10 - 4 ) attributed to scores of 944 single-nucleotide polymorphisms (each associated with AF at P <1×10 - 3 in a previous analysis). Associations between AF genetic risk and stroke were enriched in the cardioembolic stroke subset (strongest P =1.2×10 - 9 , 944 single-nucleotide polymorphism score). In contrast, AF genetic risk was not significantly associated with noncardioembolic stroke subtypes. Comprehensive AF genetic risk scores were specific for cardioembolic stroke. Incomplete workups and subtype misclassification may have limited the power to detect associations with strokes of undetermined pathogenesis. Future studies are warranted to determine whether AF genetic risk is a useful biomarker to enhance clinical discrimination of stroke pathogeneses. © 2017 American Heart Association, Inc.

  12. Exploring genetic variants predisposing to diabetes mellitus and their association with indicators of socioeconomic status.

    PubMed

    Schmidt, Börge; Dragano, Nico; Scherag, André; Pechlivanis, Sonali; Hoffmann, Per; Nöthen, Markus M; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne

    2014-06-16

    The relevance of disease-related genetic variants for the explanation of social inequalities in complex diseases is unclear and empirical analyses are largely missing. The aim of our study was to examine whether genetic variants predisposing to diabetes mellitus are associated with socioeconomic status in a population-based cohort. We genotyped 11 selected diabetes-related single nucleotide polymorphisms in 4655 participants (age 45-75 years) of the Heinz Nixdorf Recall study. Diabetes status was self-reported or defined by blood glucose levels. Education, income and paternal occupation were assessed as indicators of socioeconomic status. Multiple regression analyses were used to examine the association of socioeconomic status and diabetes by estimating sex-specific and age-adjusted prevalence ratios and their corresponding 95%-confidence intervals. To explore the relationship between individual single nucleotide polymorphisms and socioeconomic status sex- and age-adjusted odds ratios were computed. We adjusted the alpha-level for multiple testing of 11 single nucleotide polymorphisms using Bonferroni's method (α(BF) ~ 0.005). In addition, we explored the association of a genetic risk score with socioeconomic status. Social inequalities in diabetes were observed for all indicators of socioeconomic status. However, there were no significant associations between individual diabetes-related risk alleles and socioeconomic status with odds ratios ranging from 0.87 to 1.23. Similarly, the genetic risk score analysis revealed no evidence for an association. Our data provide no evidence for an association between 11 diabetes-related risk alleles and different indicators of socioeconomic status in a population-based cohort, suggesting that the explored genetic variants do not contribute to health inequalities in diabetes.

  13. Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

    PubMed Central

    Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

    2016-01-01

    Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

  14. A single mutation in Taiwanese H6N1 influenza hemagglutinin switches binding to human-type receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    de Vries, Robert P.; Tzarum, Netanel; Peng, Wenjie

    In June 2013, the first case of human infection with an avian H6N1 virus was reported in a Taiwanese woman. Although this was a single non-fatal case, the virus continues to circulate in Taiwanese poultry. As with any emerging avian virus that infects humans, there is concern that acquisition of human-type receptor specificity could enable transmission in the human population. Despite mutations in the receptor-binding pocket of the human H6N1 isolate, it has retained avian-type (NeuAcα2-3Gal) receptor specificity. However, we show here that a single nucleotide substitution, resulting in a change from Gly to Asp at position 225 (G225D), completelymore » switches specificity to human-type (NeuAcα2-6Gal) receptors. Significantly, G225D H6 loses binding to chicken trachea epithelium and is now able to bind to human tracheal tissue. Structural analysis reveals that Asp225 directly interacts with the penultimate Gal of the human-type receptor, stabilizing human receptor binding.« less

  15. Structure, sequence and expression of the hepatitis delta (δ) viral genome

    NASA Astrophysics Data System (ADS)

    Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael

    1986-10-01

    Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.

  16. Identification of a Polymorphic Gene, BCL2A1, Encoding Two Novel Hematopoietic Lineage-specific Minor Histocompatibility Antigens

    PubMed Central

    Akatsuka, Yoshiki; Nishida, Tetsuya; Kondo, Eisei; Miyazaki, Mikinori; Taji, Hirohumi; Iida, Hiroatsu; Tsujimura, Kunio; Yazaki, Makoto; Naoe, Tomoki; Morishima, Yasuo; Kodera, Yoshihisa; Kuzushima, Kiyotaka; Takahashi, Toshitada

    2003-01-01

    We report the identification of two novel minor histocompatibility antigens (mHAgs), encoded by two separate single nucleotide polymorphisms on a single gene, BCL2A1, and restricted by human histocompatibility leukocyte antigen (HLA)-A*2402 (the most common HLA-A allele in Japanese) and B*4403, respectively. Two cytotoxic T lymphocyte (CTL) clones specific for these mHAgs were first isolated from two distinct recipients after hematopoietic cell transplantation. Both clones lyse only normal and malignant cells within the hematopoietic lineage. To localize the gene encoding the mHAgs, two-point linkage analysis was performed on the CTL lytic patterns of restricting HLA-transfected B lymphoblastoid cell lines obtained from Centre d'Etude du Polymorphisme Humain. Both CTL clones showed a completely identical lytic pattern for 4 pedigrees and the gene was localized within a 3.6-cM interval of 15q24.3–25.1 region that encodes at least 46 genes. Of those, only BCL2A1 has been reported to be expressed in hematopoietic cells and possess three nonsynonymous nucleotide changes. Minigene transfection and epitope reconstitution assays with synthetic peptides identified both HLA-A*2402– and B*4403-restricted mHAg epitopes to be encoded by distinct polymorphisms within BCL2A1. PMID:12771180

  17. Large-Scale Development of Cost-Effective Single-Nucleotide Polymorphism Marker Assays for Genetic Mapping in Pigeonpea and Comparative Mapping in Legumes

    PubMed Central

    Saxena, Rachit K.; Varma Penmetsa, R.; Upadhyaya, Hari D.; Kumar, Ashish; Carrasquilla-Garcia, Noelia; Schlueter, Jessica A.; Farmer, Andrew; Whaley, Adam M.; Sarma, Birinchi K.; May, Gregory D.; Cook, Douglas R.; Varshney, Rajeev K.

    2012-01-01

    Single-nucleotide polymorphisms (SNPs, >2000) were discovered by using RNA-seq and allele-specific sequencing approaches in pigeonpea (Cajanus cajan). For making the SNP genotyping cost-effective, successful competitive allele-specific polymerase chain reaction (KASPar) assays were developed for 1616 SNPs and referred to as PKAMs (pigeonpea KASPar assay markers). Screening of PKAMs on 24 genotypes [23 from cultivated species and 1 wild species (Cajanus scarabaeoides)] defined a set of 1154 polymorphic markers (77.4%) with a polymorphism information content (PIC) value from 0.04 to 0.38. One thousand and ninety-four PKAMs showed polymorphisms between parental lines of the reference mapping population (C. cajan ICP 28 × C. scarabaeoides ICPW 94). By using high-quality marker genotyping data on 167 F2 lines from the population, a comprehensive genetic map comprising 875 PKAMs with an average inter-marker distance of 1.11 cM was developed. Previously mapped 35 simple sequence repeat markers were integrated into the PKAM map and an integrated genetic map of 996.21 cM was constructed. Mapped PKAMs showed a higher degree of synteny with the genome of Glycine max followed by Medicago truncatula and Lotus japonicus and least with Vigna unguiculata. These PKAMs will be useful for genetics research and breeding applications in pigeonpea and for utilizing genome information from other legume species. PMID:23103470

  18. Genes determining the severity of cerebral palsy: the role of single nucleotide polymorphisms on the amount and structure of apolipoprotein E

    PubMed Central

    Lien, Espen; Andersen, Guro; Bao, Yongde; Gordish-Dressman, Heather; Skranes, Jon S.; Blackman, James A.; Vik, Torstein

    2015-01-01

    Aim ApolipoproteinE (apoE) influences repair and other processes in the brain and the apoE4 variant is a risk factor for Alzheimer's disease and for prolonged recovery following traumatic brain injury. We previously reported that specific single nucleotide polymorphisms in the APOE or TOMM40 genes affecting the structure and production of apoE were associated with epilepsy, more impaired hand function and gastrostomy tube feeding in children with cerebral palsy (CP). This study explored how various combinations of the same polymorphisms may affect these clinical manifestations. Methods Successful DNA analyses of APOE and TOMM40 were carried out on 227 children. The CP Register of Norway provided details of gross and fine motor function, epilepsy and gastrostomy tube feeding. Possible associations between these clinical manifestations and various combinations of the APOEε2, ε3 or ε4 alleles and of the rs59007384 polymorphism in the TOMM40 gene were explored. Results Epilepsy, impaired fine motor function and gastrostomy tube feeding were less common in children carrying the combination of rs59007384 GG and APOEε2 or ε3 than in children with other combinations. Conclusion Our findings suggest that specific combinations of genes influence the structure and production of apoE differently and affect the clinical manifestations of CP. PMID:25703783

  19. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    PubMed Central

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

  20. Detection of Strand Cleavage And Oxidation Damage Using Model DNA Molecules Captured in a Nanoscale Pore

    NASA Technical Reports Server (NTRS)

    Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.

    2003-01-01

    We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.

  1. Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

    PubMed

    Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

    2017-06-13

    We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

  2. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

    PubMed

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

    2018-02-23

    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  3. Parallel gene analysis with allele-specific padlock probes and tag microarrays

    PubMed Central

    Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

    2003-01-01

    Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

  4. Origins and Domestication of Cultivated Banana Inferred from Chloroplast and Nuclear Genes

    PubMed Central

    Zhang, Cui; Wang, Xin-Feng; Shi, Feng-Xue; Chen, Wen-Na; Ge, Xue-Jun

    2013-01-01

    Background Cultivated bananas are large, vegetatively-propagated members of the genus Musa. More than 1,000 cultivars are grown worldwide and they are major economic and food resources in numerous developing countries. It has been suggested that cultivated bananas originated from the islands of Southeast Asia (ISEA) and have been developed through complex geodomestication pathways. However, the maternal and parental donors of most cultivars are unknown, and the pattern of nucleotide diversity in domesticated banana has not been fully resolved. Methodology/Principal Findings We studied the genetics of 16 cultivated and 18 wild Musa accessions using two single-copy nuclear (granule-bound starch synthase I, GBSS I, also known as Waxy, and alcohol dehydrogenase 1, Adh1) and two chloroplast (maturase K, matK, and the trnL-F gene cluster) genes. The results of phylogenetic analyses showed that all A-genome haplotypes of cultivated bananas were grouped together with those of ISEA subspecies of M. acuminata (A-genome). Similarly, the B- and S-genome haplotypes of cultivated bananas clustered with the wild species M. balbisiana (B-genome) and M. schizocarpa (S-genome), respectively. Notably, it has been shown that distinct haplotypes of each cultivar (A-genome group) were nested together to different ISEA subspecies M. acuminata. Analyses of nucleotide polymorphism in the Waxy and Adh1 genes revealed that, in comparison to the wild relatives, cultivated banana exhibited slightly lower nucleotide diversity both across all sites and specifically at silent sites. However, dramatically reduced nucleotide diversity was found at nonsynonymous sites for cultivated bananas. Conclusions/Significance Our study not only confirmed the origin of cultivated banana as arising from multiple intra- and inter-specific hybridization events, but also showed that cultivated banana may have not suffered a severe genetic bottleneck during the domestication process. Importantly, our findings suggested that multiple maternal origins and a reduction in nucleotide diversity at nonsynonymous sites are general attributes of cultivated bananas. PMID:24260405

  5. OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities

    NASA Astrophysics Data System (ADS)

    Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.

    2016-09-01

    The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

  6. MicroRNA-196a2 Biomarker and Targetome Network Analysis in Solid Tumors.

    PubMed

    Toraih, Eman A; Fawzy, Manal S; Mohammed, Eman A; Hussein, Mohammad H; El-Labban, Mohamad M

    2016-12-01

    MicroRNAs (miRNAs) have been linked to cancer development and progression. The molecular mechanisms underlying the genetic associations of the miRNA single nucleotide polymorphism with cancer vary by cancer site. As there are no previous studies on the miR-196a2 variant or expression in any type of cancer among our population, we aimed to determine the expression profile of mature miR-196a2 in various types of solid tumors and to analyze the impact of its polymorphism (rs11614913; C/T) on the expression levels. The study included 230 cancer patients (including 17 types of cancer), 26 patients with pre-cancer lesions, and 100 unrelated controls. Archived formalin-fixed, paraffin-embedded specimens (n = 197) were available for both miRNA expression analysis and single nucleotide polymorphism identification. Venous blood was collected from 59 histologically confirmed sporadic cancer patients and the study controls for single nucleotide polymorphism identification. Real-time polymerase chain reaction analysis was performed for allelic discrimination and relative quantification of miR-196a2 in the study samples. In silico target gene prediction and network analysis was performed. We found that individuals with the T variant were associated with cancer risk under all genetic association models, especially in colorectal, esophageal, skin, lung, thyroid, and renal cancer. Overall and stratified analysis showed miR-196a2 over-expression in most of the current malignant tumor samples relative to their corresponding cancer-free tissues. Carriers of the C allele had significantly higher expression levels of miR-196a2. Correlation with the clinicopathological features of cancer showed organ-specific effects. Gene enrichment analysis of predicted and validated targets speculated the putative role of miR-196a2 in cancer-associated biology. We highlighted cancer-type specific expression profiles of miR-196a2, which was correlated with the clinicopathological features in various types of cancer. Taken together, our results suggest that the miRNA signature could have promising diagnostic and prognostic significance.

  7. Positive transcriptional regulation of the human micro opioid receptor gene by poly(ADP-ribose) polymerase-1 and increase of its DNA binding affinity based on polymorphism of G-172 -> T.

    PubMed

    Ono, Takeshi; Kaneda, Toshio; Muto, Akihiro; Yoshida, Tadashi

    2009-07-24

    Micro opioid receptor (MOR) agonists such as morphine are applied widely in clinical practice as pain therapy. The effects of morphine through MOR, such as analgesia and development of tolerance and dependence, are influenced by individual specificity. Recently, we analyzed single nucleotide polymorphisms on the human MOR gene to investigate the factors that contribute to individual specificity. In process of single nucleotide polymorphisms analysis, we found that specific nuclear proteins bound to G(-172) --> T region in exon 1 in MOR gene, and its affinity to DNA was increased by base substitution from G(-172) to T(-172). The isolated protein was identified by mass spectrometry and was confirmed by Western blotting to be poly(ADP-ribose) polymerase-1 (PARP-1). The overexpressed PARP-1 bound to G(-172) --> T and enhanced the transcription of reporter vectors containing G(-172) and T(-172). Furthermore, PARP-1 inhibitor (benzamide) decreased PARP-1 binding to G(-172) --> T without affecting mRNA or protein expression level of PARP-1 and down-regulated the subsequent MOR gene expression in SH-SY5Y cells. Moreover, we found that tumor necrosis factor-alpha enhanced MOR gene expression as well as increased PARP-1 binding to the G(-172) --> T region and G(-172) --> T-dependent transcription in SH-SY5Y cells. These effects were also inhibited by benzamide. In this study, our data suggest that PARP-1 positively regulates MOR gene transcription via G(-172) --> T, which might influence individual specificity in therapeutic opioid effects.

  8. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic.

    PubMed

    Muneta, Yoshihiro; Minagawa, Yu; Kusumoto, Masahiro; Shinkai, Hiroki; Uenishi, Hirohide; Splichal, Igor

    2012-06-01

    In the present study, an allele-specific primer-polymerase chain reaction (ASP-PCR) for genotyping a single nucleotide polymorphism (SNP) of swine Toll-like receptor 5 (TLR5) (C1205T; P402L) that is related to the impaired recognition of Salmonella enterica serovar Choleraesuis (SC) was developed. The allele frequencies in several pig breeds in Japan and the Czech Republic were also compared. The swine TLR5 C1205T mutation was successfully determined by ASP-PCR using genomic DNA samples in Japan that had previously been genotyped by a sequencing method. Using the PCR condition determined, genomic DNA samples from blood obtained from 110 pigs from seven different breeds in the Czech Republic were genotyped by the ASP-PCR. The genotyping results from the ASP-PCR completely matched the results from the sequencing method. The allele frequency of the swine TLR5 C1205T mutation was 27.5% in the Landrace breed of the Czech Republic compared with 50.0% in Japanese Landrace. In Japan, the C1205T mutation was found only in the Landrace breed, whereas in the Czech Republic it was found in both the Landrace and Piétrain breeds. These results indicate the usefulness of ASP-PCR for detecting a specific SNP for swine TLR5 affecting ligand recognition. They also suggest the possibility of genetically improving pigs to enhance their resistance against SC infection by eliminating or selecting this specific SNP of swine TLR5. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  9. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  10. The A2 Adenosine Receptor: Guanine Nucleotide Modulation of Agonist Binding Is Enhanced by Proteolysis

    PubMed Central

    NANOFF, CHRISTIAN; JACOBSON, KENNETH A.; STILES, GARY L.

    2012-01-01

    SUMMARY Agonist binding to the A2 adenosine receptor (A2AR) and its regulation by guanine nucleotides was studied using the newly developed radioligand 125l-2-[4-(2-{2-[(4-ammnophenyl)methylcarbonylamino]ethylaminnocarbonyl}ethyl)phenyl]ethylamino-5′-N-ethylcarboxamidoadenosine (1251-PAPA-APEC) and its photoaffinity analog 125l-azido-PAPA-APEC. A single protein of Mr 45,000, displaying the appropriate A2AR pharmacology, is Iabeled in membranes from bovine striatum, PC12 cells, and frog erythrocytes. In DDT1 MF2 cells the labeled protein has a slightly lower molecular weight. Incorporation of 125l-azido-PAPA-APEC into membranes from rabbit striatum, however, reveals two specifically labeled peptides (Mr ~47,O00 and 38,000), both of which display A2AR pharmacology. Inhibition of protease activity leads to a decrease in the amount of the Mr 38,000 protein, with only the Mr 47,000 protein remaining. This suggests that the Mr 38,000 peptide is a proteolytic product of the Mr 47,000 A2AR protein. In membranes containing the intact undigested A2AR protein, guanine nucleotides induce a small to insignificant decrease in agonist binding, which is atypical of stimulatory Gs-coupled receptors. This minimal effect is observed in rabbit striatal membranes prepared in the presence of protease inhibitors, as well as in the other tissues studied. Binding to rabbit stnatal membranes that possess the partially digested receptor protein, however, reveals a 50% reduction in maximal specific agonist binding upon addition of guanine nucleotides. Inhibition of proteolysis in rabbit striatum, on the other hand, results in a diminished ability of guanine nucleotides to regulate agonist binding. Thus, the enhanced effectiveness of guanine nucleotides in rabbit striatal membranes is associated with the generation of the Mr 38,000 peptide fragment. Guanosine 5′-(β,γ-imido)triphosphate reduces photoaffinity labeling by 55% in the Mr 38,000 protein, whereas the labeling is decreased by only 28% in the Mr 47,000 receptor protein. Our data, therefore, suggest that, unless proteolysis occurs, the A2AR in all tissues studied is tightly associated with the Gs protein and displays minimal guanine nucleotide modulation of agonist binding, which makes the A2AR an atypical stimulatory receptor. PMID:1899902

  11. Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer

    DOEpatents

    Kwok, Pui-Yan; Chen, Xiangning

    1999-01-01

    A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

  12. Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

    USDA-ARS?s Scientific Manuscript database

    In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

  13. Rhabdomyolysis After Out-of-Water Exercise in an Elite Adolescent Water Polo Player Carrying the IL-6 174C Allele Single-Nucleotide Polymorphism.

    PubMed

    Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan

    2015-12-01

    We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.

  14. Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5'-Untranslated Region among Cases of the Same Outbreak from a Single Source

    PubMed Central

    Wu, Shuang; Nakamoto, Shingo; Kanda, Tatsuo; Jiang, Xia; Nakamura, Masato; Miyamura, Tatsuo; Shirasawa, Hiroshi; Sugiura, Nobuyuki; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

    2014-01-01

    Hepatitis A virus (HAV) is a causative agent of acute viral hepatitis for which an effective vaccine has been developed. Here we describe ultra-deep pyrosequences (UDPSs) of HAV 5'-untranslated region (5'UTR) among cases of the same outbreak, which arose from a single source, associated with a revolving sushi bar. We determined the reference sequence from HAV-derived clone from an attendant by the Sanger method. Sixteen UDPSs from this outbreak and one from another sporadic case were compared with this reference. Nucleotide errors yielded a UDPS error rate of < 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. Analysis of UDPSs detected low-prevalence HAV variations in 5'UTR, but no specific mutations associated with severity in these outbreak cases. To our surprise, HAV strains in this outbreak conserved HAV IRES sequence even if we performed analysis of UDPSs. UDPS analysis of HAV 5'UTR gave us no association between the disease severity of hepatitis A and HAV 5'UTR substitutions. It might be more interesting to perform ultra-deep sequencing of full length HAV genome in order to reveal possible unknown genomic determinants associated with disease severity. Further studies will be needed. PMID:24396287

  15. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis

    PubMed Central

    Olsen, Randall J.; Sitkiewicz, Izabela; Ayeras, Ara A.; Gonulal, Vedia E.; Cantu, Concepcion; Beres, Stephen B.; Green, Nicole M.; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P.; Montgomery, Charles A.; Cartwright, Joiner; McGeer, Allison; Low, Donald E.; Whitney, Adeline R.; Cagle, Philip T.; Blasdel, Terry L.; DeLeo, Frank R.; Musser, James M.

    2010-01-01

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis (“flesh-eating disease”). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the ΔmtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research. PMID:20080771

  16. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis.

    PubMed

    Olsen, Randall J; Sitkiewicz, Izabela; Ayeras, Ara A; Gonulal, Vedia E; Cantu, Concepcion; Beres, Stephen B; Green, Nicole M; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P; Montgomery, Charles A; Cartwright, Joiner; McGeer, Allison; Low, Donald E; Whitney, Adeline R; Cagle, Philip T; Blasdel, Terry L; DeLeo, Frank R; Musser, James M

    2010-01-12

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis ("flesh-eating disease"). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the DeltamtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research.

  17. Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply.

    PubMed

    Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei

    2017-08-01

    Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. tRNAHis guanylyltransferase catalyzes a 3'-5' polymerization reaction that is distinct from G-1 addition.

    PubMed

    Jackman, Jane E; Phizicky, Eric M

    2006-06-06

    Yeast tRNA(His) guanylyltransferase, Thg1, is an essential protein that adds a single guanine to the 5' end (G(-1)) of tRNA(His). This G(-1) residue is required for aminoacylation of tRNA(His) by histidyl-tRNA synthetase, both in vitro and in vivo. The guanine nucleotide addition reaction catalyzed by Thg1 extends the polynucleotide chain in the reverse (3'-5') direction of other known polymerases, albeit by one nucleotide. Here, we show that alteration of the 3' end of the Thg1 substrate tRNA(His) unleashes an unexpected reverse polymerase activity of wild-type Thg1, resulting in the 3'-5' addition of multiple nucleotides to the tRNA, with efficiency comparable to the G(-1) addition reaction. The addition of G(-1) forms a mismatched G.A base pair at the 5' end of tRNA(His), and, with monophosphorylated tRNA substrates, it is absolutely specific for tRNA(His). By contrast, reverse polymerization forms multiple G.C or C.G base pairs, and, with preactivated tRNA species, it can initiate at positions other than -1 and is not specific for tRNA(His). Thus, wild-type Thg1 catalyzes a templated polymerization reaction acting in the reverse direction of that of canonical DNA and RNA polymerases. Surprisingly, Thg1 can also readily use dNTPs for nucleotide addition. These results suggest that 3'-5' polymerization represents either an uncharacterized role for Thg1 in RNA or DNA repair or metabolism, or it may be a remnant of an earlier catalytic strategy used in nature.

  19. Srs2 prevents Rad51 filament formation by repetitive motion on DNA.

    PubMed

    Qiu, Yupeng; Antony, Edwin; Doganay, Sultan; Koh, Hye Ran; Lohman, Timothy M; Myong, Sua

    2013-01-01

    Srs2 dismantles presynaptic Rad51 filaments and prevents its re-formation as an anti-recombinase. However, the molecular mechanism by which Srs2 accomplishes these tasks remains unclear. Here we report a single-molecule fluorescence study of the dynamics of Rad51 filament formation and its disruption by Srs2. Rad51 forms filaments on single-stranded DNA by sequential binding of primarily monomers and dimers in a 5'-3' direction. One Rad51 molecule binds to three nucleotides, and six monomers are required to achieve a stable nucleation cluster. Srs2 exhibits ATP-dependent repetitive motion on single-stranded DNA and this activity prevents re-formation of the Rad51 filament. The same activity of Srs2 cannot prevent RecA filament formation, indicating its specificity for Rad51. Srs2's DNA-unwinding activity is greatly suppressed when Rad51 filaments form on duplex DNA. Taken together, our results reveal an exquisite and highly specific mechanism by which Srs2 regulates the Rad51 filament formation.

  20. Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

    PubMed Central

    Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

    2014-01-01

    Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

  1. A response to Yu et al. "A forward-backward fragment assembling algorithm for the identification of genomic amplification and deletion breakpoints using high-density single nucleotide polymorphism (SNP) array", BMC Bioinformatics 2007, 8: 145.

    PubMed

    Rueda, Oscar M; Diaz-Uriarte, Ramon

    2007-10-16

    Yu et al. (BMC Bioinformatics 2007,8: 145+) have recently compared the performance of several methods for the detection of genomic amplification and deletion breakpoints using data from high-density single nucleotide polymorphism arrays. One of the methods compared is our non-homogenous Hidden Markov Model approach. Our approach uses Markov Chain Monte Carlo for inference, but Yu et al. ran the sampler for a severely insufficient number of iterations for a Markov Chain Monte Carlo-based method. Moreover, they did not use the appropriate reference level for the non-altered state. We rerun the analysis in Yu et al. using appropriate settings for both the Markov Chain Monte Carlo iterations and the reference level. Additionally, to show how easy it is to obtain answers to additional specific questions, we have added a new analysis targeted specifically to the detection of breakpoints. The reanalysis shows that the performance of our method is comparable to that of the other methods analyzed. In addition, we can provide probabilities of a given spot being a breakpoint, something unique among the methods examined. Markov Chain Monte Carlo methods require using a sufficient number of iterations before they can be assumed to yield samples from the distribution of interest. Running our method with too small a number of iterations cannot be representative of its performance. Moreover, our analysis shows how our original approach can be easily adapted to answer specific additional questions (e.g., identify edges).

  2. Biochemical and Genetic Markers in Aggressiveness and Recurrence of Prostate Cancer: Race-Specific Links to Inflammation and Insulin Resistance

    DTIC Science & Technology

    2013-07-01

    as a statistical graphic, and Pearson product moment correlation coefficients as measures of the strength of linear association; 4) performing SNP ...determine if there are differences in single nucleotide polymorphisms ( SNPs ) in selected candidate genes implicated in metabolic syndrome, obesity, chronic...samples for the serum and SNP analyses. We have reached a target of 500 patients at the end of year 2; however, some of the patients turned out to be

  3. High-Resolution Mapping of Structural Mutations in Prostate Cancer with Single Nucleotide Polymorphism Arrays

    DTIC Science & Technology

    2006-11-01

    study of the NCI60 panel of cancer cell lines [39]. More recently, amplifications of NOTCH3 were noted in ovarian tumors by an SNP array analysis...and the functional role of NOTCH3 was suggested by the ability to suppress cell proliferation by inhibiting NOTCH3 [40]. Allele-specific copy...Identified and functionally validated the oncogene MITF. 40 Park JT, Li M, Nakayama K, et al. Notch3 gene amplification in ovarian cancer. Cancer Res

  4. Eradication of Large Solid Tumors by Gene Therapy with a T-Cell Receptor Targeting a Single Cancer-Specific Point Mutation.

    PubMed

    Leisegang, Matthias; Engels, Boris; Schreiber, Karin; Yew, Poh Yin; Kiyotani, Kazuma; Idel, Christian; Arina, Ainhoa; Duraiswamy, Jaikumar; Weichselbaum, Ralph R; Uckert, Wolfgang; Nakamura, Yusuke; Schreiber, Hans

    2016-06-01

    Cancers usually contain multiple unique tumor-specific antigens produced by single amino acid substitutions (AAS) and encoded by somatic nonsynonymous single nucleotide substitutions. We determined whether adoptively transferred T cells can reject large, well-established solid tumors when engineered to express a single type of T-cell receptor (TCR) that is specific for a single AAS. By exome and RNA sequencing of an UV-induced tumor, we identified an AAS in p68 (mp68), a co-activator of p53. This AAS seemed to be an ideal tumor-specific neoepitope because it is encoded by a trunk mutation in the primary autochthonous cancer and binds with highest affinity to the MHC. A high-avidity mp68-specific TCR was used to genetically engineer T cells as well as to generate TCR-transgenic mice for adoptive therapy. When the neoepitope was expressed at high levels and by all cancer cells, their direct recognition sufficed to destroy intratumor vessels and eradicate large, long-established solid tumors. When the neoepitope was targeted as autochthonous antigen, T cells caused cancer regression followed by escape of antigen-negative variants. Escape could be thwarted by expressing the antigen at increased levels in all cancer cells or by combining T-cell therapy with local irradiation. Therapeutic efficacies of TCR-transduced and TCR-transgenic T cells were similar. Gene therapy with a single TCR targeting a single AAS can eradicate large established cancer, but a uniform expression and/or sufficient levels of the targeted neoepitope or additional therapy are required to overcome tumor escape. Clin Cancer Res; 22(11); 2734-43. ©2015 AACRSee related commentary by Liu, p. 2602. ©2015 American Association for Cancer Research.

  5. Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

    DTIC Science & Technology

    2013-10-01

    identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

  6. Single-cell analysis of intercellular heteroplasmy of mtDNA in Leber hereditary optic neuropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kobayashi, Y.; Sharpe, H.; Brown, N.

    1994-07-01

    The authors have investigated the distribution of mutant mtDNA molecules in single cells from a patient with Leber hereditary optic neuropathy (LHON). LHON is a maternally inherited disease that is characterized by a sudden-onset bilateral loss of central vision, which typically occurs in early adulthood. More than 50% of all LHON patients carry an mtDNA mutation at nucleotide position 11778. This nucleotide change converts a highly conserved arginine residue to histidine at codon 340 in the NADH-ubiquinone oxidoreductase subunit 4 (ND4) gene of mtDNA. In the present study, the authors used PCR amplification of mtDNA from lymphocytes to investigate mtDNAmore » heteroplasmy at the single-cell level in a LHON patient. They found that most cells were either homoplasmic normal or homoplasmic mutant at nucleotide position 11778. Some (16%) cells contained both mutant and normal mtDNA.« less

  7. Method for producing labeled single-stranded nucleic acid probes

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    1999-10-19

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

  8. Single Locked Nucleic Acid-Enhanced Nanopore Genetic Discrimination of Pathogenic Serotypes and Cancer Driver Mutations.

    PubMed

    Tian, Kai; Chen, Xiaowei; Luan, Binquan; Singh, Prashant; Yang, Zhiyu; Gates, Kent S; Lin, Mengshi; Mustapha, Azlin; Gu, Li-Qun

    2018-05-22

    Accurate and rapid detection of single-nucleotide polymorphism (SNP) in pathogenic mutants is crucial for many fields such as food safety regulation and disease diagnostics. Current detection methods involve laborious sample preparations and expensive characterizations. Here, we investigated a single locked nucleic acid (LNA) approach, facilitated by a nanopore single-molecule sensor, to accurately determine SNPs for detection of Shiga toxin producing Escherichia coli (STEC) serotype O157:H7, and cancer-derived EGFR L858R and KRAS G12D driver mutations. Current LNA applications that require incorporation and optimization of multiple LNA nucleotides. But we found that in the nanopore system, a single LNA introduced in the probe is sufficient to enhance the SNP discrimination capability by over 10-fold, allowing accurate detection of the pathogenic mutant DNA mixed in a large amount of the wild-type DNA. Importantly, the molecular mechanistic study suggests that such a significant improvement is due to the effect of the single-LNA that both stabilizes the fully matched base-pair and destabilizes the mismatched base-pair. This sensitive method, with a simplified, low cost, easy-to-operate LNA design, could be generalized for various applications that need rapid and accurate identification of single-nucleotide variations.

  9. Evolution of specific 3'-5'-linkages in RNA in pre-biotic soup: a new hypothesis.

    PubMed

    Kumar, Vaijayanti A

    2016-11-02

    This article reviews the different possibilities towards progression of the formation of DNA/RNA in the chemical world, before life, in enzyme-free conditions. The advent of deoxyribo- and ribopentose-sugars, nucleosides, nucleotides and oligonucleotides in the prebiotic soup is briefly discussed. Further, the formation of early single stranded oligomers, base-pairing possibilities and information transfer based on the stability parameters of the derived duplexes is reviewed. Each theory has its own merits and demerits which we have elaborated upon. Lastly, using clues from this literature, a possible explanation for the specific 3'-5'-linkages in RNA is proposed.

  10. Combined use of a new SNP-based assay and multilocus SSR markers to assess genetic diversity of Xylella fastidiosa subsp. pauca infecting citrus and coffee plants.

    PubMed

    Montes-Borrego, Miguel; Lopes, Joao R S; Jiménez-Díaz, Rafael M; Landa, Blanca B

    2015-03-01

    Two haplotypes of Xylella fastidiosa subsp. pauca (Xfp) that correlated with their host of origin were identified in a collection of 90 isolates infecting citrus and coffee plants in Brazil, based on a single-nucleotide polymorphism in the gyrB sequence. A new single-nucleotide primer extension (SNuPE) protocol was designed for rapid identification of Xfp according to the host source. The protocol proved to be robust for the prediction of the Xfp host source in blind tests using DNA from cultures of the bacterium, infected plants, and insect vectors allowed to feed on Xfp-infected citrus plants. AMOVA and STRUCTURE analyses of microsatellite data separated most Xfp populations on the basis of their host source, indicating that they were genetically distinct. The combined use of the SNaPshot protocol and three previously developed multilocus SSR markers showed that two haplotypes and distinct isolates of Xfp infect citrus and coffee in Brazil and that multiple, genetically different isolates can be present in a single orchard or infect a single tree. This combined approach will be very useful in studies of the epidemiology of Xfp-induced diseases, host specificity of bacterial genotypes, the occurrence of Xfp host jumping, vector feeding habits, etc., in economically important cultivated plants or weed host reservoirs of Xfp in Brazil and elsewhere. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

  11. RNAcentral: A comprehensive database of non-coding RNA sequences

    DOE PAGES

    Williams, Kelly Porter; Lau, Britney Yan

    2016-10-28

    RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

  12. RNAcentral: A comprehensive database of non-coding RNA sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, Kelly Porter; Lau, Britney Yan

    RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

  13. Electron attachment to DNA single strands: gas phase and aqueous solution.

    PubMed

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F

    2007-01-01

    The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage.

  14. Differences in N-linked glycosylation between human surfactant protein-B variants of the C or T allele at the single-nucleotide polymorphism at position 1580: implications for disease.

    PubMed Central

    Wang, Guirong; Christensen, Neil D; Wigdahl, Brian; Guttentag, Susan H; Floros, Joanna

    2003-01-01

    Human surfactant protein-B (SP-B), a hydrophobic protein, is essential for normal lung function. SP-B is expressed and secreted by specific lung cell types, i.e. alveolar type II and Clara cells, of the respiratory epithelium. The SP-B precursor (42 kDa) undergoes post-translational processing to generate an 8 kDa mature SP-B. A single-nucleotide polymorphism (SNP) at nucleotide 1580 (C/T) in exon 4 of SP-B that changes amino acid 131 from threonine to isoleucine (Thr131-->Ile) is associated with several pulmonary diseases. The Thr131-->Ile substitution can eliminate a potential N-linked glycosylation site, Asn129-Gln-Thr131, which is present in the SP-B variant of the C allele (ACT/Thr) but not in that of the T allele (ATT/Ile). To determine whether the C allele SP-B variant is indeed glycosylated at Asn(129)-Gln-Thr131, we first generated stably transfected Chinese hamster ovary cell lines that expressed each version of SP-B, and developed specific SP-B polyclonal anti-peptide antibodies. Using both the stably transfected cell lines and fetal lung explants, we observed that the C allele variant is indeed glycosylated at the Asn129-Gln-Thr131 site, whereas the T allele variant, which served as a control, is not. In addition, we also confirmed that both SP-B variants contain another N-linked glycosylation site, Asn311-Ser-Ser313. Given its association with several pulmonary diseases, this finding provides useful information for future studies in disease systems associated with this SNP. Further, we speculate that, given the fact that this SNP is found frequently in the general population, N-linked glycosylation at residue Asn129 interferes with SP-B processing, secretion and folding under certain disease conditions. PMID:12356334

  15. Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

    PubMed

    Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

    2009-08-13

    Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

  16. Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template.

    PubMed

    Yuan, Quan; McHenry, Charles S

    2009-11-13

    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

  17. Genetic risk profiling and gene signature modeling to predict risk of complications after IPAA.

    PubMed

    Sehgal, Rishabh; Berg, Arthur; Polinski, Joseph I; Hegarty, John P; Lin, Zhenwu; McKenna, Kevin J; Stewart, David B; Poritz, Lisa S; Koltun, Walter A

    2012-03-01

    Severe pouchitis and Crohn's disease-like complications are 2 adverse postoperative complications that confound the success of the IPAA in patients with ulcerative colitis. To date, approximately 83 single nucleotide polymorphisms within 55 genes have been associated with IBD. The aim of this study was to identify single-nucleotide polymorphisms that correlate with complications after IPAA that could be utilized in a gene signature fashion to predict postoperative complications and aid in preoperative surgical decision making. One hundred forty-two IPAA patients were retrospectively classified as "asymptomatic" (n = 104, defined as no Crohn's disease-like complications or severe pouchitis for at least 2 years after IPAA) and compared with a "severe pouchitis" group (n = 12, ≥ 4 episodes pouchitis per year for 2 years including the need for long-term therapy to maintain remission) and a "Crohn's disease-like" group (n = 26, presence of fistulae, pouch inlet stricture, proximal small-bowel disease, or pouch granulomata, occurring at least 6 months after surgery). Genotyping for 83 single-nucleotide polymorphisms previously associated with Crohn's disease and/or ulcerative colitis was performed on a customized Illumina genotyping platform. The top 2 single-nucleotide polymorphisms statistically identified as being independently associated with each of Crohn's disease-like and severe pouchitis were used in a multivariate logistic regression model. These single-nucleotide polymorphisms were then used to create probability equations to predict overall chance of a positive or negative outcome for that complication. The top 2 single-nucleotide polymorphisms for Crohn's disease-like complications were in the 10q21 locus and the gene for PTGER4 (p = 0.006 and 0.007), whereas for severe pouchitis it was NOD2 and TNFSF15 (p = 0.003 and 0.011). Probability equations suggested that the risk of these 2 complications greatly increased with increasing number of risk alleles, going as high as 92% for severe pouchitis and 65% for Crohn's disease-like complications. In this IPAA patient cohort, mutations in the 10q21 locus and the PTGER4 gene were associated with Crohn's disease-like complications, whereas mutations in NOD2 and TNFSF15 correlated with severe pouchitis. Preoperative genetic analysis and use of such gene signatures hold promise for improved preoperative surgical patient selection to minimize these IPAA complications.

  18. Pre-steady-state Kinetic Analysis of a Family D DNA Polymerase from Thermococcus sp. 9°N Reveals Mechanisms for Archaeal Genomic Replication and Maintenance*

    PubMed Central

    Schermerhorn, Kelly M.; Gardner, Andrew F.

    2015-01-01

    Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179

  19. Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

    PubMed Central

    O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

    2006-01-01

    Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

  20. Multiplex Droplet Digital PCR Quantification of Recurrent Somatic Mutations in Diffuse Large B-Cell and Follicular Lymphoma.

    PubMed

    Alcaide, Miguel; Yu, Stephen; Bushell, Kevin; Fornika, Daniel; Nielsen, Julie S; Nelson, Brad H; Mann, Koren K; Assouline, Sarit; Johnson, Nathalie A; Morin, Ryan D

    2016-09-01

    A plethora of options to detect mutations in tumor-derived DNA currently exist but each suffers limitations in analytical sensitivity, cost, or scalability. Droplet digital PCR (ddPCR) is an appealing technology for detecting the presence of specific mutations based on a priori knowledge and can be applied to tumor biopsies, including formalin-fixed paraffin embedded (FFPE) tissues. More recently, ddPCR has gained popularity in its utility in quantifying circulating tumor DNA. We have developed a suite of novel ddPCR assays for detecting recurrent mutations that are prevalent in common B-cell non-Hodgkin lymphomas (NHLs), including diffuse large B-cell lymphoma, follicular lymphoma, and lymphoplasmacytic lymphoma. These assays allowed the differentiation and counting of mutant and wild-type molecules using one single hydrolysis probe. We also implemented multiplexing that allowed the simultaneous detection of distinct mutations and an "inverted" ddPCR assay design, based on employing probes matching wild-type alleles, capable of detecting the presence of multiple single nucleotide polymorphisms. The assays successfully detected and quantified somatic mutations commonly affecting enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) (Y641) and signal transducer and activator of transcription 6 (STAT6) (D419) hotspots in fresh tumor, FFPE, and liquid biopsies. The "inverted" ddPCR approach effectively reported any single nucleotide variant affecting either of these 2 hotspots as well. Finally, we could effectively multiplex hydrolysis probes targeting 2 additional lymphoma-related hotspots: myeloid differentiation primary response 88 (MYD88; L265P) and cyclin D3 (CCND3; I290R). Our suite of ddPCR assays provides sufficient analytical sensitivity and specificity for either the invasive or noninvasive detection of multiple recurrent somatic mutations in B-cell NHLs. © 2016 American Association for Clinical Chemistry.

  1. Single-nucleotide polymorphisms in the SEPTIN12 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

    PubMed

    Miyakawa, Hiroe; Miyamoto, Toshinobu; Koh, Eitetsu; Tsujimura, Akira; Miyagawa, Yasushi; Saijo, Yasuaki; Namiki, Mikio; Sengoku, Kazuo

    2012-01-01

    Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, 10 novel genes involved in human spermatogenesis, including human SEPTIN12, were identified by expression microarray analysis of human testicular tissue. Septin12 is a member of the septin family of conserved cytoskeletal GTPases that form heteropolymeric filamentous structures in interphase cells. It is expressed specifically in the testis. Therefore, we hypothesized that mutation or polymorphisms of SEPTIN12 participate in male infertility, especially Sertoli cell-only syndrome (SCOS). To investigate whether SEPTIN12 gene defects are associated with azoospermia caused by SCOS, mutational analysis was performed in 100 Japanese patients by direct sequencing of coding regions. Statistical analysis was performed in patients with SCOS and in 140 healthy control men. No mutations were found in SEPTIN12 ; however, 8 coding single-nucleotide polymorphisms (SNP1-SNP8) could be detected in the patients with SCOS. The genotype and allele frequencies in SNP3, SNP4, and SNP6 were notably higher in the SCOS group than in the control group (P < .001). These results suggest that SEPTIN12 might play a critical role in human spermatogenesis.

  2. Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

    PubMed

    Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

    2014-05-09

    ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.

  3. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, J.J.; Quesada, M.A.; Randesi, M.

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

  4. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

  5. A single amino acid substitution in the Bombyx-specific mucin-like membrane protein causes resistance to Bombyx mori densovirus.

    PubMed

    Ito, Katsuhiko; Kidokoro, Kurako; Katsuma, Susumu; Sezutsu, Hideki; Uchino, Keiro; Kobayashi, Isao; Tamura, Toshiki; Yamamoto, Kimiko; Mita, Kazuei; Shimada, Toru; Kadono-Okuda, Keiko

    2018-05-09

    Bombyx mori densovirus type 1 (BmDV) is a pathogen that causes flacherie disease in the silkworm. The absolute nonsusceptibility to BmDV among certain silkworm strains is determined independently by two genes, nsd-1 and Nid-1. However, neither of these genes has been molecularly identified to date. Here, we isolated the nsd-1 gene by positional cloning and characterized the properties of its product, NSD-1. Sequence and biochemical analyses revealed that this gene encodes a Bombyx-specific mucin-like glycoprotein with a single transmembrane domain. The NSD-1 protein was specifically expressed in the larval midgut epithelium, the known infection site of BmDV. Sequence analysis of the nsd-1 gene from 13 resistant and 12 susceptible strains suggested that a specific arginine residue in the extracellular tail of the NSD-1 protein was common among susceptible strains. Germline transformation of the susceptible-type nsd-1 (with a single nucleotide substitution) conferred partial susceptibility to resistant larvae, indicating that the +  nsd-1 gene is required for the susceptibility of B. mori larvae to BmDV and the susceptibility is solely a result of the substitution of a single amino acid with arginine. Taken together, our results provide striking evidence that a novel membrane-bound mucin-like protein functions as a cell-surface receptor for a densovirus.

  6. Advances in targeting cyclic nucleotide phosphodiesterases

    PubMed Central

    Maurice, Donald H.; Ke, Hengming; Ahmad, Faiyaz; Wang, Yousheng; Chung, Jay; Manganiello, Vincent C.

    2014-01-01

    Cyclic nucleotide phosphodiesterases (PDEs) catalyse the hydrolysis of cyclic AMP and cyclic GMP, thereby regulating the intracellular concentrations of these cyclic nucleotides, their signalling pathways and, consequently, myriad biological responses in health and disease. Currently, a small number of PDE inhibitors are used clinically for treating the pathophysiological dysregulation of cyclic nucleotide signalling in several disorders, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication and chronic obstructive pulmonary disease. However, pharmaceutical interest in PDEs has been reignited by the increasing understanding of the roles of individual PDEs in regulating the subcellular compartmentalization of specific cyclic nucleotide signalling pathways, by the structure-based design of novel specific inhibitors and by the development of more sophisticated strategies to target individual PDE variants. PMID:24687066

  7. Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis

    PubMed Central

    Waterfall, Christy M.; Cobb, Benjamin D.

    2001-01-01

    Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a ‘matrix-based’ optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable. PMID:11726702

  8. Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.

    PubMed

    Waterfall, C M; Cobb, B D

    2001-12-01

    Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.

  9. Highly selective detection of single-nucleotide polymorphisms using a quartz crystal microbalance biosensor based on the toehold-mediated strand displacement reaction.

    PubMed

    Wang, Dingzhong; Tang, Wei; Wu, Xiaojie; Wang, Xinyi; Chen, Gengjia; Chen, Qiang; Li, Na; Liu, Feng

    2012-08-21

    Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.

  10. Homogeneous real-time detection of single-nucleotide polymorphisms by strand displacement amplification on the BD ProbeTec ET system.

    PubMed

    Wang, Sha-Sha; Thornton, Keith; Kuhn, Andrew M; Nadeau, James G; Hellyer, Tobin J

    2003-10-01

    The BD ProbeTec ET System is based on isothermal strand displacement amplification (SDA) of target nucleic acid coupled with homogeneous real-time detection using fluorescent probes. We have developed a novel, rapid method using this platform that incorporates a universal detection format for identification of single-nucleotide polymorphisms (SNPs) and other genotypic variations. The system uses a common pair of fluorescent Detector Probes in conjunction with unlabeled allele-specific Adapter Primers and a universal buffer chemistry to permit analysis of multiple SNP loci under generic assay conditions. We used Detector Probes labeled with different dyes to facilitate differentiation of two alternative alleles in a single reaction with no postamplification manipulation. We analyzed six SNPs within the human beta(2)-adrenergic receptor (beta(2)AR) gene, using whole blood, buccal swabs, and urine samples, and compared results with those obtained by DNA sequencing. Unprocessed whole blood was successfully genotyped with as little as 0.1-1 micro L of sample per reaction. All six beta(2)AR assays were able to accommodate >/==" BORDER="0">20 micro L of unprocessed whole blood. For the 14 individuals tested, genotypes determined with the six beta(2)AR assays agreed with DNA sequencing results. SDA-based allelic differentiation on the BD ProbeTec ET System can detect SNPs rapidly, using whole blood, buccal swabs, or urine.

  11. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    PubMed Central

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  12. Functional effects of single nucleotide polymorphisms in the coding region of human N-acetyltransferase 1

    PubMed Central

    Zhu, Yuanqi; Hein, David W.

    2007-01-01

    Genetic variants of human N-acetyltransferase 1 (NAT1) are associated with cancer and birth defects. N- and O-acetyltransferase catalytic activities, Michaelis-Menten kinetic constants (Km & Vmax), and steady state expression levels of NAT1-specific mRNA and protein were determined for the reference NAT1*4 and variant human NAT1 haplotypes possessing single nucleotide polymorphisms (SNPs) in the open reading frame. Although none of the SNPs caused a significant effect on steady state levels of NAT1-specific mRNA, C97T(R33stop), C190T(R64W), C559T (R187stop) and A752T(D251V) each reduced NAT1 protein level and/or N- and O-acetyltransferase catalytic activities to levels below detection. G560A(R187Q) substantially reduced NAT1 protein level and catalytic activities and increased substrate Km. The G445A(V149I), G459A(synonymous) and T640G(S214A) haplotype present in NAT1*11 significantly (p<0.05) increased NAT1 protein level and catalytic activity. Neither T21G(synonymous), T402C(synonymous), A613G(M205V), T777C(synonymous), G781A(E261K), or A787G(I263V) significantly affected Km, catalytic activity, mRNA or protein level. These results suggest heterogeneity among slow NAT1 acetylator phenotypes. PMID:17909564

  13. Development of a cost-efficient novel method for rapid, concurrent genotyping of five common single nucleotide polymorphisms of the brain derived neurotrophic factor (BDNF) gene by tetra-primer amplification refractory mutation system.

    PubMed

    Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M

    2015-09-01

    Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  14. Genomic paradigms for food-borne enteric pathogen analysis at the USFDA: case studies highlighting method utility, integration and resolution.

    PubMed

    Elkins, C A; Kotewicz, M L; Jackson, S A; Lacher, D W; Abu-Ali, G S; Patel, I R

    2013-01-01

    Modern risk control and food safety practices involving food-borne bacterial pathogens are benefiting from new genomic technologies for rapid, yet highly specific, strain characterisations. Within the United States Food and Drug Administration (USFDA) Center for Food Safety and Applied Nutrition (CFSAN), optical genome mapping and DNA microarray genotyping have been used for several years to quickly assess genomic architecture and gene content, respectively, for outbreak strain subtyping and to enhance retrospective trace-back analyses. The application and relative utility of each method varies with outbreak scenario and the suspect pathogen, with comparative analytical power enhanced by database scale and depth. Integration of these two technologies allows high-resolution scrutiny of the genomic landscapes of enteric food-borne pathogens with notable examples including Shiga toxin-producing Escherichia coli (STEC) and Salmonella enterica serovars from a variety of food commodities. Moreover, the recent application of whole genome sequencing technologies to food-borne pathogen outbreaks and surveillance has enhanced resolution to the single nucleotide scale. This new wealth of sequence data will support more refined next-generation custom microarray designs, targeted re-sequencing and "genomic signature recognition" approaches involving a combination of genes and single nucleotide polymorphism detection to distil strain-specific fingerprinting to a minimised scale. This paper examines the utility of microarrays and optical mapping in analysing outbreaks, reviews best practices and the limits of these technologies for pathogen differentiation, and it considers future integration with whole genome sequencing efforts.

  15. Identification of single nucleotide polymorphisms in hematopoietic cell transplant patients affecting early recognition of, and response to, endotoxin.

    PubMed

    Guinan, Eva C; Palmer, Christine D; Mancuso, Christy J; Brennan, Lisa; Stoler-Barak, Liat; Kalish, Leslie A; Suter, Eugenie E; Gallington, Leighanne C; Huhtelin, David P; Mansilla, Maria; Schumann, Ralf R; Murray, Jeffrey C; Weiss, Jerrold; Levy, Ofer

    2014-10-01

    Hematopoietic cell transplant (HCT) is a life-saving therapy for many malignant and non-malignant bone marrow diseases. Associated morbidities are often due to transplant-related toxicities and infections, exacerbated by regimen-induced immune suppression and systemic incursion of bacterial products. Patients undergoing myeloablative conditioning for HCT become endotoxemic and display blood/plasma changes consistent with lipopolysaccharide (LPS)-induced systemic innate immune activation. Herein, we addressed whether patients scheduled for HCT display differences in recognition/response to LPS ex vivo traceable to specific single nucleotide polymorphisms (SNPs). Two SNPs of LPS binding protein (LBP) were associated with changes in plasma LBP levels, with one LBP SNP also associating with differences in efficiency of extraction and transfer of endotoxin to myeloid differentiation factor-2 (MD-2), a step needed for activation of TLR4. None of the examined SNPs of CD14, bactericidal/permeability-increasing protein (BPI), TLR4 or MD-2 were associated with corresponding protein plasma levels or endotoxin delivery to MD-2, but CD14 and BPI SNPs significantly associated with differences in LPS-induced TNF-α release ex vivo and infection frequency, respectively. These findings suggest that specific LBP, CD14 and BPI SNPs might be contributory assessments in studies where clinical outcome may be affected by host response to endotoxin and bacterial infection. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  16. Nano-enabled bioanalytical approaches to ultrasensitive detection of low abundance single nucleotide polymorphisms

    PubMed Central

    Lapitan Jr., Lorico D. S.; Guo, Yuan

    2015-01-01

    Single nucleotide polymorphisms (SNPs) constitute the most common types of genetic variations in the human genome. A number of SNPs have been linked to the development of life threatening diseases including cancer, cardiovascular diseases and neurodegenerative diseases. The ability for ultrasensitive and accurate detection of low abundant disease-related SNPs in bodily fluids (e.g. blood, serum, etc.) holds a significant value in the development of non-invasive future biodiagnostic tools. Over the past two decades, nanomaterials have been utilized in a myriad of biosensing applications due to their ability of detecting extremely low quantities of biologically important biomarkers with high sensitivity and accuracy. Of particular interest is the application of such technologies in the detection of SNPs. The use of various nanomaterials, coupled with different powerful signal amplification strategies, has paved the way for a new generation of ultrasensitive SNP biodiagnostic assays. Over the past few years, several ultrasensitive SNP biosensors capable of detecting specific targets down to the ultra-low regimes (ca. aM and below) and therefore holding great promises for early clinical diagnosis of diseases have been developed. This mini review will highlight some of the most recent, significant advances in nanomaterial-based ultrasensitive SNP sensing technologies capable of detecting specific targets on the attomolar (10–18 M) regime or below. In particular, the design of novel, powerful signal amplification strategies that hold the key to the ultrasensitivity is highlighted. PMID:25785914

  17. Development of a simple and practical method of discrimination between Vibrio furnissii and V. fluvialis based on single-nucleotide polymorphisms of 16S rRNA genes observed in V. furnissii but not in V. fluvialis.

    PubMed

    Takajo, Ichiro; Yamada, Akiteru; Umeki, Kazumi; Saeki, Yuji; Hashikura, Yuuki; Yamamoto, Ikuo; Umekita, Kunihiko; Urayama-Kawano, Midori; Yamasaki, Shogo; Taniguchi, Takako; Misawa, Naoaki; Okayama, Akihiko

    2018-01-01

    Vibrio furnissii and V. fluvialis are closely related, the discrimination of which by conventional biochemical assay remains a challenge. Investigation of the sequence of the 16S rRNA genes in a clinical isolate of V. furnissii by visual inspection of a sequencing electropherogram revealed two sites of single-nucleotide polymorphisms (SNPs; positions 460 A/G and 1261 A/G) in these genes. A test of 12 strains each of V. fluvialis and V. furnissii revealed these SNPs to be common in V. furnissii but not in V. fluvialis. Divergence of SNP frequency was observed among the strains of V. furnissii tested. Because the SNPs described in V. furnissii produce a difference in the target sequence of restriction enzymes, a combination of polymerase chain reaction (PCR) of the 16S rRNA genes using conventional primers and restriction fragment length polymorphism analysis using Eco RV and Eae I was shown to discriminate between V. fluvialis and V. furnissii. This method is simple and alleviates the need for expensive equipment or primer sets specific to these bacteria. Therefore, we believe that this method can be useful, alongside specific PCR and mass spectrometry, when there is a need to discriminate between V. fluvialis and V. furnissii. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

    PubMed

    Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

    2015-02-07

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.

  19. A single mutation in Taiwanese H6N1 influenza hemagglutinin switches binding to human-type receptors.

    PubMed

    de Vries, Robert P; Tzarum, Netanel; Peng, Wenjie; Thompson, Andrew J; Ambepitiya Wickramasinghe, Iresha N; de la Pena, Alba T Torrents; van Breemen, Marielle J; Bouwman, Kim M; Zhu, Xueyong; McBride, Ryan; Yu, Wenli; Sanders, Rogier W; Verheije, Monique H; Wilson, Ian A; Paulson, James C

    2017-09-01

    In June 2013, the first case of human infection with an avian H6N1 virus was reported in a Taiwanese woman. Although this was a single non-fatal case, the virus continues to circulate in Taiwanese poultry. As with any emerging avian virus that infects humans, there is concern that acquisition of human-type receptor specificity could enable transmission in the human population. Despite mutations in the receptor-binding pocket of the human H6N1 isolate, it has retained avian-type (NeuAcα2-3Gal) receptor specificity. However, we show here that a single nucleotide substitution, resulting in a change from Gly to Asp at position 225 (G225D), completely switches specificity to human-type (NeuAcα2-6Gal) receptors. Significantly, G225D H6 loses binding to chicken trachea epithelium and is now able to bind to human tracheal tissue. Structural analysis reveals that Asp225 directly interacts with the penultimate Gal of the human-type receptor, stabilizing human receptor binding. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  20. Nucleotide-binding oligomerization domain containing 1 (NOD1) haplotypes and single nucleotide polymorphisms modify susceptibility to inflammatory bowel diseases in a New Zealand caucasian population: a case-control study

    PubMed Central

    Huebner, Claudia; Ferguson, Lynnette R; Han, Dug Yeo; Philpott, Martin; Barclay, Murray L; Gearry, Richard B; McCulloch, Alan; Demmers, Pieter S; Browning, Brian L

    2009-01-01

    Background The nucleotide-binding oligomerization domain containing 1 (NOD1) gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of NOD1 single nucleotide polymorphisms (SNPs) on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line. Findings DNA samples from 388 Crohn's disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in NOD1, using the MassARRAY® iPLEX Gold assay. Transcriptional activation of the protein produced by NOD1 (Nod1) was studied after infection of Caco2 cells with Escherichia coli LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50–0.88, p < 0.002) but not UC. There was an increased frequency of the three SNP (rs2075818, rs2075822, rs2907748) haplotype, CTG (p = 0.004) and a decreased frequency of the GTG haplotype (p = 0.02).in CD. The rs2075822 CT or TT genotypes were at an increased frequency (genotype p value = 0.02), while the rs2907748 AA or AG genotypes showed decreased frequencies in UC (p = 0.04), but not in CD. Functional assays showed that Nod1 is produced 6 hours after bacterial invasion of the Caco2 cell line. Conclusion The NOD1 gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population. PMID:19327158

  1. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

    PubMed Central

    2012-01-01

    Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

  2. Analysis of in vivo correction of defined mismatches in the DNA mismatch repair mutants msh2, msh3 and msh6 of Saccharomyces cerevisiae.

    PubMed

    Lühr, B; Scheller, J; Meyer, P; Kramer, W

    1998-02-01

    We have analysed the correction of defined mismatches in wild-type and msh2, msh3, msh6 and msh3 msh6 mutants of Saccharomyces cerevisiae in two different yeast strain backgrounds by transformation with plasmid heteroduplex DNA constructs. Ten different base/base mismatches, two single-nucleotide loops and a 38-nucleotide loop were tested. Repair of all types of mismatches was severely impaired in msh2 and msh3 msh6 mutants. In msh6 mutants, repair efficiency of most base/base mismatches was reduced to a similar extent as in msh3 msh6 double mutants. G/T and A/C mismatches, however, displayed residual repair in msh6 mutants in one strain background, implying a role for Msh3p in recognition of base/base mismatches. Furthermore, the efficiency of repair of base/base mismatches was considerably reduced in msh3 mutants in one strain background, indicating a requirement for MSH3 for fully efficient mismatch correction. Also the efficiency of repair of the 38-nucleotide loop was reduced in msh3 mutants, and to a lesser extent in msh6 mutants. The single-nucleotide loop with an unpaired A was less efficiently repaired in msh3 mutants and that with an unpaired T was less efficiently corrected in msh6 mutants, indicating non-redundant functions for the two proteins in the recognition of single-nucleotide loops.

  3. Demonstration of Protein-Based Human Identification Using the Hair Shaft Proteome

    PubMed Central

    Leppert, Tami; Anex, Deon S.; Hilmer, Jonathan K.; Matsunami, Nori; Baird, Lisa; Stevens, Jeffery; Parsawar, Krishna; Durbin-Johnson, Blythe P.; Rocke, David M.; Nelson, Chad; Fairbanks, Daniel J.; Wilson, Andrew S.; Rice, Robert H.; Woodward, Scott R.; Bothner, Brian; Hart, Bradley R.; Leppert, Mark

    2016-01-01

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 single nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). This study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts. PMID:27603779

  4. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    PubMed

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  5. Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe.

    PubMed

    Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L

    2015-11-01

    Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. Copyright © 2015 by the Genetics Society of America.

  6. Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe

    PubMed Central

    Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R.; McQueen, Philip G.; Yang, Andrew X.; Mizuguchi, Takeshi; Grewal, Shiv I. S.; Levin, Henry L.

    2015-01-01

    Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and −9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. PMID:26358720

  7. High-Throughput Genotyping of Single Nucleotide Polymorphisms in the Plasmodium falciparum dhfr Gene by Asymmetric PCR and Melt-Curve Analysis▿

    PubMed Central

    Cruz, Rochelle E.; Shokoples, Sandra E.; Manage, Dammika P.; Yanow, Stephanie K.

    2010-01-01

    Mutations within the Plasmodium falciparum dihydrofolate reductase gene (Pfdhfr) contribute to resistance to antimalarials such as sulfadoxine-pyrimethamine (SP). Of particular importance are the single nucleotide polymorphisms (SNPs) within codons 51, 59, 108, and 164 in the Pfdhfr gene that are associated with SP treatment failure. Given that traditional genotyping methods are time-consuming and laborious, we developed an assay that provides the rapid, high-throughput analysis of parasite DNA isolated from clinical samples. This assay is based on asymmetric real-time PCR and melt-curve analysis (MCA) performed on the LightCycler platform. Unlabeled probes specific to each SNP are included in the reaction mixture and hybridize differentially to the mutant and wild-type sequences within the amplicon, generating distinct melting curves. Since the probe is present throughout PCR and MCA, the assay proceeds seamlessly with no further addition of reagents. This assay was validated for analytical sensitivity and specificity using plasmids, purified genomic DNA from reference strains, and parasite cultures. For all four SNPs, correct genotypes were identified with 100 copies of the template. The performance of the assay was evaluated with a blind panel of clinical isolates from travelers with low-level parasitemia. The concordance between our assay and DNA sequencing ranged from 84 to 100% depending on the SNP. We also directly compared our MCA assay to a published TaqMan real-time PCR assay and identified major issues with the specificity of the TaqMan probes. Our assay provides a number of technical improvements that facilitate the high-throughput screening of patient samples to identify SP-resistant malaria. PMID:20631115

  8. What can time-frequency and phase coherence measures tell us about the genetic basis of P3 amplitude?

    PubMed Central

    McGue, Matt; Iacono, William G.

    2017-01-01

    In a recent comprehensive investigation, we largely failed to identify significant genetic markers associated with P3 amplitude or to corroborate previous associations between P3 and specific single nucleotide polymorphisms (SNPs) or genes. In the present study we extended this line of investigation to examine time-frequency (TF) activity and intertrial phase coherence (ITPC) in the P3 time window, both of which are associated with P3 amplitude. Previous genome-wide research has reported associations between P3-related theta and delta activity and individual genetic variants. A large, population-based sample of 4211 subjects, comprising male and female adolescent twins and their parents, was genotyped for 527,828 single nucleotide polymorphisms (SNPs), from which over six million SNPs were accurately imputed. Heritability estimates were greater for TF energy than ITPC, whether based on biometric models or the combined influence of all measured SNPs (derived from genome-wide complex trait analysis). The magnitude of overlap in the specific SNPs associated with delta energy and ITPC and P3 amplitude was significant. A genome-wide analysis of all SNPs, accompanied by an analysis of approximately 17,600 genes, indicated a region of chromosome 2 around TEKT4 that was significantly associated with theta ITPC. Analysis of candidate SNPs and genes previously reported to be associated with P3 or related phenotypes yielded one association surviving correction for multiple tests: between theta energy and CRHR1. However, we did not obtain significant associations for SNPs implicated in previous genome-wide studies of TF measures. Identifying specific genetic variants associated with P3 amplitude remains a challenge. PMID:27871913

  9. SNPchiMp v.3: integrating and standardizing single nucleotide polymorphism data for livestock species.

    PubMed

    Nicolazzi, Ezequiel L; Caprera, Andrea; Nazzicari, Nelson; Cozzi, Paolo; Strozzi, Francesco; Lawley, Cindy; Pirani, Ali; Soans, Chandrasen; Brew, Fiona; Jorjani, Hossein; Evans, Gary; Simpson, Barry; Tosser-Klopp, Gwenola; Brauning, Rudiger; Williams, John L; Stella, Alessandra

    2015-04-10

    In recent years, the use of genomic information in livestock species for genetic improvement, association studies and many other fields has become routine. In order to accommodate different market requirements in terms of genotyping cost, manufacturers of single nucleotide polymorphism (SNP) arrays, private companies and international consortia have developed a large number of arrays with different content and different SNP density. The number of currently available SNP arrays differs among species: ranging from one for goats to more than ten for cattle, and the number of arrays available is increasing rapidly. However, there is limited or no effort to standardize and integrate array- specific (e.g. SNP IDs, allele coding) and species-specific (i.e. past and current assemblies) SNP information. Here we present SNPchiMp v.3, a solution to these issues for the six major livestock species (cow, pig, horse, sheep, goat and chicken). Original data was collected directly from SNP array producers and specific international genome consortia, and stored in a MySQL database. The database was then linked to an open-access web tool and to public databases. SNPchiMp v.3 ensures fast access to the database (retrieving within/across SNP array data) and the possibility of annotating SNP array data in a user-friendly fashion. This platform allows easy integration and standardization, and it is aimed at both industry and research. It also enables users to easily link the information available from the array producer with data in public databases, without the need of additional bioinformatics tools or pipelines. In recognition of the open-access use of Ensembl resources, SNPchiMp v.3 was officially credited as an Ensembl E!mpowered tool. Availability at http://bioinformatics.tecnoparco.org/SNPchimp.

  10. Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

    PubMed Central

    Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

    1982-01-01

    We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

  11. Neutralizing antibodies against West Nile virus identified directly from human B cells by single-cell analysis and next generation sequencing

    PubMed Central

    Tsioris, Konstantinos; Gupta, Namita T.; Ogunniyi, Adebola O.; Zimnisky, Ross M.; Qian, Feng; Yao, Yi; Wang, Xiaomei; Stern, Joel N. H.; Chari, Raj; Briggs, Adrian W.; Clouser, Christopher R.; Vigneault, Francois; Church, George M.; Garcia, Melissa N.; Murray, Kristy O.; Montgomery, Ruth R.; Kleinstein, Steven H.; Love, J. Christopher

    2015-01-01

    West Nile virus infection (WNV) is an emerging mosquito-borne disease that can lead to severe neurological illness and currently has no available treatment or vaccine. Using microengraving, an integrated single-cell analysis method, we analyzed a cohort of subjects infected with WNV - recently infected and post-convalescent subjects - and efficiently identified four novel WNV neutralizing antibodies. We also assessed the humoral response to WNV on a single-cell and repertoire level by integrating next generation sequencing (NGS) into our analysis. The results from single-cell analysis indicate persistence of WNV-specific memory B cells and antibody-secreting cells in post-convalescent subjects. These cells exhibited class-switched antibody isotypes. Furthermore, the results suggest that the antibody response itself does not predict the clinical severity of the disease (asymptomatic or symptomatic). Using the nucleotide coding sequences for WNV-specific antibodies derived from single cells, we revealed the ontogeny of expanded WNV-specific clones in the repertoires of recently infected subjects through NGS and bioinformatic analysis. This analysis also indicated that the humoral response to WNV did not depend on an anamnestic response, due to an unlikely previous exposure to the virus. The innovative and integrative approach presented here to analyze the evolution of neutralizing antibodies from natural infection on a single-cell and repertoire level can also be applied to vaccine studies, and could potentially aid the development of therapeutic antibodies and our basic understanding of other infectious diseases. PMID:26481611

  12. Neutralizing antibodies against West Nile virus identified directly from human B cells by single-cell analysis and next generation sequencing.

    PubMed

    Tsioris, Konstantinos; Gupta, Namita T; Ogunniyi, Adebola O; Zimnisky, Ross M; Qian, Feng; Yao, Yi; Wang, Xiaomei; Stern, Joel N H; Chari, Raj; Briggs, Adrian W; Clouser, Christopher R; Vigneault, Francois; Church, George M; Garcia, Melissa N; Murray, Kristy O; Montgomery, Ruth R; Kleinstein, Steven H; Love, J Christopher

    2015-12-01

    West Nile virus (WNV) infection is an emerging mosquito-borne disease that can lead to severe neurological illness and currently has no available treatment or vaccine. Using microengraving, an integrated single-cell analysis method, we analyzed a cohort of subjects infected with WNV - recently infected and post-convalescent subjects - and efficiently identified four novel WNV neutralizing antibodies. We also assessed the humoral response to WNV on a single-cell and repertoire level by integrating next generation sequencing (NGS) into our analysis. The results from single-cell analysis indicate persistence of WNV-specific memory B cells and antibody-secreting cells in post-convalescent subjects. These cells exhibited class-switched antibody isotypes. Furthermore, the results suggest that the antibody response itself does not predict the clinical severity of the disease (asymptomatic or symptomatic). Using the nucleotide coding sequences for WNV-specific antibodies derived from single cells, we revealed the ontogeny of expanded WNV-specific clones in the repertoires of recently infected subjects through NGS and bioinformatic analysis. This analysis also indicated that the humoral response to WNV did not depend on an anamnestic response, due to an unlikely previous exposure to the virus. The innovative and integrative approach presented here to analyze the evolution of neutralizing antibodies from natural infection on a single-cell and repertoire level can also be applied to vaccine studies, and could potentially aid the development of therapeutic antibodies and our basic understanding of other infectious diseases.

  13. Generalization of Associations of Kidney-Related Genetic Loci to American Indians

    PubMed Central

    Haack, Karin; Almasy, Laura; Laston, Sandra; Lee, Elisa T.; Best, Lyle G.; Fabsitz, Richard R.; MacCluer, Jean W.; Howard, Barbara V.; Umans, Jason G.; Cole, Shelley A.

    2014-01-01

    Summary Background and objectives CKD disproportionally affects American Indians, who similar to other populations, show genetic susceptibility to kidney outcomes. Recent studies have identified several loci associated with kidney traits, but their relevance in American Indians is unknown. Design, setting, participants, & measurements This study used data from a large, family-based genetic study of American Indians (the Strong Heart Family Study), which includes 94 multigenerational families enrolled from communities located in Oklahoma, the Dakotas, and Arizona. Individuals were recruited from the Strong Heart Study, a population-based study of cardiovascular disease in American Indians. This study selected 25 single nucleotide polymorphisms in 23 loci identified from recently published kidney-related genome-wide association studies in individuals of European ancestry to evaluate their associations with kidney function (estimated GFR; individuals 18 years or older, up to 3282 individuals) and albuminuria (urinary albumin to creatinine ratio; n=3552) in the Strong Heart Family Study. This study also examined the association of single nucleotide polymorphisms in the APOL1 region with estimated GFR in 1121 Strong Heart Family Study participants. GFR was estimated using the abbreviated Modification of Diet in Renal Disease Equation. Additive genetic models adjusted for age and sex were used. Results This study identified significant associations of single nucleotide polymorphisms with estimated GFR in or nearby PRKAG2, SLC6A13, UBE2Q2, PIP5K1B, and WDR72 (P<2.1 × 10-3 to account for multiple testing). Single nucleotide polymorphisms in these loci explained 2.2% of the estimated GFR total variance and 2.9% of its heritability. An intronic variant of BCAS3 was significantly associated with urinary albumin to creatinine ratio. APOL1 single nucleotide polymorphisms were not associated with estimated GFR in a single variant test or haplotype analyses, and the at-risk variants identified in individuals with African ancestry were not detected in DNA sequencing of American Indians. Conclusion This study extends the genetic associations of loci affecting kidney function to American Indians, a population at high risk of kidney disease, and provides additional support for a potential biologic relevance of these loci across ancestries. PMID:24311711

  14. Repeat associated mechanisms of genome evolution and function revealed by the Mus caroli and Mus pahari genomes

    PubMed Central

    Thybert, David; Roller, Maša; Navarro, Fábio C.P.; Fiddes, Ian; Streeter, Ian; Feig, Christine; Martin-Galvez, David; Kolmogorov, Mikhail; Janoušek, Václav; Akanni, Wasiu; Aken, Bronwen; Aldridge, Sarah; Chakrapani, Varshith; Chow, William; Clarke, Laura; Cummins, Carla; Doran, Anthony; Dunn, Matthew; Goodstadt, Leo; Howe, Kerstin; Howell, Matthew; Josselin, Ambre-Aurore; Karn, Robert C.; Laukaitis, Christina M.; Jingtao, Lilue; Martin, Fergal; Muffato, Matthieu; Nachtweide, Stefanie; Quail, Michael A.; Sisu, Cristina; Stanke, Mario; Stefflova, Klara; Van Oosterhout, Cock; Veyrunes, Frederic; Ward, Ben; Yang, Fengtang; Yazdanifar, Golbahar; Zadissa, Amonida; Adams, David J.; Brazma, Alvis; Gerstein, Mark; Paten, Benedict; Pham, Son; Keane, Thomas M.; Odom, Duncan T.; Flicek, Paul

    2018-01-01

    Understanding the mechanisms driving lineage-specific evolution in both primates and rodents has been hindered by the lack of sister clades with a similar phylogenetic structure having high-quality genome assemblies. Here, we have created chromosome-level assemblies of the Mus caroli and Mus pahari genomes. Together with the Mus musculus and Rattus norvegicus genomes, this set of rodent genomes is similar in divergence times to the Hominidae (human-chimpanzee-gorilla-orangutan). By comparing the evolutionary dynamics between the Muridae and Hominidae, we identified punctate events of chromosome reshuffling that shaped the ancestral karyotype of Mus musculus and Mus caroli between 3 and 6 million yr ago, but that are absent in the Hominidae. Hominidae show between four- and sevenfold lower rates of nucleotide change and feature turnover in both neutral and functional sequences, suggesting an underlying coherence to the Muridae acceleration. Our system of matched, high-quality genome assemblies revealed how specific classes of repeats can play lineage-specific roles in related species. Recent LINE activity has remodeled protein-coding loci to a greater extent across the Muridae than the Hominidae, with functional consequences at the species level such as reproductive isolation. Furthermore, we charted a Muridae-specific retrotransposon expansion at unprecedented resolution, revealing how a single nucleotide mutation transformed a specific SINE element into an active CTCF binding site carrier specifically in Mus caroli, which resulted in thousands of novel, species-specific CTCF binding sites. Our results show that the comparison of matched phylogenetic sets of genomes will be an increasingly powerful strategy for understanding mammalian biology. PMID:29563166

  15. Assessing host-specificity of Escherichia coli using a supervised learning logic-regression-based analysis of single nucleotide polymorphisms in intergenic regions.

    PubMed

    Zhi, Shuai; Li, Qiaozhi; Yasui, Yutaka; Edge, Thomas; Topp, Edward; Neumann, Norman F

    2015-11-01

    Host specificity in E. coli is widely debated. Herein, we used supervised learning logic-regression-based analysis of intergenic DNA sequence variability in E. coli in an attempt to identify single nucleotide polymorphism (SNP) biomarkers of E. coli that are associated with natural selection and evolution toward host specificity. Seven-hundred and eighty strains of E. coli were isolated from 15 different animal hosts. We utilized logic regression for analyzing DNA sequence data of three intergenic regions (flanked by the genes uspC-flhDC, csgBAC-csgDEFG, and asnS-ompF) to identify genetic biomarkers that could potentially discriminate E. coli based on host sources. Across 15 different animal hosts, logic regression successfully discriminated E. coli based on animal host source with relatively high specificity (i.e., among the samples of the non-target animal host, the proportion that correctly did not have the host-specific marker pattern) and sensitivity (i.e., among the samples from a given animal host, the proportion that correctly had the host-specific marker pattern), even after fivefold cross validation. Permutation tests confirmed that for most animals, host specific intergenic biomarkers identified by logic regression in E. coli were significantly associated with animal host source. The highest level of biomarker sensitivity was observed in deer isolates, with 82% of all deer E. coli isolates displaying a unique SNP pattern that was 98% specific to deer. Fifty-three percent of human isolates displayed a unique biomarker pattern that was 98% specific to humans. Twenty-nine percent of cattle isolates displayed a unique biomarker that was 97% specific to cattle. Interestingly, even within a related host group (i.e., Family: Canidae [domestic dogs and coyotes]), highly specific SNP biomarkers (98% and 99% specificity for dog and coyotes, respectively) were observed, with 21% of dog E. coli isolates displaying a unique dog biomarker and 61% of coyote isolates displaying a unique coyote biomarker. Application of a supervised learning method, such as logic regression, to DNA sequence analysis at certain intergenic regions demonstrates that some E. coli strains may evolve to become host-specific. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Genetics Home Reference: TK2-related mitochondrial DNA depletion syndrome, myopathic form

    MedlinePlus

    ... mtDNA. Specifically, this enzyme plays a role in recycling mtDNA building blocks (nucleotides) so that errors in ... kinase 2. A decrease in enzyme activity impairs recycling of mtDNA nucleotides, causing a shortage of nucleotides ...

  17. Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

    PubMed

    Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2009-06-01

    The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

  18. Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

    PubMed

    Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

    2014-12-01

    Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Copy Number Variation across European Populations

    PubMed Central

    Chen, Wanting; Hayward, Caroline; Wright, Alan F.; Hicks, Andrew A.; Vitart, Veronique; Knott, Sara; Wild, Sarah H.; Pramstaller, Peter P.; Wilson, James F.; Rudan, Igor; Porteous, David J.

    2011-01-01

    Genome analysis provides a powerful approach to test for evidence of genetic variation within and between geographical regions and local populations. Copy number variants which comprise insertions, deletions and duplications of genomic sequence provide one such convenient and informative source. Here, we investigate copy number variants from genome wide scans of single nucleotide polymorphisms in three European population isolates, the island of Vis in Croatia, the islands of Orkney in Scotland and the South Tyrol in Italy. We show that whereas the overall copy number variant frequencies are similar between populations, their distribution is highly specific to the population of origin, a finding which is supported by evidence for increased kinship correlation for specific copy number variants within populations. PMID:21829696

  20. Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

    PubMed Central

    Khan, A S

    1984-01-01

    The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

  1. Characteristics of allelic gene expression in human brain cells from single-cell RNA-seq data analysis.

    PubMed

    Zhao, Dejian; Lin, Mingyan; Pedrosa, Erika; Lachman, Herbert M; Zheng, Deyou

    2017-11-10

    Monoallelic expression of autosomal genes has been implicated in human psychiatric disorders. However, there is a paucity of allelic expression studies in human brain cells at the single cell and genome wide levels. In this report, we reanalyzed a previously published single-cell RNA-seq dataset from several postmortem human brains and observed pervasive monoallelic expression in individual cells, largely in a random manner. Examining single nucleotide variants with a predicted functional disruption, we found that the "damaged" alleles were overall expressed in fewer brain cells than their counterparts, and at a lower level in cells where their expression was detected. We also identified many brain cell type-specific monoallelically expressed genes. Interestingly, many of these cell type-specific monoallelically expressed genes were enriched for functions important for those brain cell types. In addition, function analysis showed that genes displaying monoallelic expression and correlated expression across neuronal cells from different individual brains were implicated in the regulation of synaptic function. Our findings suggest that monoallelic gene expression is prevalent in human brain cells, which may play a role in generating cellular identity and neuronal diversity and thus increasing the complexity and diversity of brain cell functions.

  2. Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

    PubMed

    Seal, B S; Neill, J D; Ridpath, J F

    1994-07-01

    Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

  3. SNPGenie: estimating evolutionary parameters to detect natural selection using pooled next-generation sequencing data.

    PubMed

    Nelson, Chase W; Moncla, Louise H; Hughes, Austin L

    2015-11-15

    New applications of next-generation sequencing technologies use pools of DNA from multiple individuals to estimate population genetic parameters. However, no publicly available tools exist to analyse single-nucleotide polymorphism (SNP) calling results directly for evolutionary parameters important in detecting natural selection, including nucleotide diversity and gene diversity. We have developed SNPGenie to fill this gap. The user submits a FASTA reference sequence(s), a Gene Transfer Format (.GTF) file with CDS information and a SNP report(s) in an increasing selection of formats. The program estimates nucleotide diversity, distance from the reference and gene diversity. Sites are flagged for multiple overlapping reading frames, and are categorized by polymorphism type: nonsynonymous, synonymous, or ambiguous. The results allow single nucleotide, single codon, sliding window, whole gene and whole genome/population analyses that aid in the detection of positive and purifying natural selection in the source population. SNPGenie version 1.2 is a Perl program with no additional dependencies. It is free, open-source, and available for download at https://github.com/hugheslab/snpgenie. nelsoncw@email.sc.edu or austin@biol.sc.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases

    PubMed Central

    Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten

    2013-01-01

    Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002

  5. Formation of template-switching artifacts by linear amplification.

    PubMed

    Chakravarti, Dhrubajyoti; Mailander, Paula C

    2008-07-01

    Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

  6. [The study of complex-formation of DNA with the antimicrobial drug decamethoxine].

    PubMed

    Sorokin, V A; Blagoĭ, Iu P; Valeev, V A; Gladchenko, G O; Sukhodub, L F; Volianskiĭ, Iu L

    1990-01-01

    The interaction of effective antibacterial drug decametoxyn with natural DNA was studied by UV-spectroscopy. Decametoxyn shows a specificity to nucleotides: it decreases the cooperativity of melting and the thermal stability of DNA parts enriched by AT pairs. The characteristics of the helix-coil transition on the DNA parts enriched by GC-pairs are invariable. Interaction with AT-pairs results in their partial or complete melting at room temperature, followed by intermolecule aggregation. Interacting with phosphates decametoxyn manifests itself not as a dication but as two single-charged ions.

  7. Single Nucleotide Polymorphisms (SNP)-specific Quantitative Real Time Polymerase Chain Reaction (PCR) Assay for Analyzing Competition and Emergence of the Military Hypersporulating Strains of Bacillus Atrophaeous var. Globigii

    DTIC Science & Technology

    2012-09-01

    Emergence of the Military Hypersporulating Strains of Bacillus Atrophaeous var. Globigii by Doncho V. Zhelev, Christopher Dupuis , Suelynn Ren, Anna...Globigii Doncho V. Zhelev, Christopher Dupuis , Suelynn Ren, Anna Le, and Mia Hunt Sensors and Electron Devices Directorate, ARL Henry Gibbons...Zhelev, Christopher Dupuis , Suelynn Ren, Anna Le, Mia Hunt, and Henry Gibbons 5d. PROJECT NUMBER EC-SE-2011-05 5e. TASK NUMBER 5f. WORK UNIT

  8. Design and Validation of CRISPR/Cas9 Systems for Targeted Gene Modification in Induced Pluripotent Stem Cells.

    PubMed

    Lee, Ciaran M; Zhu, Haibao; Davis, Timothy H; Deshmukh, Harshahardhan; Bao, Gang

    2017-01-01

    The CRISPR/Cas9 system is a powerful tool for precision genome editing. The ability to accurately modify genomic DNA in situ with single nucleotide precision opens up new possibilities for not only basic research but also biotechnology applications and clinical translation. In this chapter, we outline the procedures for design, screening, and validation of CRISPR/Cas9 systems for targeted modification of coding sequences in the human genome and how to perform genome editing in induced pluripotent stem cells with high efficiency and specificity.

  9. A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

    PubMed Central

    Urschitz, Johann; Sultan, Omar; Ward, Kenneth

    2011-01-01

    Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

  10. Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

    PubMed

    Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

    2016-11-18

    Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

  11. Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

    PubMed

    Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

    2007-09-01

    HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

  12. Electron attachment to DNA single strands: gas phase and aqueous solution

    PubMed Central

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F.

    2007-01-01

    The 2′-deoxyguanosine-3′,5′-diphosphate, 2′-deoxyadenosine-3′,5′-diphosphate, 2′-deoxycytidine-3′,5′-diphosphate and 2′-deoxythymidine-3′,5′-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3′,5′-dTDP (0.17 eV) and 3′,5′-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3′,5′-dTDP > 3′,5′-dCDP > 3′,5′-dGDP > 3′,5′-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3′-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3′-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3′,5′-dADP− (0.26 eV) and 3′,5′-dGDP− (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage. PMID:17660189

  13. Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

    PubMed

    Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

    2013-02-01

    Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

  14. Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

    PubMed

    Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

    2009-10-01

    A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

  15. Genetic and epigenetic variation in the lineage specification of regulatory T cells

    PubMed Central

    Arvey, Aaron; van der Veeken, Joris; Plitas, George; Rich, Stephen S; Concannon, Patrick; Rudensky, Alexander Y

    2015-01-01

    Regulatory T (Treg) cells, which suppress autoimmunity and other inflammatory states, are characterized by a distinct set of genetic elements controlling their gene expression. However, the extent of genetic and associated epigenetic variation in the Treg cell lineage and its possible relation to disease states in humans remain unknown. We explored evolutionary conservation of regulatory elements and natural human inter-individual epigenetic variation in Treg cells to identify the core transcriptional control program of lineage specification. Analysis of single nucleotide polymorphisms in core lineage-specific enhancers revealed disease associations, which were further corroborated by high-resolution genotyping to fine map causal polymorphisms in lineage-specific enhancers. Our findings suggest that a small set of regulatory elements specify the Treg lineage and that genetic variation in Treg cell-specific enhancers may alter Treg cell function contributing to polygenic disease. DOI: http://dx.doi.org/10.7554/eLife.07571.001 PMID:26510014

  16. Associations between single nucleotide polymorphisms in folate uptake and metabolizing genes with blood folate, homocysteine and DNA uracil concentrations

    USDA-ARS?s Scientific Manuscript database

    Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...

  17. Diversity of human copy number variation and multicopy genes.

    PubMed

    Sudmant, Peter H; Kitzman, Jacob O; Antonacci, Francesca; Alkan, Can; Malig, Maika; Tsalenko, Anya; Sampas, Nick; Bruhn, Laurakay; Shendure, Jay; Eichler, Evan E

    2010-10-29

    Copy number variants affect both disease and normal phenotypic variation, but those lying within heavily duplicated, highly identical sequence have been difficult to assay. By analyzing short-read mapping depth for 159 human genomes, we demonstrated accurate estimation of absolute copy number for duplications as small as 1.9 kilobase pairs, ranging from 0 to 48 copies. We identified 4.1 million "singly unique nucleotide" positions informative in distinguishing specific copies and used them to genotype the copy and content of specific paralogs within highly duplicated gene families. These data identify human-specific expansions in genes associated with brain development, reveal extensive population genetic diversity, and detect signatures consistent with gene conversion in the human species. Our approach makes ~1000 genes accessible to genetic studies of disease association.

  18. 3'-End labeling of nucleic acids by a polymerase ribozyme.

    PubMed

    Samanta, Biswajit; Horning, David P; Joyce, Gerald F

    2018-06-13

    A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.

  19. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    PubMed

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily adapted to novel NGS assays. Examples, tutorials, and extensive documentation can be found at https://plastid.readthedocs.io .

  20. Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus.

    PubMed

    Hsin, Wei-Chen; Chang, Chan-Hua; Chang, Chi-You; Peng, Wei-Hao; Chien, Chung-Liang; Chang, Ming-Fu; Chang, Shin C

    2018-05-24

    Middle East respiratory syndrome coronavirus (MERS-CoV) consists of a positive-sense, single-stranded RNA genome and four structural proteins: the spike, envelope, membrane, and nucleocapsid protein. The assembly of the viral genome into virus particles involves viral structural proteins and is believed to be mediated through recognition of specific sequences and RNA structures of the viral genome. A culture system for the production of MERS coronavirus-like particles (MERS VLPs) was determined and established by electron microscopy and the detection of coexpressed viral structural proteins. Using the VLP system, a 258-nucleotide RNA fragment, which spans nucleotides 19,712 to 19,969 of the MERS-CoV genome (designated PS258(19712-19969) ME ), was identified to function as a packaging signal. Assembly of the RNA packaging signal into MERS VLPs is dependent on the viral nucleocapsid protein. In addition, a 45-nucleotide stable stem-loop substructure of the PS258(19712-19969) ME interacted with both the N-terminal domain and the C-terminal domain of the viral nucleocapsid protein. Furthermore, a functional SARS-CoV RNA packaging signal failed to assemble into the MERS VLPs, which indicated virus-specific assembly of the RNA genome. A MERS-oV RNA packaging signal was identified by the detection of GFP expression following an incubation of MERS VLPs carrying the heterologous mRNA GFP-PS258(19712-19969) ME with virus permissive Huh7 cells. The MERS VLP system could help us in understanding virus infection and morphogenesis.

  1. Detecting and Analyzing Genetic Recombination Using RDP4.

    PubMed

    Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

    2017-01-01

    Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

  2. Rapid identification of genes controlling virulence and immunity in malaria parasites

    PubMed Central

    Xangsayarath, Phonepadith; Tang, Jianxia; Yahata, Kazuhide; Zoungrana, Augustin; Mitaka, Hayato; Acharjee, Arita; Datta, Partha P.; Hunt, Paul; Carter, Richard; Kaneko, Osamu; Mustonen, Ville; Pain, Arnab

    2017-01-01

    Identifying the genetic determinants of phenotypes that impact disease severity is of fundamental importance for the design of new interventions against malaria. Here we present a rapid genome-wide approach capable of identifying multiple genetic drivers of medically relevant phenotypes within malaria parasites via a single experiment at single gene or allele resolution. In a proof of principle study, we found that a previously undescribed single nucleotide polymorphism in the binding domain of the erythrocyte binding like protein (EBL) conferred a dramatic change in red blood cell invasion in mutant rodent malaria parasites Plasmodium yoelii. In the same experiment, we implicated merozoite surface protein 1 (MSP1) and other polymorphic proteins, as the major targets of strain-specific immunity. Using allelic replacement, we provide functional validation of the substitution in the EBL gene controlling the growth rate in the blood stages of the parasites. PMID:28704525

  3. High-Performance Multiplex SNP Analysis of Three Hemochromatosis-Related Mutations With Capillary Array Electrophoresis Microplates

    PubMed Central

    Medintz, Igor; Wong, Wendy W.; Berti, Lorenzo; Shiow, Lawrence; Tom, Jennifer; Scherer, James; Sensabaugh, George; Mathies, Richard A.

    2001-01-01

    An assay is described for high-throughput single nucleotide polymorphism (SNP) genotyping on a microfabricated capillary array electrophoresis (CAE) microchip. The assay targets the three common variants at the HFE locus associated with the genetic disease hereditary hemochromatosis (HHC). The assay employs allele-specific PCR (ASPCR) for the C282Y (845g->a), H63D (187c->g), and S65C (193a->t) variants using fluorescently-labeled energy-transfer (ET) allele-specific primers. Using a 96-channel radial CAE microplate, the labeled ASPCR products generated from 96 samples in a reference Caucasian population are simultaneously separated with single-base-pair resolution and genotyped in under 10 min. Detection is accomplished with a laser-excited rotary four-color fluorescence scanner. The allele-specific amplicons are differentiated on the basis of both their size and the color of the label emission. This study is the first demonstration of the combined use of ASPCR with ET primers and microfabricated radial CAE microplates to perform multiplex SNP analyses in a clinically relevant population. PMID:11230165

  4. Elastin: a possible genetic biomarker for more severe ligament injuries in elite soccer. A pilot study

    PubMed Central

    Artells, Rosa; Pruna, Ricard; Dellal, Alexandre; Maffulli, Nicola

    2016-01-01

    Summary Background The study of new genetic biomarkers in genes related to connective tissue repair and regeneration may help to identify individuals with greater predisposition to injury, who may benefit from targeted preventive measures, and those who require longer recovery time following a muscle, ligament or tendon injury. The present study investigated whether single nucleotide polymorphisms of the Elastin gene could be related to MCL injury. Methods 60 top class football players were studied to identify single nucleotide polymorphisms for the Elastin (ELN) gene using Allelic Discrimination analysis. Each player was followed for 7 seasons, and each MCL injury was noted. Results Ligament injury rate, severity and recovery time are related to specific genotypes observed in the elastin gene, especially the ELN-AA (16 MCL) and the ELN-AG (3 MCL). Players with the ELN-GG genotype sustained no MCL injury during the 7 seasons of the study. Conclusions The identification of polymorphisms in the ELN gene may be used as a novel tool to better define an athlete’s genotype, and help to plan training and rehabilitation programmes to prevent or minimize MCL ligament injuries, and optimize the therapeutic and rehabilitation process after soft tissue injuries, and manage the workloads during trainings and matches. PMID:27900291

  5. Genomic Changes Associated with Reproductive and Migratory Ecotypes in Sockeye Salmon (Oncorhynchus nerka)

    PubMed Central

    Veale, Andrew J.

    2017-01-01

    Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. PMID:29045601

  6. Comparative genomics of the mimicry switch in Papilio dardanus.

    PubMed

    Timmermans, Martijn J T N; Baxter, Simon W; Clark, Rebecca; Heckel, David G; Vogel, Heiko; Collins, Steve; Papanicolaou, Alexie; Fukova, Iva; Joron, Mathieu; Thompson, Martin J; Jiggins, Chris D; ffrench-Constant, Richard H; Vogler, Alfried P

    2014-07-22

    The African Mocker Swallowtail, Papilio dardanus, is a textbook example in evolutionary genetics. Classical breeding experiments have shown that wing pattern variation in this polymorphic Batesian mimic is determined by the polyallelic H locus that controls a set of distinct mimetic phenotypes. Using bacterial artificial chromosome (BAC) sequencing, recombination analyses and comparative genomics, we show that H co-segregates with an interval of less than 500 kb that is collinear with two other Lepidoptera genomes and contains 24 genes, including the transcription factor genes engrailed (en) and invected (inv). H is located in a region of conserved gene order, which argues against any role for genomic translocations in the evolution of a hypothesized multi-gene mimicry locus. Natural populations of P. dardanus show significant associations of specific morphs with single nucleotide polymorphisms (SNPs), centred on en. In addition, SNP variation in the H region reveals evidence of non-neutral molecular evolution in the en gene alone. We find evidence for a duplication potentially driving physical constraints on recombination in the lamborni morph. Absence of perfect linkage disequilibrium between different genes in the other morphs suggests that H is limited to nucleotide positions in the regulatory and coding regions of en. Our results therefore support the hypothesis that a single gene underlies wing pattern variation in P. dardanus.

  7. Toll-like receptor cascade and gene polymorphism in host-pathogen interaction in Lyme disease.

    PubMed

    Rahman, Shusmita; Shering, Maria; Ogden, Nicholas H; Lindsay, Robbin; Badawi, Alaa

    2016-01-01

    Lyme disease (LD) risk occurs in North America and Europe where the tick vectors of the causal agent Borrelia burgdorferi sensu lato are found. It is associated with local and systemic manifestations, and has persistent posttreatment health complications in some individuals. The innate immune system likely plays a critical role in both host defense against B. burgdorferi and disease severity. Recognition of B. burgdorferi, activation of the innate immune system, production of proinflammatory cytokines, and modulation of the host adaptive responses are all initiated by Toll-like receptors (TLRs). A number of Borrelia outer-surface proteins (eg, OspA and OspB) are recognized by TLRs. Specifically, TLR1 and TLR2 were identified as the receptors most relevant to LD. Several functional single-nucleotide polymorphisms have been identified in TLR genes, and are associated with varying cytokines types and synthesis levels, altered pathogen recognition, and disruption of the downstream signaling cascade. These single-nucleotide polymorphism-related functional alterations are postulated to be linked to disease development and posttreatment persistent illness. Elucidating the role of TLRs in LD may facilitate a better understanding of disease pathogenesis and can provide an insight into novel therapeutic targets during active disease or postinfection and posttreatment stages.

  8. Toll-like receptor cascade and gene polymorphism in host–pathogen interaction in Lyme disease

    PubMed Central

    Rahman, Shusmita; Shering, Maria; Ogden, Nicholas H; Lindsay, Robbin; Badawi, Alaa

    2016-01-01

    Lyme disease (LD) risk occurs in North America and Europe where the tick vectors of the causal agent Borrelia burgdorferi sensu lato are found. It is associated with local and systemic manifestations, and has persistent posttreatment health complications in some individuals. The innate immune system likely plays a critical role in both host defense against B. burgdorferi and disease severity. Recognition of B. burgdorferi, activation of the innate immune system, production of proinflammatory cytokines, and modulation of the host adaptive responses are all initiated by Toll-like receptors (TLRs). A number of Borrelia outer-surface proteins (eg, OspA and OspB) are recognized by TLRs. Specifically, TLR1 and TLR2 were identified as the receptors most relevant to LD. Several functional single-nucleotide polymorphisms have been identified in TLR genes, and are associated with varying cytokines types and synthesis levels, altered pathogen recognition, and disruption of the downstream signaling cascade. These single-nucleotide polymorphism-related functional alterations are postulated to be linked to disease development and posttreatment persistent illness. Elucidating the role of TLRs in LD may facilitate a better understanding of disease pathogenesis and can provide an insight into novel therapeutic targets during active disease or postinfection and posttreatment stages. PMID:27330321

  9. Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

    PubMed

    Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

    2005-02-01

    Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

  10. A Perfect Match Genomic Landscape Provides a Unified Framework for the Precise Detection of Variation in Natural and Synthetic Haploid Genomes

    PubMed Central

    Palacios-Flores, Kim; García-Sotelo, Jair; Castillo, Alejandra; Uribe, Carina; Aguilar, Luis; Morales, Lucía; Gómez-Romero, Laura; Reyes, José; Garciarubio, Alejandro; Boege, Margareta; Dávila, Guillermo

    2018-01-01

    We present a conceptually simple, sensitive, precise, and essentially nonstatistical solution for the analysis of genome variation in haploid organisms. The generation of a Perfect Match Genomic Landscape (PMGL), which computes intergenome identity with single nucleotide resolution, reveals signatures of variation wherever a query genome differs from a reference genome. Such signatures encode the precise location of different types of variants, including single nucleotide variants, deletions, insertions, and amplifications, effectively introducing the concept of a general signature of variation. The precise nature of variants is then resolved through the generation of targeted alignments between specific sets of sequence reads and known regions of the reference genome. Thus, the perfect match logic decouples the identification of the location of variants from the characterization of their nature, providing a unified framework for the detection of genome variation. We assessed the performance of the PMGL strategy via simulation experiments. We determined the variation profiles of natural genomes and of a synthetic chromosome, both in the context of haploid yeast strains. Our approach uncovered variants that have previously escaped detection. Moreover, our strategy is ideally suited for further refining high-quality reference genomes. The source codes for the automated PMGL pipeline have been deposited in a public repository. PMID:29367403

  11. Thermal drift is enough to drive a single microtubule along its axis even in the absence of motor proteins.

    PubMed Central

    Nakata, T; Sato-Yoshitake, R; Okada, Y; Noda, Y; Hirokawa, N

    1993-01-01

    One-dimensional diffusion of microtubules (MTs), a back-and-forth motion of MTs due to thermal diffusion, was reported in dynein motility assay. The interaction between MTs and dynein that allows such motion was implicated in its importance in the force generating cycle of dynein ATPase cycle. However, it was not known whether the phenomenon is special to motor proteins. Here we show two independent examples of one-dimensional diffusion of MTs in the absence of motor proteins. Dynamin, a MT-activated GTPase, causes a nucleotide dependent back-and-forth movement of single MT up to 1 micron along the longitudinal axes, although the MT never showed unidirectional consistent movement. Quantitative analysis of the motion and its nucleotide condition indicates that the motion is due to a thermal driven diffusion, restricted to one dimension, under the weak interaction between MT and dynamin. However, specific protein-protein interaction is not essential for the motion, because similar back-and-forth movement of MT was achieved on coverslips coated with only 0.8% methylcellulose. Both cases demonstrate that thermal diffusion could provide a considerable sliding of MTs only if MTs are restricted on the surface appropriately. Images FIGURE 1 FIGURE 2 FIGURE 3 PMID:7906153

  12. A dynamic sandwich assay on magnetic beads for selective detection of single-nucleotide mutations at room temperature.

    PubMed

    Wang, Junxiu; Xiong, Guoliang; Ma, Liang; Wang, Shihui; Zhou, Xu; Wang, Lei; Xiao, Lehui; Su, Xin; Yu, Changyuan

    2017-08-15

    Single-nucleotide mutation (SNM) has proven to be associated with a variety of human diseases. Development of reliable methods for the detection of SNM is crucial for molecular diagnosis and personalized medicine. The sandwich assays are widely used tools for detecting nucleic acid biomarkers due to their low cost and rapid signaling. However, the poor hybridization specificity of signal probe at room temperature hampers the discrimination of mutant and wild type. Here, we demonstrate a dynamic sandwich assay on magnetic beads for SNM detection based on the transient binding between signal probe and target. By taking the advantage of mismatch sensitive thermodynamics of transient DNA binding, the dynamic sandwich assay exhibits high discrimination factor for mutant with a broad range of salt concentration at room temperature. The beads used in this assay serve as a tool for separation, and might be helpful to enhance SNM selectivity. Flexible design of signal probe and facile magnetic separation allow multiple-mode downstream analysis including colorimetric detection and isothermal amplification. With this method, BRAF mutations in the genomic DNA extracted from cancer cell lines were tested, allowing sensitive detection of SNM at very low abundances (0.1-0.5% mutant/wild type). Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Single nucleotide primer extension (SNuPE) analysis of the G6PD gene in somatic cells and oocytes of a kangaroo (Macropus robustus).

    PubMed

    Watson, D; Jacombs, A S; Loebel, D A; Robinson, E S; Johnston, P G

    2000-06-01

    cDNA sequence analysis of the X-linked glucose-6-phosphate dehydrogenase (G6PD) gene has shown a base difference between two subspecies of the kangaroo, Macropus robustus robustus (wallaroo) and M. r. erubescens (euro). A thymine residue in the wallaroo at position 358 in exon 5 has been replaced by a cytosine residue in the euro, which accounts for the previously reported electrophoretic difference between the two subspecies. This base difference allowed use of the Single Nucleotide Primer Extension (SNuPE) technique to study allele-specific expression of G6PD at the transcriptional level. We began by examining G6PD expression in somatic cells and observed complete paternal X inactivation in all somatic tissues of adult female heterozygotes, whereas we found partial paternal allele activity in cultured fibroblasts, thus confirming previous allozyme electrophoresis studies. In late dictyate oocytes from an adult heterozygote, the assay also detected expression of both the maternal and paternal alleles at the G6PD locus, with the maternal allele showing preferential expression. Thus reactivation of the inactive paternally derived X chromosome occurs during oogenesis in M. robustus, although the exact timing of reactivation remains to be determined.

  14. Effect of functionally significant deiodinase single nucleotide polymorphisms on drinking behavior in alcohol dependence: an exploratory investigation

    PubMed Central

    Lee, MR; Schwandt, ML; Bollinger, JW; Dias, AA; Oot, EN; Goldman, D; Hodgkinson, CA; Leggio, L

    2016-01-01

    Background Abnormalities of the hypothalamic-pituitary-thyroid (HPT) axis have been reported in alcoholism, however, there is no definitive agreement on the specific thyroid abnormalities and their underlying mechanisms in alcohol dependence (AD). The biological activity of thyroid hormones or the availability of T3 is regulated by the three deiodinase enzymes D1, D2 and D3. In the context of alcohol use, functionally significant single nucleotide polymorphisms (SNP’s) of these deiodinase genes may play a role in HPT dysfunction. Methods The present study explored the effect of three functionally significant SNP’s (D1: rs2235544, D2: rs225014 and rs12885300) of deiodinase genes on drinking behavior and thyroid stimulating hormone (TSH) levels in alcohol dependent (N=521) and control subjects (N=228). Results Rs225014 was associated with significant differences in the amount of naturalistic alcohol drinking assessed by the Timeline Follow-Back (TLFB). Alcohol-dependent subjects had significantly higher thyroid stimulating hormone levels compared to controls; however, there was no effect of genotype on TSH levels for either group. Conclusions These findings extend previous studies on thyroid dysfunction in alcoholism and provide novel, albeit preliminary, information by linking functionally significant genetic polymorphisms of the deiodinase enzymes with alcohol drinking behavior. PMID:26207529

  15. Detection of single-nucleotide polymorphisms using an ON-OFF switching of regenerated biosensor based on a locked nucleic acid-integrated and toehold-mediated strand displacement reaction.

    PubMed

    Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing

    2014-03-04

    Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.

  16. Implication of common and disease specific variants in CLU, CR1, and PICALM.

    PubMed

    Ferrari, Raffaele; Moreno, Jorge H; Minhajuddin, Abu T; O'Bryant, Sid E; Reisch, Joan S; Barber, Robert C; Momeni, Parastoo

    2012-08-01

    Two recent genome-wide association studies (GWAS) for late onset Alzheimer's disease (LOAD) revealed 3 new genes: clusterin (CLU), phosphatidylinositol binding clathrin assembly protein (PICALM), and complement receptor 1 (CR1). In order to evaluate association with these genome-wide association study-identified genes and to isolate the variants contributing to the pathogenesis of LOAD, we genotyped the top single nucleotide polymorphisms (SNPs), rs11136000 (CLU), rs3818361 (CR1), and rs3851179 (PICALM), and sequenced the entire coding regions of these genes in our cohort of 342 LOAD patients and 277 control subjects. We confirmed the association of rs3851179 (PICALM) (p = 7.4 × 10(-3)) with the disease status. Through sequencing we identified 18 variants in CLU, 3 of which were found exclusively in patients; 8 variants (out of 65) in CR1 gene were only found in patients and the 16 variants identified in PICALM gene were present in both patients and controls. In silico analysis of the variants in PICALM did not predict any damaging effect on the protein. The haplotype analysis of the variants in each gene predicted a common haplotype when the 3 single nucleotide polymorphisms rs11136000 (CLU), rs3818361 (CR1), and rs3851179 (PICALM), respectively, were included. For each gene the haplotype structure and size differed between patients and controls. In conclusion, we confirmed association of CLU, CR1, and PICALM genes with the disease status in our cohort through identification of a number of disease-specific variants among patients through the sequencing of the coding region of these genes. Published by Elsevier Inc.

  17. Homo sapiens-Specific Binding Site Variants within Brain Exclusive Enhancers Are Subject to Accelerated Divergence across Human Population.

    PubMed

    Zehra, Rabail; Abbasi, Amir Ali

    2018-03-01

    Empirical assessments of human accelerated noncoding DNA frgaments have delineated presence of many cis-regulatory elements. Enhancers make up an important category of such accelerated cis-regulatory elements that efficiently control the spatiotemporal expression of many developmental genes. Establishing plausible reasons for accelerated enhancer sequence divergence in Homo sapiens has been termed significant in various previously published studies. This acceleration by including closely related primates and archaic human data has the potential to open up evolutionary avenues for deducing present-day brain structure. This study relied on empirically confirmed brain exclusive enhancers to avoid any misjudgments about their regulatory status and categorized among them a subset of enhancers with an exceptionally accelerated rate of lineage specific divergence in humans. In this assorted set, 13 distinct transcription factor binding sites were located that possessed unique existence in humans. Three of 13 such sites belonging to transcription factors SOX2, RUNX1/3, and FOS/JUND possessed single nucleotide variants that made them unique to H. sapiens upon comparisons with Neandertal and Denisovan orthologous sequences. These variants modifying the binding sites in modern human lineage were further substantiated as single nucleotide polymorphisms via exploiting 1000 Genomes Project Phase3 data. Long range haplotype based tests laid out evidence of positive selection to be governing in African population on two of the modern human motif modifying alleles with strongest results for SOX2 binding site. In sum, our study acknowledges acceleration in noncoding regulatory landscape of the genome and highlights functional parts within it to have undergone accelerated divergence in present-day human population.

  18. Role of a GAG Hinge in the Nucleotide-induced Conformational Change Governing Nucleotide Specificity by T7 DNA Polymerase*

    PubMed Central

    Jin, Zhinan; Johnson, Kenneth A.

    2011-01-01

    A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches. PMID:20978284

  19. Extension of the COG and arCOG databases by amino acid and nucleotide sequences

    PubMed Central

    Meereis, Florian; Kaufmann, Michael

    2008-01-01

    Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

  20. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    PubMed

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  1. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    PubMed Central

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  2. Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

    PubMed Central

    Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

    1999-01-01

    We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

  3. Molecular Characterization of Bombyx mori Cytoplasmic Polyhedrosis Virus Genome Segment 4

    PubMed Central

    Ikeda, Keiko; Nagaoka, Sumiharu; Winkler, Stefan; Kotani, Kumiko; Yagi, Hiroaki; Nakanishi, Kae; Miyajima, Shigetoshi; Kobayashi, Jun; Mori, Hajime

    2001-01-01

    The complete nucleotide sequence of the genome segment 4 (S4) of Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) was determined. The 3,259-nucleotide sequence contains a single long open reading frame which spans nucleotides 14 to 3187 and which is predicted to encode a protein with a molecular mass of about 130 kDa. Western blot analysis showed that S4 encodes BmCPV protein VP3, which is one of the outer components of the BmCPV virion. Sequence analysis of the deduced amino acid sequence of BmCPV VP3 revealed possible sequence homology with proteins from rice ragged stunt virus (RRSV) S2, Nilaparvata lugens reovirus S4, and Fiji disease fijivirus S4. This may suggest that plant reoviruses originated from insect viruses and that RRSV emerged more recently than other plant reoviruses. A chimeric protein consisting of BmCPV VP3 and green fluorescent protein (GFP) was constructed and expressed with BmCPV polyhedrin using a baculovirus expression vector. The VP3-GFP chimera was incorporated into BmCPV polyhedra and released under alkaline conditions. The results indicate that specific interactions occur between BmCPV polyhedrin and VP3 which might facilitate BmCPV virion occlusion into the polyhedra. PMID:11134312

  4. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  5. Obesity-Related Genomic Loci Are Associated with Type 2 Diabetes in a Han Chinese Population

    PubMed Central

    Zhao, Qi; He, Jiang; Chen, Li; Zhao, Zhigang; Li, Qiang; Ge, Jiapu; Chen, Gang; Guo, Xiaohui; Lu, Juming; Weng, Jianping; Jia, Weiping; Ji, Linong; Xiao, Jianzhong; Shan, Zhongyan; Liu, Jie; Tian, Haoming; Ji, Qiuhe; Zhu, Dalong; Zhou, Zhiguang; Shan, Guangliang; Yang, Wenying

    2014-01-01

    Background and Aims Obesity is a well-known risk factor for type 2 diabetes. Genome-wide association studies have identified a number of genetic loci associated with obesity. The aim of this study is to examine the contribution of obesity-related genomic loci to type 2 diabetes in a Chinese population. Methods We successfully genotyped 18 obesity-related single nucleotide polymorphisms among 5338 type 2 diabetic patients and 4663 controls. Both individual and joint effects of these single nucleotide polymorphisms on type 2 diabetes and quantitative glycemic traits (assessing β-cell function and insulin resistance) were analyzed using logistic and linear regression models, respectively. Results Two single nucleotide polymorphisms near MC4R and GNPDA2 genes were significantly associated with type 2 diabetes before adjusting for body mass index and waist circumference (OR (95% CI) = 1.14 (1.06, 1.22) for the A allele of rs12970134, P = 4.75×10−4; OR (95% CI) = 1.10 (1.03, 1.17) for the G allele of rs10938397, P = 4.54×10−3). When body mass index and waist circumference were further adjusted, the association of MC4R with type 2 diabetes remained significant (P = 1.81×10−2) and that of GNPDA2 was attenuated (P = 1.26×10−1), suggesting the effect of the locus including GNPDA2 on type 2 diabetes may be mediated through obesity. Single nucleotide polymorphism rs2260000 within BAT2 was significantly associated with type 2 diabetes after adjusting for body mass index and waist circumference (P = 1.04×10−2). In addition, four single nucleotide polymorphisms (near or within SEC16B, BDNF, MAF and PRL genes) showed significant associations with quantitative glycemic traits in controls even after adjusting for body mass index and waist circumference (all P values<0.05). Conclusions This study indicates that obesity-related genomic loci were associated with type 2 diabetes and glycemic traits in the Han Chinese population. PMID:25093408

  6. SRD5A1 and SRD5A2 are associated with treatment for benign prostatic hyperplasia with the combination of 5α-reductase inhibitors and α-adrenergic receptor antagonists.

    PubMed

    Gu, Xin; Na, Rong; Huang, Tao; Wang, Li; Tao, Sha; Tian, Lu; Chen, Zhuo; Jiao, Yang; Kang, Jian; Zheng, Siqun; Xu, Jianfeng; Sun, Jielin; Qi, Jun

    2013-08-01

    Common treatments for benign prostatic hyperplasia include 5α-reductase inhibitors and α-adrenergic receptor antagonists. However, these treatments can only partially decrease the risk of benign prostatic hyperplasia progression. SRD5A1 and SRD5A2 are 5α-reductase inhibitor targets. We investigated the association between drug efficacy and single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a Chinese population. We genotyped 11 tagging single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a total of 426 benign prostatic hyperplasia cases and 1,008 controls from Xinhua Hospital, Shanghai, People's Republic of China. Cases were treated with type II 5α-reductase inhibitors and α-adrenergic receptor antagonists. We tested the association of tagging single nucleotide polymorphisms with benign prostatic hyperplasia risk/progression, clinical characteristics at baseline, including the I-PSS (International Prostate Symptom Score) and total prostate volume, and changes in clinical characteristics after treatment. The 11 tagging single nucleotide polymorphisms were not significantly associated with benign prostatic hyperplasia risk or progression (each p >0.05). In the SRD5A1 gene rs6884552 and rs3797177 were significantly associated with baseline I-PSS (p = 0.04 and 0.003, respectively). In the SRD5A2 gene rs523349 (V89L) and rs9332975 were significantly associated with baseline total prostate volume (p = 0.01 and 0.001, respectively). In SRD5A1 rs166050 was significantly associated with the posttreatment change in total prostate volume (p = 0.04). In SRD5A2 rs523349 and rs612224 were significantly associated with the posttreatment I-PSS change (p = 0.03 and 0.009, respectively). SRD5A1 and SRD5A2 single nucleotide polymorphisms are significantly associated with the clinical characteristics of benign prostatic hyperplasia and the efficacy of benign prostatic hyperplasia treatment. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  7. Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3.

    PubMed

    Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H

    2006-04-01

    We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.

  8. Kinetic gating mechanism of DNA damage recognition by Rad4/XPC

    NASA Astrophysics Data System (ADS)

    Chen, Xuejing; Velmurugu, Yogambigai; Zheng, Guanqun; Park, Beomseok; Shim, Yoonjung; Kim, Youngchang; Liu, Lili; van Houten, Bennett; He, Chuan; Ansari, Anjum; Min, Jung-Hyun

    2015-01-01

    The xeroderma pigmentosum C (XPC) complex initiates nucleotide excision repair by recognizing DNA lesions before recruiting downstream factors. How XPC detects structurally diverse lesions embedded within normal DNA is unknown. Here we present a crystal structure that captures the yeast XPC orthologue (Rad4) on a single register of undamaged DNA. The structure shows that a disulphide-tethered Rad4 flips out normal nucleotides and adopts a conformation similar to that seen with damaged DNA. Contrary to many DNA repair enzymes that can directly reject non-target sites as structural misfits, our results suggest that Rad4/XPC uses a kinetic gating mechanism whereby lesion selectivity arises from the kinetic competition between DNA opening and the residence time of Rad4/XPC per site. This mechanism is further supported by measurements of Rad4-induced lesion-opening times using temperature-jump perturbation spectroscopy. Kinetic gating may be a general mechanism used by site-specific DNA-binding proteins to minimize time-consuming interrogations of non-target sites.

  9. Kinetic gating mechanism of DNA damage recognition by Rad4/XPC

    DOE PAGES

    Chen, Xuejing; Velmurugu, Yogambigai; Zheng, Guanqun; ...

    2015-01-06

    The xeroderma pigmentosum C (XPC) complex initiates nucleotide excision repair by recognizing DNA lesions before recruiting downstream factors. How XPC detects structurally diverse lesions embedded within normal DNA is unknown. Here we present a crystal structure that captures the yeast XPC orthologue (Rad4) on a single register of undamaged DNA. The structure shows that a disulphide-tethered Rad4 flips out normal nucleotides and adopts a conformation similar to that seen with damaged DNA. Contrary to many DNA repair enzymes that can directly reject non-target sites as structural misfits, our results suggest that Rad4/XPC uses a kinetic gating mechanism whereby lesion selectivitymore » arises from the kinetic competition between DNA opening and the residence time of Rad4/XPC per site. This mechanism is further supported by measurements of Rad4-induced lesion-opening times using temperature-jump perturbation spectroscopy. Lastly, kinetic gating may be a general mechanism used by site-specific DNA-binding proteins to minimize time-consuming interrogations of non-target sites.« less

  10. A rapid, ratiometric, enzyme-free, and sensitive single-step miRNA detection using three-way junction based FRET probes

    NASA Astrophysics Data System (ADS)

    Luo, Qingying; Liu, Lin; Yang, Cai; Yuan, Jing; Feng, Hongtao; Chen, Yan; Zhao, Peng; Yu, Zhiqiang; Jin, Zongwen

    2018-03-01

    MicroRNAs (miRNAs) are single stranded endogenous molecules composed of only 18-24 nucleotides which are critical for gene expression regulating the translation of messenger RNAs. Conventional methods based on enzyme-assisted nucleic acid amplification techniques have many problems, such as easy contamination, high cost, susceptibility to false amplification, and tendency to have sequence mismatches. Here we report a rapid, ratiometric, enzyme-free, sensitive, and highly selective single-step miRNA detection using three-way junction assembled (or self-assembled) FRET probes. The developed strategy can be operated within the linear range from subnanomolar to hundred nanomolar concentrations of miRNAs. In comparison with the traditional approaches, our method showed high sensitivity for the miRNA detection and extreme selectivity for the efficient discrimination of single-base mismatches. The results reveal that the strategy paved a new avenue for the design of novel highly specific probes applicable in diagnostics and potentially in microscopic imaging of miRNAs in real biological environments.

  11. Clonal architecture of secondary acute myeloid leukemia defined by single-cell sequencing.

    PubMed

    Hughes, Andrew E O; Magrini, Vincent; Demeter, Ryan; Miller, Christopher A; Fulton, Robert; Fulton, Lucinda L; Eades, William C; Elliott, Kevin; Heath, Sharon; Westervelt, Peter; Ding, Li; Conrad, Donald F; White, Brian S; Shao, Jin; Link, Daniel C; DiPersio, John F; Mardis, Elaine R; Wilson, Richard K; Ley, Timothy J; Walter, Matthew J; Graubert, Timothy A

    2014-07-01

    Next-generation sequencing has been used to infer the clonality of heterogeneous tumor samples. These analyses yield specific predictions-the population frequency of individual clones, their genetic composition, and their evolutionary relationships-which we set out to test by sequencing individual cells from three subjects diagnosed with secondary acute myeloid leukemia, each of whom had been previously characterized by whole genome sequencing of unfractionated tumor samples. Single-cell mutation profiling strongly supported the clonal architecture implied by the analysis of bulk material. In addition, it resolved the clonal assignment of single nucleotide variants that had been initially ambiguous and identified areas of previously unappreciated complexity. Accordingly, we find that many of the key assumptions underlying the analysis of tumor clonality by deep sequencing of unfractionated material are valid. Furthermore, we illustrate a single-cell sequencing strategy for interrogating the clonal relationships among known variants that is cost-effective, scalable, and adaptable to the analysis of both hematopoietic and solid tumors, or any heterogeneous population of cells.

  12. 17q25 Locus Is Associated With White Matter Hyperintensity Volume in Ischemic Stroke, But Not With Lacunar Stroke Status

    PubMed Central

    Adib-Samii, Poneh; Rost, Natalia; Traylor, Matthew; Devan, William; Biffi, Alessandro; Lanfranconi, Silvia; Fitzpatrick, Kaitlin; Bevan, Steve; Kanakis, Allison; Valant, Valerie; Gschwendtner, Andreas; Malik, Rainer; Richie, Alexa; Gamble, Dale; Segal, Helen; Parati, Eugenio A.; Ciusani, Emilio; Holliday, Elizabeth G.; Maguire, Jane; Wardlaw, Joanna; Worrall, Bradford; Bis, Joshua; Wiggins, Kerri L.; Longstreth, Will; Kittner, Steve J.; Cheng, Yu-Ching; Mosley, Thomas; Falcone, Guido J.; Furie, Karen L.; Leiva-Salinas, Carlos; Lau, Benison C.; Khan, Muhammed Saleem; Sharma, Pankaj; Fornage, Myriam; Mitchell, Braxton D.; Psaty, Bruce M.; Sudlow, Cathie; Levi, Christopher; Boncoraglio, Giorgio B.; Rothwell, Peter M.; Meschia, James; Dichgans, Martin; Rosand, Jonathan; Markus, Hugh S.

    2013-01-01

    Background and Purpose Recently, a novel locus at 17q25 was associated with white matter hyperintensities (WMH) on MRI in stroke-free individuals. We aimed to replicate the association with WMH volume (WMHV) in patients with ischemic stroke. If the association acts by promoting a small vessel arteriopathy, it might be expected to also associate with lacunar stroke. Methods We quantified WMH on MRI in the stroke-free hemisphere of 2588 ischemic stroke cases. Association between WMHV and 6 single-nucleotide polymorphisms at chromosome 17q25 was assessed by linear regression. These single-nucleotide polymorphisms were also investigated for association with lacunar stroke in 1854 cases and 51 939 stroke-free controls from METASTROKE. Meta-analyses with previous reports and a genetic risk score approach were applied to identify other novel WMHV risk variants and uncover shared genetic contributions to WMHV in community participants without stroke and ischemic stroke. Results Single-nucleotide polymorphisms at 17q25 were associated with WMHV in ischemic stroke, the most significant being rs9894383 (P=0.0006). In contrast, there was no association between any single-nucleotide polymorphism and lacunar stroke. A genetic risk score analysis revealed further genetic components to WMHV shared between community participants without stroke and ischemic stroke. Conclusions This study provides support for an association between the 17q25 locus and WMH. In contrast, it is not associated with lacunar stroke, suggesting that the association does not act by promoting small-vessel arteriopathy or the same arteriopathy responsible for lacunar infarction. PMID:23674528

  13. Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

    PubMed Central

    Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

    2015-01-01

    Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

  14. Repeat associated mechanisms of genome evolution and function revealed by the Mus caroli and Mus pahari genomes.

    PubMed

    Thybert, David; Roller, Maša; Navarro, Fábio C P; Fiddes, Ian; Streeter, Ian; Feig, Christine; Martin-Galvez, David; Kolmogorov, Mikhail; Janoušek, Václav; Akanni, Wasiu; Aken, Bronwen; Aldridge, Sarah; Chakrapani, Varshith; Chow, William; Clarke, Laura; Cummins, Carla; Doran, Anthony; Dunn, Matthew; Goodstadt, Leo; Howe, Kerstin; Howell, Matthew; Josselin, Ambre-Aurore; Karn, Robert C; Laukaitis, Christina M; Jingtao, Lilue; Martin, Fergal; Muffato, Matthieu; Nachtweide, Stefanie; Quail, Michael A; Sisu, Cristina; Stanke, Mario; Stefflova, Klara; Van Oosterhout, Cock; Veyrunes, Frederic; Ward, Ben; Yang, Fengtang; Yazdanifar, Golbahar; Zadissa, Amonida; Adams, David J; Brazma, Alvis; Gerstein, Mark; Paten, Benedict; Pham, Son; Keane, Thomas M; Odom, Duncan T; Flicek, Paul

    2018-04-01

    Understanding the mechanisms driving lineage-specific evolution in both primates and rodents has been hindered by the lack of sister clades with a similar phylogenetic structure having high-quality genome assemblies. Here, we have created chromosome-level assemblies of the Mus caroli and Mus pahari genomes. Together with the Mus musculus and Rattus norvegicus genomes, this set of rodent genomes is similar in divergence times to the Hominidae (human-chimpanzee-gorilla-orangutan). By comparing the evolutionary dynamics between the Muridae and Hominidae, we identified punctate events of chromosome reshuffling that shaped the ancestral karyotype of Mus musculus and Mus caroli between 3 and 6 million yr ago, but that are absent in the Hominidae. Hominidae show between four- and sevenfold lower rates of nucleotide change and feature turnover in both neutral and functional sequences, suggesting an underlying coherence to the Muridae acceleration. Our system of matched, high-quality genome assemblies revealed how specific classes of repeats can play lineage-specific roles in related species. Recent LINE activity has remodeled protein-coding loci to a greater extent across the Muridae than the Hominidae, with functional consequences at the species level such as reproductive isolation. Furthermore, we charted a Muridae-specific retrotransposon expansion at unprecedented resolution, revealing how a single nucleotide mutation transformed a specific SINE element into an active CTCF binding site carrier specifically in Mus caroli , which resulted in thousands of novel, species-specific CTCF binding sites. Our results show that the comparison of matched phylogenetic sets of genomes will be an increasingly powerful strategy for understanding mammalian biology. © 2018 Thybert et al.; Published by Cold Spring Harbor Laboratory Press.

  15. Short double-stranded RNAs with an overhanging 5' ppp-nucleotide, as found in arenavirus genomes, act as RIG-I decoys.

    PubMed

    Marq, Jean-Baptiste; Hausmann, Stéphane; Veillard, Nicolas; Kolakofsky, Daniel; Garcin, Dominique

    2011-02-25

    Arenavirus RNA genomes are initiated by a "prime and realign" mechanism, such that the initiating GTP is found as a single unpaired (overhanging) nucleotide when the complementary genome ends anneal to form double-stranded (ds) RNA panhandle structures. dsRNAs modeled on these structures do not induce interferon (IFN), as opposed to blunt-ended (5' ppp)dsRNA. This study examines whether these viral structures can also act as decoys, by trapping RIG-I in inactive dsRNA complexes. We examined the ability of various dsRNAs to activate the RIG-I ATPase (presumably a measure of helicase translocation on dsRNA) relative to their ability to induce IFN. We found that there is no simple relationship between these two properties, as if RIG-I can translocate on short dsRNAs without inducing IFN. Moreover, we found that (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide can in fact competitively inhibit the ability of blunt-ended (5' ppp)dsRNAs to induce IFN when co-transfected into cells and that this inhibition is strongly dependent on the presence of the 5' ppp. In contrast, (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide does not inhibit poly(I-C)-induced IFN activation, which is independent of the presence of a 5' ppp group.

  16. Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast

    PubMed Central

    Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora

    2006-01-01

    Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318

  17. Mutation-Specific Mechanisms of Hyperactivation of Noonan Syndrome SOS Molecules Detected with Single-molecule Imaging in Living Cells.

    PubMed

    Nakamura, Yuki; Umeki, Nobuhisa; Abe, Mitsuhiro; Sako, Yasushi

    2017-10-26

    Noonan syndrome (NS) is a congenital hereditary disorder associated with developmental and cardiac defects. Some patients with NS carry mutations in SOS, a guanine nucleotide exchange factor (GEF) for the small GTPase RAS. NS mutations have been identified not only in the GEF domain, but also in various domains of SOS, suggesting that multiple mechanisms disrupt SOS function. In this study, we examined three NS mutations in different domains of SOS to clarify the abnormality in its translocation to the plasma membrane, where SOS activates RAS. The association and dissociation kinetics between SOS tagged with a fluorescent protein and the living cell surface were observed in single molecules. All three mutants showed increased affinity for the plasma membrane, inducing excessive RAS signalling. However, the mechanisms by which their affinity was increased were specific to each mutant. Conformational disorder in the resting state, increased probability of a conformational change on the plasma membrane, and an increased association rate constant with the membrane receptor are the suggested mechanisms. These different properties cause the specific phenotypes of the mutants, which should be rescuable with different therapeutic strategies. Therefore, single-molecule kinetic analyses of living cells are useful for the pathological analysis of genetic diseases.

  18. Genome amplification of single sperm using multiple displacement amplification.

    PubMed

    Jiang, Zhengwen; Zhang, Xingqi; Deka, Ranjan; Jin, Li

    2005-06-07

    Sperm typing is an effective way to study recombination rate on a fine scale in regions of interest. There are two strategies for the amplification of single meiotic recombinants: repulsion-phase allele-specific PCR and whole genome amplification (WGA). The former can selectively amplify single recombinant molecules from a batch of sperm but is not scalable for high-throughput operation. Currently, primer extension pre-amplification is the only method used in WGA of single sperm, whereas it has limited capacity to produce high-coverage products enough for the analysis of local recombination rate in multiple large regions. Here, we applied for the first time a recently developed WGA method, multiple displacement amplification (MDA), to amplify single sperm DNA, and demonstrated its great potential for producing high-yield and high-coverage products. In a 50 mul reaction, 76 or 93% of loci can be amplified at least 2500- or 250-fold, respectively, from single sperm DNA, and second-round MDA can further offer >200-fold amplification. The MDA products are usable for a variety of genetic applications, including sequencing and microsatellite marker and single nucleotide polymorphism (SNP) analysis. The use of MDA in single sperm amplification may open a new era for studies on local recombination rates.

  19. Genetics of Oxidative Stress in Obesity

    PubMed Central

    Rupérez, Azahara I.; Gil, Angel; Aguilera, Concepción M.

    2014-01-01

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications. PMID:24562334

  20. Genetics of oxidative stress in obesity.

    PubMed

    Rupérez, Azahara I; Gil, Angel; Aguilera, Concepción M

    2014-02-20

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications.

  1. A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

    PubMed

    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

    2011-06-15

    A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Replacement of RNA hairpins by in vitro selected tetranucleotides.

    PubMed Central

    Dichtl, B; Pan, T; DiRenzo, A B; Uhlenbeck, O C

    1993-01-01

    An in vitro selection method based on the autolytic cleavage of yeast tRNA(Phe) by Pb2+ was applied to obtain tRNA derivatives with the anticodon hairpin replaced by four single-stranded nucleotides. Based on the rates of the site-specific cleavage by Pb2+ and the presence of a specific UV-induced crosslink, certain tetranucleotide sequences allow proper folding of the rest of the tRNA molecule, whereas others do not. One such successful tetramer sequence was also used to replace the acceptor stem of yeast tRNA(Phe) and the anticodon hairpin of E.coli tRNA(Phe) without disrupting folding. These experiments suggest that certain tetramers may be able to replace structurally nonessential hairpins in any RNA. Images PMID:7680121

  3. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    NASA Astrophysics Data System (ADS)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  4. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    PubMed

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  5. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    NASA Astrophysics Data System (ADS)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  6. Nucleotide variation in genes invloved in wood formation in two pine species

    Treesearch

    David Pot; Lisa McMillan; Craig Echt; Gregoire Le Provost; Pauline Garnier-Gere; Sheree Cato; Christophe Plomion

    2005-01-01

    Nucleotide diversity in eight genes related to wood formation was investigated in two pine species, Pinus pinaster and P. radiata. The nucleotide diversity patterns observed and their properties were compared between the two species according to the specific characteristics of the samples analysed. A lower diversity was observed in P. radiata...

  7. Interstrand disulfide crosslinking of DNA bases supports a double nucleotide unpairing mechanism for flap endonucleases.

    PubMed

    Beddows, Amanda; Patel, Nikesh; Finger, L David; Atack, John M; Williams, David M; Grasby, Jane A

    2012-09-14

    Flap endonucleases (FENs) are proposed to select their target phosphate diester by unpairing the two terminal nucleotides of duplex. Interstrand disulfide crosslinks, introduced by oxidation of thiouracil and thioguanine bases, abolished the specificity of human FEN1 for hydrolysis one nucleotide into the 5'-duplex.

  8. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  9. Conformational Smear Characterization and Binning of Single-Molecule Conductance Measurements for Enhanced Molecular Recognition.

    PubMed

    Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-01

    Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.

  10. Translational genomics for abiotic stress in sorghum: transcriptional profiling and validation of SNP markers between germplasm with differential cold tolerance

    USDA-ARS?s Scientific Manuscript database

    One focus of the Sorghum Translational Genomics Lab (part of sorghum CRIS, PSGD, CSRL, USDA-ARS, Lubbock TX) is to utilize nucleotide variation between sorghum germplasm such as those derived from RNA seq for translation and validation of Single Nucleotide Polymorphism (SNP) into easy access DNA m...

  11. A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, G K; Hillier, L; Brandstrom, M

    2005-02-20

    We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

  12. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    PubMed

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  13. Detecting and Removing Ascertainment Bias in Microsatellites from the HGDP-CEPH Panel

    PubMed Central

    Eriksson, Anders; Manica, Andrea

    2011-01-01

    Although ascertainment bias in single nucleotide polymorphisms is a well-known problem, it is generally accepted that microsatellites have mutation rates too high for bias to be a concern. Here, we analyze in detail the large set of microsatellites typed for the Human Genetic Diversity Panel (HGDP)-CEPH panel. We develop a novel framework based on rarefaction to compare heterozygosity across markers with different mutation rates. We find that, whereas di- and tri-nucleotides show similar patterns of within- and between-population heterozygosity, tetra-nucleotides are inconsistent with the other two motifs. In addition, di- and tri-nucleotides are consistent with 16 unbiased tetra-nucleotide markers, whereas the HPGP-CEPH tetra-nucleotides are significantly different. This discrepancy is due to the HGDP-CEPH tetra-nucleotides being too homogeneous across Eurasia, even after their slower mutation rate is taken into account by rarefying the other markers. The most likely explanation for this pattern is ascertainment bias. We strongly advocate the exclusion of tetra-nucleotides from future population genetics analysis of this dataset, and we argue that other microsatellite datasets should be investigated for the presence of bias using the approach outlined in this article. PMID:22384358

  14. Single nucleotide polymorphism detection in aldehyde dehydrogenase 2 (ALDH2) gene using bacterial magnetic particles based on dissociation curve analysis.

    PubMed

    Maruyama, Kohei; Takeyama, Haruko; Nemoto, Etsuo; Tanaka, Tsuyoshi; Yoda, Kiyoshi; Matsunaga, Tadashi

    2004-09-20

    Single nucleotide polymorphism (SNP) detection for aldehyde dehydrogenase 2 (ALDH2) gene based on DNA thermal dissociation curve analysis was successfully demonstrated using an automated system with bacterial magnetic particles (BMPs) by developing a new method for avoiding light scattering caused by nanometer-size particles when using commercially available fluorescent dyes such as FITC, Cy3, and Cy5 as labeling chromophores. Biotin-labeled PCR products in ALDH2, two allele-specific probes (Cy3-labeled detection probe for ALDH2*1 and Cy5-labeled detection probe for ALDH2*2), streptavidin-immobilized BMPs (SA-BMPs) were simultaneously mixed. The mixture was denatured at 70 degrees C for 3 min, cooled slowly to 25 degrees C, and incubated for 10 min, allowing the DNA duplex to form between Cy3- or Cy5-labeled detection probes and biotin-labeled PCR products on SA-BMPs. Then duplex DNA-BMP complex was heated to 58 degrees C, a temperature determined by dissociation curve analysis and a dissociated single-base mismatched detection probe was removed at the same temperature under precise control. Furthermore, fluorescence signal from the detection probe was liberated into the supernatant from completely matched duplex DNA-BMP complex by heating to 80 degrees C and measured. In the homozygote target DNA (ALDH2*1/*1 and ALDH2*2/*2), the fluorescence signals from single-base mismatched were decreased to background level, indicating that mismatched hybridization was efficiently removed by the washing process. In the heterozygote target DNA (ALDH2*1/*2), each fluorescence signals was at a similar level. Therefore, three genotypes of SNP in ALDH2 gene were detected using the automated detection system with BMPs. Copyright 2004 Wiley Periodicals, Inc.

  15. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    PubMed

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  16. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  17. Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

    PubMed Central

    Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

    2014-01-01

    Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

  18. Normal Genetic Variation, Cognition, and Aging

    PubMed Central

    Greenwood, P. M.; Parasuraman, Raja

    2005-01-01

    This article reviews the modulation of cognitive function by normal genetic variation. Although the heritability of “g” is well established, the genes that modulate specific cognitive functions are largely unidentified. Application of the allelic association approach to individual differences in cognition has begun to reveal the effects of single nucleotide polymorphisms on specific and general cognitive functions. This article proposes a framework for relating genotype to cognitive phenotype by considering the effect of genetic variation on the protein product of specific genes within the context of the neural basis of particular cognitive domains. Specificity of effects is considered, from genes controlling part of one receptor type to genes controlling agents of neuronal repair, and evidence is reviewed of cognitive modulation by polymorphisms in dopaminergic and cholinergic receptor genes, dopaminergic enzyme genes, and neurotrophic genes. Although allelic variation in certain genes can be reliably linked to cognition—specifically to components of attention, working memory, and executive function in healthy adults—the specificity, generality, and replicability of the effects are not fully known. PMID:15006290

  19. Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

    PubMed Central

    Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

    2016-01-01

    Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

  20. BEND3 is involved in the human-specific repression of calreticulin: Implication for the evolution of higher brain functions in human.

    PubMed

    Aghajanirefah, A; Nguyen, L N; Ohadi, M

    2016-01-15

    Recent emerging evidence indicates that changes in gene expression levels are linked to human evolution. We have previously reported a human-specific nucleotide in the promoter sequence of the calreticulin (CALR) gene at position -220C, which is the site of action of valproic acid. Reversion of this nucleotide to the ancestral A-allele has been detected in patients with degrees of deficit in higher brain cognitive functions. This mutation has since been reported in the 1000 genomes database at an approximate frequency of <0.0004 in humans (rs138452745). In the study reported here, we present update on the status of rs138452745 across evolution, based on the Ensembl and NCBI databases. The DNA pulldown assay was also used to identify the proteins binding to the C- and A-alleles, using two cell lines, SK-N-BE and HeLa. Consistent with our previous findings, the C-allele is human-specific, and the A-allele is the rule across all other species (N=38). This nucleotide resides in a block of 12-nucleotides that is strictly conserved across evolution. The DNA pulldown experiments revealed that in both SK-N-BE and HeLa cells, the transcription repressor BEN domain containing 3 (BEND3) binds to the human-specific C-allele, whereas the nuclear factor I (NFI) family members, NF1A, B, C, and X, specifically bind to the ancestral A-allele. This binding pattern is consistent with a previously reported decreased promoter activity of the C-allele vs. the A-allele. We propose that there is a link between binding of BEND3 to the CALR rs138452745 C-allele and removal of NFI binding site from this nucleotide, and the evolution of human-specific higher brain functions. To our knowledge, CALR rs138452745 is the first instance of enormous nucleotide conservation across evolution, except in the human species. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  2. [The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

    PubMed

    Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

    2017-11-01

    Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1.92-8.79, P <0.001) in males and 1.73 (95% CI 0.80-3.76, P =0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

  3. CNG and HCN channels: two peas, one pod.

    PubMed

    Craven, Kimberley B; Zagotta, William N

    2006-01-01

    Cyclic nucleotide-activated ion channels play a fundamental role in a variety of physiological processes. By opening in response to intracellular cyclic nucleotides, they translate changes in concentrations of signaling molecules to changes in membrane potential. These channels belong to two families: the cyclic nucleotide-gated (CNG) channels and the hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels. The two families exhibit high sequence similarity and belong to the superfamily of voltage-gated potassium channels. Whereas HCN channels are activated by voltage and CNG channels are virtually voltage independent, both channels are activated by cyclic nucleotide binding. Furthermore, the channels are thought to have similar channel structures, leading to similar mechanisms of activation by cyclic nucleotides. However, although these channels are structurally and behaviorally similar, they have evolved to perform distinct physiological functions. This review describes the physiological roles and biophysical behavior of CNG and HCN channels. We focus on how similarities in structure and activation mechanisms result in common biophysical models, allowing CNG and HCN channels to be viewed as a single genre.

  4. Structure of a eukaryotic cyclic nucleotide-gated channel

    PubMed Central

    Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian

    2018-01-01

    Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415

  5. SNPase-ARMS qPCR: Ultrasensitive Mutation-Based Detection of Cell-Free Tumor DNA in Melanoma Patients

    PubMed Central

    Stadler, Julia; Eder, Johanna; Pratscher, Barbara; Brandt, Sabine; Schneller, Doris; Müllegger, Robert; Vogl, Claus; Trautinger, Franz; Brem, Gottfried; Burgstaller, Joerg P.

    2015-01-01

    Cell-free circulating tumor DNA in the plasma of cancer patients has become a common point of interest as indicator of therapy options and treatment response in clinical cancer research. Especially patient- and tumor-specific single nucleotide variants that accurately distinguish tumor DNA from wild type DNA are promising targets. The reliable detection and quantification of these single-base DNA variants is technically challenging. Currently, a variety of techniques is applied, with no apparent “gold standard”. Here we present a novel qPCR protocol that meets the conditions of extreme sensitivity and specificity that are required for detection and quantification of tumor DNA. By consecutive application of two polymerases, one of them designed for extreme base-specificity, the method reaches unprecedented sensitivity and specificity. Three qPCR assays were tested with spike-in experiments, specific for point mutations BRAF V600E, PTEN T167A and NRAS Q61L of melanoma cell lines. It was possible to detect down to one copy of tumor DNA per reaction (Poisson distribution), at a background of up to 200 000 wild type DNAs. To prove its clinical applicability, the method was successfully tested on a small cohort of BRAF V600E positive melanoma patients. PMID:26562020

  6. Methods to Increase the Sensitivity of High Resolution Melting Single Nucleotide Polymorphism Genotyping in Malaria.

    PubMed

    Daniels, Rachel; Hamilton, Elizabeth J; Durfee, Katelyn; Ndiaye, Daouda; Wirth, Dyann F; Hartl, Daniel L; Volkman, Sarah K

    2015-11-10

    Despite decades of eradication efforts, malaria remains a global burden. Recent renewed interest in regional elimination and global eradication has been accompanied by increased genomic information about Plasmodium parasite species responsible for malaria, including characteristics of geographical populations as well as variations associated with reduced susceptibility to anti-malarial drugs. One common genetic variation, single-nucleotide polymorphisms (SNPs), offers attractive targets for parasite genotyping. These markers are useful not only for tracking drug resistance markers but also for tracking parasite populations using markers not under drug or other selective pressures. SNP genotyping methods offer the ability to track drug resistance as well as to fingerprint individual parasites for population surveillance, particularly in response to malaria control efforts in regions nearing elimination status. While informative SNPs have been identified that are agnostic to specific genotyping technologies, high-resolution melting (HRM) analysis is particularly suited to field-based studies. Compared to standard fluorescent-probe based methods that require individual SNPs in a single labeled probe and offer at best 10% sensitivity to detect SNPs in samples that contain multiple genomes (polygenomic), HRM offers 2-5% sensitivity. Modifications to HRM, such as blocked probes and asymmetric primer concentrations as well as optimization of amplification annealing temperatures to bias PCR towards amplification of the minor allele, further increase the sensitivity of HRM. While the sensitivity improvement depends on the specific assay, we have increased detection sensitivities to less than 1% of the minor allele. In regions approaching malaria eradication, early detection of emerging or imported drug resistance is essential for prompt response. Similarly, the ability to detect polygenomic infections and differentiate imported parasite types from cryptic local reservoirs can inform control programs. This manuscript describes modifications to high resolution melting technology that further increase its sensitivity to identify polygenomic infections in patient samples.

  7. Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).

    PubMed

    Studer, Jacqueline; Bartsch, Christine; Haas, Cordula

    2014-07-01

    Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.

  8. Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.

    PubMed

    Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko

    2017-12-01

    A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  9. Tissue-Specific and Genetic Regulation of Insulin Sensitivity-Associated Transcripts in African Americans

    PubMed Central

    Sharma, Neeraj K.; Sajuthi, Satria P.; Chou, Jeff W.; Calles-Escandon, Jorge; Demons, Jamehl; Rogers, Samantha; Ma, Lijun; Palmer, Nicholette D.; McWilliams, David R.; Beal, John; Comeau, Mary E.; Cherry, Kristina; Hawkins, Gregory A.; Menon, Lata; Kouba, Ethel; Davis, Donna; Burris, Marcie; Byerly, Sara J.; Easter, Linda; Bowden, Donald W.; Freedman, Barry I.; Langefeld, Carl D.

    2016-01-01

    Context: Compared with European Americans, African Americans (AAs) are more insulin resistant, have a higher insulin secretion response to glucose, and develop type 2 diabetes more often. Molecular processes and/or genetic variations contributing to altered glucose homeostasis in high-risk AAs remain uncharacterized. Objective: Adipose and muscle transcript expression profiling and genotyping were performed in 260 AAs to identify genetic regulatory mechanisms associated with insulin sensitivity (SI). We hypothesized that: 1) transcription profiles would reveal tissue-specific modulation of physiologic pathways with SI, and 2) a subset of SI-associated transcripts would be controlled by DNA sequence variants as expression quantitative traits, and these variants in turn would be associated with SI. Design and Settings: The cross-sectional research study was performed in a clinical research unit. Participants: Unrelated nondiabetic AAs were recruited for the study. Main Outcome Measures: SI was measured by frequently sampled iv glucose tolerance test. Results: The expression levels of 2212 transcripts in adipose and 145 transcripts in muscle were associated with SI. Genes involved in eIF2, eIF4-p70S6K, and mTOR signaling were modulated with SI in both tissues. Genes involved in leukocyte extravasation signaling showed adipose-specific regulation, and genes involved in oxidative phosphorylation had discordant regulation between tissues. Intersecting cis-expression quantitative trait loci results with data from transcript-SI association analysis identified cis-regulatory single nucleotide polymorphisms for 363 and 42 SI-associated transcripts in adipose and muscle, respectively. Cis-eSNPs for three SI-associated adipose transcripts, NINJ1, AGA, and CLEC10A were associated with SI. Abrogation of NINJ1 induction in THP1 macrophages modulated expression of genes in chemokine signaling, cell adhesion, and angiogenesis pathways. Conclusion: This study identified multiple pathways associated with SI; particularly discordant tissue-specific regulation of the oxidative phosphorylation pathway, and adipose-specific regulation of transcripts in the leukocyte extravasation signaling pathway that seem to be important in insulin resistance. Identification of single nucleotide polymorphisms associated with SI and with modulation of expression of SI-associated transcripts, including NINJ1, reveals novel genetic regulatory mechanisms of insulin resistance in AAs. PMID:26789776

  10. Catalytic analysis of APOBEC3G involving real-time NMR spectroscopy reveals nucleic acid determinants for deamination.

    PubMed

    Kamba, Keisuke; Nagata, Takashi; Katahira, Masato

    2015-01-01

    APOBEC3G (A3G) is a single-stranded DNA-specific cytidine deaminase that preferentially converts cytidine to uridine at the third position of triplet cytosine (CCC) hotspots. A3G restricts the infectivity of viruses, such as HIV-1, by targeting CCC hotspots scattered through minus DNA strands, reverse-transcribed from genomic RNA. Previously, we developed a real-time NMR method and elucidated the origin of the 3'→5' polarity of deamination of DNA by the C-terminal domain of A3G (CD2), which is a phenomenon by which a hotspot located closer to the 5'-end is deaminated more effectively than one less close to the 5'-end, through quantitative analysis involving nonspecific binding to and sliding along DNA. In the present study we applied the real-time NMR method to analyze the catalytic activity of CD2 toward DNA oligonucleotides containing a nucleotide analog at a single or multiple positions. Analyses revealed the importance of the sugar and base moieties throughout the consecutive 5 nucleotides, the CCC hotspot being positioned at the center. It was also shown that the sugar or base moieties of the nucleotides outside this 5 nucleotide recognition sequence are also relevant as to CD2's activity. Analyses involving DNA oligonucleotides having two CCC hotspots linked by a long sequence of either deoxyribonucleotides, ribonucleotides or abasic deoxyribonucleotides suggested that the phosphate backbone is required for CD2 to slide along the DNA strand and to exert the 3'→5' polarity. Examination of the effects of different salt concentrations on the 3'→5' polarity indicated that the higher the salt concentration, the less prominent the 3'→5' polarity. This is most likely the result of alleviation of sliding due to a decrease in the affinity of CD2 with the phosphate backbone at high salt concentrations. We also investigated the reactivity of substrates containing 5-methylcytidine (5mC) or 5-hydroxymethylcytidine, and found that A3G exhibited low activity toward 5mC.

  11. The waiting time problem in a model hominin population.

    PubMed

    Sanford, John; Brewer, Wesley; Smith, Franzine; Baumgardner, John

    2015-09-17

    Functional information is normally communicated using specific, context-dependent strings of symbolic characters. This is true within the human realm (texts and computer programs), and also within the biological realm (nucleic acids and proteins). In biology, strings of nucleotides encode much of the information within living cells. How do such information-bearing nucleotide strings arise and become established? This paper uses comprehensive numerical simulation to understand what types of nucleotide strings can realistically be established via the mutation/selection process, given a reasonable timeframe. The program Mendel's Accountant realistically simulates the mutation/selection process, and was modified so that a starting string of nucleotides could be specified, and a corresponding target string of nucleotides could be specified. We simulated a classic pre-human hominin population of at least 10,000 individuals, with a generation time of 20 years, and with very strong selection (50% selective elimination). Random point mutations were generated within the starting string. Whenever an instance of the target string arose, all individuals carrying the target string were assigned a specified reproductive advantage. When natural selection had successfully amplified an instance of the target string to the point of fixation, the experiment was halted, and the waiting time statistics were tabulated. Using this methodology we tested the effect of mutation rate, string length, fitness benefit, and population size on waiting time to fixation. Biologically realistic numerical simulations revealed that a population of this type required inordinately long waiting times to establish even the shortest nucleotide strings. To establish a string of two nucleotides required on average 84 million years. To establish a string of five nucleotides required on average 2 billion years. We found that waiting times were reduced by higher mutation rates, stronger fitness benefits, and larger population sizes. However, even using the most generous feasible parameters settings, the waiting time required to establish any specific nucleotide string within this type of population was consistently prohibitive. We show that the waiting time problem is a significant constraint on the macroevolution of the classic hominin population. Routine establishment of specific beneficial strings of two or more nucleotides becomes very problematic.

  12. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  13. The nucleotide sequence and genome organization of Plasmopara halstedii virus.

    PubMed

    Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

    2011-03-17

    Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

  14. Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

    PubMed

    Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T

    2017-02-01

    To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.

  15. In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation

    PubMed Central

    Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F.; Sampson, Juliana K.; Khalid, Haniya; Sheth, Nihar U.; Batalo, Michael; Serrano, Myrna G.; Roberts, Catherine H.; Hess, Michael L.; Buck, Gregory A.; Neale, Michael C.; Manjili, Masoud H.; Toor, Amir Ahmed

    2014-01-01

    Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor–recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential. PMID:25414699

  16. In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation.

    PubMed

    Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F; Sampson, Juliana K; Khalid, Haniya; Sheth, Nihar U; Batalo, Michael; Serrano, Myrna G; Roberts, Catherine H; Hess, Michael L; Buck, Gregory A; Neale, Michael C; Manjili, Masoud H; Toor, Amir Ahmed

    2014-01-01

    Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor-recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential.

  17. Strand-specific Recognition of DNA Damages by XPD Provides Insights into Nucleotide Excision Repair Substrate Versatility*

    PubMed Central

    Buechner, Claudia N.; Heil, Korbinian; Michels, Gudrun; Carell, Thomas; Kisker, Caroline; Tessmer, Ingrid

    2014-01-01

    Recognition and removal of DNA damages is essential for cellular and organismal viability. Nucleotide excision repair (NER) is the sole mechanism in humans for the repair of carcinogenic UV irradiation-induced photoproducts in the DNA, such as cyclobutane pyrimidine dimers. The broad substrate versatility of NER further includes, among others, various bulky DNA adducts. It has been proposed that the 5′-3′ helicase XPD (xeroderma pigmentosum group D) protein plays a decisive role in damage verification. However, despite recent advances such as the identification of a DNA-binding channel and central pore in the protein, through which the DNA is threaded, as well as a dedicated lesion recognition pocket near the pore, the exact process of target site recognition and verification in eukaryotic NER still remained elusive. Our single molecule analysis by atomic force microscopy reveals for the first time that XPD utilizes different recognition strategies to verify structurally diverse lesions. Bulky fluorescein damage is preferentially detected on the translocated strand, whereas the opposite strand preference is observed for a cyclobutane pyrimidine dimer lesion. Both states, however, lead to similar conformational changes in the resulting specific complexes, indicating a merge to a “final” verification state, which may then trigger the recruitment of further NER proteins. PMID:24338567

  18. Analysis of the beak and feather disease viral genome indicates the existence of several genotypes which have a complex psittacine host specificity.

    PubMed

    de Kloet, E; de Kloet, S R

    2004-12-01

    A study was made of the phylogenetic relationships between fifteen complete nucleotide sequences as well as 43 nucleotide sequences of the putative coat protein gene of different strains belonging to the virus species Beak and feather disease virus obtained from 39 individuals of 16 psittacine species. The species included among others, cockatoos ( Cacatuini), African grey parrots ( Psittacus erithacus) and peach-faced lovebirds ( Agapornis roseicollis), which were infected at different geographical locations, within and outside Australia, the native origin of the virus. The derived amino acid sequences of the putative coat protein were highly diverse, with differences between some strains amounting to 50 of the 250 amino acids. Phylogenetic analysis demonstrated that the putative coat gene sequences form six clusters which show a varying degree of psittacine species specificity. Most, but not all strains infecting African grey parrots formed a single cluster as did the strains infecting the cockatoos. Strains infecting the lovebirds clustered with those infecting such Australasian species as Eclectus roratus, Psittacula kramerii and Psephotus haematogaster. Although individual birds included in this study were, where studied, often infected by closely related strains, infection by highly diverged trains was also detected. The possible relationship between BFD viral strains and clinical disease signs is discussed.

  19. Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

    DOE PAGES

    Parker, Glendon J.; Leppert, Tami; Anex, Deon S.; ...

    2016-09-07

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

  20. Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease

    PubMed Central

    Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.

    2016-01-01

    Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047

  1. Refactoring the Genetic Code for Increased Evolvability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pines, Gur; Winkler, James D.; Pines, Assaf

    ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less

  2. Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parker, Glendon J.; Leppert, Tami; Anex, Deon S.

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

  3. Refactoring the Genetic Code for Increased Evolvability

    DOE PAGES

    Pines, Gur; Winkler, James D.; Pines, Assaf; ...

    2017-11-14

    ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less

  4. Transient state kinetics of transcription elongation by T7 RNA polymerase.

    PubMed

    Anand, Vasanti Subramanian; Patel, Smita S

    2006-11-24

    The single subunit DNA-dependent RNA polymerase (RNAP) from bacteriophage T7 catalyzes both promoter-dependent transcription initiation and promoter-independent elongation. Using a promoter-free substrate, we have dissected the kinetic pathway of single nucleotide incorporation during elongation. We show that T7 RNAP undergoes a slow conformational change (0.01-0.03 s(-1)) to form an elongation competent complex with the promoter-free substrate (dissociation constant (Kd) of 96 nM). The complex binds to a correct NTP (Kd of 80 microM) and incorporates the nucleoside monophosphate (NMP) into RNA primer very efficiently (220 s(-1) at 25 degrees C). An overall free energy change (-5.5 kcal/mol) and internal free energy change (-3.7 kcal/mol) of single NMP incorporation was calculated from the measured equilibrium constants. In the presence of inorganic pyrophosphate (PPi), the elongation complex catalyzes the reverse pyrophosphorolysis reaction at a maximum rate of 0.8 s(-1) with PPi Kd of 1.2 mM. Several experiments were designed to investigate the rate-limiting step in the pathway of single nucleotide addition. Acid-quench and pulse-chase kinetics indicated that an isomerization step before chemistry is rate-limiting. The very similar rate constants of sequential incorporation of two nucleotides indicated that the steps after chemistry are fast. Based on available data, we propose that the preinsertion to insertion isomerization of NTP observed in the crystallographic studies of T7 RNAP is a likely candidate for the rate-limiting step. The studies here provide a kinetic framework to investigate structure-function and fidelity of RNA synthesis and to further explore the role of the conformational change in nucleotide selection during RNA synthesis.

  5. T/T homozygosity of the tenascin-C gene polymorphism rs2104772 negatively influences exercise-induced angiogenesis.

    PubMed

    Valdivieso, Paola; Toigo, Marco; Hoppeler, Hans; Flück, Martin

    2017-01-01

    Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise.

  6. Functionalized Anodic Aluminum Oxide Membrane–Electrode System for Enzyme Immobilization

    PubMed Central

    2015-01-01

    A nanoporous membrane system with directed flow carrying reagents to sequentially attached enzymes to mimic nature’s enzyme complex system was demonstrated. Genetically modified glycosylation enzyme, OleD Loki variant, was immobilized onto nanometer-scale electrodes at the pore entrances/exits of anodic aluminum oxide membranes through His6-tag affinity binding. The enzyme activity was assessed in two reactions—a one-step “reverse” sugar nucleotide formation reaction (UDP-Glc) and a two-step sequential sugar nucleotide formation and sugar nucleotide-based glycosylation reaction. For the one-step reaction, enzyme specific activity of 6–20 min–1 on membrane supports was seen to be comparable to solution enzyme specific activity of 10 min–1. UDP-Glc production efficiencies as high as 98% were observed at a flow rate of 0.5 mL/min, at which the substrate residence time over the electrode length down pore entrances was matched to the enzyme activity rate. This flow geometry also prevented an unwanted secondary product hydrolysis reaction, as observed in the test homogeneous solution. Enzyme utilization increased by a factor of 280 compared to test homogeneous conditions due to the continuous flow of fresh substrate over the enzyme. To mimic enzyme complex systems, a two-step sequential reaction using OleD Loki enzyme was performed at membrane pore entrances then exits. After UDP-Glc formation at the entrance electrode, aglycon 4-methylumbelliferone was supplied at the exit face of the reactor, affording overall 80% glycosylation efficiency. The membrane platform showed the ability to be regenerated with purified enzyme as well as directly from expression crude, thus demonstrating a single-step immobilization and purification process. PMID:25025628

  7. Structural insight into the mechanism of substrate specificity and catalytic activity of an HD domain phosphohydrolase: the 5′-deoxyribonucleotidase YfbR from Escherichia coli

    PubMed Central

    Zimmerman, Matthew D.; Proudfoot, Michael; Yakunin, Alexander; Minor, Wladek

    2008-01-01

    Summary HD-domain phosphohydrolases have nucleotidase and phosphodiesterase activities and play important roles in the metabolism of nucleotides and in signaling. We present three 2.1 Å resolution crystal structures (one in the free state and two complexed with natural substrates) of a HD-domain phosphohydrolase, the E. coli 5′-nucleotidase YfbR. The free-state structure of YfbR contains a large cavity accommodating the metal-coordinating HD motif (H33, H68, D69, and D137) and other conserved residues (R18, E72, and D77). Alanine scanning mutagenesis confirms that these residues are important for activity. Two structures of the catalytically inactive mutant E72A complexed with Co2+ and either TMP or dAMP disclose the novel binding mode of deoxyribonucleotides in the active site. Residue R18 stabilizes the phosphate on the Co2+, and residue D77 forms a strong hydrogen bond critical for binding the ribose. The indole side chain of W19 is located close to the 2′-carbon atom of the deoxyribose moiety and is proposed to act as the selectivity switch for deoxyribonucleotide, which is supported by comparison to YfdR, another 5′-nucleotidase in E. coli. The nucleotide bases of both dAMP and TMP make no specific hydrogen bonds with the protein, explaining the lack of nucleotide base selectivity. The YfbR E72A substrate complex structures also suggest a plausible single-step nucleophilic substitution mechanism. This is the first proposed molecular mechanism for a HD-domain phosphohydrolase based directly on substrate-bound crystal structures. PMID:18353368

  8. T/T homozygosity of the tenascin-C gene polymorphism rs2104772 negatively influences exercise-induced angiogenesis

    PubMed Central

    Toigo, Marco; Hoppeler, Hans

    2017-01-01

    Background Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Methods Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Results Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Conclusion Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise. PMID:28384286

  9. The avilamycin resistance determinants AviRa and AviRb methylate 23S rRNA at the guanosine 2535 base and the uridine 2479 ribose.

    PubMed

    Treede, Irina; Jakobsen, Lene; Kirpekar, Finn; Vester, Birte; Weitnauer, Gabriele; Bechthold, Andreas; Douthwaite, Stephen

    2003-07-01

    Avilamycin is an orthosomycin antibiotic that has shown considerable potential for clinical use, although it is presently used as a growth promoter in animal feed. Avilamycin inhibits bacterial protein synthesis by binding to the 50S ribosomal subunit. The ribosomes of the producer strain, Streptomyces viridochromogenes Tü57, are protected from the drug by the action of three resistance factors located in the avilamycin biosynthetic gene cluster. Two of the resistance factors, aviRa and aviRb, encode rRNA methyltransferases that specifically target 23S rRNA. Recombinant AviRa and AviRb proteins retain their activity after purification, and both specifically methylate in vitro transcripts of 23S rRNA domain V. Reverse transcriptase primer extension indicated that AviRa is an N-methyltransferase that targets G2535 within helix 91 of the rRNA, whereas AviRb modified the 2'-O-ribose position of nucleotide U2479 within helix 89. MALDI mass spectrometry confirmed the exact positions of each of these modifications, and additionally established that a single methyl group is added at each nucleotide. Neither of these two nucleotides have previously been described as a target for enzymatic methylation. Molecular models of the 50S subunit crystal structure show that the N-1 of the G2535 base and the 2'-hydroxyl of U2479 are separated by approximately 10 A, a distance that can be spanned by avilamycin. In addition to defining new resistance mechanisms, these data refine our understanding of the probable ribosome contacts made by orthosomycins and of how these antibiotics inhibit protein synthesis.

  10. Candida kantuleensis sp. nov., a d-xylose-fermenting yeast species isolated from peat in a tropical peat swamp forest.

    PubMed

    Nitiyon, Sukanya; Khunnamwong, Pannida; Lertwattanasakul, Noppon; Limtong, Savitree

    2018-05-24

    Three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) representing a single novel anamorphic and d-xylose-fermenting yeast species were obtained from three peat samples collected from Khan Thulee peat swamp forest in Surat Thani province, Thailand. The strains differed from each other by one to two nucleotide substitutions in the sequences of the D1/D2 region of the large subunit (LSU) rRNA gene and zero to one nucleotide substitution in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the three strains represented a single Candida species that was distinct from the other related species in the Lodderomyces/Candida albicans clade. The three strains form a subclade with the other Candida species including Candida sanyaensis, Candida tropicalis and Candida sojae. C. sanyaensis was the most closely related species, with 2.1-2.4 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 3.8-4.0 % nucleotide substitutions in the ITS region. The three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) were assigned as a single novel species, which was named Candida kantuleensis sp. nov. The type strain is DMKU-XE11 T (=CBS 15219 T =TBRC 7764 T ). The MycoBank number for C. kantuleensis sp. nov. is MB 824179.

  11. IL-TIF/IL-22: genomic organization and mapping of the human and mouse genes.

    PubMed

    Dumoutier, L; Van Roost, E; Ameye, G; Michaux, L; Renauld, J C

    2000-12-01

    IL-TIF is a new cytokine originally identified as a gene induced by IL-9 in murine T lymphocytes, and showing 22% amino acid identity with IL-10. Here, we report the sequence and organization of the mouse and human IL-TIF genes, which both consist of 6 exons spreading over approximately 6 Kb. The IL-TIF gene is a single copy gene in humans, and is located on chromosome 12q15, at 90 Kb from the IFN gamma gene, and at 27 Kb from the AK155 gene, which codes for another IL-10-related cytokine. In the mouse, the IL-TIF gene is located on chromosome 10, also in the same region as the IFN gamma gene. Although it is a single copy gene in BALB/c and DBA/2 mice, the IL-TIF gene is duplicated in other strains such as C57Bl/6, FVB and 129. The two copies, which show 98% nucleotide identity in the coding region, were named IL-TIF alpha and IL-TIF beta. Beside single nucleotide variations, they differ by a 658 nucleotide deletion in IL-TIF beta, including the first non-coding exon and 603 nucleotides from the promoter. A DNA fragment corresponding to this deletion was sufficient to confer IL-9-regulated expression of a luciferase reporter plasmid, suggesting that the IL-TIF beta gene is either differentially regulated, or not expressed at all.

  12. SNPitty: An Intuitive Web Application for Interactive B-Allele Frequency and Copy Number Visualization of Next-Generation Sequencing Data.

    PubMed

    van Riet, Job; Krol, Niels M G; Atmodimedjo, Peggy N; Brosens, Erwin; van IJcken, Wilfred F J; Jansen, Maurice P H M; Martens, John W M; Looijenga, Leendert H; Jenster, Guido; Dubbink, Hendrikus J; Dinjens, Winand N M; van de Werken, Harmen J G

    2018-03-01

    Exploration and visualization of next-generation sequencing data are crucial for clinical diagnostics. Software allowing simultaneous visualization of multiple regions of interest coupled with dynamic heuristic filtering of genetic aberrations is, however, lacking. Therefore, the authors developed the web application SNPitty that allows interactive visualization and interrogation of variant call format files by using B-allele frequencies of single-nucleotide polymorphisms and single-nucleotide variants, coverage metrics, and copy numbers analysis results. SNPitty displays variant alleles and allelic imbalances with a focus on loss of heterozygosity and copy number variation using genome-wide heterozygous markers and somatic mutations. In addition, SNPitty is capable of generating predefined reports that summarize and highlight disease-specific targets of interest. SNPitty was validated for diagnostic interpretation of somatic events by showcasing a serial dilution series of glioma tissue. Additionally, SNPitty is demonstrated in four cancer-related scenarios encountered in daily clinical practice and on whole-exome sequencing data of peripheral blood from a Down syndrome patient. SNPitty allows detection of loss of heterozygosity, chromosomal and gene amplifications, homozygous or heterozygous deletions, somatic mutations, or any combination thereof in regions or genes of interest. Furthermore, SNPitty can be used to distinguish molecular relationships between multiple tumors from a single patient. On the basis of these data, the authors demonstrate that SNPitty is robust and user friendly in a wide range of diagnostic scenarios. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  13. Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

    PubMed

    Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

    2006-08-01

    Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

  14. Rapid Genotyping of Single Nucleotide Polymorphisms Influencing Warfarin Drug Response by Surface-Enhanced Laser Desorption and Ionization Time-of-Flight (SELDI-TOF) Mass Spectrometry

    PubMed Central

    Yang, Shangbin; Xu, LiHui; Wu, Haifeng M.

    2010-01-01

    Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy. PMID:20075209

  15. Rapid genotyping of single nucleotide polymorphisms influencing warfarin drug response by surface-enhanced laser desorption and ionization time-of-flight (SELDI-TOF) mass spectrometry.

    PubMed

    Yang, Shangbin; Xu, LiHui; Wu, Haifeng M

    2010-03-01

    Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy.

  16. Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

    PubMed

    Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

    2017-04-01

    Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

  17. The influence of specific neighboring bases on substitution bias in noncoding regions of the plant chloroplast genome.

    PubMed

    Morton, B R; Oberholzer, V M; Clegg, M T

    1997-09-01

    Substitutions occurring in noncoding sequences of the plant chloroplast genome violate the independence of sites that is assumed by substitution models in molecular evolution. The probability that a substitution at a site is a transversion, as opposed to a transition, increases significantly with increasing A + T content of the two adjacent nucleotides. In the present study, this dependency of substitutions on local context is examined further in a number of noncoding regions from the chloroplast genome of members of the grass family (Poaceae). Two features were examined; the influence of specific neighboring bases, as opposed to the general A + T content, on transversion proportion and an influence on substitutions by nucleotides other than the two immediately adjacent to the site of substitution. In both cases, a significant effect was found. In the case of specific nucleotides, transversion proportion is significantly higher at sites with a pyrimidine immediately 5' on either strand. Substitutions at sites of the type YNR, where N is the site of substitution, have the highest rate of transversion. This specific effect is secondary to the A + T content effect such that, in terms of proportion of substitutions that are transversions, the nucleotides are ranked T > A > C > G as to their effect when they are immediately 5' to the site of substitution. In the case of nucleotides other than the immediate neighbors, a significant influence on substitution dynamics is observed in the case where the two neighboring bases are both A and/or T. Thus, substitutions are primarily, but not exclusively, influenced by the composition of the two nucleotides that are immediately adjacent. These results indicate that the pattern of molecular evolution of the plant chloroplast genome is extremely complex as a result of a variety of inter-site dependencies.

  18. Biosynthesis of nucleotide sugars by a promiscuous UDP-sugar pyrophosphorylase from Arabidopsis thaliana (AtUSP).

    PubMed

    Liu, Jun; Zou, Yang; Guan, Wanyi; Zhai, Yafei; Xue, Mengyang; Jin, Lan; Zhao, Xueer; Dong, Junkai; Wang, Wenjun; Shen, Jie; Wang, Peng George; Chen, Min

    2013-07-01

    Nucleotide sugars are activated forms of monosaccharides and key intermediates of carbohydrate metabolism in all organisms. The availability of structurally diverse nucleotide sugars is particularly important for the characterization of glycosyltransferases. Given that limited methods are available for preparation of nucleotide sugars, especially their useful non-natural derivatives, we introduced herein an efficient one-step three-enzyme catalytic system for the synthesis of nucleotide sugars from monosaccharides. In this study, a promiscuous UDP-sugar pyrophosphorylase (USP) from Arabidopsis thaliana (AtUSP) was used with a galactokinase from Streptococcus pneumoniae TIGR4 (SpGalK) and an inorganic pyrophosphatase (PPase) to effectively synthesize four UDP-sugars. AtUSP has better tolerance for C4-derivatives of Gal-1-P compared to UDP-glucose pyrophosphorylase from S. pneumoniae TIGR4 (SpGalU). Besides, the nucleotide substrate specificity and kinetic parameters of AtUSP were systematically studied. AtUSP exhibited considerable activity toward UTP, dUTP and dTTP, the yield of which was 87%, 85% and 84%, respectively. These results provide abundant information for better understanding of the relationship between substrate specificity and structural features of AtUSP. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

    PubMed

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

  20. TFBSshape: a motif database for DNA shape features of transcription factor binding sites

    PubMed Central

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

  1. Use of single-nucleotide polymorphisms (SNPs) to distinguish gene expression subtypes of chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME).

    PubMed

    Shimosako, Nana; Kerr, Jonathan R

    2014-12-01

    We have reported gene expression changes in patients with chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) and the fact that such gene expression data can be used to identify subtypes of CFS/ME with distinct clinical phenotypes. Due to the difficulties in using a comparative gene expression method as an aid to CFS/ME disease and subtype-specific diagnosis, we have attempted to develop such a method based on single-nucleotide polymorphism (SNP) analysis. To identify SNP allele associations with CFS/ME and CFS/ME subtypes, we tested genomic DNA of patients with CFS/ME (n=108), patients with endogenous depression (n=17) and normal blood donors (n=68) for 504 human SNP alleles located within 88 CFS-associated human genes using the SNP Genotyping GoldenGate Assay (Illumina, San Diego, California, USA). 360 ancestry informative markers (AIM) were also examined. 21 SNPs were significantly associated with CFS/ME compared with depression and normal groups. 148 SNP alleles had a significant association with one or more CFS/ME subtypes. For each subtype, associated SNPs tended to be grouped together within particular genes. AIM SNPs indicated that 4 subjects were of Asian origin while the remainder were Caucasian. Hierarchical clustering of AIM data revealed the relatedness between 2 couples of patients with CFS only and confirmed the overall heterogeneity of all subjects. This study provides evidence that human SNPs located within CFS/ME associated genes are associated with particular genomic subtypes of CFS/ME. Further work is required to develop this into a clinically useful subtype-specific diagnostic test. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  2. VirVarSeq: a low-frequency virus variant detection pipeline for Illumina sequencing using adaptive base-calling accuracy filtering.

    PubMed

    Verbist, Bie M P; Thys, Kim; Reumers, Joke; Wetzels, Yves; Van der Borght, Koen; Talloen, Willem; Aerssens, Jeroen; Clement, Lieven; Thas, Olivier

    2015-01-01

    In virology, massively parallel sequencing (MPS) opens many opportunities for studying viral quasi-species, e.g. in HIV-1- and HCV-infected patients. This is essential for understanding pathways to resistance, which can substantially improve treatment. Although MPS platforms allow in-depth characterization of sequence variation, their measurements still involve substantial technical noise. For Illumina sequencing, single base substitutions are the main error source and impede powerful assessment of low-frequency mutations. Fortunately, base calls are complemented with quality scores (Qs) that are useful for differentiating errors from the real low-frequency mutations. A variant calling tool, Q-cpileup, is proposed, which exploits the Qs of nucleotides in a filtering strategy to increase specificity. The tool is imbedded in an open-source pipeline, VirVarSeq, which allows variant calling starting from fastq files. Using both plasmid mixtures and clinical samples, we show that Q-cpileup is able to reduce the number of false-positive findings. The filtering strategy is adaptive and provides an optimized threshold for individual samples in each sequencing run. Additionally, linkage information is kept between single-nucleotide polymorphisms as variants are called at the codon level. This enables virologists to have an immediate biological interpretation of the reported variants with respect to their antiviral drug responses. A comparison with existing SNP caller tools reveals that calling variants at the codon level with Q-cpileup results in an outstanding sensitivity while maintaining a good specificity for variants with frequencies down to 0.5%. The VirVarSeq is available, together with a user's guide and test data, at sourceforge: http://sourceforge.net/projects/virtools/?source=directory. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. Chemiluminescence resonance energy transfer imaging on magnetic particles for single-nucleotide polymorphism detection based on ligation chain reaction.

    PubMed

    Bi, Sai; Zhang, Zhipeng; Dong, Ying; Wang, Zonghua

    2015-03-15

    A novel ligation chain reaction (LCR) methodology for single-nucleotide polymorphism (SNP) detection was developed based on luminol-H2O2-horseradish peroxidase (HRP)-mimicking DNAzyme-fluorescein chemiluminescence resonance energy transfer (CRET) imaging on magnetic particles. For LCR, four unique target-complement probes (X and X(⁎), YG and Y(⁎)) for the amplification of K-ras (G12C) were designed by modifying G-quadruplex sequence at 3'-end of YG and fluorescein at 5'-end of Y(⁎). After the LCR, the resulting products of XYG/X(⁎)Y(⁎) with biotin-labeled X(⁎) were captured onto streptavidin-coated magnetic particles (SA-MPs) via specific biotin-SA interaction, which stimulated the CRET reaction from hemin/G-quadruplex-catalyzed luminol-H2O2 CL system to fluorescein. By collecting signals by a cooled low-light CCD, a CRET imaging method was proposed for visual detection and quantitative analysis of SNP. As low as 0.86fM mutant DNA was detected by this assay, and positive mutation detection was achieved with a wild-type to mutant ratio of 10,000:1. This high sensitivity and specificity could be attributed to not only the exponential amplification and excellent discrimination of LCR but also the employment of SA-MPs. SA-MPs ensured the feasibility of the proposed strategy, which also simplified the operations through magnetic separation and separated the reaction and detection procedures to improve sensitivity. The proposed LCR-CRET imaging strategy extends the application of signal amplification techniques to SNP detection, providing a promising platform for effective and high-throughput genetic diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Genetic evaluations of Chinese patients with odontohypophosphatasia resulting from heterozygosity for mutations in the tissue-non-specific alkaline phosphatase gene.

    PubMed

    Wan, Jia; Zhang, Li; Liu, Tang; Wang, Yewei

    2017-08-01

    Hypophosphatasia is a rare heritable metabolic disorder characterized by defective bone and tooth mineralization accompanied by a deficiency of tissue-non-specific (liver/bone/kidney) isoenzyme of alkaline phosphatase activity, caused by a number of loss-of-function mutations in the alkaline phosphatase liver type gene. We seek to explore the clinical manifestations and identify the mutations associated with the disease in a Chinese odonto- hypophosphatasia family. The proband and his younger brother affected with premature loss of primary teeth at their 2-year-old. They have mild abnormal serum alkaline phosphatase and 25-hydroxy vitamin D values, but the serum alkaline phosphatase activity of their father, mother and grandmother, who showed no clinical symptoms of hypophosphatasia, was exhibited significant decreased. In addition to premature loss of primary teeth, the proband and his younger brother showed low bone mineral density, X-rays showed that they had slight metaphyseal osteoporosis changes, but no additional skeletal abnormalities. Deoxyribonucleic acid sequencing and analysis revealed a single nucleotide polymorphism c.787T>C (p.Y263H) in exon 7 and/or a novel mutation c.-92C>T located at 5'UTR were found in the affected individuals. We examined all individuals of an odonto- hypophosphatasia family by clinical and radiographic examinations as well as laboratory assays. Furthermore, all 12 exons and the exon-intron boundaries of the alkaline phosphatase liver type gene were amplified and directly sequenced for further analysis and screened for mutations. Our present findings suggest the single nucleotide polymorphism c.787T>C and c.-92C>T should be responsible for the odonto- hypophosphatasia disorders in this family.

  5. Effects of IL1B single nucleotide polymorphisms on depressive and anxiety symptoms are determined by severity and type of life stress.

    PubMed

    Kovacs, David; Eszlari, Nora; Petschner, Peter; Pap, Dorottya; Vas, Szilvia; Kovacs, Peter; Gonda, Xenia; Juhasz, Gabriella; Bagdy, Gyorgy

    2016-08-01

    Interleukin-1β is one of the main mediators in the cross-talk between the immune system and the central nervous system. Higher interleukin-1β levels are found in mood spectrum disorders, and the stress-induced expression rate of the interleukin-1β gene (IL1B) is altered by polymorphisms in the region. Therefore we examined the effects of rs16944 and rs1143643 single nucleotide polymorphisms (SNPs) within the IL1B gene on depressive and anxiety symptoms, as measured by the Brief Symptom Inventory, in a Hungarian population sample of 1053 persons. Distal and proximal environmental stress factors were also included in our analysis, namely childhood adversity and recent negative life-events. We found that rs16944 minor (A) allele specifically interacted with childhood adversity increasing depressive and anxiety symptoms, while rs1143643's minor (A) allele showed protective effect against depressive symptoms after recent life stress. The genetic main effects of the two SNPs were not significant in the main analysis, but the interaction effects remained significant after correction for multiple testing. In addition, the effect of rs16944 A allele was reversed in a subsample with low-exposure to life stress, suggesting a protective effect against depressive symptoms, in the post hoc analysis. In summary, both of the two IL1B SNPs showed specific environmental stressor-dependent effects on mood disorder symptoms. We also demonstrated that the presence of exposure to childhood adversity changed the direction of the rs16944 effect on depression phenotype. Therefore our results suggest that it is advisable to include environmental factors in genetic association studies when examining the effect of the IL1B gene. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  6. The role of cystic fibrosis transmembrane conductance regulator phenylalanine 508 side chain in ion channel gating

    PubMed Central

    Cui, Liying; Aleksandrov, Luba; Hou, Yue-Xian; Gentzsch, Martina; Chen, Jey-Hsin; Riordan, John R; Aleksandrov, Andrei A

    2006-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an ion channel employing the ABC transporter structural motif. Deletion of a single residue (Phe508) in the first nucleotide-binding domain (NBD1), which occurs in most patients with cystic fibrosis, impairs both maturation and function of the protein. However, substitution of the Phe508 with small uncharged amino acids, including cysteine, is permissive for maturation. To explore the possible role of the phenylalanine aromatic side chain in channel gating we introduced a cysteine at this position in cysless CFTR, enabling its selective chemical modification by sulfhydryl reagents. Both cysless and wild-type CFTR ion channels have identical mean open times when activated by different nucleotide ligands. Moreover, both channels could be locked in an open state by introducing an ATPase inhibiting mutation (E1371S). However, the introduction of a single cysteine (F508C) prevented the cysless E1371S channel from maintaining the permanently open state, allowing closing to occur. Chemical modification of cysless E1371S/F508C by sulfhydryl reagents was used to probe the role of the side chain in ion channel function. Specifically, benzyl-methanethiosulphonate modification of this variant restored the gating behaviour to that of cysless E1371S containing the wild-type phenylalanine at position 508. This provides the first direct evidence that a specific interaction of the Phe508 aromatic side chain plays a role in determining the residency time in the closed state. Thus, despite the fact that this aromatic side chain is not essential for CFTR folding, it is important in the ion channel function. PMID:16484308

  7. A High-Throughput Data Mining of Single Nucleotide Polymorphisms in Coffea Species Expressed Sequence Tags Suggests Differential Homeologous Gene Expression in the Allotetraploid Coffea arabica1[W

    PubMed Central

    Vidal, Ramon Oliveira; Mondego, Jorge Maurício Costa; Pot, David; Ambrósio, Alinne Batista; Andrade, Alan Carvalho; Pereira, Luiz Filipe Protasio; Colombo, Carlos Augusto; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães

    2010-01-01

    Polyploidization constitutes a common mode of evolution in flowering plants. This event provides the raw material for the divergence of function in homeologous genes, leading to phenotypic novelty that can contribute to the success of polyploids in nature or their selection for use in agriculture. Mounting evidence underlined the existence of homeologous expression biases in polyploid genomes; however, strategies to analyze such transcriptome regulation remained scarce. Important factors regarding homeologous expression biases remain to be explored, such as whether this phenomenon influences specific genes, how paralogs are affected by genome doubling, and what is the importance of the variability of homeologous expression bias to genotype differences. This study reports the expressed sequence tag assembly of the allopolyploid Coffea arabica and one of its direct ancestors, Coffea canephora. The assembly was used for the discovery of single nucleotide polymorphisms through the identification of high-quality discrepancies in overlapped expressed sequence tags and for gene expression information indirectly estimated by the transcript redundancy. Sequence diversity profiles were evaluated within C. arabica (Ca) and C. canephora (Cc) and used to deduce the transcript contribution of the Coffea eugenioides (Ce) ancestor. The assignment of the C. arabica haplotypes to the C. canephora (CaCc) or C. eugenioides (CaCe) ancestral genomes allowed us to analyze gene expression contributions of each subgenome in C. arabica. In silico data were validated by the quantitative polymerase chain reaction and allele-specific combination TaqMAMA-based method. The presence of differential expression of C. arabica homeologous genes and its implications in coffee gene expression, ontology, and physiology are discussed. PMID:20864545

  8. Translating natural genetic variation to gene expression in a computational model of the Drosophila gap gene regulatory network

    PubMed Central

    Kozlov, Konstantin N.; Kulakovskiy, Ivan V.; Zubair, Asif; Marjoram, Paul; Lawrie, David S.; Nuzhdin, Sergey V.; Samsonova, Maria G.

    2017-01-01

    Annotating the genotype-phenotype relationship, and developing a proper quantitative description of the relationship, requires understanding the impact of natural genomic variation on gene expression. We apply a sequence-level model of gap gene expression in the early development of Drosophila to analyze single nucleotide polymorphisms (SNPs) in a panel of natural sequenced D. melanogaster lines. Using a thermodynamic modeling framework, we provide both analytical and computational descriptions of how single-nucleotide variants affect gene expression. The analysis reveals that the sequence variants increase (decrease) gene expression if located within binding sites of repressors (activators). We show that the sign of SNP influence (activation or repression) may change in time and space and elucidate the origin of this change in specific examples. The thermodynamic modeling approach predicts non-local and non-linear effects arising from SNPs, and combinations of SNPs, in individual fly genotypes. Simulation of individual fly genotypes using our model reveals that this non-linearity reduces to almost additive inputs from multiple SNPs. Further, we see signatures of the action of purifying selection in the gap gene regulatory regions. To infer the specific targets of purifying selection, we analyze the patterns of polymorphism in the data at two phenotypic levels: the strengths of binding and expression. We find that combinations of SNPs show evidence of being under selective pressure, while individual SNPs do not. The model predicts that SNPs appear to accumulate in the genotypes of the natural population in a way biased towards small increases in activating action on the expression pattern. Taken together, these results provide a systems-level view of how genetic variation translates to the level of gene regulatory networks via combinatorial SNP effects. PMID:28898266

  9. Characterization of the equine 2'-5' oligoadenylate synthetase 1 (OAS1) and ribonuclease L (RNASEL) innate immunity genes

    PubMed Central

    Rios, Jonathan J; Perelygin, Andrey A; Long, Maureen T; Lear, Teri L; Zharkikh, Andrey A; Brinton, Margo A; Adelson, David L

    2007-01-01

    Background The mammalian OAS/RNASEL pathway plays an important role in antiviral host defense. A premature stop-codon within the murine Oas1b gene results in the increased susceptibility of mice to a number of flaviviruses, including West Nile virus (WNV). Mutations in either the OAS1 or RNASEL genes may also modulate the outcome of WNV-induced disease or other viral infections in horses. Polymorphisms in the human OAS gene cluster have been previously utilized for case-control analysis of virus-induced disease in humans. No polymorphisms have yet been identified in either the equine OAS1 or RNASEL genes for use in similar case-control studies. Results Genomic sequence for equine OAS1 was obtained from a contig assembly generated from a shotgun subclone library of CHORI-241 BAC 100I10. Specific amplification of regions of the OAS1 gene from 13 horses of various breeds identified 33 single nucleotide polymorphisms (SNP) and two microsatellites. RNASEL cDNA sequences were determined for 8 mammals and utilized in a phylogenetic analysis. The chromosomal location of the RNASEL gene was assigned by FISH to ECA5p17-p16 using two selected CHORI-241 BAC clones. The horse genomic RNASEL sequence was assembled. Specific amplification of regions of the RNASEL gene from 13 horses identified 31 SNPs. Conclusion In this report, two dinucleotide microsatellites and 64 single nucleotide polymorphisms within the equine OAS1 and RNASEL genes were identified. These polymorphisms are the first to be reported for these genes and will facilitate future case-control studies of horse susceptibility to infectious diseases. PMID:17822564

  10. Real-time fluorescence ligase chain reaction for sensitive detection of single nucleotide polymorphism based on fluorescence resonance energy transfer.

    PubMed

    Sun, Yueying; Lu, Xiaohui; Su, Fengxia; Wang, Limei; Liu, Chenghui; Duan, Xinrui; Li, Zhengping

    2015-12-15

    Most of practical methods for detection of single nucleotide polymorphism (SNP) need at least two steps: amplification (usually by PCR) and detection of SNP by using the amplification products. Ligase chain reaction (LCR) can integrate the amplification and allele discrimination in one step. However, the detection of LCR products still remains a great challenge for highly sensitive and quantitative SNP detection. Herein, a simple but robust strategy for real-time fluorescence LCR has been developed for highly sensitive and quantitative SNP detection. A pair of LCR probes are firstly labeled with a fluorophore and a quencher, respectively. When the pair of LCR probes are ligated in LCR, the fluorophore will be brought close to the quencher, and thus, the fluorescence will be specifically quenched by fluorescence resonance energy transfer (FRET). The decrease of fluorescence intensity resulted from FRET can be real-time monitored in the LCR process. With the proposed real-time fluorescence LCR assay, 10 aM DNA targets or 100 pg genomic DNA can be accurately determined and as low as 0.1% mutant DNA can be detected in the presence of a large excess of wild-type DNA, indicating the high sensitivity and specificity. The real-time measuring does not require the detection step after LCR and gives a wide dynamic range for detection of DNA targets (from 10 aM to 1 pM). As LCR has been widely used for detection of SNP, DNA methylation, mRNA and microRNA, the real-time fluorescence LCR assay shows great potential for various genetic analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Associations between incident ischemic stroke events and stroke and cardiovascular disease-related genome-wide association studies single nucleotide polymorphisms in the Population Architecture Using Genomics and Epidemiology study.

    PubMed

    Carty, Cara L; Buzková, Petra; Fornage, Myriam; Franceschini, Nora; Cole, Shelley; Heiss, Gerardo; Hindorff, Lucia A; Howard, Barbara V; Mann, Sue; Martin, Lisa W; Zhang, Ying; Matise, Tara C; Prentice, Ross; Reiner, Alexander P; Kooperberg, Charles

    2012-04-01

    Genome-wide association studies (GWAS) have identified loci associated with ischemic stroke (IS) and cardiovascular disease (CVD) in European-descent individuals, but their replication in different populations has been largely unexplored. Nine single nucleotide polymorphisms (SNPs) selected from GWAS and meta-analyses of stroke, and 86 SNPs previously associated with myocardial infarction and CVD risk factors, including blood lipids (high density lipoprotein [HDL], low density lipoprotein [LDL], and triglycerides), type 2 diabetes, and body mass index (BMI), were investigated for associations with incident IS in European Americans (EA) N=26 276, African-Americans (AA) N=8970, and American Indians (AI) N=3570 from the Population Architecture using Genomics and Epidemiology Study. Ancestry-specific fixed effects meta-analysis with inverse variance weighting was used to combine study-specific log hazard ratios from Cox proportional hazards models. Two of 9 stroke SNPs (rs783396 and rs1804689) were significantly associated with [corrected] IS hazard in AA; none were significant in this large EA cohort. Of 73 CVD risk factor SNPs tested in EA, 2 (HDL and triglycerides SNPs) were associated with IS. In AA, SNPs associated with LDL, HDL, and BMI were significantly associated with IS (3 of 86 SNPs tested). Out of 58 SNPs tested in AI, 1 LDL SNP was significantly associated with IS. Our analyses showing lack of replication in spite of reasonable power for many stroke SNPs and differing results by ancestry highlight the need to follow up on GWAS findings and conduct genetic association studies in diverse populations. We found modest IS associations with BMI and lipids SNPs, though these findings require confirmation.

  12. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  13. 37 CFR 41.37 - Appeal brief.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

  14. 37 CFR 41.37 - Appeal brief.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

  15. Electron microscopic visualization of sites of nascent DNA synthesis by streptavidin-gold binding to biotinylated nucleotides incorporated in vivo

    PubMed Central

    1988-01-01

    Biotinylated nucleotides (bio-11-dCTP, bio-11-dUTP, and bio-7-dATP) were microinjected into unfertilized and fertilized Xenopus laevis eggs. The amounts introduced were comparable to in vivo deoxy- nucleoside triphosphate pools. At various times after microinjection, DNA was extracted from eggs or embryos and subjected to electrophoresis on agarose gels. Newly synthesized biotinylated DNA was analyzed by Southern transfer and visualized using either the BluGENE or Detek-hrp streptavidin-based nucleic acid detection systems. Quantitation of the amount of biotinylated DNA observed at various times showed that the microinjected biotinylated nucleotides were efficiently incorporated in vivo, both into replicating endogenous chromosomal DNA and into replicating microinjected exogenous plasmid DNA. At least one biotinylated nucleotide could be incorporated in vivo for every eight nucleotides of DNA synthesized. Control experiments also showed that heavily biotinylated DNA was not subjected to detectable DNA repair during early embryogenesis (for at least 5 h after activation of the eggs). The incorporated biotinylated nucleotides were visualized by electron microscopy by using streptavidin-colloidal gold or streptavidin-ferritin conjugates to bind specifically to the biotin groups projecting from the newly replicated DNA. The incorporated biotinylated nucleotides were thus made visible as electron-dense spots on the underlying DNA molecules. Biotinylated nucleotides separated by 20-50 bases could be resolved. We conclude that nascent DNA synthesized in vivo in Xenopus laevis eggs can be visualized efficiently and specifically using the techniques described. PMID:3392102

  16. Characterization and Regulation of Aquaporin Genes of Sorghum [Sorghum bicolor (L.) Moench] in Response to Waterlogging Stress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kadam, Suhas; Abril, Alejandra; Dhanapal, Arun P.

    Waterlogging is a significant environmental constraint to crop production, and a better understanding of plant responses is critical for the improvement of crop tolerance to waterlogged soils. Aquaporins (AQPs) are a class of channel-forming proteins that play an important role in water transport in plants. Our study aimed to examine the regulation of AQP genes under waterlogging stress and to characterize the genetic variability of AQP genes in sorghum (Sorghum bicolor). Transcriptional profiling of AQP genes in response to waterlogging stress in nodal root tips and nodal root basal regions of two tolerant and two sensitive sorghum genotypes at 18more » and 96 h after waterlogging stress imposition revealed significant gene-specific pattern with regard to genotype, root tissue sample, and time point. For some tissue sample and time point combinations, PIP2-6, PIP2-7, TIP2-2, TIP4-4, and TIP5-1 expression was differentially regulated in tolerant compared to sensitive genotypes. The differential response of these AQP genes suggests that they may play a tissue specific role in mitigating waterlogging stress. Genetic analysis of sorghum revealed that AQP genes were clustered into the same four subfamilies as in maize (Zea mays) and rice (Oryza sativa) and that residues determining the AQP channel specificity were largely conserved across species. Single nucleotide polymorphism (SNP) data from 50 sorghum accessions were used to build an AQP gene-based phylogeny of the haplotypes. Phylogenetic analysis based on single nucleotide polymorphisms of sorghum AQP genes placed the tolerant and sensitive genotypes used for the expression study in distinct groups. Expression analyses suggested that selected AQPs may play a pivotal role in sorghum tolerance to water logging stress. Furthermore experimentation is needed to verify their role and to leverage phylogenetic analyses and AQP expression data to improve water logging tolerance in sorghum.« less

  17. Characterization and Regulation of Aquaporin Genes of Sorghum [Sorghum bicolor (L.) Moench] in Response to Waterlogging Stress

    DOE PAGES

    Kadam, Suhas; Abril, Alejandra; Dhanapal, Arun P.; ...

    2017-05-30

    Waterlogging is a significant environmental constraint to crop production, and a better understanding of plant responses is critical for the improvement of crop tolerance to waterlogged soils. Aquaporins (AQPs) are a class of channel-forming proteins that play an important role in water transport in plants. Our study aimed to examine the regulation of AQP genes under waterlogging stress and to characterize the genetic variability of AQP genes in sorghum (Sorghum bicolor). Transcriptional profiling of AQP genes in response to waterlogging stress in nodal root tips and nodal root basal regions of two tolerant and two sensitive sorghum genotypes at 18more » and 96 h after waterlogging stress imposition revealed significant gene-specific pattern with regard to genotype, root tissue sample, and time point. For some tissue sample and time point combinations, PIP2-6, PIP2-7, TIP2-2, TIP4-4, and TIP5-1 expression was differentially regulated in tolerant compared to sensitive genotypes. The differential response of these AQP genes suggests that they may play a tissue specific role in mitigating waterlogging stress. Genetic analysis of sorghum revealed that AQP genes were clustered into the same four subfamilies as in maize (Zea mays) and rice (Oryza sativa) and that residues determining the AQP channel specificity were largely conserved across species. Single nucleotide polymorphism (SNP) data from 50 sorghum accessions were used to build an AQP gene-based phylogeny of the haplotypes. Phylogenetic analysis based on single nucleotide polymorphisms of sorghum AQP genes placed the tolerant and sensitive genotypes used for the expression study in distinct groups. Expression analyses suggested that selected AQPs may play a pivotal role in sorghum tolerance to water logging stress. Furthermore experimentation is needed to verify their role and to leverage phylogenetic analyses and AQP expression data to improve water logging tolerance in sorghum.« less

  18. Genetic variants and early cigarette smoking and nicotine dependence phenotypes in adolescents.

    PubMed

    O'Loughlin, Jennifer; Sylvestre, Marie-Pierre; Labbe, Aurélie; Low, Nancy C; Roy-Gagnon, Marie-Hélène; Dugas, Erika N; Karp, Igor; Engert, James C

    2014-01-01

    While the heritability of cigarette smoking and nicotine dependence (ND) is well-documented, the contribution of specific genetic variants to specific phenotypes has not been closely examined. The objectives of this study were to test the associations between 321 tagging single-nucleotide polymorphisms (SNPs) that capture common genetic variation in 24 genes, and early smoking and ND phenotypes in novice adolescent smokers, and to assess if genetic predictors differ across these phenotypes. In a prospective study of 1294 adolescents aged 12-13 years recruited from ten Montreal-area secondary schools, 544 participants who had smoked at least once during the 7-8 year follow-up provided DNA. 321 single-nucleotide polymorphisms (SNPs) in 24 candidate genes were tested for an association with number of cigarettes smoked in the past 3 months, and with five ND phenotypes (a modified version of the Fagerstrom Tolerance Questionnaire, the ICD-10 and three clusters of ND symptoms representing withdrawal symptoms, use of nicotine for self-medication, and a general ND/craving symptom indicator). The pattern of SNP-gene associations differed across phenotypes. Sixteen SNPs in seven genes (ANKK1, CHRNA7, DDC, DRD2, COMT, OPRM1, SLC6A3 (also known as DAT1)) were associated with at least one phenotype with a p-value <0.01 using linear mixed models. After permutation and FDR adjustment, none of the associations remained statistically significant, although the p-values for the association between rs557748 in OPRM1 and the ND/craving and self-medication phenotypes were both 0.076. Because the genetic predictors differ, specific cigarette smoking and ND phenotypes should be distinguished in genetic studies in adolescents. Fifteen of the 16 top-ranked SNPs identified in this study were from loci involved in dopaminergic pathways (ANKK1/DRD2, DDC, COMT, OPRM1, and SLC6A3). Dopaminergic pathways may be salient during early smoking and the development of ND.

  19. Nucleotide and bivalent cation specificity of the insulin-granule proton translocase.

    PubMed Central

    Hutton, J C; Peshavaria, M

    1983-01-01

    1. The nucleotide and bivalent cation specificity of the proton translocase activity of insulin secretory granules was investigated by assessing the inhibitor-sensitive rates of nucleotide hydrolysis by these organelles in relation to their chemiosmotic properties. 2. The relative rates of nucleotide hydrolysis by freeze/thawed granule preparations were: Mg2+ATP (100%) greater than Mg2+GTP (55%) greater than Mg2+UTP (48%) greater than Mg2+ITP (44%) greater than Mg2+CTP (23%) greater than Mg2+TTP (20%), and by intact granules were: Mg2+ATP (100%) greater than Mg2+ITP (74%) greater than Mg2+GTP (60%) greater than Mg2+CTP (35%). Mg2+ATP, Mg2+GTP and Mg2+ITP hydrolyses were inhibited by tributyltin and stimulated, in intact granules, by the protonophore carbonyl cyanide p-trifluoromethoxyphenylhydrazone; Mg2+CTP hydrolysis was not markedly affected by these compounds. Correspondingly, only Mg2+ATP, Mg2+GTP and Mg2+ITP produced large changes in the delta psi and delta mu H+ across the granule membrane. 3. The relative rates of maximal ATPase activity stimulated by bivalent cations in freeze/thawed granule preparations were: Mg2+ (100%) greater than Mn2+ (82%) greater than Ca2+ (40%) greater than Co2+ (36%) greater than Zn2+ (0%), and in intact granules were: Mg2+ (100%) greater than Mn2+ (85%) greater than Co2+ (61%) greater than Ca2+ (42%). Tributyltin and carbonyl cyanide p-trifluoromethoxyphenylhydrazone affected Mg2+-, Mn2+- and Co2+-activated, but not Ca2+-activated, ATP hydrolysis. Correspondingly, only Mg2+, Mn2+ and Co2+ supported the generation of a delta psi and delta mu H+ across granule membranes in the presence of ATP. 4. The results were consistent with a single proton translocase that had its catalytic site exposed on the external face of the granule membrane. The indicated specificity (Mg2+ATP = Mn2+ATP greater than Co2+ATP greater than Mg2+GTP greater than Mg2+ITP) was similar to that of enzymes described in membrane fractions prepared from adenohypophyseal tissue, adrenal chromaffin granules and yeast vacuoles. The insulin-granule activity thus appears to be a type of proton translocase, which is characteristic of intracellular storage vesicles in eukaryotic cells. PMID:6303313

  20. Associations between serum bone-specific alkaline phosphatase activity, biochemical parameters, and functional polymorphisms of the tissue-nonspecific alkaline phosphatase gene in a Japanese population.

    PubMed

    Sogabe, Natsuko; Tanabe, Rieko; Haraikawa, Mayu; Maruoka, Yutaka; Orimo, Hideo; Hosoi, Takayuki; Goseki-Sone, Masae

    2013-01-01

    We had demonstrated that single nucleotide polymorphism (787T>C) in the tissue-nonspecific ALP (TNSALP) gene was associated with the bone mineral density (BMD). BMD was the lowest among TNSALP 787T homozygotes (TT-type) and highest among TNSALP 787T>C homozygotes (CC-type) in postmenopausal women. In the present study, we investigated the effects of the TNSALP genotype on associations among serum bonespecific alkaline phosphatase (BAP), serum calcium, and phosphorus in healthy young Japanese subjects. Young healthy adult subjects (n=193) were genotyped for the polymorphism, and we measured the levels of serum BAP, serum calcium, and phosphorus. Dietary nutrient intakes were calculated based on 3-day food records before the day of blood examinations. Grouped by the TNSALP genotype, a significant negative correlation between serum BAP and phosphorus was observed in 787T>C homozygotes (CC-type), but not in heterozygotes (TCtype), nor in 787T homozygotes (TT-type). In the present study, we revealed that the single nucleotide polymorphism 787T>C in the TNSALP gene had effects on the correlation between serum BAP and phosphorus in young adult subjects. These results suggest that variation in TNSALP may be an important determinant of phosphate metabolism. Our data may be useful for planning strategies to prevent osteoporosis.

  1. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome

    PubMed Central

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions. PMID:26544948

  2. Single-nucleotide polymorphisms in the LRWD1 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

    PubMed

    Miyamoto, T; Koh, E; Tsujimura, A; Miyagawa, Y; Saijo, Y; Namiki, M; Sengoku, K

    2014-04-01

    Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, ten novel genes involved in human spermatogenesis, including human LRWD1, have been identified by expression microarray analysis of human testictissue. The human LRWD1 protein mediates the origin recognition complex in chromatin, which is critical for the initiation of pre-replication complex assembly in G1 and chromatin organization in post-G1 cells. The Lrwd1 gene expression is specific to the testis in mice. Therefore, we hypothesized that mutation or polymorphisms of LRWD1 participate in male infertility, especially azoospermia. To investigate whether LRWD1 gene defects are associated with azoospermia caused by SCOS and meiotic arrest (MA), mutational analysis was performed in 100 and 30 Japanese patients by direct sequencing of the coding regions, respectively. Statistical analysis was performed for patients with SCOS and MA and in 100 healthy control men. No mutations were found in LRWD1; however, three coding single-nucleotide polymorphisms (SNP1-SNP3) could be detected in the patients. The genotype and allele frequencies in SNP1 and SNP2 were notably higher in the SCOS group than in the control group (P < 0.05). These results suggest the critical role of LRWD1 in human spermatogenesis. © 2013 Blackwell Verlag GmbH.

  3. Fluorescent signatures for variable DNA sequences

    PubMed Central

    Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.

    2012-01-01

    Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378

  4. Genomic Changes Associated with Reproductive and Migratory Ecotypes in Sockeye Salmon (Oncorhynchus nerka).

    PubMed

    Veale, Andrew J; Russello, Michael A

    2017-10-01

    Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. A Perfect Match Genomic Landscape Provides a Unified Framework for the Precise Detection of Variation in Natural and Synthetic Haploid Genomes.

    PubMed

    Palacios-Flores, Kim; García-Sotelo, Jair; Castillo, Alejandra; Uribe, Carina; Aguilar, Luis; Morales, Lucía; Gómez-Romero, Laura; Reyes, José; Garciarubio, Alejandro; Boege, Margareta; Dávila, Guillermo

    2018-04-01

    We present a conceptually simple, sensitive, precise, and essentially nonstatistical solution for the analysis of genome variation in haploid organisms. The generation of a Perfect Match Genomic Landscape (PMGL), which computes intergenome identity with single nucleotide resolution, reveals signatures of variation wherever a query genome differs from a reference genome. Such signatures encode the precise location of different types of variants, including single nucleotide variants, deletions, insertions, and amplifications, effectively introducing the concept of a general signature of variation. The precise nature of variants is then resolved through the generation of targeted alignments between specific sets of sequence reads and known regions of the reference genome. Thus, the perfect match logic decouples the identification of the location of variants from the characterization of their nature, providing a unified framework for the detection of genome variation. We assessed the performance of the PMGL strategy via simulation experiments. We determined the variation profiles of natural genomes and of a synthetic chromosome, both in the context of haploid yeast strains. Our approach uncovered variants that have previously escaped detection. Moreover, our strategy is ideally suited for further refining high-quality reference genomes. The source codes for the automated PMGL pipeline have been deposited in a public repository. Copyright © 2018 by the Genetics Society of America.

  6. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    PubMed

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  7. Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

    PubMed Central

    Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

    2006-01-01

    Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

  8. Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder.

    PubMed

    Yanagi, Kumiko; Kaname, Tadashi; Wakui, Keiko; Hashimoto, Ohiko; Fukushima, Yoshimitsu; Naritomi, Kenji

    2012-01-01

    Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered.

  9. Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder

    PubMed Central

    Yanagi, Kumiko; Kaname, Tadashi; Wakui, Keiko; Hashimoto, Ohiko; Fukushima, Yoshimitsu; Naritomi, Kenji

    2012-01-01

    Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered. PMID:22934180

  10. Association between ASMT and autistic-like traits in children from a Swedish nationwide cohort.

    PubMed

    Jonsson, Lina; Anckarsäter, Henrik; Zettergren, Anna; Westberg, Lars; Walum, Hasse; Lundström, Sebastian; Larsson, Henrik; Lichtenstein, Paul; Melke, Jonas

    2014-02-01

    Individuals with autism spectrum disorders often show low levels of melatonin, and it has been suggested that this decrease may be because of the low activity of the acetylserotonin O-methyltransferase (ASMT), the last enzyme in the melatonin-synthesis pathway. Also, genetic variants in ASMT have been associated with autism, as well as with low ASMT activity and melatonin levels, suggesting that the low ASMT activity observed in autism may partly be because of variations within the ASMT gene. In this study, we present a symptom-based approach to investigate possible associations between ASMT and autistic-like traits in the general population. To this end, continuous measures of autistic-like traits were assessed in a nationally representative twin cohort (n=1771) from Sweden and six single nucleotide polymorphisms (SNPs), and a duplication of exons 2-8 in ASMT were genotyped. Our results show a nominally significant association, in girls, between one single nucleotide polymorphism (rs5949028) in the last intron of ASMT and social interaction impairments. No significant association, however, was observed with traits related to language impairment or restricted and repetitive behavior. In conclusion, our results support the possible involvement of the ASMT gene in autism spectrum disorders, and our finding that only one of the three traits shows association suggests that genetic research may benefit from adopting a symptom-specific approach to identify genes involved in autism psychopathology.

  11. A noncoding melanophilin gene (MLPH) SNP at the splice donor of exon 1 represents a candidate causal mutation for coat color dilution in dogs.

    PubMed

    Drögemüller, Cord; Philipp, Ute; Haase, Bianca; Günzel-Apel, Anne-Rose; Leeb, Tosso

    2007-01-01

    Coat color dilution in several breeds of dog is characterized by a specific pigmentation phenotype and sometimes accompanied by hair loss and recurrent skin inflammation, the so-called color dilution alopecia or black hair follicular dysplasia. Coat color dilution (d) is inherited as a Mendelian autosomal recessive trait. In a previous study, MLPH polymorphisms showed perfect cosegregation with the dilute phenotype within breeds. However, different dilute haplotypes were found in different breeds, and no single polymorphism was identified in the coding sequence that was likely to be causative for the dilute phenotype. We resequenced the 5'-region of the canine MLPH gene and identified a strong candidate single nucleotide polymorphism within the nontranslated exon 1, which showed perfect association to the dilute phenotype in 65 dilute dogs from 7 different breeds. The A/G polymorphism is located at the last nucleotide of exon 1 and the mutant A-allele is predicted to reduce splicing efficiency 8-fold. An MLPH mRNA expression study using quantitative reverse transcriptase-polymerase chain reaction confirmed that dd animals had only about approximately 25% of the MLPH transcript compared with DD animals. These results provide preliminary evidence that the reported regulatory MLPH mutation might represent a causal mutation for coat color dilution in dogs.

  12. Single Nucleotide Polymorphisms in B-Genome Specific UDP-Glucosyl Transferases Associated with Fusarium Head Blight Resistance and Reduced Deoxynivalenol Accumulation in Wheat Grain.

    PubMed

    Sharma, Pallavi; Gangola, Manu P; Huang, Chen; Kutcher, H Randy; Ganeshan, Seedhabadee; Chibbar, Ravindra N

    2018-01-01

    An in vitro spike culture method was optimized to evaluate Fusarium head blight (FHB) resistance in wheat (Triticum aestivum) and used to screen a population of ethyl methane sulfonate treated spike culture-derived variants (SCDV). Of the 134 SCDV evaluated, the disease severity score of 47 of the variants was ≤30%. Single nucleotide polymorphisms (SNP) in the UDP-glucosyltransferase (UGT) genes, TaUGT-2B, TaUGT-3B, and TaUGT-EST, differed between AC Nanda (an FHB-susceptible wheat variety) and Sumai-3 (an FHB-resistant wheat cultivar). SNP at 450 and 1,558 bp from the translation initiation site in TaUGT-2B and TaUGT-3B, respectively were negatively correlated with FHB severity in the SCDV population, whereas the SNP in TaUGT-EST was not associated with FHB severity. Fusarium graminearum strain M7-07-1 induced early expression of TaUGT-2B and TaUGT-3B in FHB-resistant SCDV lines, which were associated with deoxynivalenol accumulation and reduced FHB disease progression. At 8 days after inoculation, deoxynivalenol concentration varied from 767 ppm in FHB-resistant variants to 2,576 ppm in FHB-susceptible variants. The FHB-resistant SCDV identified can be used as new sources of FHB resistance in wheat improvement programs.

  13. [The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

    PubMed

    Bai, Peng; Tian, Li; Zhou, Xue-ping

    2005-05-01

    DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

  14. Testing for genetic association taking into account phenotypic information of relatives.

    PubMed

    Uh, Hae-Won; Wijk, Henk Jan van der; Houwing-Duistermaat, Jeanine J

    2009-12-15

    We investigated efficient case-control association analysis using family data. The outcome of interest was coronary heart disease. We employed existing and new methods that take into account the correlations among related individuals to obtain the proper type I error rates. The methods considered for autosomal single-nucleotide polymorphisms were: 1) generalized estimating equations-based methods, 2) variance-modified Cochran-Armitage (MCA) trend test incorporating kinship coefficients, and 3) genotypic modified quasi-likelihood score test. Additionally, for X-linked single-nucleotide polymorphisms we proposed a two-degrees-of-freedom test. Performance of these methods was tested using Framingham Heart Study 500 k array data.

  15. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    PubMed

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  16. Allelic imbalance of multiple sclerosis susceptibility genes IKZF3 and IQGAP1 in human peripheral blood.

    PubMed

    Keshari, Pankaj K; Harbo, Hanne F; Myhr, Kjell-Morten; Aarseth, Jan H; Bos, Steffan D; Berge, Tone

    2016-04-14

    Multiple sclerosis is a chronic inflammatory, demyelinating disease of the central nervous system. Recent genome-wide studies have revealed more than 110 single nucleotide polymorphisms as associated with susceptibility to multiple sclerosis, but their functional contribution to disease development is mostly unknown. Consistent allelic imbalance was observed for rs907091 in IKZF3 and rs11609 in IQGAP1, which are in strong linkage disequilibrium with the multiple sclerosis associated single nucleotide polymorphisms rs12946510 and rs8042861, respectively. Using multiple sclerosis patients and healthy controls heterozygous for rs907091 and rs11609, we showed that the multiple sclerosis risk alleles at IKZF3 and IQGAP1 are expressed at higher levels as compared to the protective allele. Furthermore, individuals homozygous for the multiple sclerosis risk allele at IQGAP1 had a significantly higher total expression of IQGAP1 compared to individuals homozygous for the protective allele. Our data indicate a possible regulatory role for the multiple sclerosis-associated IKZF3 and IQGAP1 variants. We suggest that such cis-acting mechanisms may contribute to the multiple sclerosis association of single nucleotide polymorphisms at IKZF3 and IQGAP1.

  17. Creatine kinase: Essential arginine residues at the nucleotide binding site identified by chemical modification and high-resolution tandem mass spectrometry

    PubMed Central

    Wood, Troy D.; Guan, Ziqiang; Borders, Charles L.; Chen, Lorenzo H.; Kenyon, George L.; McLafferty, Fred W.

    1998-01-01

    Phenylglyoxal is an arginine-specific reagent that inactivates creatine kinase (CK). Previous results suggest that modification of the dimeric enzyme at a single arginine residue per subunit causes complete inactivation accompanied by the loss of nucleotide binding; the actual site of modification was not identified. Here, high-resolution tandem mass spectrometry (MS/MS) was used to identify three phenylglyoxal-modified Arg residues in monomeric rabbit muscle CK. Electrospray ionizaton Fourier-transform MS of the phenylglyoxal-modified CK that had lost ≈80% activity identified three species: unmodified, once-modified (+116 Da), and twice-modified (+232 Da) enzyme in a ratio of approximately 1:4:1. MS/MS restricts the derivatized sites to P122-P212 and P283-V332, whereas MS of Lys-C digestions revealed two modified peptides, A266-K297 and G116-K137. The only Arg in A266-K297 is Arg-291 (invariant), whereas MS/MS of modified G116-K137 shows that two of the three sites Arg-129, Arg-131, or Arg-134 (all invariant) can contain the modification. The recently reported x-ray crystal structure for the octameric chicken mitochondrial CK indicates that its nucleotide triphosphate-binding site indeed contains the equivalent of R291, R129, and R131 reported here to be at the active site of rabbit muscle CK. PMID:9520370

  18. Canine olfactory receptor gene polymorphism and its relation to odor detection performance by sniffer dogs.

    PubMed

    Lesniak, Anna; Walczak, Marta; Jezierski, Tadeusz; Sacharczuk, Mariusz; Gawkowski, Maciej; Jaszczak, Kazimierz

    2008-01-01

    The outstanding sensitivity of the canine olfactory system has been acknowledged by using sniffer dogs in military and civilian service for detection of a variety of odors. It is hypothesized that the canine olfactory ability is determined by polymorphisms in olfactory receptor (OR) genes. We investigated 5 OR genes for polymorphic sites which might affect the olfactory ability of service dogs in different fields of specific substance detection. All investigated OR DNA sequences proved to have allelic variants, the majority of which lead to protein sequence alteration. Homozygous individuals at 2 gene loci significantly differed in their detection skills from other genotypes. This suggests a role of specific alleles in odor detection and a linkage between single-nucleotide polymorphism and odor recognition efficiency.

  19. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    PubMed

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  20. Dynamic variable selection in SNP genotype autocalling from APEX microarray data.

    PubMed

    Podder, Mohua; Welch, William J; Zamar, Ruben H; Tebbutt, Scott J

    2006-11-30

    Single nucleotide polymorphisms (SNPs) are DNA sequence variations, occurring when a single nucleotide--adenine (A), thymine (T), cytosine (C) or guanine (G)--is altered. Arguably, SNPs account for more than 90% of human genetic variation. Our laboratory has developed a highly redundant SNP genotyping assay consisting of multiple probes with signals from multiple channels for a single SNP, based on arrayed primer extension (APEX). This mini-sequencing method is a powerful combination of a highly parallel microarray with distinctive Sanger-based dideoxy terminator sequencing chemistry. Using this microarray platform, our current genotype calling system (known as SNP Chart) is capable of calling single SNP genotypes by manual inspection of the APEX data, which is time-consuming and exposed to user subjectivity bias. Using a set of 32 Coriell DNA samples plus three negative PCR controls as a training data set, we have developed a fully-automated genotyping algorithm based on simple linear discriminant analysis (LDA) using dynamic variable selection. The algorithm combines separate analyses based on the multiple probe sets to give a final posterior probability for each candidate genotype. We have tested our algorithm on a completely independent data set of 270 DNA samples, with validated genotypes, from patients admitted to the intensive care unit (ICU) of St. Paul's Hospital (plus one negative PCR control sample). Our method achieves a concordance rate of 98.9% with a 99.6% call rate for a set of 96 SNPs. By adjusting the threshold value for the final posterior probability of the called genotype, the call rate reduces to 94.9% with a higher concordance rate of 99.6%. We also reversed the two independent data sets in their training and testing roles, achieving a concordance rate up to 99.8%. The strength of this APEX chemistry-based platform is its unique redundancy having multiple probes for a single SNP. Our model-based genotype calling algorithm captures the redundancy in the system considering all the underlying probe features of a particular SNP, automatically down-weighting any 'bad data' corresponding to image artifacts on the microarray slide or failure of a specific chemistry. In this regard, our method is able to automatically select the probes which work well and reduce the effect of other so-called bad performing probes in a sample-specific manner, for any number of SNPs.

  1. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

    PubMed Central

    Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

    2011-01-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

  2. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    PubMed

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

    2017-01-01

    RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments.

  3. The miR9863 Family Regulates Distinct Mla Alleles in Barley to Attenuate NLR Receptor-Triggered Disease Resistance and Cell-Death Signaling

    PubMed Central

    Liu, Jie; Cheng, Xiliu; Liu, Da; Xu, Weihui; Wise, Roger; Shen, Qian-Hua

    2014-01-01

    Barley (Hordeum vulgare L.) Mla alleles encode coiled-coil (CC), nucleotide binding, leucine-rich repeat (NB-LRR) receptors that trigger isolate-specific immune responses against the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh). How Mla or NB-LRR genes in grass species are regulated at post-transcriptional level is not clear. The microRNA family, miR9863, comprises four members that differentially regulate distinct Mla alleles in barley. We show that miR9863 members guide the cleavage of Mla1 transcripts in barley, and block or reduce the accumulation of MLA1 protein in the heterologous Nicotiana benthamiana expression system. Regulation specificity is determined by variation in a unique single-nucleotide-polymorphism (SNP) in mature miR9863 family members and two SNPs in the Mla miR9863-binding site that separates these alleles into three groups. Further, we demonstrate that 22-nt miR9863s trigger the biogenesis of 21-nt phased siRNAs (phasiRNAs) and together these sRNAs form a feed-forward regulation network for repressing the expression of group I Mla alleles. Overexpression of miR9863 members specifically attenuates MLA1, but not MLA10-triggered disease resistance and cell-death signaling. We propose a key role of the miR9863 family in dampening immune response signaling triggered by a group of MLA immune receptors in barley. PMID:25502438

  4. Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

    PubMed Central

    Pi, J; Wookey, P J; Pittard, A J

    1991-01-01

    The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

  5. A multistep damage recognition mechanism for global genomic nucleotide excision repair

    PubMed Central

    Sugasawa, Kaoru; Okamoto, Tomoko; Shimizu, Yuichiro; Masutani, Chikahide; Iwai, Shigenori; Hanaoka, Fumio

    2001-01-01

    A mammalian nucleotide excision repair (NER) factor, the XPC–HR23B complex, can specifically bind to certain DNA lesions and initiate the cell-free repair reaction. Here we describe a detailed analysis of its binding specificity using various DNA substrates, each containing a single defined lesion. A highly sensitive gel mobility shift assay revealed that XPC–HR23B specifically binds a small bubble structure with or without damaged bases, whereas dual incision takes place only when damage is present in the bubble. This is evidence that damage recognition for NER is accomplished through at least two steps; XPC–HR23B first binds to a site that has a DNA helix distortion, and then the presence of injured bases is verified prior to dual incision. Cyclobutane pyrimidine dimers (CPDs) were hardly recognized by XPC–HR23B, suggesting that additional factors may be required for CPD recognition. Although the presence of mismatched bases opposite a CPD potentiated XPC–HR23B binding, probably due to enhancement of the helix distortion, cell-free excision of such compound lesions was much more efficient than expected from the observed affinity for XPC–HR23B. This also suggests that additional factors and steps are required for the recognition of some types of lesions. A multistep mechanism of this sort may provide a molecular basis for ensuring the high level of damage discrimination that is required for global genomic NER. PMID:11238373

  6. A multistep damage recognition mechanism for global genomic nucleotide excision repair.

    PubMed

    Sugasawa, K; Okamoto, T; Shimizu, Y; Masutani, C; Iwai, S; Hanaoka, F

    2001-03-01

    A mammalian nucleotide excision repair (NER) factor, the XPC-HR23B complex, can specifically bind to certain DNA lesions and initiate the cell-free repair reaction. Here we describe a detailed analysis of its binding specificity using various DNA substrates, each containing a single defined lesion. A highly sensitive gel mobility shift assay revealed that XPC-HR23B specifically binds a small bubble structure with or without damaged bases, whereas dual incision takes place only when damage is present in the bubble. This is evidence that damage recognition for NER is accomplished through at least two steps; XPC-HR23B first binds to a site that has a DNA helix distortion, and then the presence of injured bases is verified prior to dual incision. Cyclobutane pyrimidine dimers (CPDs) were hardly recognized by XPC-HR23B, suggesting that additional factors may be required for CPD recognition. Although the presence of mismatched bases opposite a CPD potentiated XPC-HR23B binding, probably due to enhancement of the helix distortion, cell-free excision of such compound lesions was much more efficient than expected from the observed affinity for XPC-HR23B. This also suggests that additional factors and steps are required for the recognition of some types of lesions. A multistep mechanism of this sort may provide a molecular basis for ensuring the high level of damage discrimination that is required for global genomic NER.

  7. Evolution of divergent DNA recognition specificities in VDE homing endonucleases from two yeast species

    PubMed Central

    Posey, Karen L.; Koufopanou, Vassiliki; Burt, Austin; Gimble, Frederick S.

    2004-01-01

    Homing endonuclease genes (HEGs) are mobile DNA elements that are thought to confer no benefit to their host. They encode site-specific DNA endonucleases that perpetuate the element within a species population by homing and disseminate it between species by horizontal transfer. Several yeast species contain the VMA1 HEG that encodes the intein-associated VMA1-derived endonuclease (VDE). The evolutionary state of VDEs from 12 species was assessed by assaying their endonuclease activities. Only two enzymes are active, PI-ZbaI from Zygosaccharomyces bailii and PI-ScaI from Saccharomyces cariocanus. PI-ZbaI cleaves the Z.bailii recognition sequence significantly faster than the Saccharomyces cerevisiae site, which differs at six nucleotide positions. A mutational analysis indicates that PI-ZbaI cleaves the S.cerevisiae substrate poorly due to the absence of a contact that is analogous to one made in PI-SceI between Gln-55 and nucleotides +9/+10. PI-ZbaI cleaves the Z.bailii substrate primarily due to a single base-pair substitution (A/T+5 → T/A+5). Structural modeling of the PI-ZbaI/DNA complex suggests that Arg-331, which is absent in PI-SceI, contacts T/A+5, and the reduced activity observed in a PI-ZbaI R331A mutant provides evidence for this interaction. These data illustrate that homing endonucleases evolve altered specificity as they adapt to recognize alternative target sites. PMID:15280510

  8. Evolution of divergent DNA recognition specificities in VDE homing endonucleases from two yeast species.

    PubMed

    Posey, Karen L; Koufopanou, Vassiliki; Burt, Austin; Gimble, Frederick S

    2004-01-01

    Homing endonuclease genes (HEGs) are mobile DNA elements that are thought to confer no benefit to their host. They encode site-specific DNA endonucleases that perpetuate the element within a species population by homing and disseminate it between species by horizontal transfer. Several yeast species contain the VMA1 HEG that encodes the intein-associated VMA1-derived endonuclease (VDE). The evolutionary state of VDEs from 12 species was assessed by assaying their endonuclease activities. Only two enzymes are active, PI-ZbaI from Zygosaccharomyces bailii and PI-ScaI from Saccharomyces cariocanus. PI-ZbaI cleaves the Z.bailii recognition sequence significantly faster than the Saccharomyces cerevisiae site, which differs at six nucleotide positions. A mutational analysis indicates that PI-ZbaI cleaves the S.cerevisiae substrate poorly due to the absence of a contact that is analogous to one made in PI-SceI between Gln-55 and nucleotides +9/+10. PI-ZbaI cleaves the Z.bailii substrate primarily due to a single base-pair substitution (A/T+5 --> T/A+5). Structural modeling of the PI-ZbaI/DNA complex suggests that Arg-331, which is absent in PI-SceI, contacts T/A+5, and the reduced activity observed in a PI-ZbaI R331A mutant provides evidence for this interaction. These data illustrate that homing endonucleases evolve altered specificity as they adapt to recognize alternative target sites.

  9. High-resolution genetic map for understanding the effect of genome-wide recombination rate, selection sweep and linkage disequilibrium on nucleotide diversity in watermelon

    USDA-ARS?s Scientific Manuscript database

    Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...

  10. Identification of Erwinia species isolated from apples and pears by differential PCR.

    PubMed

    Gehring, I; Geider, K

    2012-04-01

    Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. 2'-Bispyrene-modified 2'-O-methyl RNA probes as useful tools for the detection of RNA: synthesis, fluorescent properties, and duplex stability.

    PubMed

    Krasheninina, Olga A; Novopashina, Darya S; Lomzov, Alexander A; Venyaminova, Alya G

    2014-09-05

    The synthesis and properties two series of new 2'-O-methyl RNA probes, each containing a single insertion of a 2'-bispyrenylmethylphosphorodiamidate derivative of a nucleotide (U, C, A, and G), are described. As demonstrated by UV melting studies, the probes form stable complexes with model RNAs and DNAs. Significant increases (up to 21-fold) in pyrene excimer fluorescence intensity were observed upon binding of most of the probes with complementary RNAs, but not with DNAs. The fluorescence spectra are independent of the nature of the modified nucleotides. The nucleotides on the 5'-side of the modified nucleotide have no effect on the fluorescence spectra, whereas the natures of the two nucleotides on the 3'-side are important: CC, CG, and UC dinucleotide units on the 3'-side of the modified nucleotide provide the maximum increases in excimer fluorescence intensity. This study suggests that these 2'-bispyrene-labeled 2'-O-methyl RNA probes might be useful tools for detection of RNAs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Antinociceptive effect of purine nucleotides.

    PubMed

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  13. Negative Enrichment and Isolation of Circulating Tumor Cells for Whole Genome Amplification.

    PubMed

    Kanwar, Nisha; Done, Susan J

    2017-01-01

    Circulating tumor cells (CTCs) are a rare population of cells found in the peripheral blood of patients with many types of cancer such as breast, prostate, colon, and lung cancers. Higher numbers of these cells in blood are associated with a poorer prognosis of patients. Genomic profiling of CTCs would help characterize markers specific for the identification of these cells in blood, and also define genomic alterations that give these cells a metastatic advantage over other cells in the primary tumor. Here, we describe an immunomagnetic method to enrich CTCs from the blood of patients with breast cancer, followed by single-cell laser capture microdissection to isolate single CTCs. Whole genome amplification of isolated CTCs allows for many downstream applications to be performed to aide in their characterization, such as whole genome or exome sequencing, Single Nucleotide Polymorphism (SNP) and copy number analysis, and targeted sequencing or quantitative Polymerase Chain Reaction (qPCR) for genomic analyses.

  14. A homogeneous nucleic acid hybridization assay based on strand displacement.

    PubMed Central

    Vary, C P

    1987-01-01

    A homogeneous nucleic acid hybridization assay which is conducted in solution and requires no separation steps is described. The assay is based on the concept of strand displacement. In the strand displacement assay, an RNA "signal strand" is hybridized within a larger DNA strand termed the "probe strand", which is, in turn, complementary to the target nucleic acid of interest. Hybridization of the target nucleic acid with the probe strand ultimately results in displacement of the RNA signal strand. Strand displacement, therefore, causes conversion of the RNA from double to single-stranded form. The single-strand specificity of polynucleotide phosphorylase (EC 2.7.7.8) allows discrimination between double-helical and single-stranded forms of the RNA signal strand. As displacement proceeds, free RNA signal strands are preferentially phosphorolyzed to component nucleoside diphosphates, including adenosine diphosphate. The latter nucleotide is converted to ATP by pyruvate kinase(EC 2.7.1.40). Luciferase catalyzed bioluminescence is employed to measure the ATP generated as a result of strand displacement. Images PMID:3309890

  15. Ultrasensitive electrochemical biosensor for detection of DNA from Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification.

    PubMed

    Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan

    2014-09-02

    A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.

  16. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by Mismatch and Double-strand Break Repair DNA substrates

    PubMed Central

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M.; Bianco, Piero R.; Surtees, Jennifer A.

    2014-01-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3′ non-homologous tail removal (3′NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3′ NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3′ NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3′ NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. PMID:24746922

  18. Unique Structural and Nucleotide Exchange Features of the Rho1 GTPase of Entamoeba histolytica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bosch, Dustin E.; Wittchen, Erika S.; Qiu, Connie

    The single-celled human parasite Entamoeba histolytica possesses a dynamic actin cytoskeleton vital for its intestinal and systemic pathogenicity. The E. histolytica genome encodes several Rho family GTPases known to regulate cytoskeletal dynamics. EhRho1, the first family member identified, was reported to be insensitive to the Rho GTPase-specific Clostridium botulinum C3 exoenzyme, raising the possibility that it may be a misclassified Ras family member. Here, we report the crystal structures of EhRho1 in both active and inactive states. EhRho1 is activated by a conserved switch mechanism, but diverges from mammalian Rho GTPases in lacking a signature Rho insert helix. EhRho1 engagesmore » a homolog of mDia, EhFormin1, suggesting a role in mediating serum-stimulated actin reorganization and microtubule formation during mitosis. EhRho1, but not a constitutively active mutant, interacts with a newly identified EhRhoGDI in a prenylation-dependent manner. Furthermore, constitutively active EhRho1 induces actin stress fiber formation in mammalian fibroblasts, thereby identifying it as a functional Rho family GTPase. EhRho1 exhibits a fast rate of nucleotide exchange relative to mammalian Rho GTPases due to a distinctive switch one isoleucine residue reminiscent of the constitutively active F28L mutation in human Cdc42, which for the latter protein, is sufficient for cellular transformation. Nonconserved, nucleotide-interacting residues within EhRho1, revealed by the crystal structure models, were observed to contribute a moderating influence on fast spontaneous nucleotide exchange. Collectively, these observations indicate that EhRho1 is a bona fide member of the Rho GTPase family, albeit with unique structural and functional aspects compared with mammalian Rho GTPases.« less

  19. Probing Gαi1 Protein Activation at Single Amino Acid Resolution

    PubMed Central

    Sun, Dawei; Maeda, Shoji; Matkovic, Milos; Mendieta, Sandro; Mayer, Daniel; Dawson, Roger; Schertler, Gebhard F.X.; Madan Babu, M.; Veprintsev, Dmitry B.

    2016-01-01

    We present comprehensive single amino acid resolution maps of the residues stabilising the human Gαi1 subunit in nucleotide- and receptor-bound states. We generated these maps by measuring the effects of alanine mutations on the stability of Gαi1 and of the rhodopsin-Gαi1 complex. We identified stabilization clusters in the GTPase and helical domains responsible for structural integrity and the conformational changes associated with activation. In activation cluster I, helices α1 and α5 pack against strands β1-3 to stabilize the nucleotide-bound states. In the receptor-bound state, these interactions are replaced by interactions between α5 and strands β4-6. Key residues in this cluster are Y320, crucial for the stabilization of the receptor-bound state, and F336, which stabilizes nucleotide-bound states. Destabilization of helix α1, caused by rearrangement of this activation cluster, leads to the weakening of the inter-domain interface and release of GDP. PMID:26258638

  20. Multiplexed droplet single-cell RNA-sequencing using natural genetic variation.

    PubMed

    Kang, Hyun Min; Subramaniam, Meena; Targ, Sasha; Nguyen, Michelle; Maliskova, Lenka; McCarthy, Elizabeth; Wan, Eunice; Wong, Simon; Byrnes, Lauren; Lanata, Cristina M; Gate, Rachel E; Mostafavi, Sara; Marson, Alexander; Zaitlen, Noah; Criswell, Lindsey A; Ye, Chun Jimmie

    2018-01-01

    Droplet single-cell RNA-sequencing (dscRNA-seq) has enabled rapid, massively parallel profiling of transcriptomes. However, assessing differential expression across multiple individuals has been hampered by inefficient sample processing and technical batch effects. Here we describe a computational tool, demuxlet, that harnesses natural genetic variation to determine the sample identity of each droplet containing a single cell (singlet) and detect droplets containing two cells (doublets). These capabilities enable multiplexed dscRNA-seq experiments in which cells from unrelated individuals are pooled and captured at higher throughput than in standard workflows. Using simulated data, we show that 50 single-nucleotide polymorphisms (SNPs) per cell are sufficient to assign 97% of singlets and identify 92% of doublets in pools of up to 64 individuals. Given genotyping data for each of eight pooled samples, demuxlet correctly recovers the sample identity of >99% of singlets and identifies doublets at rates consistent with previous estimates. We apply demuxlet to assess cell-type-specific changes in gene expression in 8 pooled lupus patient samples treated with interferon (IFN)-β and perform eQTL analysis on 23 pooled samples.

Top