Compositions and methods for detecting single nucleotide polymorphisms

DOEpatents

Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

2016-11-22

Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

[Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

PubMed

Li, Su-Xia

2004-12-01

Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

PubMed

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.

PubMed

Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru

2015-11-01

Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.

Bitterness of the Non-nutritive Sweetener Acesulfame Potassium Varies With Polymorphisms in TAS2R9 and TAS2R31

PubMed Central

2013-01-01

Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

PubMed Central

El-Sabrout, Karim; Aggag, Sarah A.

2017-01-01

Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

PubMed

Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

2017-09-01

Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.

Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

PubMed

Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

2012-10-01

To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

Calving traits of crossbred Brahman Cows are Associated with Heat Shock Protein 70 Genetic Polymorphisms

USDA-ARS?s Scientific Manuscript database

Objectives were to: 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 gene, and 2) evaluate associations between Hsp70 SNP and calving rates of Brahman-influenced cows. Specific primers were designed for PCR amplification of a 539 b...

Detection of single-nucleotide polymorphisms using gold nanoparticles and single-strand-specific nucleases.

PubMed

Chen, Yen-Ting; Hsu, Chiao-Ling; Hou, Shao-Yi

2008-04-15

The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.

Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

Human leukocyte antigen and cytokine receptor gene polymorphisms associated with heterogeneous immune responses to mumps viral vaccine.

PubMed

Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A

2008-05-01

Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine-induced immune responses.

Human Leukocyte Antigen and Cytokine Receptor Gene Polymorphisms Associated With Heterogeneous Immune Responses to Mumps Viral Vaccine

PubMed Central

Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.

2009-01-01

OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine–induced immune responses. PMID:18450852

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan

Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less

Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

PubMed

Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

2016-04-01

Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

NASA Astrophysics Data System (ADS)

Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

2016-05-01

A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c

Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

PubMed Central

Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

2016-01-01

Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

PubMed

Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

2012-05-01

Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

PubMed

Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

2018-01-01

To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

PubMed

Kemp, S J; Maillard, J C; Teale, A J

1993-04-01

A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

Prediction of Adult Dyslipidemia Using Genetic and Childhood Clinical Risk Factors: The Cardiovascular Risk in Young Finns Study.

PubMed

Nuotio, Joel; Pitkänen, Niina; Magnussen, Costan G; Buscot, Marie-Jeanne; Venäläinen, Mikko S; Elo, Laura L; Jokinen, Eero; Laitinen, Tomi; Taittonen, Leena; Hutri-Kähönen, Nina; Lyytikäinen, Leo-Pekka; Lehtimäki, Terho; Viikari, Jorma S; Juonala, Markus; Raitakari, Olli T

2017-06-01

Dyslipidemia is a major modifiable risk factor for cardiovascular disease. We examined whether the addition of novel single-nucleotide polymorphisms for blood lipid levels enhances the prediction of adult dyslipidemia in comparison to childhood lipid measures. Two thousand four hundred and twenty-two participants of the Cardiovascular Risk in Young Finns Study who had participated in 2 surveys held during childhood (in 1980 when aged 3-18 years and in 1986) and at least once in a follow-up study in adulthood (2001, 2007, and 2011) were included. We examined whether inclusion of a lipid-specific weighted genetic risk score based on 58 single-nucleotide polymorphisms for low-density lipoprotein cholesterol, 71 single-nucleotide polymorphisms for high-density lipoprotein cholesterol, and 40 single-nucleotide polymorphisms for triglycerides improved the prediction of adult dyslipidemia compared with clinical childhood risk factors. Adjusting for age, sex, body mass index, physical activity, and smoking in childhood, childhood lipid levels, and weighted genetic risk scores were associated with an increased risk of adult dyslipidemia for all lipids. Risk assessment based on 2 childhood lipid measures and the lipid-specific weighted genetic risk scores improved the accuracy of predicting adult dyslipidemia compared with the approach using only childhood lipid measures for low-density lipoprotein cholesterol (area under the receiver-operating characteristic curve 0.806 versus 0.811; P =0.01) and triglycerides (area under the receiver-operating characteristic curve 0.740 versus area under the receiver-operating characteristic curve 0.758; P <0.01). The overall net reclassification improvement and integrated discrimination improvement were significant for all outcomes. The inclusion of weighted genetic risk scores to lipid-screening programs in childhood could modestly improve the identification of those at highest risk of dyslipidemia in adulthood. © 2017 American Heart Association, Inc.

Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

PubMed

Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

2018-04-01

Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

PubMed

Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

2016-11-01

Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

PubMed Central

Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

2016-01-01

Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

USDA-ARS?s Scientific Manuscript database

High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

USDA-ARS?s Scientific Manuscript database

Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

USDA-ARS?s Scientific Manuscript database

We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

USDA-ARS?s Scientific Manuscript database

Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

USDA-ARS?s Scientific Manuscript database

Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

USDA-ARS?s Scientific Manuscript database

Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

PubMed

Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

2017-06-13

We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

Development of a rapid serotyping method for Salmonella enterica using serotype-specific single-nucleotide polymorphisms

USDA-ARS?s Scientific Manuscript database

Salmonella enterica subsp. enterica serotype Enteriditis (S. Enteriditis) is the leading cause of salmonellosis worldwide, including the USA. Many S. enterica serotypes known to cause foodborne disease are associated with broiler meat contamination. While some serotypes are specific to birds (S. e...

Using of methods of speckle optics for Chlamydia trachomatis typing

NASA Astrophysics Data System (ADS)

Ulyanov, Sergey S.; Zaytsev, Sergey S.; Ulianova, Onega V.; Saltykov, Yury V.; Feodorova, Valentina A.

2017-03-01

Specific method of transformation of nucleotide of gene into speckle pattern is suggested. Reference speckle pattern of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci as well is generated. Perspectives of proposed technique in the gene identification and detection of natural genetic mutations as single nucleotide polymorphism (SNP) are demonstrated.

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

USDA-ARS?s Scientific Manuscript database

Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

Prospects for inferring pairwise relationships with single nucleotide polymorphisms

Treesearch

Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

2003-01-01

An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

USDA-ARS?s Scientific Manuscript database

Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

USDA-ARS?s Scientific Manuscript database

Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

PubMed

Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

2017-06-26

Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

NASA Astrophysics Data System (ADS)

Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

2016-05-01

We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

Comparison of two PCR-based methods and automated DNA sequencing for prop-1 genotyping in Ames dwarf mice.

PubMed

Gerstner, Arpad; DeFord, James H; Papaconstantinou, John

2003-07-25

Ames dwarfism is caused by a homozygous single nucleotide mutation in the pituitary specific prop-1 gene, resulting in combined pituitary hormone deficiency, reduced growth and extended lifespan. Thus, these mice serve as an important model system for endocrinological, aging and longevity studies. Because the phenotype of wild type and heterozygous mice is undistinguishable, it is imperative for successful breeding to accurately genotype these animals. Here we report a novel, yet simple, approach for prop-1 genotyping using PCR-based allele-specific amplification (PCR-ASA). We also compare this method to other potential genotyping techniques, i.e. PCR-based restriction fragment length polymorphism analysis (PCR-RFLP) and fluorescence automated DNA sequencing. We demonstrate that the single-step PCR-ASA has several advantages over the classical PCR-RFLP because the procedure is simple, less expensive and rapid. To further increase the specificity and sensitivity of the PCR-ASA, we introduced a single-base mismatch at the 3' penultimate position of the mutant primer. Our results also reveal that the fluorescence automated DNA sequencing has limitations for detecting a single nucleotide polymorphism in the prop-1 gene, particularly in heterozygotes.

Variation of Cats under Domestication: Genetic Assignment of Domestic Cats to Breeds and Worldwide Random Bred Populations

PubMed Central

Kurushima, J. D.; Lipinski, M. J.; Gandolfi, B.; Froenicke, L.; Grahn, J. C.; Grahn, R. A.; Lyons, L. A.

2012-01-01

Summary Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40–50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (accuracy single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the mis-assigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multi-step assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, i.e. race. PMID:23171373

Mismatch cleavage by single-strand specific nucleases

PubMed Central

Till, Bradley J.; Burtner, Chris; Comai, Luca; Henikoff, Steven

2004-01-01

We have investigated the ability of single-strand specific (sss) nucleases from different sources to cleave single base pair mismatches in heteroduplex DNA templates used for mutation and single-nucleotide polymorphism analysis. The TILLING (Targeting Induced Local Lesions IN Genomes) mismatch cleavage protocol was used with the LI-COR gel detection system to assay cleavage of amplified heteroduplexes derived from a variety of induced mutations and naturally occurring polymorphisms. We found that purified nucleases derived from celery (CEL I), mung bean sprouts and Aspergillus (S1) were able to specifically cleave nearly all single base pair mismatches tested. Optimal nicking of heteroduplexes for mismatch detection was achieved using higher pH, temperature and divalent cation conditions than are routinely used for digestion of single-stranded DNA. Surprisingly, crude plant extracts performed as well as the highly purified preparations for this application. These observations suggest that diverse members of the S1 family of sss nucleases act similarly in cleaving non-specifically at bulges in heteroduplexes, and single-base mismatches are the least accessible because they present the smallest single-stranded region for enzyme binding. We conclude that a variety of sss nucleases and extracts can be effectively used for high-throughput mutation and polymorphism discovery. PMID:15141034

A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

NASA Astrophysics Data System (ADS)

Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

2016-04-01

We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

ERIC Educational Resources Information Center

Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

2012-01-01

Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

USDA-ARS?s Scientific Manuscript database

Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

USDA-ARS?s Scientific Manuscript database

Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

PubMed

Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

2018-02-23

The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

Large-Scale Development of Cost-Effective Single-Nucleotide Polymorphism Marker Assays for Genetic Mapping in Pigeonpea and Comparative Mapping in Legumes

PubMed Central

Saxena, Rachit K.; Varma Penmetsa, R.; Upadhyaya, Hari D.; Kumar, Ashish; Carrasquilla-Garcia, Noelia; Schlueter, Jessica A.; Farmer, Andrew; Whaley, Adam M.; Sarma, Birinchi K.; May, Gregory D.; Cook, Douglas R.; Varshney, Rajeev K.

2012-01-01

Single-nucleotide polymorphisms (SNPs, >2000) were discovered by using RNA-seq and allele-specific sequencing approaches in pigeonpea (Cajanus cajan). For making the SNP genotyping cost-effective, successful competitive allele-specific polymerase chain reaction (KASPar) assays were developed for 1616 SNPs and referred to as PKAMs (pigeonpea KASPar assay markers). Screening of PKAMs on 24 genotypes [23 from cultivated species and 1 wild species (Cajanus scarabaeoides)] defined a set of 1154 polymorphic markers (77.4%) with a polymorphism information content (PIC) value from 0.04 to 0.38. One thousand and ninety-four PKAMs showed polymorphisms between parental lines of the reference mapping population (C. cajan ICP 28 × C. scarabaeoides ICPW 94). By using high-quality marker genotyping data on 167 F2 lines from the population, a comprehensive genetic map comprising 875 PKAMs with an average inter-marker distance of 1.11 cM was developed. Previously mapped 35 simple sequence repeat markers were integrated into the PKAM map and an integrated genetic map of 996.21 cM was constructed. Mapped PKAMs showed a higher degree of synteny with the genome of Glycine max followed by Medicago truncatula and Lotus japonicus and least with Vigna unguiculata. These PKAMs will be useful for genetics research and breeding applications in pigeonpea and for utilizing genome information from other legume species. PMID:23103470

Single nucleotide polymorphisms of TNF-Α gene in febrile seizures.

PubMed

Zare-Shahabadi, Ameneh; Ashrafi, Mahmoud Reza; Shahrokhi, Amin; Soltani, Samaneh; Zoghi, Samaneh; Soleimani, Farin; Vameghi, Roshanak; Badv, Reza Shervin; Rezaei, Nima

2015-09-15

Febrile seizures (FS) is the most common seizure disorder during childhood. This study was performed in 78 patients with FS and 137 control subjects to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence specific primers method. The highest positive allelic association that made the patients susceptible to FS was seen for TNF-α -238/G (p<0.0001). The GG genotype at TNF-α -238 was significantly higher in the patients with FS, compared to the controls (p=0.0001). Also, GA genotype at the same position was significantly lower in patients than in controls (P=0.0001). The GG haplotype had a significant positive association at TNF-α (308, 238) while GA haplotype showed a negative association (P<0.001). Our data support the idea that TNF-α single-nucleotide polymorphisms play a role in the pathogenesis of FS. Copyright © 2015 Elsevier B.V. All rights reserved.

The Single Nucleotide Polymorphism Consortium

NASA Technical Reports Server (NTRS)

Morgan, Michael

2003-01-01

I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

Analysis of single nucleotide polymorphisms in case-control studies.

PubMed

Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

2011-01-01

Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

PubMed

Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

2012-09-04

A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

USDA-ARS?s Scientific Manuscript database

The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

NASA Astrophysics Data System (ADS)

Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

2015-11-01

Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

The origin of multiple clones in the parthenogenetic lizard species Darevskia rostombekowi.

PubMed

Ryskov, Alexey P; Osipov, Fedor A; Omelchenko, Andrey V; Semyenova, Seraphima K; Girnyk, Anastasiya E; Korchagin, Vitaly I; Vergun, Andrey A; Murphy, Robert W

2017-01-01

The all-female Caucasian rock lizard Darevskia rostombekowi and other unisexual species of this genus reproduce normally via true parthenogenesis. Typically, diploid parthenogenetic reptiles exhibit some amount of clonal diversity. However, allozyme data from D. rostombekowi have suggested that this species consists of a single clone. Herein, we test this hypothesis by evaluating variation at three variable microsatellite loci for 42 specimens of D. rostombekowi from four populations in Armenia. Analyses based on single nucleotide polymorphisms of each locus reveal five genotypes or presumptive clones in this species. All individuals are heterozygous at the loci. The major clone occurs in 24 individuals and involves three populations. Four rare clones involve one or several individuals from one or two populations. Most variation owes to parent-specific single nucleotide polymorphisms, which occur as heterozygotes. This result fails to reject the hypothesis of a single hybridization founder event that resulted in the initial formation of one major clone. The other clones appear to have originated via post-formation microsatellite mutations of the major clone.

Demonstration of Protein-Based Human Identification Using the Hair Shaft Proteome

PubMed Central

Leppert, Tami; Anex, Deon S.; Hilmer, Jonathan K.; Matsunami, Nori; Baird, Lisa; Stevens, Jeffery; Parsawar, Krishna; Durbin-Johnson, Blythe P.; Rocke, David M.; Nelson, Chad; Fairbanks, Daniel J.; Wilson, Andrew S.; Rice, Robert H.; Woodward, Scott R.; Bothner, Brian; Hart, Bradley R.; Leppert, Mark

2016-01-01

Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 single nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). This study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts. PMID:27603779

A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

PubMed Central

Urschitz, Johann; Sultan, Omar; Ward, Kenneth

2011-01-01

Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

USDA-ARS?s Scientific Manuscript database

Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

ERIC Educational Resources Information Center

Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

2010-01-01

Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

USDA-ARS?s Scientific Manuscript database

The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

Treesearch

Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

2016-01-01

Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

ERIC Educational Resources Information Center

Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

2017-01-01

Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

PubMed

Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

2007-08-31

Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

Genetic Factors Influencing Coagulation Factor XIII B-Subunit Contribute to Risk of Ischemic Stroke.

PubMed

Hanscombe, Ken B; Traylor, Matthew; Hysi, Pirro G; Bevan, Stephen; Dichgans, Martin; Rothwell, Peter M; Worrall, Bradford B; Seshadri, Sudha; Sudlow, Cathie; Williams, Frances M K; Markus, Hugh S; Lewis, Cathryn M

2015-08-01

Abnormal coagulation has been implicated in the pathogenesis of ischemic stroke, but how this association is mediated and whether it differs between ischemic stroke subtypes is unknown. We determined the shared genetic risk between 14 coagulation factors and ischemic stroke and its subtypes. Using genome-wide association study results for 14 coagulation factors from the population-based TwinsUK sample (N≈2000 for each factor), meta-analysis results from the METASTROKE consortium ischemic stroke genome-wide association study (12 389 cases, 62 004 controls), and genotype data for 9520 individuals from the WTCCC2 ischemic stroke study (3548 cases, 5972 controls-the largest METASTROKE subsample), we explored shared genetic risk for coagulation and stroke. We performed three analyses: (1) a test for excess concordance (or discordance) in single nucleotide polymorphism effect direction across coagulation and stroke, (2) an estimation of the joint effect of multiple coagulation-associated single nucleotide polymorphisms in stroke, and (3) an evaluation of common genetic risk between coagulation and stroke. One coagulation factor, factor XIII subunit B (FXIIIB), showed consistent effects in the concordance analysis, the estimation of polygenic risk, and the validation with genotype data, with associations specific to the cardioembolic stroke subtype. Effect directions for FXIIIB-associated single nucleotide polymorphisms were significantly discordant with cardioembolic disease (smallest P=5.7×10(-04)); the joint effect of FXIIIB-associated single nucleotide polymorphisms was significantly predictive of ischemic stroke (smallest P=1.8×10(-04)) and the cardioembolic subtype (smallest P=1.7×10(-04)). We found substantial negative genetic covariation between FXIIIB and ischemic stroke (rG=-0.71, P=0.01) and the cardioembolic subtype (rG=-0.80, P=0.03). Genetic markers associated with low FXIIIB levels increase risk of ischemic stroke cardioembolic subtype. © 2015 The Authors.

Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

USDA-ARS?s Scientific Manuscript database

In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

Rhabdomyolysis After Out-of-Water Exercise in an Elite Adolescent Water Polo Player Carrying the IL-6 174C Allele Single-Nucleotide Polymorphism.

PubMed

Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan

2015-12-01

We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.

Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply.

PubMed

Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei

2017-08-01

Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Polymorphisms in the microglial marker molecule CX3CR1 affect the blood volume of the human brain.

PubMed

Sakai, Mai; Takeuchi, Hikaru; Yu, Zhiqian; Kikuchi, Yoshie; Ono, Chiaki; Takahashi, Yuta; Ito, Fumiaki; Matsuoka, Hiroo; Tanabe, Osamu; Yasuda, Jun; Taki, Yasuyuki; Kawashima, Ryuta; Tomita, Hiroaki

2018-06-01

CX3CR1, a G-protein-coupled receptor, is involved in various inflammatory processes. Two non-synonymous single nucleotide polymorphisms, V249I (rs3732379) and T280M (rs3732378), are located in the sixth and seventh transmembrane domains of the CX3CR1 protein, respectively. Previous studies have indicated significant associations between T280M and leukocyte functional characteristics, including adhesion, signaling, and chemotaxis, while the function of V249I is unclear. In the brain, microglia are the only proven and widely accepted CX3CR1-expressing cells. This study aimed to specify whether there were specific brain regions on which these two single nucleotide polymorphisms exert their biological impacts through their functional effects on microglia. Associations between the single nucleotide polymorphisms and brain characteristics, including gray and white matter volumes, white matter integrity, resting arterial blood volume, and cerebral blood flow, were evaluated among 1300 healthy Japanese individuals. The major allele carriers (V249 and T280) were significantly associated with an increased total arterial blood volume of the whole brain, especially around the bilateral precuneus, left posterior cingulate cortex, and left posterior parietal cortex. There were no significant associations between the genotypes and other brain structural indicators. This finding suggests that the CX3CR1 variants may affect arterial structures in the brain, possibly via interactions between microglia and brain microvascular endothelial cells. © 2018 The Authors. Psychiatry and Clinical Neurosciences © 2018 Japanese Society of Psychiatry and Neurology.

Genes determining the severity of cerebral palsy: the role of single nucleotide polymorphisms on the amount and structure of apolipoprotein E

PubMed Central

Lien, Espen; Andersen, Guro; Bao, Yongde; Gordish-Dressman, Heather; Skranes, Jon S.; Blackman, James A.; Vik, Torstein

2015-01-01

Aim ApolipoproteinE (apoE) influences repair and other processes in the brain and the apoE4 variant is a risk factor for Alzheimer's disease and for prolonged recovery following traumatic brain injury. We previously reported that specific single nucleotide polymorphisms in the APOE or TOMM40 genes affecting the structure and production of apoE were associated with epilepsy, more impaired hand function and gastrostomy tube feeding in children with cerebral palsy (CP). This study explored how various combinations of the same polymorphisms may affect these clinical manifestations. Methods Successful DNA analyses of APOE and TOMM40 were carried out on 227 children. The CP Register of Norway provided details of gross and fine motor function, epilepsy and gastrostomy tube feeding. Possible associations between these clinical manifestations and various combinations of the APOEε2, ε3 or ε4 alleles and of the rs59007384 polymorphism in the TOMM40 gene were explored. Results Epilepsy, impaired fine motor function and gastrostomy tube feeding were less common in children carrying the combination of rs59007384 GG and APOEε2 or ε3 than in children with other combinations. Conclusion Our findings suggest that specific combinations of genes influence the structure and production of apoE differently and affect the clinical manifestations of CP. PMID:25703783

Population-Specific Patterns of Linkage Disequilibrium and SNP Variation in Spring and Winter Polyploid Wheat

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are ideally suited for the construction of high-resolution genetic maps, studying population evolutionary history and performing genome-wide association mapping experiments. Here we used a genome-wide set of 1536 SNPs to study linkage disequilibrium (LD) and po...

Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

PubMed Central

Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

2015-01-01

Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

PubMed Central

Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

2013-01-01

In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

Pneumonic Plague Outbreak, Northern Madagascar, 2011

PubMed Central

Richard, Vincent; Herindrainy, Perlinot; Soanandrasana, Rahelinirina; Ratsitoharina, Maherisoa; Rakotomanana, Fanjasoa; Andrianalimanana, Samuel; Scholz, Holger C.; Rajerison, Minoarisoa

2015-01-01

Yersinia pestis, the causative agent of plague, is endemic to Madagascar, particularly to the central highlands. Although plague has not been previously reported in northern Madagascar, an outbreak of pneumonic plague occurred in this remote area in 2011. Over a 27-day period, 17 suspected, 2 presumptive, and 3 confirmed human cases were identified, and all 15 untreated 20 patients died. Molecular typing of Y. pestis isolated from 2 survivors and 5 Rattus rattus rat samples identified the Madagascar-specific 1.ORI3-k single-nucleotide polymorphism genotype and 4 clustered regularly interspaced short palindromic repeat patterns. This outbreak had a case-fatality rate of 100% for nontreated patients. The Y. pestis 1.ORI3-k single-nucleotide polymorphism genotype might cause larger epidemics. Multidrug-resistant strains and persistence of the pathogen in natural foci near human settlements pose severe risks to populations in plague-endemic regions and require outbreak response strategies. PMID:25530466

Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

PubMed Central

Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

2006-01-01

Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

DTIC Science & Technology

2013-10-01

identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

Canine olfactory receptor gene polymorphism and its relation to odor detection performance by sniffer dogs.

PubMed

Lesniak, Anna; Walczak, Marta; Jezierski, Tadeusz; Sacharczuk, Mariusz; Gawkowski, Maciej; Jaszczak, Kazimierz

2008-01-01

The outstanding sensitivity of the canine olfactory system has been acknowledged by using sniffer dogs in military and civilian service for detection of a variety of odors. It is hypothesized that the canine olfactory ability is determined by polymorphisms in olfactory receptor (OR) genes. We investigated 5 OR genes for polymorphic sites which might affect the olfactory ability of service dogs in different fields of specific substance detection. All investigated OR DNA sequences proved to have allelic variants, the majority of which lead to protein sequence alteration. Homozygous individuals at 2 gene loci significantly differed in their detection skills from other genotypes. This suggests a role of specific alleles in odor detection and a linkage between single-nucleotide polymorphism and odor recognition efficiency.

Mycobacterium leprae: genes, pseudogenes and genetic diversity

PubMed Central

Singh, Pushpendra; Cole, Stewart T

2011-01-01

Leprosy, which has afflicted human populations for millenia, results from infection with Mycobacterium leprae, an unculturable pathogen with an exceptionally long generation time. Considerable insight into the biology and drug resistance of the leprosy bacillus has been obtained from genomics. M. leprae has undergone reductive evolution and pseudogenes now occupy half of its genome. Comparative genomics of four different strains revealed remarkable conservation of the genome (99.995% identity) yet uncovered 215 polymorphic sites, mainly single nucleotide polymorphisms, and a handful of new pseudogenes. Mapping these polymorphisms in a large panel of strains defined 16 single nucleotide polymorphism-subtypes that showed strong geographical associations and helped retrace the evolution of M. leprae. PMID:21162636

Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

PubMed

Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

2016-06-01

We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

Bayesian analysis of parent-specific transmission ratio distortion in seven Spanish beef cattle breeds.

PubMed

Casellas, J; Cañas-Álvarez, J J; González-Rodríguez, A; Puig-Oliveras, A; Fina, M; Piedrafita, J; Molina, A; Díaz, C; Baró, J A; Varona, L

2017-02-01

Transmission ratio distortion (TRD) is the departure from the expected Mendelian ratio in offspring, a poorly investigated biological phenomenon in livestock species. Given the current availability of specific parametric methods for the analysis of segregation data, this study focused on the screening of TRD in 602 402 single nucleotide polymorphisms covering all autosomal chromosomes in seven Spanish beef cattle breeds. On average, 0.13% (n = 786) and 0.01% (n = 29) of genetic markers evidenced sire- or dam-specific TRD respectively. There were no single nucleotide polymorphisms accounting for both sire- and dam-specific TRD at the same time, and only one marker (rs43147474) accounted for (sire-specific) TRD in all seven breeds. It must be noted that rs43147474 is located in the fourth intronic region of the GTP-binding protein 10 gene, and this locus has been previously linked to the maintenance of mitochondria and nucleolar architectures. Alternatively, other candidate genes surround this hot-spot for sire-specific TRD in the cattle genome, and they are related to embryonic and postnatal lethality as well as prostate cancer, among others. This research characterized the distribution of TRD in the bovine genome, highlighting heterogeneous results when comparing across breeds. © 2016 Stichting International Foundation for Animal Genetics.

High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

PubMed Central

Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

2006-01-01

Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

Genetic risk profiling and gene signature modeling to predict risk of complications after IPAA.

PubMed

Sehgal, Rishabh; Berg, Arthur; Polinski, Joseph I; Hegarty, John P; Lin, Zhenwu; McKenna, Kevin J; Stewart, David B; Poritz, Lisa S; Koltun, Walter A

2012-03-01

Severe pouchitis and Crohn's disease-like complications are 2 adverse postoperative complications that confound the success of the IPAA in patients with ulcerative colitis. To date, approximately 83 single nucleotide polymorphisms within 55 genes have been associated with IBD. The aim of this study was to identify single-nucleotide polymorphisms that correlate with complications after IPAA that could be utilized in a gene signature fashion to predict postoperative complications and aid in preoperative surgical decision making. One hundred forty-two IPAA patients were retrospectively classified as "asymptomatic" (n = 104, defined as no Crohn's disease-like complications or severe pouchitis for at least 2 years after IPAA) and compared with a "severe pouchitis" group (n = 12, ≥ 4 episodes pouchitis per year for 2 years including the need for long-term therapy to maintain remission) and a "Crohn's disease-like" group (n = 26, presence of fistulae, pouch inlet stricture, proximal small-bowel disease, or pouch granulomata, occurring at least 6 months after surgery). Genotyping for 83 single-nucleotide polymorphisms previously associated with Crohn's disease and/or ulcerative colitis was performed on a customized Illumina genotyping platform. The top 2 single-nucleotide polymorphisms statistically identified as being independently associated with each of Crohn's disease-like and severe pouchitis were used in a multivariate logistic regression model. These single-nucleotide polymorphisms were then used to create probability equations to predict overall chance of a positive or negative outcome for that complication. The top 2 single-nucleotide polymorphisms for Crohn's disease-like complications were in the 10q21 locus and the gene for PTGER4 (p = 0.006 and 0.007), whereas for severe pouchitis it was NOD2 and TNFSF15 (p = 0.003 and 0.011). Probability equations suggested that the risk of these 2 complications greatly increased with increasing number of risk alleles, going as high as 92% for severe pouchitis and 65% for Crohn's disease-like complications. In this IPAA patient cohort, mutations in the 10q21 locus and the PTGER4 gene were associated with Crohn's disease-like complications, whereas mutations in NOD2 and TNFSF15 correlated with severe pouchitis. Preoperative genetic analysis and use of such gene signatures hold promise for improved preoperative surgical patient selection to minimize these IPAA complications.

Using haplotypes to unravel the inheritance of Holstein coat color for a larger audience

USDA-ARS?s Scientific Manuscript database

Haplotype testing identifies single-nucleotide polymorphisms that bracket a group of alleles from several different genes located on a specific chromosomal section of DNA. For a trait with a limited number of genotypes and phenotypes, the rules of inheritance can be determined by matching up certain...

Rapid molecular pathotyping of major salmonella enterica serotypes based on single-nucleotide polymorphisms (SNPs) in the adenylate cyclase (cyaA) gene

USDA-ARS?s Scientific Manuscript database

Introduction: Salmonella enterica subsp. enterica serotype Enteriditis (S. Enteriditis) is the leading cause of salmonellosis worldwide, including the USA. Many S. enterica serotypes known to cause foodborne disease are associated with broiler meat contamination. While some serotypes are specific...

Using Single-nucleotide Polymorphisms and Genetic Mapping to find Candidate Genes that Influence Varroa-Specific Hygiene

USDA-ARS?s Scientific Manuscript database

Varroa-sensitive hygienic (VSH) behavior is one of two behaviors identified that are most important for controlling the growth of Varroa mite populations in bee hives. A study was conducted to map quantitative trait loci (QTL) that influence VSH so that resistance genes could be identified. Crosses ...

The regulated secretory pathway and human disease: insights from gene variants and single nucleotide polymorphisms.

PubMed

Lin, Wei-Jye; Salton, Stephen R

2013-01-01

The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.

The Regulated Secretory Pathway and Human Disease: Insights from Gene Variants and Single Nucleotide Polymorphisms

PubMed Central

Lin, Wei-Jye; Salton, Stephen R.

2013-01-01

The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired. PMID:23964269

Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

DOE PAGES

Parker, Glendon J.; Leppert, Tami; Anex, Deon S.; ...

2016-09-07

Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parker, Glendon J.; Leppert, Tami; Anex, Deon S.

Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

PubMed

Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

2009-06-15

DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

PubMed Central

Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

2016-01-01

Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?

USDA-ARS?s Scientific Manuscript database

Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...

Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

PubMed

Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

2005-02-01

Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

Functional Analysis of a Novel Genome-Wide Association Study Signal in SMAD3 That Confers Protection From Coronary Artery Disease.

PubMed

Turner, Adam W; Martinuk, Amy; Silva, Anada; Lau, Paulina; Nikpay, Majid; Eriksson, Per; Folkersen, Lasse; Perisic, Ljubica; Hedin, Ulf; Soubeyrand, Sebastien; McPherson, Ruth

2016-05-01

A recent genome-wide association study meta-analysis identified an intronic single nucleotide polymorphism in SMAD3, rs56062135C>T, the minor allele (T) which associates with protection from coronary artery disease. Relevant to atherosclerosis, SMAD3 is a key contributor to transforming growth factor-β pathway signaling. Here, we seek to identify ≥1 causal coronary artery disease-associated single nucleotide polymorphisms at the SMAD3 locus and characterize mechanisms whereby the risk allele(s) contribute to coronary artery disease risk. By genetic and epigenetic fine mapping, we identified a candidate causal single nucleotide polymorphism rs17293632C>T (D', 0.97; r(2), 0.94 with rs56062135) in intron 1 of SMAD3 with predicted functional effects. We show that the sequence encompassing rs17293632 acts as a strong enhancer in human arterial smooth muscle cells. The common allele (C) preserves an activator protein (AP)-1 site and enhancer function, whereas the protective (T) allele disrupts the AP-1 site and significantly reduces enhancer activity (P<0.001). Pharmacological inhibition of AP-1 activity upstream demonstrates that this allele-specific enhancer effect is AP-1 dependent (P<0.001). Chromatin immunoprecipitation experiments reveal binding of several AP-1 component proteins with preferential binding to the (C) allele. We show that rs17293632 is an expression quantitative trait locus for SMAD3 in blood and atherosclerotic plaque with reduced expression of SMAD3 in carriers of the protective allele. Finally, siRNA knockdown of SMAD3 in human arterial smooth muscle cells increases cell viability, consistent with an antiproliferative role. The coronary artery disease-associated rs17293632C>T single nucleotide polymorphism represents a novel functional cis-acting element at the SMAD3 locus. The protective (T) allele of rs17293632 disrupts a consensus AP-1 binding site in a SMAD3 intron 1 enhancer, reduces enhancer activity and SMAD3 expression, altering human arterial smooth muscle cell proliferation. © 2016 American Heart Association, Inc.

No association between polymorphisms in the DDC gene and paranoid schizophrenia in a northern Chinese population.

PubMed

Zhang, Boyu; Jia, Yanbin; Yuan, Yanbo; Yu, Xin; Xu, Qi; Shen, Yucun; Shen, Yan

2004-09-01

Several lines of evidence suggest that dysfunctions of neurotransmitters are associated with schizophrenia. DOPA decarboxylase (DDC) is an enzyme involved directly in the synthesis of dopamine and serotonin, and indirectly in the synthesis of noradrenaline. Therefore, the DDC gene can be considered a candidate gene for schizophrenia. We performed an association study between three single nucleotide polymorphisms in the DDC gene and paranoid schizophrenia. However, in our study no significant differences were found in the genotype distributions and allele frequencies between 80 paranoid schizophrenics and 108 controls for any of the polymorphisms. Neither did the haplotypes of the single nucleotide polymorphisms show any association with paranoid schizophrenia. Therefore, we conclude that the polymorphisms studied do not play a major role in paranoid schizophrenia pathogenesis in the population investigated.

DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

NASA Astrophysics Data System (ADS)

Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

2017-02-01

Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

PubMed

Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

2009-06-01

The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

PubMed

Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

2014-12-01

Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

"SLC2A3" Single-Nucleotide Polymorphism and Duplication Influence Cognitive Processing and Population-Specific Risk for Attention-Deficit/Hyperactivity Disorder

ERIC Educational Resources Information Center

Merker, Sören; Reif, Andreas; Ziegler, Georg C.; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J.; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K.; Franke, Barbara; Lesch, Klaus-Peter

2017-01-01

Background: Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of…

Uncovering drug-responsive regulatory elements

PubMed Central

Luizon, Marcelo R; Ahituv, Nadav

2015-01-01

Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224

Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

PubMed

Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

2016-11-18

Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

PubMed

Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

2007-09-01

HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

Polymorphism of SLC25A32, the folate transporter gene, is associated with plasma folate levels and bone fractures in Japanese postmenopausal women.

PubMed

Urano, Tomohiko; Shiraki, Masataka; Saito, Mitsuru; Sasaki, Noriko; Ouchi, Yasuyoshi; Inoue, Satoshi

2014-10-01

Elevation of homocysteine is associated with an increased risk for bone fractures. We previously reported that the methylenetetrahydrofolate reductase (MTHFR) gene polymorphism is associated with homocysteine levels and fracture. The association between the fracture and folate levels or their related gene polymorphisms is not completely clear. We speculated that the SLC25A32 gene, the mitochondrial inner membrane folate transporter, also could be implicated in the regulation of folate metabolism and fracture. A total of 851 Japanese postmenopausal women participated in the association study between the single nucleotide polymorphism genotype and plasma homocysteine or folate. We also tested the association between the candidate single nucleotide polymorphism and 663 postmenopausal women. The AA genotype of rs2241777 single nucleotide polymorphism at the 3'UTR region in the SLC25A32 gene was associated with lower plasma folate concentration compared with the other genotypes in 851 postmenopausal women. A total of 674 postmenopausal ambulatory Japanese women were followed up for 5.5 ± 0.1 years (mean ± SE). The AA genotype groups also showed an apparently higher rate and earlier onset of incident fractures than the other genotypes. A total of 407 participants had >70% young-adult mean bone mineral density at the start of the observation. These results show that the SLC25A32 gene polymorphism could be a risk factor for lower folate concentration and future fracture. © 2013 Japan Geriatrics Society.

Application of virtual phase-shifting speckle-interferometry for detection of polymorphism in the Chlamydia trachomatis omp1 gene

NASA Astrophysics Data System (ADS)

Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.

2018-04-01

Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.

Generalization of Associations of Kidney-Related Genetic Loci to American Indians

PubMed Central

Haack, Karin; Almasy, Laura; Laston, Sandra; Lee, Elisa T.; Best, Lyle G.; Fabsitz, Richard R.; MacCluer, Jean W.; Howard, Barbara V.; Umans, Jason G.; Cole, Shelley A.

2014-01-01

Summary Background and objectives CKD disproportionally affects American Indians, who similar to other populations, show genetic susceptibility to kidney outcomes. Recent studies have identified several loci associated with kidney traits, but their relevance in American Indians is unknown. Design, setting, participants, & measurements This study used data from a large, family-based genetic study of American Indians (the Strong Heart Family Study), which includes 94 multigenerational families enrolled from communities located in Oklahoma, the Dakotas, and Arizona. Individuals were recruited from the Strong Heart Study, a population-based study of cardiovascular disease in American Indians. This study selected 25 single nucleotide polymorphisms in 23 loci identified from recently published kidney-related genome-wide association studies in individuals of European ancestry to evaluate their associations with kidney function (estimated GFR; individuals 18 years or older, up to 3282 individuals) and albuminuria (urinary albumin to creatinine ratio; n=3552) in the Strong Heart Family Study. This study also examined the association of single nucleotide polymorphisms in the APOL1 region with estimated GFR in 1121 Strong Heart Family Study participants. GFR was estimated using the abbreviated Modification of Diet in Renal Disease Equation. Additive genetic models adjusted for age and sex were used. Results This study identified significant associations of single nucleotide polymorphisms with estimated GFR in or nearby PRKAG2, SLC6A13, UBE2Q2, PIP5K1B, and WDR72 (P<2.1 × 10-3 to account for multiple testing). Single nucleotide polymorphisms in these loci explained 2.2% of the estimated GFR total variance and 2.9% of its heritability. An intronic variant of BCAS3 was significantly associated with urinary albumin to creatinine ratio. APOL1 single nucleotide polymorphisms were not associated with estimated GFR in a single variant test or haplotype analyses, and the at-risk variants identified in individuals with African ancestry were not detected in DNA sequencing of American Indians. Conclusion This study extends the genetic associations of loci affecting kidney function to American Indians, a population at high risk of kidney disease, and provides additional support for a potential biologic relevance of these loci across ancestries. PMID:24311711

Association of the rs7903146 single nucleotide polymorphism at the Transcription Factor 7-like 2 (TCF7L2) locus with type 2 diabetes in Brazilian subjects.

PubMed

Barra, Gustavo Barcelos; Dutra, Ludmila Alves Sanches; Watanabe, Sílvia Conde; Costa, Patrícia Godoy Garcia; Cruz, Patrícia Sales Marques da; Azevedo, Monalisa Ferreira; Amato, Angélica Amorim

2012-11-01

To investigate the association of the T allele of the single nucleotide polymorphism (SNP) rs7903146 of TCF7L2 with the occurrence of T2D in a sample of subjects followed up at the Brasilia University Hospital. The SNP rs7903146 of TCF7L2 was genotyped by allele-specific PCR in 113 patients with known T2D and in 139 non-diabetic controls in Brasilia, Brazil. We found that the T allele of the SNP rs7903146 of TCF7L2 was significantly associated with T2D risk (odds ratio of 3.92 for genotype TT in the recessive genetic model, p = 0.004 and 1.5 for T allele, p = 0.032). These results reinforce previous findings on the consistent association of this genetic factor and the risk of T2D in populations of diverse ethnic backgrounds.

CGDSNPdb: a database resource for error-checked and imputed mouse SNPs.

PubMed

Hutchins, Lucie N; Ding, Yueming; Szatkiewicz, Jin P; Von Smith, Randy; Yang, Hyuna; de Villena, Fernando Pardo-Manuel; Churchill, Gary A; Graber, Joel H

2010-07-06

The Center for Genome Dynamics Single Nucleotide Polymorphism Database (CGDSNPdb) is an open-source value-added database with more than nine million mouse single nucleotide polymorphisms (SNPs), drawn from multiple sources, with genotypes assigned to multiple inbred strains of laboratory mice. All SNPs are checked for accuracy and annotated for properties specific to the SNP as well as those implied by changes to overlapping protein-coding genes. CGDSNPdb serves as the primary interface to two unique data sets, the 'imputed genotype resource' in which a Hidden Markov Model was used to assess local haplotypes and the most probable base assignment at several million genomic loci in tens of strains of mice, and the Affymetrix Mouse Diversity Genotyping Array, a high density microarray with over 600,000 SNPs and over 900,000 invariant genomic probes. CGDSNPdb is accessible online through either a web-based query tool or a MySQL public login. Database URL: http://cgd.jax.org/cgdsnpdb/

A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

PubMed

Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

2016-03-15

In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.

Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

PubMed

Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

2012-01-01

PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

A novel single-nucleotide polymorphism of the visfatin gene and its associations with performance traits in the chicken.

PubMed

Han, R-L; Lan, X-Y; Zhang, L-Z; Ren, G; Jing, Y-J; Li, M-J; Zhang, B; Zhao, M; Guo, Y-K; Kang, X-T; Chen, H

2010-01-01

Visfatin is a peptide that is predominantly expressed in visceral adipose tissue and is hypothesized to be related to obesity and insulin resistance. In this study, a novel silent single-nucleotide polymorphism (SNP) was found in exon 7 of the chicken visfatin gene (also known as PBEF1) by single-stranded conformation polymorphism (SSCP) and DNA sequencing. In total, 836 chickens forming an F2 resource population of Gushi chicken crossed with Anka broiler were genotyped by XbaI forced RFLP, and the associations of this polymorphism with chicken growth, carcass characteristics, and meat quality were analyzed. Significant associations were found between the polymorphism and 4-week body weight (BW4), 6-week body weight (BW6), 4-week body slanting length (BSL4), fat bandwidth (FBW), breast muscle water loss rate (BWLR) and breast muscle fiber density (BFD) (P < 0.05), as well as 4-week breastbone length (BBL4) (P < 0.01). These observations suggested that the polymorphism in exon7 of the visfatin gene had significant effects on the early growth traits of chicken.

Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).

PubMed

Studer, Jacqueline; Bartsch, Christine; Haas, Cordula

2014-07-01

Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.

Single-nucleotide polymorphisms in the SEPTIN12 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

PubMed

Miyakawa, Hiroe; Miyamoto, Toshinobu; Koh, Eitetsu; Tsujimura, Akira; Miyagawa, Yasushi; Saijo, Yasuaki; Namiki, Mikio; Sengoku, Kazuo

2012-01-01

Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, 10 novel genes involved in human spermatogenesis, including human SEPTIN12, were identified by expression microarray analysis of human testicular tissue. Septin12 is a member of the septin family of conserved cytoskeletal GTPases that form heteropolymeric filamentous structures in interphase cells. It is expressed specifically in the testis. Therefore, we hypothesized that mutation or polymorphisms of SEPTIN12 participate in male infertility, especially Sertoli cell-only syndrome (SCOS). To investigate whether SEPTIN12 gene defects are associated with azoospermia caused by SCOS, mutational analysis was performed in 100 Japanese patients by direct sequencing of coding regions. Statistical analysis was performed in patients with SCOS and in 140 healthy control men. No mutations were found in SEPTIN12 ; however, 8 coding single-nucleotide polymorphisms (SNP1-SNP8) could be detected in the patients with SCOS. The genotype and allele frequencies in SNP3, SNP4, and SNP6 were notably higher in the SCOS group than in the control group (P < .001). These results suggest that SEPTIN12 might play a critical role in human spermatogenesis.

Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

PubMed

Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

2014-05-09

ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.

Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease

PubMed Central

Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.

2016-01-01

Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047

N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

PubMed Central

Hein, David W.

2009-01-01

Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

PubMed

Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

2012-04-01

Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

Identification of a Polymorphic Gene, BCL2A1, Encoding Two Novel Hematopoietic Lineage-specific Minor Histocompatibility Antigens

PubMed Central

Akatsuka, Yoshiki; Nishida, Tetsuya; Kondo, Eisei; Miyazaki, Mikinori; Taji, Hirohumi; Iida, Hiroatsu; Tsujimura, Kunio; Yazaki, Makoto; Naoe, Tomoki; Morishima, Yasuo; Kodera, Yoshihisa; Kuzushima, Kiyotaka; Takahashi, Toshitada

2003-01-01

We report the identification of two novel minor histocompatibility antigens (mHAgs), encoded by two separate single nucleotide polymorphisms on a single gene, BCL2A1, and restricted by human histocompatibility leukocyte antigen (HLA)-A*2402 (the most common HLA-A allele in Japanese) and B*4403, respectively. Two cytotoxic T lymphocyte (CTL) clones specific for these mHAgs were first isolated from two distinct recipients after hematopoietic cell transplantation. Both clones lyse only normal and malignant cells within the hematopoietic lineage. To localize the gene encoding the mHAgs, two-point linkage analysis was performed on the CTL lytic patterns of restricting HLA-transfected B lymphoblastoid cell lines obtained from Centre d'Etude du Polymorphisme Humain. Both CTL clones showed a completely identical lytic pattern for 4 pedigrees and the gene was localized within a 3.6-cM interval of 15q24.3–25.1 region that encodes at least 46 genes. Of those, only BCL2A1 has been reported to be expressed in hematopoietic cells and possess three nonsynonymous nucleotide changes. Minigene transfection and epitope reconstitution assays with synthetic peptides identified both HLA-A*2402– and B*4403-restricted mHAg epitopes to be encoded by distinct polymorphisms within BCL2A1. PMID:12771180

The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

PubMed

Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

2011-01-01

Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

PubMed Central

Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo

2016-01-01

Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

Characterization of the equine 2'-5' oligoadenylate synthetase 1 (OAS1) and ribonuclease L (RNASEL) innate immunity genes

PubMed Central

Rios, Jonathan J; Perelygin, Andrey A; Long, Maureen T; Lear, Teri L; Zharkikh, Andrey A; Brinton, Margo A; Adelson, David L

2007-01-01

Background The mammalian OAS/RNASEL pathway plays an important role in antiviral host defense. A premature stop-codon within the murine Oas1b gene results in the increased susceptibility of mice to a number of flaviviruses, including West Nile virus (WNV). Mutations in either the OAS1 or RNASEL genes may also modulate the outcome of WNV-induced disease or other viral infections in horses. Polymorphisms in the human OAS gene cluster have been previously utilized for case-control analysis of virus-induced disease in humans. No polymorphisms have yet been identified in either the equine OAS1 or RNASEL genes for use in similar case-control studies. Results Genomic sequence for equine OAS1 was obtained from a contig assembly generated from a shotgun subclone library of CHORI-241 BAC 100I10. Specific amplification of regions of the OAS1 gene from 13 horses of various breeds identified 33 single nucleotide polymorphisms (SNP) and two microsatellites. RNASEL cDNA sequences were determined for 8 mammals and utilized in a phylogenetic analysis. The chromosomal location of the RNASEL gene was assigned by FISH to ECA5p17-p16 using two selected CHORI-241 BAC clones. The horse genomic RNASEL sequence was assembled. Specific amplification of regions of the RNASEL gene from 13 horses identified 31 SNPs. Conclusion In this report, two dinucleotide microsatellites and 64 single nucleotide polymorphisms within the equine OAS1 and RNASEL genes were identified. These polymorphisms are the first to be reported for these genes and will facilitate future case-control studies of horse susceptibility to infectious diseases. PMID:17822564

MicroRNA-196a2 Biomarker and Targetome Network Analysis in Solid Tumors.

PubMed

Toraih, Eman A; Fawzy, Manal S; Mohammed, Eman A; Hussein, Mohammad H; El-Labban, Mohamad M

2016-12-01

MicroRNAs (miRNAs) have been linked to cancer development and progression. The molecular mechanisms underlying the genetic associations of the miRNA single nucleotide polymorphism with cancer vary by cancer site. As there are no previous studies on the miR-196a2 variant or expression in any type of cancer among our population, we aimed to determine the expression profile of mature miR-196a2 in various types of solid tumors and to analyze the impact of its polymorphism (rs11614913; C/T) on the expression levels. The study included 230 cancer patients (including 17 types of cancer), 26 patients with pre-cancer lesions, and 100 unrelated controls. Archived formalin-fixed, paraffin-embedded specimens (n = 197) were available for both miRNA expression analysis and single nucleotide polymorphism identification. Venous blood was collected from 59 histologically confirmed sporadic cancer patients and the study controls for single nucleotide polymorphism identification. Real-time polymerase chain reaction analysis was performed for allelic discrimination and relative quantification of miR-196a2 in the study samples. In silico target gene prediction and network analysis was performed. We found that individuals with the T variant were associated with cancer risk under all genetic association models, especially in colorectal, esophageal, skin, lung, thyroid, and renal cancer. Overall and stratified analysis showed miR-196a2 over-expression in most of the current malignant tumor samples relative to their corresponding cancer-free tissues. Carriers of the C allele had significantly higher expression levels of miR-196a2. Correlation with the clinicopathological features of cancer showed organ-specific effects. Gene enrichment analysis of predicted and validated targets speculated the putative role of miR-196a2 in cancer-associated biology. We highlighted cancer-type specific expression profiles of miR-196a2, which was correlated with the clinicopathological features in various types of cancer. Taken together, our results suggest that the miRNA signature could have promising diagnostic and prognostic significance.

Single-feature polymorphism discovery in the barley transcriptome

PubMed Central

Rostoks, Nils; Borevitz, Justin O; Hedley, Peter E; Russell, Joanne; Mudie, Sharon; Morris, Jenny; Cardle, Linda; Marshall, David F; Waugh, Robbie

2005-01-01

A probe-level model for analysis of GeneChip gene-expression data is presented which identified more than 10,000 single-feature polymorphisms (SFP) between two barley genotypes. The method has good sensitivity, as 67% of known single-nucleotide polymorphisms (SNP) were called as SFPs. This method is applicable to all oligonucleotide microarray data, accounts for SNP effects in gene-expression data and represents an efficient and versatile approach for highly parallel marker identification in large genomes. PMID:15960806

Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

PubMed

Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

2012-05-17

The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit.

Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

PubMed Central

2012-01-01

Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. Keywords: single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit PMID:22594601

Genetic polymorphisms and the risk of stroke after cardiac surgery.

PubMed

Grocott, Hilary P; White, William D; Morris, Richard W; Podgoreanu, Mihai V; Mathew, Joseph P; Nielsen, Dahlia M; Schwinn, Debra A; Newman, Mark F

2005-09-01

Stroke represents a significant cause of morbidity and mortality after cardiac surgery. Although the risk of stroke varies according to both patient and procedural factors, the impact of genetic variants on stroke risk is not well understood. Therefore, we tested the hypothesis that specific genetic polymorphisms are associated with an increased risk of stroke after cardiac surgery. Patients undergoing cardiac surgery utilizing cardiopulmonary bypass surgery were studied. DNA was isolated from preoperative blood and analyzed for 26 different single-nucleotide polymorphisms. Multivariable logistic regression modeling was used to determine the association of clinical and genetic characteristics with stroke. Permutation analysis was used to adjust for multiple comparisons inherent in genetic association studies. A total of 1635 patients experiencing 28 strokes (1.7%) were included in the final genetic model. The combination of the 2 minor alleles of C-reactive protein (CRP; 3'UTR 1846C/T) and interleukin-6 (IL-6; -174G/C) polymorphisms, occurring in 583 (35.7%) patients, was significantly associated with stroke (odds ratio, 3.3; 95% CI, 1.4 to 8.1; P=0.0023). In a multivariable logistic model adjusting for age, the CRP and IL-6 single-nucleotide polymorphism combination remained significantly associated with stroke (P=0.0020). We demonstrate that common genetic variants of CRP (3'UTR 1846C/T) and IL-6 (-174G/C) are significantly associated with the risk of stroke after cardiac surgery, suggesting a pivotal role of inflammation in post-cardiac surgery stroke.

Obesity-Related Genomic Loci Are Associated with Type 2 Diabetes in a Han Chinese Population

PubMed Central

Zhao, Qi; He, Jiang; Chen, Li; Zhao, Zhigang; Li, Qiang; Ge, Jiapu; Chen, Gang; Guo, Xiaohui; Lu, Juming; Weng, Jianping; Jia, Weiping; Ji, Linong; Xiao, Jianzhong; Shan, Zhongyan; Liu, Jie; Tian, Haoming; Ji, Qiuhe; Zhu, Dalong; Zhou, Zhiguang; Shan, Guangliang; Yang, Wenying

2014-01-01

Background and Aims Obesity is a well-known risk factor for type 2 diabetes. Genome-wide association studies have identified a number of genetic loci associated with obesity. The aim of this study is to examine the contribution of obesity-related genomic loci to type 2 diabetes in a Chinese population. Methods We successfully genotyped 18 obesity-related single nucleotide polymorphisms among 5338 type 2 diabetic patients and 4663 controls. Both individual and joint effects of these single nucleotide polymorphisms on type 2 diabetes and quantitative glycemic traits (assessing β-cell function and insulin resistance) were analyzed using logistic and linear regression models, respectively. Results Two single nucleotide polymorphisms near MC4R and GNPDA2 genes were significantly associated with type 2 diabetes before adjusting for body mass index and waist circumference (OR (95% CI) = 1.14 (1.06, 1.22) for the A allele of rs12970134, P = 4.75×10−4; OR (95% CI) = 1.10 (1.03, 1.17) for the G allele of rs10938397, P = 4.54×10−3). When body mass index and waist circumference were further adjusted, the association of MC4R with type 2 diabetes remained significant (P = 1.81×10−2) and that of GNPDA2 was attenuated (P = 1.26×10−1), suggesting the effect of the locus including GNPDA2 on type 2 diabetes may be mediated through obesity. Single nucleotide polymorphism rs2260000 within BAT2 was significantly associated with type 2 diabetes after adjusting for body mass index and waist circumference (P = 1.04×10−2). In addition, four single nucleotide polymorphisms (near or within SEC16B, BDNF, MAF and PRL genes) showed significant associations with quantitative glycemic traits in controls even after adjusting for body mass index and waist circumference (all P values<0.05). Conclusions This study indicates that obesity-related genomic loci were associated with type 2 diabetes and glycemic traits in the Han Chinese population. PMID:25093408

SRD5A1 and SRD5A2 are associated with treatment for benign prostatic hyperplasia with the combination of 5α-reductase inhibitors and α-adrenergic receptor antagonists.

PubMed

Gu, Xin; Na, Rong; Huang, Tao; Wang, Li; Tao, Sha; Tian, Lu; Chen, Zhuo; Jiao, Yang; Kang, Jian; Zheng, Siqun; Xu, Jianfeng; Sun, Jielin; Qi, Jun

2013-08-01

Common treatments for benign prostatic hyperplasia include 5α-reductase inhibitors and α-adrenergic receptor antagonists. However, these treatments can only partially decrease the risk of benign prostatic hyperplasia progression. SRD5A1 and SRD5A2 are 5α-reductase inhibitor targets. We investigated the association between drug efficacy and single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a Chinese population. We genotyped 11 tagging single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a total of 426 benign prostatic hyperplasia cases and 1,008 controls from Xinhua Hospital, Shanghai, People's Republic of China. Cases were treated with type II 5α-reductase inhibitors and α-adrenergic receptor antagonists. We tested the association of tagging single nucleotide polymorphisms with benign prostatic hyperplasia risk/progression, clinical characteristics at baseline, including the I-PSS (International Prostate Symptom Score) and total prostate volume, and changes in clinical characteristics after treatment. The 11 tagging single nucleotide polymorphisms were not significantly associated with benign prostatic hyperplasia risk or progression (each p >0.05). In the SRD5A1 gene rs6884552 and rs3797177 were significantly associated with baseline I-PSS (p = 0.04 and 0.003, respectively). In the SRD5A2 gene rs523349 (V89L) and rs9332975 were significantly associated with baseline total prostate volume (p = 0.01 and 0.001, respectively). In SRD5A1 rs166050 was significantly associated with the posttreatment change in total prostate volume (p = 0.04). In SRD5A2 rs523349 and rs612224 were significantly associated with the posttreatment I-PSS change (p = 0.03 and 0.009, respectively). SRD5A1 and SRD5A2 single nucleotide polymorphisms are significantly associated with the clinical characteristics of benign prostatic hyperplasia and the efficacy of benign prostatic hyperplasia treatment. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.

PubMed

Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej

2016-01-01

Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.

17q25 Locus Is Associated With White Matter Hyperintensity Volume in Ischemic Stroke, But Not With Lacunar Stroke Status

PubMed Central

Adib-Samii, Poneh; Rost, Natalia; Traylor, Matthew; Devan, William; Biffi, Alessandro; Lanfranconi, Silvia; Fitzpatrick, Kaitlin; Bevan, Steve; Kanakis, Allison; Valant, Valerie; Gschwendtner, Andreas; Malik, Rainer; Richie, Alexa; Gamble, Dale; Segal, Helen; Parati, Eugenio A.; Ciusani, Emilio; Holliday, Elizabeth G.; Maguire, Jane; Wardlaw, Joanna; Worrall, Bradford; Bis, Joshua; Wiggins, Kerri L.; Longstreth, Will; Kittner, Steve J.; Cheng, Yu-Ching; Mosley, Thomas; Falcone, Guido J.; Furie, Karen L.; Leiva-Salinas, Carlos; Lau, Benison C.; Khan, Muhammed Saleem; Sharma, Pankaj; Fornage, Myriam; Mitchell, Braxton D.; Psaty, Bruce M.; Sudlow, Cathie; Levi, Christopher; Boncoraglio, Giorgio B.; Rothwell, Peter M.; Meschia, James; Dichgans, Martin; Rosand, Jonathan; Markus, Hugh S.

2013-01-01

Background and Purpose Recently, a novel locus at 17q25 was associated with white matter hyperintensities (WMH) on MRI in stroke-free individuals. We aimed to replicate the association with WMH volume (WMHV) in patients with ischemic stroke. If the association acts by promoting a small vessel arteriopathy, it might be expected to also associate with lacunar stroke. Methods We quantified WMH on MRI in the stroke-free hemisphere of 2588 ischemic stroke cases. Association between WMHV and 6 single-nucleotide polymorphisms at chromosome 17q25 was assessed by linear regression. These single-nucleotide polymorphisms were also investigated for association with lacunar stroke in 1854 cases and 51 939 stroke-free controls from METASTROKE. Meta-analyses with previous reports and a genetic risk score approach were applied to identify other novel WMHV risk variants and uncover shared genetic contributions to WMHV in community participants without stroke and ischemic stroke. Results Single-nucleotide polymorphisms at 17q25 were associated with WMHV in ischemic stroke, the most significant being rs9894383 (P=0.0006). In contrast, there was no association between any single-nucleotide polymorphism and lacunar stroke. A genetic risk score analysis revealed further genetic components to WMHV shared between community participants without stroke and ischemic stroke. Conclusions This study provides support for an association between the 17q25 locus and WMH. In contrast, it is not associated with lacunar stroke, suggesting that the association does not act by promoting small-vessel arteriopathy or the same arteriopathy responsible for lacunar infarction. PMID:23674528

Associations between serum bone-specific alkaline phosphatase activity, biochemical parameters, and functional polymorphisms of the tissue-nonspecific alkaline phosphatase gene in a Japanese population.

PubMed

Sogabe, Natsuko; Tanabe, Rieko; Haraikawa, Mayu; Maruoka, Yutaka; Orimo, Hideo; Hosoi, Takayuki; Goseki-Sone, Masae

2013-01-01

We had demonstrated that single nucleotide polymorphism (787T>C) in the tissue-nonspecific ALP (TNSALP) gene was associated with the bone mineral density (BMD). BMD was the lowest among TNSALP 787T homozygotes (TT-type) and highest among TNSALP 787T>C homozygotes (CC-type) in postmenopausal women. In the present study, we investigated the effects of the TNSALP genotype on associations among serum bonespecific alkaline phosphatase (BAP), serum calcium, and phosphorus in healthy young Japanese subjects. Young healthy adult subjects (n=193) were genotyped for the polymorphism, and we measured the levels of serum BAP, serum calcium, and phosphorus. Dietary nutrient intakes were calculated based on 3-day food records before the day of blood examinations. Grouped by the TNSALP genotype, a significant negative correlation between serum BAP and phosphorus was observed in 787T>C homozygotes (CC-type), but not in heterozygotes (TCtype), nor in 787T homozygotes (TT-type). In the present study, we revealed that the single nucleotide polymorphism 787T>C in the TNSALP gene had effects on the correlation between serum BAP and phosphorus in young adult subjects. These results suggest that variation in TNSALP may be an important determinant of phosphate metabolism. Our data may be useful for planning strategies to prevent osteoporosis.

A noncoding melanophilin gene (MLPH) SNP at the splice donor of exon 1 represents a candidate causal mutation for coat color dilution in dogs.

PubMed

Drögemüller, Cord; Philipp, Ute; Haase, Bianca; Günzel-Apel, Anne-Rose; Leeb, Tosso

2007-01-01

Coat color dilution in several breeds of dog is characterized by a specific pigmentation phenotype and sometimes accompanied by hair loss and recurrent skin inflammation, the so-called color dilution alopecia or black hair follicular dysplasia. Coat color dilution (d) is inherited as a Mendelian autosomal recessive trait. In a previous study, MLPH polymorphisms showed perfect cosegregation with the dilute phenotype within breeds. However, different dilute haplotypes were found in different breeds, and no single polymorphism was identified in the coding sequence that was likely to be causative for the dilute phenotype. We resequenced the 5'-region of the canine MLPH gene and identified a strong candidate single nucleotide polymorphism within the nontranslated exon 1, which showed perfect association to the dilute phenotype in 65 dilute dogs from 7 different breeds. The A/G polymorphism is located at the last nucleotide of exon 1 and the mutant A-allele is predicted to reduce splicing efficiency 8-fold. An MLPH mRNA expression study using quantitative reverse transcriptase-polymerase chain reaction confirmed that dd animals had only about approximately 25% of the MLPH transcript compared with DD animals. These results provide preliminary evidence that the reported regulatory MLPH mutation might represent a causal mutation for coat color dilution in dogs.

Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

PubMed

Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

2017-04-01

Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

Genetics of Oxidative Stress in Obesity

PubMed Central

Rupérez, Azahara I.; Gil, Angel; Aguilera, Concepción M.

2014-01-01

Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications. PMID:24562334

Genetics of oxidative stress in obesity.

PubMed

Rupérez, Azahara I; Gil, Angel; Aguilera, Concepción M

2014-02-20

Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications.

Gold nanoparticle enhanced fluorescence anisotropy for the assay of single nucleotide polymorphisms (SNPs) based on toehold-mediated strand-displacement reaction.

PubMed

Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na

2013-03-15

We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.

Effects of the BDNF Val66Met Polymorphism on Anxiety-Like Behavior Following Nicotine Withdrawal in Mice

PubMed Central

Lee, Bridgin G.; Anastasia, Agustin; Hempstead, Barbara L.; Lee, Francis S.

2015-01-01

Introduction: Nicotine withdrawal is characterized by both affective and cognitive symptoms. Identifying genetic polymorphisms that could affect the symptoms associated with nicotine withdrawal are important in predicting withdrawal sensitivity and identifying personalized cessation therapies. In the current study we used a mouse model of a non-synonymous single nucleotide polymorphism in the translated region of the brain-derived neurotrophic factor (BDNF) gene that substitutes a valine (Val) for a methionine (Met) amino acid (Val66Met) to examine the relationship between the Val66Met single nucleotide polymorphism and nicotine dependence. Methods: This study measured proBDNF and the BDNF prodomain levels following nicotine and nicotine withdrawal and examined a mouse model of a common polymorphism in this protein (BDNFMet/Met) in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test. Results: Using the BDNF knock-in mouse containing the BDNF Val66Met polymorphism we found: (1) blunted anxiety-like behavior in BDNFMet/Met mice following withdrawal in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test; (2) the anxiolytic effects of chronic nicotine are absent in BDNFMet/Met mice; and (3) an increase in BDNF prodomain in BDNFMet/Met mice following nicotine withdrawal. Conclusions: Our study is the first to examine the effect of the BDNF Val66Met polymorphism on the affective symptoms of withdrawal from nicotine in mice. In these mice, a single-nucleotide polymorphism in the translated region of the BDNF gene can result in a blunted withdrawal, as measured by decreased anxiety-like behavior. The significant increase in the BDNF prodomain in BDNFMet/Met mice following nicotine cessation suggests a possible role of this ligand in the circuitry remodeling after withdrawal. PMID:25744957

Association between polymorphisms in prostanoid receptor genes and aspirin-intolerant asthma.

PubMed

Kim, Sang-Heon; Kim, Yoon-Keun; Park, Heung-Woo; Jee, Young-Koo; Kim, Sang-Hoon; Bahn, Joon-Woo; Chang, Yoon-Seok; Kim, Seung-Hyun; Ye, Young-Min; Shin, Eun-Soon; Lee, Jong-Eun; Park, Hae-Sim; Min, Kyung-Up

2007-04-01

Genetic predisposition is linked to the pathogenesis of aspirin-intolerant asthma. Most candidate gene approaches have focused on leukotriene-related pathways, whereas there have been relatively few studies evaluating the effects of polymorphisms in prostanoid receptor genes on the development of aspirin-intolerant asthma. Therefore, we investigated the potential association between prostanoid receptor gene polymorphisms and the aspirin-intolerant asthma phenotype. We screened for genetic variations in the prostanoid receptor genes PTGER1, PTGER2, PTGER3, PTGER4, PTGDR, PTGIR, PTGFR, and TBXA2R using direct sequencing, and selected 32 tagging single nucleotide polymorphisms among the 77 polymorphisms with frequencies >0.02 based on linkage disequilibrium for genotyping. We compared the genotype distributions and allele frequencies of three participant groups (108 patients with aspirin-intolerant asthma, 93 patients with aspirin-tolerant asthma, and 140 normal controls). Through association analyses studies of the 32 single nucleotide polymorphisms, the following single nucleotide polymorphisms were found to have significant associations with the aspirin-intolerant asthma phenotype: -616C>G (P=0.038) and -166G>A (P=0.023) in PTGER2; -1709T>A (P=0.043) in PTGER3; -1254A>G (P=0.018) in PTGER4; 1915T>C (P=0.015) in PTGIR; and -4684C>T (P=0.027), and 795T>C (P=0.032) in TBXA2R. In the haplotype analysis of each gene, the frequency of PTGIR ht3[G-G-C-C], which includes 1915T>C, differed significantly between the aspirin-intolerant asthma patients and aspirin-tolerant asthma patients (P=0.015). These findings suggest that genetic polymorphisms in PTGER2, PTGER3, PTGER4, PTGIR, and TBXA2R play important roles in the pathogenesis of aspirin-intolerant asthma.

Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

USDA-ARS?s Scientific Manuscript database

The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

Association study between alcoholism and endocannabinoid metabolic enzyme genes encoding fatty acid amide hydrolase and monoglyceride lipase in a Japanese population.

PubMed

Iwasaki, Shinya; Ishiguro, Hiroki; Higuchi, Susumu; Onaivi, Emmanuel S; Arinami, Tadao

2007-08-01

Fatty acid amide hydrolase (FAAH) and monoglyceride lipase (MGLL) are the major endocannabinoid metabolic enzymes. Owing to the importance of endocannabinoid system in addiction, the Pro129Thr polymorphism in the FAAH gene has reportedly been associated with substance abuse and dependence in a Caucasian population. To determine whether the single nucleodtide polymorphisms of the FAAH and MGLL genes are associated with alcoholism in a Japanese population. We conducted case-control studies for total 14 tag single nucleotide polymorphisms in those two genes using Japanese 729 patients with alcoholism and 799 healthy controls. Genotype and allele frequencies were compared between these groups. None of these genetic markers, however, showed significant association with alcoholism in Japanese. Whereas we examined associations in a larger sample size between alcoholism and tag single nucleotide polymorphisms that covered most regions of these endocannabinoid metabolic enzyme genes, we found that these are not associated with susceptibility to alcoholism in a Japanese population.

Impact of IL-10 (−1082) Promoter–Single Nucleotide Polymorphism on the Outcome of Hepatitis C Virus Genotype 4 Infection

PubMed Central

Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.

2014-01-01

Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945

Impact of IL-10 (-1082) promoter-single nucleotide polymorphism on the outcome of hepatitis C virus genotype 4 infection.

PubMed

Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A

2014-01-01

Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.

Genotype-Phenotype Study of the Middle Gangetic Plain in India Shows Association of rs2470102 with Skin Pigmentation.

PubMed

Mishra, Anshuman; Nizammuddin, Sheikh; Mallick, Chandana Basu; Singh, Sakshi; Prakash, Satya; Siddiqui, Niyamat Ali; Rai, Niraj; Carlus, S Justin; Sudhakar, Digumarthi V S; Tripathi, Vishnu P; Möls, Märt; Kim-Howard, Xana; Dewangan, Hemlata; Mishra, Abhishek; Reddy, Alla G; Roy, Biswajit; Pandey, Krishna; Chaubey, Gyaneshwer; Das, Pradeep; Nath, Swapan K; Singh, Lalji; Thangaraj, Kumarasamy

2017-03-01

Our understanding of the genetics of skin pigmentation has been largely skewed towards populations of European ancestry, imparting less attention to South Asian populations, who behold huge pigmentation diversity. Here, we investigate skin pigmentation variation in a cohort of 1,167 individuals in the Middle Gangetic Plain of the Indian subcontinent. Our data confirm the association of rs1426654 with skin pigmentation among South Asians, consistent with previous studies, and also show association for rs2470102 single nucleotide polymorphism. Our haplotype analyses further help us delineate the haplotype distribution across social categories and skin color. Taken together, our findings suggest that the social structure defined by the caste system in India has a profound influence on the skin pigmentation patterns of the subcontinent. In particular, social category and associated single nucleotide polymorphisms explain about 32% and 6.4%, respectively, of the total phenotypic variance. Phylogeography of the associated single nucleotide polymorphisms studied across 52 diverse populations of the Indian subcontinent shows wide presence of the derived alleles, although their frequencies vary across populations. Our results show that both polymorphisms (rs1426654 and rs2470102) play an important role in the skin pigmentation diversity of South Asians. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

[Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

PubMed

Khrustaleva, A M; Gritsenko, O F; Klovach, N V

2013-11-01

The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.

Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

PubMed Central

Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

2014-01-01

Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

Polymorphism at the merozoite surface protein-3alpha locus of Plasmodium vivax: global and local diversity.

PubMed

Bruce, M C; Galinski, M R; Barnwell, J W; Snounou, G; Day, K P

1999-10-01

Allelic diversity at the Plasmodium vivax merozoite surface protein-3alpha (PvMsp-3alpha) locus was investigated using a combined polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) protocol. Symptomatic patient isolates from global geographic origins showed a high level of polymorphism at the nucleotide level. These samples were used to validate the sensitivity, specificity, and reproducibility of the PCR/RFLP method. It was then used to investigate PvMsp3alpha diversity in field samples from children living in a single village in a malaria-endemic region of Papua New Guinea, with the aim of assessing the usefulness of this locus as an epidemiologic marker of P. vivax infections. Eleven PvMsp-3alpha alleles were distinguishable in 16 samples with single infections, revealing extensive parasite polymorphism within this restricted area. Multiple infections were easily detected and accounted for 5 (23%) of 22 positive samples. Pairs of samples from individual children provided preliminary evidence for high turnover of P. vivax populations.

Atrial Fibrillation Genetic Risk and Ischemic Stroke Mechanisms.

PubMed

Lubitz, Steven A; Parsons, Owen E; Anderson, Christopher D; Benjamin, Emelia J; Malik, Rainer; Weng, Lu-Chen; Dichgans, Martin; Sudlow, Cathie L; Rothwell, Peter M; Rosand, Jonathan; Ellinor, Patrick T; Markus, Hugh S; Traylor, Matthew

2017-06-01

Atrial fibrillation (AF) is a leading cause of cardioembolic stroke, but the relationship between AF and noncardioembolic stroke subtypes are unclear. Because AF may be unrecognized, and because AF has a substantial genetic basis, we assessed for predisposition to AF across ischemic stroke subtypes. We examined associations between AF genetic risk and Trial of Org 10172 in Acute Stroke Treatment stroke subtypes in 2374 ambulatory individuals with ischemic stroke and 5175 without from the Wellcome Trust Case-Control Consortium 2 using logistic regression. We calculated AF genetic risk scores using single-nucleotide polymorphisms associated with AF in a previous independent analysis across a range of preselected significance thresholds. There were 460 (19.4%) individuals with cardioembolic stroke, 498 (21.0%) with large vessel, 474 (20.0%) with small vessel, and 814 (32.3%) individuals with strokes of undetermined cause. Most AF genetic risk scores were associated with stroke, with the strongest association ( P =6×10 - 4 ) attributed to scores of 944 single-nucleotide polymorphisms (each associated with AF at P <1×10 - 3 in a previous analysis). Associations between AF genetic risk and stroke were enriched in the cardioembolic stroke subset (strongest P =1.2×10 - 9 , 944 single-nucleotide polymorphism score). In contrast, AF genetic risk was not significantly associated with noncardioembolic stroke subtypes. Comprehensive AF genetic risk scores were specific for cardioembolic stroke. Incomplete workups and subtype misclassification may have limited the power to detect associations with strokes of undetermined pathogenesis. Future studies are warranted to determine whether AF genetic risk is a useful biomarker to enhance clinical discrimination of stroke pathogeneses. © 2017 American Heart Association, Inc.

Exploring genetic variants predisposing to diabetes mellitus and their association with indicators of socioeconomic status.

PubMed

Schmidt, Börge; Dragano, Nico; Scherag, André; Pechlivanis, Sonali; Hoffmann, Per; Nöthen, Markus M; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne

2014-06-16

The relevance of disease-related genetic variants for the explanation of social inequalities in complex diseases is unclear and empirical analyses are largely missing. The aim of our study was to examine whether genetic variants predisposing to diabetes mellitus are associated with socioeconomic status in a population-based cohort. We genotyped 11 selected diabetes-related single nucleotide polymorphisms in 4655 participants (age 45-75 years) of the Heinz Nixdorf Recall study. Diabetes status was self-reported or defined by blood glucose levels. Education, income and paternal occupation were assessed as indicators of socioeconomic status. Multiple regression analyses were used to examine the association of socioeconomic status and diabetes by estimating sex-specific and age-adjusted prevalence ratios and their corresponding 95%-confidence intervals. To explore the relationship between individual single nucleotide polymorphisms and socioeconomic status sex- and age-adjusted odds ratios were computed. We adjusted the alpha-level for multiple testing of 11 single nucleotide polymorphisms using Bonferroni's method (α(BF) ~ 0.005). In addition, we explored the association of a genetic risk score with socioeconomic status. Social inequalities in diabetes were observed for all indicators of socioeconomic status. However, there were no significant associations between individual diabetes-related risk alleles and socioeconomic status with odds ratios ranging from 0.87 to 1.23. Similarly, the genetic risk score analysis revealed no evidence for an association. Our data provide no evidence for an association between 11 diabetes-related risk alleles and different indicators of socioeconomic status in a population-based cohort, suggesting that the explored genetic variants do not contribute to health inequalities in diabetes.

Association between Single Nucleotide Polymorphism of Vitamin D Receptor Gene FokI Polymorphism and Clinical Progress of Benign Prostatic Hyperplasia

PubMed Central

Ruan, Li; Zhu, Jian-guo; Pan, Cong; Hua, Xing; Yuan, Dong-bo; Li, Zheng-ming; Zhong, Wei-de

2015-01-01

Background. The aim of the study was to investigate the association between single nucleotide polymorphism (SNP) of vitamin D receptor (VDR) gene and clinical progress of benign prostatic hyperplasia (BPH) in Chinese men. Methods. The DNA was extracted from blood of 200 BPH patients with operation (progression group) and 200 patients without operation (control group), respectively. The genotypes of VDR gene FokI SNP represented by “F/f” were identified by PCR-restriction fragment length polymorphism. The odds ratio (OR) of having progression of BPH for having the genotype were calculated. Results. Our date indicated that the f alleles of the VDR gene FokI SNP associated with the progression of BPH (P = 0.009). Conclusion. For the first time, our study demonstrated that VDR gene FokI SNP may be associated with the risk of BPH progress. PMID:25685834

Positive transcriptional regulation of the human micro opioid receptor gene by poly(ADP-ribose) polymerase-1 and increase of its DNA binding affinity based on polymorphism of G-172 -> T.

PubMed

Ono, Takeshi; Kaneda, Toshio; Muto, Akihiro; Yoshida, Tadashi

2009-07-24

Micro opioid receptor (MOR) agonists such as morphine are applied widely in clinical practice as pain therapy. The effects of morphine through MOR, such as analgesia and development of tolerance and dependence, are influenced by individual specificity. Recently, we analyzed single nucleotide polymorphisms on the human MOR gene to investigate the factors that contribute to individual specificity. In process of single nucleotide polymorphisms analysis, we found that specific nuclear proteins bound to G(-172) --> T region in exon 1 in MOR gene, and its affinity to DNA was increased by base substitution from G(-172) to T(-172). The isolated protein was identified by mass spectrometry and was confirmed by Western blotting to be poly(ADP-ribose) polymerase-1 (PARP-1). The overexpressed PARP-1 bound to G(-172) --> T and enhanced the transcription of reporter vectors containing G(-172) and T(-172). Furthermore, PARP-1 inhibitor (benzamide) decreased PARP-1 binding to G(-172) --> T without affecting mRNA or protein expression level of PARP-1 and down-regulated the subsequent MOR gene expression in SH-SY5Y cells. Moreover, we found that tumor necrosis factor-alpha enhanced MOR gene expression as well as increased PARP-1 binding to the G(-172) --> T region and G(-172) --> T-dependent transcription in SH-SY5Y cells. These effects were also inhibited by benzamide. In this study, our data suggest that PARP-1 positively regulates MOR gene transcription via G(-172) --> T, which might influence individual specificity in therapeutic opioid effects.

Development of a simple and practical method of discrimination between Vibrio furnissii and V. fluvialis based on single-nucleotide polymorphisms of 16S rRNA genes observed in V. furnissii but not in V. fluvialis.

PubMed

Takajo, Ichiro; Yamada, Akiteru; Umeki, Kazumi; Saeki, Yuji; Hashikura, Yuuki; Yamamoto, Ikuo; Umekita, Kunihiko; Urayama-Kawano, Midori; Yamasaki, Shogo; Taniguchi, Takako; Misawa, Naoaki; Okayama, Akihiko

2018-01-01

Vibrio furnissii and V. fluvialis are closely related, the discrimination of which by conventional biochemical assay remains a challenge. Investigation of the sequence of the 16S rRNA genes in a clinical isolate of V. furnissii by visual inspection of a sequencing electropherogram revealed two sites of single-nucleotide polymorphisms (SNPs; positions 460 A/G and 1261 A/G) in these genes. A test of 12 strains each of V. fluvialis and V. furnissii revealed these SNPs to be common in V. furnissii but not in V. fluvialis. Divergence of SNP frequency was observed among the strains of V. furnissii tested. Because the SNPs described in V. furnissii produce a difference in the target sequence of restriction enzymes, a combination of polymerase chain reaction (PCR) of the 16S rRNA genes using conventional primers and restriction fragment length polymorphism analysis using Eco RV and Eae I was shown to discriminate between V. fluvialis and V. furnissii. This method is simple and alleviates the need for expensive equipment or primer sets specific to these bacteria. Therefore, we believe that this method can be useful, alongside specific PCR and mass spectrometry, when there is a need to discriminate between V. fluvialis and V. furnissii. Copyright © 2017 Elsevier B.V. All rights reserved.

Elastin: a possible genetic biomarker for more severe ligament injuries in elite soccer. A pilot study

PubMed Central

Artells, Rosa; Pruna, Ricard; Dellal, Alexandre; Maffulli, Nicola

2016-01-01

Summary Background The study of new genetic biomarkers in genes related to connective tissue repair and regeneration may help to identify individuals with greater predisposition to injury, who may benefit from targeted preventive measures, and those who require longer recovery time following a muscle, ligament or tendon injury. The present study investigated whether single nucleotide polymorphisms of the Elastin gene could be related to MCL injury. Methods 60 top class football players were studied to identify single nucleotide polymorphisms for the Elastin (ELN) gene using Allelic Discrimination analysis. Each player was followed for 7 seasons, and each MCL injury was noted. Results Ligament injury rate, severity and recovery time are related to specific genotypes observed in the elastin gene, especially the ELN-AA (16 MCL) and the ELN-AG (3 MCL). Players with the ELN-GG genotype sustained no MCL injury during the 7 seasons of the study. Conclusions The identification of polymorphisms in the ELN gene may be used as a novel tool to better define an athlete’s genotype, and help to plan training and rehabilitation programmes to prevent or minimize MCL ligament injuries, and optimize the therapeutic and rehabilitation process after soft tissue injuries, and manage the workloads during trainings and matches. PMID:27900291

Toll-like receptor cascade and gene polymorphism in host-pathogen interaction in Lyme disease.

PubMed

Rahman, Shusmita; Shering, Maria; Ogden, Nicholas H; Lindsay, Robbin; Badawi, Alaa

2016-01-01

Lyme disease (LD) risk occurs in North America and Europe where the tick vectors of the causal agent Borrelia burgdorferi sensu lato are found. It is associated with local and systemic manifestations, and has persistent posttreatment health complications in some individuals. The innate immune system likely plays a critical role in both host defense against B. burgdorferi and disease severity. Recognition of B. burgdorferi, activation of the innate immune system, production of proinflammatory cytokines, and modulation of the host adaptive responses are all initiated by Toll-like receptors (TLRs). A number of Borrelia outer-surface proteins (eg, OspA and OspB) are recognized by TLRs. Specifically, TLR1 and TLR2 were identified as the receptors most relevant to LD. Several functional single-nucleotide polymorphisms have been identified in TLR genes, and are associated with varying cytokines types and synthesis levels, altered pathogen recognition, and disruption of the downstream signaling cascade. These single-nucleotide polymorphism-related functional alterations are postulated to be linked to disease development and posttreatment persistent illness. Elucidating the role of TLRs in LD may facilitate a better understanding of disease pathogenesis and can provide an insight into novel therapeutic targets during active disease or postinfection and posttreatment stages.

Toll-like receptor cascade and gene polymorphism in host–pathogen interaction in Lyme disease

PubMed Central

Rahman, Shusmita; Shering, Maria; Ogden, Nicholas H; Lindsay, Robbin; Badawi, Alaa

2016-01-01

Lyme disease (LD) risk occurs in North America and Europe where the tick vectors of the causal agent Borrelia burgdorferi sensu lato are found. It is associated with local and systemic manifestations, and has persistent posttreatment health complications in some individuals. The innate immune system likely plays a critical role in both host defense against B. burgdorferi and disease severity. Recognition of B. burgdorferi, activation of the innate immune system, production of proinflammatory cytokines, and modulation of the host adaptive responses are all initiated by Toll-like receptors (TLRs). A number of Borrelia outer-surface proteins (eg, OspA and OspB) are recognized by TLRs. Specifically, TLR1 and TLR2 were identified as the receptors most relevant to LD. Several functional single-nucleotide polymorphisms have been identified in TLR genes, and are associated with varying cytokines types and synthesis levels, altered pathogen recognition, and disruption of the downstream signaling cascade. These single-nucleotide polymorphism-related functional alterations are postulated to be linked to disease development and posttreatment persistent illness. Elucidating the role of TLRs in LD may facilitate a better understanding of disease pathogenesis and can provide an insight into novel therapeutic targets during active disease or postinfection and posttreatment stages. PMID:27330321

Effect of functionally significant deiodinase single nucleotide polymorphisms on drinking behavior in alcohol dependence: an exploratory investigation

PubMed Central

Lee, MR; Schwandt, ML; Bollinger, JW; Dias, AA; Oot, EN; Goldman, D; Hodgkinson, CA; Leggio, L

2016-01-01

Background Abnormalities of the hypothalamic-pituitary-thyroid (HPT) axis have been reported in alcoholism, however, there is no definitive agreement on the specific thyroid abnormalities and their underlying mechanisms in alcohol dependence (AD). The biological activity of thyroid hormones or the availability of T3 is regulated by the three deiodinase enzymes D1, D2 and D3. In the context of alcohol use, functionally significant single nucleotide polymorphisms (SNP’s) of these deiodinase genes may play a role in HPT dysfunction. Methods The present study explored the effect of three functionally significant SNP’s (D1: rs2235544, D2: rs225014 and rs12885300) of deiodinase genes on drinking behavior and thyroid stimulating hormone (TSH) levels in alcohol dependent (N=521) and control subjects (N=228). Results Rs225014 was associated with significant differences in the amount of naturalistic alcohol drinking assessed by the Timeline Follow-Back (TLFB). Alcohol-dependent subjects had significantly higher thyroid stimulating hormone levels compared to controls; however, there was no effect of genotype on TSH levels for either group. Conclusions These findings extend previous studies on thyroid dysfunction in alcoholism and provide novel, albeit preliminary, information by linking functionally significant genetic polymorphisms of the deiodinase enzymes with alcohol drinking behavior. PMID:26207529

Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

PubMed Central

Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

1999-01-01

We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

Experimental Review of DNA-Based Methods for Wine Traceability and Development of a Single-Nucleotide Polymorphism (SNP) Genotyping Assay for Quantitative Varietal Authentication.

PubMed

Catalano, Valentina; Moreno-Sanz, Paula; Lorenzi, Silvia; Grando, Maria Stella

2016-09-21

The genetic varietal authentication of wine was investigated according to DNA isolation procedures reported for enological matrices and also by testing 11 commercial extraction kits and various protocol modifications. Samples were collected at different stages of the winemaking process of renowned Italian wines Brunello di Montalcino, Lambruschi Modenesi, and Trento DOC. Results demonstrated not only that grape DNA loss is produced by the fermentation process but also that clarification and stabilization operations contribute to the reduction of double-stranded DNA content on wine. Despite the presence of inhibitors, downstream PCR genotyping yielded reliable nuclear and chloroplast SSR markers for must samples, whereas no amplification or inconsistent results were obtained at later stages of the vinification. In addition, a TaqMan genotyping assay based on cultivar-specific single-nucleotide polymorphisms (SNPs) was designed, which allowed assessment of grapevine DNA mixtures. Once the wine matrix limitations are overcome, this sensitive tool may be implemented for the relative quantification of cultivars used for blend wines or frauds.

Recent Sex Chromosome Divergence despite Ancient Dioecy in the Willow Salix viminalis

PubMed Central

Pucholt, Pascal; Wright, Alison E.; Conze, Lei Liu; Mank, Judith E.; Berlin, Sofia

2017-01-01

Abstract Sex chromosomes can evolve when recombination is halted between a pair of chromosomes, and this can lead to degeneration of the sex-limited chromosome. In the early stages of differentiation sex chromosomes are homomorphic, and even though homomorphic sex chromosomes are very common throughout animals and plants, we know little about the evolutionary forces shaping these types of sex chromosomes. We used DNA- and RNA-Seq data from females and males to explore the sex chromosomes in the female heterogametic willow, Salix viminalis, a species with ancient dioecy but with homomorphic sex chromosomes. We detected no major sex differences in read coverage in the sex determination (SD) region, indicating that the W region has not significantly degenerated. However, single nucleotide polymorphism densities in the SD region are higher in females compared with males, indicating very recent recombination suppression, followed by the accumulation of sex-specific single nucleotide polymorphisms. Interestingly, we identified two female-specific scaffolds that likely represent W-chromosome-specific sequence. We show that genes located in the SD region display a mild excess of male-biased expression in sex-specific tissue, and we use allele-specific gene expression analysis to show that this is the result of masculinization of expression on the Z chromosome rather than degeneration of female-expression on the W chromosome. Together, our results demonstrate that insertion of small DNA fragments and accumulation of sex-biased gene expression can occur before the detectable decay of the sex-limited chromosome. PMID:28453634

Association of functional polymorphisms of the transforming growth factor B1 gene with survival and graft-versus-host disease after unrelated donor hematopoietic stem cell transplantation

PubMed Central

Berro, Mariano; Mayor, Neema P.; Maldonado-Torres, Hazael; Cooke, Louise; Kusminsky, Gustavo; Marsh, Steven G.E.; Madrigal, J. Alejandro; Shaw, Bronwen E.

2010-01-01

Background Many genetic factors play major roles in the outcome of hematopoietic stem cell transplants from unrelated donors. Transforming growth factor β1 is a member of a highly pleiotrophic family of growth factors involved in the regulation of numerous immunomodulatory processes. Design and Methods We investigated the impact of single nucleotide polymorphisms at codons 10 and 25 of TGFB1, the gene encoding for transforming growth factor β1, on outcomes in 427 mye-loablative-conditioned transplanted patients. In addition, transforming growth factor β1 plasma levels were measured in 263 patients and 327 donors. Results Patients homozygous for the single nucleotide polymorphism at codon 10 had increased non-relapse mortality (at 3 years: 46.8% versus 29.4%, P=0.014) and reduced overall survival (at 5 years 29.3% versus 42.2%, P=0.013); the differences remained statistically significant in multivariate analysis. Donor genotype alone had no impact, although multiple single nucleotide polymorphisms within the pair were significantly associated with higher non-relapse mortality (at 3 years: 44% versus 29%, P=0.021) and decreased overall survival (at 5 years: 33.8% versus 41.9%, P=0.033). In the 10/10 HLA matched transplants (n=280), recipients of non-wild type grafts tended to have a higher incidence of acute graft-versus-host disease grades II-IV (P=0.052). In multivariate analysis, when analyzed with patients’ genotype, the incidences of both overall and grades II-IV acute graft-versus-host disease were increased (P=0.025 and P=0.009, respectively) in non-wild-type pairs. Conclusions We conclude that increasing numbers of single nucleotide polymorphisms in codon 10 of TGFB1 in patients and donors are associated with a worse outcome following hematopoietic stem cell transplantation from unrelated donors. PMID:19713222

Bridging the Gap Between Large-scale Data Sets and Analyses: Semi-automated Methods to Facilitate Length Polymorphism Scoring and Data Analyses.

EPA Science Inventory

Amplified fragment length polymorphism (AFLP) markers can be developed more quickly and at a lower cost than microsatellite and single nucleotide polymorphism markers, which makes them ideal markers for large-scale studies of understudied taxa — such as species at risk. However,...

Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease

PubMed Central

Heidari, Mohammad Mehdi; Soheilyfar, Sorour

2016-01-01

Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013

Unique CD44 intronic SNP is associated with tumor grade in breast cancer: a case control study and in silico analysis.

PubMed

Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan

2018-01-01

CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.

[Efficiency of 27-plex single nucleotide polymorphism multiplex system for ancestry inference in different populations].

PubMed

Feng, Xing-Ling; Sun, Qi-Fan; Liu, Hong; Wei, Yi-Liang; DU, Wei-An; Li, Cai-Xia; Chen, Ling; Liu, Chao

2016-04-20

To validate the efficiency of 27-plex single nucleotide polymorphism (SNP) multiplex system for ancestry inference. The 27-plex SNP system was validated for its sensitivity and species specificity. A total of 533 samples were collected from African, Southern Chinese Han, China's ethic minorities (Yi, Hui, Miao, Tibet, and Uygur), European, Central Asian, Western Asian, Southern Asian, Southeast Asian and South American populations for clustering analysis of the genotypes by citing 3 representative continental ancestral groups [East Asia (CHB), Europe (CEU), and Africa (YRI)] from HapMap database. The system sensitivity is 0.125 ng. Twenty and six genotypes were detected in chimpanzee and monkeys, respectively. Except in rs10496971, no more products were found in other animals. The system was capable of differentiating intercontinental populations but not of distinguishing between East Asian and Southeast Asian population or between Southern Chinese Han population and Chinese Ethnic populations (Hui, Miao, Yi and Tibet). This system achieved a 100% accuracy for intercontinental population source inference for 46 blind test samples. 27-plex SNPs multiplex system has a high sensitivity and species specificity and can correctly differentiate the ancestry origins of individuals from African, European and East Asian for criminal case investigation. But this system is not capable of distinguishing subpopulation groups and more specific ancestry-informative markers are needed to improve its recognition of Southeast Asian and Chinese ethnic populations.

[The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

PubMed

Bai, Peng; Tian, Li; Zhou, Xue-ping

2005-05-01

DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

Testing for genetic association taking into account phenotypic information of relatives.

PubMed

Uh, Hae-Won; Wijk, Henk Jan van der; Houwing-Duistermaat, Jeanine J

2009-12-15

We investigated efficient case-control association analysis using family data. The outcome of interest was coronary heart disease. We employed existing and new methods that take into account the correlations among related individuals to obtain the proper type I error rates. The methods considered for autosomal single-nucleotide polymorphisms were: 1) generalized estimating equations-based methods, 2) variance-modified Cochran-Armitage (MCA) trend test incorporating kinship coefficients, and 3) genotypic modified quasi-likelihood score test. Additionally, for X-linked single-nucleotide polymorphisms we proposed a two-degrees-of-freedom test. Performance of these methods was tested using Framingham Heart Study 500 k array data.

Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

PubMed

Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

2015-05-15

Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

Allelic imbalance of multiple sclerosis susceptibility genes IKZF3 and IQGAP1 in human peripheral blood.

PubMed

Keshari, Pankaj K; Harbo, Hanne F; Myhr, Kjell-Morten; Aarseth, Jan H; Bos, Steffan D; Berge, Tone

2016-04-14

Multiple sclerosis is a chronic inflammatory, demyelinating disease of the central nervous system. Recent genome-wide studies have revealed more than 110 single nucleotide polymorphisms as associated with susceptibility to multiple sclerosis, but their functional contribution to disease development is mostly unknown. Consistent allelic imbalance was observed for rs907091 in IKZF3 and rs11609 in IQGAP1, which are in strong linkage disequilibrium with the multiple sclerosis associated single nucleotide polymorphisms rs12946510 and rs8042861, respectively. Using multiple sclerosis patients and healthy controls heterozygous for rs907091 and rs11609, we showed that the multiple sclerosis risk alleles at IKZF3 and IQGAP1 are expressed at higher levels as compared to the protective allele. Furthermore, individuals homozygous for the multiple sclerosis risk allele at IQGAP1 had a significantly higher total expression of IQGAP1 compared to individuals homozygous for the protective allele. Our data indicate a possible regulatory role for the multiple sclerosis-associated IKZF3 and IQGAP1 variants. We suggest that such cis-acting mechanisms may contribute to the multiple sclerosis association of single nucleotide polymorphisms at IKZF3 and IQGAP1.

Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

PubMed

Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

2014-04-01

Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

Electrochemical primer extension based on polyoxometalate electroactive labels for multiplexed detection of single nucleotide polymorphisms.

PubMed

Chahin, Nassif; Uribe, Laura A; Debela, Ahmed M; Thorimbert, Serge; Hasenknopf, Bernold; Ortiz, Mayreli; Katakis, Ioannis; O'Sullivan, Ciara K

2018-06-07

Polyoxymetalates (POMs) ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ) were used to modify dideoxynucleotides (ddNTPs) through amide bond formation, and applied to the multiplexed detection of single nucleotide polymorphisms (SNPs) in an electrochemical primer extension reaction. Each gold electrode of an array was functionalised with a short single stranded thiolated DNA probe, specifically designed to extend with the POM-ddNTP at the SNP site to be interrogated. The system was applied to the simultaneous detection of 4 SNPs within a single stranded 103-mer model target generated using asymmetric PCR, highlighting the potential of POM-ddNTPs for targeted, multiplexed SNP detection. The four DNA bases were successfully labelled with both ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ), and [SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- demonstrated to be the more suitable due to its single oxidation peak, which provides an unequivocal signal. The POM-ddNTP enzymatically incorporated to the DNA anchored to the surface was visualised by AFM using gold coated mica. The developed assay has been demonstrated to be highly reproducible, simple to carry out and with very low non-specific background signals. Future work will focus on applying the developed platform to the detection of SNPs associated with rifampicin resistance in real samples from patients suffering from tuberculosis. Copyright © 2018. Published by Elsevier B.V.

Genetic Variants of TPCN2 Associated with Type 2 Diabetes Risk in the Chinese Population

PubMed Central

Zhang, Yu; Fan, Xiaofang; Zhang, Ning; Zheng, Hui; Song, Yuping; Shen, Chunfang; Shen, Jiayi; Ren, Fengdong; Yang, Jialin

2016-01-01

Objective The aim of this study was to determine whether TPCN2 genetic variants are associated with type 2 diabetes and to elucidate which variants in TPCN2 confer diabetes susceptibility in the Chinese population. Research Design and Methods The sample population included 384 patients with type 2 diabetes and 1468 controls. Anthropometric parameters, glycemic and lipid profiles and insulin resistance were measured. We selected 6 TPCN2 tag single nucleotide polymorphisms (rs35264875, rs267603153, rs267603154, rs3829241, rs1551305, and rs3750965). Genotypes were determined using a Sequenom MassARRAY SNP genotyping system. Results Ultimately, we genotyped 3 single nucleotide polymorphisms (rs3750965, rs3829241, and rs1551305) in all individuals. There was a 5.1% higher prevalence of the rs1551305 variant allele in type 2 diabetes individuals (A) compared with wild-type homozygous individuals (G). The AA genotype of rs1551305 was associated with a higher diabetes risk (p<0.05). The distributions of rs3829241 and rs3750965 polymorphisms were not significantly different between the two groups. HOMA-%B of subjects harboring the AA genotype of rs1551305 decreased by 14.87% relative to the GG genotype. Conclusions TPCN2 plays a role in metabolic regulation, and the rs1551305 single nucleotide polymorphism is associated with type 2 diabetes risk. Future work will begin to unravel the underlying mechanisms. PMID:26918892

Genetic and epigenetic variation in the lineage specification of regulatory T cells

PubMed Central

Arvey, Aaron; van der Veeken, Joris; Plitas, George; Rich, Stephen S; Concannon, Patrick; Rudensky, Alexander Y

2015-01-01

Regulatory T (Treg) cells, which suppress autoimmunity and other inflammatory states, are characterized by a distinct set of genetic elements controlling their gene expression. However, the extent of genetic and associated epigenetic variation in the Treg cell lineage and its possible relation to disease states in humans remain unknown. We explored evolutionary conservation of regulatory elements and natural human inter-individual epigenetic variation in Treg cells to identify the core transcriptional control program of lineage specification. Analysis of single nucleotide polymorphisms in core lineage-specific enhancers revealed disease associations, which were further corroborated by high-resolution genotyping to fine map causal polymorphisms in lineage-specific enhancers. Our findings suggest that a small set of regulatory elements specify the Treg lineage and that genetic variation in Treg cell-specific enhancers may alter Treg cell function contributing to polygenic disease. DOI: http://dx.doi.org/10.7554/eLife.07571.001 PMID:26510014

Association between Tryptophan Hydroxylase 2 Gene Polymorphism and Completed Suicide

ERIC Educational Resources Information Center

Fudalej, Sylwia; Ilgen, Mark; Fudalej, Marcin; Kostrzewa, Grazyna; Barry, Kristen; Wojnar, Marcin; Krajewski, Pawel; Blow, Frederic; Ploski, Rafal

2010-01-01

The association between suicide and a single nucleotide polymorphism (rs1386483) was examined in the recently identified tryptophan hydroxylase 2 (TPH2) gene. Blood samples of 143 suicide victims and 162 age- and sex-matched controls were examined. The frequency of the TT genotype in the TPH2 polymorphism was higher in suicide victims than in…

Association of ABCB1 and ABCG2 single nucleotide polymorphisms with clinical findings and response to chemotherapy treatments in Kurdish patients with breast cancer.

PubMed

Ghafouri, Houshiyar; Ghaderi, Bayazid; Amini, Sabrieh; Nikkhoo, Bahram; Abdi, Mohammad; Hoseini, Abdolhakim

2016-06-01

The possible interaction between gene polymorphisms and risk of cancer progression is very interesting. Polymorphisms in multi-drug resistance genes have an important role in response to anti-cancer drugs. The present study was aimed to evaluate the possible effects of ABCB1 C3435T and ABCG2 C421A single nucleotide polymorphisms on clinical and pathological outcomes of Kurdish patients with breast cancer. One hundred breast cancer patients and 200 healthy controls were enrolled in this case-control study. Clinical and pathological findings of all individuals were reported, and immunohistochemistry staining was used to assess the tissue expression of specific breast cancer proteins. The ABCB1 C3435T and ABCG2 C421 genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP). The distribution of different genotypes between patient and control groups was only significant for ABCG2 C421A. A allele of ABCG2 C421A polymorphisms were significantly higher in patients than in controls. Patients with AA genotype of ABCG2 C421A were at higher risk of progressing breast cancer. Patients with A allele of ABCG2 had complete response to chemotherapeutic agents. There was no statistically significant association between ABCB1 C3435T and ABCG2 C421A polymorphisms and tissue expression of ER, PR, Her2/neu, and Ki67. The ABCB1 C3435T has no correlation with clinical findings and treatment with chemotherapy drugs. The A allele of ABCG2 C421A may be a risk factor for progression of breast cancer in Kurdish patients. In addition, breast cancer patients with C allele of this polymorphism have weaker response to treatments with anthracyclines and Paclitaxol.

Association of the widespread A149P hereditary fructose intolerance mutation with newly identified sequence polymorphisms in the aldolase B gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brooks, C.C.; Tolan, D.R.

1993-04-01

Hereditary fructose intolerance (HFI) is a potentially fatal autosomal recessive disease resulting from the catalytic deficiency of fructose 1-phosphate aldolase (aldolase B) in fructose-metabolizing tissues. The A149P mutation in exon 5 of the aldolase B gene, located on chromosome 9q2l.3-q22.2, is widespread and the most common HFI mutation, accounting for 57% of HFI chromosomes. The possible origin of this mutation was studied by linkage to polymorphisms within the aldolase B gene. DNA fragments of the aldolase B gene containing the polymorphic marker loci from HFI patients homozygous for the A149P allele were amplified by PCR. Absolute linkage to a commonmore » Pvull RFLP allele was observed in 10 A149P homozygotes. In a more informative study, highly heterozygous polymorphisms were detected by direct sequence determination of a PCR-amplified aldolase B gene fragment. Two two-allele, single-base-pair polymorphisms, themselves in absolute linkage disequilibrium, in intron 8 (C at nucleotide 84 and A at nucleotide 105, or T at 84 and G at 105) of the aldolase B gene were identified. Mendelian segregation of these polymorphisms was confirmed in three families. Allele-specific oligonucleotide (ASO) hybridizations with probes for both sequence polymorphisms showed that 47% of 32 unrelated individuals were heterozygous at these loci; the calculated PIC value was .37. Finally, ASO hybridizations of PCR-amplified DNA from 15 HFI patients homozygous for the A149P allele with probes for these sequence polymorphisms revealed absolute linkage disequilibrium between the A149P mutation and the 84T/105G allele. These results are consistent with a single origin of the A149P allele and subsequent spread by genetic drift. 32 refs., 4 figs., 3 tabs.« less

The AVPR1A Gene and Its Single Nucleotide Polymorphism rs10877969: A Literature Review of Associations with Health Conditions and Pain.

PubMed

Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J

2018-03-01

Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Effects of the BDNF Val66Met Polymorphism on Anxiety-Like Behavior Following Nicotine Withdrawal in Mice.

PubMed

Lee, Bridgin G; Anastasia, Agustin; Hempstead, Barbara L; Lee, Francis S; Blendy, Julie A

2015-12-01

Nicotine withdrawal is characterized by both affective and cognitive symptoms. Identifying genetic polymorphisms that could affect the symptoms associated with nicotine withdrawal are important in predicting withdrawal sensitivity and identifying personalized cessation therapies. In the current study we used a mouse model of a non-synonymous single nucleotide polymorphism in the translated region of the brain-derived neurotrophic factor (BDNF) gene that substitutes a valine (Val) for a methionine (Met) amino acid (Val66Met) to examine the relationship between the Val66Met single nucleotide polymorphism and nicotine dependence. This study measured proBDNF and the BDNF prodomain levels following nicotine and nicotine withdrawal and examined a mouse model of a common polymorphism in this protein (BDNF(Met/Met)) in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test. Using the BDNF knock-in mouse containing the BDNF Val66Met polymorphism we found: (1) blunted anxiety-like behavior in BDNF(Met/Met) mice following withdrawal in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test; (2) the anxiolytic effects of chronic nicotine are absent in BDNF(Met/Met) mice; and (3) an increase in BDNF prodomain in BDNF(Met/Met) mice following nicotine withdrawal. Our study is the first to examine the effect of the BDNF Val66Met polymorphism on the affective symptoms of withdrawal from nicotine in mice. In these mice, a single-nucleotide polymorphism in the translated region of the BDNF gene can result in a blunted withdrawal, as measured by decreased anxiety-like behavior. The significant increase in the BDNF prodomain in BDNF(Met/Met) mice following nicotine cessation suggests a possible role of this ligand in the circuitry remodeling after withdrawal. © The Author 2015. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

Rapid identification of genes controlling virulence and immunity in malaria parasites

PubMed Central

Xangsayarath, Phonepadith; Tang, Jianxia; Yahata, Kazuhide; Zoungrana, Augustin; Mitaka, Hayato; Acharjee, Arita; Datta, Partha P.; Hunt, Paul; Carter, Richard; Kaneko, Osamu; Mustonen, Ville; Pain, Arnab

2017-01-01

Identifying the genetic determinants of phenotypes that impact disease severity is of fundamental importance for the design of new interventions against malaria. Here we present a rapid genome-wide approach capable of identifying multiple genetic drivers of medically relevant phenotypes within malaria parasites via a single experiment at single gene or allele resolution. In a proof of principle study, we found that a previously undescribed single nucleotide polymorphism in the binding domain of the erythrocyte binding like protein (EBL) conferred a dramatic change in red blood cell invasion in mutant rodent malaria parasites Plasmodium yoelii. In the same experiment, we implicated merozoite surface protein 1 (MSP1) and other polymorphic proteins, as the major targets of strain-specific immunity. Using allelic replacement, we provide functional validation of the substitution in the EBL gene controlling the growth rate in the blood stages of the parasites. PMID:28704525

Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

PubMed

Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

2013-06-01

Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and reliable genotyping tool to assist hybrid cotton breeding.

Footprints of ancient-balanced polymorphisms in genetic variation data from closely related species

PubMed Central

Gao, Ziyue; Przeworski, Molly; Sella, Guy

2015-01-01

When long-lasting, balancing selection can lead to “trans-species” polymorphisms that are shared by two or more species identical by descent. In such cases, the gene genealogy at the selected site clusters by allele instead of by species, and nearby neutral sites also have unusual genealogies because of linkage. While this scenario is expected to leave discernible footprints in genetic variation data, the specific patterns remain poorly characterized. Motivated by recent findings in primates, we focus on the case of a biallelic polymorphism under ancient balancing selection and derive approximations for summaries of the polymorphism data from two species. Specifically, we characterize the length of the segment that carries most of the footprints, the expected number of shared neutral single nucleotide polymorphisms (SNPs), and the patterns of allelic associations among them. We confirm the accuracy of our approximations by coalescent simulations. We further show that for humans and chimpanzees—more generally, for pairs of species with low genetic diversity levels—these patterns are highly unlikely to be generated by neutral recurrent mutations. We discuss the implications for the design and interpretation of genome scans for ancient balanced polymorphisms in primates and other taxa. PMID:25403856

Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping

2010-12-01

Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

Single-nucleotide polymorphisms in the LRWD1 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

PubMed

Miyamoto, T; Koh, E; Tsujimura, A; Miyagawa, Y; Saijo, Y; Namiki, M; Sengoku, K

2014-04-01

Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, ten novel genes involved in human spermatogenesis, including human LRWD1, have been identified by expression microarray analysis of human testictissue. The human LRWD1 protein mediates the origin recognition complex in chromatin, which is critical for the initiation of pre-replication complex assembly in G1 and chromatin organization in post-G1 cells. The Lrwd1 gene expression is specific to the testis in mice. Therefore, we hypothesized that mutation or polymorphisms of LRWD1 participate in male infertility, especially azoospermia. To investigate whether LRWD1 gene defects are associated with azoospermia caused by SCOS and meiotic arrest (MA), mutational analysis was performed in 100 and 30 Japanese patients by direct sequencing of the coding regions, respectively. Statistical analysis was performed for patients with SCOS and MA and in 100 healthy control men. No mutations were found in LRWD1; however, three coding single-nucleotide polymorphisms (SNP1-SNP3) could be detected in the patients. The genotype and allele frequencies in SNP1 and SNP2 were notably higher in the SCOS group than in the control group (P < 0.05). These results suggest the critical role of LRWD1 in human spermatogenesis. © 2013 Blackwell Verlag GmbH.

HERC1 polymorphisms: population-specific variations in haplotype composition.

PubMed

Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen

2009-08-01

Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.

Genomic diversity of the human intestinal parasite Entamoeba histolytica

PubMed Central

2012-01-01

Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046

Recent Sex Chromosome Divergence despite Ancient Dioecy in the Willow Salix viminalis.

PubMed

Pucholt, Pascal; Wright, Alison E; Conze, Lei Liu; Mank, Judith E; Berlin, Sofia

2017-08-01

Sex chromosomes can evolve when recombination is halted between a pair of chromosomes, and this can lead to degeneration of the sex-limited chromosome. In the early stages of differentiation sex chromosomes are homomorphic, and even though homomorphic sex chromosomes are very common throughout animals and plants, we know little about the evolutionary forces shaping these types of sex chromosomes. We used DNA- and RNA-Seq data from females and males to explore the sex chromosomes in the female heterogametic willow, Salix viminalis, a species with ancient dioecy but with homomorphic sex chromosomes. We detected no major sex differences in read coverage in the sex determination (SD) region, indicating that the W region has not significantly degenerated. However, single nucleotide polymorphism densities in the SD region are higher in females compared with males, indicating very recent recombination suppression, followed by the accumulation of sex-specific single nucleotide polymorphisms. Interestingly, we identified two female-specific scaffolds that likely represent W-chromosome-specific sequence. We show that genes located in the SD region display a mild excess of male-biased expression in sex-specific tissue, and we use allele-specific gene expression analysis to show that this is the result of masculinization of expression on the Z chromosome rather than degeneration of female-expression on the W chromosome. Together, our results demonstrate that insertion of small DNA fragments and accumulation of sex-biased gene expression can occur before the detectable decay of the sex-limited chromosome. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Interferon regulatory factor 5 (IRF5) gene variants are associated with multiple sclerosis in three distinct populations

PubMed Central

Kristjansdottir, G; Sandling, J K; Bonetti, A; Roos, I M; Milani, L; Wang, C; Gustafsdottir, S M; Sigurdsson, S; Lundmark, A; Tienari, P J; Koivisto, K; Elovaara, I; Pirttilä, T; Reunanen, M; Peltonen, L; Saarela, J; Hillert, J; Olsson, T; Landegren, U; Alcina, A; Fernández, O; Leyva, L; Guerrero, M; Lucas, M; Izquierdo, G; Matesanz, F; Syvänen, A-C

2008-01-01

Background: IRF5 is a transcription factor involved both in the type I interferon and the toll-like receptor signalling pathways. Previously, IRF5 has been found to be associated with systemic lupus erythematosus, rheumatoid arthritis and inflammatory bowel diseases. Here we investigated whether polymorphisms in the IRF5 gene would be associated with yet another disease with features of autoimmunity, multiple sclerosis (MS). Methods: We genotyped nine single nucleotide polymorphisms and one insertion-deletion polymorphism in the IRF5 gene in a collection of 2337 patients with MS and 2813 controls from three populations: two case–control cohorts from Spain and Sweden, and a set of MS trio families from Finland. Results: Two single nucleotide polymorphism (SNPs) (rs4728142, rs3807306), and a 5 bp insertion-deletion polymorphism located in the promoter and first intron of the IRF5 gene, showed association signals with values of p<0.001 when the data from all cohorts were combined. The predisposing alleles were present on the same common haplotype in all populations. Using electrophoretic mobility shift assays we observed allele specific differences in protein binding for the SNP rs4728142 and the 5 bp indel, and by a proximity ligation assay we demonstrated increased binding of the transcription factor SP1 to the risk allele of the 5 bp indel. Conclusion: These findings add IRF5 to the short list of genes shown to be associated with MS in more than one population. Our study adds to the evidence that there might be genes or pathways that are common in multiple autoimmune diseases, and that the type I interferon system is likely to be involved in the development of these diseases. PMID:18285424

The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

PubMed

Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

2011-10-01

The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, G K; Hillier, L; Brandstrom, M

2005-02-20

We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

PubMed

Zeng, Lingwen; Xiao, Zhuo

2017-01-01

A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

PubMed

Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

2017-05-01

Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

No Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Experimentally Elicited Social Preferences

PubMed Central

Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

2010-01-01

Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395

No association between oxytocin receptor (OXTR) gene polymorphisms and experimentally elicited social preferences.

PubMed

Apicella, Coren L; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

2010-06-16

Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant.

Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

PubMed

Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

2008-01-01

Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

Multiplex Allele-Specific Amplification from Whole Blood for Detecting Multiple Polymorphisms Simultaneously

PubMed Central

Zhu, Jianjie; Chen, Lanxin; Mao, Yong; Zhou, Huan

2013-01-01

Allele-specific amplification on the basis of polymerase chain reaction (PCR) has been widely used for single-nucleotide polymorphism (SNP) genotyping. However, the extraction of PCR-compatible genomic DNA from whole blood is usually required. This process is complicated and tedious, and is prone to cause cross-contamination between samples. To facilitate direct PCR amplification from whole blood without the extraction of genomic DNA, we optimized the pH value of PCR solution and the concentrations of magnesium ions and facilitator glycerol. Then, we developed multiplex allele-specific amplifications from whole blood and applied them to a case–control study. In this study, we successfully established triplex, five-plex, and eight-plex allele-specific amplifications from whole blood for determining the distribution of genotypes and alleles of 14 polymorphisms in 97 gastric cancer patients and 141 healthy controls. Statistical analysis results showed significant association of SNPs rs9344, rs1799931, and rs1800629 with the risk of gastric cancer. This method is accurate, time-saving, cost-effective, and easy-to-do, especially suitable for clinical prediction of disease susceptibility. PMID:23072573

Associations between single nucleotide polymorphisms in folate uptake and metabolizing genes with blood folate, homocysteine and DNA uracil concentrations

USDA-ARS?s Scientific Manuscript database

Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...

Markers and mapping revisited: finding your gene.

PubMed

Jones, Neil; Ougham, Helen; Thomas, Howard; Pasakinskiene, Izolda

2009-01-01

This paper is an update of our earlier review (Jones et al., 1997, Markers and mapping: we are all geneticists now. New Phytologist 137: 165-177), which dealt with the genetics of mapping, in terms of recombination as the basis of the procedure, and covered some of the first generation of markers, including restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPDs), simple sequence repeats (SSRs) and quantitative trait loci (QTLs). In the intervening decade there have been numerous developments in marker science with many new systems becoming available, which are herein described: cleavage amplification polymorphism (CAP), sequence-specific amplification polymorphism (S-SAP), inter-simple sequence repeat (ISSR), sequence tagged site (STS), sequence characterized amplification region (SCAR), selective amplification of microsatellite polymorphic loci (SAMPL), single nucleotide polymorphism (SNP), expressed sequence tag (EST), sequence-related amplified polymorphism (SRAP), target region amplification polymorphism (TRAP), microarrays, diversity arrays technology (DArT), single-strand conformation polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE) and methylation-sensitive PCR. In addition there has been an explosion of knowledge and databases in the area of genomics and bioinformatics. The number of flowering plant ESTs is c. 19 million and counting, with all the opportunity that this provides for gene-hunting, while the survey of bioinformatics and computer resources points to a rapid growth point for future activities in unravelling and applying the burst of new information on plant genomes. A case study is presented on tracking down a specific gene (stay-green (SGR), a post-transcriptional senescence regulator) using the full suite of mapping tools and comparative mapping resources. We end with a brief speculation on how genome analysis may progress into the future of this highly dynamic arena of plant science.

Landscape of Insertion Polymorphisms in the Human Genome

PubMed Central

Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

2015-01-01

Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

PubMed Central

Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

2016-01-01

Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

PubMed

Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

2014-06-01

Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

Single-Nucleotide Polymorphism-Microarray Ploidy Analysis of Paraffin-Embedded Products of Conception in Recurrent Pregnancy Loss Evaluations.

PubMed

Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C

2015-07-01

To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal cytogenetic results. Recommended recurrent pregnancy loss screening was unnecessary in almost half the patients in our study. II.

A molecular platform for the diagnosis of multidrug-resistant and pre-extensively drug-resistant tuberculosis based on single nucleotide polymorphism mutations present in Colombian isolates of Mycobacterium tuberculosis.

PubMed

Martínez, Luz Maira Wintaco; Castro, Gloria Puerto; Guerrero, Martha Inírida

2016-02-01

Developing a fast, inexpensive, and specific test that reflects the mutations present in Mycobacterium tuberculosis isolates according to geographic region is the main challenge for drug-resistant tuberculosis (TB) control. The objective of this study was to develop a molecular platform to make a rapid diagnosis of multidrug-resistant (MDR) and extensively drug-resistant TB based on single nucleotide polymorphism (SNP) mutations present in therpoB, katG, inhA,ahpC, and gyrA genes from Colombian M. tuberculosis isolates. The amplification and sequencing of each target gene was performed. Capture oligonucleotides, which were tested before being used with isolates to assess the performance, were designed for wild type and mutated codons, and the platform was standardised based on the reverse hybridisation principle. This method was tested on DNA samples extracted from clinical isolates from 160 Colombian patients who were previously phenotypically and genotypically characterised as having susceptible or MDR M. tuberculosis. For our method, the kappa index of the sequencing results was 0,966, 0,825, 0,766, 0,740, and 0,625 forrpoB, katG, inhA,ahpC, and gyrA, respectively. Sensitivity and specificity were ranked between 90-100% compared with those of phenotypic drug susceptibility testing. Our assay helps to pave the way for implementation locally and for specifically adapted methods that can simultaneously detect drug resistance mutations to first and second-line drugs within a few hours.

Rapid single nucleotide polymorphism based method for hematopoietic chimerism analysis and monitoring using high-speed droplet allele-specific PCR and allele-specific quantitative PCR.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Uehara, Masayuki; Sugano, Mitsutoshi; Okumura, Nobuo; Honda, Takayuki

2015-05-20

Chimerism analysis is important for the evaluation of engraftment and predicting relapse following hematopoietic stem cell transplantation (HSCT). We developed a chimerism analysis for single nucleotide polymorphisms (SNPs), including rapid screening of the discriminable donor/recipient alleles using droplet allele-specific PCR (droplet-AS-PCR) pre-HSCT and quantitation of recipient DNA using AS-quantitative PCR (AS-qPCR) following HSCT. SNP genotyping of 20 donor/recipient pairs via droplet-AS-PCR and the evaluation of the informativity of 5 SNP markers for chimerism analysis were performed. Samples from six follow-up patients were analyzed to assess the chimerism via AS-qPCR. These results were compared with that determined by short tandem repeat PCR (STR-PCR). Droplet-AS-PCR could determine genotypes within 8min. The total informativity using all 5 loci was 95% (19/20). AS-qPCR provided the percentage of recipient DNA in all 6 follow-up patients without influence of the stutter peak or the amplification efficacy, which affected the STR-PCR results. The droplet-AS-PCR had an advantage over STR-PCR in terms of rapidity and simplicity for screening before HSCT. Furthermore, AS-qPCR had better accuracy than STR-PCR for quantification of recipient DNA following HSCT. The present chimerism assay compensates for the disadvantages of STR-PCR and is readily performable in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

NASA Astrophysics Data System (ADS)

Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

2017-02-01

Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P < 0.01), from which we constructed four main haplotypes due to linkage disequilibrium. Furthermore, the most effective haplotype H2 (GAGGAT) had extremely significant relationship with high glycogen content ( P < 0.0001). These findings revealed the potential influence of Cg-GYS polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

Interactions between genetic variants associated with adiposity traits and soft drinks in relation to longitudinal changes in body weight and waist circumference.

PubMed

Olsen, Nanna J; Ängquist, Lars; Larsen, Sofus C; Linneberg, Allan; Skaaby, Tea; Husemoen, Lise Lotte N; Toft, Ulla; Tjønneland, Anne; Halkjær, Jytte; Hansen, Torben; Pedersen, Oluf; Overvad, Kim; Ahluwalia, Tarunveer S; Sørensen, Thorkild Ia; Heitmann, Berit L

2016-09-01

Intake of sugar-sweetened beverages is associated with obesity, and this association may be modified by a genetic predisposition to obesity. We examined the interactions between a molecular genetic predisposition to various aspects of obesity and the consumption of soft drinks, which are a major part of sugar-sweetened beverages, in relation to changes in adiposity measures. A total of 4765 individuals were included in the study. On the basis of 50 obesity-associated single nucleotide polymorphisms that are associated with body mass index (BMI), waist circumference (WC), or the waist-to-hip ratio adjusted for BMI (WHRBMI), the following 4 genetic predisposition scores (GRSs) were constructed: a complete genetic predisposition score including all 50 single nucleotide polymorphisms (GRSComplete), a genetic predisposition score including BMI-associated single nucleotide polymorphisms (GRSBMI), a genetic predisposition score including waist circumference-associated single nucleotide polymorphisms (GRSWC), and a genetic predisposition score including the waist-to-hip ratio adjusted for BMI-associated single nucleotide polymorphisms (GRSWHR). Associations between soft drink intake and the annual change (Δ) in body weight (BW), WC, or waist circumference adjusted for BMI (WCBMI) and possible interactions with the GRSs were examined with the use of linear regression analyses and meta-analyses. For each soft drink serving per day, soft drink consumption was significantly associated with a higher ΔBW of 0.07 kg/y (95% CI: 0.01, 0.13 kg/y; P = 0.020) but not with the ΔWC or ΔWCBMI In analyses of the ΔBW, we showed an interaction only with the GRSWC (per risk allele for each soft drink serving per day: -0.06 kg/y; 95% CI: -0.10, -0.02 kg/y; P = 0.006). In analyses of the ΔWC, we showed interactions only with the GRSBMI and GRSComplete [per risk allele for each soft drink serving per day: 0.05 cm/y (95% CI: 0.02, 0.09 cm/y; P = 0.001) and 0.05 cm/y (95% CI: 0.02, 0.07 cm/y; P = 0.001), respectively]. Nearly identical results were observed in analyses of the ΔWCBMI CONCLUSIONS: A genetic predisposition to a high WC may attenuate the association between soft drink intake and BW gain. A genetic predisposition to high BMI as well as a genetic predisposition to high BMI, WC, and WHRBMI combined may strengthen the association between soft drink intake and WC gain. However, the public health impact may be limited. © 2016 American Society for Nutrition.

Polymorphic amplified typing sequences (PATS) and pulsed-field gel electrophoresis (PFGE) yield comparable results in the strain typing of a diverse set of bovine Escherichia coli O157 isolates

USDA-ARS?s Scientific Manuscript database

The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...

Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

PubMed

Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

2018-01-30

Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

PubMed Central

Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

2015-01-01

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

Radiogenomics Consortium (RGC)

Cancer.gov

The Radiogenomics Consortium's hypothesis is that a cancer patient's likelihood of developing toxicity to radiation therapy is influenced by common genetic variations, such as single nucleotide polymorphisms (SNPs).

Association between methylenetetrahydrofolate reductase polymorphism C677T and risk of chronic myeloid leukemia in Serbian population.

PubMed

Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila

2012-07-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.

Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

PubMed

Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

2006-08-01

Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

Interaction of TLR-IFN and HLA polymorphisms on susceptibility of chronic HBV infection in Southwest Han Chinese.

PubMed

He, Dengming; Tao, Shiqi; Guo, Shimin; Li, Maoshi; Wu, Junqiu; Huang, Hongfei; Guo, Xinwu; Yan, Guohua; Zhu, Peng; Wang, Yuming

2015-08-01

The toll-like receptor-interferon (TLR-IFN) signalling pathway plays a crucial role in HBV infection. Human leucocyte antigen (HLA) polymorphisms are associated with chronic HBV infection by genome wide association study (GWAS). We aimed to explore interaction between TLR-IFN and HLA gene polymorphisms in susceptibility of chronic HBV infection. In the Chinese Southwest Han population, 1191 chronic HBV infection patients and 273 HBV clearance were selected. A total of 39 single nucleotide polymorphism loci in 23 genes of the TLR-IFN pathway and four HLA polymorphism loci associated with chronic HBV infection identified by GWAS were selected for genotyping. SNPStats, QVALUE, and multifactor dimensionality reduction were used for statistical analysis. A significant association was seen in several of the TLR-IFN pathway genes, TLR9 rs352140 (OR = 0.70, P = 0.0088), IL1B rs16944 (OR = 0.67, P = 0.016), IL12B rs3212227 (OR = 1.38, P = 0.021), IFNGR1 rs3799488 (OR = 1.48, P = 0.0048), IFNGR2 rs1059293 (OR = 0.27, P = 0.011), MX1 rs467960 (OR = 0.68, P = 0.022), as well as four loci in HLA, rs3077 (OR = 0.55, P < 0.0001), rs2856718 (OR = 0.60, P = 4e-04), rs9277535 (OR = 0.54, P < 0.0001) and rs7453920 (OR = 0.43, P < 0.0001). A synergistic relationship was seen between rs9277535 and rs16944 (0.13%), rs1143623 and rs6613 (0.10%). The combination of rs9277535 in HLA and rs16944 in IL1B was the best model to predict chronic HBV infection (testing accuracy = 0.6040, P = 0.0010, cross-validation consistency = 10/10). TLR-IFN pathway gene polymorphisms are associated with chronic HBV infection. Interactions with polymorphisms in these genes may be one mechanism by which HLA polymorphisms influence susceptibility to chronic HBV infection, as specific single nucleotide polymorphism combinations are highly predictive of chronic HBV infection. © 2014 The Authors. Liver International Published by John Wiley & Sons Ltd.

BDNF Polymorphism Predicts General Intelligence after Penetrating Traumatic Brain Injury

PubMed Central

Rostami, Elham; Krueger, Frank; Zoubak, Serguei; Dal Monte, Olga; Raymont, Vanessa; Pardini, Matteo; Hodgkinson, Colin A.; Goldman, David; Risling, Mårten; Grafman, Jordan

2011-01-01

Neuronal plasticity is a fundamental factor in cognitive outcome following traumatic brain injury. Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, plays an important role in this process. While there are many ways to measure cognitive outcome, general cognitive intelligence is a strong predictor of everyday decision-making, occupational attainment, social mobility and job performance. Thus it is an excellent measure of cognitive outcome following traumatic brain injury (TBI). Although the importance of the single-nucleotide polymorphisms polymorphism on cognitive function has been previously addressed, its role in recovery of general intelligence following TBI is unknown. We genotyped male Caucasian Vietnam combat veterans with focal penetrating TBI (pTBI) (n = 109) and non-head injured controls (n = 38) for 7 BDNF single-nucleotide polymorphisms. Subjects were administrated the Armed Forces Qualification Test (AFQT) at three different time periods: pre-injury on induction into the military, Phase II (10–15 years post-injury, and Phase III (30–35 years post-injury). Two single-nucleotide polymorphisms, rs7124442 and rs1519480, were significantly associated with post-injury recovery of general cognitive intelligence with the most pronounced effect at the Phase II time point, indicating lesion-induced plasticity. The genotypes accounted for 5% of the variance of the AFQT scores, independently of other significant predictors such as pre-injury intelligence and percentage of brain volume loss. These data indicate that genetic variations in BDNF play a significant role in lesion-induced recovery following pTBI. Identifying the underlying mechanism of this brain-derived neurotrophic factor effect could provide insight into an important aspect of post-traumatic cognitive recovery. PMID:22087305

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

PubMed

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

2017-01-01

RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments.

Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

PubMed

Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

2017-04-01

Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

Normal Genetic Variation, Cognition, and Aging

PubMed Central

Greenwood, P. M.; Parasuraman, Raja

2005-01-01

This article reviews the modulation of cognitive function by normal genetic variation. Although the heritability of “g” is well established, the genes that modulate specific cognitive functions are largely unidentified. Application of the allelic association approach to individual differences in cognition has begun to reveal the effects of single nucleotide polymorphisms on specific and general cognitive functions. This article proposes a framework for relating genotype to cognitive phenotype by considering the effect of genetic variation on the protein product of specific genes within the context of the neural basis of particular cognitive domains. Specificity of effects is considered, from genes controlling part of one receptor type to genes controlling agents of neuronal repair, and evidence is reviewed of cognitive modulation by polymorphisms in dopaminergic and cholinergic receptor genes, dopaminergic enzyme genes, and neurotrophic genes. Although allelic variation in certain genes can be reliably linked to cognition—specifically to components of attention, working memory, and executive function in healthy adults—the specificity, generality, and replicability of the effects are not fully known. PMID:15006290

Reciprocal uniparental disomy in yeast.

PubMed

Andersen, Sabrina L; Petes, Thomas D

2012-06-19

In the diploid cells of most organisms, including humans, each chromosome is usually distinguishable from its partner homolog by multiple single-nucleotide polymorphisms. One common type of genetic alteration observed in tumor cells is uniparental disomy (UPD), in which a pair of homologous chromosomes are derived from a single parent, resulting in loss of heterozygosity for all single-nucleotide polymorphisms while maintaining diploidy. Somatic UPD events are usually explained as reflecting two consecutive nondisjunction events. Here we report a previously undescribed mode of chromosome segregation in Saccharomyces cerevisiae in which one cell division produces daughter cells with reciprocal UPD for the same pair of chromosomes without an aneuploid intermediate. One pair of sister chromatids is segregated into one daughter cell and the other pair is segregated into the other daughter cell, mimicking a meiotic chromosome segregation pattern. We term this process "reciprocal uniparental disomy."

Systematic, genome-wide, sex-specific linkage of cardiovascular traits in French Canadians.

PubMed

Seda, Ondrej; Tremblay, Johanne; Gaudet, Daniel; Brunelle, Pierre-Luc; Gurau, Alexandru; Merlo, Ettore; Pilote, Louise; Orlov, Sergei N; Boulva, Francis; Petrovich, Milan; Kotchen, Theodore A; Cowley, Allen W; Hamet, Pavel

2008-04-01

The sexual dimorphism of cardiovascular traits, as well as susceptibility to a variety of related diseases, has long been recognized, yet their sex-specific genomic determinants are largely unknown. We systematically assessed the sex-specific heritability and linkage of 539 hemodynamic, metabolic, anthropometric, and humoral traits in 120 French-Canadian families from the Saguenay-Lac-St-Jean region of Quebec, Canada. We performed multipoint linkage analysis using microsatellite markers followed by peak-wide linkage scan based on Affymetrix Human Mapping 50K Array Xba240 single nucleotide polymorphism genotypes in 3 settings, including the entire sample and then separately in men and women. Nearly one half of the traits were age and sex independent, one quarter were both age and sex dependent, and one eighth were exclusively age or sex dependent. Sex-specific phenotypes are most frequent in heart rate and blood pressure categories, whereas sex- and age-independent determinants are predominant among humoral and biochemical parameters. Twenty sex-specific loci passing multiple testing criteria were corroborated by 2-point single nucleotide polymorphism linkage. Several resting systolic blood pressure measurements showed significant genotype-by-sex interaction, eg, male-specific locus at chromosome 12 (male-female logarithm of odds difference: 4.16; interaction P=0.0002), which was undetectable in the entire population, even after adjustment for sex. Detailed interrogation of this locus revealed a 220-kb block overlapping parts of TAO-kinase 3 and SUDS3 genes. In summary, a large number of complex cardiovascular traits display significant sexual dimorphism, for which we have demonstrated genomic determinants at the haplotype level. Many of these would have been missed in a traditional, sex-adjusted setting.

Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

PubMed

Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

2009-07-14

In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

Institutional Protocol to Manage Consanguinity Detected by Genetic Testing in Pregnancy in a Minor

PubMed Central

Chen, Laura P.; Beck, Anita E.; Tsuchiya, Karen D.; Chow, Penny M.; Mirzaa, Ghayda M.; Wiester, Rebecca T.

2015-01-01

Single-nucleotide polymorphism arrays and other types of genetic tests have the potential to detect first-degree consanguinity and uncover parental rape in cases of minor teenage pregnancy. We present 2 cases in which genetic testing identified parental rape of a minor teenager. In case 1, single-nucleotide polymorphism array in a patient with multiple developmental abnormalities demonstrated multiple long stretches of homozygosity, revealing parental rape of a teenage mother. In case 2, a vague maternal sexual assault history and diagnosis of Pompe disease by direct gene sequencing identified parental rape of a minor. Given the medical, legal, and ethical implications of such revelations, a protocol was developed at our institution to manage consanguinity identified via genetic testing. PMID:25687148

Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis

PubMed Central

Waterfall, Christy M.; Cobb, Benjamin D.

2001-01-01

Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a ‘matrix-based’ optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable. PMID:11726702

Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.

PubMed

Waterfall, C M; Cobb, B D

2001-12-01

Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.

A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

PubMed

López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

2012-06-01

The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.

The Impact of BDNF Polymorphisms on Suicidality in Treatment-Resistant Major Depressive Disorder: A European Multicenter Study.

PubMed

Schosser, Alexandra; Carlberg, Laura; Calati, Raffaella; Serretti, Alessandro; Massat, Isabel; Spindelegger, Christoph; Linotte, Sylvie; Mendlewicz, Julien; Souery, Daniel; Zohar, Joseph; Montgomery, Stuart; Kasper, Siegfried

2017-10-01

Numerous studies have reported associations between the brain-derived neurotrophic factor (BDNF) gene and psychiatric disorders, including suicidal behavior, although with conflicting results. A total of 250 major depressive disorder patients were collected in the context of a European multicenter resistant depression study and treated with antidepressants at adequate doses for at least 4 weeks. Suicidality was assessed using the Mini International Neuropsychiatric Interview and Hamilton Rating Scale for Depression, and treatment response using the HAM-D. Genotyping was performed for the functional Val66Met polymorphism (rs6265) and 7 additional tagging single nucleotide polymorphisms within the BDNF gene. Neither BDNF single markers nor haplotypes were found to be associated with suicide risk and lifetime history of suicide attempts. Gender-specific analyses revealed nonsignificant single marker (rs908867) and haplotypic association with suicide risk in males after multiple testing correction. Analyzing treatment response phenotypes, the functional Val66Met polymorphism as well as rs10501087 showed significant genotypic and haplotypic association with suicide risk in remitters (n=34, 13.6%). Considering the sample size, the present findings need to be replicated in larger samples to confirm or refute a role of BDNF in the investigated suicidal behavior phenotypes. © The Author 2017. Published by Oxford University Press on behalf of CINP.

Genetic Risk Conferred from Single Nucleotide Polymorphisms Towards Type II Diabetes Mellitus

DTIC Science & Technology

2013-02-14

prediabetes ” 4 . Among MHS beneficiaries ages 40 – 49, the prevalence of obesity (e.g., body mass index > 30kg/m 3 ) has been recently reported to...polymorphisms in WFS1 on prediabetic phenotypes in a population-based sample of middle-aged people with normal and abnormal glucose regulation

Polymorphism in the GALNT1 Gene and Epithelial Ovarian Cancer in Non-Hispanic White Women: The Ovarian Cancer Association Consortium

PubMed Central

Phelan, Catherine M.; Tsai, Ya-Yu; Goode, Ellen L.; Vierkant, Robert A.; Fridley, Brooke L.; Beesley, Jonathan; Chen, Xiao Qing; Webb, Penelope M.; Chanock, Stephen; Cramer, Daniel W.; Moysich, Kirsten; Edwards, Robert P.; Chang-Claude, Jenny; Garcia-Closas, Montserrat; Yang, Hannah; Wang-Gohrke, Shan; Hein, Rebecca; Green, Adele C.; Lissowska, Jolanta; Carney, Michael E.; Lurie, Galina; Wilkens, Lynne R.; Ness, Roberta B.; Pearce, Celeste Leigh; Wu, Anna H.; Van Den Berg, David J.; Stram, Daniel O.; Terry, Kathryn L.; Whiteman, David C.; Whittemore, Alice S.; DiCioccio, Richard A.; McGuire, Valerie; Doherty, Jennifer A.; Rossing, Mary Anne; Anton-Culver, Hoda; Ziogas, Argyrios; Hogdall, Claus; Hogdall, Estrid; Kjaer, Susanne Krüger; Blaakaer, Jan; Quaye, Lydia; Ramus, Susan J.; Jacobs, Ian; Song, Honglin; Pharoah, Paul D.P.; Iversen, Edwin S.; Marks, Jeffrey R.; Pike, Malcolm C.; Gayther, Simon A.; Cunningham, Julie M.; Goodman, Marc T.; Schildkraut, Joellen M.; Chenevix-Trench, Georgia; Berchuck, Andrew; Sellers, Thomas A.

2010-01-01

Aberrant glycosylation is a well-described hallmark of cancer. In a previous ovarian cancer case control study that examined polymorphisms in 26 glycosylation-associated genes, we found strong statistical evidence (P = 0.00017) that women who inherited two copies of a single-nucleotide polymorphism in the UDP-N-acetylgalactosamine:polypeptide N-acetylgalactosaminyltransferase, GALNT1, had decreased ovarian cancer risk. The current study attempted to replicate this observation. The GALNT1 single-nucleotide polymorphism rs17647532 was genotyped in 6,965 cases and 8,377 controls from 14 studies forming the Ovarian Cancer Association Consortium. The fixed effects estimate per rs17647532 allele was null (odds ratio, 0.99; 95% confidence interval, 0.92–1.07). When a recessive model was fit, the results were unchanged. Test for hetero geneity of the odds ratios revealed consistency across the 14 replication sites but significant differences compared with the original study population (P = 0.03). This study underscores the need for replication of putative findings in genetic association studies. PMID:20142253

A domesticated transposon mediates the effects of a single-nucleotide polymorphism responsible for enhanced muscle growth.

PubMed

Butter, Falk; Kappei, Dennis; Buchholz, Frank; Vermeulen, Michiel; Mann, Matthias

2010-04-01

Single-nucleotide polymorphisms (SNPs) in the regulatory regions of the genome can have a profound impact on phenotype. The G3072A polymorphism in intron 3 of insulin-like growth factor 2 (IGF2) is implicated in higher muscle content and reduced fat in European pigs and is bound by a putative repressor. Here, we identify this repressor--which we call muscle growth regulator (MGR)--by using a DNA protein interaction screen based on quantitative mass spectrometry. MGR has a bipartite nuclear localization signal, two BED-type zinc fingers and is highly conserved between placental mammals. Surprisingly, the gene is located in an intron and belongs to the hobo-Ac-Tam3 transposase superfamily, suggesting regulatory use of a formerly parasitic element. In transactivation assays, MGR differentially represses the expression of the two SNP variants. Knockdown of MGR in C2C12 myoblast cells upregulates Igf2 expression and mild overexpression retards growth. Thus, MGR is the repressor responsible for enhanced muscle growth in the IGF2 G3072A polymorphism in commercially bred pigs.

Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

NASA Astrophysics Data System (ADS)

Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

2013-09-01

Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

Lack of association between ESR1 gene polymorphisms and premature ovarian failure in Serbian women.

PubMed

Li, J; Vujovic, S; Dalgleish, R; Thompson, J; Dragojevic-Dikic, S; Al-Azzawi, F

2014-06-01

It has previously been reported that estrogen receptor-alpha (ERα) gene (ESR1: estrogen receptor 1) polymorphisms are associated with premature ovarian failure (POF). The aim of this study was to investigate whether these genetic polymorphisms of ESR1 are associated with POF in Serbian women. A series of 197 POF cases matched with 547 fertile controls was recruited by the Institute for Endocrinology, Diabetes and Metabolic Disorders of Serbia between 2007 and 2010. Genomic DNA was extracted from saliva using Oragene® DNA sample collection kits. Two single-nucleotide polymorphisms (SNPs), PvuII and XbaI, in ESR1 were genotyped by dynamic allele-specific hybridization. Haplotype analyses were performed with the restriction fragment length polymorphism method. SNP and haplotype effects were analyzed by logistic regression models. No significant difference was found in the distribution of ESR1 PvuII and XbaI polymorphisms or haplotypes between the POF and control groups. The two ESR1 SNPs, PvuII and XbaI, are not commonly associated with POF in Serbian women and may not contribute to the genetic basis of the condition.

A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

PubMed

Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

2011-06-15

A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

Effects of IL1B single nucleotide polymorphisms on depressive and anxiety symptoms are determined by severity and type of life stress.

PubMed

Kovacs, David; Eszlari, Nora; Petschner, Peter; Pap, Dorottya; Vas, Szilvia; Kovacs, Peter; Gonda, Xenia; Juhasz, Gabriella; Bagdy, Gyorgy

2016-08-01

Interleukin-1β is one of the main mediators in the cross-talk between the immune system and the central nervous system. Higher interleukin-1β levels are found in mood spectrum disorders, and the stress-induced expression rate of the interleukin-1β gene (IL1B) is altered by polymorphisms in the region. Therefore we examined the effects of rs16944 and rs1143643 single nucleotide polymorphisms (SNPs) within the IL1B gene on depressive and anxiety symptoms, as measured by the Brief Symptom Inventory, in a Hungarian population sample of 1053 persons. Distal and proximal environmental stress factors were also included in our analysis, namely childhood adversity and recent negative life-events. We found that rs16944 minor (A) allele specifically interacted with childhood adversity increasing depressive and anxiety symptoms, while rs1143643's minor (A) allele showed protective effect against depressive symptoms after recent life stress. The genetic main effects of the two SNPs were not significant in the main analysis, but the interaction effects remained significant after correction for multiple testing. In addition, the effect of rs16944 A allele was reversed in a subsample with low-exposure to life stress, suggesting a protective effect against depressive symptoms, in the post hoc analysis. In summary, both of the two IL1B SNPs showed specific environmental stressor-dependent effects on mood disorder symptoms. We also demonstrated that the presence of exposure to childhood adversity changed the direction of the rs16944 effect on depression phenotype. Therefore our results suggest that it is advisable to include environmental factors in genetic association studies when examining the effect of the IL1B gene. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Allelic inhibition of displacement activity: a simplified one tube allele-specific PCR for evaluation of ITPA polymorphisms.

PubMed

Galmozzi, E; Facchetti, F; Degasperi, E; Aghemo, A; Lampertico, P

2013-02-01

Recently, genome-wide association studies (GWAS) in patients with chronic hepatitis C virus (HCV) infection have identified two functional single nucleotide polymorphisms (SNPs) in the inosine triphosphatase (ITPA) gene, that are associated strongly and independently with hemolytic anemia in patients exposed to pegylated-interferon (Peg-IFN) plus ribavirin (RBV) combined therapy. Here has been developed a simplified allele discrimination polymerase chain reaction (PCR) assay named allelic inhibition of displacement activity (AIDA) for evaluation of ITPA polymorphisms. AIDA system relies on three unlabeled primers only, two outer common primers and one inner primer with allele-specific 3' terminus mismatch. DNA samples from 192 patients with chronic HCV infection were used to validate the AIDA system and results were compared with the gold standard TaqMan(®) SNP genotyping assay. Concordant data were obtained for all samples, granting for high specificity of the method. In conclusion, AIDA is a practical one-tube method to reproducibly and to assess accurately rs7270101 and rs1127354 ITPA SNPs. Copyright © 2012 Elsevier B.V. All rights reserved.

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

PubMed

Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2014-08-01

Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

Biochemical and Genetic Markers in Aggressiveness and Recurrence of Prostate Cancer: Race-Specific Links to Inflammation and Insulin Resistance

DTIC Science & Technology

2013-07-01

as a statistical graphic, and Pearson product moment correlation coefficients as measures of the strength of linear association; 4) performing SNP ...determine if there are differences in single nucleotide polymorphisms ( SNPs ) in selected candidate genes implicated in metabolic syndrome, obesity, chronic...samples for the serum and SNP analyses. We have reached a target of 500 patients at the end of year 2; however, some of the patients turned out to be

High-Resolution Mapping of Structural Mutations in Prostate Cancer with Single Nucleotide Polymorphism Arrays

DTIC Science & Technology

2006-11-01

study of the NCI60 panel of cancer cell lines [39]. More recently, amplifications of NOTCH3 were noted in ovarian tumors by an SNP array analysis...and the functional role of NOTCH3 was suggested by the ability to suppress cell proliferation by inhibiting NOTCH3 [40]. Allele-specific copy...Identified and functionally validated the oncogene MITF. 40 Park JT, Li M, Nakayama K, et al. Notch3 gene amplification in ovarian cancer. Cancer Res

Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

PubMed

Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

2015-01-01

Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

A Family-Based Association Study of CYP11A1 and CYP11B1 Gene Polymorphisms With Autism in Chinese Trios.

PubMed

Deng, Hong-Zhu; You, Cong; Xing, Yu; Chen, Kai-Yun; Zou, Xiao-Bing

2016-05-01

Autism spectrum disorder is a group of neurodevelopmental disorders with the higher prevalence in males. Our previous studies have indicated lower progesterone levels in the children with autism spectrum disorder, suggesting involvement of the cytochrome P-450scc gene (CYP11A1) and cytochrome P-45011beta gene (CYP11B1) as candidate genes in autism spectrum disorder. The aim of this study was to investigate the family-based genetic association between single-nucleotide polymorphisms, rs2279357 in the CYP11A1 gene and rs4534 and rs4541 in the CYP11B1 gene and autism spectrum disorder in Chinese children, which were selected according to the location in the coding region and 5' and 3' regions and minor allele frequencies of greater than 0.05 in the Chinese populations. The transmission disequilibrium test and case-control association analyses were performed in 100 Chinese Han autism spectrum disorder family trios. The genotype and allele frequency of the 3 single-nucleotide polymorphisms had no statistical difference between the children with autism spectrum disorder and their parents (P> .05). Transmission disequilibrium test analysis showed transmission disequilibrium of CYP11A1 gene rs2279357 single-nucleotide polymorphisms (χ(2)= 5.038,P< .001). Our findings provide further support for the hypothesis that a susceptibility gene for autism spectrum disorder exists within or near the CYP11A1 gene in the Han Chinese population. © The Author(s) 2015.

Sequence polymorphisms at the growth hormone GH1/GH2-N and GH2-Z gene copies and their relationship with dairy traits in domestic sheep (Ovis aries).

PubMed

Vacca, G M; Dettori, M L; Balia, F; Luridiana, S; Mura, M C; Carcangiu, V; Pazzola, M

2013-09-01

The purpose was to analyze the growth hormone GH1/GH2-N and GH2-Z gene copies and to assess their possible association with milk traits in Sarda sheep. Two hundred multiparous lactating ewes were monitored. The two gene copies were amplified separately and each was used as template for a nested PCR, to investigate single strand conformation polymorphism (SSCP) of the 5'UTR, exon-1, exon-5 and 3'UTR DNA regions. SSCP analysis revealed marked differences in the number of polymorphic patterns between the two genes. Sequencing revealed five nucleotide changes at the GH1/GH2-N gene. Five nucleotide changes occurred at the GH2-Z gene: one was located in exon-5 (c.556G > A) and resulted in a putative amino acid substitution G186S. All the nucleotide changes were copy-specific, except c.*30delT, which was common to both GH1/GH2-N and GH2-Z. Variability in the promoter regions of each gene might have consequences on the expression level, due to the involvement in potential transcription factor binding sites. Both gene copies influenced milk yield. A correlation with milk protein and casein content was also evidenced. These results may have implications that make them useful for future breeding strategies in dairy sheep breeding.

Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.

PubMed

Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O

2010-07-01

Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

Impact of EZH2 polymorphisms on urothelial cell carcinoma susceptibility and clinicopathologic features.

PubMed

Yu, Yung-Luen; Su, Kuo-Jung; Hsieh, Ming-Ju; Wang, Shian-Shiang; Wang, Po-Hui; Weng, Wei-Chun; Yang, Shun-Fa

2014-01-01

The gene EZH2, the polycomb group protein enhancer of zeste 2, encodes a transcriptional repressor that also serves as a histone methyltransferase that is associated with progression to more advanced disease in a variety of malignancies. EZH2 expression level in urothelial cell carcinoma (UCC) is highly correlated with tumor aggressiveness, but it has not been determined if specific EZH2 genetic variants are associated with UCC risk. This study investigated the potential associations of EZH2 single-nucleotide polymorphisms with UCC susceptibility and its clinicopathologic characteristics. A total of 233 UCC patients and 552 cancer-free controls, all of whom were from Taiwan, were analyzed for four EZH2 single-nucleotide polymorphisms (rs6950683, rs2302427, rs3757441, and rs41277434) using real-time PCR genotyping. After adjusting for other co-variants, we found that individuals carrying at least one C allele at EZH2 rs6950683 had a lower risk of developing UCC than did major allele carriers. The CCCA or TGTA haplotype among the four EZH2 sites was also associated with a reduced risk of UCC. Furthermore, UCC patients who carried at least one G allele at rs2302427 had a lower invasive tumor stage than did patients carrying the major allele. The rs6950683 SNPs of EZH2 might contribute to the prediction of UCC susceptibility. This is the first study to provide insight into risk factors associated with EZH2 variants in carcinogenesis of UCC in Taiwan.

Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

PubMed

Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

2015-11-05

Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

SNPs in DNA repair or oxidative stress genes and late subcutaneous fibrosis in patients following single shot partial breast irradiation

PubMed Central

2012-01-01

Background The aim of this study was to evaluate the potential association between single nucleotide polymorphisms related response to radiotherapy injury, such as genes related to DNA repair or enzymes involved in anti-oxidative activities. The paper aims to identify marker genes able to predict an increased risk of late toxicity studying our group of patients who underwent a Single Shot 3D-CRT PBI (SSPBI) after BCS (breast conserving surgery). Methods A total of 57 breast cancer patients who underwent SSPBI were genotyped for SNPs (single nucleotide polymorphisms) in XRCC1, XRCC3, GST and RAD51 by Pyrosequencing technology. Univariate analysis (ORs and 95% CI) was performed to correlate SNPs with the risk of developing ≥ G2 fibrosis or fat necrosis. Results A higher significant risk of developing ≥ G2 fibrosis or fat necrosis in patients with: polymorphic variant GSTP1 (Ile105Val) (OR = 2.9; 95%CI, 0.88-10.14, p = 0.047). Conclusions The presence of some SNPs involved in DNA repair or response to oxidative stress seem to be able to predict late toxicity. Trial Registration ClinicalTrials.gov: NCT01316328 PMID:22272830

Prediction of peripheral neuropathy in multiple myeloma patients receiving bortezomib and thalidomide: a genetic study based on a single nucleotide polymorphism array.

PubMed

García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia

2017-12-01

Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.

Characterizing the genetic risk for Type 2 diabetes in a Malaysian multi-ethnic cohort.

PubMed

Abdullah, N; Abdul Murad, N A; Attia, J; Oldmeadow, C; Mohd Haniff, E A; Syafruddin, S E; Abd Jalal, N; Ismail, N; Ishak, M; Jamal, R; Scott, R J; Holliday, E G

2015-10-01

To characterize the association with Type 2 diabetes of known Type 2 diabetes risk variants in people in Malaysia of Malay, Chinese and Indian ancestry who participated in the Malaysian Cohort project. We genotyped 1604 people of Malay ancestry (722 cases, 882 controls), 1654 of Chinese ancestry (819 cases, 835 controls) and 1728 of Indian ancestry (851 cases, 877 controls). First, 62 candidate single-nucleotide polymorphisms previously associated with Type 2 diabetes were assessed for association via logistic regression within ancestral groups and then across ancestral groups using a meta-analysis. Second, estimated odds ratios were assessed for excess directional concordance with previously studied populations. Third, a genetic risk score aggregating allele dosage across the candidate single-nucleotide polymorphisms was tested for association within and across ancestral groups. After Bonferroni correction, seven individual single-nucleotide polymorphisms were associated with Type 2 diabetes in the combined Malaysian sample. We observed a highly significant excess in concordance of effect directions between Malaysian and previously studied populations. The genetic risk score was strongly associated with Type 2 diabetes in all Malaysian groups, explaining from 1.0 to 1.7% of total Type 2 diabetes risk variance. This study suggests there is substantial overlap of the genetic risk alleles underlying Type 2 diabetes in Malaysian and other populations. © 2015 The Authors. Diabetic Medicine © 2015 Diabetes UK.

Highly selective detection of single-nucleotide polymorphisms using a quartz crystal microbalance biosensor based on the toehold-mediated strand displacement reaction.

PubMed

Wang, Dingzhong; Tang, Wei; Wu, Xiaojie; Wang, Xinyi; Chen, Gengjia; Chen, Qiang; Li, Na; Liu, Feng

2012-08-21

Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.

Homogeneous real-time detection of single-nucleotide polymorphisms by strand displacement amplification on the BD ProbeTec ET system.

PubMed

Wang, Sha-Sha; Thornton, Keith; Kuhn, Andrew M; Nadeau, James G; Hellyer, Tobin J

2003-10-01

The BD ProbeTec ET System is based on isothermal strand displacement amplification (SDA) of target nucleic acid coupled with homogeneous real-time detection using fluorescent probes. We have developed a novel, rapid method using this platform that incorporates a universal detection format for identification of single-nucleotide polymorphisms (SNPs) and other genotypic variations. The system uses a common pair of fluorescent Detector Probes in conjunction with unlabeled allele-specific Adapter Primers and a universal buffer chemistry to permit analysis of multiple SNP loci under generic assay conditions. We used Detector Probes labeled with different dyes to facilitate differentiation of two alternative alleles in a single reaction with no postamplification manipulation. We analyzed six SNPs within the human beta(2)-adrenergic receptor (beta(2)AR) gene, using whole blood, buccal swabs, and urine samples, and compared results with those obtained by DNA sequencing. Unprocessed whole blood was successfully genotyped with as little as 0.1-1 micro L of sample per reaction. All six beta(2)AR assays were able to accommodate >/==" BORDER="0">20 micro L of unprocessed whole blood. For the 14 individuals tested, genotypes determined with the six beta(2)AR assays agreed with DNA sequencing results. SDA-based allelic differentiation on the BD ProbeTec ET System can detect SNPs rapidly, using whole blood, buccal swabs, or urine.

SNPGenie: estimating evolutionary parameters to detect natural selection using pooled next-generation sequencing data.

PubMed

Nelson, Chase W; Moncla, Louise H; Hughes, Austin L

2015-11-15

New applications of next-generation sequencing technologies use pools of DNA from multiple individuals to estimate population genetic parameters. However, no publicly available tools exist to analyse single-nucleotide polymorphism (SNP) calling results directly for evolutionary parameters important in detecting natural selection, including nucleotide diversity and gene diversity. We have developed SNPGenie to fill this gap. The user submits a FASTA reference sequence(s), a Gene Transfer Format (.GTF) file with CDS information and a SNP report(s) in an increasing selection of formats. The program estimates nucleotide diversity, distance from the reference and gene diversity. Sites are flagged for multiple overlapping reading frames, and are categorized by polymorphism type: nonsynonymous, synonymous, or ambiguous. The results allow single nucleotide, single codon, sliding window, whole gene and whole genome/population analyses that aid in the detection of positive and purifying natural selection in the source population. SNPGenie version 1.2 is a Perl program with no additional dependencies. It is free, open-source, and available for download at https://github.com/hugheslab/snpgenie. nelsoncw@email.sc.edu or austin@biol.sc.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Translational genomics for abiotic stress in sorghum: transcriptional profiling and validation of SNP markers between germplasm with differential cold tolerance

USDA-ARS?s Scientific Manuscript database

One focus of the Sorghum Translational Genomics Lab (part of sorghum CRIS, PSGD, CSRL, USDA-ARS, Lubbock TX) is to utilize nucleotide variation between sorghum germplasm such as those derived from RNA seq for translation and validation of Single Nucleotide Polymorphism (SNP) into easy access DNA m...

Ocular findings associated with a Cys39Arg mutation in the Norrie disease gene.

PubMed

Joos, K M; Kimura, A E; Vandenburgh, K; Bartley, J A; Stone, E M

1994-12-01

To diagnose the carriers and noncarriers in a family affected with Norrie disease based on molecular analysis. Family members from three generations, including one affected patient, two obligate carriers, one carrier identified with linkage analysis, one noncarrier identified with linkage analysis, and one female family member with indeterminate carrier status, were examined clinically and electrophysiologically. Linkage analysis had previously failed to determine the carrier status of one female family member in the third generation. Blood samples were screened for mutations in the Norrie disease gene with single-strand conformation polymorphism analysis. The mutation was characterized by dideoxy-termination sequencing. Ophthalmoscopy and electroretinographic examination failed to detect the carrier state. The affected individuals and carriers in this family were found to have a transition from thymidine to cytosine in the first nucleotide of codon 39 of the Norrie disease gene, causing a cysteine-to-arginine mutation. Single-strand conformation polymorphism analysis identified a patient of indeterminate status (by linkage) to be a noncarrier of Norrie disease. Ophthalmoscopy and electroretinography could not identify carriers of this Norrie disease mutation. Single-strand conformation polymorphism analysis was more sensitive and specific than linkage analysis in identifying carriers in this family.

Does Marriage Moderate Genetic Effects on Delinquency and Violence?

PubMed Central

Li, Yi; Liu, Hexuan; Guo, Guang

2015-01-01

Using data from the National Longitudinal Study of Adolescent to Adult Health (N = 1,254), the authors investigated whether marriage can foster desistance from delinquency and violence by moderating genetic effects. In contrast to existing gene–environment research that typically focuses on one or a few genetic polymorphisms, they extended a recently developed mixed linear model to consider the collective influence of 580 single nucleotide polymorphisms in 64 genes related to aggression and risky behavior. The mixed linear model estimates the proportion of variance in the phenotype that is explained by the single nucleotide polymorphisms. The authors found that the proportion of variance in delinquency/violence explained was smaller among married individuals than unmarried individuals. Because selection, confounding, and heterogeneity may bias the estimate of the Gene × Marriage interaction, they conducted a series of analyses to address these issues. The findings suggest that the Gene × Marriage interaction results were not seriously affected by these issues. PMID:26549892

Val66Met Polymorphism of BDNF Alters Prodomain Structure to Induce Neuronal Growth Cone Retraction

PubMed Central

Anastasia, Agustin; Deinhardt, Katrin; Chao, Moses V.; Will, Nathan E.; Irmady, Krithi; Lee, Francis S.; Hempstead, Barbara L.; Bracken, Clay

2013-01-01

A common single-nucleotide polymorphism in the human brain-derived neurotrophic factor (BDNF) gene results in a Val66Met substitution in the BDNF prodomain region. This single-nucleotide polymorphism is associated with alterations in memory and with enhanced risk to develop depression and anxiety disorders in humans. Here we show that the isolated BDNF prodomain is detected in the hippocampus and that it can be secreted from neurons in an activity-dependent manner. Using nuclear magnetic resonance spectroscopy and circular dichroism we find that the prodomain is intrinsically disordered, and the Val66Met substitution induces structural changes. Surprisingly, application of Met66 (but not Val66) BDNF prodomain induces acute growth cone retraction and a decrease in Rac activity in hippocampal neurons. Expression of p75NTR and differential engagement of the Met66 prodomain to the SorCS2 receptor are required for this effect. These results identify the Met66 prodomain as a new active ligand which modulates neuronal morphology. PMID:24048383

Genetic diversity revealed by single nucleotide polymorphism markers in a worldwide germplasm collection of durum wheat.

PubMed

Ren, Jing; Sun, Daokun; Chen, Liang; You, Frank M; Wang, Jirui; Peng, Yunliang; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua

2013-03-28

Evaluation of genetic diversity and genetic structure in crops has important implications for plant breeding programs and the conservation of genetic resources. Newly developed single nucleotide polymorphism (SNP) markers are effective in detecting genetic diversity. In the present study, a worldwide durum wheat collection consisting of 150 accessions was used. Genetic diversity and genetic structure were investigated using 946 polymorphic SNP markers covering the whole genome of tetraploid wheat. Genetic structure was greatly impacted by multiple factors, such as environmental conditions, breeding methods reflected by release periods of varieties, and gene flows via human activities. A loss of genetic diversity was observed from landraces and old cultivars to the modern cultivars released during periods of the Early Green Revolution, but an increase in cultivars released during the Post Green Revolution. Furthermore, a comparative analysis of genetic diversity among the 10 mega ecogeographical regions indicated that South America, North America, and Europe possessed the richest genetic variability, while the Middle East showed moderate levels of genetic diversity.

AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

PubMed

Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

2009-01-01

The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

PubMed

Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

2015-03-13

To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.

PubMed

Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis

2013-10-01

Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System

NASA Astrophysics Data System (ADS)

Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro

2012-04-01

A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.

Brief Report: Glutamate Transporter Gene (SLC1A1) Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

PubMed Central

Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

2015-01-01

Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive–compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples. PMID:20155310

Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

PubMed Central

Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

2016-01-01

Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

Glutamate transporter gene (SLC1A1) single nucleotide polymorphism (rs301430) and repetitive behaviors and anxiety in children with autism spectrum disorder.

PubMed

Gadow, Kenneth D; Roohi, Jasmin; DeVincent, Carla J; Kirsch, Sarah; Hatchwell, Eli

2010-09-01

Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples.

Connecting Common Genetic Polymorphisms to Protein Function: A Modular Project Sequence for Lecture or Lab

ERIC Educational Resources Information Center

Berndsen, Christopher E.; Young, Byron H.; McCormick, Quinlin J.; Enke, Raymond A.

2016-01-01

Single nucleotide polymorphisms (SNPs) in DNA can result in phenotypes where the biochemical basis may not be clear due to the lack of protein structures. With the growing number of modeling and simulation software available on the internet, students can now participate in determining how small changes in genetic information impact cellular…

The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican Health Study

USDA-ARS?s Scientific Manuscript database

Background-Low high-density lipoprotein cholesterol (HDL-C) is associated with an increased risk for atherosclerosis and concentrations are modulated by genetic and environmental factors such as smoking. Objective- To assess whether the association of common single nucleotide polymorphisms (SNPs...

Using PCR-RFLP Technology to Teach Single Nucleotide Polymorphism for Undergraduates

ERIC Educational Resources Information Center

Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

2013-01-01

Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a…

Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

PubMed Central

Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

2014-01-01

Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

A response to Yu et al. "A forward-backward fragment assembling algorithm for the identification of genomic amplification and deletion breakpoints using high-density single nucleotide polymorphism (SNP) array", BMC Bioinformatics 2007, 8: 145.

PubMed

Rueda, Oscar M; Diaz-Uriarte, Ramon

2007-10-16

Yu et al. (BMC Bioinformatics 2007,8: 145+) have recently compared the performance of several methods for the detection of genomic amplification and deletion breakpoints using data from high-density single nucleotide polymorphism arrays. One of the methods compared is our non-homogenous Hidden Markov Model approach. Our approach uses Markov Chain Monte Carlo for inference, but Yu et al. ran the sampler for a severely insufficient number of iterations for a Markov Chain Monte Carlo-based method. Moreover, they did not use the appropriate reference level for the non-altered state. We rerun the analysis in Yu et al. using appropriate settings for both the Markov Chain Monte Carlo iterations and the reference level. Additionally, to show how easy it is to obtain answers to additional specific questions, we have added a new analysis targeted specifically to the detection of breakpoints. The reanalysis shows that the performance of our method is comparable to that of the other methods analyzed. In addition, we can provide probabilities of a given spot being a breakpoint, something unique among the methods examined. Markov Chain Monte Carlo methods require using a sufficient number of iterations before they can be assumed to yield samples from the distribution of interest. Running our method with too small a number of iterations cannot be representative of its performance. Moreover, our analysis shows how our original approach can be easily adapted to answer specific additional questions (e.g., identify edges).

Genomic Changes Associated with Reproductive and Migratory Ecotypes in Sockeye Salmon (Oncorhynchus nerka)

PubMed Central

Veale, Andrew J.

2017-01-01

Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. PMID:29045601

Comparative genomics of the mimicry switch in Papilio dardanus.

PubMed

Timmermans, Martijn J T N; Baxter, Simon W; Clark, Rebecca; Heckel, David G; Vogel, Heiko; Collins, Steve; Papanicolaou, Alexie; Fukova, Iva; Joron, Mathieu; Thompson, Martin J; Jiggins, Chris D; ffrench-Constant, Richard H; Vogler, Alfried P

2014-07-22

The African Mocker Swallowtail, Papilio dardanus, is a textbook example in evolutionary genetics. Classical breeding experiments have shown that wing pattern variation in this polymorphic Batesian mimic is determined by the polyallelic H locus that controls a set of distinct mimetic phenotypes. Using bacterial artificial chromosome (BAC) sequencing, recombination analyses and comparative genomics, we show that H co-segregates with an interval of less than 500 kb that is collinear with two other Lepidoptera genomes and contains 24 genes, including the transcription factor genes engrailed (en) and invected (inv). H is located in a region of conserved gene order, which argues against any role for genomic translocations in the evolution of a hypothesized multi-gene mimicry locus. Natural populations of P. dardanus show significant associations of specific morphs with single nucleotide polymorphisms (SNPs), centred on en. In addition, SNP variation in the H region reveals evidence of non-neutral molecular evolution in the en gene alone. We find evidence for a duplication potentially driving physical constraints on recombination in the lamborni morph. Absence of perfect linkage disequilibrium between different genes in the other morphs suggests that H is limited to nucleotide positions in the regulatory and coding regions of en. Our results therefore support the hypothesis that a single gene underlies wing pattern variation in P. dardanus.

Association of Ugrp2 gene polymorphisms with adenoid hypertrophy in the pediatric population.

PubMed

Atilla, Mahmut Huntürk; Özdaş, Sibel; Özdaş, Talih; Baştimur, Sibel; Muz, Sami Engin; Öz, Işılay; Kurt, Kenan; İzbirak, Afife; Babademez, Mehmet Ali; Vatandaş, Nilgün

2017-08-01

Adenoid hypertrophy is a condition that presents itself as the chronic enlargement of adenoid tissues; it is frequently observed in the pediatric population. The Ugrp2 gene, a member of the secretoglobin superfamily, encodes a low-molecular weight protein that functions in the differentiation of upper airway epithelial cells. However, little is known about the association of Ugrp2 genetic variations with adenoid hypertrophy. The aim of this study is to investigate the association of single nucleotide polymorphisms in the Ugrp2 gene with adenoid hypertrophy and its related phenotypes. A total of 219 children, comprising 114 patients suffering from adenoid hypertrophy and 105 healthy patients without adenoid hypertrophy, were enrolled in this study. Genotypes of the Ugrp2 gene were determined by DNA sequencing. We identified four single nucleotide polymorphisms (IVS1-189G>A, IVS1-89T>G, c.201delC, and IVS2-15G>A) in the Ugrp2 gene. Our genotype analysis showed that the Ugrp2 (IVS1-89T>G) TG and (c.201delC) CdelC genotypes and their minor alleles were associated with a considerable increase in the risk of adenoid hypertrophy compared with the controls (p=0.012, p=0.009, p=0.013, and p=0.037, respectively). Furthermore, Ugrp2 (GTdelCG, GTdelCA) haplotypes were significantly associated with adenoid hypertrophy (four single nucleotide polymorphisms ordered from 5' to 3'; p=0.0001). Polymorfism-Polymorfism interaction analysis indicated a strong interaction between combined genotypes of the Ugrp2 gene contributing to adenoid hypertrophy, as well as an increased chance of its diagnosis (p<0.0001). In addition, diplotypes carrying the mutant Ugrp2 (c.201delC) allele were strongly associated with an increased risk of adenoid hypertrophy with asthma and adenoid hypertrophy with allergies (p=0.003 and p=0.0007, respectively). Some single nucleotide polymorphisms and their combinations in the Ugrp2 gene are associated with an increased risk of developing adenoid hypertrophy. Therefore, we tried to underline the importance of genetic factors associated with adenoid hypertrophy and adenoid hypertrophy-related clinical phenotypes. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

Genetic differences in ChTLR15 gene polymorphism and expression involved in Salmonella enterica natural and artificial infection respectively, of Chinese native chicken breeds, with a focus on sexual dimorphism.

PubMed

Hu, Y; Chen, W W; Liu, H X; Shan, Y J; Zhu, C H; Li, H F; Zou, J M

2016-01-01

Chicken Toll-like receptor 15 (ChTLR15) has been shown to participate in immune activation in response to various pathogens and in the innate defence against infection. Two genetically distinct Chinese breeds of chicken (Qinyuan Partridge and Baier breeds) were used to study the correlation between ChTLR15 single nucleotide polymorphisms and the natural infection status of salmonella in hens, and also to examine genetic and sex-specific effects on ChTLR15 mRNA expression in heterophils and spleen during acute infection with Salmonella enterica serovar Enteritidis (SE) from 1 to 10 days after experimental infection. Three single-nucleotide polymorphisms (G168A, C726T and A1166G) in a single exon of ChTLR15 were identified in the two breeds, but only C726T showed a significant association with salmonella infection. Compared with layer-type Baier chicks, meat-type Qingyuan chicks showed a higher tolerance for capture stress and (SE) infection, as measured, respectively, by the modified body weight of chicks in the control group and in the infection group. Meanwhile, ChTLR15 down-regulation in heterophils and up-regulation in spleen were involved in the response to pathogenic SE colonization during the acute infection period. These significant genetic effects in females led to greater differences in both innate and adaptive immune responses than those exhibited in males. These results suggest that genetics, time and gender play important roles in the modulation of ChTLR15 mRNA level elicited by the SE-mediated immune response differentially in the two genetically distinct breeds, with a focus on sexual dimorphism.

Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

PubMed

Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

2013-03-01

Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mangoni, Monica; Bisanzi, Simonetta; Carozzi, Francesca

Purpose: Clinical radiosensitivity varies considerably among patients, and radiation-induced side effects developing in normal tissue can be therapy limiting. Some single nucleotide polymorphisms (SNPs) have been shown to correlate with hypersensitivity to radiotherapy. We conducted a prospective study of 87 female patients with breast cancer who received radiotherapy after breast surgery. We evaluated the association between acute skin reaction following radiotherapy and 11 genetic polymorphisms in DNA repair genes: XRCC1 (Arg399Gln and Arg194Trp), XRCC3 (Thr241Met), XPD (Asp312Asn and Lys751Gln), MSH2 (gIVS12-6T>C), MLH1 (Ile219Val), MSH3 (Ala1045Thr), MGMT (Leu84Phe), and in damage-detoxification GSTM1 and GSTT1 genes (allele deletion). Methods and Materials: Individualmore » genetic polymorphisms were determined by polymerase chain reaction and single nucleotide primer extension for single nucleotide polymorphisms or by a multiplex polymerase chain reaction assay for deletion polymorphisms. The development of severe acute skin reaction (moist desquamation or interruption of radiotherapy due to toxicity) associated with genetic polymorphisms was modeled using Cox proportional hazards, accounting for cumulative biologically effective radiation dose. Results: Radiosensitivity developed in eight patients and was increased in carriers of variants XRCC3-241Met allele (hazard ratio [HR] unquantifiably high), MSH2 gIVS12-6nt-C allele (HR = 53.36; 95% confidence intervals [95% CI], 3.56-798.98), and MSH3-1045Ala allele (HR unquantifiably high). Carriers of XRCC1-Arg194Trp variant allele in combination with XRCC1-Arg399Gln wild-type allele had a significant risk of radiosensitivity (HR = 38.26; 95% CI, 1.19-1232.52). Conclusions: To our knowledge, this is the first report to find an association between MSH2 and MSH3 genetic variants and the development of radiosensitivity in breast cancer patients. Our findings suggest the hypothesis that mismatch repair mechanisms may be involved in cellular response to radiotherapy. Genetic polymorphisms may be promising candidates for predicting acute radiosensitivity, but further studies are necessary to confirm our findings.« less

Functional effects of single nucleotide polymorphisms in the coding region of human N-acetyltransferase 1

PubMed Central

Zhu, Yuanqi; Hein, David W.

2007-01-01

Genetic variants of human N-acetyltransferase 1 (NAT1) are associated with cancer and birth defects. N- and O-acetyltransferase catalytic activities, Michaelis-Menten kinetic constants (Km & Vmax), and steady state expression levels of NAT1-specific mRNA and protein were determined for the reference NAT1*4 and variant human NAT1 haplotypes possessing single nucleotide polymorphisms (SNPs) in the open reading frame. Although none of the SNPs caused a significant effect on steady state levels of NAT1-specific mRNA, C97T(R33stop), C190T(R64W), C559T (R187stop) and A752T(D251V) each reduced NAT1 protein level and/or N- and O-acetyltransferase catalytic activities to levels below detection. G560A(R187Q) substantially reduced NAT1 protein level and catalytic activities and increased substrate Km. The G445A(V149I), G459A(synonymous) and T640G(S214A) haplotype present in NAT1*11 significantly (p<0.05) increased NAT1 protein level and catalytic activity. Neither T21G(synonymous), T402C(synonymous), A613G(M205V), T777C(synonymous), G781A(E261K), or A787G(I263V) significantly affected Km, catalytic activity, mRNA or protein level. These results suggest heterogeneity among slow NAT1 acetylator phenotypes. PMID:17909564

Development of a cost-efficient novel method for rapid, concurrent genotyping of five common single nucleotide polymorphisms of the brain derived neurotrophic factor (BDNF) gene by tetra-primer amplification refractory mutation system.

PubMed

Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M

2015-09-01

Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Identification of single nucleotide polymorphisms in hematopoietic cell transplant patients affecting early recognition of, and response to, endotoxin.

PubMed

Guinan, Eva C; Palmer, Christine D; Mancuso, Christy J; Brennan, Lisa; Stoler-Barak, Liat; Kalish, Leslie A; Suter, Eugenie E; Gallington, Leighanne C; Huhtelin, David P; Mansilla, Maria; Schumann, Ralf R; Murray, Jeffrey C; Weiss, Jerrold; Levy, Ofer

2014-10-01

Hematopoietic cell transplant (HCT) is a life-saving therapy for many malignant and non-malignant bone marrow diseases. Associated morbidities are often due to transplant-related toxicities and infections, exacerbated by regimen-induced immune suppression and systemic incursion of bacterial products. Patients undergoing myeloablative conditioning for HCT become endotoxemic and display blood/plasma changes consistent with lipopolysaccharide (LPS)-induced systemic innate immune activation. Herein, we addressed whether patients scheduled for HCT display differences in recognition/response to LPS ex vivo traceable to specific single nucleotide polymorphisms (SNPs). Two SNPs of LPS binding protein (LBP) were associated with changes in plasma LBP levels, with one LBP SNP also associating with differences in efficiency of extraction and transfer of endotoxin to myeloid differentiation factor-2 (MD-2), a step needed for activation of TLR4. None of the examined SNPs of CD14, bactericidal/permeability-increasing protein (BPI), TLR4 or MD-2 were associated with corresponding protein plasma levels or endotoxin delivery to MD-2, but CD14 and BPI SNPs significantly associated with differences in LPS-induced TNF-α release ex vivo and infection frequency, respectively. These findings suggest that specific LBP, CD14 and BPI SNPs might be contributory assessments in studies where clinical outcome may be affected by host response to endotoxin and bacterial infection. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Nano-enabled bioanalytical approaches to ultrasensitive detection of low abundance single nucleotide polymorphisms

PubMed Central

Lapitan Jr., Lorico D. S.; Guo, Yuan

2015-01-01

Single nucleotide polymorphisms (SNPs) constitute the most common types of genetic variations in the human genome. A number of SNPs have been linked to the development of life threatening diseases including cancer, cardiovascular diseases and neurodegenerative diseases. The ability for ultrasensitive and accurate detection of low abundant disease-related SNPs in bodily fluids (e.g. blood, serum, etc.) holds a significant value in the development of non-invasive future biodiagnostic tools. Over the past two decades, nanomaterials have been utilized in a myriad of biosensing applications due to their ability of detecting extremely low quantities of biologically important biomarkers with high sensitivity and accuracy. Of particular interest is the application of such technologies in the detection of SNPs. The use of various nanomaterials, coupled with different powerful signal amplification strategies, has paved the way for a new generation of ultrasensitive SNP biodiagnostic assays. Over the past few years, several ultrasensitive SNP biosensors capable of detecting specific targets down to the ultra-low regimes (ca. aM and below) and therefore holding great promises for early clinical diagnosis of diseases have been developed. This mini review will highlight some of the most recent, significant advances in nanomaterial-based ultrasensitive SNP sensing technologies capable of detecting specific targets on the attomolar (10–18 M) regime or below. In particular, the design of novel, powerful signal amplification strategies that hold the key to the ultrasensitivity is highlighted. PMID:25785914

Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic.

PubMed

Muneta, Yoshihiro; Minagawa, Yu; Kusumoto, Masahiro; Shinkai, Hiroki; Uenishi, Hirohide; Splichal, Igor

2012-06-01

In the present study, an allele-specific primer-polymerase chain reaction (ASP-PCR) for genotyping a single nucleotide polymorphism (SNP) of swine Toll-like receptor 5 (TLR5) (C1205T; P402L) that is related to the impaired recognition of Salmonella enterica serovar Choleraesuis (SC) was developed. The allele frequencies in several pig breeds in Japan and the Czech Republic were also compared. The swine TLR5 C1205T mutation was successfully determined by ASP-PCR using genomic DNA samples in Japan that had previously been genotyped by a sequencing method. Using the PCR condition determined, genomic DNA samples from blood obtained from 110 pigs from seven different breeds in the Czech Republic were genotyped by the ASP-PCR. The genotyping results from the ASP-PCR completely matched the results from the sequencing method. The allele frequency of the swine TLR5 C1205T mutation was 27.5% in the Landrace breed of the Czech Republic compared with 50.0% in Japanese Landrace. In Japan, the C1205T mutation was found only in the Landrace breed, whereas in the Czech Republic it was found in both the Landrace and Piétrain breeds. These results indicate the usefulness of ASP-PCR for detecting a specific SNP for swine TLR5 affecting ligand recognition. They also suggest the possibility of genetically improving pigs to enhance their resistance against SC infection by eliminating or selecting this specific SNP of swine TLR5. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

Impact of Maspin Polymorphism rs2289520 G/C and Its Interaction with Gene to Gene, Alcohol Consumption Increase Susceptibility to Oral Cancer Occurrence.

PubMed

Yang, Po-Yu; Miao, Nae-Fang; Lin, Chiao-Wen; Chou, Ying-Erh; Yang, Shun-Fa; Huang, Hui-Chuan; Chang, Hsiu-Ju; Tsai, Hsiu-Ting

2016-01-01

The purpose of this study was to identify gene polymorphisms of mammary serine protease inhibitor (Maspin) specific to patients with oral cancer susceptibility and clinicopathological status. Three single-nucleotide polymorphisms (SNPs) of the Maspin gene from 741 patients with oral cancer and 601 non-cancer controls were analyzed by real-time PCR. The participants with G/G homozygotes or with G/C heterozygotes of Maspin rs2289520 polymorphism had a 2.07-fold (p = 0.01) and a 2.01-fold (p = 0.02) risk of developing oral cancer compared to those with C/C homozygotes. Moreover, gene-gene interaction increased the risk of oral cancer susceptibility among subjects expose to oral cancer related risk factors, including areca, alcohol, and tobacco consumption. G allele of Maspin rs2289520 polymorphism may be a factor that increases the susceptibility to oral cancer. The interactions of gene to oral cancer-related environmental risk factors have a synergetic effect that can further enhance oral cancer development.

Identification of single nucleotide polymorphisms in the ASB15 gene and their associations with chicken growth and carcass traits.

PubMed

Wang, Y C; Jiang, R R; Kang, X T; Li, Z J; Han, R L; Geng, J; Fu, J X; Wang, J F; Wu, J P

2015-09-25

ASB15 is a member of the ankyrin repeat and suppressor of cytokine signaling box family, and is predominantly expressed in skeletal muscle. In the present study, an F2 resource population of Gushi chickens crossed with Anka broilers was used to investigate the genetic effects of the chicken ASB15 gene. Two single nucleotide polymorphisms (SNPs) (rs315759231 A>G and rs312619270 T>C) were identified in exon 7 of the ASB15 gene using forced chain reaction-restriction fragment length polymorphism and DNA sequencing. One was a missense SNP (rs315759231 A>G) and the other was a synonymous SNP (rs312619270 T>C). The rs315759231 A>G polymorphism was significantly associated with body weight at birth, 12-week body slanting length, semi-evisceration weight, evisceration weight, leg muscle weight, and carcass weight (P < 0.05). The rs312619270 T>C polymorphism was significantly associated with body weight at birth, 4, 8, and 12-week body weight, 8-week shank length, 12-week breast bone length, 8 and 12-week body slanting length, breast muscle weight, and carcass weight (P < 0.05). Our results suggest that the ASB15 gene profoundly affects chicken growth and carcass traits.

Association between ghrelin gene variations, body mass index, and waist-to-hip ratio in patients with polycystic ovary syndrome.

PubMed

Xu, L; Shi, Y; Gu, J; Wang, Y; Wang, L; You, L; Qi, X; Ye, Y; Chen, Z

2014-03-01

To investigate the association between 2 single nucleotide polymorphisms (SNP501A/C and 604 G/A) in the promoter of the ghrelin gene and the hormonal and metabolic phenotypes of polycystic ovary syndrome (PCOS) in a Chinese population. 285 patients with PCOS and 260 healthy controls were selected for a prospective, case-control study at Shandong Provincial Hospital, Jinan, China. All subjects underwent genotype analysis of the 2 single nucleotide polymorphisms of the ghrelin gene. Measurements were also taken of blood lipids, glucose, and hormone levels, and calculations of body mass index (BMI) and waist-to-hip ratio (WHR) were performed to detect hormonal and metabolic phenotypes. No significant diff erences in polymorphism genotypes were found between PCOS patients and healthy controls. However, the frequency of the -501 A/C A allele was significantly higher in the PCOS group than in the control group. PCOS -501 A/C A carriers had significantly higher BMI and WHR than PCOS women with the CC genotype. -604 G/A polymorphisms were not associated with clinical or biochemical characteristics of PCOS. The -501 A/C polymorphism of the ghrelin gene is associated with metabolic features of PCOS in a Chinese population. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.

rs11613352 polymorphism (TT genotype) associates with a decrease of triglycerides and an increase of HDL in familial hypercholesterolemia patients.

PubMed

Aledo, Rosa; Padró, Teresa; Mata, Pedro; Alonso, Rodrigo; Badimon, Lina

2015-04-01

Recent genome-wide association studies have identified a locus on chromosome 12q13.3 associated with plasma levels of triglyceride and high-density lipoprotein cholesterol, with rs11613352 being the lead single nucleotide polymorphism in this genome-wide association study locus. The aim of the study is to investigate the involvement of rs11613352 in a population with high cardiovascular risk due to familial hypercholesterolemia. The single nucleotide polymorphism was genotyped by Taqman(®) assay in a cohort of 601 unrelated familial hypercholesterolemia patients and its association with plasma triglyceride and high-density lipoprotein cholesterol levels was analyzed by multivariate methods based on linear regression. Minimal allele frequency was 0.17 and genotype frequencies were 0.69, 0.27, and 0.04 for CC, CT, and TT genotypes, respectively. The polymorphism is associated in a recessive manner (TT genotype) with a decrease in triglyceride levels (P=.002) and with an increase in high-density lipoprotein cholesterol levels (P=.021) after adjusting by age and sex. The polymorphism rs11613352 may contribute to modulate the cardiovascular risk by modifying plasma lipid levels in familial hypercholesterolemia patients. Copyright © 2014 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

Association between RTEL1 gene polymorphisms and COPD susceptibility in a Chinese Han population.

PubMed

Ding, Yipeng; Xu, Heping; Yao, Jinjian; Xu, Dongchuan; He, Ping; Yi, Shengyang; Li, Quanni; Liu, Yuanshui; Wu, Cibing; Tian, Zhongjie

2017-01-01

We investigated the association between single-nucleotide polymorphisms in regulation of telomere elongation helicase 1 ( RTEL1 ), which has been associated with telomere length in several brain cancers and age-related diseases, and the risk of chronic obstructive pulmonary disease (COPD) in a Chinese Han population. In a case-control study that included 279 COPD cases and 290 healthy controls, five single-nucleotide polymorphisms in RTEL1 were selected and genotyped using the Sequenom MassARRAY platform. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression after adjusting for age and gender. In the genotype model analysis, we determined that rs4809324 polymorphism had a decreased effect on the risk of COPD (CC versus TT: OR =0.28; 95% CI =0.10-0.82; P =0.02). In the genetic model analysis, we found that the "C/C" genotype of rs4809324 was associated with a decreased risk of COPD based on the codominant model (OR =0.33; 95% CI =0.13-0.86; P =0.022) and recessive model (OR =0.32; 95% CI =0.12-0.80; P =0.009). Our data shed new light on the association between genetic polymorphisms of RTEL1 and COPD susceptibility in the Chinese Han population.

Polymorphisms in the oxytocin receptor gene are associated with the development of psychopathy.

PubMed

Dadds, Mark R; Moul, Caroline; Cauchi, Avril; Dobson-Stone, Carol; Hawes, David J; Brennan, John; Urwin, Ruth; Ebstein, Richard E

2014-02-01

The co-occurrence of child conduct problems (CPs) and callous-unemotional (CU) traits confers risk for psychopathy. The oxytocin (OXT) system is a likely candidate for involvement in the development of psychopathy. We tested variations in the OXT receptor gene (OXTR) in CP children and adolescents with varying levels of CU traits. Two samples of Caucasian children, aged 4-16 years, who met DSM criteria for disruptive behavior problems and had no features of autism spectrum disorder, were stratified into low versus high CU traits. Measures were the frequencies of nine candidate OXTR polymorphisms (single nucleotide polymorphisms). In Sample 1, high CU traits were associated with single nucleotide polymorphism rs1042778 in the 3' untranslated region of OXTR and the CGCT haplotype of rs2268490, rs2254298, rs237889, and rs13316193. The association of rs1042778 was replicated in the second rural sample and held across gender and child versus adolescent age groups. We conclude that polymorphic variation of the OXTR characterizes children with high levels of CU traits and CPs. The results are consistent with a hypothesized role of OXT in the developmental antecedents of psychopathy, particularly the differential amygdala activation model of psychopathic traits, and add genetic evidence that high CU traits specify a distinct subgroup within CP children.

Polymorphism of the renalase gene in gestational diabetes mellitus.

PubMed

Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna

2017-01-01

Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p < 0.05), whereas rs2576178 showed weak association (p = 0.030) that was lost after multiple adjustments (p = 0.09). We inferred a modest association of the rs10887800 polymorphism with gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.

Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

PubMed

Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A

2015-03-15

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review.

PubMed

Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

2015-07-01

Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association.

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

PubMed Central

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N.; Kumar, Dibyendu

2017-01-01

Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. Results The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. Conclusions This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments. PMID:28234981

[Association of single nucleotide polymorphism at interleukin-10 gene 1082 nt with the risk of gastric cancer in Chinese population].

PubMed

Zhou, Shao-zhang; Zhu, Wei-liang; Li, Ming-ying; Li, Hong-yi; Zhang, Ji-ren

2008-08-01

To study the association of single nucleotide polymorphism at interleukin-10 gene 1082 locus with Helicobacter pylori (Hp) infection and the risk of gastric cancer in high prevalent region (Shaanxi Province)aand low prevalence region (Guangdong Province) in China. The genomic DNA was extracted from the peripheral blood of 104 healthy individuals, 104 gastric cancer patients from Guangdong Province, and from 102 healthy volunteers and 102 gastric cancer patients in Shaanxi Province, China. The single nucleotide polymorphism at IL-10 gene 1082 locus was analyzed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The serum levels of anit-Hp IgG was measured by enzyme-linked immunosorbent assay. The frequencies of IL-10-1082 A/A, A/G and G/G genotypes in the 412 subjects were 86.7%, 10.7% and 2.4%, respectively. In the low prevalence region, the number of carriers of IL-10-1082 G* was much greater in the cancer patients than in the healthy controls (14.4% vs 7.7%, Chi2=4.02, P<0.05, OR=1.01, 95% CI=1.08-3.10). The presence of IL-10-1082 G* was associated with significantly increased risk of gastric cancer following Hp infection (Chi(2)=5.36, P<0.05, OR=6.0, 95% CI=1.23-17.52). In the high prevalence region, the frequency of IL-10-1082 G* was slightly higher among the cancer patients than in the healthy controls, but this difference was not statistically significant (12.7% vs 16.6%, P>0.05). The G* genotype of IL-10 gene 1082 locus may be associated with increased risk of gastric cancer in China.

Single Nucleotide Polymorphism in ATM Gene, Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study

PubMed Central

Shen, Li; Yin, Zhihua; Wu, Wei; Ren, Yangwu; Li, Xuelian; Zhou, Baosen

2014-01-01

Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism, environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained, 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44, 95% confidence interval (CI) 1.02–2.02, P = 0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89, 95%CI 1.03–3.49, P = 0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore, ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. PMID:24819391

Genome-Wide Association Study Identifies Risk Variants for Lichen Planus in Patients With Hepatitis C Virus Infection.

PubMed

Nagao, Yumiko; Nishida, Nao; Toyo-Oka, Licht; Kawaguchi, Atsushi; Amoroso, Antonio; Carrozzo, Marco; Sata, Michio; Mizokami, Masashi; Tokunaga, Katsushi; Tanaka, Yasuhito

2017-06-01

There is a close relationship between hepatitis C virus (HCV) infection and lichen planus, a chronic inflammatory mucocutaneous disease. We performed a genome-wide association study (GWAS) to identify genetic variants associated with HCV-related lichen planus. We conducted a GWAS of 261 patients with HCV infection treated at a tertiary medical center in Japan from October 2007 through January 2013; a total of 71 had lichen planus and 190 had normal oral mucosa. We validated our findings in a GWAS of 38 patients with HCV-associated lichen planus and 7 HCV-infected patients with normal oral mucosa treated at a medical center in Italy. Single-nucleotide polymorphisms in NRP2 (rs884000) and IGFBP4 (rs538399) were associated with risk of HCV-associated lichen planus (P < 1 × 10 -4 ). We also found an association between a single-nucleotide polymorphism in the HLA-DR/DQ genes (rs9461799) and susceptibility to HCV-associated lichen planus. The odds ratios for the minor alleles of rs884000, rs538399, and rs9461799 were 3.25 (95% confidence interval, 1.95-5.41), 0.40 (95% confidence interval, 0.25-0.63), and 2.15 (95% confidence interval, 1.41-3.28), respectively. In a GWAS of Japanese patients with HCV infection, we replicated associations between previously reported polymorphisms in HLA class II genes and risk for lichen planus. We also identified single-nucleotide polymorphisms in NRP2 and IGFBP4 loci that increase and reduce risk of lichen planus, respectively. These genetic variants might be used to identify patients with HCV infection who are at risk for lichen planus. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

Polygenic Overlap Between C-Reactive Protein, Plasma Lipids, and Alzheimer Disease.

PubMed

Desikan, Rahul S; Schork, Andrew J; Wang, Yunpeng; Thompson, Wesley K; Dehghan, Abbas; Ridker, Paul M; Chasman, Daniel I; McEvoy, Linda K; Holland, Dominic; Chen, Chi-Hua; Karow, David S; Brewer, James B; Hess, Christopher P; Williams, Julie; Sims, Rebecca; O'Donovan, Michael C; Choi, Seung Hoan; Bis, Joshua C; Ikram, M Arfan; Gudnason, Vilmundur; DeStefano, Anita L; van der Lee, Sven J; Psaty, Bruce M; van Duijn, Cornelia M; Launer, Lenore; Seshadri, Sudha; Pericak-Vance, Margaret A; Mayeux, Richard; Haines, Jonathan L; Farrer, Lindsay A; Hardy, John; Ulstein, Ingun Dina; Aarsland, Dag; Fladby, Tormod; White, Linda R; Sando, Sigrid B; Rongve, Arvid; Witoelar, Aree; Djurovic, Srdjan; Hyman, Bradley T; Snaedal, Jon; Steinberg, Stacy; Stefansson, Hreinn; Stefansson, Kari; Schellenberg, Gerard D; Andreassen, Ole A; Dale, Anders M

2015-06-09

Epidemiological findings suggest a relationship between Alzheimer disease (AD), inflammation, and dyslipidemia, although the nature of this relationship is not well understood. We investigated whether this phenotypic association arises from a shared genetic basis. Using summary statistics (P values and odds ratios) from genome-wide association studies of >200 000 individuals, we investigated overlap in single-nucleotide polymorphisms associated with clinically diagnosed AD and C-reactive protein (CRP), triglycerides, and high- and low-density lipoprotein levels. We found up to 50-fold enrichment of AD single-nucleotide polymorphisms for different levels of association with C-reactive protein, low-density lipoprotein, high-density lipoprotein, and triglyceride single-nucleotide polymorphisms using a false discovery rate threshold <0.05. By conditioning on polymorphisms associated with the 4 phenotypes, we identified 55 loci associated with increased AD risk. We then conducted a meta-analysis of these 55 variants across 4 independent AD cohorts (total: n=29 054 AD cases and 114 824 healthy controls) and discovered 2 genome-wide significant variants on chromosome 4 (rs13113697; closest gene, HS3ST1; odds ratio=1.07; 95% confidence interval=1.05-1.11; P=2.86×10(-8)) and chromosome 10 (rs7920721; closest gene, ECHDC3; odds ratio=1.07; 95% confidence interval=1.04-1.11; P=3.38×10(-8)). We also found that gene expression of HS3ST1 and ECHDC3 was altered in AD brains compared with control brains. We demonstrate genetic overlap between AD, C-reactive protein, and plasma lipids. By conditioning on the genetic association with the cardiovascular phenotypes, we identify novel AD susceptibility loci, including 2 genome-wide significant variants conferring increased risk for AD. © 2015 American Heart Association, Inc.

Association of Allelic Interaction of Single Nucleotide Polymorphisms of Influx and Efflux Transporters Genes With Nonhematologic Adverse Events of Docetaxel in Breast Cancer Patients.

PubMed

Jabir, Rafid Salim; Ho, Gwo Fuang; Annuar, Muhammad Azrif Bin Ahmad; Stanslas, Johnson

2018-05-04

Nonhematologic adverse events (AEs) of docetaxel constitute an extra burden in the treatment of cancer patients and necessitate either a dose reduction or an outright switch of docetaxel for other regimens. These AEs are frequently associated with genetic polymorphisms of genes encoding for proteins involved docetaxel disposition. Therefore, we investigated that association in Malaysian breast cancer patients. A total of 110 Malaysian breast cancer patients were enrolled in the present study, and their blood samples were investigated for different single nucleotide polymorphisms using polymerase chain reaction restriction fragment length polymorphism. AEs were evaluated using the Common Terminology Criteria for Adverse Events, version 4.0. Fatigue, nausea, oral mucositis, and vomiting were the most common nonhematologic AEs. Rash was associated with heterozygous and mutant genotypes of ABCB1 3435C>T (P < .05). Moreover, patients carrying the GG genotype of ABCB1 2677G>A/T reported more fatigue than those carrying the heterozygous genotype GA (P < .05). The presence of ABCB1 3435-T, ABCC2 3972-C, ABCC2 1249-G, and ABCB1 2677-G alleles was significantly associated with nausea and oral mucositis. The coexistence of ABCB1 3435-C, ABCC2 3972-C, ABCC2 1249-G, and ABCB1 2677-A was significantly associated with vomiting (P < .05). The prevalence of nonhematologic AEs in breast cancer patients treated with docetaxel has been relatively high. The variant allele of ABCB1 3435C>T polymorphism could be a potential predictive biomarker of docetaxel-induced rash, and homozygous wild-type ABCB1 2677G>A/T might predict for a greater risk of fatigue. In addition, the concurrent presence of specific alleles could be predictive of vomiting, nausea, and oral mucositis. Copyright © 2018 Elsevier Inc. All rights reserved.

Inosine triphosphatase polymorphisms and ribavirin pharmacokinetics as determinants of ribavirin-associate anemia in patients receiving standard anti-HCV treatment.

PubMed

DʼAvolio, Antonio; Ciancio, Alessia; Siccardi, Marco; Smedile, Antonina; Baietto, Lorena; Simiele, Marco; Marucco, Diego Aguilar; Cariti, Giuseppe; Calcagno, Andrea; de Requena, Daniel Gonzalez; Sciandra, Mauro; Cusato, Jessica; Troshina, Giulia; Bonora, Stefano; Rizzetto, Mario; Di Perri, Giovanni

2012-04-01

Functional variants of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of plasma RBV concentrations on hemoglobin (Hb) decrement. Moreover, no data have been published on the possible interplay between these 2 factors. A retrospective analysis included 167 patients. The ITPA variants rs7270101 and rs1127354 were genotyped and tested using the χ test for association with Hb reduction at week 4. We also investigated, using multivariate logistic regression, the impact of RBV plasma exposure on Hb concentrations. Both single nucleotide polymorphisms were associated with Hb decrease. The carrier of at least 1 variant allele in the functional ITPA single nucleotide polymorphisms was associated with a lower decrement of Hb (-1.1 g/dL), as compared with patients without a variant allele (-2.75 g/dL; P = 4.09 × 10). RBV concentrations were not influenced by ITPA genotypes. A cut-off of 2.3 μg/mL of RBV was found to be associated with anemia (area-under-receiver operating characteristic = 0.630, sensitivity = 50.0%, and specificity = 69.5%, P = 0.008). In multivariate logistic regression analyses, the carrier of a variant allele (P = 0.005) and plasma RBV concentrations <2.3 μg/mL (P = 0.016) were independently associated with protection against clinically significant anemia at week 4. Although no direct relationship was found between ITPA polymorphisms and plasma RBV concentrations, both factors were shown to be significantly associated with anemia. A multivariate regression model based on ITPA genetic polymorphisms and RBV trough concentration was developed for predicting the risk of anemia. By relying upon these 2 variables, an individualized management of anemia seems to be feasible in recipients of pegylated interferon-RBV therapy.

Single nucleotide polymorphism (SNP) discovery in rainbow trout using restriction site associated DNA (RAD) sequencing of doubled haploids and assessment of polymorphism in a population survey

USDA-ARS?s Scientific Manuscript database

Background: Our goal is to produce a high-throughput SNP genotyping platform for genomic analyses in rainbow trout that will enable fine mapping of QTL, whole genome association studies, genomic selection for improved aquaculture production traits, and genetic analyses of wild populations that aid ...

Identification of one polymorphism from the PAPP-A2 gene associated to fertility in Romosinuano beef heifers raised under a subtropical environment

USDA-ARS?s Scientific Manuscript database

The objective of this study was to identify single nucleotide polymorphisms (SNP) associated to fertility in female cows raised under a subtropical environment. Re-sequencing of 9 genes associated to GH-IGF endocrine pathway located in bovine chromosome 5, identified 75 SNP useful for associative ge...

CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

PubMed Central

Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

2004-01-01

Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

Inherited variations in the SOD and GPX gene families and cancer risk.

PubMed

Yuzhalin, Arseniy E; Kutikhin, Anton G

2012-05-01

Antioxidant defence enzymes are essential protectors of living organisms against oxidative stress. These enzymes are involved in the detoxification and decomposition of harmful chemical compounds called reactive oxygen species (ROS), which are, first and foremost, a source of intracellular oxidative stress. ROS directly promote the oxidative damage of genes resulting in aberrant regulation of many vital cell processes. As a consequence, the presence of ROS can lead to genomic instability, deregulation of transcription, induction of mitogenic signal transduction pathways and replication errors, all of which may increase the risk of cancer development. Single nucleotide polymorphisms of antioxidant defence genes may significantly modify the functional activity of the encoded proteins; therefore, certain alleles can be established as risk factors for particular cancer types. In the future, these risk alleles may be utilized as genomic markers of cancer predisposition to allow for early prevention measures among carriers of these alleles. The review is devoted to common single nucleotide polymorphisms of the superoxide dismutase (SOD) and glutathione peroxidase (GPX) gene families and their impact on carcinogenesis. The predictive significance of several polymorphisms was determined, and these polymorphisms were recommended for further in-depth research.

Protective Role of BST2 Polymorphisms in Mother-to-Child Transmission of HIV-1 and Adult AIDS Progression.

PubMed

Kamada, Anselmo J; Bianco, Anna M; Zupin, Luisa; Girardelli, Martina; Matte, Maria C C; Medeiros, Rúbia Marília de; Almeida, Sabrina Esteves de Matos; Rocha, Marineide M; Segat, Ludovica; Chies, José A B; Kuhn, Louise; Crovella, Sergio

2016-07-01

Bone marrow stromal cell antigen-2 (BST-2)/Tetherin is a restriction factor that prevents Human immunodeficiency virus type 1 (HIV-1) release from infected cells and mediates pro-inflammatory cytokine production. This study investigated the risk conferred by single nucleotide polymorphisms (rs919266, rs9192677, and rs9576) at BST-2 coding gene (BST2) in HIV-1 mother-to-child transmission and in disease progression. Initially, 101 HIV-1+ pregnant women and 331 neonates exposed to HIV-1 from Zambia were enrolled. Additional BST2 single nucleotide polymorphism analyses were performed in 2 cohorts with acquired immunodeficiency syndrome (AIDS) progression: an adult Brazilian cohort (37 rapid, 30 chronic and 21 long-term non-progressors) and an Italian pediatric cohort (21 rapid and 67 slow progressors). The rs9576A allele was nominally associated with protection during breastfeeding (P = 0.019) and individuals carrying rs919266 GA showed slower progression to AIDS (P = 0.033). Despite the influence of rs919266 and rs9576 on BST2 expression being still undetermined, a preventive role by BST2 polymorphisms was found during HIV-1 infection.

[Relationship of Ghrelin gene polymorphism with congenital anorectal malformation and Hirschsprung disease].

PubMed

Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin

2015-07-01

To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.

Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

PubMed

Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

2017-09-01

It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

Essentials of Conservation Biotechnology: A mini review

NASA Astrophysics Data System (ADS)

Merlyn Keziah, S.; Subathra Devi, C.

2017-11-01

Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.

Constitutional and functional genetics of human alcohol-related hepatocellular carcinoma.

PubMed

Nahon, Pierre; Nault, Jean-Charles

2017-11-01

Exploration of the constitutional genetics of hepatocellular carcinoma (HCC) has identified numerous variants associated with a higher risk of liver cancer in alcoholic cirrhotic patients. Although Genome-Wide Association studies have not been carried out in the field of alcohol-related HCC, common single nucleotide polymorphisms conferring a small increase in the risk of liver cancer risk have been identified and shown to modulate ethanol metabolism, inflammation, oxidative stress, iron or lipid metabolism. Specific patterns of gene mutations including CTNNB1, TERT, ARID1A and SMARCA2 exist in alcohol-related HCC. Moreover, a specific mutational process observed at the nucleotide level by next generation sequencing has revealed cooperation between alcohol and tobacco in the development of HCC. Combining this genetic information with epidemiological and clinical data that might define specific HCC risk classes and refine surveillance strategies needs to be assessed in large prospective cohorts of patients with alcoholic cirrhosis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Potassium channel KCNH2 K897T polymorphism and cardiac repolarization during exercise test: The Finnish Cardiovascular Study.

PubMed

Koskela, J; Laiho, J; KäHönen, M; Rontu, R; Lehtinen, R; Viik, J; Niemi, M; Niemelä, K; Kööbi, T; Turjanmaa, V; Pörsti, I; Lehtimäki, T; Nieminen, T

2008-01-01

Cardiac repolarization is regulated, in part, by the KCNH2 gene, which encodes a rapidly activating component of the delayed rectifier potassium channel. The gene expresses a functional single nucleotide polymorphism, K897T, which changes the biophysical properties of the channel. The objective of this study was to evaluate whether this polymorphism influences two indices of repolarization--the QT interval and T-wave alternans (TWA)--during different phases of a physical exercise test. The cohort consisted of 1,975 patients undergoing an exercise test during which on-line electrocardiographic data were registered. Information on coronary risk factors and medication was recorded. The 2690A>C nucleotide variation in the KCNH2 gene corresponding to the K897T amino acid change was analysed after polymerase chain reaction with allele-specific TaqMan probes. Among all subjects, the QTc intervals did not differ between the three genotype groups (p> or =0.31, RANOVA). Women with the CC genotype tended to have longer QT intervals during the exercise test, but the difference was statistically significant only at rest (p = 0.011, ANOVA). This difference was also detected when the analysis was adjusted for several factors influencing the QT interval. No statistically significant effects of the K897T polymorphism on TWA were observed among all subjects (p = 0.16, RANOVA), nor in men and women separately. The K897T polymorphism of the KCNH2 gene may not be a major genetic determinant for the TWA, but the influence of the CC genotype on QT interval deserves further research among women.

Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population

PubMed Central

Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

2016-01-01

Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991

A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

PubMed

Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

2005-02-01

A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages

PubMed Central

Desai, Prerak T.; den Bakker, Henk C.; Mikoleit, Matthew; Tolar, Beth; Trees, Eija; Hendriksen, Rene S.; Frye, Jonathan G.; Porwollik, Steffen; Weimer, Bart C.; Wiedmann, Martin; Weinstock, George M.; Fields, Patricia I.; McClelland, Michael

2014-01-01

Salmonella enterica serotype Enteritidis is one of the most commonly reported causes of human salmonellosis. Its low genetic diversity, measured by fingerprinting methods, has made subtyping a challenge. We used whole-genome sequencing to characterize 125 S. enterica Enteritidis and 3 S. enterica serotype Nitra strains. Single-nucleotide polymorphisms were filtered to identify 4,887 reliable loci that distinguished all isolates from each other. Our whole-genome single-nucleotide polymorphism typing approach was robust for S. enterica Enteritidis subtyping with combined data for different strains from 2 different sequencing platforms. Five major genetic lineages were recognized, which revealed possible patterns of geographic and epidemiologic distribution. Analyses on the population dynamics and evolutionary history estimated that major lineages emerged during the 17th–18th centuries and diversified during the 1920s and 1950s. PMID:25147968

Group B Streptococcus Infections Caused by Improper Sourcing and Handling of Fish for Raw Consumption, Singapore, 2015-2016.

PubMed

Chau, Man L; Chen, Swaine L; Yap, Min; Hartantyo, Sri H P; Chiew, Paul K T; Fernandez, Charlene J; Wong, Wai K; Fong, Rockey K; Tan, Wei L; Tan, Brian Z Y; Ng, Youming; Aung, Kyaw T; Mehershahi, Kurosh S; Goh, Christopher; Kang, Joanne S L; Barkham, Timothy; Leong, Adeline O K; Gutiérrez, Ramona A; Ng, Lee C

2017-12-01

We assessed microbial safety and quality of raw fish sold in Singapore during 2015-2016 to complement epidemiologic findings for an outbreak of infection with group B Streptococcus serotype III sequence type (ST) 283 associated with raw fish consumption. Fish-associated group B Streptococcus ST283 strains included strains nearly identical (0-2 single-nucleotide polymorphisms) with the human outbreak strain, as well as strains in another distinct ST283 clade (57-71 single-nucleotide polymorphisms). Our investigations highlight the risk for contamination of freshwater fish (which are handled and distributed separately from saltwater fish sold as sashimi) and the need for improved hygienic handling of all fish for raw consumption. These results have led to updated policy and guidelines regarding the sale of ready-to-eat raw fish dishes in Singapore.

New Mycobacterium tuberculosis Complex Sublineage, Brazzaville, Congo

PubMed Central

Malm, Sven; Linguissi, Laure S. Ghoma; Tekwu, Emmanuel M.; Vouvoungui, Jeannhey C.; Kohl, Thomas A.; Beckert, Patrick; Sidibe, Anissa; Rüsch-Gerdes, Sabine; Madzou-Laboum, Igor K.; Kwedi, Sylvie; Penlap Beng, Véronique; Frank, Matthias; Ntoumi, Francine

2017-01-01

Tuberculosis is a leading cause of illness and death in Congo. No data are available about the population structure and transmission dynamics of the Mycobacterium tuberculosis complex strains prevalent in this central Africa country. On the basis of single-nucleotide polymorphisms detected by whole-genome sequencing, we phylogenetically characterized 74 MTBC isolates from Brazzaville, the capital of Congo. The diversity of the study population was high; most strains belonged to the Euro-American lineage, which split into Latin American Mediterranean, Uganda I, Uganda II, Haarlem, X type, and a new dominant sublineage named Congo type (n = 26). Thirty strains were grouped in 5 clusters (each within 12 single-nucleotide polymorphisms), from which 23 belonged to the Congo type. High cluster rates and low genomic diversity indicate recent emergence and transmission of the Congo type, a new Euro-American sublineage of MTBC. PMID:28221129

New Mycobacterium tuberculosis Complex Sublineage, Brazzaville, Congo.

PubMed

Malm, Sven; Linguissi, Laure S Ghoma; Tekwu, Emmanuel M; Vouvoungui, Jeannhey C; Kohl, Thomas A; Beckert, Patrick; Sidibe, Anissa; Rüsch-Gerdes, Sabine; Madzou-Laboum, Igor K; Kwedi, Sylvie; Penlap Beng, Véronique; Frank, Matthias; Ntoumi, Francine; Niemann, Stefan

2017-03-01

Tuberculosis is a leading cause of illness and death in Congo. No data are available about the population structure and transmission dynamics of the Mycobacterium tuberculosis complex strains prevalent in this central Africa country. On the basis of single-nucleotide polymorphisms detected by whole-genome sequencing, we phylogenetically characterized 74 MTBC isolates from Brazzaville, the capital of Congo. The diversity of the study population was high; most strains belonged to the Euro-American lineage, which split into Latin American Mediterranean, Uganda I, Uganda II, Haarlem, X type, and a new dominant sublineage named Congo type (n = 26). Thirty strains were grouped in 5 clusters (each within 12 single-nucleotide polymorphisms), from which 23 belonged to the Congo type. High cluster rates and low genomic diversity indicate recent emergence and transmission of the Congo type, a new Euro-American sublineage of MTBC.

Minireview: Signal Bias, Allosterism, and Polymorphic Variation at the GLP-1R: Implications for Drug Discovery

PubMed Central

Koole, Cassandra; Savage, Emilia E.; Christopoulos, Arthur; Miller, Laurence J.

2013-01-01

The glucagon-like peptide-1 receptor (GLP-1R) controls the physiological responses to the incretin hormone glucagon-like peptide-1 and is a major therapeutic target for the treatment of type 2 diabetes, owing to the broad range of effects that are mediated upon its activation. These include the promotion of glucose-dependent insulin secretion, increased insulin biosynthesis, preservation of β-cell mass, improved peripheral insulin action, and promotion of weight loss. Regulation of GLP-1R function is complex, with multiple endogenous and exogenous peptides that interact with the receptor that result in the activation of numerous downstream signaling cascades. The current understanding of GLP-1R signaling and regulation is limited, with the desired spectrum of signaling required for the ideal therapeutic outcome still to be determined. In addition, there are several single-nucleotide polymorphisms (used in this review as defining a natural change of single nucleotide in the receptor sequence; clinically, this is viewed as a single-nucleotide polymorphism only if the frequency of the mutation occurs in 1% or more of the population) distributed within the coding sequence of the receptor protein that have the potential to produce differential responses for distinct ligands. In this review, we discuss the current understanding of GLP-1R function, in particular highlighting recent advances in the field on ligand-directed signal bias, allosteric modulation, and probe dependence and the implications of these behaviors for drug discovery and development. PMID:23864649

Niemann-Pick C1 modulates hepatic triglyceride metabolism and its genetic variation contributes to serum triglyceride levels.

PubMed

Uronen, Riikka-Liisa; Lundmark, Per; Orho-Melander, Marju; Jauhiainen, Matti; Larsson, Kristina; Siegbahn, Agneta; Wallentin, Lars; Zethelius, Björn; Melander, Olle; Syvänen, Ann-Christine; Ikonen, Elina

2010-08-01

To study how Niemann-Pick disease type C1 (NPC1) influences hepatic triacylglycerol (TG) metabolism and to determine whether this is reflected in circulating lipid levels. In Npc1(-/-) mice, the hepatic cholesterol content is increased but the TG content is decreased. We investigated lipid metabolism in Npc1(-/-) mouse hepatocytes and the association of NPC1 single-nucleotide polymorphisms with circulating TGs in humans. TGs were reduced in Npc1(-/-) mouse serum and hepatocytes. In Npc1(-/-) hepatocytes, the incorporation of [3H]oleic acid and [3H]acetate into TG was decreased, but shunting of oleic acid- or acetate-derived [3H]carbons into cholesterol was increased. Inhibition of cholesterol synthesis normalized TG synthesis, content, and secretion in Npc1(-/-) hepatocytes, suggesting increased hepatic cholesterol neogenesis as a cause for the reduced TG content and secretion. We found a significant association between serum TG levels and 5 common NPC1 single-nucleotide polymorphisms in a cohort of 1053 men, with the lowest P=8.7 x 10(-4) for the single-nucleotide polymorphism rs1429934. The association between the rs1429934 A allele and higher TG levels was replicated in 2 additional cohorts, which included 8041 individuals. This study provides evidence of the following: (1) in mice, loss of NPC1 function reduces hepatocyte TG content and secretion by increasing the metabolic flux of carbons into cholesterol synthesis; and (2) common variation in NPC1 contributes to serum TG levels in humans.

Large meta-analysis of genome-wide association studies identifies five loci for lean body mass.

PubMed

Zillikens, M Carola; Demissie, Serkalem; Hsu, Yi-Hsiang; Yerges-Armstrong, Laura M; Chou, Wen-Chi; Stolk, Lisette; Livshits, Gregory; Broer, Linda; Johnson, Toby; Koller, Daniel L; Kutalik, Zoltán; Luan, Jian'an; Malkin, Ida; Ried, Janina S; Smith, Albert V; Thorleifsson, Gudmar; Vandenput, Liesbeth; Hua Zhao, Jing; Zhang, Weihua; Aghdassi, Ali; Åkesson, Kristina; Amin, Najaf; Baier, Leslie J; Barroso, Inês; Bennett, David A; Bertram, Lars; Biffar, Rainer; Bochud, Murielle; Boehnke, Michael; Borecki, Ingrid B; Buchman, Aron S; Byberg, Liisa; Campbell, Harry; Campos Obanda, Natalia; Cauley, Jane A; Cawthon, Peggy M; Cederberg, Henna; Chen, Zhao; Cho, Nam H; Jin Choi, Hyung; Claussnitzer, Melina; Collins, Francis; Cummings, Steven R; De Jager, Philip L; Demuth, Ilja; Dhonukshe-Rutten, Rosalie A M; Diatchenko, Luda; Eiriksdottir, Gudny; Enneman, Anke W; Erdos, Mike; Eriksson, Johan G; Eriksson, Joel; Estrada, Karol; Evans, Daniel S; Feitosa, Mary F; Fu, Mao; Garcia, Melissa; Gieger, Christian; Girke, Thomas; Glazer, Nicole L; Grallert, Harald; Grewal, Jagvir; Han, Bok-Ghee; Hanson, Robert L; Hayward, Caroline; Hofman, Albert; Hoffman, Eric P; Homuth, Georg; Hsueh, Wen-Chi; Hubal, Monica J; Hubbard, Alan; Huffman, Kim M; Husted, Lise B; Illig, Thomas; Ingelsson, Erik; Ittermann, Till; Jansson, John-Olov; Jordan, Joanne M; Jula, Antti; Karlsson, Magnus; Khaw, Kay-Tee; Kilpeläinen, Tuomas O; Klopp, Norman; Kloth, Jacqueline S L; Koistinen, Heikki A; Kraus, William E; Kritchevsky, Stephen; Kuulasmaa, Teemu; Kuusisto, Johanna; Laakso, Markku; Lahti, Jari; Lang, Thomas; Langdahl, Bente L; Launer, Lenore J; Lee, Jong-Young; Lerch, Markus M; Lewis, Joshua R; Lind, Lars; Lindgren, Cecilia; Liu, Yongmei; Liu, Tian; Liu, Youfang; Ljunggren, Östen; Lorentzon, Mattias; Luben, Robert N; Maixner, William; McGuigan, Fiona E; Medina-Gomez, Carolina; Meitinger, Thomas; Melhus, Håkan; Mellström, Dan; Melov, Simon; Michaëlsson, Karl; Mitchell, Braxton D; Morris, Andrew P; Mosekilde, Leif; Newman, Anne; Nielson, Carrie M; O'Connell, Jeffrey R; Oostra, Ben A; Orwoll, Eric S; Palotie, Aarno; Parker, Stephen C J; Peacock, Munro; Perola, Markus; Peters, Annette; Polasek, Ozren; Prince, Richard L; Räikkönen, Katri; Ralston, Stuart H; Ripatti, Samuli; Robbins, John A; Rotter, Jerome I; Rudan, Igor; Salomaa, Veikko; Satterfield, Suzanne; Schadt, Eric E; Schipf, Sabine; Scott, Laura; Sehmi, Joban; Shen, Jian; Soo Shin, Chan; Sigurdsson, Gunnar; Smith, Shad; Soranzo, Nicole; Stančáková, Alena; Steinhagen-Thiessen, Elisabeth; Streeten, Elizabeth A; Styrkarsdottir, Unnur; Swart, Karin M A; Tan, Sian-Tsung; Tarnopolsky, Mark A; Thompson, Patricia; Thomson, Cynthia A; Thorsteinsdottir, Unnur; Tikkanen, Emmi; Tranah, Gregory J; Tuomilehto, Jaakko; van Schoor, Natasja M; Verma, Arjun; Vollenweider, Peter; Völzke, Henry; Wactawski-Wende, Jean; Walker, Mark; Weedon, Michael N; Welch, Ryan; Wichmann, H-Erich; Widen, Elisabeth; Williams, Frances M K; Wilson, James F; Wright, Nicole C; Xie, Weijia; Yu, Lei; Zhou, Yanhua; Chambers, John C; Döring, Angela; van Duijn, Cornelia M; Econs, Michael J; Gudnason, Vilmundur; Kooner, Jaspal S; Psaty, Bruce M; Spector, Timothy D; Stefansson, Kari; Rivadeneira, Fernando; Uitterlinden, André G; Wareham, Nicholas J; Ossowski, Vicky; Waterworth, Dawn; Loos, Ruth J F; Karasik, David; Harris, Tamara B; Ohlsson, Claes; Kiel, Douglas P

2017-07-19

Lean body mass, consisting mostly of skeletal muscle, is important for healthy aging. We performed a genome-wide association study for whole body (20 cohorts of European ancestry with n = 38,292) and appendicular (arms and legs) lean body mass (n = 28,330) measured using dual energy X-ray absorptiometry or bioelectrical impedance analysis, adjusted for sex, age, height, and fat mass. Twenty-one single-nucleotide polymorphisms were significantly associated with lean body mass either genome wide (p < 5 × 10 -8 ) or suggestively genome wide (p < 2.3 × 10 -6 ). Replication in 63,475 (47,227 of European ancestry) individuals from 33 cohorts for whole body lean body mass and in 45,090 (42,360 of European ancestry) subjects from 25 cohorts for appendicular lean body mass was successful for five single-nucleotide polymorphisms in/near HSD17B11, VCAN, ADAMTSL3, IRS1, and FTO for total lean body mass and for three single-nucleotide polymorphisms in/near VCAN, ADAMTSL3, and IRS1 for appendicular lean body mass. Our findings provide new insight into the genetics of lean body mass.Lean body mass is a highly heritable trait and is associated with various health conditions. Here, Kiel and colleagues perform a meta-analysis of genome-wide association studies for whole body lean body mass and find five novel genetic loci to be significantly associated.

Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA

PubMed Central

Watson, Claire L.; Lockwood, Diana N. J.

2009-01-01

Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306

IL10A genotypic association with decreased IL-10 circulating levels in malaria infected individuals from endemic area of the Brazilian Amazon.

PubMed

Pereira, Virginia A; Sánchez-Arcila, Juan C; Teva, Antonio; Perce-da-Silva, Daiana S; Vasconcelos, Mariana P A; Lima, Cleoni A M; Aprígio, Cesarino J L; Rodrigues-da-Silva, Rodrigo N; Santos, Davi O; Banic, Dalma M; Bonecini-Almeida, Maria G; Lima-Júnior, Josué C; Oliveira-Ferreira, Joseli

2015-01-28

Cytokines play an important role in human immune responses to malaria and variation in their production may influence the course of infection and determine the outcome of the disease. The differential production of cytokines has been linked to single nucleotide polymorphisms in gene promoter regions, signal sequences, and gene introns. Although some polymorphisms play significant roles in susceptibility to malaria, gene polymorphism studies in Brazil are scarce. A population of 267 individuals from Brazilian Amazon exposed to malaria was genotyped for five single nucleotide polymorphisms (SNPs), IFNG + 874 T/A, IL10A-1082G/A, IL10A-592A/C, IL10A-819 T/C and NOS2A-954G/C. Specific DNA fragments were amplified by polymerase chain reaction, allowing the detection of the polymorphism genotypes. The polymorphisms IL10A-592A/C and IL10A-819 T/C were estimated by a single analysis due to the complete linkage disequilibrium between the two SNPs with D' = 0.99. Plasma was used to measure the levels of IFN-γ and IL-10 cytokines by Luminex and nitrogen radicals by Griess reaction. No differences were observed in genotype and allelic frequency of IFNG + 874 T/A and NOS2A-954G/C between positive and negative subjects for malaria infection. Interesting, the genotype NOS2A-954C/C was not identified in the study population. Significant differences were found in IL10A-592A/C and IL10A-819 T/C genotypes distribution, carriers of IL10A -592A/-819 T alleles (genotypes AA/TT + AC/TC) were more frequent among subjects with malaria than in negative subjects that presented a higher frequency of the variant C allele (p < 0.0001). The presence of the allele C was associated with low producer of IL-10 and low parasitaemia. In addition, the GTA haplotypes formed from combinations of investigated polymorphisms in IL10A were significantly associated with malaria (+) and the CCA haplotype with malaria (-) groups. The IL10A-1082G/A polymorphism showed high frequency of heterozygous AG genotype in the population, but it was not possible to infer any association of the polymorphism because their distribution was not in Hardy Weinberg equilibrium. This study shows that the IL10A-592A/C and IL10A-819 T/C polymorphisms were associated with malaria and decreased IL-10 levels and low parasite density suggesting that this polymorphism influence IL-10 levels and may influence in the susceptibility to clinical malaria.

Differentiation of Erwinia amylovora and Erwinia pyrifoliae strains with single nucleotide polymorphisms and by synthesis of dihydrophenylalanine.

PubMed

Gehring, I; Geider, K

2012-07-01

Fire blight has spread from North America to New Zealand, Europe, and the Mediterranean region. We were able to differentiate strains from various origins with a novel PCR method. Three Single Nucleotide Polymorphisms (SNPs) in the Erwinia amylovora genome were characteristic of isolates from North America and could distinguish them from isolates from other parts of the world. They were derived from the galE, acrB, and hrpA genes of strains Ea273 and Ea1/79. These genes were analyzed by conventional PCR (cPCR) and quantitative PCR (qPCR) with differential primer annealing temperatures. North-American E. amylovora strains were further differentiated according to their production of L: -2,5-dihydrophenylalanine (DHP) as tested by growth inhibition of the yeast Rhodotorula glutinis. E. amylovora fruit tree (Maloideae) and raspberry (rubus) strains were also differentiated by Single Strand Conformational Polymorphism analysis. Strains from the related species Erwinia pyrifoliae isolated in Korea and Japan were all DHP positive, but were differentiated from each other by SNPs in the galE gene. Differential PCR is a rapid and simple method to distinguish E. amylovora as well as E. pyrifoliae strains according to their geographical origin.

Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

PubMed Central

Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

2012-01-01

Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

Effect of P450 Oxidoreductase Polymorphisms on the Metabolic Activities of Ten Cytochrome P450s Varied by Polymorphic CYP Genotypes in Human Liver Microsomes.

PubMed

Fang, Yan; Gao, Na; Tian, Xin; Zhou, Jun; Zhang, Hai-Feng; Gao, Jie; He, Xiao-Pei; Wen, Qiang; Jia, Lin-Jing; Jin, Han; Qiao, Hai-Ling

2018-06-27

Background/ Aims: Little is known about the effect of P450 oxidoreductase (POR) gene polymorphisms on the activities of CYPs with multiple genotypes. We genotyped 102 human livers for 18 known POR single nucleotide polymorphisms (SNPs) with allelic frequencies greater than 1% as well as for 27 known SNPs in 10 CYPs. CYP enzyme activities in microsomes prepared from these livers were determined by measuring probe substrate metabolism by high performance liquid chromatograph. We found that the effects of the 18 POR SNPs on 10 CYP activities were CYP genotype-dependent. The POR mutations were significantly associated with decreased overall Km for CYP2B6 and 2E1, and specific genotypes within CYP1A2, 2A6, 2B6, 2C8, 2D6 and 2E1 were identified as being affected by these POR SNPs. Notably, the effect of a specific POR mutation on the activity of a CYP genotype could not be predicted from other CYP genotypes of even the same CYP. When combining one POR SNP with other POR SNPs, a hitherto unrecognized effect of multiple-site POR gene polymorphisms (MSGP) on CYP activity was uncovered, which was not necessarily consistent with the effect of either single POR SNP. The effects of POR SNPs on CYP activities were not only CYP-dependent, but more importantly, CYP genotype-dependent. Moreover, the effect of a POR SNP alone and in combination with other POR SNPs (MSGP) was not always consistent, nor predictable. Understanding the impact of POR gene polymorphisms on drug metabolism necessitates knowing the complete SNP complement of POR and the genotype of the relevant CYPs. © 2018 The Author(s). Published by S. Karger AG, Basel.

Chemokine gene polymorphisms associate with gender in patients with uveitis.

PubMed

Chen, Y; Vaughan, R W; Kondeatis, E; Fortune, F; Graham, E M; Stanford, M R; Wallace, G R

2004-01-01

Uveitis is an inflammatory condition of ocular tissue characterized by leukocyte infiltration, tissue damage, and decreased visual acuity. Chemokines have been implicated in the pathogenesis of uveitis. Polymorphisms in the genes encoding chemokines have been described as affecting chemokine production or function. We analyzed the frequency of single-nucleotide polymorphisms (SNPs) in genes encoding CCL2 (-2518 and -2076) and CCL5 (-403 and -28) in patients with Behçet's disease (BD), a systemic form of uveitis, and patients with retinal vasculitis (RV), an organ-specific form of disease. We report that there was no association between any SNP and disease. However, when segregated on the basis of gender the CCR5 -403 AA genotype was only found in male patients with BD. Similarly, CCL2 genotypes 1/2 were predominant in males, while genotype 4 was significantly associated with disease in female patients with BD. Differences in disease symptoms and severity between males and females have been described in BD and gender-specific genetic differences in chemokine gene function may be involved.

Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast

PubMed Central

Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora

2006-01-01

Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318

Systematic search for single nucleotide polymorphisms in a lymphoid tyrosine phosphatase gene (PTPN22): association between a promoter polymorphism and type 1 diabetes in Asian populations.

PubMed

Kawasaki, Eiji; Awata, Takuya; Ikegami, Hiroshi; Kobayashi, Tetsuro; Maruyama, Taro; Nakanishi, Koji; Shimada, Akira; Uga, Miho; Uga, Mho; Kurihara, Susumu; Kawabata, Yumiko; Tanaka, Shoichiro; Kanazawa, Yasuhiko; Lee, Inkyu; Eguchi, Katsumi

2006-03-15

The protein tyrosine phosphatase, nonreceptor 22 gene (PTPN22) maps to human chromosome 1p13.3-p13.1 and encodes an important negative regulator of T-cell activation, lymphoid-specific phosphatase (Lyp). Recently, the minor allele of a single-nucleotide polymorphism (SNP) at nucleotide position 1858 (rs2476601, +1858C > T) was found to be associated with type 1 diabetes. However, the degree of the association is variable among ethnic populations, suggesting the presence of other disease-associated variants in PTPN22. To examine this possibility, we carried out a systemic search for PTPN22 using direct sequencing of PCR-amplified products in the Japanese population. Association and linkage studies were also conducted in 1,690 Japanese samples, 180 Korean samples, and 472 Caucasian samples from 95 nuclear families. We identified five novel SNPs, but not the +1858C > T SNP. Of these two frequent SNPs, -1123G > C, and +2740C > T were in strong linkage disequilibrium (LD), and the -1123G > C promoter SNP was associated with acute-onset but not slow-onset type 1 diabetes in the Japanese population (odds ratio [OR] = 1.42, 95% CI = 1.07-1.89, P = 0.015). This association was observed also in Korean patients with type 1 diabetes (Mantel-Haenszel chi2= 6.543, P = 0.0105, combined OR = 1.41 95% CI = 1.09-1.82). Furthermore, the affected family-based control (AFBAC) association test and the transmission disequilibrium analysis of multiplex families of European descent from the British Diabetes Association (BDA) Warren Repository indicated that the association was stronger in -1123G > C compared to +1858C > T. In conclusion, the type 1 diabetes association with PTPN22 is confirmed, but it cannot be attributed solely to the +1858C > T variant. The promoter -1123G > C SNP is a more likely causative variant in PTPN22. 2006 Wiley-Liss, Inc.

The two single nucleotide polymorphisms in the H37/RBM5 tumour suppressor gene at 3p21.3 correlated with different subtypes of non-small cell lung cancers

PubMed Central

Oh, Juliana J.; Koegel, Ashley; Phan, Diana T.; Razfar, Ali; Slamon, Dennis J.

2007-01-01

Summary Allele loss and genetic alteration in chromosome 3p, particularly in 3p21.3 region, are the most frequent and the earliest genomic abnormalities found in lung cancer. Multiple 3p21.3 genes exhibit various degrees of tumour suppression activity suggesting that 3p21.3 genes may function as an integrated tumour suppressor region through their diverse biological activities. We have previously demonstrated growth inhibitory effects and tumour suppression mechanism of the H37/RBM5 gene which is one of the 19 genes residing in the 370kb minimal overlap region at 3p21.3. In the current study, in an attempt to find, if any, mutations in the H37 coding region in lung cancer cells, we compared nucleotide sequences of the entire H37 gene in tumour vs. adjacent normal tissues from 17 non-small cell lung cancer (NSCLC) patients. No mutations were detected, instead, we found the two silent single nucleotide polymorphisms (SNPs), C1138T and C2185T, within the coding region of the H37 gene. In addition, we found that specific allele types at these SNP positions are correlated with different histological subtypes of NSCLC; tumours containing heterozygous alleles (C+T) at these SNP positions are more likely to be associated with adenocarcinoma (AC) whereas homozygous alleles (either C or T) are associated with squamous cell carcinoma (SCC) (p=0.0098). We postulate that, these two silent polymorphisms may be in linkage disequilibrium (LD) with a disease causative allele in the 3p21.3 tumour suppressor region which is packed with a large number of important genes affecting lung cancer development. In addition, because of prevalent loss of heterozygosity (LOH) detected at 3p21.3 which precedes lung cancer initiation, these SNPs may be developed into a marker screening for the high risk individuals. PMID:17606309

Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication.

PubMed

Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

2016-06-04

Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.

Single Nucleotide Polymorphisms (SNP)-specific Quantitative Real Time Polymerase Chain Reaction (PCR) Assay for Analyzing Competition and Emergence of the Military Hypersporulating Strains of Bacillus Atrophaeous var. Globigii

DTIC Science & Technology

2012-09-01

Emergence of the Military Hypersporulating Strains of Bacillus Atrophaeous var. Globigii by Doncho V. Zhelev, Christopher Dupuis , Suelynn Ren, Anna...Globigii Doncho V. Zhelev, Christopher Dupuis , Suelynn Ren, Anna Le, and Mia Hunt Sensors and Electron Devices Directorate, ARL Henry Gibbons...Zhelev, Christopher Dupuis , Suelynn Ren, Anna Le, Mia Hunt, and Henry Gibbons 5d. PROJECT NUMBER EC-SE-2011-05 5e. TASK NUMBER 5f. WORK UNIT

Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

PubMed

Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

2014-01-01

Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

An Exploration of the Serotonin System in Antisocial Boys with High Levels of Callous-Unemotional Traits

PubMed Central

Moul, Caroline; Dobson-Stone, Carol; Brennan, John; Hawes, David; Dadds, Mark

2013-01-01

Background The serotonin system is thought to play a role in the aetiology of antisocial and aggressive behaviour in both adults and children however previous findings have been inconsistent. Recently, research has suggested that the function of the serotonin system may be specifically altered in a sub-set of antisocial populations – those with psychopathic (callous-unemotional) personality traits. We explored the relationships between callous-unemotional traits and functional polymorphisms of selected serotonin-system genes, and tested the association between callous-unemotional traits and serum serotonin levels independently of antisocial and aggressive behaviour. Method Participants were boys with antisocial behaviour problems aged 3–16 years referred to University of New South Wales Child Behaviour Research Clinics. Participants volunteered either a blood or saliva sample from which levels of serum serotonin (N = 66) and/or serotonin-system single nucleotide polymorphisms (N = 157) were assayed. Results Functional single nucleotide polymorphisms from the serotonin 1b receptor gene (HTR1B) and 2a receptor gene (HTR2A) were found to be associated with callous-unemotional traits. Serum serotonin level was a significant predictor of callous-unemotional traits; levels were significantly lower in boys with high callous-unemotional traits than in boys with low callous-unemotional traits. Conclusion Results provide support to the emerging literature that argues for a genetically-driven system-wide alteration in serotonin function in the aetiology of callous-unemotional traits. The findings should be interpreted as preliminary and future research that aims to replicate and further investigate these results is required. PMID:23457595

An exploration of the serotonin system in antisocial boys with high levels of callous-unemotional traits.

PubMed

Moul, Caroline; Dobson-Stone, Carol; Brennan, John; Hawes, David; Dadds, Mark

2013-01-01

The serotonin system is thought to play a role in the aetiology of antisocial and aggressive behaviour in both adults and children however previous findings have been inconsistent. Recently, research has suggested that the function of the serotonin system may be specifically altered in a sub-set of antisocial populations - those with psychopathic (callous-unemotional) personality traits. We explored the relationships between callous-unemotional traits and functional polymorphisms of selected serotonin-system genes, and tested the association between callous-unemotional traits and serum serotonin levels independently of antisocial and aggressive behaviour. Participants were boys with antisocial behaviour problems aged 3-16 years referred to University of New South Wales Child Behaviour Research Clinics. Participants volunteered either a blood or saliva sample from which levels of serum serotonin (N = 66) and/or serotonin-system single nucleotide polymorphisms (N = 157) were assayed. Functional single nucleotide polymorphisms from the serotonin 1b receptor gene (HTR1B) and 2a receptor gene (HTR2A) were found to be associated with callous-unemotional traits. Serum serotonin level was a significant predictor of callous-unemotional traits; levels were significantly lower in boys with high callous-unemotional traits than in boys with low callous-unemotional traits. Results provide support to the emerging literature that argues for a genetically-driven system-wide alteration in serotonin function in the aetiology of callous-unemotional traits. The findings should be interpreted as preliminary and future research that aims to replicate and further investigate these results is required.

Association of tumour necrosis factor-alpha G/A -238 and G/A -308 single nucleotide polymorphisms with juvenile idiopathic arthritis.

PubMed

Maddah, M; Harsini, S; Ziaee, V; Moradinejad, M H; Rezaei, A; Zoghi, S; Sadr, M; Aghighi, Y; Rezaei, N

2016-12-01

Juvenile idiopathic arthritis (JIA) is a heterogeneous autoimmune disorder of unknown origin. As proinflammatory cytokines are known to contribute towards the pathogenesis of JIA, this case-control study was performed to examine the associations of certain single nucleotide polymorphisms (SNPs) of tumour necrosis factor-α (TNF-α) gene. Fifty-three patients with JIA participated in this study as patients group and compared with 137 healthy unrelated controls. Genotyping was performed for TNF-α gene at positions -308 and -238, using polymerase chain reaction with sequence-specific primers method. Results of the analysed data revealed a significant positive association for TNF-α gene at positions -308 and -238 for A allele in patients group compared with controls (P < 0.01). At the genotypic level, the frequency of TNF-α gene at positions -308 and -238 for GG genotype was discovered to be higher in the patients with JIA compared to the healthy controls (P < 0.01), while GA genotype at the same positions was observed to be less frequent in the case group than the controls (P < 0.01). At the haplotypic level, a significant positive association for TNF-α GG haplotype (positions -308, -238) together with a notable negative association for TNF-α AG and GA haplotypes at the same positions were detected in the patients group in comparison with the healthy individuals (P < 0.01). Cytokine gene polymorphisms might affect the development of JIA. Particular TNF-α gene variants could render individuals more susceptible to JIA.. © 2016 John Wiley & Sons Ltd.

Association between genetic polymorphisms in the XRCC1, XRCC3, XPD, GSTM1, GSTT1, MSH2, MLH1, MSH3, and MGMT genes and radiosensitivity in breast cancer patients.

PubMed

Mangoni, Monica; Bisanzi, Simonetta; Carozzi, Francesca; Sani, Cristina; Biti, Giampaolo; Livi, Lorenzo; Barletta, Emanuela; Costantini, Adele Seniori; Gorini, Giuseppe

2011-09-01

Clinical radiosensitivity varies considerably among patients, and radiation-induced side effects developing in normal tissue can be therapy limiting. Some single nucleotide polymorphisms (SNPs) have been shown to correlate with hypersensitivity to radiotherapy. We conducted a prospective study of 87 female patients with breast cancer who received radiotherapy after breast surgery. We evaluated the association between acute skin reaction following radiotherapy and 11 genetic polymorphisms in DNA repair genes: XRCC1 (Arg399Gln and Arg194Trp), XRCC3 (Thr241Met), XPD (Asp312Asn and Lys751Gln), MSH2 (gIVS12-6T>C), MLH1 (Ile219Val), MSH3 (Ala1045Thr), MGMT (Leu84Phe), and in damage-detoxification GSTM1 and GSTT1 genes (allele deletion). Individual genetic polymorphisms were determined by polymerase chain reaction and single nucleotide primer extension for single nucleotide polymorphisms or by a multiplex polymerase chain reaction assay for deletion polymorphisms. The development of severe acute skin reaction (moist desquamation or interruption of radiotherapy due to toxicity) associated with genetic polymorphisms was modeled using Cox proportional hazards, accounting for cumulative biologically effective radiation dose. Radiosensitivity developed in eight patients and was increased in carriers of variants XRCC3-241Met allele (hazard ratio [HR] unquantifiably high), MSH2 gIVS12-6nt-C allele (HR=53.36; 95% confidence intervals [95% CI], 3.56-798.98), and MSH3-1045Ala allele (HR unquantifiably high). Carriers of XRCC1-Arg194Trp variant allele in combination with XRCC1-Arg399Gln wild-type allele had a significant risk of radiosensitivity (HR=38.26; 95% CI, 1.19-1232.52). To our knowledge, this is the first report to find an association between MSH2 and MSH3 genetic variants and the development of radiosensitivity in breast cancer patients. Our findings suggest the hypothesis that mismatch repair mechanisms may be involved in cellular response to radiotherapy. Genetic polymorphisms may be promising candidates for predicting acute radiosensitivity, but further studies are necessary to confirm our findings. Copyright © 2011 Elsevier Inc. All rights reserved.

High-resolution genetic map for understanding the effect of genome-wide recombination rate, selection sweep and linkage disequilibrium on nucleotide diversity in watermelon

USDA-ARS?s Scientific Manuscript database

Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...

Unsupportive social interactions and affective states: examining associations of two oxytocin-related polymorphisms.

PubMed

McInnis, Opal A; McQuaid, Robyn J; Matheson, Kimberly; Anisman, Hymie

2017-01-01

Two single-nucleotide polymorphisms (SNPs) on oxytocin-related genes, specifically the oxytocin receptor (OXTR) rs53576 and the CD38 rs3796863 variants, have been associated with alterations in prosocial behaviors. A cross-sectional study was conducted among undergraduate students (N = 476) to examine associations between the OXTR and CD38 polymorphisms and unsupportive social interactions and mood states. Results revealed no association between perceived levels of unsupportive social interactions and the OXTR polymorphism. However, A carriers of the CD38 polymorphism, a variant previously associated with elevated oxytocin, reported greater perceived peer unsupportive interactions compared to CC carriers. As expected, perceived unsupportive interactions from peers was associated with greater negative affect, which was moderated by the CD38 polymorphism. Specifically, this relation was stronger among CC carriers of the CD38 polymorphism (a variant thought to be linked to lower oxytocin). When examining whether the OXTR polymorphism moderated the relation between unsupportive social interactions from peers and negative affect there was a trend toward significance, however, this did not withstand multiple testing corrections. These findings are consistent with the perspective that a variant on an oxytocin polymorphism that may be tied to lower oxytocin is related to poor mood outcomes in association with negative social interactions. At the same time, having a genetic constitution presumed to be associated with higher oxytocin was related to increased perceptions of unsupportive social interactions. These seemingly paradoxical findings could be related to previous reports in which variants associated with prosocial behaviors were also tied to relatively more effective coping styles to deal with challenges.

Detection of single-nucleotide polymorphisms using an ON-OFF switching of regenerated biosensor based on a locked nucleic acid-integrated and toehold-mediated strand displacement reaction.

PubMed

Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing

2014-03-04

Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.

Genetic Diversity of Blumeria graminis f. sp. hordei in Central Europe and Its Comparison with Australian Population

PubMed Central

Komínková, Eva; Dreiseitl, Antonín; Malečková, Eva; Doležel, Jaroslav

2016-01-01

Population surveys of Blumeria graminis f. sp. hordei (Bgh), a causal agent of more than 50% of barley fungal infections in the Czech Republic, have been traditionally based on virulence tests, at times supplemented with non-specific Restriction fragment length polymorphism or Random amplified polymorphic DNA markers. A genomic sequence of Bgh, which has become available recently, enables identification of potential markers suitable for population genetics studies. Two major strategies relying on transposable elements and microsatellites were employed in this work to develop a set of Repeat junction markers, Single sequence repeat and Single nucleotide polymorphism markers. A resolution power of the new panel of markers comprising 33 polymorphisms was demonstrated by a phylogenetic analysis of 158 Bgh isolates. A core set of 97 Czech isolates was compared to a set 50 Australian isolates on the background of 11 diverse isolates collected throughout the world. 73.2% of Czech isolates were found to be genetically unique. An extreme diversity of this collection was in strong contrast with the uniformity of the Australian one. This work paves the way for studies of population structure and dynamics based on genetic variability among different Bgh isolates originating from geographically limited regions. PMID:27875588

Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

PubMed

Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

2013-02-01

Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

Cognitive Function in Adolescence: Testing for Interactions Between Breast-Feeding and "FADS2" Polymorphisms

ERIC Educational Resources Information Center

Martin, Nicolas W.; Benyamin, Beben; Hansell, Narelle K.; Montgomery, Grant W.; Martin, Nicholas G.; Wright, Margaret J.; Bates, Timothy C.

2011-01-01

Objectives: Breast-fed C-allele carriers of the rs single nucleotide polymorphism in the fatty acyl desaturase 2 ("FADS2") gene have been reported to show a 6.4 to 7 IQ point advantage over formula-fed C-allele carriers, with no effect of breast-feeding in GG carriers. An Australian sample was examined to determine if an interaction between…

Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

PubMed

Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

2015-03-04

Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

Contrasting Genomic Diversity in Two Closely Related Postharvest Pathogens: Penicillium digitatum and Penicillium expansum.

PubMed

Julca, Irene; Droby, Samir; Sela, Noa; Marcet-Houben, Marina; Gabaldón, Toni

2015-12-14

Penicillium digitatum and Penicillium expansum are two closely related fungal plant pathogens causing green and blue mold in harvested fruit, respectively. The two species differ in their host specificity, being P. digitatum restricted to citrus fruits and P. expansum able to infect a wide range of fruits after harvest. Although host-specific Penicillium species have been found to have a smaller gene content, it is so far unclear whether these different host specificities impact genome variation at the intraspecific level. Here we assessed genome variation across four P. digitatum and seven P. expansum isolates from geographically distant regions. Our results show very high similarity (average 0.06 SNPs [single nucleotide polymorphism] per kb) between globally distributed isolates of P. digitatum pointing to a recent expansion of a single lineage. This low level of genetic variation found in our samples contrasts with the higher genetic variability observed in the similarly distributed P. expansum isolates (2.44 SNPs per kb). Patterns of polymorphism in P. expansum indicate that recombination exists between genetically diverged strains. Consistent with the existence of sexual recombination and heterothallism, which was unknown for this species, we identified the two alternative mating types in different P. expansum isolates. Patterns of polymorphism in P. digitatum indicate a recent clonal population expansion of a single lineage that has reached worldwide distribution. We suggest that the contrasting patterns of genomic variation between the two species reflect underlying differences in population dynamics related with host specificities and related agricultural practices. It should be noted, however, that this results should be confirmed with a larger sampling of strains, as new strains may broaden the diversity so far found in P. digitatum. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

PubMed

Yates, Christopher M; Sternberg, Michael J E

2013-11-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

High-resolution single-nucleotide polymorphism array-profiling in myeloproliferative neoplasms identifies novel genomic aberrations

PubMed Central

Stegelmann, Frank; Bullinger, Lars; Griesshammer, Martin; Holzmann, Karlheinz; Habdank, Marianne; Kuhn, Susanne; Maile, Carmen; Schauer, Stefanie; Döhner, Hartmut; Döhner, Konstanze

2010-01-01

Single-nucleotide polymorphism arrays allow for genome-wide profiling of copy-number alterations and copy-neutral runs of homozygosity at high resolution. To identify novel genetic lesions in myeloproliferative neoplasms, a large series of 151 clinically well characterized patients was analyzed in our study. Copy-number alterations were rare in essential thrombocythemia and polycythemia vera. In contrast, approximately one third of myelofibrosis patients exhibited small genomic losses (less than 5 Mb). In 2 secondary myelofibrosis cases the tumor suppressor gene NF1 in 17q11.2 was affected. Sequencing analyses revealed a mutation in the remaining NF1 allele of one patient. In terms of copy-neutral aberrations, no chromosomes other than 9p were recurrently affected. In conclusion, novel genomic aberrations were identified in our study, in particular in patients with myelofibrosis. Further analyses on single-gene level are necessary to uncover the mechanisms that are involved in the pathogenesis of myeloproliferative neoplasms. PMID:20015882

[Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits].

PubMed

Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia

2008-07-01

Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (P<0.01) and significant association with wool yield in site C (P<0.05). It was concluded from the results that FGF5 gene could be the potential major gene affecting wool yield or link with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.

Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

PubMed

Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

2010-10-01

Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification.

Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

PubMed Central

Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

2012-01-01

Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

Provitamin A Accumulation in Cassava (Manihot esculenta) Roots Driven by a Single Nucleotide Polymorphism in a Phytoene Synthase Gene[W

PubMed Central

Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

2010-01-01

Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

Using PCR-RFLP technology to teach single nucleotide polymorphism for undergraduates.

PubMed

Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

2013-01-01

Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a serial experiment in molecular biology laboratory course to teach single nucleotide polymorphism (SNP) to undergraduate students majoring in molecular biology or genetics. The flanking sequence of rs4382766 was located in Prdx6 gene, which contained a restriction site of SspI, and was used as a target in this lab course. The students could mimic real research by integrating different techniques, such as database retrieving, genomic DNA isolation, PCR, and restriction enzyme assay. This serial experiment of PCR-RFLP helps students set up intact idea of molecular biology and understand the relation among individual experiments. Students were found to be more enthusiastic during the laboratory classes than those in the former curriculum. Copyright © 2013 Wiley Periodicals, Inc.

Polycystic ovary syndrome: association of a C/T single nucleotide polymorphism at tyrosine kinase domain of insulin receptor gene with pathogenesis among lean Japanese women.

PubMed

Kashima, Katsunori; Yahata, Tetsuro; Fujita, Kazuyuki; Tanaka, Kenichi

2013-01-01

To assess whether the insulin receptor (INSR) gene contributes to genetic susceptibility to polycystic ovary syndrome (PCOS) in a Japanese population. We ex-amined the frequency of the His 1058 C/T single nucleotide polymorphism (SNP) found in exon 17 of the INSR gene in 61 Japanese PCOS patients and 99 Japanese healthy controls. In addition, we analyzed the association between the genotype of this SNP and the clinical phenotypes. The frequency of the C/C genotype was not significantly different between all PCOS patients (47.5%) and controls (35.4%). However, among the lean cases (body mass index < or = 20 kg/m2) the frequency of the C/C genotype was significantly increased (p < 0.05) in PCOS patients (65.0%) as compared with controls (36.6%). We concluded that the His 1058 C/T polymorphism at the tyrosine kinase domain of the INSR gene had a relationship to the pathogenesis of lean PCOS patients in a Japanese population.

High-Throughput Genotyping of Single Nucleotide Polymorphisms in the Plasmodium falciparum dhfr Gene by Asymmetric PCR and Melt-Curve Analysis▿

PubMed Central

Cruz, Rochelle E.; Shokoples, Sandra E.; Manage, Dammika P.; Yanow, Stephanie K.

2010-01-01

Mutations within the Plasmodium falciparum dihydrofolate reductase gene (Pfdhfr) contribute to resistance to antimalarials such as sulfadoxine-pyrimethamine (SP). Of particular importance are the single nucleotide polymorphisms (SNPs) within codons 51, 59, 108, and 164 in the Pfdhfr gene that are associated with SP treatment failure. Given that traditional genotyping methods are time-consuming and laborious, we developed an assay that provides the rapid, high-throughput analysis of parasite DNA isolated from clinical samples. This assay is based on asymmetric real-time PCR and melt-curve analysis (MCA) performed on the LightCycler platform. Unlabeled probes specific to each SNP are included in the reaction mixture and hybridize differentially to the mutant and wild-type sequences within the amplicon, generating distinct melting curves. Since the probe is present throughout PCR and MCA, the assay proceeds seamlessly with no further addition of reagents. This assay was validated for analytical sensitivity and specificity using plasmids, purified genomic DNA from reference strains, and parasite cultures. For all four SNPs, correct genotypes were identified with 100 copies of the template. The performance of the assay was evaluated with a blind panel of clinical isolates from travelers with low-level parasitemia. The concordance between our assay and DNA sequencing ranged from 84 to 100% depending on the SNP. We also directly compared our MCA assay to a published TaqMan real-time PCR assay and identified major issues with the specificity of the TaqMan probes. Our assay provides a number of technical improvements that facilitate the high-throughput screening of patient samples to identify SP-resistant malaria. PMID:20631115

What can time-frequency and phase coherence measures tell us about the genetic basis of P3 amplitude?

PubMed Central

McGue, Matt; Iacono, William G.

2017-01-01

In a recent comprehensive investigation, we largely failed to identify significant genetic markers associated with P3 amplitude or to corroborate previous associations between P3 and specific single nucleotide polymorphisms (SNPs) or genes. In the present study we extended this line of investigation to examine time-frequency (TF) activity and intertrial phase coherence (ITPC) in the P3 time window, both of which are associated with P3 amplitude. Previous genome-wide research has reported associations between P3-related theta and delta activity and individual genetic variants. A large, population-based sample of 4211 subjects, comprising male and female adolescent twins and their parents, was genotyped for 527,828 single nucleotide polymorphisms (SNPs), from which over six million SNPs were accurately imputed. Heritability estimates were greater for TF energy than ITPC, whether based on biometric models or the combined influence of all measured SNPs (derived from genome-wide complex trait analysis). The magnitude of overlap in the specific SNPs associated with delta energy and ITPC and P3 amplitude was significant. A genome-wide analysis of all SNPs, accompanied by an analysis of approximately 17,600 genes, indicated a region of chromosome 2 around TEKT4 that was significantly associated with theta ITPC. Analysis of candidate SNPs and genes previously reported to be associated with P3 or related phenotypes yielded one association surviving correction for multiple tests: between theta energy and CRHR1. However, we did not obtain significant associations for SNPs implicated in previous genome-wide studies of TF measures. Identifying specific genetic variants associated with P3 amplitude remains a challenge. PMID:27871913

SNPchiMp v.3: integrating and standardizing single nucleotide polymorphism data for livestock species.

PubMed

Nicolazzi, Ezequiel L; Caprera, Andrea; Nazzicari, Nelson; Cozzi, Paolo; Strozzi, Francesco; Lawley, Cindy; Pirani, Ali; Soans, Chandrasen; Brew, Fiona; Jorjani, Hossein; Evans, Gary; Simpson, Barry; Tosser-Klopp, Gwenola; Brauning, Rudiger; Williams, John L; Stella, Alessandra

2015-04-10

In recent years, the use of genomic information in livestock species for genetic improvement, association studies and many other fields has become routine. In order to accommodate different market requirements in terms of genotyping cost, manufacturers of single nucleotide polymorphism (SNP) arrays, private companies and international consortia have developed a large number of arrays with different content and different SNP density. The number of currently available SNP arrays differs among species: ranging from one for goats to more than ten for cattle, and the number of arrays available is increasing rapidly. However, there is limited or no effort to standardize and integrate array- specific (e.g. SNP IDs, allele coding) and species-specific (i.e. past and current assemblies) SNP information. Here we present SNPchiMp v.3, a solution to these issues for the six major livestock species (cow, pig, horse, sheep, goat and chicken). Original data was collected directly from SNP array producers and specific international genome consortia, and stored in a MySQL database. The database was then linked to an open-access web tool and to public databases. SNPchiMp v.3 ensures fast access to the database (retrieving within/across SNP array data) and the possibility of annotating SNP array data in a user-friendly fashion. This platform allows easy integration and standardization, and it is aimed at both industry and research. It also enables users to easily link the information available from the array producer with data in public databases, without the need of additional bioinformatics tools or pipelines. In recognition of the open-access use of Ensembl resources, SNPchiMp v.3 was officially credited as an Ensembl E!mpowered tool. Availability at http://bioinformatics.tecnoparco.org/SNPchimp.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

NASA Astrophysics Data System (ADS)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

PubMed Central

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-01-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

PubMed Central

Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

2000-01-01

Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

Association between a polymorphism in the IL-12p40 gene and cytomegalovirus reactivation after kidney transplantation.

PubMed

Hoffmann, Thomas W; Halimi, Jean-Michel; Büchler, Mathias; Velge-Roussel, Florence; Goudeau, Alain; Al Najjar, Azmi; Boulanger, Marie-Denise; Houssaini, Tarik Sqalli; Marliere, Jean-Frédéric; Lebranchu, Yvon; Baron, Christophe

2008-05-27

Cytomegalovirus (CMV) infection is associated with a significant rate of morbidity after organ transplantation. The genetic factors influencing its occurrence have been little investigated. IL-12 plays a crucial role in anti-infectious immune responses, especially by stimulating IFNgamma production. An A-to-C single nucleotide polymorphism (SNP) within the 3'-untranslated region of the IL-12p40 gene has been characterized and was reported to be both functionally and clinically relevant. However, the impact of this single nucleotide polymorphism on events after organ transplantation has never been reported. In this study, we investigated the impact of the 3'-untranslated region polymorphism on the occurrence of CMV infection in 469 kidney recipients transplanted at the University Hospital of Tours between 1995 and 2005. The polymorphism was genotyped using the restriction fragment length polymorphism method and CMV infection was determined by pp65 antigenemia. Multifactorial Cox regression analysis demonstrated that the presence of the C allele was an independent risk factor for CMV infection (OR=1.52, P=0.043), the risk being even higher when study was restricted to patients with positive CMV serological status before the graft and who did not receive any CMV prophylaxis (OR=1.88, P=0.028). This study identified a new genetic risk factor for CMV reactivation after kidney transplantation. The results of our study suggest that C carriers might especially benefit from CMV prophylaxis.

The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review

PubMed Central

Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

2015-01-01

Context: Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. Evidence Acquisition: The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. Results: The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. Conclusions: In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association. PMID:26425125

Association between RTEL1 gene polymorphisms and COPD susceptibility in a Chinese Han population

PubMed Central

Ding, Yipeng; Xu, Heping; Yao, Jinjian; Xu, Dongchuan; He, Ping; Yi, Shengyang; Li, Quanni; Liu, Yuanshui; Wu, Cibing; Tian, Zhongjie

2017-01-01

Objective We investigated the association between single-nucleotide polymorphisms in regulation of telomere elongation helicase 1 (RTEL1), which has been associated with telomere length in several brain cancers and age-related diseases, and the risk of chronic obstructive pulmonary disease (COPD) in a Chinese Han population. Methods In a case–control study that included 279 COPD cases and 290 healthy controls, five single-nucleotide polymorphisms in RTEL1 were selected and genotyped using the Sequenom MassARRAY platform. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression after adjusting for age and gender. Results In the genotype model analysis, we determined that rs4809324 polymorphism had a decreased effect on the risk of COPD (CC versus TT: OR =0.28; 95% CI =0.10–0.82; P=0.02). In the genetic model analysis, we found that the “C/C” genotype of rs4809324 was associated with a decreased risk of COPD based on the codominant model (OR =0.33; 95% CI =0.13–0.86; P=0.022) and recessive model (OR =0.32; 95% CI =0.12–0.80; P=0.009). Conclusion Our data shed new light on the association between genetic polymorphisms of RTEL1 and COPD susceptibility in the Chinese Han population. PMID:28360516

Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

PubMed Central

McDonald, Megan C.; McGinness, Lachlan; Hane, James K.; Williams, Angela H.; Milgate, Andrew; Solomon, Peter S.

2016-01-01

Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene. PMID:26837952

Increased frequency of de novo copy number variants in congenital heart disease by integrative analysis of single nucleotide polymorphism array and exome sequence data.

PubMed

Glessner, Joseph T; Bick, Alexander G; Ito, Kaoru; Homsy, Jason; Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R; Golhar, Ryan; Sanders, Stephan J; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A Jeremy; State, Matthew W; Kaltman, Jonathan R; White, Peter S; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K

2014-10-24

Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown pathogenesis. To determine the contribution of de novo copy number variants (CNVs) in the pathogenesis of sporadic CHD. We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism arrays and whole exome sequencing. Results were experimentally validated using digital droplet polymerase chain reaction. We compared validated CNVs in CHD cases with CNVs in 1301 healthy control trios. The 2 complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either single nucleotide polymorphism array (P=7×10(-5); odds ratio, 4.6) or whole exome sequencing data (P=6×10(-4); odds ratio, 3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (P=0.02; odds ratio, 2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in whole exome sequencing and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q subtelomeric deletions. We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. © 2014 American Heart Association, Inc.

Evidence from single nucleotide polymorphism analyses of ADVANCE study demonstrates EFNB3 as a hypertension risk gene.

PubMed

Tremblay, Johanne; Wang, Yujia; Raelson, John; Marois-Blanchet, Francois-Christophe; Wu, Zenghui; Luo, Hongyu; Bradley, Edward; Chalmers, John; Woodward, Mark; Harrap, Stephen; Hamet, Pavel; Wu, Jiangping

2017-03-08

EPH kinases and their ligands, ephrins (EFNs), have vital and diverse biological functions. We recently reported that Efnb3 gene deletion results in hypertension in female but not male mice. These data suggest that EFNB3 regulates blood pressure in a sex- and sex hormone-dependent way. In the present study, we conducted a human genetic study to assess the association of EFNB3 single nucleotide polymorphisms with human hypertension risks, using 3,448 patients with type 2 diabetes from the ADVANCE study (Action in Diabetes and Vascular Disease: Peterax and Diamicron MR Controlled Evaluation). We have observed significant association between 2 SNPs in the 3' untranslated region or within the adjacent region just 3' of the EFNB3 gene with hypertension, corroborating our findings from the mouse model. Thus, our investigation has shown that EFNB3 is a hypertension risk gene in certain individuals.

[Intra- and interpopulation variability of southwestern Kamchatka sockeye salmon Oncorhynchus nerka inferred from the data on single nucleotide polymorphism].

PubMed

Khrustaleva, A M; Klovach, N V; Gritsenko, O F; Seeb, J E

2014-07-01

The variability of 45 single nucleotide polymorphism (SNP) loci was studied in nine samples of the sockeye salmon Oncorhynchus nerka from the rivers of southwestern Kamchatka. The Wahlund effect, gametic disequilibrium at some loci, and a decrease in interpopulation genetic diversity estimates observed in samples from the Bolshaya River outlet are explained in terms of the samples' heterogeneity. Partitioning of mixed samples using some biological characteristics of the individuals led to a noticeable decrease in the frequency of these phenomena. It was demonstrated that the allelic diversity between the populations within the river Plotnikovs accounted for the larger part of genetic variation, as compared to the differentiation between the basins. The SNP loci responsible for intra- and interpopulation differentiation of sockeye salmon from the rivers of southwestern Kamchatka were identified. Some recommendations for field population genetic studies of Asian sockeye salmon were formulated.

L-RCA (ligation-rolling circle amplification): a general method for genotyping of single nucleotide polymorphisms (SNPs)

PubMed Central

Qi, Xiaoquan; Bakht, Saleha; Devos, Katrien M.; Gale, Mike D.; Osbourn, Anne

2001-01-01

A flexible, non-gel-based single nucleotide polymorphism (SNP) detection method is described. The method adopts thermostable ligation for allele discrimination and rolling circle amplification (RCA) for signal enhancement. Clear allelic discrimination was achieved after staining of the final reaction mixtures with Cybr-Gold and visualisation by UV illumination. The use of a compatible buffer system for all enzymes allows the reaction to be initiated and detected in the same tube or microplate well, so that the experiment can be scaled up easily for high-throughput detection. Only a small amount of DNA (i.e. 50 ng) is required per assay, and use of carefully designed short padlock probes coupled with generic primers and probes make the SNP detection cost effective. Biallelic assay by hybridisation of the RCA products with fluorescence dye-labelled probes is demonstrated, indicating that ligation-RCA (L-RCA) has potential for multiplexed assays. PMID:11713336

Group B Streptococcus Infections Caused by Improper Sourcing and Handling of Fish for Raw Consumption, Singapore, 2015–2016

PubMed Central

Chau, Man L.; Chen, Swaine L.; Yap, Min; Hartantyo, Sri H.P.; Chiew, Paul K.T.; Fernandez, Charlene J.; Wong, Wai K.; Fong, Rockey K.; Tan, Wei L.; Tan, Brian Z.Y.; Ng, Youming; Aung, Kyaw T.; Mehershahi, Kurosh S.; Goh, Christopher; Kang, Joanne S.L.; Barkham, Timothy; Leong, Adeline O.K.; Gutiérrez, Ramona A.

2017-01-01

We assessed microbial safety and quality of raw fish sold in Singapore during 2015–2016 to complement epidemiologic findings for an outbreak of infection with group B Streptococcus serotype III sequence type (ST) 283 associated with raw fish consumption. Fish-associated group B Streptococcus ST283 strains included strains nearly identical (0–2 single-nucleotide polymorphisms) with the human outbreak strain, as well as strains in another distinct ST283 clade (57–71 single-nucleotide polymorphisms). Our investigations highlight the risk for contamination of freshwater fish (which are handled and distributed separately from saltwater fish sold as sashimi) and the need for improved hygienic handling of all fish for raw consumption. These results have led to updated policy and guidelines regarding the sale of ready-to-eat raw fish dishes in Singapore. PMID:29148967

Artemisinin Resistance-Associated Polymorphisms at the K13-Propeller Locus Are Absent in Plasmodium falciparum Isolates from Haiti

PubMed Central

Carter, Tamar E.; Boulter, Alexis; Existe, Alexandre; Romain, Jean R.; St. Victor, Jean Yves; Mulligan, Connie J.; Okech, Bernard A.

2015-01-01

Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. PMID:25646258

DNAzyme based gap-LCR detection of single-nucleotide polymorphism.

PubMed

Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo

2013-07-15

Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.

Selection and Management of DNA Markers for Use in Genomic Evaluation

USDA-ARS?s Scientific Manuscript database

A database was constructed to store genotypes for 50,972 single-nucleotide polymorphisms (SNP) from the Illumina BovineSNP50 BeadChip for over 30,000 animals. The database allows storage of multiple samples per animal and stores all SNP genotypes for a sample in a single row. An indicator specifies ...

Association genetics in Pinus taeda L. I. wood property traits

Treesearch

Santiago C. Gonzalez-Martinez; Nicholas C. Wheeler; Elhan Ersoz; C. Dana Nelson; David B. Neale

2007-01-01

Genetic association is a powerful method for dissecting complex adaptive traits due to (i) fine-scale mapping resulting from historical recombination, (ii) wide coverage of phenotypic and genotypic variation within a single experiment, and (iii) the simultaneous discovery of loci and alleles. In this article, genetic association among single nucleotide polymorphisms (...

Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

PubMed

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

2011-05-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

PubMed Central

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

2011-01-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

Implication of common and disease specific variants in CLU, CR1, and PICALM.

PubMed

Ferrari, Raffaele; Moreno, Jorge H; Minhajuddin, Abu T; O'Bryant, Sid E; Reisch, Joan S; Barber, Robert C; Momeni, Parastoo

2012-08-01

Two recent genome-wide association studies (GWAS) for late onset Alzheimer's disease (LOAD) revealed 3 new genes: clusterin (CLU), phosphatidylinositol binding clathrin assembly protein (PICALM), and complement receptor 1 (CR1). In order to evaluate association with these genome-wide association study-identified genes and to isolate the variants contributing to the pathogenesis of LOAD, we genotyped the top single nucleotide polymorphisms (SNPs), rs11136000 (CLU), rs3818361 (CR1), and rs3851179 (PICALM), and sequenced the entire coding regions of these genes in our cohort of 342 LOAD patients and 277 control subjects. We confirmed the association of rs3851179 (PICALM) (p = 7.4 × 10(-3)) with the disease status. Through sequencing we identified 18 variants in CLU, 3 of which were found exclusively in patients; 8 variants (out of 65) in CR1 gene were only found in patients and the 16 variants identified in PICALM gene were present in both patients and controls. In silico analysis of the variants in PICALM did not predict any damaging effect on the protein. The haplotype analysis of the variants in each gene predicted a common haplotype when the 3 single nucleotide polymorphisms rs11136000 (CLU), rs3818361 (CR1), and rs3851179 (PICALM), respectively, were included. For each gene the haplotype structure and size differed between patients and controls. In conclusion, we confirmed association of CLU, CR1, and PICALM genes with the disease status in our cohort through identification of a number of disease-specific variants among patients through the sequencing of the coding region of these genes. Published by Elsevier Inc.

Single-nucleotide polymorphisms and mRNA expression for melatonin synthesis rate-limiting enzyme in recurrent depressive disorder.

PubMed

Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata

2010-05-01

Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.

Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

PubMed

Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

2018-06-01

Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genomic Changes Associated with Reproductive and Migratory Ecotypes in Sockeye Salmon (Oncorhynchus nerka).

PubMed

Veale, Andrew J; Russello, Michael A

2017-10-01

Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder.

PubMed

Yanagi, Kumiko; Kaname, Tadashi; Wakui, Keiko; Hashimoto, Ohiko; Fukushima, Yoshimitsu; Naritomi, Kenji

2012-01-01

Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered.

Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder

PubMed Central

Yanagi, Kumiko; Kaname, Tadashi; Wakui, Keiko; Hashimoto, Ohiko; Fukushima, Yoshimitsu; Naritomi, Kenji

2012-01-01

Mutations in the X-linked genes neuroligin 3 (NLGN3) and neuroligin 4X (NLGN4X) were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD) patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered. PMID:22934180

Association between ASMT and autistic-like traits in children from a Swedish nationwide cohort.

PubMed

Jonsson, Lina; Anckarsäter, Henrik; Zettergren, Anna; Westberg, Lars; Walum, Hasse; Lundström, Sebastian; Larsson, Henrik; Lichtenstein, Paul; Melke, Jonas

2014-02-01

Individuals with autism spectrum disorders often show low levels of melatonin, and it has been suggested that this decrease may be because of the low activity of the acetylserotonin O-methyltransferase (ASMT), the last enzyme in the melatonin-synthesis pathway. Also, genetic variants in ASMT have been associated with autism, as well as with low ASMT activity and melatonin levels, suggesting that the low ASMT activity observed in autism may partly be because of variations within the ASMT gene. In this study, we present a symptom-based approach to investigate possible associations between ASMT and autistic-like traits in the general population. To this end, continuous measures of autistic-like traits were assessed in a nationally representative twin cohort (n=1771) from Sweden and six single nucleotide polymorphisms (SNPs), and a duplication of exons 2-8 in ASMT were genotyped. Our results show a nominally significant association, in girls, between one single nucleotide polymorphism (rs5949028) in the last intron of ASMT and social interaction impairments. No significant association, however, was observed with traits related to language impairment or restricted and repetitive behavior. In conclusion, our results support the possible involvement of the ASMT gene in autism spectrum disorders, and our finding that only one of the three traits shows association suggests that genetic research may benefit from adopting a symptom-specific approach to identify genes involved in autism psychopathology.

Single Nucleotide Polymorphisms in B-Genome Specific UDP-Glucosyl Transferases Associated with Fusarium Head Blight Resistance and Reduced Deoxynivalenol Accumulation in Wheat Grain.

PubMed

Sharma, Pallavi; Gangola, Manu P; Huang, Chen; Kutcher, H Randy; Ganeshan, Seedhabadee; Chibbar, Ravindra N

2018-01-01

An in vitro spike culture method was optimized to evaluate Fusarium head blight (FHB) resistance in wheat (Triticum aestivum) and used to screen a population of ethyl methane sulfonate treated spike culture-derived variants (SCDV). Of the 134 SCDV evaluated, the disease severity score of 47 of the variants was ≤30%. Single nucleotide polymorphisms (SNP) in the UDP-glucosyltransferase (UGT) genes, TaUGT-2B, TaUGT-3B, and TaUGT-EST, differed between AC Nanda (an FHB-susceptible wheat variety) and Sumai-3 (an FHB-resistant wheat cultivar). SNP at 450 and 1,558 bp from the translation initiation site in TaUGT-2B and TaUGT-3B, respectively were negatively correlated with FHB severity in the SCDV population, whereas the SNP in TaUGT-EST was not associated with FHB severity. Fusarium graminearum strain M7-07-1 induced early expression of TaUGT-2B and TaUGT-3B in FHB-resistant SCDV lines, which were associated with deoxynivalenol accumulation and reduced FHB disease progression. At 8 days after inoculation, deoxynivalenol concentration varied from 767 ppm in FHB-resistant variants to 2,576 ppm in FHB-susceptible variants. The FHB-resistant SCDV identified can be used as new sources of FHB resistance in wheat improvement programs.

Differences in N-linked glycosylation between human surfactant protein-B variants of the C or T allele at the single-nucleotide polymorphism at position 1580: implications for disease.

PubMed Central

Wang, Guirong; Christensen, Neil D; Wigdahl, Brian; Guttentag, Susan H; Floros, Joanna

2003-01-01

Human surfactant protein-B (SP-B), a hydrophobic protein, is essential for normal lung function. SP-B is expressed and secreted by specific lung cell types, i.e. alveolar type II and Clara cells, of the respiratory epithelium. The SP-B precursor (42 kDa) undergoes post-translational processing to generate an 8 kDa mature SP-B. A single-nucleotide polymorphism (SNP) at nucleotide 1580 (C/T) in exon 4 of SP-B that changes amino acid 131 from threonine to isoleucine (Thr131-->Ile) is associated with several pulmonary diseases. The Thr131-->Ile substitution can eliminate a potential N-linked glycosylation site, Asn129-Gln-Thr131, which is present in the SP-B variant of the C allele (ACT/Thr) but not in that of the T allele (ATT/Ile). To determine whether the C allele SP-B variant is indeed glycosylated at Asn(129)-Gln-Thr131, we first generated stably transfected Chinese hamster ovary cell lines that expressed each version of SP-B, and developed specific SP-B polyclonal anti-peptide antibodies. Using both the stably transfected cell lines and fetal lung explants, we observed that the C allele variant is indeed glycosylated at the Asn129-Gln-Thr131 site, whereas the T allele variant, which served as a control, is not. In addition, we also confirmed that both SP-B variants contain another N-linked glycosylation site, Asn311-Ser-Ser313. Given its association with several pulmonary diseases, this finding provides useful information for future studies in disease systems associated with this SNP. Further, we speculate that, given the fact that this SNP is found frequently in the general population, N-linked glycosylation at residue Asn129 interferes with SP-B processing, secretion and folding under certain disease conditions. PMID:12356334

Associations of polymorphisms in the Pit-1 gene with growth and carcass traits in Angus beef cattle.

PubMed

Zhao, Q; Davis, M E; Hines, H C

2004-08-01

The Pit-1 gene was studied as a candidate for genetic markers of growth and carcass traits. Angus beef cattle that were divergently selected for high- or low-blood serum IGF-I concentration were used in this study. The single-strand conformation polymorphism method was used to identify polymorphism in the Pit-1 gene including regions from intron 2 to exon 6. Two polymorphisms, Pit1I3H (HinfI) and Pit1I3NL (NlaIII), were detected in intron 3 of the Pit-1 gene. One polymorphism, Pit1I4N (BstNI), was found in intron 4, and a single nucleotide polymorphism, Pit1I5, was found in intron 5. The previously reported polymorphism in exon 6, Pit1E6H (HinfI), was also studied in 416 Angus beef cattle. Associations of the polymorphisms with growth traits, carcass traits, and IGF-I concentration were analyzed using a general linear model procedure. No significant associations were observed between these polymorphisms and growth and carcass traits.

p16 gene silencing along with p53 single-nucleotide polymorphism and risk of esophageal cancer in Northeast India.

PubMed

Das, Mandakini; Sharma, Santanu Kumar; Sekhon, Gaganpreet Singh; Mahanta, Jagadish; Phukan, Rup Kumar; Jalan, Bimal Kumar

2017-05-01

The high incidence of esophageal cancer in Northeast India and the unique ethnic background and dietary habits provide a great opportunity to study the molecular genetics behind esophageal squamous cell carcinoma in this part of the region. We hypothesized that in addition to currently known environmental risk factors for esophageal cancer, genetic and epigenetic factors are also involved in esophageal carcinogenesis in Northeast India. Therefore, in this study, we explored the possible association between the two important G1 cell cycle regulatory genes p16 and p53 and environmental risk factors and risk of esophageal carcinogenesis. A total of 100 newly diagnosed esophageal cancer cases along with equal number of age-, sex-, and ethnicity-matched controls were included in this study. Methylation-specific polymerase chain reaction was used to determine the p16 promoter methylation status. Single-nucleotide polymorphism at codon 72 of p53 gene was assessed by the polymerase chain reaction-restriction fragment length polymorphism method. Aberrant methylation of p16 gene was seen in 81% of esophageal cancer cases. Hypermethylation of p16 gene was not found in healthy controls. p53 Pro/Pro genotype was found to be a risk genotype in Northeast India compared with Arg/Pro and Arg/Arg. p53 variant/polymorphism was significantly associated with esophageal cancer risk in the study population under all three genetic models, namely, dominant model (Arg/Pro + Pro/Pro vs Arg/Arg odds ratio = 2.25, confidence interval = 1.19-4.26; p = 0.012), recessive model (Arg/Arg + Arg/Pro vs Pro/Pro odds ratio = 2.35, confidence interval = 1.24-4.44; p = 0.008), and homozygous model (Pro/Pro vs Arg/Arg odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). However, p53 variant/polymorphism was not statistically associated with esophageal cancer risk under the heterozygous model (Pro/Pro vs Arg/Pro). In the case-only analysis based on p16 methylation, the p53 variant/polymorphism (Pro/Pro or Arg/Pro) showed significant association for esophageal cancer risk (odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). Gene-gene and gene-environment interaction using the case-only approach revealed a strong association between p16 methylation, p53 single-nucleotide polymorphism, and environmental factors and esophageal cancer risk. Cases with p16 methylation and p53 variant/polymorphism (Pro/Pro or Arg/Pro) along with both betel quid and tobacco chewing habit (odds ratio = 8.29, confidence interval = 1.14-60.23; p = 0.037) conferred eightfold increased risk toward esophageal cancer development. This study reveals a synergistic interaction between epigenetic, genetic, and environmental factors and risk of esophageal cancer in this high-incidence region of Northeast India. The inactivation of either p16 or p53 in a majority of esophageal cancer cases in this study suggests the possible crosstalk between the important cell cycle genes.

African American-preponderant single nucleotide polymorphisms (SNPs) and risk of breast cancer

PubMed Central

Kato, Ikuko; Cichon, Michelle; Yee, Cecilia L.; Land, Susan; Korczak, Jeannette F.

2009-01-01

Background African American women more often present with more aggressive types of breast cancer than Caucasian women, but little is known whether genetic polymorphisms specific to or disproportionate in African Americans are associated with their risk of breast cancer. Methods A population-based case-control study was conducted including 194 cases identified through the Metropolitan Detroit Cancer Surveillance System and 189 controls recruited through random digit dialing to examine polymorphisms in genes involved in estrogen metabolism and action. Results The African American-specific CYP1A1 5639C allele was associated with an increased risk of breast cancer (odds ratio(OR)=2.34, 95%confidence interval (CI): 1.23–4.44) and this association with the CYP1A1 5639 locus was dependent on another polymorphism in the CYP3A4 gene (P=0.043 for the interaction). In addition, African American-predominant CYP1B1 432 Val allele was significantly more often found in the cases than in the controls overall and the HSD17B1 312 Gly allele was specifically associated with premenopausal breast cancer risk (OR=3.00, 95% CI: 1.29–6.99). Conclusion These observations need to be confirmed in larger studies due to the limited statistical power of the study based on a small number of cases. PMID:19679043

Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

PubMed

Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

2013-06-01

Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

Large Scale Single Nucleotide Polymorphism Study of PD Susceptibility

DTIC Science & Technology

2005-03-01

identification of eight genetic loci in the familial PD, the results of intensive investigations of polymorphisms in dozens of genes related to sporadic, late...1) investigate the association between classical, sporadic PD and 2386 SNPs in 23 genes implicated in the pathogenesis of PD; (2) construct...addition, experiences derived from this study may be applied in other complex disorders for the identification of susceptibility genes , as well as in genome

Association of "ADAM10" and "CAMK2A" Polymorphisms with Conduct Disorder: Evidence from Family-Based Studies

ERIC Educational Resources Information Center

Jian, Xue-Qiu; Wang, Ke-Sheng; Wu, Tie-Jian; Hillhouse, Joel J.; Mullersman, Jerald E.

2011-01-01

Twin and family studies have shown that genetic factors play a role in the development of conduct disorder (CD). The purpose of this study was to identify genetic variants associated with CD using a family-based association study. We used 4,720 single nucleotide polymorphisms (SNPs) from the Illumina Panel and 11,120 SNPs from the Affymetrix 10K…

Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information.

PubMed

van Binsbergen, R; Veerkamp, R F; Calus, M P L

2012-04-01

The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Predicting stroke through genetic risk functions: the CHARGE Risk Score Project.

PubMed

Ibrahim-Verbaas, Carla A; Fornage, Myriam; Bis, Joshua C; Choi, Seung Hoan; Psaty, Bruce M; Meigs, James B; Rao, Madhu; Nalls, Mike; Fontes, Joao D; O'Donnell, Christopher J; Kathiresan, Sekar; Ehret, Georg B; Fox, Caroline S; Malik, Rainer; Dichgans, Martin; Schmidt, Helena; Lahti, Jari; Heckbert, Susan R; Lumley, Thomas; Rice, Kenneth; Rotter, Jerome I; Taylor, Kent D; Folsom, Aaron R; Boerwinkle, Eric; Rosamond, Wayne D; Shahar, Eyal; Gottesman, Rebecca F; Koudstaal, Peter J; Amin, Najaf; Wieberdink, Renske G; Dehghan, Abbas; Hofman, Albert; Uitterlinden, André G; Destefano, Anita L; Debette, Stephanie; Xue, Luting; Beiser, Alexa; Wolf, Philip A; Decarli, Charles; Ikram, M Arfan; Seshadri, Sudha; Mosley, Thomas H; Longstreth, W T; van Duijn, Cornelia M; Launer, Lenore J

2014-02-01

Beyond the Framingham Stroke Risk Score, prediction of future stroke may improve with a genetic risk score (GRS) based on single-nucleotide polymorphisms associated with stroke and its risk factors. The study includes 4 population-based cohorts with 2047 first incident strokes from 22,720 initially stroke-free European origin participants aged ≥55 years, who were followed for up to 20 years. GRSs were constructed with 324 single-nucleotide polymorphisms implicated in stroke and 9 risk factors. The association of the GRS to first incident stroke was tested using Cox regression; the GRS predictive properties were assessed with area under the curve statistics comparing the GRS with age and sex, Framingham Stroke Risk Score models, and reclassification statistics. These analyses were performed per cohort and in a meta-analysis of pooled data. Replication was sought in a case-control study of ischemic stroke. In the meta-analysis, adding the GRS to the Framingham Stroke Risk Score, age and sex model resulted in a significant improvement in discrimination (all stroke: Δjoint area under the curve=0.016, P=2.3×10(-6); ischemic stroke: Δjoint area under the curve=0.021, P=3.7×10(-7)), although the overall area under the curve remained low. In all the studies, there was a highly significantly improved net reclassification index (P<10(-4)). The single-nucleotide polymorphisms associated with stroke and its risk factors result only in a small improvement in prediction of future stroke compared with the classical epidemiological risk factors for stroke.

Effect of the g.-723G-->T polymorphism in the bovine myogenic factor 5 (Myf5) gene promoter region on gene transcript level in the longissimus dorsi muscle and on meat traits of Polish Holstein-Friesian cattle.

PubMed

Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech

2010-06-01

Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.

Association between RTEL1, PHLDB1, and TREH Polymorphisms and Glioblastoma Risk: A Case-Control Study

PubMed Central

Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjuan; Li, Shanqu

2015-01-01

Background Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. Material/Methods In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Results Using the χ2 test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes “CC” of rs2297440 and “GG” of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Conclusions Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population. PMID:26156397

Association between RTEL1, PHLDB1, and TREH Polymorphisms and Glioblastoma Risk: A Case-Control Study.

PubMed

Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjun; Li, Shanqu

2015-07-09

Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Using the χ(2) test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes "CC" of rs2297440 and "GG" of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population.

Assay for identification of heterozygous single-nucleotide polymorphism (Ala67Thr) in human poliovirus receptor gene.

PubMed

Nandi, Shyam Sundar; Sharma, Deepa Kailash; Deshpande, Jagadish M

2016-07-01

It is important to understand the role of cell surface receptors in susceptibility to infectious diseases. CD155 a member of the immunoglobulin super family, serves as the poliovirus receptor (PVR). Heterozygous (Ala67Thr) polymorphism in CD155 has been suggested as a risk factor for paralytic outcome of poliovirus infection. The present study pertains to the development of a screening test to detect the single nucleotide (SNP) polymorphism in the CD155 gene. New primers were designed for PCR, sequencing and SNP analysis of Exon2 of CD155 gene. DNAs extracted from either whole blood (n=75) or cells from oral cavity (n=75) were used for standardization and validation of the SNP assay. DNA sequencing was used as the gold standard method. A new SNP assay for detection of heterozygous Ala67Thr genotype was developed and validated by testing 150 DNA samples. Heterozygous CD155 was detected in 27.33 per cent (41/150) of DNA samples tested by both SNP detection assay and sequencing. The SNP detection assay was successfully developed for identification of Ala67Thr polymorphism in human PVR/CD155 gene. The SNP assay will be useful for large scale screening of DNA samples.

Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population.

PubMed

Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

2016-06-02

Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Rapid Identification and Differentiation of Trichophyton Species, Based on Sequence Polymorphisms of the Ribosomal Internal Transcribed Spacer Regions, by Rolling-Circle Amplification▿

PubMed Central

Kong, Fanrong; Tong, Zhongsheng; Chen, Xiaoyou; Sorrell, Tania; Wang, Bin; Wu, Qixuan; Ellis, David; Chen, Sharon

2008-01-01

DNA sequencing analyses have demonstrated relatively limited polymorphisms within the fungal internal transcribed spacer (ITS) regions among Trichophyton spp. We sequenced the ITS region (ITS1, 5.8S, and ITS2) for 42 dermatophytes belonging to seven species (Trichophyton rubrum, T. mentagrophytes, T. soudanense, T. tonsurans, Epidermophyton floccosum, Microsporum canis, and M. gypseum) and developed a novel padlock probe and rolling-circle amplification (RCA)-based method for identification of single nucleotide polymorphisms (SNPs) that could be exploited to differentiate between Trichophyton spp. Sequencing results demonstrated intraspecies genetic variation for T. tonsurans, T. mentagrophytes, and T. soudanense but not T. rubrum. Signature sets of SNPs between T. rubrum and T. soudanense (4-bp difference) and T. violaceum and T. soudanense (3-bp difference) were identified. The RCA assay correctly identified five Trichophyton species. Although the use of two “group-specific” probes targeting both the ITS1 and the ITS2 regions were required to identify T. soudanense, the other species were identified by single ITS1- or ITS2-targeted species-specific probes. There was good agreement between ITS sequencing and the RCA assay. Despite limited genetic variation between Trichophyton spp., the sensitive, specific RCA-based SNP detection assay showed potential as a simple, reproducible method for the rapid (2-h) identification of Trichophyton spp. PMID:18234865

Scanning the Effects of Ethyl Methanesulfonate on the Whole Genome of Lotus japonicus Using Second-Generation Sequencing Analysis

PubMed Central

Mohd-Yusoff, Nur Fatihah; Ruperao, Pradeep; Tomoyoshi, Nurain Emylia; Edwards, David; Gresshoff, Peter M.; Biswas, Bandana; Batley, Jacqueline

2015-01-01

Genetic structure can be altered by chemical mutagenesis, which is a common method applied in molecular biology and genetics. Second-generation sequencing provides a platform to reveal base alterations occurring in the whole genome due to mutagenesis. A model legume, Lotus japonicus ecotype Miyakojima, was chemically mutated with alkylating ethyl methanesulfonate (EMS) for the scanning of DNA lesions throughout the genome. Using second-generation sequencing, two individually mutated third-generation progeny (M3, named AM and AS) were sequenced and analyzed to identify single nucleotide polymorphisms and reveal the effects of EMS on nucleotide sequences in these mutant genomes. Single-nucleotide polymorphisms were found in every 208 kb (AS) and 202 kb (AM) with a bias mutation of G/C-to-A/T changes at low percentage. Most mutations were intergenic. The mutation spectrum of the genomes was comparable in their individual chromosomes; however, each mutated genome has unique alterations, which are useful to identify causal mutations for their phenotypic changes. The data obtained demonstrate that whole genomic sequencing is applicable as a high-throughput tool to investigate genomic changes due to mutagenesis. The identification of these single-point mutations will facilitate the identification of phenotypically causative mutations in EMS-mutated germplasm. PMID:25660167

New genetic variants associated with prostate cancer

Cancer.gov

Researchers have newly identified 23 common genetic variants -- one-letter changes in DNA known as single-nucleotide polymorphisms or SNPs -- that are associated with risk of prostate cancer. These results come from an analysis of more than 10 million SNP

Genetic discovery in Xylella fastidiosa through sequence analysis of selected randomly amplified polymorphic DNAs.

PubMed

Chen, Jianchi; Civerolo, Edwin L; Jarret, Robert L; Van Sluys, Marie-Anne; de Oliveira, Mariana C

2005-02-01

Xylella fastidiosa causes many important plant diseases including Pierce's disease (PD) in grape and almond leaf scorch disease (ALSD). DNA-based methodologies, such as randomly amplified polymorphic DNA (RAPD) analysis, have been playing key roles in genetic information collection of the bacterium. This study further analyzed the nucleotide sequences of selected RAPDs from X. fastidiosa strains in conjunction with the available genome sequence databases and unveiled several previously unknown novel genetic traits. These include a sequence highly similar to those in the phage family of Podoviridae. Genome comparisons among X. fastidiosa strains suggested that the "phage" is currently active. Two other RAPDs were also related to horizontal gene transfer: one was part of a broadly distributed cryptic plasmid and the other was associated with conjugal transfer. One RAPD inferred a genomic rearrangement event among X. fastidiosa PD strains and another identified a single nucleotide polymorphism of evolutionary value.

Amino acid sequence of the Amur tiger prion protein.

PubMed

Wu, Changde; Pang, Wanyong; Zhao, Deming

2006-10-01

Prion diseases are fatal neurodegenerative disorders in human and animal associated with conformational conversion of a cellular prion protein (PrP(C)) into the pathologic isoform (PrP(Sc)). Various data indicate that the polymorphisms within the open reading frame (ORF) of PrP are associated with the susceptibility and control the species barrier in prion diseases. In the present study, partial Prnp from 25 Amur tigers (tPrnp) were cloned and screened for polymorphisms. Four single nucleotide polymorphisms (T423C, A501G, C511A, A610G) were found; the C511A and A610G nucleotide substitutions resulted in the amino acid changes Lysine171Glutamine and Alanine204Threoine, respectively. The tPrnp amino acid sequence is similar to house cat (Felis catus ) and sheep, but differs significantly from other two cat Prnp sequences that were previously deposited in GenBank.

Polymorphism in the promoter region of the Toll-like receptor 9 gene and cervical human papillomavirus infection.

PubMed

Oliveira, Lucas Boeno; Louvanto, Karolina; Ramanakumar, Agnihotram V; Franco, Eduardo L; Villa, Luisa L

2013-08-01

Polymorphism in the Toll-like receptor (TLR) 9 gene has been shown to have a significant role in some diseases; however, little is known about its possible role in the natural history of human papillomavirus (HPV) infections. We investigated the association between a single-nucleotide polymorphism (SNP) (rs5743836) in the promoter region of TLR9 (T1237C) and type-specific HPV infections. Specimens were derived from a cohort of 2462 women enrolled in the Ludwig-McGill Cohort Study. We randomly selected 500 women who had a cervical HPV infection detected at least once during the study as cases. We defined two control groups: (i) a random sample of 300 women who always tested HPV negative, and (ii) a sample of 234 women who were always HPV negative but had a minimum of ten visits during the study. TLR9 genotyping was performed using bidirectional PCR amplification of specific alleles. Irrespective of group, the WT homozygous TLR9 genotype (TT) was the most common form, followed by the heterozygous (TC) and the mutant homozygous (CC) forms. There were no consistent associations between polymorphism and infection risk, either overall or by type or species. Likewise, there were no consistently significant associations between polymorphism and HPV clearance or persistence. We concluded that this polymorphism in the promoter region of TLR9 gene does not seem to have a mediating role in the natural history of the HPV infection.

Nucleotide-binding oligomerization domain containing 1 (NOD1) haplotypes and single nucleotide polymorphisms modify susceptibility to inflammatory bowel diseases in a New Zealand caucasian population: a case-control study

PubMed Central

Huebner, Claudia; Ferguson, Lynnette R; Han, Dug Yeo; Philpott, Martin; Barclay, Murray L; Gearry, Richard B; McCulloch, Alan; Demmers, Pieter S; Browning, Brian L

2009-01-01

Background The nucleotide-binding oligomerization domain containing 1 (NOD1) gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of NOD1 single nucleotide polymorphisms (SNPs) on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line. Findings DNA samples from 388 Crohn's disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in NOD1, using the MassARRAY® iPLEX Gold assay. Transcriptional activation of the protein produced by NOD1 (Nod1) was studied after infection of Caco2 cells with Escherichia coli LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50–0.88, p < 0.002) but not UC. There was an increased frequency of the three SNP (rs2075818, rs2075822, rs2907748) haplotype, CTG (p = 0.004) and a decreased frequency of the GTG haplotype (p = 0.02).in CD. The rs2075822 CT or TT genotypes were at an increased frequency (genotype p value = 0.02), while the rs2907748 AA or AG genotypes showed decreased frequencies in UC (p = 0.04), but not in CD. Functional assays showed that Nod1 is produced 6 hours after bacterial invasion of the Caco2 cell line. Conclusion The NOD1 gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population. PMID:19327158

Development of a Multiplex Single Base Extension Assay for Mitochondrial DNA Haplogroup Typing

PubMed Central

Nelson, Tahnee M.; Just, Rebecca S.; Loreille, Odile; Schanfield, Moses S.; Podini, Daniele

2007-01-01

Aim To provide a screening tool to reduce time and sample consumption when attempting mtDNA haplogroup typing. Methods A single base primer extension assay was developed to enable typing, in a single reaction, of twelve mtDNA haplogroup specific polymorphisms. For validation purposes a total of 147 samples were tested including 73 samples successfully haplogroup typed using mtDNA control region (CR) sequence data, 21 samples inconclusively haplogroup typed by CR data, 20 samples previously haplogroup typed using restriction fragment length polymorphism (RFLP) analysis, and 31 samples of known ancestral origin without previous haplogroup typing. Additionally, two highly degraded human bones embalmed and buried in the early 1950s were analyzed using the single nucleotide polymorphisms (SNP) multiplex. Results When the SNP multiplex was used to type the 96 previously CR sequenced specimens, an increase in haplogroup or macrohaplogroup assignment relative to conventional CR sequence analysis was observed. The single base extension assay was also successfully used to assign a haplogroup to decades-old, embalmed skeletal remains dating to World War II. Conclusion The SNP multiplex was successfully used to obtain haplogroup status of highly degraded human bones, and demonstrated the ability to eliminate possible contributors. The SNP multiplex provides a low-cost, high throughput method for typing of mtDNA haplogroups A, B, C, D, E, F, G, H, L1/L2, L3, M, and N that could be useful for screening purposes for human identification efforts and anthropological studies. PMID:17696300

Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

PubMed Central

Ryynänen, Heikki J; Primmer, Craig R

2006-01-01

Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

PubMed

Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

2006-06-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

PubMed Central

Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

2006-01-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

Copy Number Variation across European Populations

PubMed Central

Chen, Wanting; Hayward, Caroline; Wright, Alan F.; Hicks, Andrew A.; Vitart, Veronique; Knott, Sara; Wild, Sarah H.; Pramstaller, Peter P.; Wilson, James F.; Rudan, Igor; Porteous, David J.

2011-01-01

Genome analysis provides a powerful approach to test for evidence of genetic variation within and between geographical regions and local populations. Copy number variants which comprise insertions, deletions and duplications of genomic sequence provide one such convenient and informative source. Here, we investigate copy number variants from genome wide scans of single nucleotide polymorphisms in three European population isolates, the island of Vis in Croatia, the islands of Orkney in Scotland and the South Tyrol in Italy. We show that whereas the overall copy number variant frequencies are similar between populations, their distribution is highly specific to the population of origin, a finding which is supported by evidence for increased kinship correlation for specific copy number variants within populations. PMID:21829696

High Genetic Diversity Revealed by Variable-Number Tandem Repeat Genotyping and Analysis of hsp65 Gene Polymorphism in a Large Collection of “Mycobacterium canettii” Strains Indicates that the M. tuberculosis Complex Is a Recently Emerged Clone of “M. canettii”

PubMed Central

Fabre, Michel; Koeck, Jean-Louis; Le Flèche, Philippe; Simon, Fabrice; Hervé, Vincent; Vergnaud, Gilles; Pourcel, Christine

2004-01-01

We have analyzed, using complementary molecular methods, the diversity of 43 strains of “Mycobacterium canettii” originating from the Republic of Djibouti, on the Horn of Africa, from 1998 to 2003. Genotyping by multiple-locus variable-number tandem repeat analysis shows that all the strains belong to a single but very distant group when compared to strains of the Mycobacterium tuberculosis complex (MTBC). Thirty-one strains cluster into one large group with little variability and five strains form another group, whereas the other seven are more diverged. In total, 14 genotypes are observed. The DR locus analysis reveals additional variability, some strains being devoid of a direct repeat locus and others having unique spacers. The hsp65 gene polymorphism was investigated by restriction enzyme analysis and sequencing of PCR amplicons. Four new single nucleotide polymorphisms were discovered. One strain was characterized by three nucleotide changes in 441 bp, creating new restriction enzyme polymorphisms. As no sequence variability was found for hsp65 in the whole MTBC, and as a single point mutation separates M. tuberculosis from the closest “M. canettii” strains, this diversity within “M. canettii” subspecies strongly suggests that it is the most probable source species of the MTBC rather than just another branch of the MTBC. PMID:15243089

Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

PubMed Central

Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

2009-01-01

Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Single-Nucleotide Polymorphisms Identified in Clinical Samples Can Affect MicroRNA Processing, Level of Expression, and Silencing Activity

PubMed Central

Han, Soo-Jin; Marshall, Vickie; Barsov, Eugene; Quiñones, Octavio; Ray, Alex; Labo, Nazzarena; Trivett, Matthew; Ott, David; Renne, Rolf

2013-01-01

Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 12 pre-microRNAs that can produce 25 KSHV mature microRNAs. We previously reported single-nucleotide polymorphisms (SNPs) in KSHV-encoded pre-microRNA and mature microRNA sequences from clinical samples (V. Marshall et al., J. Infect. Dis., 195:645–659, 2007). To determine whether microRNA SNPs affect pre-microRNA processing and, ultimately, mature microRNA expression levels, we performed a detailed comparative analysis of (i) mature microRNA expression levels, (ii) in vitro Drosha/Dicer processing, and (iii) RNA-induced silencing complex-dependent targeting of wild-type (wt) and variant microRNA genes. Expression of pairs of wt and variant pre-microRNAs from retroviral vectors and measurement of KSHV mature microRNA expression by real-time reverse transcription-PCR (RT-PCR) revealed differential expression levels that correlated with the presence of specific sequence polymorphisms. Measurement of KSHV mature microRNA expression in a panel of primary effusion lymphoma cell lines by real-time RT-PCR recapitulated some observed expression differences but suggested a more complex relationship between sequence differences and expression of mature microRNA. Furthermore, in vitro maturation assays demonstrated significant SNP-associated changes in Drosha/DGCR8 and/or Dicer processing. These data demonstrate that SNPs within KSHV-encoded pre-microRNAs are associated with differential microRNA expression levels. Given the multiple reports on the involvement of microRNAs in cancer, the biological significance of these phenotypic and genotypic variants merits further studies in patients with KSHV-associated malignancies. PMID:24006441

Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

PubMed Central

2013-01-01

Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome. PMID:24010766

ABCB1 genetic variability and methadone dosage requirements in opioid-dependent individuals.

PubMed

Coller, Janet K; Barratt, Daniel T; Dahlen, Karianne; Loennechen, Morten H; Somogyi, Andrew A

2006-12-01

The most common treatment for opioid dependence is substitution therapy with another opioid such as methadone. The methadone dosage is individualized but highly variable, and program retention rates are low due in part to nonoptimal dosing resulting in withdrawal symptoms and further heroin craving and use. Methadone is a substrate for the P-glycoprotein transporter, encoded by the ABCB1 gene, which regulates central nervous system exposure. This retrospective study aimed to investigate the influence of ABCB1 genetic variability on methadone dose requirements. Genomic deoxyribonucleic acid was isolated from opioid-dependent subjects (n = 60) and non-opioid-dependent control subjects (n = 60), and polymerase chain reaction-restriction fragment length polymorphism and allele-specific polymerase chain reaction were used to determine the presence of single nucleotide polymorphisms at positions 61, 1199, 1236, 2677, and 3435. ABCB1 haplotypes were inferred with PHASE software (version 2.1). There were no significant differences in the allele or genotype frequencies of the individual single nucleotide polymorphisms or haplotypes between the 2 populations. ABCB1 genetic variability influenced daily methadone dose requirements, such that subjects carrying 2 copies of the wild-type haplotype required higher doses compared with those with 1 copy and those with no copies (98.3 +/- 10.4, 58.6 +/- 20.9, and 55.4 +/- 26.1 mg/d, respectively; P = .029). In addition, carriers of the AGCTT haplotype required significantly lower doses than noncarriers (38.0 +/- 16.8 and 61.3 +/- 24.6 mg/d, respectively; P = .04). Although ABCB1 genetic variability is not related to the development of opioid dependence, identification of variant haplotypes may, after larger prospective studies have been performed, provide clinicians with a tool for methadone dosage individualization.

Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

PubMed

Silva-Junior, Orzenil B; Grattapaglia, Dario

2015-11-01

We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Single nucleotide polymorphisms in the Trx2/TXNIP and TrxR2 genes of the mitochondrial thioredoxin antioxidant system and the risk of diabetic retinopathy in patients with Type 2 diabetes mellitus.

PubMed

Ramus, Sara Mankoc; Cilensek, Ines; Petrovic, Mojca Globocnik; Soucek, Miroslav; Kruzliak, Peter; Petrovic, Daniel

2016-03-01

Oxidative stress plays an important role in the pathogenesis of diabetes and its complications. The aim of this study was to examine the possible association between seven single nucleotide polymorphisms (SNPs) of the Trx2/TXNIP and TrxR2 genes encoding proteins involved in the thioredoxin antioxidant defence system and the risk of diabetic retinopthy (DR). Cross-sectional case-control study. A total of 802 Slovenian patients with Type 2 diabetes mellitus; 277 patients with DR and 525 with no DR were enrolled. Patients genotypes of the SNPs; including rs8140110, rs7211, rs7212, rs4755, rs1548357, rs4485648 and rs5748469 were determined by the competitive allele specific PCR method. Each genotype of examined SNPs was regressed in a logistic model, assuming the co-dominant, dominant and the recessive models of inheritance with covariates of duration of diabetes, HbA1c, insulin therapy, total cholesterol and LDL cholesterol levels. In the present study, for the first time we identified an association between the rs4485648 polymorphism of the TrxR2 gene and DR in Caucasians with Type 2 DM. The estimated ORs of adjusted logistic regression models were found to be as follows: 4.4 for CT heterozygotes, 4.3 for TT homozygotes (co-dominant genetic model) and 4.4 for CT+TT genotypes (dominant genetic model). In our case-control study we were not able to demonstrate any association between rs8140110, rs7211, rs7212, rs4755, rs1548357, and rs5748469 and DR, however, our findings provide evidence that the rs4485648 polymorphism of the TrxR2 gene might exert an independent effect on the development of DR. Copyright © 2016 Elsevier Inc. All rights reserved.

Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication

PubMed Central

Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

2016-01-01

Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to “Gopoong” and “K-1” were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information. PMID:27271615

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

PubMed

Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

2017-11-01

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1.92-8.79, P <0.001) in males and 1.73 (95% CI 0.80-3.76, P =0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

Host genotype-specific therapies can optimize the inflammatory response to mycobacterial infections

PubMed Central

Tobin, David M.; Roca, Francisco J.; Oh, Sungwhan F.; McFarland, Ross; Vickery, Thad W.; Ray, John P.; Ko, Dennis C.; Zou, Yuxia; Bang, Nguyen D.; Chau, Tran T. H.; Vary, Jay C.; Hawn, Thomas R.; Dunstan, Sarah J.; Farrar, Jeremy J.; Thwaites, Guy E.; King, Mary-Claire; Serhan, Charles N.; Ramakrishnan, Lalita

2012-01-01

Summary Susceptibility to tuberculosis is historically ascribed to an inadequate immune response that fails to control infecting mycobacteria. In zebrafish, we find that susceptibility to Mycobacterium marinum can result from either inadequate or excessive acute inflammation. Modulation of the leukotriene A4 hydrolase (LTA4H) locus, which controls the balance of pro- and anti-inflammatory eicosanoids, reveals two distinct molecular routes to mycobacterial susceptibility converging on dysregulated TNF levels: inadequate inflammation caused by excess lipoxins and hyperinflammation driven by excess leukotriene B4. We identify therapies that specifically target each of these extremes. In humans, we identify a single nucleotide polymorphism in the LTA4H promoter that regulates its transcriptional activity. In tuberculous meningitis, the polymorphism is associated with inflammatory cell recruitment, patient survival and response to adjunctive anti-inflammatory therapy. Together, our findings suggest that host-directed therapies tailored to patient LTA4H genotypes may counter detrimental effects of either extreme of inflammation. PMID:22304914

Oxytocin receptor gene polymorphism modulates the effects of social support on heart rate variability

PubMed Central

Kanthak, Magdalena K.; Chen, Frances S.; Kumsta, Robert; Hill, LaBarron K.; Thayer, Julian F.; Heinrichs, Markus

2017-01-01

A large body of empirical research has demonstrated stress-buffering effects of social support. However, recent studies suggest that genetic variation of the oxytocin system (specifically, a common single nucleotide polymorphism, rs53576, of the oxytocin receptor gene) modulates the efficacy of social support. The timing and neurobiological basis of this genetic modulation were investigated using a standardized, laboratory-based psychological stress procedure (Trier Social Stress Test for Groups, TSST-G). To index potential stress buffering effects of social support mediated by the oxytocin system, heart rate variability (HRV) was obtained before and during the TSST-G from 40 healthy participants. Results indicate that social support is associated with higher HRV only in G allele carriers. Specifically, social support increased heart rate variability during direct social interaction and only in individuals with at least one copy of the G allele of rs53576. These findings support the idea that the stress-attenuating effects of social support are modulated by genetic variation of the oxytocin system. PMID:26903384

No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

PubMed

Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

2012-07-30

This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

Genome-environment associations in sorghum landraces predict adaptive traits

USDA-ARS?s Scientific Manuscript database

Improving environmental adaptation in crops is essential for food security under global change, but phenotyping adaptive traits remains a major bottleneck. If associations between single-nucleotide polymorphism (SNP) alleles and environment of origin in crop landraces reflect adaptation, then these ...

Identification of SNP Haplotypes and Prospects of Association Mapping in Watermelon

USDA-ARS?s Scientific Manuscript database

Watermelon is the fifth most economically important vegetable crop cultivated world-wide. Implementing Single Nucleotide Polymorphism (SNP) marker technology in watermelon breeding and germplasm evaluation programs holds a key to improve horticulturally important traits. Next-generation sequencing...

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

Large Scale Single Nucleotide Polymorphism Study of PD Susceptibility

DTIC Science & Technology

2006-03-01

familial PD, the results of intensive investigations of polymorphisms in dozens of genes related to sporadic, late onset, typical PD have not shown...association between classical, sporadic PD and 2386 SNPs in 23 genes implicated in the pathogenesis of PD; (2) construct haplotypes based on the SNP...derived from this study may be applied in other complex disorders for the identification of susceptibility genes , as well as in genome-wide SNP

Prevalence of combinatorial CYP2C9 and VKORC1 genotypes in Puerto Ricans: implications for warfarin management in Hispanics.

PubMed

Duconge, Jorge; Cadilla, Carmen L; Windemuth, Andreas; Kocherla, Mohan; Gorowski, Krystyna; Seip, Richard L; Bogaard, Kali; Renta, Jessica Y; Piovanetti, Paola; D'Agostino, Darrin; Santiago-Borrero, Pedro J; Ruaño, Gualberto

2009-01-01

Polymorphisms in the cytochrome P450 2C9 (CYP2C9) and vitamin K epoxide reductase complex subunit 1 (VKORC1) genes significantly alter the effective warfarin dose. We determined the frequencies of alleles, single carriers, and double carriers of single nucleotide polymorphisms (SNPs) in the CYP2C9 and VKORC1 genes in a Puerto Rican cohort and gauged the impact of these polymorphisms on warfarin dosage using a published algorithm. A total of 92 DNA samples were genotyped using Luminex x-MAP technology. The polymorphism frequencies were 6.52%, 5.43% and 28.8% for CYP2C9 *2, *3 and VKORC1-1639 C>A polymorphisms, respectively. The prevalence of combinatorial genotypes was 16% for carriers of both the CYP2C9 and VKORC1 polymorphisms, 9% for carriers of CYP2C9 polymorphisms, 35% for carriers of the VKORC1 polymorphism, and the remaining 40% were non-carriers for either gene. Based on a published warfarin dosing algorithm, single, double and triple carriers of functionally deficient polymorphisms predict reductions of 1.0-1.6, 2.0-2.9, and 2.9-3.7 mg/day, respectively, in warfarin dose. Overall, 60% of the population carried at least a single polymorphism predicting deficient warfarin metabolism or responsiveness and 13% were double carriers with polymorphisms in both genes studied. Combinatorial genotyping of CYP2C9 and VKORC1 can allow for individualized dosing of warfarin among patients with gene polymorphisms, potentially reducing the risk of stroke or bleeding.

Single nucleotide polymorphism detection in aldehyde dehydrogenase 2 (ALDH2) gene using bacterial magnetic particles based on dissociation curve analysis.

PubMed

Maruyama, Kohei; Takeyama, Haruko; Nemoto, Etsuo; Tanaka, Tsuyoshi; Yoda, Kiyoshi; Matsunaga, Tadashi

2004-09-20

Single nucleotide polymorphism (SNP) detection for aldehyde dehydrogenase 2 (ALDH2) gene based on DNA thermal dissociation curve analysis was successfully demonstrated using an automated system with bacterial magnetic particles (BMPs) by developing a new method for avoiding light scattering caused by nanometer-size particles when using commercially available fluorescent dyes such as FITC, Cy3, and Cy5 as labeling chromophores. Biotin-labeled PCR products in ALDH2, two allele-specific probes (Cy3-labeled detection probe for ALDH2*1 and Cy5-labeled detection probe for ALDH2*2), streptavidin-immobilized BMPs (SA-BMPs) were simultaneously mixed. The mixture was denatured at 70 degrees C for 3 min, cooled slowly to 25 degrees C, and incubated for 10 min, allowing the DNA duplex to form between Cy3- or Cy5-labeled detection probes and biotin-labeled PCR products on SA-BMPs. Then duplex DNA-BMP complex was heated to 58 degrees C, a temperature determined by dissociation curve analysis and a dissociated single-base mismatched detection probe was removed at the same temperature under precise control. Furthermore, fluorescence signal from the detection probe was liberated into the supernatant from completely matched duplex DNA-BMP complex by heating to 80 degrees C and measured. In the homozygote target DNA (ALDH2*1/*1 and ALDH2*2/*2), the fluorescence signals from single-base mismatched were decreased to background level, indicating that mismatched hybridization was efficiently removed by the washing process. In the heterozygote target DNA (ALDH2*1/*2), each fluorescence signals was at a similar level. Therefore, three genotypes of SNP in ALDH2 gene were detected using the automated detection system with BMPs. Copyright 2004 Wiley Periodicals, Inc.

Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

PubMed

Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

2015-02-03

The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

Rapid Genotyping of Single Nucleotide Polymorphisms Influencing Warfarin Drug Response by Surface-Enhanced Laser Desorption and Ionization Time-of-Flight (SELDI-TOF) Mass Spectrometry

PubMed Central

Yang, Shangbin; Xu, LiHui; Wu, Haifeng M.

2010-01-01

Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy. PMID:20075209

Rapid genotyping of single nucleotide polymorphisms influencing warfarin drug response by surface-enhanced laser desorption and ionization time-of-flight (SELDI-TOF) mass spectrometry.

PubMed

Yang, Shangbin; Xu, LiHui; Wu, Haifeng M

2010-03-01

Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy.

Exploring single nucleotide polymorphisms previously related to obesity and metabolic traits in pediatric-onset type 2 diabetes.

PubMed

Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel

2017-07-01

To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.

Single nucleotide polymorphisms in the CXCR1 gene and its association with clinical mastitis incidence in Polish Holstein-Friesian cows.

PubMed

Pokorska, J; Dusza, M; Kułaj, D; Żukowski, K; Makulska, J

2016-04-28

The aim of this study was to identify the association between single nucleotide polymorphisms (SNPs) in the bovine chemokine receptor (CXCR1) gene and the resistance or susceptibility of cows to mastitis. The analysis of the CXCR1 polymorphism was carried out using polymerase chain reaction restriction fragment length polymorphism analysis for six SNP mutations (c.+291C>T, c.+365T>C, c.+816C>A, c.+819G>A, +1093C>T, and +1373C>A), of which four were located within the coding region and two in the 3'UTR region of the CXCR1 gene. Genetic material from 146 Polish Holstein-Friesian cows was analyzed after dividing into two groups depending on the incidence of clinical mastitis. Identified polymorphisms were in linkage disequilibrium and formed two linkage groups. Three haplotypes (CCCATA, TTAGCC, CTCGCC), forming six haplotype combinations, were detected. The logistic regression showed a significant association between the CC genotype at c.+365T>C and susceptibility of cows to clinical mastitis (P = 0.047). The frequency of haplotype combination 1/1 (CCCATA/CCCATA) was not significantly higher in cows susceptible to mastitis (P = 0.062). Of the identified SNP mutations, only c.+365T>C is a nonsynonymous mutation that induces a change in the coded protein [GCC (Ala) to GTC (Val) at the 122nd amino acid]. This amino acid change can result in changes in receptor function, which may be a reason for the increased mastitis incidence observed in cows with polymorphism at this site.

Detection of Epidemic USA300 Community-Associated Methicillin-Resistant Staphylococcus aureus Strains by Use of a Single Allele-Specific PCR Assay Targeting a Novel Polymorphism of Staphylococcus aureus pbp3

PubMed Central

Chadwick, Sean G.; Prasad, Aditya; Smith, W. Lamar; Mordechai, Eli; Adelson, Martin E.

2013-01-01

In recent years, the dramatic increase in community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) infections has become a significant health care challenge. Early detection of CA-MRSA is important because of its increased virulence associated with the arginine catabolic mobile element (ACME), Panton-Valentine leukocidin (PVL), and other toxins that may contribute to disease severity. In particular, the USA300 epidemic clone has emerged and now represents the cause of as much as 98% of CA-MRSA skin and soft tissue infections in the United States. Current diagnostic assays used to identify CA-MRSA strains are based on complex multiplex PCRs targeting the staphylococcal cassette chromosome mec (SCCmec) DNA junction, a multitude of genes, and noncoding DNA fragments or on a number of lengthy sequence-typing methods. Here, two nucleotide polymorphisms, G88A and G2047A, that were found to be in strict linkage disequilibrium in the S. aureus penicillin-binding protein 3 (pbp3) gene were also found to be highly associated with the USA300 clone of CA-MRSA. Clinical isolates that contained this pbp3 allele were also positive for the presence of SCCmec type IV, the ACME, and the PVL toxin gene and matched the t008 or t121 molecular spa types, which are associated specifically with the USA300 CA-MRSA clone. A single allele-specific PCR targeting the G88A polymorphism was developed and was found to be 100% sensitive and specific for the detection of USA300 CA-MRSA and 91.5% sensitive and 100% specific for the detection of all CA-MRSA isolates in this study. PMID:23698534

PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

PubMed

Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

2009-03-01

The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

PubMed

Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

2012-04-01

Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

A Single Nucleotide Polymorphism in the Phospholipase D1 Gene is Associated with Risk of Non-Small Cell Lung Cancer

PubMed Central

Ahn, Myung-Ju; Park, Shin-Young; Kim, Won Kyu; Cho, Ju Hwan; Chang, Brian Junho; Kim, Dong Jo; Ahn, Jin Seok; Park, Keunchil; Han, Joong-Soo

2012-01-01

Phospholipase D (PLD) has an important role in various biological functions including vesicular transport, endocytosis, exocytosis, cell migration, and mitosis. These cellular biological processes are deregulated in the development of various human tumors. In order to explore the relationship between the PLD1 gene and risk of non-small cell lung cancer (NSCLC), single nucleotide polymorphisms (SNP) in the PLD1 exon region were surveyed in 211 NSCLC patients and 205 normal controls. In this study, we identified six SNPs at exon 23 in the PLD1 gene. Among the six SNPs, the most notable was a heterozygous A to C transition at nucleotide 2698 (A2698C, p<0.001). In addition, the genotype frequencies of A2744C (AC+CC) and A2756C (AC+CC) were associated with gender (female, A2744C and A2756C: p=0.071) in NSCLC patients. Interestingly, although the SNP A2698C did not cause change in amino acid, correlation between odd ratio of NSCLC patients and the SNP A2698C was observed to be statistically significant. PMID:23675264

Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.)

PubMed Central

2012-01-01

Background High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). Results We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. Conclusion By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously. PMID:22583801

Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.).

PubMed

Stoffel, Kevin; van Leeuwen, Hans; Kozik, Alexander; Caldwell, David; Ashrafi, Hamid; Cui, Xinping; Tan, Xiaoping; Hill, Theresa; Reyes-Chin-Wo, Sebastian; Truco, Maria-Jose; Michelmore, Richard W; Van Deynze, Allen

2012-05-14

High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously.

Distinguishing functional polymorphism from random variation in the sequences of >10,000 HLA-A, -B and -C alleles.

PubMed

Robinson, James; Guethlein, Lisbeth A; Cereb, Nezih; Yang, Soo Young; Norman, Paul J; Marsh, Steven G E; Parham, Peter

2017-06-01

HLA class I glycoproteins contain the functional sites that bind peptide antigens and engage lymphocyte receptors. Recently, clinical application of sequence-based HLA typing has uncovered an unprecedented number of novel HLA class I alleles. Here we define the nature and extent of the variation in 3,489 HLA-A, 4,356 HLA-B and 3,111 HLA-C alleles. This analysis required development of suites of methods, having general applicability, for comparing and analyzing large numbers of homologous sequences. At least three amino-acid substitutions are present at every position in the polymorphic α1 and α2 domains of HLA-A, -B and -C. A minority of positions have an incidence >1% for the 'second' most frequent nucleotide, comprising 70 positions in HLA-A, 85 in HLA-B and 54 in HLA-C. The majority of these positions have three or four alternative nucleotides. These positions were subject to positive selection and correspond to binding sites for peptides and receptors. Most alleles of HLA class I (>80%) are very rare, often identified in one person or family, and they differ by point mutation from older, more common alleles. These alleles with single nucleotide polymorphisms reflect the germ-line mutation rate. Their frequency predicts the human population harbors 8-9 million HLA class I variants. The common alleles of human populations comprise 42 core alleles, which represent all selected polymorphism, and recombinants that have assorted this polymorphism.

Distinguishing functional polymorphism from random variation in the sequences of >10,000 HLA-A, -B and -C alleles

PubMed Central

Cereb, Nezih; Yang, Soo Young; Marsh, Steven G. E.; Parham, Peter

2017-01-01

HLA class I glycoproteins contain the functional sites that bind peptide antigens and engage lymphocyte receptors. Recently, clinical application of sequence-based HLA typing has uncovered an unprecedented number of novel HLA class I alleles. Here we define the nature and extent of the variation in 3,489 HLA-A, 4,356 HLA-B and 3,111 HLA-C alleles. This analysis required development of suites of methods, having general applicability, for comparing and analyzing large numbers of homologous sequences. At least three amino-acid substitutions are present at every position in the polymorphic α1 and α2 domains of HLA-A, -B and -C. A minority of positions have an incidence >1% for the ‘second’ most frequent nucleotide, comprising 70 positions in HLA-A, 85 in HLA-B and 54 in HLA-C. The majority of these positions have three or four alternative nucleotides. These positions were subject to positive selection and correspond to binding sites for peptides and receptors. Most alleles of HLA class I (>80%) are very rare, often identified in one person or family, and they differ by point mutation from older, more common alleles. These alleles with single nucleotide polymorphisms reflect the germ-line mutation rate. Their frequency predicts the human population harbors 8–9 million HLA class I variants. The common alleles of human populations comprise 42 core alleles, which represent all selected polymorphism, and recombinants that have assorted this polymorphism. PMID:28650991

Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma.

PubMed

Zhang, Ruixing; Wang, Rui; Zhang, Fengbin; Wu, Chensi; Fan, Haiyan; Li, Yan; Wang, Cuiju; Guo, Zhanjun

2010-11-26

Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome.

Clinical Significance of the Single Nucleotide Polymorphism TLR2 R753Q in Heart Transplant Recipients at Risk for Cytomegalovirus Disease

PubMed Central

Schneider, Martina; Matiqi, Teresa; Kundi, Michael; Rieder, Franz JJ; Andreas, Martin; Strassl, Robert; Zuckermann, Andreas; Jungbauer, Christof; Steininger, Christoph

2017-01-01

Background The Toll-like receptor 2 (TLR2) is a significant component of innate immunity against cytomegalovirus (CMV) infection but information on the clinical significance of the most common single nucleotide polymorphism (SNP) (R753Q) is conflicting. Objectives The inconsistent observations of the immunological and clinical significance of the TLR2 R753Q polymorphism for CMV infection indicates the influence of confounders. Study design The presence of the TLR2 polymorphism was determined by a genotyping assay of 175 HTX patients and 281 healthy blood donors and evaluated in relation to selected virological and clinical parameters. Results Relative frequency of TLR2 polymorphism was similar in HTX patients and blood donors (homozygous wild-type, 94.3% vs. 94.0%; heterozygous, 5.1% vs. 5.7%; homozygous mutated, <1%). CMV viremia was detectable in 108 (61.7%) of HTX patients. The TLR2 polymorphism was neither associated with occurrence or level of CMV infection nor with survival, graft failure or rejection, or CMV serostatus of patient before transplantation. Nevertheless, CMV viremia occurred in 83.1% of R+/D+, 77.1% of R+/D-, and 64.3% of R-/D+ patients. Time of first CMV viremia was in R-/D+ patients later than in CMV-seropositive patients (median, 182 days versus 23 days; P<0.001) corresponding to the duration of antiviral prophylaxis in R-/D+ patients. Conclusions The TLR2 R753Q polymorphism is extremely rare in the general population and HTX patients. Screening for this risk factor of CMV disease may not be cost-effective in contrast to testing for CMV viremia. PMID:27723526

Cognitive function in adolescence: testing for interactions between breast-feeding and FADS2 polymorphisms.

PubMed

Martin, Nicolas W; Benyamin, Beben; Hansell, Narelle K; Montgomery, Grant W; Martin, Nicholas G; Wright, Margaret J; Bates, Timothy C

2011-01-01

Breast-fed C-allele carriers of the rs174575 single nucleotide polymorphism in the fatty acyl desaturase 2 (FADS2) gene have been reported to show a 6.4 to 7 IQ point advantage over formula-fed C-allele carriers, with no effect of breast-feeding in GG carriers. An Australian sample was examined to determine if an interaction between breast-feeding and the rs174575 single nucleotide polymorphism had any effect on IQ. This hypothesis was tested in more than 700 families of adolescent twins assessed for IQ and breast-feeding, birth weight, and FADS2 polymorphisms, and parental socioeconomic status and education, and maternal FADS2 status. No significant evidence for a moderating effect on IQ of rs174575 C-carrier status and breast-feeding was found, and there no effects of maternal FADS2 status on offspring IQ. In addition, no main effects of any FADS2 polymorphisms on IQ were found when the genotype was kept as two-homozygote and one-heterozygote categories and indeed no evidence for effects of breast-feeding on IQ scores after controlling for parental socioeconomic status and education. The investigation was extended to two additional FADS2 polymorphisms (rs1535 and rs174583), but again, although these polymorphisms code alleles affecting fatty acid metabolism, no main or interaction effects were found on IQ. These results support the view that apparent effects of breast-feeding on IQ reflect differential likelihood of breast-feeding as a function of parental education and did not support the predicted interaction effect of FADS2 and breast-feeding on IQ. Copyright © 2011 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.

Association of N-acetyltransferase-2 and glutathione S-transferase polymorphisms with idiopathic male infertility in Vietnam male subjects.

PubMed

Trang, Nguyen Thi; Huyen, Vu Thi; Tuan, Nguyen Thanh; Phan, Tran Duc

2018-04-25

N-acetyltransferase-2 (NAT2) and Glutathione S-transferases (GSTs) are phase-II xenobiotic metabolizing enzymes participating in detoxification of toxic arylamines, aromatic amines, hydrazines and reactive oxygen species (ROS), which are produced under oxidative and electrophile stresses. The purpose of this research was to investigate whether two common single-nucleotide polymorphisms (SNP) of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) associated with susceptibility to idiopathic male infertility. A total 300 DNA samples (150 infertile patients and 150 healthy control) were genotyped for the polymorphisms by ARMS - PCR. We revealed a significant association between the NAT2 variant genotypes (CT + TT (rs1799929), (OR: 3.74; p < 0.001)) and (GA + AA (rs1799930), (OR: 3.75; p < 0.001)) or GSTP1 variant genotypes (GA + AA (rs1695), (OR: 5.11; p < 0,001)) and (CT + TT (rs1138272), (OR: 7.42; p < 0,001) with idiopathic infertility risk. Our findings rate the effect of single-nucleotide polymorphisms of GSTP1 and/or NAT2 in modulation of the risk of male infertility in subjects from Vietnam. This pilot study is the first (as far as we know) to reveal that polymorphisms of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) are some novel genetic markers for susceptibility to idiopathic male infertility. Copyright © 2018 Elsevier B.V. All rights reserved.

Cyclooxygenase 2 gene polymorphisms and chronic periodontitis in a North Indian population: a pilot study

PubMed Central

Daing, Anika; Singh, Sarvendra Vikram; Saimbi, Charanjeet Singh; Khan, Mohammad Akhlaq

2012-01-01

Purpose Cyclooxygenase (COX) enzyme catalyzes the production of prostaglandins, which are important mediators of tissue destruction in periodontitis. Single nucleotide polymorphisms of COX2 enzyme have been associated with increasing susceptibility to inflammatory diseases. The present study evaluates the association of two single nucleotide polymorphisms in COX2 gene (-1195G>A and 8473C>T) with chronic periodontitis in North Indians. Methods Both SNPs and their haplotypes were used to explore the associations between COX2 polymorphisms and chronic periodontitis in 56 patients and 60 controls. Genotyping was done by polymerase chain reaction followed by restriction fragment length polymorphism. Chi-square test and logistic regression analysis were performed for association analysis. Results By the individual genotype analysis, mutant genotypes (GA and AA) of COX2 -1195 showed more than a two fold risk (odds ratio [OR]>2) and COX2 8473 (TC and CC) showed a reduced risk for the disease, but the findings were not statistically significant. Haplotype analysis showed that the frequency of the haplotype AT was higher in the case group and a significant association was found for haplotype AT (OR, 1.79; 95% confidence interval, 1.03 to 3.11; P=0.0370) indicating an association between the AT haplotype of COX2 gene SNPs and chronic periodontitis. Conclusions Individual genotypes of both the SNPs were not associated while haplotype AT was found to be associated with chronic periodontitis in North Indians. PMID:23185695

IGF-I gene variability is associated with an increased risk for AD.

PubMed

Vargas, Teo; Martinez-Garcia, Ana; Antequera, Desiree; Vilella, Elisabet; Clarimon, Jordi; Mateo, Ignacio; Sanchez-Juan, Pascual; Rodriguez-Rodriguez, Eloy; Frank, Ana; Rosich-Estrago, Marcel; Lleo, Alberto; Molina-Porcel, Laura; Blesa, Rafael; Gomez-Isla, Teresa; Combarros, Onofre; Bermejo-Pareja, Felix; Valdivieso, Fernando; Bullido, Maria Jesus; Carro, Eva

2011-03-01

Insulin-like growth factor I (IGF-I), a neuroprotective factor with a wide spectrum of actions in the adult brain, is involved in the pathogenesis of Alzheimer's disease (AD). Circulating levels of IGF-I change in AD patients and are implicated in the clearance of brain amyloid beta (Aβ) complexes. To investigate this hypothesis, we screened the IGF-I gene for various well known single nucleotide polymorphisms (SNPs) covering % of the gene variability in a population of 2352 individuals. Genetic analysis indicated different distribution of genotypes of 1 single nucleotide polymorphism, and 1 extended haplotype in the AD population compared with healthy control subjects. In particular, the frequency of rs972936 GG genotype was significantly greater in AD patients than in control subjects (63% vs. 55%). The rs972936 GG genotype was associated with an increased risk for disease, independently of apolipoprotein E genotype, and with enhanced circulating levels of IGF-I. These findings suggest that polymorphisms within the IGF-I gene could infer greater risk for AD through their effect on IGF-I levels, and confirm the physiological role IGF-I in the pathogenesis of AD. Copyright © 2011 IBRO. Published by Elsevier Inc. All rights reserved.

Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

PubMed

Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

2017-04-04

Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

Association of a single nucleotide polymorphism in the akirin 2 gene with economically important traits in Korean native cattle.

PubMed

Kim, H; Lee, S K; Hong, M W; Park, S R; Lee, Y S; Kim, J W; Lee, H K; Jeong, D K; Song, Y H; Lee, S J

2013-12-01

The akirin 2 gene, located on chromosome 9 in cattle, was previously reported to be associated with nuclear factor-kappa B (NF-κB), involved in immune reactions and marbling of meat. To determine whether a single nucleotide polymorphism (SNP) in akirin 2 is associated with economically important traits of Korean native cattle, the c.*188G>A SNP DNA marker in the 3'-UTR region of akirin 2 was analyzed for its association with carcass weight, longissimus muscle area and marbling. The c.*188G>A SNP was genotyped by polymerase chain reaction restriction fragment length polymorphism, and the frequency of the AA, AG, and GG genotypes were 6.82%, 71.29% and 21.88% respectively. This SNP was significantly associated with longissimus muscle area (Bonferroni corrected P < 0.05), and marbling score (Bonferroni corrected P < 0.01). These results suggest that the c.*188G>A SNP of akirin 2 might be useful as a DNA marker for longissimus muscle area and marbling scores in Korean native cattle. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

Functional single nucleotide polymorphisms of matrix metalloproteinase 7 and 12 genes in idiopathic recurrent spontaneous abortion.

PubMed

Barišić, Anita; Pereza, Nina; Hodžić, Alenka; Kapović, Miljenko; Peterlin, Borut; Ostojić, Saša

2017-03-01

The aim of this study was to investigate the potential association of matrix metalloproteinase 7 (MMP7) -181 A/G and MMP12 -82 A/G functional single nucleotide polymorphisms (SNP) with idiopathic recurrent spontaneous abortion (IRSA) in Slovenian reproductive couples. A case-control study was conducted on 149 couples with 3 or more consecutive idiopathic spontaneous pregnancy loses and 149 women and men with at least 2 live births and no history of pregnancy complications. Genotyping of MMP7 -181 A/G and MMP12 -82 A/G SNPs was performed using polymerase chain reaction and restriction fragment length polymorphism methods. There were no statistically significant differences in the distribution of MMP7 -181 A/G and MMP12 -82 A/G genotype, allele, or haplotype frequencies between IRSA patients and controls, as well as patients' primary and secondary IRSA. We also found no association of MMP7 -181 A/G and MMP12 -82 A/G genotypes, alleles, and haplotypes with IRSA. We found no evidence to support the association between IRSA and MMP7 -181 A/G and MMP12 -82 A/G SNPs in Slovenian reproductive couples.

Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map.

PubMed

Hewett, Duncan; Samuelsson, Lena; Polding, Joanne; Enlund, Fredrik; Smart, Devi; Cantone, Kathryn; See, Chee Gee; Chadha, Sapna; Inerot, Annica; Enerback, Charlotta; Montgomery, Doug; Christodolou, Chris; Robinson, Phil; Matthews, Paul; Plumpton, Mary; Wahlstrom, Jan; Swanbeck, Gunnar; Martinsson, Tommy; Roses, Allen; Riley, John; Purvis, Ian

2002-03-01

Psoriasis is a chronic inflammatory disease of the skin with both genetic and environmental risk factors. Here we describe the creation of a single-nucleotide polymorphism (SNP) map spanning 900-1200 kb of chromosome 3q21, which had been previously recognized as containing a psoriasis susceptibility locus, PSORS5. We genotyped 644 individuals, from 195 Swedish psoriatic families, for 19 polymorphisms. Linkage disequilibrium (LD) between marker and disease was assessed using the transmission/disequilibrium test (TDT). In the TDT analysis, alleles of three of these SNPs showed significant association with disease (P<0.05). A 160-kb interval encompassing these three SNPs was sequenced, and a coding sequence consisting of 13 exons was identified. The predicted protein shares 30-40% homology with the family of cation/chloride cotransporters. A five-marker haplotype spanning the 3' half of this gene is associated with psoriasis to a P value of 3.8<10(-5). We have called this gene SLC12A8, coding for a member of the solute carrier family 12 proteins. It belongs to a class of genes that were previously unrecognized as playing a role in psoriasis pathogenesis.

Highlights from the functional single nucleotide polymorphisms associated with human muscle size and strength or FAMuSS study.

PubMed

Pescatello, Linda S; Devaney, Joseph M; Hubal, Monica J; Thompson, Paul D; Hoffman, Eric P

2013-01-01

The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.

Highlights from the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength or FAMuSS Study

PubMed Central

Pescatello, Linda S.; Devaney, Joseph M.; Hubal, Monica J.; Thompson, Paul D.; Hoffman, Eric P.

2013-01-01

The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity. PMID:24455711

Discovery of 100K SNP array and its utilization in sugarcane

USDA-ARS?s Scientific Manuscript database

Next generation sequencing (NGS) enable us to identify thousands of single nucleotide polymorphisms (SNPs) marker for genotyping and fingerprinting. However, the process requires very precise bioinformatics analysis and filtering process. High throughput SNP array with predefined genomic location co...

Development of genome-wide SNP assays for rice

USDA-ARS?s Scientific Manuscript database

With the introduction of new sequencing technologies, single nucleotide polymorphisms (SNPs) are rapidly replacing simple sequence repeats (SSRs) as the DNA marker of choice for applications in plant breeding and genetics because they are more abundant, stable, amenable to automation, efficient, and...

Large scale variation in DNA copy number in chicken breeds

USDA-ARS?s Scientific Manuscript database

Background Detecting genetic variation is a critical step in elucidating the molecular mechanisms underlying phenotypic diversity. Until recently, such detection has mostly focused on single nucleotide polymorphisms (SNPs) because of the ease in screening complete genomes. Another type of variant, c...

Capturing haplotypes in germplasm core collections

USDA-ARS?s Scientific Manuscript database

Genomewide data sets of single nucleotide polymorphisms (SNPs) offer great potential to improve ex situ conservation. Two factors impede their use for producing core collections. First, due to the large number of SNPs, the assembly of collections that maximize diversity may be intractable using ex...

Marker-assisted backcross approach for important agronomic traits of sorghum

USDA-ARS?s Scientific Manuscript database

Sequencing technologies are useful for identification of thousands of single nucleotide polymorphisms (SNPs) in a cost effective manner. QTL mapping, association mapping and Mutmap approaches provide opportunities for use of such SNPs to associate and identify genes that control important agronomic ...

Single nucleotide polymorphisms in the Mycobacterium bovis genome resolve phylogenetic relationships

USDA-ARS?s Scientific Manuscript database

Mycobacterium bovis isolates carry restricted allelic variation yet exhibit a range of disease phenotypes and host preferences. Conventional genotyping methods target small hyper-variable regions of their genome and provide anonymous biallelic information insufficient to develop phylogeny. To resolv...

HomSI: a homozygous stretch identifier from next-generation sequencing data.

PubMed

Görmez, Zeliha; Bakir-Gungor, Burcu; Sagiroglu, Mahmut Samil

2014-02-01

In consanguineous families, as a result of inheriting the same genomic segments through both parents, the individuals have stretches of their genomes that are homozygous. This situation leads to the prevalence of recessive diseases among the members of these families. Homozygosity mapping is based on this observation, and in consanguineous families, several recessive disease genes have been discovered with the help of this technique. The researchers typically use single nucleotide polymorphism arrays to determine the homozygous regions and then search for the disease gene by sequencing the genes within this candidate disease loci. Recently, the advent of next-generation sequencing enables the concurrent identification of homozygous regions and the detection of mutations relevant for diagnosis, using data from a single sequencing experiment. In this respect, we have developed a novel tool that identifies homozygous regions using deep sequence data. Using *.vcf (variant call format) files as an input file, our program identifies the majority of homozygous regions found by microarray single nucleotide polymorphism genotype data. HomSI software is freely available at www.igbam.bilgem.tubitak.gov.tr/softwares/HomSI, with an online manual.

Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

PubMed Central

Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

2013-01-01

The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

Translating Mendelian and complex inheritance of Alzheimer's disease genes for predicting unique personal genome variants

PubMed Central

Regan, Kelly; Wang, Kanix; Doughty, Emily; Li, Haiquan; Li, Jianrong; Lee, Younghee; Kann, Maricel G

2012-01-01

Objective Although trait-associated genes identified as complex versus single-gene inheritance differ substantially in odds ratio, the authors nonetheless posit that their mechanistic concordance can reveal fundamental properties of the genetic architecture, allowing the automated interpretation of unique polymorphisms within a personal genome. Materials and methods An analytical method, SPADE-gen, spanning three biological scales was developed to demonstrate the mechanistic concordance between Mendelian and complex inheritance of Alzheimer's disease (AD) genes: biological functions (BP), protein interaction modeling, and protein domain implicated in the disease-associated polymorphism. Results Among Gene Ontology (GO) biological processes (BP) enriched at a false detection rate <5% in 15 AD genes of Mendelian inheritance (Online Mendelian Inheritance in Man) and independently in those of complex inheritance (25 host genes of intragenic AD single-nucleotide polymorphisms confirmed in genome-wide association studies), 16 overlapped (empirical p=0.007) and 45 were similar (empirical p<0.009; information theory). SPAN network modeling extended the canonical pathway of AD (KEGG) with 26 new protein interactions (empirical p<0.0001). Discussion The study prioritized new AD-associated biological mechanisms and focused the analysis on previously unreported interactions associated with the biological processes of polymorphisms that affect specific protein domains within characterized AD genes and their direct interactors using (1) concordant GO-BP and (2) domain interactions within STRING protein–protein interactions corresponding to the genomic location of the AD polymorphism (eg, EPHA1, APOE, and CD2AP). Conclusion These results are in line with unique-event polymorphism theory, indicating how disease-associated polymorphisms of Mendelian or complex inheritance relate genetically to those observed as ‘unique personal variants’. They also provide insight for identifying novel targets, for repositioning drugs, and for personal therapeutics. PMID:22319180

Novel Association of WNK4 Gene, Ala589Ser Polymorphism in Essential Hypertension, and Type 2 Diabetes Mellitus in Malaysia.

PubMed

Ghodsian, Nooshin; Ismail, Patimah; Ahmadloo, Salma; Heidari, Farzad; Haghvirdizadeh, Polin; Ataollahi Eshkoor, Sima; Etemad, Ali

2016-01-01

With-no-lysine (K) Kinase-4 (WNK4) consisted of unique serine and threonine protein kinases, genetically associated with an autosomal dominant form of hypertension. Argumentative consequences have lately arisen on the association of specific single nucleotide polymorphisms of WNK4 gene and essential hypertension (EHT). The aim of this study was to determine the association of Ala589Ser polymorphism of WNK4 gene with essential hypertensive patients in Malaysia. WNK4 gene polymorphism was specified utilizing mutagenically separated polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) method in 320 subjects including 163 cases and 157 controls. Close relation between Ala589Ser polymorphism and elevated systolic and diastolic blood pressure (SBP and DBP) was recognized. Sociodemographic factors including body mass index (BMI), age, the level of fasting blood sugar (FBS), low density lipoprotein (LDL), and triglyceride (TG) in the cases and healthy subjects exhibited strong differences (p < 0.05). The distribution of allele frequency and genotype of WNK4 gene Ala589Ser polymorphism showed significant differences (p < 0.05) between EHT subjects with or without type 2 diabetes mellitus (T2DM) and normotensive subjects, statistically. The WNK4 gene variation influences significantly blood pressure increase. Ala589Ser probably has effects on the enzymic activity leading to enhanced predisposition to the disorder.

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

T/T homozygosity of the tenascin-C gene polymorphism rs2104772 negatively influences exercise-induced angiogenesis.

PubMed

Valdivieso, Paola; Toigo, Marco; Hoppeler, Hans; Flück, Martin

2017-01-01

Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise.

T/T homozygosity of the tenascin-C gene polymorphism rs2104772 negatively influences exercise-induced angiogenesis

PubMed Central

Toigo, Marco; Hoppeler, Hans

2017-01-01

Background Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Methods Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Results Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Conclusion Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise. PMID:28384286

Interaction between beta2 adrenergic receptor polymorphisms determines the extent of isoproterenol-induced vasodilatation ex vivo.

PubMed

Khalaila, Jawad M; Elami, Amir; Caraco, Yoseph

2007-10-01

Single nucleotide polymorphisms at nucleotides 46, 79 and 491 of the beta2 adrenergic receptor (beta2AR) gene modify its pharmacological properties and may alter the response to agonists. The purpose of this study was to evaluate the role played by beta2AR polymorphisms on isoproterenol-induced relaxation of internal mammary arteries ex vivo. Internal mammary leftover segments were collected from 96 patients undergoing coronary artery bypass operation. Vascular rings were allowed to reach equilibrium with physiological Krebs solution before precontraction with U46619. Using the organ bath technique, cumulative dose-response curve of isoproterenol was constructed and average EC50 calculated. beta2AR genotyping was performed using a PCR-RFLP analysis. Arterial segments obtained from Gly16 homozygotes displayed reduced sensitivity to isoproterenol compared with carriers of Arg16 allele(s) [Mean (-log) EC50+/-SD, 6.42+/-0.24, 95% confidence interval (CI) 6.32-6.53 vs. 6.67+/-0.25, 95% CI 6.62-6.73, P<0.001]. Among Gly16 homozygotes, the presence of two Glu27 alleles restored vascular response to the level noted among Arg16 carriers (6.58+/-0.17, 95% CI 6.41-6.76). The least response to isoproterenol was noted in a single patient carrying the Gly16Gly-Gln27Glu-Thr164Ile combined genotype requiring almost six-fold higher isoproterenol concentration than carriers of the wild-type genotype to achieve half the maximal arterial dilatation (17.78 x 10(-7) vs. 3.01 x 10(-7) +/- 2.62 x 10(-7) mol/l). Vascular dilatation by isoproterenol is determined by a complex interaction between polymorphisms at nucleotides 46, 79 and 491 of the beta2AR gene. Further studies are warranted to evaluate the effect of additional polymorphisms in the coding and noncoding regions on vascular reactivity.

Integrated Cox's model for predicting survival time of glioblastoma multiforme.

PubMed

Ai, Zhibing; Li, Longti; Fu, Rui; Lu, Jing-Min; He, Jing-Dong; Li, Sen

2017-04-01

Glioblastoma multiforme is the most common primary brain tumor and is highly lethal. This study aims to figure out signatures for predicting the survival time of patients with glioblastoma multiforme. Clinical information, messenger RNA expression, microRNA expression, and single-nucleotide polymorphism array data of patients with glioblastoma multiforme were retrieved from The Cancer Genome Atlas. Patients were separated into two groups by using 1 year as a cutoff, and a logistic regression model was used to figure out any variables that can predict whether the patient was able to live longer than 1 year. Furthermore, Cox's model was used to find out features that were correlated with the survival time. Finally, a Cox model integrated the significant clinical variables, messenger RNA expression, microRNA expression, and single-nucleotide polymorphism was built. Although the classification method failed, signatures of clinical features, messenger RNA expression levels, and microRNA expression levels were figured out by using Cox's model. However, no single-nucleotide polymorphisms related to prognosis were found. The selected clinical features were age at initial diagnosis, Karnofsky score, and race, all of which had been suggested to correlate with survival time. Both of the two significant microRNAs, microRNA-221 and microRNA-222, were targeted to p27 Kip1 protein, which implied the important role of p27 Kip1 on the prognosis of glioblastoma multiforme patients. Our results suggested that survival modeling was more suitable than classification to figure out prognostic biomarkers for patients with glioblastoma multiforme. An integrated model containing clinical features, messenger RNA levels, and microRNA expression levels was built, which has the potential to be used in clinics and thus to improve the survival status of glioblastoma multiforme patients.

A Genome-Wide Association Study of Chronic Obstructive Pulmonary Disease in Hispanics

PubMed Central

Chen, Wei; Brehm, John M.; Manichaikul, Ani; Cho, Michael H.; Boutaoui, Nadia; Yan, Qi; Burkart, Kristin M.; Enright, Paul L.; Rotter, Jerome I.; Petersen, Hans; Leng, Shuguang; Obeidat, Ma’en; Bossé, Yohan; Brandsma, Corry-Anke; Hao, Ke; Rich, Stephen S.; Powell, Rhea; Avila, Lydiana; Soto-Quiros, Manuel; Silverman, Edwin K.; Tesfaigzi, Yohannes; Barr, R. Graham

2015-01-01

Rationale: Genome-wide association studies (GWAS) of chronic obstructive pulmonary disease (COPD) have identified disease-susceptibility loci, mostly in subjects of European descent. Objectives: We hypothesized that by studying Hispanic populations we would be able to identify unique loci that contribute to COPD pathogenesis in Hispanics but remain undetected in GWAS of non-Hispanic populations. Methods: We conducted a metaanalysis of two GWAS of COPD in independent cohorts of Hispanics in Costa Rica and the United States (Multi-Ethnic Study of Atherosclerosis [MESA]). We performed a replication study of the top single-nucleotide polymorphisms in an independent Hispanic cohort in New Mexico (the Lovelace Smokers Cohort). We also attempted to replicate prior findings from genome-wide studies in non-Hispanic populations in Hispanic cohorts. Measurements and Main Results: We found no genome-wide significant association with COPD in our metaanalysis of Costa Rica and MESA. After combining the top results from this metaanalysis with those from our replication study in the Lovelace Smokers Cohort, we identified two single-nucleotide polymorphisms approaching genome-wide significance for an association with COPD. The first (rs858249, combined P value = 6.1 × 10−8) is near the genes KLHL7 and NUPL2 on chromosome 7. The second (rs286499, combined P value = 8.4 × 10−8) is located in an intron of DLG2. The two most significant single-nucleotide polymorphisms in FAM13A from a previous genome-wide study in non-Hispanics were associated with COPD in Hispanics. Conclusions: We have identified two novel loci (in or near the genes KLHL7/NUPL2 and DLG2) that may play a role in COPD pathogenesis in Hispanic populations. PMID:25584925

A genome-wide association study of chronic obstructive pulmonary disease in Hispanics.

PubMed

Chen, Wei; Brehm, John M; Manichaikul, Ani; Cho, Michael H; Boutaoui, Nadia; Yan, Qi; Burkart, Kristin M; Enright, Paul L; Rotter, Jerome I; Petersen, Hans; Leng, Shuguang; Obeidat, Ma'en; Bossé, Yohan; Brandsma, Corry-Anke; Hao, Ke; Rich, Stephen S; Powell, Rhea; Avila, Lydiana; Soto-Quiros, Manuel; Silverman, Edwin K; Tesfaigzi, Yohannes; Barr, R Graham; Celedón, Juan C

2015-03-01

Genome-wide association studies (GWAS) of chronic obstructive pulmonary disease (COPD) have identified disease-susceptibility loci, mostly in subjects of European descent. We hypothesized that by studying Hispanic populations we would be able to identify unique loci that contribute to COPD pathogenesis in Hispanics but remain undetected in GWAS of non-Hispanic populations. We conducted a metaanalysis of two GWAS of COPD in independent cohorts of Hispanics in Costa Rica and the United States (Multi-Ethnic Study of Atherosclerosis [MESA]). We performed a replication study of the top single-nucleotide polymorphisms in an independent Hispanic cohort in New Mexico (the Lovelace Smokers Cohort). We also attempted to replicate prior findings from genome-wide studies in non-Hispanic populations in Hispanic cohorts. We found no genome-wide significant association with COPD in our metaanalysis of Costa Rica and MESA. After combining the top results from this metaanalysis with those from our replication study in the Lovelace Smokers Cohort, we identified two single-nucleotide polymorphisms approaching genome-wide significance for an association with COPD. The first (rs858249, combined P value = 6.1 × 10(-8)) is near the genes KLHL7 and NUPL2 on chromosome 7. The second (rs286499, combined P value = 8.4 × 10(-8)) is located in an intron of DLG2. The two most significant single-nucleotide polymorphisms in FAM13A from a previous genome-wide study in non-Hispanics were associated with COPD in Hispanics. We have identified two novel loci (in or near the genes KLHL7/NUPL2 and DLG2) that may play a role in COPD pathogenesis in Hispanic populations.

Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

PubMed

Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

2017-09-01

It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p < 0.0001), rs34538475 in AMBN (p < 0.0001), rs2337360 in TUFT1 (p < 0.0001), and rs2235091 (p = 0.0085) and rs198969 (p = 0.0069) in KLK4. Genotype and allele frequencies indicated both risk and protective variants for these markers. Single nucleotide polymorphisms in AMELX, AMBN, TUFT1, KLK4 genes may be considered as a risk factor for dental caries occurrence in Polish children.

Examining the role of common genetic variants on alcohol, tobacco, cannabis, and illicit drug dependence

PubMed Central

Palmer, RHC; Brick, L; Nugent, NR; Bidwell, LC; McGeary, JE; Knopik, VS; Keller, MC

2014-01-01

Background and Aims Twin and family studies suggest that genetic influences are shared across substances of abuse. However, despite evidence of heritability, genome-wide association and candidate gene studies have indicated numerous markers of limited effects, suggesting that much of the heritability remains missing. We estimated (1) the aggregate effect of common single nucleotide polymorphisms (SNPs) on multiple indicators of comorbid drug problems that are typically employed across community and population-based samples, and (2) the genetic covariance across these measures. Participants 2596 unrelated subjects from the “Study of Addiction: Genetics and Environment” provided information on alcohol, tobacco, cocaine, cannabis, and other illicit substance dependence. Phenotypic measures included: (1) a factor score based on DSM-IV drug dependence diagnoses (DD), (2) a factor score based on problem use (PU; i.e., 1+ DSM-IV symptoms), and (3) dependence vulnerability (DV; a ratio of DSM-IV symptoms to the number of substances used). Findings Univariate and bivariate Genome-wide complex trait analyses of this selected sample indicated that common SNPs explained 25-36% of the variance across measures, with DD and DV having the largest effects [h2SNP (CI)=0.36 (0.11-0.62) and 0.33(0.07-0.58), respectively; PU = 0.25 (-0.01-0.51)]. Genetic effects were shared across the three phenotypic measures of comorbid drug problems (rSNP; rDD-PU = 0.92 (0.76-1.00), rDD-DV = 0.97 (0.87-1.00), and rPU-DV = 0.96 (0.82-1.00)). Conclusion At least 20% of the variance in the generalized vulnerability to substance dependence is attributable to common single nucleotide polymorphisms. The additive effect of common single nucleotide polymorphisms is shared across important indicators of comorbid drug problems. PMID:25424661

An EPAS1 haplotype is associated with high altitude polycythemia in male Han Chinese at the Qinghai-Tibetan plateau.

PubMed

Chen, Yu; Jiang, Chunhua; Luo, Yongjun; Liu, Fuyu; Gao, Yuqi

2014-12-01

Hemoglobin concentration at high altitude is considered an important marker of high altitude adaptation, and native Tibetans in the Qinghai-Tibetan plateau show lower hemoglobin concentrations than Han people who have emigrated from plains areas. Genetic studies revealed that EPAS1 plays a key role in high altitude adaptation and is associated with the low hemoglobin concentration in Tibetans. Three single nucleotide polymorphisms (rs13419896, rs4953354, rs1868092) of noncoding regions in EPAS1 exhibited significantly different allele frequencies in the Tibetan and Han populations and were associated with low hemoglobin concentrations in Tibetans. To explore the hereditary basis of high altitude polycythemia (HAPC) and investigate the association between EPAS1 and HAPC in the Han population, these 3 single nucleotide polymorphisms were assessed in 318 male Han Chinese HAPC patients and 316 control subjects. Genotyping was performed by high resolution melting curve analysis. The G-G-G haplotype of rs13419896, rs4953354, and rs1868092 was significantly more frequent in HAPC patients than in control subjects, whereas no differences in the allele or genotype frequencies of the 3 single nucleotide polymorphisms were found between HAPC patients and control subjects. Moreover, genotypes of rs1868092 (AA) and rs4953354 (GG) that were not observed in the Chinese Han in the Beijing population were found at frequencies of 1.6% and 0.9%, respectively, in our study population of HAPC patients and control subjects. Carriers of this EPAS1 haplotype (G-G-G, rs13419896, rs4953354, and rs1868092) may have a higher risk for HAPC. These results may contribute to a better understanding of the pathogenesis of HAPC in the Han population. Copyright © 2014 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

A map of single nucleotide polymorphisms of the date palm (Phoenix dactylifera) based on whole genome sequencing of 62 varieties

USDA-ARS?s Scientific Manuscript database

Date palm is one of the few crop species that thrive in arid environments and are the most significant fruit crop in the Middle East and North Africa, but lacks genomic resources that can accelerate breeding efforts. Here, we present the first comprehensive catalogue of ~12 million common single nuc...

A single nucleotide polymorphism in COQ9 affects mitochondrial and ovarian function and fertility in Holstein cows

USDA-ARS?s Scientific Manuscript database

A single missense mutation at position 159 of COQ9 (GàA) has been associated with genetic variation in fertility in Holstein cattle, with the A allele associated with higher fertility. COQ9 is involved in the synthesis of coenzyme COQ10, a component of the electron transport system of the mitochondr...

Use of single-nucleotide polymorphisms (SNPs) to distinguish gene expression subtypes of chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME).

PubMed

Shimosako, Nana; Kerr, Jonathan R

2014-12-01

We have reported gene expression changes in patients with chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) and the fact that such gene expression data can be used to identify subtypes of CFS/ME with distinct clinical phenotypes. Due to the difficulties in using a comparative gene expression method as an aid to CFS/ME disease and subtype-specific diagnosis, we have attempted to develop such a method based on single-nucleotide polymorphism (SNP) analysis. To identify SNP allele associations with CFS/ME and CFS/ME subtypes, we tested genomic DNA of patients with CFS/ME (n=108), patients with endogenous depression (n=17) and normal blood donors (n=68) for 504 human SNP alleles located within 88 CFS-associated human genes using the SNP Genotyping GoldenGate Assay (Illumina, San Diego, California, USA). 360 ancestry informative markers (AIM) were also examined. 21 SNPs were significantly associated with CFS/ME compared with depression and normal groups. 148 SNP alleles had a significant association with one or more CFS/ME subtypes. For each subtype, associated SNPs tended to be grouped together within particular genes. AIM SNPs indicated that 4 subjects were of Asian origin while the remainder were Caucasian. Hierarchical clustering of AIM data revealed the relatedness between 2 couples of patients with CFS only and confirmed the overall heterogeneity of all subjects. This study provides evidence that human SNPs located within CFS/ME associated genes are associated with particular genomic subtypes of CFS/ME. Further work is required to develop this into a clinically useful subtype-specific diagnostic test. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Chemiluminescence resonance energy transfer imaging on magnetic particles for single-nucleotide polymorphism detection based on ligation chain reaction.

PubMed

Bi, Sai; Zhang, Zhipeng; Dong, Ying; Wang, Zonghua

2015-03-15

A novel ligation chain reaction (LCR) methodology for single-nucleotide polymorphism (SNP) detection was developed based on luminol-H2O2-horseradish peroxidase (HRP)-mimicking DNAzyme-fluorescein chemiluminescence resonance energy transfer (CRET) imaging on magnetic particles. For LCR, four unique target-complement probes (X and X(⁎), YG and Y(⁎)) for the amplification of K-ras (G12C) were designed by modifying G-quadruplex sequence at 3'-end of YG and fluorescein at 5'-end of Y(⁎). After the LCR, the resulting products of XYG/X(⁎)Y(⁎) with biotin-labeled X(⁎) were captured onto streptavidin-coated magnetic particles (SA-MPs) via specific biotin-SA interaction, which stimulated the CRET reaction from hemin/G-quadruplex-catalyzed luminol-H2O2 CL system to fluorescein. By collecting signals by a cooled low-light CCD, a CRET imaging method was proposed for visual detection and quantitative analysis of SNP. As low as 0.86fM mutant DNA was detected by this assay, and positive mutation detection was achieved with a wild-type to mutant ratio of 10,000:1. This high sensitivity and specificity could be attributed to not only the exponential amplification and excellent discrimination of LCR but also the employment of SA-MPs. SA-MPs ensured the feasibility of the proposed strategy, which also simplified the operations through magnetic separation and separated the reaction and detection procedures to improve sensitivity. The proposed LCR-CRET imaging strategy extends the application of signal amplification techniques to SNP detection, providing a promising platform for effective and high-throughput genetic diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

Genetic evaluations of Chinese patients with odontohypophosphatasia resulting from heterozygosity for mutations in the tissue-non-specific alkaline phosphatase gene.

PubMed

Wan, Jia; Zhang, Li; Liu, Tang; Wang, Yewei

2017-08-01

Hypophosphatasia is a rare heritable metabolic disorder characterized by defective bone and tooth mineralization accompanied by a deficiency of tissue-non-specific (liver/bone/kidney) isoenzyme of alkaline phosphatase activity, caused by a number of loss-of-function mutations in the alkaline phosphatase liver type gene. We seek to explore the clinical manifestations and identify the mutations associated with the disease in a Chinese odonto- hypophosphatasia family. The proband and his younger brother affected with premature loss of primary teeth at their 2-year-old. They have mild abnormal serum alkaline phosphatase and 25-hydroxy vitamin D values, but the serum alkaline phosphatase activity of their father, mother and grandmother, who showed no clinical symptoms of hypophosphatasia, was exhibited significant decreased. In addition to premature loss of primary teeth, the proband and his younger brother showed low bone mineral density, X-rays showed that they had slight metaphyseal osteoporosis changes, but no additional skeletal abnormalities. Deoxyribonucleic acid sequencing and analysis revealed a single nucleotide polymorphism c.787T>C (p.Y263H) in exon 7 and/or a novel mutation c.-92C>T located at 5'UTR were found in the affected individuals. We examined all individuals of an odonto- hypophosphatasia family by clinical and radiographic examinations as well as laboratory assays. Furthermore, all 12 exons and the exon-intron boundaries of the alkaline phosphatase liver type gene were amplified and directly sequenced for further analysis and screened for mutations. Our present findings suggest the single nucleotide polymorphism c.787T>C and c.-92C>T should be responsible for the odonto- hypophosphatasia disorders in this family.

A High-Throughput Data Mining of Single Nucleotide Polymorphisms in Coffea Species Expressed Sequence Tags Suggests Differential Homeologous Gene Expression in the Allotetraploid Coffea arabica1[W

PubMed Central

Vidal, Ramon Oliveira; Mondego, Jorge Maurício Costa; Pot, David; Ambrósio, Alinne Batista; Andrade, Alan Carvalho; Pereira, Luiz Filipe Protasio; Colombo, Carlos Augusto; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães

2010-01-01

Polyploidization constitutes a common mode of evolution in flowering plants. This event provides the raw material for the divergence of function in homeologous genes, leading to phenotypic novelty that can contribute to the success of polyploids in nature or their selection for use in agriculture. Mounting evidence underlined the existence of homeologous expression biases in polyploid genomes; however, strategies to analyze such transcriptome regulation remained scarce. Important factors regarding homeologous expression biases remain to be explored, such as whether this phenomenon influences specific genes, how paralogs are affected by genome doubling, and what is the importance of the variability of homeologous expression bias to genotype differences. This study reports the expressed sequence tag assembly of the allopolyploid Coffea arabica and one of its direct ancestors, Coffea canephora. The assembly was used for the discovery of single nucleotide polymorphisms through the identification of high-quality discrepancies in overlapped expressed sequence tags and for gene expression information indirectly estimated by the transcript redundancy. Sequence diversity profiles were evaluated within C. arabica (Ca) and C. canephora (Cc) and used to deduce the transcript contribution of the Coffea eugenioides (Ce) ancestor. The assignment of the C. arabica haplotypes to the C. canephora (CaCc) or C. eugenioides (CaCe) ancestral genomes allowed us to analyze gene expression contributions of each subgenome in C. arabica. In silico data were validated by the quantitative polymerase chain reaction and allele-specific combination TaqMAMA-based method. The presence of differential expression of C. arabica homeologous genes and its implications in coffee gene expression, ontology, and physiology are discussed. PMID:20864545