Sample records for spectrum indicators cd

  1. Vibronic coupling effect on circular dichroism spectrum: Carotenoid-retinal interaction in xanthorhodopsin

    NASA Astrophysics Data System (ADS)

    Fujimoto, Kazuhiro J.; Balashov, Sergei P.

    2017-03-01

    The role of vibronic coupling of antenna carotenoid and retinal in xanthorhodopsin (XR) in its circular dichroism (CD) spectrum is examined computationally. A vibronic exciton model combined with a transition-density-fragment interaction (TDFI) method is developed, and applied to absorption and CD spectral calculations of XR. The TDFI method is based on the electronic Coulomb and exchange interactions between transition densities for individual chromophores [K. J. Fujimoto, J. Chem. Phys. 137, 034101 (2012)], which provides a quantitative description of electronic coupling energy. The TDFI calculation reveals a dominant contribution of the Coulomb interaction to the electronic coupling energy and a negligible contribution of the exchange interaction, indicating that the antenna function of carotenoid results from the Förster type of excitation-energy transfer, not from the Dexter one. The calculated absorption and CD spectra successfully reproduce the main features of the experimental results, which allow us to investigate the mechanism of biphasic CD spectrum observed in XR. The results indicate that vibronic coupling between carotenoid and retinal plays a significant role in the shape of the CD spectrum. Further analysis reveals that the negative value of electronic coupling directly contributes to the biphasic shape of CD spectrum. This study also reveals that the C6—C7 bond rotation of salinixanthin is not the main factor for the biphasic CD spectrum although it gives a non-negligible contribution to the spectral shift. The present method is useful for analyzing the molecular mechanisms underlying the chromophore-chromophore interactions in biological systems.

  2. Communication Deviance in parents of families with adoptees at a high or low risk of schizophrenia-spectrum disorders and its associations with attributes of the adoptee and the adoptive parents.

    PubMed

    Roisko, Riikka; Wahlberg, Karl-Erik; Hakko, Helinä; Wynne, Lyman; Tienari, Pekka

    2011-01-30

    Communication Deviance (CD) in rearing parents is a known indicator of a psychopathology risk in the offspring, but the direction of the effects of these two factors on each other has remained an unresolved question. The purpose of the present study was to clarify this issue by assessing the relationship of CD in adoptive parents with certain attributes of the adoptee and adoptive parents themselves. The subjects were 109 adoptees at a high or low risk of schizophrenia-spectrum disorders and their adoptive parents. Communication Deviance was measured in individual, spouse and family Rorschach situations. Thought disorders in the adoptees were assessed using the Thought Disorder Index. The variability of CD in the adoptive parents in individual Rorschach situations was not significantly explained by any characteristics of the child. The variability in parental CD in family Rorschach situations was most closely associated with the characteristics of the parents themselves. The results strongly support the hypotheses that the frequency of Communication Deviance is an enduring trait rather than a fluctuating state and that frequent CD in parent's speech may impair the growing child's cognitive development and predispose him/her to schizophrenia-spectrum disorders. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. Association of adoptive child's thought disorders and schizophrenia spectrum disorders with their genetic liability for schizophrenia spectrum disorders, season of birth and parental Communication Deviance.

    PubMed

    Roisko, Riikka; Wahlberg, Karl-Erik; Hakko, Helinä; Tienari, Pekka

    2015-04-30

    Joint effects of genotype and the environment have turned out to be significant in the development of psychotic disorders. The purpose of the present study was to assess the association of an adoptive child׳s thought and schizophrenia spectrum disorders with genetic and environmental risk indicators and their interactions. A subgroup of the total sample used in the Finnish Adoptive Family Study was considered in the present study. The subjects were 125 adoptees at a high (n=53) or low (n=72) genetic risk of schizophrenia spectrum disorders and their adoptive parents. The risk factors evaluated were the adoptive child's genetic risk for schizophrenia spectrum disorders, winter or spring birth and parental Communication Deviance (CD). Thought disorders in the adoptees were assessed using the Thought Disorder Index and diagnoses were made according to DSM-III-R criteria. The adoptive child׳s Thought Disorder Index was only associated with parental Communication Deviance. The adoptive child's heightened genetic risk or winter or spring birth or parental CD or their interactions did not predict the adoptee's schizophrenia spectrum disorder. The results suggest that studies taking several risk indicators and their interactions into account may change views on the mutual significance of well-known risk factors. Copyright © 2015. Published by Elsevier Ireland Ltd.

  4. Biosynthesis of CdS nanoparticles in banana peel extract.

    PubMed

    Zhou, Guang Ju; Li, Shuo Hao; Zhang, Yu Cang; Fu, Yun Zhi

    2014-06-01

    Cadmium sulfide (CdS) nanoparticles (NPs) were synthesized by using banana peel extract as a convenient, non-toxic, eco-friendly 'green' capping agent. Cadmium nitrate and sodium sulfide are main reagents. A variety of CdS NPs are prepared through changing reaction conditions (banana extracts, the amount of banana peel extract, solution pH, concentration and reactive temperature). The prepared CdS colloid displays strong fluorescence spectrum. X-ray diffraction analysis demonstrates the successful formation of CdS NPs. Fourier transform infra-red (FTIR) spectrogram indicates the involvement of carboxyl, amine and hydroxyl groups in the formation of CdS NPs. Transmission electron microscope (TEM) result reveals that the average size of the NPs is around 1.48 nm.

  5. The effect of Pb addition on the morphology of CdSe quantum dot

    NASA Astrophysics Data System (ADS)

    Kim, Young-Kuk; Cho, Young-Sang; Chung, Kookchae; Choi, Chul-Jin

    2010-08-01

    CdSe quantum dots had been synthesized with a hot injection method. It was shown that the addition of Pb ions in the initial precursor solution changed the morphology of CdSe nanocrystals from slightly prolate ellipsoid to branched rod. Photoluminescence (PL) of the branched nanocrystals showed rapid depression of emission intensity due to the morphological development to the branched nanocrystal induced by Pb addition. Low temperature PL spectrum indicated that the surface recombination of charge carrier resulted in the large depression of emission from the branched nanocrystal.

  6. Synthesis and spectral characterizations of trivalent ions (Cr3+, Fe3+) doped CdO nanopowders

    NASA Astrophysics Data System (ADS)

    Aswani, T.; Babu, B.; Pushpa Manjari, V.; Joyce Stella, R.; Thirumala Rao, G.; Rama Krishna, Ch.; Ravikumar, R. V. S. S. N.

    2014-03-01

    Trivalent transition metal ions (Cr3+, Fe3+) doped CdO nanopowders via sonication in the presence of Sodium lauryl sulfate as stabilizing agent were synthesized and characterized. Powder XRD studies indicate that the obtained CdO has a cubic phase and concluded that the trivalent ions doping induced the lattice constants to change some extent. Optical absorption spectra exhibited the characteristic bands of Cr3+ and Fe3+ ions in octahedral site symmetry. Crystal field (Dq) and inter-electronic repulsion (B and C) parameters are evaluated for Cr3+ doped CdO nanopowders as Dq = 1540, B = 619 and C = 3327 cm-1 and for Fe3+ doped CdO nanopowders Dq = 920, B = 690, C = 2750 cm-1. EPR spectra of the Cr3+ and Fe3+ doped CdO nanopowders exhibited resonances at g = 1.973 and g = 2 respectively which indicate distorted octahedral site for both ions with the host. Photoluminescence spectra shows the emission bands in violet and bluish green regions for Cr3+ doped CdO, ultraviolet and blue emissions for Fe3+ doped CdO nanopowders. The CIE chromaticity coordinates were also evaluated from the emission spectrum. FT-IR spectra indicate the presence of various functional groups of host lattice.

  7. Synthesis and Use of [Cd(Detu)2(OOCCH3)2]·H2O as Single Molecule Precursor for Cds Nanoparticles

    PubMed Central

    Ajibade, Peter A.

    2013-01-01

    Substituted thiourea ligands are of interest because they possess various donor sites for metal ions and their application in separation of metal ions and as antimicrobial agents. The coordination of the sulfur donor atom led to interest in them as precursor for semiconductor nanoparticles. In this study, cadmium(II) complex of diethylthiourea was synthesized and characterized by elemental analysis, FTIR, and X-ray crystallography. Single crystal X-ray structure of the complex showed that the octahedral geometry around the Cd ion consists of two molecules of diethylthiourea acting as monodentate ligands and two chelating acetate ions. The thermal decomposition of the compound showed that it decomposed to give CdS. The compound was thermolysed in hexadecylamine (HDA) to prepare HDA-capped CdS nanoparticles. The absorption spectrum showed blue shifts in its absorption band edges which clearly indicated quantum confinement effect, and the emission spectrum showed characteristic band edge luminescence. The broad diffraction peaks of the XRD pattern showed the materials to be of the nanometric size. PMID:24294141

  8. Preparation, characterization, and thermal stability of β-cyclodextrin/soybean lecithin inclusion complex.

    PubMed

    Wang, Xinge; Luo, Zhigang; Xiao, Zhigang

    2014-01-30

    β-Cyclodextrin (β-CD), which is widely used to increase the stability, solubility, and bioavailability of guests, can form host-guest inclusion complexes with a wide variety of organic molecules. In this study the β-CD/soybean lecithin inclusion complex was prepared. The effect of reaction parameters such as reaction temperature, reaction time and the molar ratio of β-CD/soybean lecithin on inclusion ratio were studied. The inclusion ratio of the product prepared under the optimal conditions of β-CD/soybean lecithin molar ratio 2:1, reaction temperature 60°C reaction time 2h was 40.2%. The results of UV-vis, DSC, XRD and FT-IR spectrum indicated the formation of inclusion complex. The thermal stability experiment indicated that the thermal stability of soybean lecithin in inclusion complex was significantly improved compared with free soybean lecithin. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. The influence of annealing temperature on the interface and photovoltaic properties of CdS/CdSe quantum dots sensitized ZnO nanorods solar cells.

    PubMed

    Qiu, Xiaofeng; Chen, Ling; Gong, Haibo; Zhu, Min; Han, Jun; Zi, Min; Yang, Xiaopeng; Ji, Changjian; Cao, Bingqiang

    2014-09-15

    Arrays of ZnO/CdS/CdSe core/shell nanocables with different annealing temperatures have been investigated for CdS/CdSe quantum dots sensitized solar cells (QDSSCs). CdS/CdSe quantum dots were synthesized on the surface of ZnO nanorods that serve as the scaffold via a simple ion-exchange approach. The uniform microstructure was verified by scanning electron microscope and transmission electron microscope. UV-Visible absorption spectrum and Raman spectroscopy analysis indicated noticeable influence of annealing temperature on the interface structural and optical properties of the CdS/CdSe layers. Particularly, the relationship between annealing temperatures and photovoltaic performance of the corresponding QDSSCs was investigated employing photovoltaic conversion, quantum efficiency and electrochemical impedance spectra. It is demonstrated that higher cell efficiency can be obtained by optimizing the annealing temperature through extending the photoresponse range and improving QD layer crystal quality. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Cadmium sulfide thin films growth by chemical bath deposition

    NASA Astrophysics Data System (ADS)

    Hariech, S.; Aida, M. S.; Bougdira, J.; Belmahi, M.; Medjahdi, G.; Genève, D.; Attaf, N.; Rinnert, H.

    2018-03-01

    Cadmium sulfide (CdS) thin films have been prepared by a simple technique such as chemical bath deposition (CBD). A set of samples CdS were deposited on glass substrates by varying the bath temperature from 55 to 75 °C at fixed deposition time (25 min) in order to investigate the effect of deposition temperature on CdS films physical properties. The determination of growth activation energy suggests that at low temperature CdS film growth is governed by the release of Cd2+ ions in the solution. The structural characterization indicated that the CdS films structure is cubic or hexagonal with preferential orientation along the direction (111) or (002), respectively. The optical characterization indicated that the films have a fairly high transparency, which varies between 55% and 80% in the visible range of the optical spectrum, the refractive index varies from 1.85 to 2.5 and the optical gap value of which can reach 2.2 eV. It can be suggested that these properties make these films perfectly suitable for their use as window film in thin films based solar cells.

  11. Time-resolved photoluminescence study of CdSe/CdMnS/CdS core/multi-shell nanoplatelets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murphy, J. R.; Department of Physics, State University of New York, University at Buffalo, Buffalo, New York 14260; Delikanli, S.

    2016-06-13

    We used photoluminescence spectroscopy to resolve two emission features in CdSe/CdMnS/CdS and CdSe/CdS core/multi-shell nanoplatelet heterostructures. The photoluminescence from the magnetic sample has a positive circular polarization with a maximum centered at the position of the lower energy feature. The higher energy feature has a corresponding signature in the absorption spectrum; this is not the case for the low-energy feature. We have also studied the temporal evolution of these features using a pulsed-excitation/time-resolved photoluminescence technique to investigate their corresponding recombination channels. A model was used to analyze the temporal dynamics of the photoluminescence which yielded two distinct timescales associated withmore » these recombination channels. The above results indicate that the low-energy feature is associated with recombination of electrons with holes localized at the core/shell interfaces; the high-energy feature, on the other hand, is excitonic in nature with the holes confined within the CdSe cores.« less

  12. All-trans Retinoic Acid Upregulates Reduced CD38 Transcription in Lymphoblastoid Cell Lines from Autism Spectrum Disorder

    PubMed Central

    Riebold, Mathias; Mankuta, David; Lerer, Elad; Israel, Salomon; Zhong, Songfa; Nemanov, Luba; Monakhov, Mikhail V; Levi, Shlomit; Yirmiya, Nurit; Yaari, Maya; Malavasi, Fabio; Ebstein, Richard P

    2011-01-01

    Deficits in social behavior in mice lacking the CD38 gene have been attributed to impaired secretion of oxytocin. In humans, similar deficits in social behavior are associated with autistic spectrum disorder (ASD), for which genetic variants of CD38 have been pinpointed as provisional risk factors. We sought to explore, in an in vitro model, the feasibility of the theory that restoring the level of CD38 in ASD patients could be of potential clinical benefit. CD38 transcription is highly sensitive to several cytokines and vitamins. One of these, all-trans retinoic acid (ATRA), a known inducer of CD38, was added during cell culture and tested on a large sample of N = 120 lymphoblastoid cell (LBC) lines from ASD patients and their parents. Analysis of CD38 mRNA levels shows that ATRA has an upmodulatory potential on LBC derived from ASD patients as well as from their parents. The next crucial issue addressed in our study was the relationship between levels of CD38 expression and psychological parameters. The results obtained indicate a positive correlation between CD38 expression levels and patient scores on the Vineland Adaptive Behavior Scale. In addition, analysis of the role of genetic polymorphisms in the dynamics of the molecule revealed that the genotype of a single-nucleotide polymorphism (rs6449182; C>G variation) in the CpG island of intron 1, harboring the retinoic-acid response element, exerts differential roles in CD38 expression in ASD and in parental LBC. In conclusion, our results provide an empirical basis for the development of a pharmacological ASD treatment strategy based on retinoids. PMID:21528155

  13. EPR hyperfine structure of the Mo-related defect in CdWO4

    NASA Astrophysics Data System (ADS)

    Elsts, E.; Rogulis, U.

    2005-01-01

    The hyperfine structure (hf) of the electron paramagnetic resonance (EPR) spectrum of Mo-related impurity defects in CdWO4 crystals observed previously (U. Rogulis, Radiat. Meas. 29, 287 (1998) [1]) is reconsidered taking into account interactions with two different groups of neighbouring Cd nuclei. The best fit calculated EPR spectrum to the experimental is obtained considering 2 groups of 3 and 2 equivalent Cd nuclei, respectively.

  14. Simple and green synthesis of protein-conjugated CdS nanoparticles and spectroscopic study on the interaction between CdS and zein

    NASA Astrophysics Data System (ADS)

    Qin, Dezhi; Zhang, Li; Du, Xian; Wang, Yabo; Zhang, Qiuxia

    2016-09-01

    The present study demonstrates the role of zein molecules in synthesizing CdS nanoassemblies through protein-directed, green synthetic approach. Zein molecules can as capping ligand and stabilizing agent to regulate the nucleation and growth of CdS nanocrystals, and the obtained products are organic-inorganic nanocomposites. The analysis of surface charge and conductivity indicates that strong electrostatic force restricts mobility of ions, which creates a local supersaturation surrounding the binding sites of zein and reduces the activated energy of nucleation. The interaction between Cd2+/CdS and zein molecules was systematically investigated through spectroscopy techniques. Fourier transform infrared (FT-IR) spectra were used to envisage the binding of the functional groups of zein with the surface of CdS nanoparticles. Ultraviolet visible (UV-Vis) and photoluminescence (PL) spectra results show that Cd2+/CdS might interact with the aromatic amino acids of protein molecules and change its chemical microenvironment. The quantum-confined effect of nanocrystals is confirmed by optical absorption spectrum due to the small size (3-5 nm) of CdS particles. The data of circular dichroism (CD) spectra indicate that the formation of CdS nanocrystals could lead to the conformational change of zein molecules. Moreover, the possible mechanism of CdS nanocrystals growth in zein solution was also discussed. The weak interactions such as Van der Waals, hydrophobic forces and hydrogen bonds in zein molecules should play a crucial factor in the self-assembly of small nanoparticles.

  15. Infrared absorption spectrum of the simplest deuterated Criegee intermediate CD{sub 2}OO

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Yu-Hsuan; Nishimura, Yoshifumi; Witek, Henryk A., E-mail: hwitek@mail.nctu.edu.tw, E-mail: yplee@mail.nctu.edu.tw

    We report a transient infrared (IR) absorption spectrum of the simplest deuterated Criegee intermediate CD{sub 2}OO recorded using a step-scan Fourier-transform spectrometer coupled with a multipass absorption cell. CD{sub 2}OO was produced from photolysis of flowing mixtures of CD{sub 2}I{sub 2}, N{sub 2}, and O{sub 2} (13 or 87 Torr) with laser light at 308 nm. The recorded spectrum shows close structural similarity with the spectrum of CH{sub 2}OO reported previously [Y.-T. Su et al., Science 340, 174 (2013)]. The four bands observed at 852, 1017, 1054, and 1318 cm{sup −1} are assigned to the OO stretching mode, two distinctmore » in-plane OCD bending modes, and the CO stretching mode of CD{sub 2}OO, respectively, according to vibrational wavenumbers, IR intensities, rotational contours, and deuterium-isotopic shifts predicted with extensive quantum-chemical calculations. The CO-stretching mode of CD{sub 2}OO at 1318 cm{sup −1} is blue shifted from the corresponding band of CH{sub 2}OO at 1286 cm{sup −1}; this can be explained by a mechanism based on mode mixing and isotope substitution. A band near 936 cm{sup −1}, observed only at higher pressure (87 Torr), is tentatively assigned to the CD{sub 2} wagging mode of CD{sub 2}IOO.« less

  16. Theoretical Investigation of Single-Molecule Sensing Using Nanotube-Enhanced Circular Dichroism.

    PubMed

    Silva, Jaime; Milne, Bruce F; Nogueira, Fernando

    2018-06-19

    First-principles calculations have been used to investigate the potential use of circular dichroism (CD) spectroscopy in single-molecule sensing. Using a real-space implementation of time-dependent density functional theory (TDDFT), several systems involving single-walled carbon nanotubes (SWCNT) and small molecules have been studied to evaluate their CD response. Large induced CD (ICD) effects, differing for each test molecule, were observed in all SWCNT-molecule complexes. As the SWCNT used in this study shows no intrinsic CD response, the ICD spectra are the result of interaction with the small molecules. This finding is general and independent of the (a)chiral nature of the adsorbed molecule. Our results indicate that it is possible to design a system that uses SWCNT for detection of molecules using the change in CD spectrum of the system induced by adsorption of the molecule onto the SWCNT surface.

  17. Hydrothermal growth of TiO2 nanowire membranes sensitized with CdS quantum dots for the enhancement of photocatalytic performance

    PubMed Central

    2014-01-01

    In this paper, TiO2 nanowires (NWs) on Ti foils were prepared using a simple hydrothermal approach and annealing treatment. CdS quantum dots (QDs) were assembled onto the crystallized TiO2 NWs by sequential chemical bath deposition. Ultraviolet-visible absorption spectra showed that CdS adds bands in the visible to the TiO2 absorption and exhibited a broad absorption band in the visible region, which extended the scope of absorption spectrum and helped improve the photocatalytic degradation efficiency. The results of photocatalytic experiment revealed that CdS-TiO2 NWs possessed higher photocatalytic activities toward methyl orange than pure TiO2 nanowires. The degradation efficiency of 96.32% after ten cycles indicated that the as-prepared CdS-TiO2 composite exhibited excellent long-time recyclable ability and can be reused for the degradation of contaminants. PMID:24936164

  18. Multipronged CD4 T cell effector and memory responses cooperate to provide potent immunity against respiratory virus

    PubMed Central

    Strutt, Tara M.; McKinstry, K. Kai; Marshall, Nikki B.; Vong, Allen M.; Dutton, Richard W.; Swain, Susan L.

    2014-01-01

    Summary Over the last decade, the known spectrum of CD4 T cell effect or subsets has become much broader and it has become clear that there are multiple dimensions by which subsets with a particular cytokine commitment can be further defined, including their stage of differentiation, their location and most importantly, their ability to carryout discrete functions. Here we focus on our studies that highlight the synergy among discrete subsets, especially those defined by helper and cytotoxic function, in mediating viral protection and on distinctions between CD4 T cell effectors located in spleen, draining lymph node, and in tissue sites of infection. What emerges is a surprising multiplicity of CD4 T cell functions that indicate a large arsenal of mechanisms by which CD4 T cells act to combat viruses. PMID:23947353

  19. Spectroscopic manifestations of hybrid association of CdS colloidal quantum dots with J-aggregates of a thiatrimethine cyanine dye

    NASA Astrophysics Data System (ADS)

    Ovchinnikov, O. V.; Smirnov, M. S.; Shapiro, B. I.; Dedikova, A. O.; Shatskikh, T. S.

    2015-11-01

    We have found spectroscopic manifestations of hybrid association in mixtures of CdS colloidal quantum dots with an average size of 2.5-4.2 nm with J-aggregates of pyridinium salt of the 3,3'-di-(γ- sulfopropyl)-9-ethyl-4,5,4',5'-dibenzo-thiacarbocyanine betaine dye that were prepared by the sol-gel method in gelatin. Observed changes of the spectral properties of J-aggregates of dye molecules due to their hybrid association with CdS quantum dots are ensured by steric transformations of dye molecules, which lead to the formation of luminescent trans-J-aggregates. The hybrid association is accompanied by the quenching of the recombination luminescence band of CdS quantum dots (540-640 nm) and by an increase in the luminescence intensity of J-aggregates of dye molecules (670-680 nm). This regularity becomes enhanced with an increase in the ratio of the number of dye molecules to the number of quantum dots [ n dye]: [ n QD] and in the degree of overlap between the luminescence spectrum of quantum dots and the absorption spectrum of J-aggregates, which indicates that there is a resonant nonradiative transfer of the electronic excitation energy from recombination luminescence centers in CdS quantum dots to trans-J-aggregates of dye molecules conjugated to them.

  20. Circular dichroism studies of the mitochondrial channel, VDAC, from Neurospora crassa.

    PubMed Central

    Shao, L; Kinnally, K W; Mannella, C A

    1996-01-01

    The protein that forms the voltage-gated channel VDAC (or mitochondrial porin) has been purified from Neurospora crassa. At room temperature and pH 7, the circular dichoism (CD) spectrum of VDAC suspended in octyl beta-glucoside is similar to those of bacterial porins, consistent with a high beta-sheet content. When VDAC is reconstituted into phospholipid liposomes at pH 7, a similar CD spectrum is obtained and the liposomes are rendered permeable to sucrose. Heating VDAC in octyl beta-glucoside or in liposomes results in thermal denaturation. The CD spectrum irreversibly changes to one consistent with total loss of beta-sheet content, and VDAC-containing liposomes irreversibly lose sucrose permeability. When VDAC is suspended at room temperature in octyl beta-glucoside at pH < 5 or in sodium dodecyl sulfate at pH 7, its CD spectrum is consistent with partial loss of beta-sheet content. The sucrose permeability of VDAC-containing liposomes is decreased at low pH and restored at pH 7. Similarly, the pH-dependent changes in the CD spectrum of VDAC suspended in octyl beta-glucoside also are reversible. These results suggest that VDAC undergoes a reversible conformational change at low pH involving reduced beta-sheet content and loss of pore-forming activity. Images FIGURE 1 PMID:8842216

  1. Differentiating children with attention-deficit/hyperactivity disorder, conduct disorder, learning disabilities and autistic spectrum disorders by means of their motor behavior characteristics.

    PubMed

    Efstratopoulou, Maria; Janssen, Rianne; Simons, Johan

    2012-01-01

    The study was designed to investigate the discriminant validity of the Motor Behavior Checklist (MBC) for distinguishing four group of children independently classified with Attention-Deficit/Hyperactivity Disorder, (ADHD; N=22), Conduct Disorder (CD; N=17), Learning Disabilities (LD; N=24) and Autistic Spectrum Disorders (ASD; N=20). Physical education teachers used the MBC for children to rate their pupils based on their motor related behaviors. A multivariate analysis revealed significant differences among the groups on different problem scales. The results indicated that the MBC for children may be effective in discriminating children with similar disruptive behaviors (e.g., ADHD, CD) and autistic disorders, based on their motor behavior characteristics, but not children with Learning Disabilities (LD), when used by physical education teachers in school settings. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Proflavine binding to poly(rC-rA) inverts the CD spectrum but not the helix handedness.

    PubMed

    Westhof, E; Sundaralingam, M

    1984-08-01

    The interaction of proflavine hemisulfate with the sodium salt of poly(rC-rA) in solution (unbuffered) yields an inverted (mirror-like) circular dichroism (CD) spectrum to that of the free poly(rC-rA). Simultaneously, an induced negative Cotton effect appears in the proflavine band region with a maximum at 467 nm and a slight shoulder at 420 nm. This observation may be explained as resulting from the formation of a poly(rC-rA).proflavine complex with the polynucleotide existing as a right-handed parallel chain duplex with the proflavine intercalated between the CpA sequence and not the ApC sequence. The intercalation geometry here is expected to be analogous to that found in the crystal structure of the dinucleotide CpA.proflavine complex (Westhof et al. J. Mol. Biol., 1981) which forms a miniature right-handed helix. Although normally an inverted spectra could be attributed to a reversal in the helix handedness, the similarity in the 31P nuclear magnetic resonance spectra between the free and proflavine bound poly(rC-rA) indicates that their handedness is the same. The inverted CD spectrum may be a result of the different stacking orientation between the intercalated proflavine and the A-A base-pair on one hand and the triply hydrogen bonded protonated C-C base-pair on the other.

  3. Electronic spectrum of non-tetrahedral acceptors in CdTe:Cl and CdTe:Bi,Cl single crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krivobok, V. S., E-mail: krivobok@lebedev.ru; Moscow Institute of Physics and Technology; Nikolaev, S. N.

    2016-02-07

    The electronic spectra of complex acceptors in compensated CdTe:Cl, CdTe:Ag,Cl, and CdTe:Bi,Cl single crystals are studied using low-temperature photoluminescence (PL) measurements under both nonresonant and resonant excitation of distant donor–acceptor pairs (DAP). The wavelength modulation of the excitation source combined with the analysis of the differential PL signal is used to enhance narrow spectral features obscured because of inhomogeneous line broadening and/or excitation transfer for selectively excited DAPs. For the well-known tetrahedral (T{sub D}) Ag{sub Cd} acceptor, the energies of four excited states are measured, and the values obtained are shown to be in perfect agreement with the previous data.more » Moreover, splitting between the 2P{sub 3/2} (Γ{sub 8}) and 2S{sub 3/2} (Γ{sub 8}) states is clearly observed for Ag{sub Cd} centers located at a short distance (5–7 nm) from a hydrogen-like donor (Cl{sub Te}). This splitting results from the reduction of the T{sub D} symmetry taking place when the acceptor is a member of a donor–acceptor pair. For the Cl-related complex acceptor with an activation energy of ∼121 meV (A-center), the energies of eight excited states are measured. It is shown that this defect produces low-symmetry central-cell correction responsible for the strong splitting of S-like T{sub D} shells. The energy spectrum of the Bi-related shallow acceptor with an activation energy of ∼36 meV is measured as well. The spectrum obtained differs drastically from the hydrogen-like set of levels, which indicates the existence of repulsive low-symmetry perturbation of the hydrogen-like Coulomb potential. It is also shown that the spectra of selectively excited PL recorded for a macroscopic ensemble of distant donor–acceptor pairs allow one to detect the low symmetry of acceptors of a given type caused by their complex nature or by the Jahn–Teller distortion. This method does not require any additional (external) field and is applicable to acceptors in diverse zinc-blende compound semiconductors.« less

  4. Gene expression analysis in rat lungs after intratracheal exposure to nanoparticles doped with cadmium

    NASA Astrophysics Data System (ADS)

    Coccini, Teresa; Fabbri, Marco; Roda, Elisa; Grazia Sacco, Maria; Manzo, Luigi; Gribaldo, Laura

    2011-07-01

    Silica nanoparticles (NPs) incorporating cadmium (Cd) have been developed for a range of potential application including drug delivery devices. Occupational Cd inhalation has been associated with emphysema, pulmonary fibrosis and lung tumours. Mechanistically, Cd can induce oxidative stress and mediate cell-signalling pathways that are involved in inflammation.This in vivo study aimed at investigating pulmonary molecular effects of NPs doped with Cd (NP-Cd, 1 mg/animal) compared to soluble CdCl2 (400 μg/animal), in Sprague Dawley rats treated intra-tracheally, 7 and 30 days after administration. NPs of silica containing Cd salt were prepared starting from commercial nano-size silica powder (HiSil™ T700 Degussa) with average pore size of 20 nm and surface area of 240 m2/g. Toxicogenomic analysis was performed by the DNA microarray technology (using Agilent Whole Rat Genome Microarray 4×44K) to evaluate changes in gene expression of the entire genome. These findings indicate that the whole genome analysis may represent a valuable approach to assess the whole spectrum of biological responses to cadmium containing nanomaterials.

  5. Metal complexes of a new potentially heptadentate(N 7) tripodal Schiff base ligand. Synthesis, NMR studies and ab initio calculations

    NASA Astrophysics Data System (ADS)

    Salehzadeh, Sadegh; Javarsineh, Seyed Amrollah; Keypour, Hassan

    2006-03-01

    Tris(3-aminopropyl)amine, 2-pyridinecarboxaldehyde and a number of metal ions were used to prepare metal complexes of a new fully condensed potentially heptadentate(N 7) tripodal Schiff base ligand (L 333). The resulting complexes, [M(L 333)](ClO 4) 2 {M= Mn(II), Fe(II), Co(II), Ni(II), Cu(II), Zn(II), and Cd(II); L 333=[N(CH 2CH 2CH 2N dbnd6 CH(C 5H 4N)) 3]}, were characterized by microanalysis, IR and electronic spectra in all cases and by NMR spectra in the case of Zn(II) and Cd(II) complexes: these two are both seven-co-ordinate. The 1H NMR, COSY and HMQC spectra of these complexes show two kinds of protons for each methylene group. The COSY spectrum confirms the geminal coupling of the two protons of each methylene group, indicating that the protons are diastereotopic in rigid six-membered rings. In the 1H NMR spectrum of the cadmium complex the signal of the imine proton has two clear satellites peaks ( 3J=41.9 Hz) with intensities in the ratio 1:6:1 due to coupling with neighbouring 111/113Cd. This coupling constant was confirmed by 113Cd NMR spectroscopy. Ab initio studies on [Fe(L 333)] 2+, [Zn(L 333)] 2+ and [Cd(L 333)] 2+ and also on the previously known complex, [Cd(L Me333)] 2+ are also reported. The results show that the shortest bonding interaction between the metal ion and the bridging tertiary nitrogen atom of the ligand is occurs in the Cd(II) complexes.

  6. Nanostructured CdO-NiO composite for multifunctional applications

    NASA Astrophysics Data System (ADS)

    Karthik, K.; Dhanuskodi, S.; Gobinath, C.; Prabukumar, S.; Sivaramakrishnan, S.

    2018-01-01

    In this study, CdO, NiO, and CdO-NiO nanocomposites (NCs) were synthesized and investigated by X-ray diffraction (XRD), scanning electron microscopy, and Fourier transform-infrared spectroscopy. XRD detected cubic structures with average crystallite sizes of 45 nm for CdO, 25 nm for NiO, and 30 nm for CdO-NiO. The band gap was estimated based on the ultraviolet-visible spectra. The near band edge emission was determined according to the luminescence spectrum. The antibacterial activities were tested against seven foodborne pathogens and the zones of inhibition with the Gram-negative bacterium Bacillus subtilis measured as 30 mm with CdO, 20 mm NiO, and 27 mm with CdO-NiO. The death of the bacterial cells was confirmed by confocal laser scanning microscope analysis. Cytotoxicity assays indicated the non-toxic effects of the NCs on normal healthy red blood cells. Furthermore, the in vitro cytotoxic effects of the CdO, NiO, and CdO-NiO NCs were examined using the human MCF-7 breast cancer cell line based on 3-[4,5-dimethylthiazol-2-yl]2,5-diphenyltetrazolium bromide assays with normal mouse embryonic fibroblasts (NH3T3) under identical conditions.

  7. Spatial luminescence imaging of dopant incorporation in CdTe Films

    DOE PAGES

    Guthrey, Harvey; Moseley, John; Colegrove, Eric; ...

    2017-01-25

    State-of-the-art cathodoluminescence (CL) spectrum imaging with spectrum-per-pixel CL emission mapping is applied to spatially profile how dopant elements are incorporated into Cadmium telluride (CdTe). Emission spectra and intensity monitor the spatial distribution of additional charge carriers through characteristic variations in the CL emission based on computational modeling. Our results show that grain boundaries play a role in incorporating dopants in CdTe exposed to copper, phosphorus, and intrinsic point defects in CdTe. Furthermore, the image analysis provides critical, unique feedback to understand dopant incorporation and activation in the inhomogeneous CdTe material, which has struggled to reach high levels of hole density.

  8. Composition-graded nanowire solar cells fabricated in a single process for spectrum-splitting photovoltaic systems.

    PubMed

    Caselli, Derek; Liu, Zhicheng; Shelhammer, David; Ning, Cun-Zheng

    2014-10-08

    Nanomaterials such as semiconductor nanowires have unique features that could enable novel optoelectronic applications such as novel solar cells. This paper aims to demonstrate one such recently proposed concept: Monolithically Integrated Laterally Arrayed Multiple Band gap (MILAMB) solar cells for spectrum-splitting photovoltaic systems. Two cells with different band gaps were fabricated simultaneously in the same process on a single substrate using spatially composition-graded CdSSe alloy nanowires grown by the Dual-Gradient Method in a chemical vapor deposition system. CdSSe nanowire ensemble devices tested under 1 sun AM1.5G illumination achieved open-circuit voltages up to 307 and 173 mV and short-circuit current densities as high as 0.091 and 0.974 mA/cm(2) for the CdS- and CdSe-rich cells, respectively. The open-circuit voltages were roughly three times those of similar CdSSe film cells fabricated for comparison due to the superior optical quality of the nanowires. I-V measurements were also performed using optical filters to simulate spectrum-splitting. The open-circuit voltages and fill factors of the CdS-rich subcells were uniformly larger than the corresponding CdSe-rich cells for similar photon flux, as expected. This suggests that if all wires can be contacted, the wide-gap cell is expected to have greater output power than the narrow-gap cell, which is the key to achieving high efficiencies with spectrum-splitting. This paper thus provides the first proof-of-concept demonstration of simultaneous fabrication of MILAMB solar cells. This approach to solar cell fabrication using single-crystal nanowires for spectrum-splitting photovoltaics could provide a future low-cost high-efficiency alternative to the conventional high-cost high-efficiency tandem cells.

  9. [Gene Mutation Spectrum of β-Thalassemia in Dai Ethinic Population of Two Border Region in Chinese Yunnan Province].

    PubMed

    Zhang, Jie; He, Jing; Zeng, Xiao-Hong; Su, Jie; Chen, Hong; Xu, Yong-Mei; Pu, Jian; Zhu, Bao-Sheng

    2016-02-01

    To investigate the gene mutation spectrum of β-thalassemia in Dai ethnic population of 2 border region in Chinese Yunnan Province. The patients with β-thalassemia in Dai ethnic population of Dehong and Xishuangbanna autonamic prefecture were screened by using blood routine detection and capillary electrophoresis. The β-globin gene mutation in patients with β-thalassemia were detected by using PCR reverse dot-blot hybridization (PCR-RDB), the constitutive rate of gene mutation in patients with β-thalassemia of Dai ethnic population in two border regions was analyzed and compared. A total of 186 patients with gene mutation of β-thalassemia were confirmed. Among them, 10 gene mutation were found, and the 5 main gene mutations were CD26 (62.56%), CD41-42 (18.97%), CD17 (14.36%), CD71-72 (2.05%) and IVS-II-654 (1.54%). Among Dai ethinic population in Dehong region, 4 gene mutations were found including CD26 (80.31%), CD17 (11.02%), CD41-42 (6.30%) and CD71-72 (2.36%). Among Dai ethinic population in Xishuangbanna region, 6 gene mutations were found, out of them the more common gene mutations were CD41-42 (42.64%), CD26 (29.41%) and CD17 (20.59%). The gene mutations of β-thalassemia in Dai ethinic population of Yunnan province has been confirmed to be more genetic heterogenicity, the spectrums of β-thalassemia mutations in Dai ethinic population of different regions were significant different.

  10. A new simple synthesis of CdS nano-particles by composite-molten-salt method and their high photocatalytic degradation activity

    NASA Astrophysics Data System (ADS)

    Xiang, Donghu; Zhu, Yabo; Cai, Cunjin; He, Zhanjun; Liu, Zhangsheng; Yin, Dagen; Luo, Jin

    2011-12-01

    Nano-CdS crystal has been succesfully synthesized by composite molten salt (CMS) method for the first time, using composite molten salt as a reaction solvent, sodium sulfide and cadmium nitrate hexahydrate as reactants at temperature of 200 °C for 24 h in the absence of organic dispersant or capping agents. X-ray diffraction and field emission scanning electron microscopy (FESEM) images indicated that the as-synthesized product were well crystallized and belonged to nano-scale. Their UV-vis absorption spectrum demonstrated a band gap of 2.49 eV corresponding to the absorption edge of 499 nm. The experimental result of photocatalytic degradation on methyl orange by the nano-CdS showed much better photocatalysis than that by the commercial CdS powder under the irradiation of ultraviolet light source.

  11. Spectrum-per-Pixel Cathodoluminescence Imaging of CdTe Thin-Film Bevels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moseley, John; Al-Jassim, Mowafak M.; Burst, James

    2016-11-21

    We conduct T=6 K cathodoluminescence (CL) spectrum imaging with a nano-scale electron beam on beveled surfaces of CdTe thin-films at different critical stages of standard CdTe device fabrication. The through-thickness total CL intensity profiles are consistent with a reduction in grain boundary recombination due to the CdCl2 treatment. Color-coded maps of the low-temperature luminescence transition energies reveal that CdTe thin films have remarkably non-uniform opto-electronic properties, which depend strongly on sample processing history. The grain-to-grain S content in the interdiffused CdTe/CdS region is estimated from a sample size of thirty-five grains, and the S content in adjacent grains varies significantlymore » in CdCl2-treated samples. A low-temperature luminescence model is developed to interpret spectral behavior at grain boundaries and grain interiors.« less

  12. [Pre- and perinatal risk factors in autism spectrum disorder and attention deficit/hyperactivity disorder].

    PubMed

    Schmitz, Johanna C; Cholemkery, Hannah; Medda, Juliane; Freitag, Christine M

    2017-01-01

    Epidemiological studies indicate the relevance of pre- and perinatal risk factors for the genesis of attention deficit/hyperactivity disorder and autism spectrum disorder. This study compares potential risk factors in a clinical sample of children with ADHD, ASD, the combination of both diseases, ADHD and oppositional defiant or conduct disorder (ADHD & ODD/CD) and examined whether the existence of additional risk factors promotes the occurrence of combined diseases. We compared the pre- and perinatal risk factors of 341 patients (299 boys, 42 girls) from a clinical population, differentiating between children with ADHD (n=80), ASD (n=122), ADHD & ASD (n=55), or ADHD & ODD/CD (n=84). We observed a higher rate of maternal smoking, a higher rate of migration, and lower parental education among the children with ADHD & ODD/CD compared to those with ASD or ADHD. The rate of migration background was higher among the children with ASD compared to children with ADHD. Miscarriage was a specific risk factor for ADHD & ASD. Numerous risk factors described in epidemiological studies occurred only rarely in our clinical sample. The distribution of most risk factors was comparable between the examined diseases.

  13. Delineation of behavioral phenotypes in genetic syndromes: characteristics of autism spectrum disorder, affect and hyperactivity.

    PubMed

    Oliver, Chris; Berg, Katy; Moss, Jo; Arron, Kate; Burbidge, Cheryl

    2011-08-01

    We investigated autism spectrum disorder (ASD) symptomatology, hyperactivity and affect in seven genetic syndromes; Angelman (AS; n = 104), Cri du Chat (CdCS; 58), Cornelia de Lange (CdLS; 101), Fragile X (FXS; 191), Prader-Willi (PWS; 189), Smith-Magenis (SMS; 42) and Lowe (LS; 56) syndromes (age range 4-51). ASD symptomatology was heightened in CdLS and FXS. High levels of impulsivity were seen in SMS, AS, CdCS, FXS and adults with CdLS. Negative affect was prominent in adults with CdLS, while positive affect was prominent in adults with AS and FXS. Heightened levels of overactivity and impulsivity were identified in FXS, AS and SMS while low levels were identified in PWS. These findings confirm and extend previously reported behavioral phenotypes.

  14. Extending the spectral range of CdSe/ZnSe quantum wells by strain engineering

    NASA Astrophysics Data System (ADS)

    Finke, A.; Ruth, M.; Scholz, S.; Ludwig, A.; Wieck, A. D.; Reuter, D.; Pawlis, A.

    2015-01-01

    We demonstrate efficient room-temperature photoluminescence and spectral tuning of epitaxially grown ZnSe/CdSe quantum well structures almost over the whole visible spectrum (470-600 nm wavelength). The key element to achieve the observed high quantum efficiency and enormous tuning range was the implementation of a special strain engineering technique, which allows us to suppress substantial lattice relaxation of CdSe on ZnSe. Previous studies indicated that a CdSe coverage exceeding 3 ML on ZnSe results in the formation of extensive lattice defects and complete quenching of the photoluminescence at low and room temperature. In contrast, our approach of strain engineering enables the deposition of planar CdSe quantum wells with a thickness ranging from 1 to 6 ML with excellent optical properties. We attribute the observed experimental features to a controllable strain compensation effect that is present in an alternating system of tensile and compressively strained epitaxial layers and supported this model by calculations of the transition energies of the ZnSe/CdSe quantum wells.

  15. Interaction of carboxylated single-walled carbon nanotubes with bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Li, Lili; Lin, Rui; He, Hua; Jiang, Li; Gao, Mengmeng

    2013-03-01

    Carboxylated single-walled carbon nanotubes (c-SWNTs) were synthesized prosperously in order to improve dispersion of raw carbon nanotubes. Then, bovine serum albumin (BSA) was used as the template protein to study the biocompatibility of c-SWNTs by UV-Vis, fluorescence and circular dichroism (CD) spectroscopic methods at the molecular level. Results from fluorescence spectrum showed obvious decreases in fluorescence intensity of BSA induced by c-SWNTs, indicating the occurrence of interaction between BSA and c-SWNTs. Static quenching effect of c-SWNTs was verified by linear Stern-Volmer plots and KSV values. Thermodynamic parameters at different temperatures demonstrated that the interaction between c-SWNTs and BSA was mainly favored by hydrophobic force. In addition, Na+ interfered with the quenching effect of c-SWNTs, which revealed that electrostatic force played a role in binding roles of BSA to c-SWNTs simultaneously. The results of UV and synchronous fluorescence spectrum validated that hydrophobicity of amino acid residues expressly increased with the addition of c-SWNTs. The content of α-helix structure in BSA decreased by 14.06% with c-SWNTs viewed from CD spectrum. Effect of SWNTs on the conformation of BSA could be controlled by the surface chemistry of SWNTs.

  16. Characteristics of Autism Spectrum Disorder in Cornelia de Lange Syndrome

    ERIC Educational Resources Information Center

    Moss, Jo; Howlin, Patricia; Magiati, Iliana; Oliver, Chris

    2012-01-01

    Background: The prevalence of autism spectrum disorder (ASD) symptomatology is comparatively high in Cornelia de Lange syndrome (CdLS). However, the profile and developmental trajectories of these ASD characteristics are potentially different to those observed in individuals with idiopathic ASD. In this study we examine the ASD profile in CdLS in…

  17. Dual-channel optical sensing platform for detection of diminazene aceturate based on thioglycolic acid-wrapped cadmium telluride/cadmium sulfide quantum dots.

    PubMed

    Hao, Chenxia; Zhou, Tao; Liu, Shaopu; Wang, Linlin; Huang, Bowen; Kuang, Nianxi; He, Youqiu

    2016-06-15

    A dual-channel optical sensing platform which combines the advantages of dual-wavelength overlapping resonance Rayleigh scattering (DWO-RRS) and fluorescence has been designed for the detection of diminazene aceturate (DA). It is based on the use of thioglycolic acid-wrapped CdTe/CdS quantum dots (Q-dots). In the absence of DA, the thioglycolic acid-wrapped CdTe/CdS Q-dots exhibit the high fluorescence spectrum and low RRS spectrum, so are selected to develop an easy-to-get system. In the presence of DA, the thioglycolic acid-wrapped CdTe/CdS Q-dots and DA form a complex through electrostatic interaction, which result in the RRS intensity getting enhanced significantly with new RRS peaks appearing at 317 and 397 nm; the fluorescence is powerfully quenched. Under optimum conditions, the scattering intensities of the two peaks are proportional to the concentration of DA in the range of 0.0061-3.0 μg mL(-1). The detection limits for the two single peaks are 4.1 ng mL(-1) and 3.3 ng mL(-1), while that of the DWO-RRS method is 1.8 ng mL(-1), indicating that the DWO-RRS method has high sensitivity. Besides, the fluorescence also exhibits good linear range from 0.0354 to 10.0 μg mL(-1) with a detection limit of 10.6 ng mL(-1). In addition, the system has been applied to the detection of DA in milk samples with satisfactory results. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Tailoring growth conditions for efficient tuning of band edge of CdS nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Susha, N.; Nair, Swapna S., E-mail: swapna.s.nair@gmail.com; Aravind, P. B.

    2015-06-24

    CdS nanoparticles are successively synthesized by chemical precipitation method. The samples prepared at different reaction time and temperature are characterized by X-ray diffraction, Diffuse reflectance spectroscopy, Photoluminescence spectroscopy ans Energy dispersive x-ray analysis. Visible color variation is noted from light yellow to orange, indicates the quantum confinement effect and the results are again got confirmed from the optical studies. A shift in absorption peak is observed towards the lower region of the visible spectra - the “blue shift”- upon decrease in reaction time and temperature. Blue emission observed in the photoluminescence spectrum confirms the grain size induced confinement.

  19. Fluorimetric and mass spectrometric study of the interaction of β-cyclodextrin and osthole

    NASA Astrophysics Data System (ADS)

    Zhang, Huarong; Zhang, Hanqi; Qu, Chenling; Bai, Lifei; Ding, Lan

    2007-11-01

    The inclusion complex of β-cyclodextrin (β-CD) and osthole was studied by the electrospray ionization mass spectrometry (ESI-MS) and fluorescence spectrometry. From the mass spectrum, the 1:1 stoichiometric inclusion complex of β-CD and osthole was observed. The tandem mass spectrum was performed. The fluorescence intensity of osthole increased in the present of β-CD. According to the 1:1 β-CD-osthole mode, the dissociation constant ( KD) was obtained by ESI-MS and fluorescence spectrometry. The KD of β-CD-osthole inclusion complex is 6.96 × 10 -3 mol L -1 obtained by mass spectrometry and that is 8.14 × 10 -3 mol L -1 obtained by fluorescence spectrometry, which is consistent with each other.

  20. The effect of Cd substitution doping on the bandgap and absorption spectrum of ZnO

    NASA Astrophysics Data System (ADS)

    Hou, Qingyu; Li, Yong; Qu, Lingfeng; Zhao, Chunwang

    2016-08-01

    Many research papers have reported that in the ultraviolet area of 290-360 nm wavelength range, blueshift and redshift in the absorption spectrum occurred in ZnO with Cd doping; however, there is no reasonable theoretical explanation to this so far. To solve this problem, this study investigates the differences of blueshift and redshift in doping system by adopting plane-wave ultrasoft pseudopotential technology based on the density functional theory and applying LDA + U method to calculate band structures, density of states and absorption spectrum distribution of the models, which is on the basis of model geometry optimization. By increasing the Cd doping concentration, the following results are obtained: increased volume of the mixed system, raised total energy, a decrease in stability, narrowed bandgaps and a significant redshift in the absorption spectrum in the ultraviolet or visible light area.

  1. Segmented-spectrum detection mechanism for medical x-ray in CdTe

    NASA Astrophysics Data System (ADS)

    Shi, Zaifeng; Meng, Qingzhen; Cao, Qingjie; Yao, Suying

    2016-01-01

    This paper presents a segmented X-ray spectrum detection method based on a layered X-ray detector in Cadmium Telluride (CdTe) substrate. We describe the three-dimensional structure of proposed detector pixel and investigate the matched spectrum-resolving method. Polychromatic X-ray beam enter the CdTe substrate edge on and will be absorbed completely in different thickness varying with photon energy. Discrete potential wells are formed under external controlling voltage to collect the photo-electrons generated in different layers, and segmented X-ray spectrum can be deduced from the quantity of photo-electrons. In this work, we verify the feasibility of the segmented-spectrum detection mechanism by simulating the absorption of monochromatic X-ray in a CdTe substrate. Experiments in simulation show that the number of photo-electrons grow exponentially with the increase of incident thickness, and photons with different energy will be absorbed in various thickness. The charges generated in different layers are collected into adjacent potential wells, and collection efficiency is estimated to be about 87% for different incident intensity under the 40000V/cm electric field. Errors caused by charge sharing between neighboring layers are also analyzed, and it can be considered negligible by setting appropriate size of electrodes.

  2. Decreased Numbers of CD57+CD3- Cells Identify Potential Innate Immune Differences in Patients with Autism Spectrum Disorder.

    PubMed

    Siniscalco, Dario; Mijatovic, Tatjana; Bosmans, Eugene; Cirillo, Alessandra; Kruzliak, Peter; Lombardi, Vincent C; De Meirleir, Kenny; Antonucci, Nicola

    2016-01-01

    Autism spectrum disorders (ASD) are complex, and severe heterogeneous neurodevelopmental pathologies with accepted but complex immune system abnormalities. Additional knowledge regarding potential immune dysfunctions may provide a greater understanding of this malady. The aim of this study was to evaluate the CD57(+)CD3(-) mature lymphocyte subpopulation of natural killer cells as a marker of immune dysfunction in ASD. Three-color flow cytometry-based analysis of fresh peripheral blood samples from children with autism was utilized to measure CD57(+)CD3(-) lymphocytes. A reduction of CD57(+)CD3(-) lymphocyte count was recorded in a significant number of patients with autism. We demonstrated that the number of peripheral CD57(+)CD3(-) cells in children with autism often falls below the clinically accepted normal range. This implies that a defect in the counter-regulatory functions necessary for balancing pro-inflammatory cytokines exists, thus opening the way to chronic inflammatory conditions associated with ASD. Copyright © 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  3. Emotion Regulation Difficulties in Boys with Oppositional Defiant Disorder/Conduct Disorder and the Relation with Comorbid Autism Traits and Attention Deficit Traits.

    PubMed

    Schoorl, Jantiene; van Rijn, Sophie; de Wied, Minet; van Goozen, Stephanie; Swaab, Hanna

    2016-01-01

    Previous research has pointed towards a link between emotion dysregulation and aggressive behavior in children. Emotion regulation difficulties are not specific for children with persistent aggression problems, i.e. oppositional defiant disorder or conduct disorder (ODD/CD), children with other psychiatric conditions, such as autism spectrum disorders or attention-deficit/hyperactivity disorder, have emotion regulation difficulties too. On a behavioral level some overlap exists between these disorders and comorbidity is high. The aim of this study was therefore twofold: 1) to examine emotion regulation difficulties in 65 boys with ODD/CD in comparison to a non-clinical control group (NC) of 38 boys (8-12 years) using a performance measure (Ultimatum Game), parent report and self-report, and 2) to establish to what extent emotion regulation in the ODD/CD group was correlated with severity of autism and/or attention deficit traits. Results on the Ultimatum Game showed that the ODD/CD group rejected more ambiguous offers than the NC group, which is seen as an indication of poor emotion regulation. Parents also reported that the ODD/CD group experienced more emotion regulation problems in daily life than the NC group. In contrast to these cognitive and behavioral measures, self-reports did not reveal any difference, indicating that boys with ODD/CD do not perceive themselves as having impairments in regulating their emotions. Emotional decision making within the ODD/CD group was not related to variation in autism or attention deficit traits. These results support the idea that emotion dysregulation is an important problem within ODD/CD, yet boys with ODD/CD have reduced awareness of this.

  4. Emotion Regulation Difficulties in Boys with Oppositional Defiant Disorder/Conduct Disorder and the Relation with Comorbid Autism Traits and Attention Deficit Traits

    PubMed Central

    Schoorl, Jantiene; van Rijn, Sophie; de Wied, Minet; van Goozen, Stephanie; Swaab, Hanna

    2016-01-01

    Previous research has pointed towards a link between emotion dysregulation and aggressive behavior in children. Emotion regulation difficulties are not specific for children with persistent aggression problems, i.e. oppositional defiant disorder or conduct disorder (ODD/CD), children with other psychiatric conditions, such as autism spectrum disorders or attention-deficit/hyperactivity disorder, have emotion regulation difficulties too. On a behavioral level some overlap exists between these disorders and comorbidity is high. The aim of this study was therefore twofold: 1) to examine emotion regulation difficulties in 65 boys with ODD/CD in comparison to a non-clinical control group (NC) of 38 boys (8–12 years) using a performance measure (Ultimatum Game), parent report and self-report, and 2) to establish to what extent emotion regulation in the ODD/CD group was correlated with severity of autism and/or attention deficit traits. Results on the Ultimatum Game showed that the ODD/CD group rejected more ambiguous offers than the NC group, which is seen as an indication of poor emotion regulation. Parents also reported that the ODD/CD group experienced more emotion regulation problems in daily life than the NC group. In contrast to these cognitive and behavioral measures, self-reports did not reveal any difference, indicating that boys with ODD/CD do not perceive themselves as having impairments in regulating their emotions. Emotional decision making within the ODD/CD group was not related to variation in autism or attention deficit traits. These results support the idea that emotion dysregulation is an important problem within ODD/CD, yet boys with ODD/CD have reduced awareness of this. PMID:27420110

  5. Synthesis and photophysics of conjugated azomethine polyrotaxanes

    NASA Astrophysics Data System (ADS)

    Resmerita, A.-M.; Farcas, F.; Rotaru, A.; Farcas, A.

    2016-12-01

    The photophysical properties of two polyazomethine polyrotaxanes (4•αCD and 4•TMS-αCD) composed of pyrene and triazole encapsulated into native and permodified α-cyclodextrin (αCD and TMS-αCD) cavities have been investigated and compared with those of the non-rotaxane 4 counterparts. Rotaxane formation results in improvements of the solubility in organic solvents, as well as better film forming ability combined with a high transparency. The polyrotaxane 4•TMS-αCD was soluble in toluene/DMF1/1 v/v mixture and displayed useful levels of thermal stability. The fluorescence spectroscopy of 4•αCD and 4•TMS-αCD shows an obvious blue shift both in excitation and emission spectra with respect to those of non-rotaxane counterparts. 4•TMS-αCD displays a continuous absorption spectrum, whereas the reference 4 does not show any absorption maximum, neither for its emission maximum, presumably because of its very low solubility in DMF. The improved fluorescence efficiency (ΦPL) of both polyrotaxanes is attributed to the hydrophobic micro-environment within αCD and TMS-αCD cavities. The surfaces of non-rotaxane 4 counterparts showed globular formations with an agglomeration tendency, while the encapsulated 4•αCD and 4•TMS-αCD rotaxane compounds exhibited smoother surfaces, comprised by smaller grains uniformly distributed on the surface of the solid films. The presence of the αCD and TMS-αCD in 4·αCD and 4•TMS-αCD polyrotaxanes affects the LUMO energy levels to a greater extent than its HOMO energy with respect to reference 4. The wetting properties of spin-coated film of 4•TMS-αCD in water (polar) and diiodomethane (apolar), indicates that TMS-αCD makes its surface more hydrophobic. The dispersive and polar components are lower than that of the reference compounds. The doping of the rotaxane structures with iodine (I2) indicated smaller improvements of electrical conductivity (σ) values, which presents a tradeoff with their better solubility, process ability, surface characteristics and ΦPL.

  6. Only Follow-Up of Memory B Cells Helps Monitor Rituximab Administration to Patients with Neuromyelitis Optica Spectrum Disorders.

    PubMed

    Lebrun, Christine; Cohen, Mikael; Rosenthal-Allieri, Maria Alessandra; Bresch, Saskia; Benzaken, Sylvia; Marignier, Romain; Seitz-Polski, Barbara; Ticchioni, Michel

    2018-06-07

    Neuromyelitis optica spectrum disorders (NMOSD) are identified as a spectrum of inflammatory demyelinating disorders involving the brain, spinal cord and optic nerves. These disorders require early diagnosis and highly active immunosuppressive treatment. Rituximab (RTX) has demonstrated efficacy in limiting relapse in NMOSD when using several administration schedules. We questioned if the CD19+ CD27+ memory B cell count was a more reliable marker to monitor RTX administration than the RTX plasma level and CD19+ B cell count. We analyzed 125 blood samples from 17 NMOSD patients treated with RTX and also measured the level of anti-aquaporine-4 antibodies (anti-AQP-4 Abs), human anti-chimeric antibodies to the murine fragment of RTX (HACA-RTX Abs), and the RTX concentration. The mean follow-up time of the cohort was 7.4 (2-16) years. All patients improved with a mean EDSS going from 4 (1-8.5) to 2.7 (1-5.5). The mean interval between RTX infusions was 9.6 months with identification of prolonged responders. Total CD19+ B cell detection with the routine technique did not correlate to re-emergence of CD19+ CD27+ memory B cells. The RTX residual concentration did not correlate with the CD19+ CD27+ memory B cell count or with anti-RTX antibody production. In contrast to total CD19+ cell, detected with the routine technique, CD19+ CD27+ memory B cells are a reliable marker for biological relapse and allow a decrease in the frequency of infusions.

  7. Spatial Distribution of Dopant Incorporation in CdTe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guthrey, Harvey; Moseley, John; Colegrove, Eric

    2016-11-21

    In this work we use state-of-the-art cathodoluminescence (CL) spectrum imaging that provides spectrum-per-pixel mapping of the CL emission to examine how dopant elements are incorporated into CdTe. Emission spectra and intensity are used to monitor the spatial distribution of additional charge carriers through characteristic variations in the CL emission based on theoretical modeling. Our results show that grain boundaries play a role in the incorporation of dopants in CdTe, whether intrinsic or extrinsic. This type of analysis is crucial for providing feedback to design different processing schedules that optimize dopant incorporation in CdTe photovoltaic material, which has struggled to reachmore » high carrier concentration values. Here, we present results on CdTe films exposed to copper, phosphorus, and intrinsic doping treatments.« less

  8. Delineation of Behavioral Phenotypes in Genetic Syndromes: Characteristics of Autism Spectrum Disorder, Affect and Hyperactivity

    ERIC Educational Resources Information Center

    Oliver, Chris; Berg, Katy; Moss, Jo; Arron, Kate; Burbidge, Cheryl

    2011-01-01

    We investigated autism spectrum disorder (ASD) symptomatology, hyperactivity and affect in seven genetic syndromes; Angelman (AS; n = 104), Cri du Chat (CdCS; 58), Cornelia de Lange (CdLS; 101), Fragile X (FXS; 191), Prader-Willi (PWS; 189), Smith-Magenis (SMS; 42) and Lowe (LS; 56) syndromes (age range 4-51). ASD symptomatology was heightened in…

  9. Cutting Edge: Helicobacter pylori Induces Nuclear Hypersegmentation and Subtype Differentiation of Human Neutrophils In Vitro.

    PubMed

    Whitmore, Laura C; Weems, Megan N; Allen, Lee-Ann H

    2017-03-01

    Helicobacter pylori infects the human stomach and causes a spectrum of disease that includes gastritis, peptic ulcers, and gastric adenocarcinoma. A chronic, neutrophil-rich inflammatory response characterizes this infection. It is established that H. pylori stimulates neutrophil chemotaxis and a robust respiratory burst, but other aspects of this interaction are incompletely defined. We demonstrate here that H. pylori induces N1-like subtype differentiation of human neutrophils as indicated by profound nuclear hypersegmentation, a CD62L dim , CD16 bright , CD11b bright , CD66b bright , CD63 bright surface phenotype, proinflammatory cytokine secretion, and cytotoxicity. Hypersegmentation requires direct neutrophil- H. pylori contact as well as transcription and both host and bacterial protein synthesis, but not urease, NapA, VacA, CagA, or CagT. The concept of neutrophil plasticity is new and, to our knowledge, these data are the first evidence that neutrophils can undergo subtype differentiation in vitro in response to bacterial pathogen infection. We hypothesize that these changes favor H. pylori persistence and disease. Copyright © 2017 by The American Association of Immunologists, Inc.

  10. Broad-Spectrum Inhibition of HIV-1 by a Monoclonal Antibody Directed against a gp120-Induced Epitope of CD4

    PubMed Central

    Burastero, Samuele E.; Frigerio, Barbara; Lopalco, Lucia; Sironi, Francesca; Breda, Daniela; Longhi, Renato; Scarlatti, Gabriella; Canevari, Silvana; Figini, Mariangela; Lusso, Paolo

    2011-01-01

    To penetrate susceptible cells, HIV-1 sequentially interacts with two highly conserved cellular receptors, CD4 and a chemokine receptor like CCR5 or CXCR4. Monoclonal antibodies (MAbs) directed against such receptors are currently under clinical investigation as potential preventive or therapeutic agents. We immunized Balb/c mice with molecular complexes of the native, trimeric HIV-1 envelope (Env) bound to a soluble form of the human CD4 receptor. Sera from immunized mice were found to contain gp120-CD4 complex-enhanced antibodies and showed broad-spectrum HIV-1-inhibitory activity. A proportion of MAbs derived from these mice preferentially recognized complex-enhanced epitopes. In particular, a CD4-specific MAb designated DB81 (IgG1Κ) was found to preferentially bind to a complex-enhanced epitope on the D2 domain of human CD4. MAb DB81 also recognized chimpanzee CD4, but not baboon or macaque CD4, which exhibit sequence divergence in the D2 domain. Functionally, MAb DB81 displayed broad HIV-1-inhibitory activity, but it did not exert suppressive effects on T-cell activation in vitro. The variable regions of the heavy and light chains of MAb DB81 were sequenced. Due to its broad-spectrum anti-HIV-1 activity and lack of immunosuppressive effects, a humanized derivative of MAb DB81 could provide a useful complement to current preventive or therapeutic strategies against HIV-1. PMID:21818294

  11. Broad-spectrum inhibition of HIV-1 by a monoclonal antibody directed against a gp120-induced epitope of CD4.

    PubMed

    Burastero, Samuele E; Frigerio, Barbara; Lopalco, Lucia; Sironi, Francesca; Breda, Daniela; Longhi, Renato; Scarlatti, Gabriella; Canevari, Silvana; Figini, Mariangela; Lusso, Paolo

    2011-01-01

    To penetrate susceptible cells, HIV-1 sequentially interacts with two highly conserved cellular receptors, CD4 and a chemokine receptor like CCR5 or CXCR4. Monoclonal antibodies (MAbs) directed against such receptors are currently under clinical investigation as potential preventive or therapeutic agents. We immunized Balb/c mice with molecular complexes of the native, trimeric HIV-1 envelope (Env) bound to a soluble form of the human CD4 receptor. Sera from immunized mice were found to contain gp120-CD4 complex-enhanced antibodies and showed broad-spectrum HIV-1-inhibitory activity. A proportion of MAbs derived from these mice preferentially recognized complex-enhanced epitopes. In particular, a CD4-specific MAb designated DB81 (IgG1Κ) was found to preferentially bind to a complex-enhanced epitope on the D2 domain of human CD4. MAb DB81 also recognized chimpanzee CD4, but not baboon or macaque CD4, which exhibit sequence divergence in the D2 domain. Functionally, MAb DB81 displayed broad HIV-1-inhibitory activity, but it did not exert suppressive effects on T-cell activation in vitro. The variable regions of the heavy and light chains of MAb DB81 were sequenced. Due to its broad-spectrum anti-HIV-1 activity and lack of immunosuppressive effects, a humanized derivative of MAb DB81 could provide a useful complement to current preventive or therapeutic strategies against HIV-1.

  12. Analysis of protein circular dichroism spectra for secondary structure using a simple matrix multiplication.

    PubMed

    Compton, L A; Johnson, W C

    1986-05-15

    Inverse circular dichroism (CD) spectra are presented for each of the five major secondary structures of proteins: alpha-helix, antiparallel and parallel beta-sheet, beta-turn, and other (random) structures. The fraction of the each secondary structure in a protein is predicted by forming the dot product of the corresponding inverse CD spectrum, expressed as a vector, with the CD spectrum of the protein digitized in the same way. We show how this method is based on the construction of the generalized inverse from the singular value decomposition of a set of CD spectra corresponding to proteins whose secondary structures are known from X-ray crystallography. These inverse spectra compute secondary structure directly from protein CD spectra without resorting to least-squares fitting and standard matrix inversion techniques. In addition, spectra corresponding to the individual secondary structures, analogous to the CD spectra of synthetic polypeptides, are generated from the five most significant CD eigenvectors.

  13. Social Behavior and Characteristics of Autism Spectrum Disorder in Angelman, Cornelia de Lange, and Cri du Chat Syndromes

    ERIC Educational Resources Information Center

    Moss, Joanna; Howlin, Patricia; Hastings, Richard Patrick; Beaumont, Sarah; Griffith, Gemma M.; Petty, Jane; Tunnicliffe, Penny; Yates, Rachel; Villa, Darrelle; Oliver, Chris

    2013-01-01

    We evaluated autism spectrum disorder (ASD) characteristics and social behavior in Angelman (AS; "n" ?=? 19; mean age ?=?10.35 years), Cornelia de Lange (CdLS; "n" ?=? 15; mean age ?=?12.40 years), and Cri du Chat (CdCS, also known as 5 p-syndrome; "n" ?=? 19; mean age ?=? 8.80 years) syndromes. The proportion of…

  14. Impact of Antibody Bioconjugation on Emission and Energy Band Profile of CdSeTe/ZnS Quantum Dots

    NASA Astrophysics Data System (ADS)

    Torchynska, T. V.; Gomez, J. A. Jaramillo; Polupan, G.; Macotela, L. G. Vega

    2018-03-01

    The variation of the photoluminescence (PL) and Raman scattering spectra of CdSeTe/ZnS quantum dots (QDs) on conjugation to an antibody has been investigated. Two types of CdSeTe/ZnS QD with different emission wavelength (705 nm and 800 nm) were studied comparatively before and after conjugation to anti-pseudorabies virus antibody (AB). Nonconjugated QDs were characterized by Gaussian-type PL bands. PL shifts to higher energy and asymmetric shape of PL bands was detected in PL spectra of bioconjugated QDs. The surface-enhanced Raman scattering effect was exhibited by the bioconjugated CdSeTe/ZnS QDs, indicating that the excitation light used in the Raman study generated electric dipoles in the AB molecules. The optical bandgap of the CdSeTe core was calculated numerically as a function of its radius based on an effective mass approximation model. The energy band diagrams for non- and bioconjugated CdSeTe/ZnS QDs were obtained, revealing a type II quantum well in the CdSeTe core. The calculations show that AB dipoles, excited in the bioconjugated QDs, stimulate a change in the energy band diagram of the QDs that alters the PL spectrum. These results could be useful for improving the sensitivity of QD biosensors.

  15. Understanding the impact of Light cone effect on the EoR/CD 21-cm power spectrum

    NASA Astrophysics Data System (ADS)

    Datta, Kanan K.; Mondal, Rajesh; Ghara, Raghunath; Bharadwaj, Somnath; Choudhury, T. Roy

    2018-05-01

    Redshifted HI 21-cm signal from the cosmic dawn and epoch of reionization evolve considerably along the LoS. We study the impact of this evolution (so called the light cone effect) on the HI 21-cm power spectrum. It is found that the LC effect has a significant impact on the 3D power spectrum and the change could be up to a factor of few. The LC effect is particularly strong during the cosmic dawn near the `peaks' and `dips' in the power spectrum when plotted with redshift. We also show that the 3D power spectrum, which could fully describe ergodic and periodic signal, losses out some information regarding the second order statistics of the signal as the EoR/CD 21-cm signal is non-ergodic and non-periodic along the line of sight. We show that the multi-frequency angular power spectrum (MAPS) \\ell (\

  16. Polymorphism of DC-SIGN (CD209) promoter in association with clinical symptoms of dengue fever.

    PubMed

    Oliveira, Layanna Freitas de; Lima, Clayton Pereira Silva de; Azevedo, Raimunda do Socorro Silva; Mendonça, Dafne Silva Furtado de; Rodrigues, Sueli Guerreiro; Carvalho, Valéria Lima; Pinto, Eliana Vieira; Maia, Andreza Lopes; Maia, Maria Helena Thomaz; Vasconcelos, Janaina Mota; Silva, Andrea Luciana Soares da; Nunes, Márcio Roberto Teixeira; Sena, Leonardo; Vasconcelos, Pedro Fernando; Santos, Eduardo José Melo dos

    2014-06-01

    C-type lectin DC-SIGN receptor, encoded by CD209, plays a key role in the infection of dendritic cells by dengue virus (DENV). Because the -336A/G SNP (rs4804803) polymorphism in the promoter of CD209 modulates DC-SIGN expression, we investigated the putative association of this polymorphism with DENV infection and its pathogenesis. A control sample of 72 individuals, rigorously selected through a clinical investigation for absence of past dengue fever (DF) was compared to a sample of 168 patients (156 classical DF; 12 dengue hemorrhagic fever), all residents from Pará, Brazil. However, the prevalence of symptoms showed a trend higher in the AA genotype (Wilcoxon test; Z=2.02; p=0.04). Hence, our findings indicate that the G allele downregulates the spectrum of symptoms during the early acute phase of DENV infection, putatively decreasing the viremia, as suggested in the literature.

  17. Opto-Electronic Characterization CdTe Solar Cells from TCO to Back Contact with Nano-Scale CL Probe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moseley, John; Al-Jassim, Mowafak M.; Paudel, Naba

    2015-06-14

    We used cathodoluminescence (CL) (spectrum-per-pixel) imaging on beveled CdTe solar cell sections to investigate the opto-electronic properties of these devices from the TCO to the back contact. We used a nano-scale CL probe to resolve luminescence from grain boundary (GB) and grain interior (GI) locations near the CdS/CdTe interface where the grains are very small. As-deposited, CdCl2-treated, Cu-treated, and (CdCl2+Cu)-treated cells were analyzed. Color-coded CL spectrum imaging maps on bevels illustrate the distribution of the T=6 K luminescence transitions through the depth of devices with unprecedented spatial resolution. The CL at the GBs and GIs is shown to vary significantlymore » from the front to the back of devices and is a sensitive function of processing. Supporting D-SIMS depth profile, TRPL lifetime, and C-V measurements are used to link the CL data to the J-V performance of devices.« less

  18. Precise determination of the 113Cd fourth-forbidden non-unique β -decay Q value

    NASA Astrophysics Data System (ADS)

    Gamage, N. D.; Bollen, G.; Eibach, M.; Gulyuz, K.; Izzo, C.; Kandegedara, R. M. E. B.; Redshaw, M.; Ringle, R.; Sandler, R.; Valverde, A. A.

    2016-08-01

    Using Penning trap mass spectrometry, we have performed a precise determination of the Q value for the highly forbidden β decay of 113Cd. An independent measurement of the Q value fixes the end-point energy in a fit to the 113Cdβ -decay spectrum. This provides a strong test of systematics for detectors that have observed this decay, such as those developed for β β -decay searches in cadmium and other isotopes. It will also aid in the theoretical description of the β -decay spectrum. The result, Qβ=323.89 (27 ) keV , agrees at the 1.3 σ level with the value obtained from the 2012 Atomic Mass Evaluation [Chin. Phys. C 36, 1603 (2012), 10.1088/1674-1137/36/12/003], but is a factor of almost four more precise. We also report improved values for the atomic masses of 113Cd,113In, and 112Cd.

  19. Structural and Spectroscopic Studies of Sm3+/CdS Nanocrystallites in Sol-Gel TiO2-ZrO2 Matrix

    NASA Astrophysics Data System (ADS)

    Karthika, S.; Prathibha, Vasudevan; Ann, Mary K. A.; Viji, Vidyadharan; Biju, P. R.; Unnikrishnan, N. V.

    2014-02-01

    A sol-gel method was used to prepare titania-zirconia matrices doped with Sm3+/CdS nanocrystallites. The structural properties of the matrices were characterized using transmission electron microscopy (TEM), thermogravimetric analysis (TGA), differential thermal analysis (DTA), and Fourier-transform infrared spectroscopy studies. The thermal stability of the material was determined by TGA/DTA analysis. The absorption spectrum shows the characteristic peaks of the Sm3+ ions and the absorption peak corresponding to the CdS nanocrystallites. The optical bandgap and size of the CdS nanoparticles were calculated from the absorption spectrum. From TEM, the interplanar distance ( d) was estimated to be 3.533 Å, which matches with the (1 0 0) plane of bulk CdS. The measurements yield a nanocrystallite size of around 7.8 nm. The optical absorption and emission spectra confirmed the formation of CdS nanoparticles along with samarium ions in the titania-zirconia matrices. The fluorescence intensity of the samarium ions was found to be greatly enhanced by codoping with CdS nanocrystallites.

  20. Titanium Dioxide/Upconversion Nanoparticles/Cadmium Sulfide Nanofibers Enable Enhanced Full-Spectrum Absorption for Superior Solar Light Driven Photocatalysis.

    PubMed

    Zhang, Fu; Zhang, Chuan-Ling; Wang, Wan-Ni; Cong, Huai-Ping; Qian, Hai-Sheng

    2016-06-22

    In this work, we demonstrate an electrospinning technique to fabricate TiO2 /upconversion nanoparticles (UCNPs)/CdS nanofibers on large scale. In addition, the as-prepared TiO2 nanofibers are incorporated with a high population of UCNPs and CdS nanospheres; this results in Förster resonance energy-transfer configurations of the UCNPs, TiO2 , and CdS nanospheres that are in close proximity. Hence, strong fluorescent emissions for the Tm(3+) ions including the (1) G4 →(3) H6 transition are efficiently transferred to TiO2 and the CdS nanoparticles through an energy-transfer process. The as-prepared TiO2 /UCNPs/CdS nanofibers exhibit full-spectrum solar-energy absorption and enable the efficient degradation of organic dyes by fluorescence resonance energy transfer between the UCNPs and TiO2 (or CdS). The UCNPs/TiO2 /CdS nanofibers may also have enhanced energy-transfer efficiency for wide applications in solar cells, bioimaging, photodynamics, and chemotherapy. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Integration of Semiconducting Sulfides for Full-Spectrum Solar Energy Absorption and Efficient Charge Separation.

    PubMed

    Zhuang, Tao-Tao; Liu, Yan; Li, Yi; Zhao, Yuan; Wu, Liang; Jiang, Jun; Yu, Shu-Hong

    2016-05-23

    The full harvest of solar energy by semiconductors requires a material that simultaneously absorbs across the whole solar spectrum and collects photogenerated electrons and holes separately. The stepwise integration of three semiconducting sulfides, namely ZnS, CdS, and Cu2-x S, into a single nanocrystal, led to a unique ternary multi-node sheath ZnS-CdS-Cu2-x S heteronanorod for full-spectrum solar energy absorption. Localized surface plasmon resonance (LSPR) in the nonstoichiometric copper sulfide nanostructures enables effective NIR absorption. More significantly, the construction of pn heterojunctions between Cu2-x S and CdS leads to staggered gaps, as confirmed by first-principles simulations. This band alignment causes effective electron-hole separation in the ternary system and hence enables efficient solar energy conversion. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Interpretation FTIR spectrum of seawater and sediment in the Ambon Bay (TAD)

    NASA Astrophysics Data System (ADS)

    Patty, Diana Julaidy; Loupatty, Grace; Sopalauw, Fitria

    2017-01-01

    Research has done to interpretated FTIR spectrum of seawaters and sediment of the Ambon Bay (TAD). Analysis of samples of sediment and seawater using FTIR spectroscopy. The results showed the sand sediment samples identified Stretch bond OH group (3600-3500 cm-1), N-H Stretch (3400-3300 cm-1), C≡N (2250 cm-1), and NH bending (1640 to 1550 cm-1). And for seawater samples identified bonding group that is N-H Stretch (3400-3350 cm-1), N-H bending (1640 to 1550 cm-1) and C=O (1670-1640 cm-1). The existence of functional groups, carbonyl (C=O), alcohol (OH), carboxyl (COOH) can cause the complexation of metal cations. And the results showed analysis group N-O bond-containing compounds Nitro indicate heavy metal content of Lead (Pb) and group N-H bond-containing compound Amina indicate heavy metal content of Cadmium (Cd).

  3. Photoluminescent enhancement of CdSe/Cd(1-x) Zn(x)S quantum dots by hexadecylamine at room temperature.

    PubMed

    Yang, Jie; Yang, Ping

    2012-09-01

    CdSe/Cd(1-x) Zn(x)S core/shell quantum dots (QDs) were fabricated in 1-octadecene via a two step synthesis. CdSe cores were first prepared using CdO, trioctylphosphine (TOP) selenium, and stearic acid. Subsquently, a Cd(1-x) Zn(x)S shell coating was carried out using zinc acetate dihydrate, cadmium acetate dihydrate, TOPS, and hexadecylamine (HDA) starting materials in the friendly organic system under relatively low temperature. The absorption and photoluminescence (PL) spectra have a significant red shift after the coverage of Cd(1-x)Zn(x)S shell on CdSe cores. The X-ray diffraction analysis of samples confirmed the formation of core/shell structure. The PL quantum yields (QYs) of CdSe/Cd(1-x)Zn(x)S QDs were improved gradually with time at room temperature. This is ascribed to the surface passivation of HDA to the QDs during store. This phenomenon was confirmed by the Fourier transform infrared spectrum of samples. Namely, HDA does not capped on the surface of as-prepared QDs, in which a low PL QYs was observed (less than 10%). Being storing for certain time, HDA attached to the surface of the QDs, in which the PL QYs increased (up to 31%) and the full width at half maximum of PL spectra decreased. Moreover, the fluorescence decay curve of the core/shell QDs is closer to a biexponential decay profile and has a longer average PL lifetime. The variation of average PL lifetime also indicated the influence of HDA during store.

  4. Specific skin lesions in chronic myelomonocytic leukemia: a spectrum of myelomonocytic and dendritic cell proliferations: a study of 42 cases.

    PubMed

    Vitte, Franck; Fabiani, Bettina; Bénet, Claire; Dalac, Sophie; Balme, Brigitte; Delattre, Claire; Vergier, Béatrice; Beylot-Barry, Marie; Vignon-Pennamen, Dominique; Ortonne, Nicolas; Algros, Marie Paule; Carlotti, Agnès; Samaleire, Dimitri; Frouin, Eric; Levy, Anne; Laroche, Liliane; Theate, Ivan; Monnien, Franck; Mugneret, Francine; Petrella, Tony

    2012-09-01

    Chronic myelomonocytic leukemia (CMML) is a rare clonal hematopoietic disorder that can also involve the skin. The histopathology of these skin lesions is not clearly defined, and few data are available in the literature. To better understand tumoral skin involvements in CMML we carried out an extensive, retrospective clinicopathologic study of 42 cases selected from the database of the French Study Group of Cutaneous Lymphomas. On the basis of clinical data, morphology, and phenotype we identified 4 clinicopathologic profiles representing 4 distinct groups. The first group comprised myelomonocytic cell tumors (n=18), exhibiting a proliferation of granulocytic or monocytic blast cells, which were CD68 and/or MPO positive but negative for dendritic cell markers. The second group comprised mature plasmacytoid dendritic cell tumors (n=16), denoted by a proliferation of mature plasmacytoid dendritic cells, which were CD123, TCL1, and CD303 positive but CD56, CD1a, and S100 negative. The third group comprised blastic plasmacytoid dendritic cell tumors (n=4), characterized by a proliferation of monomorphous medium-sized blast cells, which were CD4, CD56, CD123, TCL1 positive but CD1a and S100 negative. The fourth group consisted of a putatively novel category of tumor that we named blastic indeterminate dendritic cell tumors (n=4), distinguished by a proliferation of large blast cells that not only exhibited monocytic markers but also the dendritic markers CD1a and S100. These 4 groups showed distinctive outcomes. Finally, we showed, by fluorescence in situ hybridization analysis, a clonal link between bone marrow disease and skin lesions in 4 patients. Herein, we have described a novel scheme for pathologists and physicians to handle specific lesions in CMML, which correspond to a spectrum of myelomonocytic and dendritic cell proliferations with different outcomes. A minimal panel of immunohistochemical markers including CD68, CD1a, S100, Langerin, and CD123 is necessary to make the correct classification in this spectrum of cutaneous CMML tumors, in which dendritic cell lineage plays an important role.

  5. One-pot template-free synthesis of porous CdMoO4 microspheres and their enhanced photocatalytic activity

    NASA Astrophysics Data System (ADS)

    Madhusudan, Puttaswamy; Zhang, Jinfeng; Yu, Jiaguo; Cheng, Bei; Xu, Difa; Zhang, Jun

    2016-11-01

    The optical and catalytic performances of materials strongly depend on their size, morphology, dimensionality and structure. Herein, we demonstrate a facile one-pot template free synthesis of hierarchical CdMoO4 porous microspheres via a simple low temperature oil bath method. The photoactivity of the as-prepared samples was evaluated by photocatalytic decolorization of Methyl Orange (MO) and Methylene Blue (MB) mixed dye aqueous solutions at ambient temperature under full solar spectrum. The results indicated that the concentration of ammonium molybdate and reaction time greatly influence the diameter, average crystallite size, specific surface area, pore structure and photocatalytic activity of the prepared samples. Especially, under the suitable conditions the prepared hierarchical CdMoO porous microspheres exhibited enhanced photocatalytic activity and high stability. Furthermore, it is found that the photocatalytic activity and formation rate of hydroxyl radicals greatly depend on the particle sizes and morphology of as-prepared samples. This work not only demonstrates a simple way to fabricate the hierarchical CdMoO4 porous microspheres but also shows a possibility for utilization of CdMoO4 porous microspheres for the photocatalytic treatment of waste water pollutants.

  6. Pruritic papular eruption and eosinophilic folliculitis associated with human immunodeficiency virus (HIV) infection: a histopathological and immunohistochemical comparative study.

    PubMed

    Afonso, João Paulo Junqueira Magalhães; Tomimori, Jane; Michalany, Nilceo Schwery; Nonogaki, Suely; Porro, Adriana Maria

    2012-08-01

    Among the papular-pruriginous dermatoses related to human immunodeficiency (HIV) infection, two entities remain poorly differentiated leading to confusion in their diagnosis: HIV-related pruritic papular eruption (HIV-PPE or prurigo) and eosinophilic folliculitis (HIV-EF). To establish histopathological and immunohistochemical parameters to differentiate between two conditions associated with HIV infection, the pruritic papular eruption (HIV-PPE) and eosinophilic folliculitis (HIV-EF). Clinically typical HIV-PPE (18 cases) and HIV-EF (10 cases) cases were compared with each other in terms of the following topics: clinical and laboratory features (gender, age, CD4+ cell and eosinophil count), histopathological features (hematoxylin-eosin and toluidine blue staining) and immunohistochemical features (anti-CD1a, anti-CD4, anti-CD7, anti-CD8, anti-CD15, anti-CD20, anti-CD30, anti-CD68/macrophage and anti-S-100 reactions). Among the HIV-EF patients, we found an intense perivascular and diffuse inflammatory infiltration compared with those patients with HIV-PPE. The tissue mast cell count by toluidine staining was higher in the HIV-EF patients, who also presented higher expression levels of CD15 (for eosinophils), CD4 (T helper), and CD7 (pan-T lymphocytes) than the HIV-PPE patients. Only quantitative differences and not qualitative differences were found. These data indicate that HIV-related PPE and EF could possibly be differentiated by histopathological and immunohistochemical findings in addition to clinical characteristics. In fact, these two inflammatory manifestations could be within the spectrum of the same disease because only quantitative, and not qualitative, differences were found. Copyright © 2011 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  7. CD Rainbows

    ERIC Educational Resources Information Center

    Ouseph, P. J.

    2007-01-01

    Several papers have been published on the use of a CD as a grating for undergraduate laboratories and/or for high school and college class demonstrations. Four years ago "The Physics Teacher" had a spectacular cover picture showing emission spectrum as viewed through a CD with no coating. That picture gave the impetus to develop a system that can…

  8. Quaternary schematics for property engineering of CdSe thin films

    NASA Astrophysics Data System (ADS)

    Chavan, G. T.; Pawar, S. T.; Prakshale, V. M.; Sikora, A.; Pawar, S. M.; Chaure, N. B.; Kamble, S. S.; Maldar, N. N.; Deshmukh, L. P.

    2017-12-01

    The synthesis of quaternary Cd1-xZnxSySe1-y (0 ≤ x = y ≤ 0.35) thin films was done through indigenously developed chemical solution growth process. As-obtained thin films were subjected to the physical, chemical, structural and optical characterizations. The nearly hydrophobic nature of the as-deposited films except binary CdSe was observed through the wettability studies. The colorimetric studies supported a change in physical color attributes. The elemental analysis done confirmed the formation of Cd(Zn, S)Se and the chemical states of constituent elements as Cd2+, Zn2+, S2- and Se2-. Structural assessment suggested the formation of the polycrystalline quaternary phase of the hexagonal wurtzite structure. The Raman spectroscopy was also employed for the confirmation studies on Cd1-xZnxSySe1-y thin films. Morphological observations indicated microstructural transformation from an aggregated bunch of nano-sized globular grains into a rhomboid network of petal/flakes like crystallites. The atomic force micrographs (AFM) revealed the enhancement in the hillock structures. From advanced AFM characterizations, we observed that the CdSe thin film has leptokurtic (Sku = 3.23) surface, whereas, quaternary Cd(Zn, S)Se films have platykurtic (Sku < 3) surface. The orientation of the surface morphology was observed through the angular spectrum studies. The optical absorption studies revealed direct allowed transition for the films with a continuous modulation of the energy bandgap from 1.8 eV to 2.31 eV.

  9. Morphology, structure and optical properties of hydrothermally synthesized CeO2/CdS nanocomposites

    NASA Astrophysics Data System (ADS)

    Mohanty, Biswajyoti; Nayak, J.

    2018-04-01

    CeO2/CdS nanocomposites were synthesized using a two-step hydrothermal technique. The effects of precursor concentration on the optical and structural properties of the CeO2/CdS nanoparticles were systematically studied. The morphology, composition and the structure of the CeO2/CdS nanocomposite powder were studied by scanning electron microscopy (SEM), energy dispersive X-ray spectrum analysis (EDXA) and X-ray diffraction (XRD), respectively. The optical properties of CeO2/CdS nanocomposites were studied by UV-vis absorption and photoluminescence (PL) spectroscopy. The optical band gaps of the CeO2/CdS nanopowders ranged from 2.34 eV to 2.39 eV as estimated from the UV-vis absorption. In the room temperature photoluminescence spectrum of CeO2/CdS nanopowder, a strong blue emission band was observed at 400 nm. Since the powder shows strong visible luminescence, it may be used as a blue phosphor in future. The original article published with this DOI was submitted in error. The correct article was inadvertently left out of the original submission. This has been rectified and the correct article was published online on 16 April 2018.

  10. Systematic investigation on Cadmium-incorporation in Li₂FeSiO₄/C cathode material for lithium-ion batteries.

    PubMed

    Zhang, Lu-Lu; Duan, Song; Yang, Xue-Lin; Liang, Gan; Huang, Yun-Hui; Cao, Xing-Zhong; Yang, Jing; Ni, Shi-Bing; Li, Ming

    2014-05-27

    Cadmium-incorporated Li2FeSiO4/C composites have been successfully synthesized by a solid-state reaction assisted with refluxing. The effect and mechanism of Cd-modification on the electrochemical performance of Li2FeSiO4/C were investigated in detail by X-ray powder diffraction, X-ray photoelectron spectroscopy, scanning electron microscopy, Raman spectra, transmission electron microscopy, positron annihilation lifetime spectroscopy and Doppler broadening spectrum, and electrochemical measurements. The results show that Cd not only exists in an amorphous state of CdO on the surface of LFS particles, but also enters into the crystal lattice of LFS. Positron annihilation lifetime spectroscopy and Doppler broadening spectrum analyses verify that Cd-incorporation increases the defect concentration and the electronic conductivity of LFS, thus improve the Li(+)-ion diffusion process. Furthermore, our electrochemical measurements verify that an appropriate amount of Cd-incorporation can achieve a satisfied electrochemical performance for LFS/C cathode material.

  11. Systematic investigation on Cadmium-incorporation in Li2FeSiO4/C cathode material for lithium-ion batteries

    PubMed Central

    Zhang, Lu-Lu; Duan, Song; Yang, Xue-Lin; Liang, Gan; Huang, Yun-Hui; Cao, Xing-Zhong; Yang, Jing; Ni, Shi-Bing; Li, Ming

    2014-01-01

    Cadmium-incorporated Li2FeSiO4/C composites have been successfully synthesized by a solid-state reaction assisted with refluxing. The effect and mechanism of Cd-modification on the electrochemical performance of Li2FeSiO4/C were investigated in detail by X-ray powder diffraction, X-ray photoelectron spectroscopy, scanning electron microscopy, Raman spectra, transmission electron microscopy, positron annihilation lifetime spectroscopy and Doppler broadening spectrum, and electrochemical measurements. The results show that Cd not only exists in an amorphous state of CdO on the surface of LFS particles, but also enters into the crystal lattice of LFS. Positron annihilation lifetime spectroscopy and Doppler broadening spectrum analyses verify that Cd-incorporation increases the defect concentration and the electronic conductivity of LFS, thus improve the Li+-ion diffusion process. Furthermore, our electrochemical measurements verify that an appropriate amount of Cd-incorporation can achieve a satisfied electrochemical performance for LFS/C cathode material. PMID:24860942

  12. Preparation of High Purity CdTe for Nuclear Detector: Electrical and Nuclear Characterization

    NASA Astrophysics Data System (ADS)

    Zaiour, A.; Ayoub, M.; Hamié, A.; Fawaz, A.; Hage-ali, M.

    High purity crystal with controllable electrical properties, however, control of the electrical properties of CdTe has not yet been fully achieved. Using the refined Cd and Te as starting materials, extremely high-purity CdTe single crystals were prepared by the traditional vertical THM. The nature of the defects involved in the transitions was studied by analyzing the position of the energy levels by TSC method. The resolution of 4.2 keV (FWHM) confirms the high quality and stability of the detectors: TSC spectrum was in coherence with detectors spectrum with a horizontal plate between 0.2 and 0.6 eV. The enhancement in resolution of detectors with a full width at half- maximum (less than 0.31 meV), lead to confirm that the combination of vacuum distillation and zone refining was very effective to obtain more purified CdTe single crystals for photovoltaic or nuclear detectors with better physical properties.

  13. Fabrication of an Organic Light-Emitting Diode from New Host π Electron Rich Zinc Complex

    NASA Astrophysics Data System (ADS)

    Jafari, Mohammad Reza; Janghouri, Mohammad; Shahedi, Zahra

    2017-01-01

    A new π electron rich zinc complex was used as a fluorescent material in organic light-emitting diodes (OLEDs). Devices with a structure of indium tin oxide/poly (3,4-ethylenedi-oxythiophene):poly(styrenesulfonate) (PEDOT: PSS) (50 nm)/polyvinylcarbazole (60 nm)/Zn: %2 porphyrin derivatives (45 nm)/Al (150 nm) were fabricated. Porphyrin derivatives accounting for 2 wt.% in the π electron rich zinc complex were used as a host. The electroluminescence (EL) spectra of porphyrin derivatives indicated a red shift, as π electron rich zinc complex EL spectra. The device (4) has also a luminance of 3420 cd/m2 and maximum efficiency of 1.58 cd/A at 15 V, which are the highest values among four devices. The result of Commission International del'Eclairage (CIE) (X, Y) coordinate and EL spectrum of device (3) indicated that it is more red shifted compared to other devices. Results of this work indicate that π electron rich zinc complex is a promising host material for high efficiency red OLEDs and has a simple structure compared to Alq3-based devices.

  14. Syntheses, structures and luminescent properties of zero-/two-dimensional Cd(II) and Eu(III) complexes

    NASA Astrophysics Data System (ADS)

    Fan, Rui-Qing; Wang, Li-Yuan; Wang, Ping; Chen, Hong; Sun, Cun-fa; Yang, Yu-Lin; Su, Qing

    2012-12-01

    Three metal-organic complexes Cd(HBIDC)(phen)2·4H2O (1), [Cd(BIC)(phen)]n (2) and {[Eu(HBIDC)(H2BIDC)(H2O)]·H2O}n (3) (H3BIDC=benzimidazole-5,6-dicarboxylic acid, H2BIC=benzimidazole-6-carboxylic acid, phen=1,10-phenanthroline) have been synthesized under hydro(solvo)thermal conditions and structurally characterized by elemental analysis, IR spectrum, and single-crystal X-ray diffraction. With similar reaction conditions, reactions of the same ligand with different metal cations selected from different blocks (d-block and f-block) result in different coordination modes of carboxylate groups and final frameworks of complexes 1 and 3. The decarboxylation was observed in complex 2 and resulted in the formation of BIC2- ligand. Complexes 1-3 have intense fluorescent emissions at room temperature in dimethylsulfoxide (DMSO) solution and in the solid-state, which indicate they are potential fluorescence materials. The quantum yields and fluorescence lifetimes of these three complexes were systematically studied.

  15. Spectroscopy characterization and quantum yield determination of quantum dots

    NASA Astrophysics Data System (ADS)

    Contreras Ortiz, S. N.; Mejía Ospino, E.; Cabanzo, R.

    2016-02-01

    In this paper we show the characterization of two kinds of quantum dots: hydrophilic and hydrophobic, with core and core/shell respectively, using spectroscopy techniques such as UV-Vis, fluorescence and Raman. We determined the quantum yield in the quantum dots using the quinine sulphate as standard. This salt is commonly used because of its quantum yield (56%) and stability. For the CdTe excitation, we used a wavelength of 549nm and for the CdSe/ZnS excitation a wavelength of 527nm. The results show that CdSe/ZnS (49%) has better fluorescence, better quantum dots, and confirm the fluorescence result. The quantum dots have shown a good fluorescence performance, so this property will be used to replace dyes, with the advantage that quantum dots are less toxic than some dyes like the rhodamine. In addition, in this work we show different techniques to find the quantum dots emission: fluorescence spectrum, synchronous spectrum and Raman spectrum.

  16. Antimicrobial peptide from mucus of Andrias davidianus: screening and purification by magnetic cell membrane separation technique.

    PubMed

    Pei, Jinjin; Jiang, Lei

    2017-07-01

    Andrias davidianus, the Chinese giant salamander, has been used in traditional Chinese medicine for many decades. However, no antimicrobial peptides (AMPs) have been described from A. davidianus until now. Here we describe a novel AMP (andricin 01) isolated from the mucus of A. davidianus. The peptide was recovered using an innovative magnetic cell membrane separation technique and was characterised using mass spectrometry and circular dichroism (CD) spectroscopy. Andricin 01 is comprised of ten amino acid residues with a total molecular mass of 955.1 Da. CD spectrum analysis gave results similar to the archetypal random coil spectrum, consistent with the three-dimensional rendering calculated by current bioinformatics tools. Andricin 01 was found to be inhibitory both to Gram-negative and Gram-positive bacteria. Furthermore, the peptide at the minimal bacterial concentration did not show cell cytotoxicity against human hepatocytes or renal cells and did not show haemolytic activity against red blood cells, indicating that is potentially safe and effective for human use. Andricin 01 shows promise as a novel antibacterial that may provide an insight into the development of new drugs. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  17. Clinical spectrum of Castleman disease–associated neuropathy

    PubMed Central

    Naddaf, Elie; Dispenzieri, Angela; Mandrekar, Jay

    2016-01-01

    Objective: To define the peripheral neuropathy phenotypes associated with Castleman disease. Methods: We conducted a retrospective chart review for patients with biopsy-proven Castleman disease evaluated between January 2003 and December 2014. Patients with associated peripheral neuropathy were identified and divided into 2 groups: those with Castleman disease without POEMS syndrome (CD-PN) and those with Castleman disease with POEMS syndrome (CD-POEMS). We used a cohort of patients with POEMS as controls. Clinical, electrodiagnostic, and laboratory characteristics were collected and compared among patient subgroups. Results: There were 7 patients with CD-PN, 20 with CD-POEMS, and 122 with POEMS. Patients with CD-PN had the mildest neuropathy characterized by predominant sensory symptoms with no pain and mild distal sensory deficits (median Neuropathy Impairment Score of 7 points). Although both patients with CD-POEMS and patients with POEMS had a severe sensory and motor neuropathy, patients with CD-POEMS were less affected (median Neuropathy Impairment Score of 33 and 66 points, respectively). The degree of severity was also reflected on electrodiagnostic testing in which patients with CD-PN demonstrated a mild degree of axonal loss, followed by patients with CD-POEMS and then those with POEMS. Demyelinating features, defined by European Federation of Neurologic Societies/Peripheral Nerve Society criteria, were present in 43% of the CD-PN, 78% of the CD-POEMS, and 86% of the POEMS group. Conclusion: There is a spectrum of demyelinating peripheral neuropathies associated with Castleman disease. CD-PN is sensory predominant and is the mildest phenotype, whereas CD-POEMS is a more severe sensory and motor neuropathy. Compared to the POEMS cohort, those with CD-POEMS neuropathy have a similar but less severe phenotype. Whether these patients respond differently to treatment deserves further study. PMID:27807187

  18. Clinical spectrum of Castleman disease-associated neuropathy.

    PubMed

    Naddaf, Elie; Dispenzieri, Angela; Mandrekar, Jay; Mauermann, Michelle L

    2016-12-06

    To define the peripheral neuropathy phenotypes associated with Castleman disease. We conducted a retrospective chart review for patients with biopsy-proven Castleman disease evaluated between January 2003 and December 2014. Patients with associated peripheral neuropathy were identified and divided into 2 groups: those with Castleman disease without POEMS syndrome (CD-PN) and those with Castleman disease with POEMS syndrome (CD-POEMS). We used a cohort of patients with POEMS as controls. Clinical, electrodiagnostic, and laboratory characteristics were collected and compared among patient subgroups. There were 7 patients with CD-PN, 20 with CD-POEMS, and 122 with POEMS. Patients with CD-PN had the mildest neuropathy characterized by predominant sensory symptoms with no pain and mild distal sensory deficits (median Neuropathy Impairment Score of 7 points). Although both patients with CD-POEMS and patients with POEMS had a severe sensory and motor neuropathy, patients with CD-POEMS were less affected (median Neuropathy Impairment Score of 33 and 66 points, respectively). The degree of severity was also reflected on electrodiagnostic testing in which patients with CD-PN demonstrated a mild degree of axonal loss, followed by patients with CD-POEMS and then those with POEMS. Demyelinating features, defined by European Federation of Neurologic Societies/Peripheral Nerve Society criteria, were present in 43% of the CD-PN, 78% of the CD-POEMS, and 86% of the POEMS group. There is a spectrum of demyelinating peripheral neuropathies associated with Castleman disease. CD-PN is sensory predominant and is the mildest phenotype, whereas CD-POEMS is a more severe sensory and motor neuropathy. Compared to the POEMS cohort, those with CD-POEMS neuropathy have a similar but less severe phenotype. Whether these patients respond differently to treatment deserves further study. © 2016 American Academy of Neurology.

  19. White random lasing in mixture of ZnSe, CdS and CdSSe micropowders

    NASA Astrophysics Data System (ADS)

    Alyamani, A. Y.; Leanenia, M. S.; Alanazi, L. M.; Aljohani, M. M.; Aljariwi, A. A.; Rzheutski, M. V.; Lutsenko, E. V.; Yablonskii, G. P.

    2016-03-01

    Room temperature random lasing with white light emission in a mixture of AIIBVI semiconductor powders was achieved for the first time. The scattering gain media was formed by the mixture of closely packed active micron sized crystallites of ZnSe, CdS, CdSSe semiconductors. The micropowders were produced by grinding bulk crystals of each compound. Optical excitation was performed by 10-nanosecond pulses of tuned Ti:Al2O3-laser at 390 nm. The lasing in the mixture of semiconductor powders was achieved simultaneously at four wavelengths in blue, green, yellow and red spectral regions after exceeding the threshold excitation power density. A drastic integral intensity increase, spectrum narrowing and appearance of mode structure accompanied the laser action. ZnSe crystallites produce the laser light at about 460 nm while CdS particles - at about 520 nm. Two types of CdSSe semiconductor micropowders with different sulfur content lase at 580 nm and 660 nm. The threshold excitation power densities for all laser lines in the emission spectrum are approximately the same of about 0.9 MW/cm2. The sum of the emission spectrum of the mixture of the micropowders forms white light with high brightness. Lasing is due to an appearance of random feedback for amplified radiation in the active medium of closely packed light scattering crystallites. The presented results may find their applications for visualization systems, lighting technology, data transmission, medicine as biosensors and in identification systems. The key feature of random lasers is low cost of its production and possibility to be deposited on any type of surface.

  20. Detector response function of an energy-resolved CdTe single photon counting detector.

    PubMed

    Liu, Xin; Lee, Hyoung Koo

    2014-01-01

    While spectral CT using single photon counting detector has shown a number of advantages in diagnostic imaging, knowledge of the detector response function of an energy-resolved detector is needed to correct the signal bias and reconstruct the image more accurately. The objective of this paper is to study the photo counting detector response function using laboratory sources, and investigate the signal bias correction method. Our approach is to model the detector response function over the entire diagnostic energy range (20 keV

  1. Ab initio calculations of supramolecular complexes of fullerene C60 with CdTe and CdS

    NASA Astrophysics Data System (ADS)

    Kvyatkovskii, O. E.; Zakharova, I. B.; Ziminov, V. M.

    2014-06-01

    This paper presents the results of ab initio quantum-chemical calculations of supramolecular complexes C60CdHal, [C60]4CdHal, and [C60]6CdHal (Hal = S, Te), which simulate the defects forming in fullerite during the absorption or adsorption of cadmium telluride (sulfide). Calculations of the electronic structure of complexes with inclusion of their relaxation to the equilibrium state have been performed in terms of the density functional theory with the B3LYP hybrid functional. The obtained enthalpies of formation of complexes show that their formation leads to the energy gain of the order of 0.5-1.5 eV depending on the complex type. It has been shown that the formation of tetrahedral complexes [C60]4CdTe with the intercalated CdTe molecule is possible only with a considerable distortion of the tetrahedral void. The energy spectrum of low-lying excited electron states for the linear and octahedral complexes has been calculated. It has been found that a decrease in symmetry with the formation of complexes leads to the appearance of excited states of allowed singlet transitions in the electron spectrum, which are forbidden in optical spectra of initial components.

  2. Magneto-optical spectrum and the effective excitonic Zeeman splitting energies of Mn and Co-doped CdSe nanowires

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiong, Wen, E-mail: wenxiong@cqu.edu.cn; Chen, Wensuo

    2013-12-21

    The electronic structure of Mn and Co-doped CdSe nanowires are calculated based on the six-band k·p effective-mass theory. Through the calculation, it is found that the splitting energies of the degenerate hole states in Mn-doped CdSe nanowires are larger than that in Co-doped CdSe nanowires when the concentration of these two kinds of magnetic ions is the same. In order to analysis the magneto-optical spectrum of Mn and Co-doped CdSe nanowires, the four lowest electron states and the four highest hole states are sorted when the magnetic field is applied, and the 10 lowest optical transitions between the conduction subbandsmore » and the valence subbands at the Γ point in Mn and Co-doped CdSe nanowires are shown in the paper, it is found that the order of the optical transitions at the Γ point almost do not change although two different kinds of magnetic ions are doped in CdSe nanowires. Finally, the effective excitonic Zeeman splitting energies at the Γ point are found to increase almost linearly with the increase of the concentration of the magnetic ions and the magnetic field; meanwhile, the giant positive effective excitonic g factors in Mn and Co-doped CdSe nanowires are predicted based on our theoretical calculation.« less

  3. Rationally Controlled Synthesis of CdSexTe1-x Alloy Nanocrystals and Their Application in Efficient Graded Bandgap Solar Cells.

    PubMed

    Wen, Shiya; Li, Miaozi; Yang, Junyu; Mei, Xianglin; Wu, Bin; Liu, Xiaolin; Heng, Jingxuan; Qin, Donghuan; Hou, Lintao; Xu, Wei; Wang, Dan

    2017-11-08

    CdSe x Te 1-x semiconductor nanocrystals (NCs), being rod-shaped/irregular dot-shaped in morphology, have been fabricated via a simple hot-injection method. The NCs composition is well controlled through varying molar ratios of Se to Te precursors. Through changing the composition of the CdSe x Te 1-x NCs, the spectral absorption of the NC thin film between 570-800 nm is proved to be tunable. It is shown that the bandgap of homogeneously alloyed CdSe x Te 1-x active thin film is nonlinearly correlated with the different compositions, which is perceived as optical bowing. The solar cell devices based on CdSe x Te 1-x NCs with the structure of ITO/ZnO/CdSe/CdSe x Te 1-x /MoO x /Au and the graded bandgap ITO/ZnO/CdSe( w / o )/CdSe x Te 1-x /CdTe/MoO x /Au are systematically evaluated. It was found that the performance of solar cells degrades almost linearly with the increase of alloy NC film thickness with respect to ITO/ZnO/CdSe/CdSe 0.2 Te 0.8 /MoO x /Au. From another perspective, in terms of the graded bandgap structure of ITO/ZnO/CdSe/CdSe x Te 1-x /CdTe/MoO x /Au, the performance is improved in contrast with its single-junction analogues. The graded bandgap structure is proved to be efficient when absorbing spectrum and the solar cells fabricated under the structure of ITO/ZnO/CdSe 0.8 Te 0.2 /CdSe 0.2 Te 0.8 /CdTe/MoO x /Au indicate power conversion efficiency (PCE) of 6.37%, a value among the highest for solution-processed inversely-structured CdSe x Te 1-x NC solar cells. As the NC solar cells are solution-processed under environmental conditions, they are promising for fabricating solar cells at low cost, roll by roll and in large area.

  4. Rationally Controlled Synthesis of CdSexTe1−x Alloy Nanocrystals and Their Application in Efficient Graded Bandgap Solar Cells

    PubMed Central

    Wen, Shiya; Li, Miaozi; Yang, Junyu; Mei, Xianglin; Wu, Bin; Liu, Xiaolin; Heng, Jingxuan; Hou, Lintao; Xu, Wei; Wang, Dan

    2017-01-01

    CdSexTe1−x semiconductor nanocrystals (NCs), being rod-shaped/irregular dot-shaped in morphology, have been fabricated via a simple hot-injection method. The NCs composition is well controlled through varying molar ratios of Se to Te precursors. Through changing the composition of the CdSexTe1−x NCs, the spectral absorption of the NC thin film between 570–800 nm is proved to be tunable. It is shown that the bandgap of homogeneously alloyed CdSexTe1−x active thin film is nonlinearly correlated with the different compositions, which is perceived as optical bowing. The solar cell devices based on CdSexTe1−x NCs with the structure of ITO/ZnO/CdSe/CdSexTe1−x/MoOx/Au and the graded bandgap ITO/ZnO/CdSe(w/o)/CdSexTe1−x/CdTe/MoOx/Au are systematically evaluated. It was found that the performance of solar cells degrades almost linearly with the increase of alloy NC film thickness with respect to ITO/ZnO/CdSe/CdSe0.2Te0.8/MoOx/Au. From another perspective, in terms of the graded bandgap structure of ITO/ZnO/CdSe/CdSexTe1−x/CdTe/MoOx/Au, the performance is improved in contrast with its single-junction analogues. The graded bandgap structure is proved to be efficient when absorbing spectrum and the solar cells fabricated under the structure of ITO/ZnO/CdSe0.8Te0.2/CdSe0.2Te0.8/CdTe/MoOx/Au indicate power conversion efficiency (PCE) of 6.37%, a value among the highest for solution-processed inversely-structured CdSexTe1−x NC solar cells. As the NC solar cells are solution-processed under environmental conditions, they are promising for fabricating solar cells at low cost, roll by roll and in large area. PMID:29117132

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Chen; Paudel, Naba R.; Yan, Yanfa

    Atom probe tomography (APT) data acquired from a CAMECA LEAP 4000 XHR for the CdS/CdTe interface for a non-CdCl 2 treated CdTe solar cell as well as the mass spectrum of an APT data set including a GB in a CdCl 2-treated CdTe solar cell are presented. Scanning electron microscopy (SEM) data showing the evolution of sample preparation for APT and scanning transmission electron microscopy (STEM) electron beam induced current (EBIC) are also presented. As a result, these data show mass spectrometry peak decomposition of Cu and Te within an APT dataset, the CdS/CdTe interface of an untreated CdTe solarmore » cell, preparation of APT needles from the CdS/CdTe interface in superstrate grown CdTe solar cells, and the preparation of a cross-sectional STEM EBIC sample.« less

  6. Changes in antiretroviral therapy guidelines: implications for public health policy and public purses.

    PubMed

    Hamilton, Alex; Garcia-Calleja, Jesus M; Vitoria, Marco; Gilks, Charles; Souteyrand, Yves; De Cock, Kevin; Crowley, Siobhan

    2010-10-01

    The World Health Organization (WHO) published a revision of the antiretroviral therapy (ART) guidelines and now recommends ART for all those with a CD4 cell count ≤350/mm(3), for people with HIV and active tuberculosis (TB) or chronic active hepatitis B irrespective of CD4 cell count and all HIV-positive pregnant women. A study was undertaken to estimate the impact of the new guidelines using four countries as examples. The current WHO/UNAIDS country projections were accessed based on the 2007 estimates for Zambia, Kenya, Cameroon and Vietnam. New projections were created using Spectrum. CD4 progression rates to need for ART were modified and compared with the baseline projections. The pattern of increased need for treatment is similar across the four projections. Initiating treatment at a CD4 count <250/mm(3) will increase the need for treatment by a median of 22% immediately, initiating ART at a CD4 count <350/mm(3) increases the need for treatment by a median of 60%, and the need for treatment doubles if ART is commenced at a CD4 count <500/mm(3). Initiating ART at a CD4 cell count <250/mm(3) would increase the need for treatment by a median of around 15% in 2012; initiating treatment at a CD4 count <350/mm(3) increases the need for treatment by a median of 42% across the same projections and about 84% if CD4 <500/mm(3) was used. The projections indicate that initiating ART earlier in the course of the disease by increasing the threshold for the initiation of ART would increase the numbers of adults in need of treatment immediately and in the future.

  7. APT mass spectrometry and SEM data for CdTe solar cells

    DOE PAGES

    Li, Chen; Paudel, Naba R.; Yan, Yanfa; ...

    2016-03-16

    Atom probe tomography (APT) data acquired from a CAMECA LEAP 4000 XHR for the CdS/CdTe interface for a non-CdCl 2 treated CdTe solar cell as well as the mass spectrum of an APT data set including a GB in a CdCl 2-treated CdTe solar cell are presented. Scanning electron microscopy (SEM) data showing the evolution of sample preparation for APT and scanning transmission electron microscopy (STEM) electron beam induced current (EBIC) are also presented. As a result, these data show mass spectrometry peak decomposition of Cu and Te within an APT dataset, the CdS/CdTe interface of an untreated CdTe solarmore » cell, preparation of APT needles from the CdS/CdTe interface in superstrate grown CdTe solar cells, and the preparation of a cross-sectional STEM EBIC sample.« less

  8. Effect of lateral size and thickness on the electronic structure and optical properties of quasi two-dimensional CdSe and CdS nanoplatelets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bose, Sumanta; Fan, W. J., E-mail: ewjfan@ntu.edu.sg; Zhang, D. H.

    2016-04-14

    The effect of lateral size and vertical thickness of CdSe and CdS nanoplatelets (NPLs) on their electronic structure and optical properties are investigated using an effective-mass envelope function theory based on the 8-band k ⋅ p model with valence force field considerations. Volumetrically larger NPLs have lower photon emission energy due to limited quantum confinement, but a greater transition matrix element (TME) due to larger electron-hole wavefunction overlap. The optical gain characteristics depend on several factors such as TME, Fermi factor, carrier density, NPL dimensions, material composition, and dephasing rate. There is a red shift in the peak position, moremore » so with an increase in thickness than lateral size. For an increasing carrier density, the gain spectrum undergoes a slight blue shift due to band filling effect. For a fixed carrier density, the Fermi factor is higher for volumetrically larger NPLs and so is the difference between the quasi-Fermi level separation and the effective bandgap. The transparency injection carrier density (and thus input current density threshold) is dimension dependent and falls for volumetrically larger NPLs, as they can attain the requisite exciton count for transparency with a relatively lower density. Between CdSe and CdS, CdSe has lower emission energy due to smaller bandgap, but a higher TME due to lower effective mass. CdS, however, has a higher so hole contribution due to a lower spin-orbit splitting energy. Both CdSe and CdS NPLs are suitable candidates for short-wavelength LEDs and lasers in the visible spectrum, but CdSe is expected to exhibit better optical performance.« less

  9. PDB2CD: a web-based application for the generation of circular dichroism spectra from protein atomic coordinates.

    PubMed

    Mavridis, Lazaros; Janes, Robert W

    2017-01-01

    Circular dichroism (CD) spectroscopy is extensively utilized for determining the percentages of secondary structure content present in proteins. However, although a large contributor, secondary structure is not the only factor that influences the shape and magnitude of the CD spectrum produced. Other structural features can make contributions so an entire protein structural conformation can give rise to a CD spectrum. There is a need for an application capable of generating protein CD spectra from atomic coordinates. However, no empirically derived method to do this currently exists. PDB2CD has been created as an empirical-based approach to the generation of protein CD spectra from atomic coordinates. The method utilizes a combination of structural features within the conformation of a protein; not only its percentage secondary structure content, but also the juxtaposition of these structural components relative to one another, and the overall structure similarity of the query protein to proteins in our dataset, the SP175 dataset, the 'gold standard' set obtained from the Protein Circular Dichroism Data Bank (PCDDB). A significant number of the CD spectra associated with the 71 proteins in this dataset have been produced with excellent accuracy using a leave-one-out cross-validation process. The method also creates spectra in good agreement with those of a test set of 14 proteins from the PCDDB. The PDB2CD package provides a web-based, user friendly approach to enable researchers to produce CD spectra from protein atomic coordinates. http://pdb2cd.cryst.bbk.ac.uk CONTACT: r.w.janes@qmul.ac.ukSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  10. Growth and optical investigations of high quality individual CdTe/(Cd,Mg)Te core/shell nanowires.

    PubMed

    Wojnar, P; Płachta, J; Kret, S; Kaleta, A; Zaleszczyk, W; Szymura, M; Wiater, M; Baczewski, L T; Pietruczik, A; Karczewski, G; Wojtowicz, T; Kossut, J

    2017-01-27

    CdTe nanowires with the average diameter of only 40 nm coated with (Cd,Mg)Te shells are grown using Au-catalyzed vapor-liquid-solid growth mechanism in a system for molecular beam epitaxy. High optical quality of individual nanowires is revealed by means of low temperature cathodoluminescence and micro-luminescence. It is found that, the optical emission spectrum consists mostly of the near band edge emission without any significant contribution of defect related luminescence. Moreover, the importance of surface passivation with (Cd,Mg)Te coating shells is demonstrated.

  11. Spectrum and immunophenotyping of 653 patients with B-cell chronic lymphoproliferative disorders in China: A single-centre analysis.

    PubMed

    Miao, Yi; Cao, Lei; Sun, Qian; Li, Xiao-Tong; Wang, Yan; Qiao, Chun; Wang, Li; Wang, Rong; Qiu, Hai-Rong; Xu, Wei; Li, Jian-Yong; Wu, Yu-Jie; Fan, Lei

    2018-02-01

    The incidence of B-cell chronic lymphoproliferative disorders (B-CLPDs) is significantly lower in China than that in western countries. There have been studies involving small cohorts with conflicting results regarding the spectrum of B-CLPDs in China, and the types and immunophenotyping of B-CLPDs in China remain largely unexplored. We conducted a retrospective analysis of 653 cases of B-CLPDs seen in our centre from 2011 to 2015. Four-colour flow cytometry was used to determine the expression of each immunological marker, and the diagnostic values of the immunological markers were also investigated. Chronic lymphocytic leukaemia (CLL) was the most common type of B-CLPD, which was consistent with that in west countries. However, the proportions of CLL (55.9%), follicular lymphoma (2.6%), and hairy cell leukaemia (0.2%) were lower, while the proportion of lymphoplasmacytic lymphoma/WaldenstrÖm macroglobulinaemia (5.4%) was higher in China, as compared with western countries. With respect to immunophenotypic characteristics, CD23 (31.7%) was more frequently expressed in mantle cell lymphoma (MCL) in our cohort than that in western countries. Immunophenotyping was useful in differentiating MCL from CLL or B-cell prolymphocytic leukaemia and lymphoplasmacytic lymphoma/WaldenstrÖm macroglobulinaemia from splenic marginal zone lymphoma. CD200 was of better diagnostic performance (accuracy: 94.6%) in differentiating CLL from MCL compared with CD23 (accuracy: 93.3%). Some cases of B-CPLDs, however, had no definite diagnoses, which were diagnosed as CD5 + B-CPLDs unclassified (7.7%) and CD5 - B-CPLDs unclassified (15.8%). This is the largest study that systematically explores the spectrum and immunophenotyping of B-CLPDs in Asia, confirming that spectrum of B-CLPDs in China was different from that in western countries. The immunophenotypic features of B-CLPDs were similar between China and western countries, although a few disparities exist. Cases with no definite diagnoses warrant further studies in the future. Copyright © 2017 John Wiley & Sons, Ltd.

  12. Magnetic circular dichroism of CdTe nanoparticles

    NASA Astrophysics Data System (ADS)

    Malakhovskii, A. V.; Sokolov, A. E.; Tsipotan, A. S.; Zharkov, S. M.; Zabluda, V. N.

    2018-04-01

    Magnetic circular dichroism (MCD) of water-soluble CdTe nanoparticles was observed in the visible spectral range for the first time. Diameter of nanoparticles varied from 2.3 to 4.5 nm. Absorption and photoluminescence spectra were also recorded. Absorption line at 19400 cm-1 and luminescent line at 18200 cm-1 were observed. Splitting of value 960 cm-1 was revealed in the MCD spectrum. Approximately the same splitting was extracted from the absorption spectrum. The MCD was identified as the temperature independent paramagnetic mixing effect. Nature of the absorption line and of its splitting are discussed.

  13. Identification of CD56 and CD57 by flow cytometry in Ewing's sarcoma or primitive neuroectodermal tumor.

    PubMed

    Gardner, L J; Polski, J M; Fallon, R; Dunphy, C H

    1998-07-01

    CD56 and CD57 are commonly considered as natural killer and neuroectodermal markers, but their expression has been identified in a wide spectrum of neoplasms including some cases of Ewing's sarcoma (ES) and primitive neuroectodermal tumor (PNET). We report two cases of small, round blue cell tumor (SRBCT), in which flow cytometry immunophenotyping (FCI) detected strong expression of CD56 and CD57 (one case). Immunohistochemical staining with Leu-19 and Leu-7 confirmed the FI results. Although CD56 and CD57 expression is consistent with ES/PNET, it can be potentially misleading if results of FCI are interpreted in the absence of other findings. These cases suggest the utility of FCI in undifferentiated SRBCT. The literature on CD56 and CD57 expression in ES/PNET is reviewed and discussed.

  14. Hodgkin's disease and CD30-positive anaplastic large cell lymphomas--a continuous spectrum of malignant disorders. A quantitative morphometric and immunohistologic study.

    PubMed Central

    Leoncini, L.; Del Vecchio, M. T.; Kraft, R.; Megha, T.; Barbini, P.; Cevenini, G.; Poggi, S.; Pileri, S.; Tosi, P.; Cottier, H.

    1990-01-01

    The authors have examined cellular areas of lymphoma tissue in 28 cases of Hodgkin's disease (HD) or anaplastic large cell lymphoma (ALCL, 'Ki-1 cell lymphoma') to evaluate the boundaries between the two entities. Methods applied included conventional histology; test point analysis; semiautomated morphometry of nuclear profile features of Reed-Sternberg and other atypical large cells (RSALCs); and immunohistochemistry of these elements on all paraffin sections and, in 15 cases, on frozen sections. Mean nuclear profile morphotypes of RSALCs per case varied independently of immunophenotype and histologic diagnosis. Conversely, immunohistochemistry demonstrated significant, although not consistent, preferential positivities of these CD30+ elements for CD15 in HD, and for epithelial membrane antigen (EMA) and CD43 in ALCLs. In the latter, RSALCs also exhibited a tendency for CD45 and CD45RO positivity and for the expression of T-cell-associated antigens. However, there were considerable overlaps. This continuous spectrum of RSALC nuclear profile morphotypes and immunophenotypes, ranging from HD over questionable cases, intermediate between HD and ALCL, to ALCLs, was paralleled by differences in the reactive component of lymphomas. Lymphocytes and granulocytes were significantly deficient in ALCLs. Images Figure 1 PMID:2173409

  15. Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing.

    PubMed

    Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N

    2017-12-01

    We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

  16. Evaluation of the photoprotective effect of β-cyclodextrin on the emission of volatile degradation products of ranitidine.

    PubMed

    Jamrógiewicz, Marzena; Wielgomas, Bartosz; Strankowski, Michał

    2014-09-01

    The process of the photo-excitation of ranitidine hydrochloride (RAN) in a solid state makes visible changes to its colour and generates an unpleasant odour. The purpose of the present study was to observe the protective effects of β-cyclodextrin (CD) complexation as well as the effect of the mixture of two stoichiometries 1:1 and 1:2 (RAN:CD, IC) on the photostability of samples in a solid state. Samples of inclusion complexes (IC) and physical mixtures (PM) were prepared and irradiated for 48h in a Suntest CPS+ chamber. Irradiated samples were analyzed using nuclear magnetic resonance ((1)H NMR), infrared spectroscopy (FT-IR), the differential scanning calorimetry method (DSC) and thermogravimetry analysis (TGA). Volatiles were monitored with the use of headspace-solid phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS). The protective effect of CD was noticed with respect to IC, and also PM. Achieved photostabilization of complexed RAN against photodegradation could be explained due to either the inclusion of the furan part of RAN into the CD cavity as shown by the (1)H NMR ROESY (rotation frame nuclear Overhauser effect spectroscopy) spectrum or the screening effect of CD. FT-IR spectra, DSC curves and microscope images of irradiated samples of protected RAN did not indicate any physical changes, such as phase transfer. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Direct electrochemistry and electrocatalytic behavior of hemoglobin entrapped in Ag@C nanocables/gold nanoparticles nanocomposites film.

    PubMed

    Hu, Xiao-Wei; Mao, Chang-Jie; Song, Ji-Ming; Niu, He-Lin; Zhang, Sheng-Yi; Cui, Rong-Jing

    2012-10-01

    Direct electrochemistry of hemoglobin (Hb) was successfully fabricated by immobilizing Hb on the nanocomposites containing of Ag@C nanocables and Au nanoparticles (AuNPs) modified glassy carbon electrode (GCE). The immobilized Hb retained its biological activity and shown high catalytic activities to the reduction of H2O2 by circular dicroism (CD) spectrum, fourier transform infrared (FT-IR) spectrum and cyclic voltammetry (CV). Experimental conditions such as scan rate and pH Value were studied and optimized. The results indicated that the resulting biosensor are linear to the concentrations of H2O2 in the ranges of 6.67 x 10(-7)-2.40 x 10(5) M, and the detection limit is 2.02 x 10(-7) M. The electrochemical biosensor has also high stability and good reproducibility.

  18. Simulation of Ã(2)A(1)←X̃(2)E laser excitation spectrum of CH3O and CD3O.

    PubMed

    Nagesh, Jayashree; Sibert, Edwin L; Stanton, John F

    2014-02-05

    A theoretical calculation of the laser-induced fluorescence excitation spectrum from X̃(2)E→Ã(2)A1 is carried out for CH3O and CD3O using a transition dipole moment surface expanded up to second order. The vibronic form of these operators is obtained using symmetry arguments. The Ã(2)A1 vibrational levels are calculated using Van Vleck perturbation theory, and the latter is used to adjust harmonic constants of the potential to match experimental fundamentals. The CH3O fit force field is tested on CD3O. For both molecules the transition energies are well reproduced, but there are systematic differences between experimental and theoretical intensities. The origins of these differences are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Synthesis and structural characterization of magnetic cadmium sulfide-cobalt ferrite nanocomposite, and study of its activity for dyes degradation under ultrasound

    NASA Astrophysics Data System (ADS)

    Farhadi, Saeed; Siadatnasab, Firouzeh

    2016-11-01

    Cadmium sulfide-cobalt ferrite (CdS/CFO) nanocomposite was easily synthesized by one-step hydrothermal decomposition of cadmium diethyldithiocarbamate complex on the CoFe2O4 nanoparticles at 200 °C. Spectroscopic techniques of powder X-ray diffraction (XRD), Fourier-transform infrared spectroscopy (FT-IR), UV-visible spectroscopy, field emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), Brunauer-Emmett-Teller (BET), and magnetic measurements were applied for characterizing the structure and morphology of the product. The results of FT-IR, XRD and EDX indicated that the CdS/CFO was highly pure. SEM and TEM results revealed that the CdS/CFO nanocomposite was formed from nearly uniform and sphere-like nanoparticles with the size of approximately 20 nm. The UV-vis absorption spectrum of the CdS/CFO nanocomposite showed the band gap of 2.21 eV, which made it suitable for sono-/photo catalytic purposes. By using the obtained CdS/CFO nanocomposite, an ultrasound-assisted advanced oxidation process (AOP) has been developed for catalytic degradation of methylene blue (MB), Rhodamine B (RhB), and methyl orange (MO)) in the presence of H2O2 as a green oxidant. CdS/CFO nanocomposite exhibited excellent sonocatalytic activity, so that, dyes were completely degraded in less than 10 min. The influences of crucial factors such as the H2O2 amount and catalyst dosage on the degradation efficiency were evaluated. The as-prepared CdS/CFO nanocomposite exhibited higher catalytic activity than pure CdS nanoparticles. Moreover, the magnetic property of CoFe2O4 made the nanocomposite recyclable.

  20. [Soft tissue sarcomas: the role of histology and molecular pathology for differential diagnosis].

    PubMed

    Poremba, C

    2006-01-01

    Soft tissue sarcomas include a wide spectrum of different entities. The so-called small round blue cell tumors and spindle cell tumors are difficult to classify based solely on conventional histology. To identify different subtypes of tumors special histochemical and immunohistochemical techniques are necessary. Analysis of protein expression by immunohistochemistry provides a helpful tool to investigate the histogenesis of tumors. A basic spectrum of antibodies should be included to study these tumors: Desmin and myogenin (or MyoD1) for skeletal differentiation; S-100, NSE, CD56, and synaptophysin for neural/neuroendocrine differentiation; CD3, CD20, and CD79 alpha for malignant lymphomas; CD34, sm-actin, and beta-catenin for spindle cell tumors; additional antigens, e. g. Ki-67 and p 53, for estimation of proliferation and tumor suppressor gene malfunctions. Nevertheless, the molecular analysis of soft tissue sarcomas is necessary for demonstration of specific translocations or gene defects to specify and proof a diagnosis. For this purpose, RT-PCR for RNA expression analysis of gene fusion transcripts and multi-color FISH for analysis of chromosomal rearrangements are used. Further investigations, using DNA microrrays may help to subclassify such tumors, with respect to prognosis or prediction of therapeutic response.

  1. pH-responsive nanoparticle assembly from peptide amphiphiles for tumor targeting drug delivery.

    PubMed

    Chang, Cong; Liang, Peiqing; Chen, Linlin; Liu, Junfeng; Chen, Shihong; Zheng, Guohua; Quan, Changyun

    2017-09-01

    In this paper, the peptide amphiphiles (PA) which consists of RGDSEEEEEEEEEEK as pH-sensitive segment and stearic acid as hydrophobic segment named RGDS-E 10 -Lys(C 18 ) was successfully synthesized. TEM images showed that uniformly dispersed nanoparticles could be formed by PA molecules in pH 7.4 medium, however, disintegrated in pH 5.0 medium. Circular dichroism (CD) spectrum indicated that polypeptide adopted a random-coil conformation in neutral medium (pH 7.4). The CD signal was significantly attenuate for decreased solubility of PA in medium with pH 5.0. As expected, the prepared RGDS-E 10 -Lys(C 18 ) assembly showed high pH-sensitive property which demonstrated a much more rapid drug release from micelles in tumor tissue (acidic environment) than in physiological environment (neutral environment). After DOX-loaded micelles incubated with tumor cells, the cytotoxicity of the micelles against Hela cells was increased obviously, indicating the great potential of micelles developed here as promising vehicle for targeted pH-responsive drug delivery.

  2. Cerebrospinal Fluid (CSF) Neuronal Biomarkers across the Spectrum of HIV Infection: Hierarchy of Injury and Detection

    PubMed Central

    Peterson, Julia; Gisslen, Magnus; Zetterberg, Henrik; Fuchs, Dietmar; Shacklett, Barbara L.; Hagberg, Lars; Yiannoutsos, Constantin T.; Spudich, Serena S.; Price, Richard W.

    2014-01-01

    The character of central nervous system (CNS) HIV infection and its effects on neuronal integrity vary with evolving systemic infection. Using a cross-sectional design and archived samples, we compared concentrations of cerebrospinal fluid (CSF) neuronal biomarkers in 143 samples from 8 HIV-infected subject groups representing a spectrum of untreated systemic HIV progression and viral suppression: primary infection; four groups of chronic HIV infection neuroasymptomatic (NA) subjects defined by blood CD4+ T cells of >350, 200–349, 50–199, and <50 cells/µL; HAD; treatment-induced viral suppression; and ‘elite’ controllers. Samples from 20 HIV-uninfected controls were also examined. The neuronal biomarkers included neurofilament light chain protein (NFL), total and phosphorylated tau (t-tau, p-tau), soluble amyloid precursor proteins alpha and beta (sAPPα, sAPPβ) and amyloid beta (Aβ) fragments 1–42, 1–40 and 1–38. Comparison of the biomarker changes showed a hierarchy of sensitivity in detection and suggested evolving mechanisms with progressive injury. NFL was the most sensitive neuronal biomarker. Its CSF concentration exceeded age-adjusted norms in all HAD patients, 75% of NA CD4<50, 40% of NA CD4 50–199, and 42% of primary infection, indicating common neuronal injury with untreated systemic HIV disease progression as well as transiently during early infection. By contrast, only 75% of HAD subjects had abnormal CSF t-tau levels, and there were no significant differences in t-tau levels among the remaining groups. sAPPα and β were also abnormal (decreased) in HAD, showed less marked change than NFL with CD4 decline in the absence of HAD, and were not decreased in PHI. The CSF Aβ peptides and p-tau concentrations did not differ among the groups, distinguishing the HIV CNS injury profile from Alzheimer's disease. These CSF biomarkers can serve as useful tools in selected research and clinical settings for patient classification, pathogenetic analysis, diagnosis and management. PMID:25541953

  3. Cerebrospinal fluid (CSF) neuronal biomarkers across the spectrum of HIV infection: hierarchy of injury and detection.

    PubMed

    Peterson, Julia; Gisslen, Magnus; Zetterberg, Henrik; Fuchs, Dietmar; Shacklett, Barbara L; Hagberg, Lars; Yiannoutsos, Constantin T; Spudich, Serena S; Price, Richard W

    2014-01-01

    The character of central nervous system (CNS) HIV infection and its effects on neuronal integrity vary with evolving systemic infection. Using a cross-sectional design and archived samples, we compared concentrations of cerebrospinal fluid (CSF) neuronal biomarkers in 143 samples from 8 HIV-infected subject groups representing a spectrum of untreated systemic HIV progression and viral suppression: primary infection; four groups of chronic HIV infection neuroasymptomatic (NA) subjects defined by blood CD4+ T cells of >350, 200-349, 50-199, and <50 cells/µL; HAD; treatment-induced viral suppression; and 'elite' controllers. Samples from 20 HIV-uninfected controls were also examined. The neuronal biomarkers included neurofilament light chain protein (NFL), total and phosphorylated tau (t-tau, p-tau), soluble amyloid precursor proteins alpha and beta (sAPPα, sAPPβ) and amyloid beta (Aβ) fragments 1-42, 1-40 and 1-38. Comparison of the biomarker changes showed a hierarchy of sensitivity in detection and suggested evolving mechanisms with progressive injury. NFL was the most sensitive neuronal biomarker. Its CSF concentration exceeded age-adjusted norms in all HAD patients, 75% of NA CD4<50, 40% of NA CD4 50-199, and 42% of primary infection, indicating common neuronal injury with untreated systemic HIV disease progression as well as transiently during early infection. By contrast, only 75% of HAD subjects had abnormal CSF t-tau levels, and there were no significant differences in t-tau levels among the remaining groups. sAPPα and β were also abnormal (decreased) in HAD, showed less marked change than NFL with CD4 decline in the absence of HAD, and were not decreased in PHI. The CSF Aβ peptides and p-tau concentrations did not differ among the groups, distinguishing the HIV CNS injury profile from Alzheimer's disease. These CSF biomarkers can serve as useful tools in selected research and clinical settings for patient classification, pathogenetic analysis, diagnosis and management.

  4. High-resolution measurements of the DT neutron spectrum using new CD foils in the Magnetic Recoil neutron Spectrometer (MRS) on the National Ignition Facility

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gatu Johnson, M., E-mail: gatu@psfc.mit.edu; Frenje, J. A.; Li, C. K.

    2016-11-15

    The Magnetic Recoil neutron Spectrometer (MRS) on the National Ignition Facility measures the DT neutron spectrum from cryogenically layered inertial confinement fusion implosions. Yield, areal density, apparent ion temperature, and directional fluid flow are inferred from the MRS data. This paper describes recent advances in MRS measurements of the primary peak using new, thinner, reduced-area deuterated plastic (CD) conversion foils. The new foils allow operation of MRS at yields 2 orders of magnitude higher than previously possible, at a resolution down to ∼200 keV FWHM.

  5. High-resolution measurements of the DT neutron spectrum using new CD foils in the Magnetic Recoil neutron Spectrometer (MRS) on the National Ignition Facility

    DOE PAGES

    Gatu Johnson, M.; Frenje, J. A.; Bionta, R. M.; ...

    2016-08-09

    The Magnetic Recoil neutron Spectrometer (MRS) on the National Ignition Facility measures the DT neutron spectrum from cryogenically layered inertial confinement fusion implosions. Yield, areal density, apparent ion temperature, and directional fluid flow are inferred from the MRS data. Here, this paper describes recent advances in MRS measurements of the primary peak using new, thinner, reduced-area deuterated plastic (CD) conversion foils. The new foils allow operation of MRS at yields 2 orders of magnitude higher than previously possible, at a resolution down to ~200 keV FWHM.

  6. High-resolution measurements of the DT neutron spectrum using new CD foils in the Magnetic Recoil neutron Spectrometer (MRS) on the National Ignition Facility.

    PubMed

    Gatu Johnson, M; Frenje, J A; Bionta, R M; Casey, D T; Eckart, M J; Farrell, M P; Grim, G P; Hartouni, E P; Hatarik, R; Hoppe, M; Kilkenny, J D; Li, C K; Petrasso, R D; Reynolds, H G; Sayre, D B; Schoff, M E; Séguin, F H; Skulina, K; Yeamans, C B

    2016-11-01

    The Magnetic Recoil neutron Spectrometer (MRS) on the National Ignition Facility measures the DT neutron spectrum from cryogenically layered inertial confinement fusion implosions. Yield, areal density, apparent ion temperature, and directional fluid flow are inferred from the MRS data. This paper describes recent advances in MRS measurements of the primary peak using new, thinner, reduced-area deuterated plastic (CD) conversion foils. The new foils allow operation of MRS at yields 2 orders of magnitude higher than previously possible, at a resolution down to ∼200 keV FWHM.

  7. Synthesis and characterization of substituted Schiff-base ligands and their d(10) metal complexes: structure-induced luminescence tuning behaviors and applications in co-sensitized solar cells.

    PubMed

    Dong, Yu-Wei; Fan, Rui-Qing; Wang, Ping; Wei, Li-Guo; Wang, Xin-Ming; Zhang, Hui-Jie; Gao, Song; Yang, Yu-Lin; Wang, Yu-Lei

    2015-03-28

    Nine IIB group complexes, [ZnL1Cl2] (Zn1), [CdL1Cl2]2 (Cd1), [HgL1Cl2] (Hg1), [ZnL2Cl2] (Zn2), [CdL2Cl2] (Cd2), [HgL2Cl2] (Hg2), [ZnL3Cl2] (Zn3), [CdL3Cl2] (Cd3) and [HgL3Cl2] (Hg3), have been synthesized from the corresponding ortho-(6-methoxy-pyridyl)(CH[double bond, length as m-dash]NAr) (where Ar = 2,6-iPr2C6H3, L1; 4-MeC6H4, L2; 2-OMeC6H4, L3) Schiff base and structurally characterized by elemental analysis, FT-IR, (1)H NMR and X-ray single-crystal analysis. Crystallographic studies reveal that the center metal of the complexes adopts a distorted tetrahedron geometry (except for Cd1 and Cd3, which display square pyramidal geometry) and C-HCl hydrogen bonds and ππ stacking interactions contribute to three-dimensional supramolecular structures. The series of complexes exhibit tunable luminescence from blue, through green, to light yellow by varying the temperature (298 K and 77 K), both in solution and in the solid state. Moreover, the quantum yields range from 0.027 to 0.422, and decrease according to the order of the periodic table (Zn > Cd > Hg). These results indicate that the center atom of the complexes leads to the geometry differences and hence to the tunable luminescence properties. Because Zn1-Zn3 exhibited higher molar extinction coefficients and a distinct absorption region, they were employed as co-sensitizers in ruthenium dye N719-sensitized photoanodes to deliver light-electricity efficiency enhancement, being assembled with counter-electrodes and electrolyte to prepare ZnX/N719 (where ZnX = Zn1, Zn2, and Zn3) co-sensitized dye sensitized solar cell (DSSC) devices. The prepared co-absorbent could overcome the deficiency of N719 absorption in the low-wavelength region of the visible spectrum, and offset competitive visible-light absorption of I3(-). Application of these prepared complexes in N719-sensitized solar cells enhanced their performance by 10-36%, which indicated a potential application of these types of complexes in DSSCs.

  8. Target-mediated drug disposition and prolonged liver accumulation of a novel humanized anti-CD81 monoclonal antibody in cynomolgus monkeys

    PubMed Central

    Vexler, Vladimir; Yu, Li; Pamulapati, Chandrasena; Garrido, Rosario; Grimm, Hans Peter; Sriraman, Priya; Bohini, Sandhya; Schraeml, Michael; Singh, Usha; Brandt, Michael; Ries, Stefan; Ma, Han; Klumpp, Klaus; Ji, Changhua

    2013-01-01

    CD81 is an essential receptor for hepatitis C virus (HCV). K21 is a novel high affinity anti-CD81 antibody with potent broad spectrum anti-HCV activity in vitro. The pharmacokinetics (PK), pharmacodynamics and liver distribution of K21 were characterized in cynomolgus monkeys after intravenous (i.v.) administration of K21. Characteristic target-mediated drug disposition (TMDD) was shown based on the PK profile of K21 and a semi-mechanistic TMDD model was used to analyze the data. From the TMDD model, the estimated size of the total target pool at baseline (Vc • Rbase) is 16 nmol/kg and the estimated apparent Michaelis-Menten constant (KM) is 4.01 nM. A simulation using estimated TMDD parameters indicated that the number of free receptors remains below 1% for at least 3 h after an i.v. bolus of 7 mg/kg. Experimentally, the availability of free CD81 on peripheral lymphocytes was measured by immunostaining with anti-CD81 antibody JS81. After K21 administration, a dose- and time-dependent reduction in free CD81 on peripheral lymphocytes was observed. Fewer than 3% of B cells could bind JS81 3 h after a 7 mg/kg dose. High concentrations of K21 were found in liver homogenates, and the liver/serum ratio of K21 increased time-dependently and reached ~160 at 168 h post-administration. The presence of K21 bound to hepatocytes was confirmed by immunohistochemistry. The fast serum clearance of K21 and accumulation in the liver are consistent with TMDD. The TMDD-driven liver accumulation of the anti-CD81 antibody K21 supports the further investigation of K21 as a therapeutic inhibitor of HCV entry. PMID:23924796

  9. Synthesis, structure characterization and optical properties of a new tripotassium cadmium pentaborate, K{sub 3}CdB{sub 5}O{sub 10}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu Hongwei; Graduate school of Chinese Academy of Sciences, Beijing 100049; Pan Shilie, E-mail: slpan@ms.xjb.ac.cn

    A new ternary borate oxide, K{sub 3}CdB{sub 5}O{sub 10}, has been synthesized by solid-state reaction at 580 deg. C. The compound crystallizes in the monoclinic space group P2{sub 1}/n with a=7.6707 (7) A, b=19.1765 (17) A, c=7.8784 (6) A, {beta}=115.6083 (49){sup o}, and Z=4. The crystal structure consists of a two-dimensional infinite [CdB{sub 5}O{sub 10}] layer, which forms by connecting isolated double ring [B{sub 5}O{sub 10}] groups and CdO{sub 4} tetrahedra. K atoms filling in the interlayer and intralayer link the layers together and balance charge. The IR spectrum has been studied and confirmed the presence of both BO{sub 3}more » and BO{sub 4} groups, and the UV-vis-IR diffuse reflectance spectrum exhibits a band gap of about 3.4 eV. The DSC analysis proves that K{sub 3}CdB{sub 5}O{sub 10} is a congruent melting compound. - Graphical abstract: A new phase, K{sub 3}CdB{sub 5}O{sub 10}, has been discovered in the ternary K{sub 2}O-CdO-B{sub 2}O{sub 3} system. The crystal structure consists of a two-dimensional infinite [CdB{sub 5}O{sub 10}] layer. Highlights: > The compound, K{sub 3}CdB{sub 5}O{sub 10}, was synthesized and characterized for the first time. {yields}K{sub 3}CdB{sub 5}O{sub 10} is a congruent melting compound, which means the large single crystals could be grown from the melt using the Czochralski pulling method. {yields}The crystal structure consists of a two-dimensional infinite [CdB{sub 5}O{sub 10}].« less

  10. A nationwide study of the association between celiac disease and the risk of autistic spectrum disorders.

    PubMed

    Ludvigsson, Jonas F; Reichenberg, Abraham; Hultman, Christina M; Murray, Joseph A

    2013-11-01

    Most case reports suggest an association between autistic spectrum disorders (ASDs) and celiac disease (CD) or positive CD serologic test results, but larger studies are contradictory. To examine the association between ASDs and CD according to small intestinal histopathologic findings. Nationwide case-control study in Sweden. Through 28 Swedish biopsy registers, we collected data about 26,995 individuals with CD (equal to villous atrophy, Marsh stage 3), 12,304 individuals with inflammation (Marsh stages 1-2), and 3719 individuals with normal mucosa (Marsh stage 0) but positive CD serologic test results (IgA/IgG gliadin, endomysium, or tissue transglutaminase) and compared them with 213,208 age- and sex-matched controls. Conditional logistic regression estimated odds ratios (ORs) for having a prior diagnosis of an ASD according to the Swedish National Patient Register. In another analysis, we used the Cox proportional hazards regression model to estimate hazard ratios (HRs) for future ASDs in individuals undergoing small intestinal biopsy. A prior ASD was not associated with CD (OR, 0.93; 95% CI, 0.51-1.68) or inflammation (OR 1.03; 95% CI, 0.40-2.64) but was associated with a markedly increased risk of having a normal mucosa but a positive CD serologic test result (OR, 4.57; 95% CI, 1.58-13.22). Restricting our data to individuals without a diagnosis of an ASD at the time of biopsy, CD (HR, 1.39; 95% CI, 1.13-1.71) and inflammation (HR, 2.01; 95% CI, 1.29-3.13) were both associated with moderate excess risks of later ASDs, whereas the HR for later ASDs in individuals with normal mucosa but positive CD serologic test results was 3.09 (95% CI, 1.99-4.80). Although this study found no association between CD or inflammation and earlier ASDs, there was a markedly increased risk of ASDs in individuals with normal mucosa but a positive CD serologic test result.

  11. Advanced Solid-State Lasers, Twelfth Topical Meeting (1997) Held in Orlando, Florida on January 27-29, 1997

    DTIC Science & Technology

    1997-01-01

    C.B. Dane, L.E. Zapata, W.A. Neuman, M.A. Norton, and L.A. Hackel; IEEE J. Quantum Electron. 31, 148 (1995) 2. J.K. Tyminski, CD . Nabors, G...these two levels increased as the concentration of Dy3+ increased under fixed Tm concentration. CO E, E m 3 </> —*\\ a> CD 3? o a>’ O...chirped mirrors and the spectrum of the mode-locked pulses. E l_ ■*-> O CD Q. CO CD _OT ZJ D. Q Q O 800 825 850 875 900 925 -200 -100 0

  12. Design and Optimization of Copper Indium Gallium Selenide Solar Cells for Lightweight Battlefield Application

    DTIC Science & Technology

    2014-06-01

    spectrum. This results in most of the incident sunlight being absorbed close to the p-n hetero - junction formed with the CdS layer. This property is what... junction layer in the solar cell hetero - junction . A thin layer of CdS is used in CIGS cells to accomplish this. CdS has a band gap of 2.4 eV, which...field between the p-n hetero - junction at the cost of absorbing more of the usable photons from reaching the CIGS layer. From Figure 28, CdS reached peak

  13. Effect of hydrogenation on the electrical and optical properties of CdZnTe substrates and HgCdTe epitaxial layers

    NASA Astrophysics Data System (ADS)

    Sitharaman, S.; Raman, R.; Durai, L.; Pal, Surendra; Gautam, Madhukar; Nagpal, Anjana; Kumar, Shiv; Chatterjee, S. N.; Gupta, S. C.

    2005-12-01

    In this paper, we report the experimental observations on the effect of plasma hydrogenation in passivating intrinsic point defects, shallow/deep levels and extended defects in low-resistivity undoped CdZnTe crystals. The optical absorption studies show transmittance improvement in the below gap absorption spectrum. Using variable temperature Hall measurement technique, the shallow defect level on which the penetrating hydrogen makes complex, has been identified. In 'compensated' n-type HgCdTe epitaxial layers, hydrogenation can improve the resistivity by two orders of magnitude.

  14. Streptomyces communities in soils polluted with heavy metals

    NASA Astrophysics Data System (ADS)

    Grishko, V. N.; Syshchikova, O. V.

    2009-02-01

    The contents of differently mobile heavy metal compounds and their influence on the formation of microbial cenoses (particularly, streptomyces communities) in technogenically disturbed soils are considered. Elevated concentrations of mobile Cu, Zn, Ni, Cd, and Fe compounds are shown to determine structural-functional changes in microbial cenoses that are displayed in a decreasing number of microorganisms and a narrower spectrum of the streptomyces species. Some specific features of the formation of streptomyces communities in technogenic soils were revealed on the basis of the analysis of their species structure with the use of the Margalef, Berger-Parker, and Sorensen indices of biodiversity.

  15. Identification of Autophagy-Related Genes and Their Regulatory miRNAs Associated with Celiac Disease in Children.

    PubMed

    Comincini, Sergio; Manai, Federico; Meazza, Cristina; Pagani, Sara; Martinelli, Carolina; Pasqua, Noemi; Pelizzo, Gloria; Biggiogera, Marco; Bozzola, Mauro

    2017-02-12

    Celiac disease (CD) is a severe genetic autoimmune disorder, affecting about one in 100 people, where the ingestion of gluten leads to damage in the small intestine. Diagnosing CD is quite complex and requires blood tests and intestinal biopsy examinations. Controversy exists regarding making the diagnosis without biopsy, due to the large spectrum of manifesting symptoms; furthermore, small-intestinal gastroscopy examinations have a relatively complex management in the pediatric population. To identify novel molecular markers useful to increase the sensitivity and specificity in the diagnosis of pediatric CD patients, the expression levels of two key autophagy executor genes ( ATG7 and BECN1 ) and their regulatory validated miRNAs (miR-17 and miR-30a, respectively) were analyzed by relative quantitative real-time-PCR on a cohort of confirmed CD patients compared to age-related controls. Among the investigated targets, the non-parametric Mann-Whitney U test and ROC analysis indicated the highest significant association of BECN1 with CD status in the blood, while in intestinal biopsies, all of the investigated sequences were positively associated with CD diagnosis. Nomogram-based analysis showed nearly opposite expression trends in blood compared to intestine tissue, while hierarchical clustering dendrograms enabled identifying CD and control subgroups based on specific genes and miRNA expression signatures. Next, using an established in vitro approach, through digested gliadin administration in Caco-2 cells, we also highlighted that the modulation of miR-17 endogenous levels using enriched exosomes increased the intracellular autophagosome content, thereby altering the autophagic status. Altogether, these results highlighted novel molecular markers that might be useful to increase the accuracy in CD diagnosis and in molecular-based stratification of the patients, further reinforcing the functional involvement of the regulation of the autophagy process within a digestive and autoimmune-related disorder as CD.

  16. Comparative investigation of the detective quantum efficiency of direct and indirect conversion detector technologies in dedicated breast CT.

    PubMed

    Kuttig, Jan D; Steiding, Christian; Kolditz, Daniel; Hupfer, Martin; Karolczak, Marek; Kalender, Willi A

    2015-06-01

    To investigate the dose saving potential of direct-converting CdTe photon-counting detector technology for dedicated breast CT. We analyzed the modulation transfer function (MTF), the noise power spectrum (NPS) and the detective quantum efficiency (DQE) of two detector technologies, suitable for breast CT (BCT): a flat-panel energy-integrating detector with a 70 μm and a 208 μm thick gadolinium oxysulfide (GOS) and a 150 μm thick cesium iodide (CsI) scintillator and a photon-counting detector with a 1000 μm thick CdTe sensor. The measurements for GOS scintillator thicknesses of 70 μm and 208 μm delivered 10% pre-sampled MTF values of 6.6 mm(-1) and 3.2 mm(-1), and DQE(0) values of 23% and 61%. The 10% pre-sampled MTF value for the 150 μm thick CsI scintillator 6.9 mm(-1), and the DQE(0) value was 49%. The CdTe sensor reached a 10% pre-sampled MTF value of 8.5 mm(-1) and a DQE(0) value of 85%. The photon-counting CdTe detector technology allows for significant dose reduction compared to the energy-integrating scintillation detector technology used in BCT today. Our comparative evaluation indicates that a high potential dose saving may be possible for BCT by using CdTe detectors, without loss of spatial resolution. Copyright © 2015 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  17. Shared and unique common genetic determinants between pediatric and adult celiac disease.

    PubMed

    Senapati, Sabyasachi; Sood, Ajit; Midha, Vandana; Sood, Neena; Sharma, Suresh; Kumar, Lalit; Thelma, B K

    2016-07-22

    Based on age of presentation, celiac disease (CD) is categorised as pediatric CD and adult CD. It however remains unclear if these are genetically and/or phenotypically distinct disorders or just different spectrum of the same disease. We therefore explored the common genetic components underlying pediatric and adult CD in a well characterized north Indian cohort. A retrospective analysis of children (n = 531) and adult (n = 871) patients with CD between January 2001 and December 2010 was done. The database included basic demographic characteristics, clinical presentations, associated diseases and complications, if any. The genotype dataset was acquired for children (n = 217) and adult CD patients (n = 340) and controls (n = 736) using Immunochip. Association analysis was performed using logistic regression model to identify susceptibility genetic variants. The predominant form of CD was classical CD in both pediatric and adult CD groups. There was remarkable similarity between pediatric and adult CD except for quantitative differences between the two groups such as female preponderance, non-classical presentation, co-occurrence of other autoimmune diseases being more common amongst adult CD. Notably, same HLA-DQ2 and -DQ8 haplotypes were established as the major risk factors in both types of CD. In addition, a few suggestively associated (p < 5 × 10(-4)) non-HLA markers were identified of which only ANK3 (rs4948256-A; rs10994257-T) was found to be shared and explain risk for ~45 % of CD patients with HLA allele. Overall phenotypic similarity between pediatric and adult CD groups can be explained by contribution of same HLA risk alleles. Different non-HLA genes/loci with minor risk seem to play crucial role in disease onset and extra intestinal manifestation of CD. None of the non-HLA risk variants reached genome-wide significance, however most of them were shown to have functional implication to disease pathogenesis. Functional relevance of our findings needs to be investigated to address clinical heterogeneity of CD. This present study is the first comparative study based on common genetic markers to suggest that CD in pediatric age group and in adults are the spectrum of the same disease with novel and shared genetic risk determinants. Follow-up fine mapping studies with larger study cohorts are warranted for further genetic investigation.

  18. Effects of Cd vacancies and unconventional spin dynamics in the Dirac semimetal Cd3As2

    NASA Astrophysics Data System (ADS)

    Koumoulis, Dimitrios; Taylor, Robert E.; McCormick, Jeffrey; Ertas, Yavuz N.; Pan, Lei; Che, Xiaoyu; Wang, Kang L.; Bouchard, Louis-S.

    2017-08-01

    Cd3As2 is a Dirac semimetal that is a 3D analog of graphene. We investigated the local structure and nuclear-spin dynamics in Cd3As2 via 113Cd NMR. The wideline spectrum of the static sample at 295 K is asymmetric and its features are well described by a two-site model with the shielding parameters extracted via Herzfeld-Berger analysis of the magic-angle spinning spectrum. Surprisingly, the 113Cd spin-lattice relaxation time (T1) is extremely long (T1 = 95 s at 295 K), in stark contrast to conductors and the effects of native defects upon semiconductors; but it is similar to that of 13C in graphene (T1 = 110 s). The temperature dependence of 1/T1 revealed a complex bipartite mechanism that included a T2 power-law behavior below 330 K and a thermally activated process above 330 K. In the high-temperature regime, the Arrhenius behavior is consistent with a field-dependent Cd atomic hopping relaxation process. At low temperatures, a T2 behavior consistent with a spin-1/2 Raman-like process provides evidence of a time-dependent spin-rotation magnetic field caused by angular oscillations of internuclear vectors due to lattice vibrations. The observed mechanism does not conform to the conventional two-band model of semimetals, but is instead closer to a mechanism observed in high-Z element ionic solids with large magnetorotation constant [A. J. Vega et al., Phys. Rev. B 74, 214420 (2006)].

  19. [Study of the interaction mechanism between brodifacoum and DNA by spectroscopy].

    PubMed

    Duan, Yun-qing; Min, Shun-geng

    2009-04-01

    The interaction between brodifacoum (3-[3-(4'-bromophenyl-4) 1,2,3,4-tetralin-10]-4-hydroxyl-coumarin) (BDF), an anticoagulant rodenticide, and calf thymus DNA (ct-DNA) was studied by UV spectrum and fluorescence spectrum. The results were summarized as follows: There was a hypochromic effect of low concentration ct-DNA on the UV spectra. The fluorescence quenching studies showed a regular decrease in the fluorescence intensity after addition of ct-DNA by the static quenching mode with a quenching constant (Ksv) of 1.21 x 10(4) L x mol(-1) at 27 degrees C. The BDF possibly bonded to ct-DNA mainly via Van der Waals forces by the corresponding thermodynamics parameter. KI quenching experiment found that there was not obvious protection of ct-DNA to BDF. The fluorescence intensity of BDF/ct-DNA system changed with the variation in ionic strength Quenching of ct-DNA on the fluorescence of BDF/beta-CD inclusion complex was reduced in contrast with the free BDF, which showed that beta-CD could provide BDF with protection. So the comprehensive interaction mode of BDF with ct-DNA may be the groove binding by the above results. It was indicated that there had been static-electro interaction between BDF and ct-DNA at the same time. The conjunct action of Van der Waals forces and electrostatic attraction favorably provide BDF bonding interaction in the groove of ct-DNA.

  20. Risk Factors Associated with Quantitative Evidence of Lung Emphysema and Fibrosis in an HIV-infected Cohort

    PubMed Central

    Leader, Joseph K.; Crothers, Kristina; Huang, Laurence; King, Mark A.; Morris, Alison; Thompson, Bruce W.; Flores, Sonia C.; Drummond, M. Bradley; Rom, William N.; Diaz, Philip T.

    2015-01-01

    Introduction The disease spectrum for HIV-infected individuals has shifted towards co-morbid non-AIDS conditions including chronic lung disease, but quantitative image analysis of lung disease has not been performed. Objectives To quantify the prevalence of structural changes of the lung indicating emphysema or fibrosis on radiographic examination. Methods A cross-sectional analysis of 510 HIV-infected participants in the multi-center Lung-HIV study was performed. Data collected included: demographics, biological markers of HIV, pulmonary function testing, and chest CT examinations. Emphysema and fibrosis-like changes were quantified on CT images based on threshold approaches. Results In our cohort: 69% was on antiretroviral therapy, 13% had a current CD4 cell count less than 200 cells/μL, 39% had an HIV viral load greater than 500 copies/mL, 25% had at least a trace level of emphysema (defined as >2.5% of voxels <-950HU). Trace emphysema was significantly correlated with age, smoking, and pulmonary function. Neither current CD4 cell count nor HIV viral load was significantly correlated with emphysema. Fibrosis-like changes were detected in 29% of the participants and were significantly correlated with HIV viral load (Pearson correlation coefficient = 0.210, p<0.05); current CD4 cell count was not associated with fibrosis. In multivariable analyses including age, race, and smoking status, HIV viral load remained significantly correlated with fibrosis-like changes (coefficient = 0.107, P = 0.03). Conclusion A higher HIV viral load was significantly associated with fibrosis-like changes possibly indicating early interstitial lung disease, but emphysematous changes were not related to current CD4 cell count or HIV viral load. PMID:26914911

  1. Alcohol-induced versus anion-induced states of alpha-chymotrypsinogen A at low pH.

    PubMed

    Khan, F; Khan, R H; Muzammil, S

    2000-09-29

    Characterization of conformational transition and folding intermediates is central to the study of protein folding. We studied the effect of various alcohols (trifluoroethanol (TFE), butanol, propanol, ethanol and methanol) and salts (K(3)FeCN(6), Na(2)SO(4), KClO(4) and KCl) on the acid-induced state of alpha-chymotrypsinogen A, a predominantly beta-sheet protein, at pH 2.0 by near-UV circular dichroism (CD), far-UV CD and 1-anilinonaphthalene-8-sulfonic acid (ANS) fluorescence measurements. Addition of alcohols led to an increase in ellipticity value at 222 nm indicating the formation of alpha-helical structure. The order of effectiveness of alcohols was shown to be TFE>butanol>propanol>ethanol>methanol. ANS fluorescence data showed a decrease in fluorescence intensity on alcohol addition, suggesting burial of hydrophobic patches. The near-UV CD spectra showed disruption of tertiary structure on alcohol addition. No change in ellipticity was observed on addition of salts at pH 2.0, whereas in the presence of 2 M urea, salts were found to induce a molten globule-like state as evident from the increases in ellipticity at 222 nm and ANS fluorescence indicating exposure of hydrophobic regions of the protein. The effectiveness in inducing the molten globule-like state, i.e. both increase in ellipticity at 222 nm and increase in ANS fluorescence, followed the order K(3)FeCN(6)>Na(2)SO(4)>KClO(4)>KCl. The loss of signal in the near-UV CD spectrum on addition of alcohols indicating disordering of tertiary structure results suggested that the decrease in ANS fluorescence intensity may be attributed to the unfolding of the ANS binding sites. The results imply that the alcohol-induced state had characteristics of an unfolded structure and lies between the molten globule and the unfolded state. Characterization of such partially folded states has important implications for protein folding.

  2. Influence of precursor concentration on physical properties of CdO thin films prepared by spray pyrolysis technique using nebulizer

    NASA Astrophysics Data System (ADS)

    Anitha, M.; Amalraj, L.; Anitha, N.

    2017-12-01

    Cadmium oxide (CdO) thin films were prepared with different concentrations of precursor solution (0.05, 0.1, 0.15, 0.2 and 0.25 M, respectively) at the optimized temperature (200 °C) using the nebulized spray pyrolysis technique to obtain better crystallinity in polycrystalline thin films on amorphous glass substrates. The XRD characterization of those samples revealed a preferential orientation along the (111) plane having a cubic structure. The scanning electron microscopy (SEM) analysis displayed that all the as-deposited thin films have spherical shaped grains. The transmittance of the as-deposited CdO thin films had decreased from 88 to 71% for longer wavelength regions (600-900 nm) as the precursor concentration had increased and then increased for higher precursor concentration. The optical band gap was found to lie between 2.45 and 2.40 eV belonging to direct transition for those thin films. The presence of Cd-O bond (540 cm-1) was confirmed by FTIR spectrum. The emission properties of CdO thin films were studied by luminescence spectrum recorded at room temperature. A maximum carrier concentration and minimum resistivity values of 4.743 × 1019 cm- 3 and 1.06 × 10-3 Ω-cm, respectively, were obtained for 0.2 M precursor concentration. These CdO thin films have high optical transmittance and high room temperature conductivity, which can be used as the TCO and Solar cell (window layer) material.

  3. Microwave-Assisted Synthesis Cd Metal Hexagonal Nanosheets

    NASA Astrophysics Data System (ADS)

    Sun, Yidong; She, Houde; Bai, Wencai; Li, Liangshan; Zhou, Hua

    2018-07-01

    Sodium borohydride (NaBH4) as reducing agent, oleic acid (OA) as surfactant, deionized water as the dispersant, reducing cadmium nitrate (Cd(NO3)2 · 4H2O) can get Cd nanosheets by microwave method. Room temperature photoluminescence (PL) spectrum for Cd nanosheets recorded under xenon light wavelength of 325 nm exhibited obviously emission bands at 331, 379, and 390 nm. By analyzing the results of XRD and TEM, the nanosheets are thought as hexagonal phase and the size is about 20 nm. This synthesis performs in a lower temperature. Moreover our method is quite simple and the cost of the experiment is relatively lower.

  4. Isotope effect on superconductivity and Raman phonons of Pyrochlore Cd2Re2O7

    NASA Astrophysics Data System (ADS)

    Razavi, F. S.; Hajialamdari, M.; Reedyk, M.; Kremer, R. K.

    2018-06-01

    Cd2Re2O7 is the only α-Pyrochlore exhibiting superconductivity with a transition temperature (Tc) of ∼ 1 K. In this study, we present the effect of oxygen isotope (18O) as well as combined 18O and cadmium isotope (116Cd) substitution on the superconductivity and Raman scattering spectrum of Cd2Re2O7. The change of Tc and the energy gap Δ(T) are reported using various techniques including point contact spectroscopy. The shift in Raman phonon frequencies upon isotope substitution will be compared with measurement of the isotope effect on the superconducting transition temperature.

  5. [Characterization of structural change of ascorbate peroxidase from Chinese kale during denaturation by circular dichroism].

    PubMed

    Xi, Jia-Fu; Tang, Lei; Zhang, Jian-Hua; Zhang, Hong-Jian; Chen, Xu-Sheng; Mao, Zhong-Gui

    2014-11-01

    Circular dichroism (CD) is a special absorption spectrum. The secondary structure of protein such as α-helix, β-sheet and β-turn in the far ultraviolet region (190-250 nm) has a characteristic CD spectrum. In order to understand the activity and structural changes of ascorbate peroxidase from Chinese kale (BaAPX) during denaturation, specific activity and percentage of secondary structure of BaAPX under different time, temperature and concentration were analyzed by CD dynamically. In addition, the percentage of four secondary structures in BaAPX was calculated by CD analysis software Dichroweb. The results show that BaAPX is a full α-type enzyme whose specific activity is positively related to the percentage of α-helix. During denaturation of BaAPX, three kinds of structural changes were proposed: the one-step structural change from initial state (N state) to minimum state of α-helix (R state) under low concentration and low temperature; the one-step structural change from N state to equilibrium state (T state) under high concentration and low temperature; the two-step structural changes from N state through R state to final T state under heat treatment and low temperature renaturation.

  6. Semiconductor Seeded Nanorods with Graded Composition Exhibiting High Quantum-Yield, High Polarization, and Minimal Blinking.

    PubMed

    Hadar, Ido; Philbin, John P; Panfil, Yossef E; Neyshtadt, Shany; Lieberman, Itai; Eshet, Hagai; Lazar, Sorin; Rabani, Eran; Banin, Uri

    2017-04-12

    Seeded semiconductor nanorods represent a unique family of quantum confined materials that manifest characteristics of mixed dimensionality. They show polarized emission with high quantum yield and fluorescence switching under an electric field, features that are desirable for use in display technologies and other optical applications. So far, their robust synthesis has been limited mainly to CdSe/CdS heterostructures, thereby constraining the spectral tunability to the red region of the visible spectrum. Herein we present a novel synthesis of CdSe/Cd 1-x Zn x S seeded nanorods with a radially graded composition that show bright and highly polarized green emission with minimal intermittency, as confirmed by ensemble and single nanorods optical measurements. Atomistic pseudopotential simulations elucidate the importance of the Zn atoms within the nanorod structure, in particular the effect of the graded composition. Thus, the controlled addition of Zn influences and improves the nanorods' optoelectronic performance by providing an additional handle to manipulate the degree confinement beyond the common size control approach. These nanorods may be utilized in applications that require the generation of a full, rich spectrum such as energy-efficient displays and lighting.

  7. On the response of alloyed ZnCdSeS quantum dot films

    NASA Astrophysics Data System (ADS)

    Valais, I.; Michail, C.; Fountzoula, C.; Tseles, D.; Yannakopoulos, P.; Nikolopoulos, D.; Bakas, A.; Fountos, G.; Saatsakis, G.; Sianoudis, I.; Kandarakis, I.; Panayiotakis, G.

    The aim of this work was to prepare composite ZnCdSeS quantum dot (QD) flexible films and to examine their optical properties under ultraviolet excitation. PMMA/QD ZnCdSeS composite films, with emission covering the visual spectrum (480-630 nm) were prepared with concentrations 10 mg/mL and 20 mg/mL by homogenously diluting dry powder QD samples in toluene and subsequently mixing with a PMMA/MMA polymer solution to the final ZnCdSeS/Toluene mixture. Scanning electron microscopy (SEM) images of the produced films were obtained. The ZnCdSeS films were excited by ultraviolet light of varying intensities and the spectral matching with various optical detectors was estimated.

  8. Increased IL-35 producing Tregs and CD19+IL-35+ cells are associated with disease progression in leprosy patients.

    PubMed

    Tarique, Mohd; Saini, Chaman; Naqvi, Raza Ali; Khanna, Neena; Rao, D N

    2017-03-01

    The clinical forms of leprosy consist of a spectrum that reflects the host's immune response to the M. leprae; it provides an ideal model to study the host pathogen interaction and immunological dysregulation in humans. IL-10 and TGF-β producing Tregs are high in leprosy patients and responsible for immune suppression and M. leprae specific T cells anergy. In leprosy, involvement of IL-35 producing Tregs and Bregs remain unstudied. To study the role of IL-35 producing Tregs and Bregs in the human leprosy. Peripheral blood mononuclear cells from leprosy patients were isolated and stimulated with M. leprae antigen (MLCwA) for 48h. Intracellular cytokine IL-35 was evaluated in CD4 + CD25 + Tregs, CD19 + cells by FACS. Expression of PD-1 on CD4 + CD25 + Tregs, CD19 + cells and its ligand (PD-L1) on B cells, CD11c cells were evaluated by flow cytometry (FACS). Serum IL-35 level was estimated by ELISA. The frequency of IL-35 producing Tregs and Bregs cells were found to be high in leprosy patients (p<0.0001) as compared to healthy controls. These cells produced suppressive cytokine IL-35 which showed positive correlation with bacteriological index (BI) and TGF-β producing Tregs, indicating its suppressive nature. We found higher expression of PD-1 on Tregs, B cell and its ligand (PD-L1) on antigen presenting cells in leprosy patients. This study point out a shift in our understanding of the immunological features that mediate and regulate the immune suppression and the disease progression in leprosy patients with a new paradigm (IL-35 producing Tregs and Bregs) that is beyond TGF-β and IL-10 producing Treg cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Temperature effect on the vibrational dynamics of cyclodextrin inclusion complexes: investigation by FTIR-ATR spectroscopy and numerical simulation.

    PubMed

    Crupi, Vincenza; Majolino, Domenico; Venuti, Valentina; Guella, Graziano; Mancini, Ines; Rossi, Barbara; Verrocchio, Paolo; Viliani, Gabriele; Stancanelli, Rosanna

    2010-07-01

    The vibrational dynamics of solid inclusion complexes of the nonsteroidal anti-inflammatory drug Ibuprofen (IBP) with beta-cyclodextrin (beta-CD) and methyl-beta-cyclodextrin (Me-beta-CD) has been investigated by using attenuated total reflection-Fourier transform infrared FTIR-ATR spectroscopy, in order to monitor the changes induced, as a consequence of complexation, on the vibrational spectrum of IBP, in the wavenumber range 600-4000 cm(-1). Quantum chemical calculations were performed on monomeric and dimeric structures of IBP, derived from symmetric hydrogen bonding of the two carboxylic groups, in order to unambiguously assign some characteristic IR bands in the IBP spectrum. The evolution in temperature from 250 to 340 K of the C horizontal lineO stretching vibration, described by a best-fit procedure, allowed us to extract the thermodynamic parameter DeltaH associated to the binding of IBP with betaCDs in the solid phase. By comparing these results, Me-beta-CD has been shown to be the most effective carrier for IBP.

  10. The Value of Ensari's Proposal in Evaluating the Mucosal Pathology of Childhood Celiac Disease: Old Classification versus New Version.

    PubMed

    Güreşci, Servet; Hızlı, Samil; Simşek, Gülçin Güler

    2012-09-01

    Small intestinal biopsy remains the gold standard in diagnosing celiac disease (CD); however, the wide spectrum of histopathological states and differential diagnosis of CD is still a diagnostic problem for pathologists. Recently, Ensari reviewed the literature and proposed an update of the histopathological diagnosis and classification for CD. In this study, the histopathological materials of 54 children in whom CD was diagnosed at our hospital were reviewed to compare the previous Marsh and Modified Marsh-Oberhuber classifications with this new proposal. In this study, we show that the Ensari classification is as accurate as the Marsh and Modified Marsh classifications in describing the consecutive states of mucosal damage seen in CD. Ensari's classification is simple, practical and facilitative in diagnosing and subtyping of mucosal pathology of CD.

  11. Critical Technology Events (CTEs) that Support the Rationale for Army Laboratories Based on S&T Functions Performed

    DTIC Science & Technology

    2013-09-01

    is very compatible to growth of mercury cadmium telluride (HgCdTe or MCT) on its surface. HgCdTe is the IR sensitive material. However, CdZnTe is...in Indiana which is one of the few test ranges in the developed world where battlefield smokes and live artillery fire could be 41 F. Shields, NV...spectral region of E&M spectrum) I2 – Image Intensification JIEDDO – Joint IED Defeat Office JPG – Jefferson Proving Ground, Indiana . JPO – Joint

  12. Efficiency of the intermolecular interaction of salicylic acid neutral form and monoanion with Cd2 + ion studied by methods of absorption and fluorescence

    NASA Astrophysics Data System (ADS)

    Lavrik, N. L.; Mulloev, N. U.

    2018-02-01

    The methods of absorption and fluorescence were used to study the efficiency of the interaction between salicylic acid derivatives SAD (neutral SA form and SA monoanion) and Cd2 + ions (in CdBr2 salt) within the range pH = 1.5 ÷ 8. The efficiency was determined from the change in both the absorption band contour and the fluorescence intensity of various SAD forms. It has been established that depending on the SAD form, the addition of CdBr2 to a starting solution leads to the formation of additional absorption for both the shorter wave lengths in the absorption spectrum of the neutral form (at pH < 3) and the longer wave lengths in the absorption spectrum for the HSal- monoanion (at pH > 4). In the fluorescence spectra, the intensity was observed to increase for the neutral SAD form (at pH < 3) and to decrease for the HSal- monoanion (at pH > 4) after addition of CdBr2. The spectral changes were interpreted in the framework of common notions about the effect of three physicochemical factors that determine the interaction between the SAD and the Cd2 + ion and affect the parameters of absorption and fluorescence spectra. These factors are: (1) the decrease in pH after addition of CdBr2 to the SAD solution, (2) the decrease in the efficiency of the H-bonding of SAD molecules to the water ones, and (3) the existence of electrostatic ion-ion interaction between the HSal- monoanion and the Cd2 + ion. The bimolecular fluorescence quenching constants Kq of HSal- monoanion fluorescence quenching by the Cd2 + ion appeared to be substantially less than those of the quenching which would follow either the dynamic (diffusion) or the concentration (static) mechanisms.

  13. 3D change detection - Approaches and applications

    NASA Astrophysics Data System (ADS)

    Qin, Rongjun; Tian, Jiaojiao; Reinartz, Peter

    2016-12-01

    Due to the unprecedented technology development of sensors, platforms and algorithms for 3D data acquisition and generation, 3D spaceborne, airborne and close-range data, in the form of image based, Light Detection and Ranging (LiDAR) based point clouds, Digital Elevation Models (DEM) and 3D city models, become more accessible than ever before. Change detection (CD) or time-series data analysis in 3D has gained great attention due to its capability of providing volumetric dynamics to facilitate more applications and provide more accurate results. The state-of-the-art CD reviews aim to provide a comprehensive synthesis and to simplify the taxonomy of the traditional remote sensing CD techniques, which mainly sit within the boundary of 2D image/spectrum analysis, largely ignoring the particularities of 3D aspects of the data. The inclusion of 3D data for change detection (termed 3D CD), not only provides a source with different modality for analysis, but also transcends the border of traditional top-view 2D pixel/object-based analysis to highly detailed, oblique view or voxel-based geometric analysis. This paper reviews the recent developments and applications of 3D CD using remote sensing and close-range data, in support of both academia and industry researchers who seek for solutions in detecting and analyzing 3D dynamics of various objects of interest. We first describe the general considerations of 3D CD problems in different processing stages and identify CD types based on the information used, being the geometric comparison and geometric-spectral analysis. We then summarize relevant works and practices in urban, environment, ecology and civil applications, etc. Given the broad spectrum of applications and different types of 3D data, we discuss important issues in 3D CD methods. Finally, we present concluding remarks in algorithmic aspects of 3D CD.

  14. High Sensitivity Detection of CdSe/ZnS Quantum Dot-Labeled DNA Based on N-type Porous Silicon Microcavities

    PubMed Central

    Lv, Changwu; Jia, Zhenhong; Lv, Jie; Zhang, Hongyan; Li, Yanyu

    2017-01-01

    N-type macroporous silicon microcavity structures were prepared using electrochemical etching in an HF solution in the absence of light and oxidants. The CdSe/ZnS water-soluble quantum dot-labeled DNA target molecules were detected by monitoring the microcavity reflectance spectrum, which was characterized by the reflectance spectrum defect state position shift resulting from changes to the structures’ refractive index. Quantum dots with a high refractive index and DNA coupling can improve the detection sensitivity by amplifying the optical response signals of the target DNA. The experimental results show that DNA combined with a quantum dot can improve the sensitivity of DNA detection by more than five times. PMID:28045442

  15. High Sensitivity Detection of CdSe/ZnS Quantum Dot-Labeled DNA Based on N-type Porous Silicon Microcavities.

    PubMed

    Lv, Changwu; Jia, Zhenhong; Lv, Jie; Zhang, Hongyan; Li, Yanyu

    2017-01-01

    N-type macroporous silicon microcavity structures were prepared using electrochemical etching in an HF solution in the absence of light and oxidants. The CdSe/ZnS water-soluble quantum dot-labeled DNA target molecules were detected by monitoring the microcavity reflectance spectrum, which was characterized by the reflectance spectrum defect state position shift resulting from changes to the structures' refractive index. Quantum dots with a high refractive index and DNA coupling can improve the detection sensitivity by amplifying the optical response signals of the target DNA. The experimental results show that DNA combined with a quantum dot can improve the sensitivity of DNA detection by more than five times.

  16. The E3Σ1+ (63S1)←A3Π0+(53P1) transition in CdAr revisited: The spectrum and new analysis of the E3Σ1+ Rydberg state interatomic potential.

    PubMed

    Urbańczyk, T; Krośnicki, M; Kędziorski, A; Koperski, J

    2018-05-05

    Revisited study of the E 3 Σ 1 + (6 3 S 1 )←A 3 Π 0+ (5 3 P 1 ) transition in CdAr using both theoretical and experimental approach is presented. Systematic detection of the E 3 Σ 1 + in ,υ'←A 3 Π 0+ ,υ″=6 transition frequencies with higher accuracy and spectrally narrower laser extended and improved analysis and simulation of the LIF excitation spectrum. More consistent characterization of the E 3 Σ 1 + in -Rydberg state inner well using inversed perturbation approach methodology was achieved. Free←bound transitions in the E 3 Σ 1 + in ←A 3 Π 0+ ,υ″=6 excitation were taken into account in the analysis and simulation of the recorded spectrum. The updated spectroscopic characterization of the A 3 Π 0+ state was also revisited. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. The E3Σ1+ (63S1) ← A3Π0+(53P1) transition in CdAr revisited: The spectrum and new analysis of the E3Σ1+ Rydberg state interatomic potential

    NASA Astrophysics Data System (ADS)

    Urbańczyk, T.; Krośnicki, M.; Kędziorski, A.; Koperski, J.

    2018-05-01

    Revisited study of the E3Σ1+ (63S1) ← A3Π0+(53P1) transition in CdAr using both theoretical and experimental approach is presented. Systematic detection of the E3Σ1+in,υ' ← A3Π0+,υ″ = 6 transition frequencies with higher accuracy and spectrally narrower laser extended and improved analysis and simulation of the LIF excitation spectrum. More consistent characterization of the E3Σ1+in-Rydberg state inner well using inversed perturbation approach methodology was achieved. Free ← bound transitions in the E3Σ1+in ← A3Π0+,υ″ = 6 excitation were taken into account in the analysis and simulation of the recorded spectrum. The updated spectroscopic characterization of the A3Π0+ state was also revisited.

  18. Testing the specificity of executive functioning impairments in adolescents with ADHD, ODD/CD and ASD.

    PubMed

    Carter Leno, Virginia; Chandler, Susie; White, Pippa; Pickles, Andrew; Baird, Gillian; Hobson, Chris; Smith, Anna B; Charman, Tony; Rubia, Katya; Simonoff, Emily

    2017-12-09

    Current diagnostic systems conceptualise attention deficit hyperactivity disorder (ADHD), oppositional defiant/conduct disorder (ODD/CD) and autism spectrum disorder (ASD) as separate diagnoses. However, all three demonstrate executive functioning (EF) impairments. Whether these impairments are trans-diagnostic or disorder-specific remains relatively unexplored. Four groups of 10-16 year-olds [typically developing (TD; N = 43), individuals clinically diagnosed with ADHD (N = 21), ODD/CD (N = 26) and ASD (N = 41)] completed Go/NoGo and Switch tasks. Group differences were tested using analysis of co-variance (ANCOVA) including age, IQ, sex, conduct problems and ADHD symptoms as co-variates. Results indicated some disorder-specificity as only the ASD group demonstrated decreased probability of inhibition in the Go/NoGo task compared to all other groups. However, shared impairments were also found; all three diagnostic groups demonstrated increased reaction time variability (RTV) compared to the TD group, and both the ODD/CD and the ASD group demonstrated increased premature responses. When controlling for ADHD symptoms and conduct problems, group differences in RTV were no longer significant; however, the ASD group continued to demonstrate increased premature responses. No group differences were found in cognitive flexibility in the Switch task. A more varied response style was present across all clinical groups, although this appeared to be accounted for by sub-threshold ODD/CD and ADHD symptoms. Only the ASD group was impaired in response inhibition and premature responsiveness relative to TD adolescents. The findings suggest that some EF impairments typically associated with ADHD may also be found in individuals with ASD.

  19. Identification of an epitope derived from the cancer testis antigen HOM-TES-14/SCP1 and presented by dendritic cells to circulating CD4+ T cells.

    PubMed

    Neumann, Frank; Wagner, Claudia; Preuss, Klaus-Dieter; Kubuschok, Boris; Schormann, Claudia; Stevanovic, Stefan; Pfreundschuh, Michael

    2005-11-01

    Because of their frequent expression in a wide spectrum of malignant tumors but not in normal tissue except testis, cancer testis antigens are promising targets. However, except for HOM-TES-14/SCP1, their expression in malignant lymphomas is rare. SCP1 (synaptonemal complex protein 1) has been shown to elicit antibody responses in the autologous host, but no T-cell responses against HOM-TES-14/SCP1 have been reported. Using the SYFPEITHI algorithm, we selected peptides with a high binding affinity to major histocompatibility complex class 2 (MHC 2) molecules. The pentadecamer epitope p635-649 induced specific CD4+ T-cell responses that were shown to be restricted by HLA-DRB1*1401. The responses could be blocked by preincubation of T cells with anti-CD4 and antigen-presenting cells with anti-HLA-DR, respectively, proving the HLA-DR-restricted presentation of p635-649 and a CD4+ T-cell-mediated effector response. Responding CD4+ cells did not secrete interleukin-5 (IL-5), indicating that they belong to the T(H)1 subtype. The natural processing and presentation of p635-649 were demonstrated by pulsing autologous and allogeneic dendritic cells with a protein fragment covering p635-649. Thus, p635-649 is the first HOM-TES-14/SCP1-derived epitope to fulfill all prerequisites for use as a peptide vaccine in patients with HOM-TES-14/SCP1-expressing tumors, which is the case in two thirds of peripheral T-cell lymphomas.

  20. Raman characterization of a new Te-rich binary compound: CdTe2.

    PubMed

    Rousset, Jean; Rzepka, Edouard; Lincot, Daniel

    2009-04-02

    Structural characterization by Raman spectroscopy of CdTe thin films electrodeposited in acidic conditions is considered in this work. This study focuses on the evolution of material properties as a function of the applied potential and the film thickness, demonstrating the possibility to obtain a new Te-rich compound with a II/VI ratio of 1/2 under specific bath conditions. Raman measurements carried out on etched samples first allow the elimination of the assumption of a mixture of phases CdTe + Te and tend to confirm the formation of the CdTe(2) binary compound. The signature of this phase on the Raman spectrum is the increase of the LO band intensity compared to that obtained for the CdTe. The influence of the laser power is also considered. While no effect is observed on CdTe films, the increase of the incident irradiation power leads to the decomposition of the CdTe(2) compound into two more stable phases namely CdTe and Te.

  1. Differentiating Children with Attention-Deficit/Hyperactivity Disorder, Conduct Disorder, Learning Disabilities and Autistic Spectrum Disorders by Means of Their Motor Behavior Characteristics

    ERIC Educational Resources Information Center

    Efstratopoulou, Maria; Janssen, Rianne; Simons, Johan

    2012-01-01

    The study was designed to investigate the discriminant validity of the Motor Behavior Checklist (MBC) for distinguishing four group of children independently classified with Attention-Deficit/Hyperactivity Disorder, (ADHD; N = 22), Conduct Disorder (CD; N = 17), Learning Disabilities (LD; N = 24) and Autistic Spectrum Disorders (ASD; N = 20).…

  2. Motor, Emotional, and Cognitive Empathy in Children and Adolescents with Autism Spectrum Disorder and Conduct Disorder

    ERIC Educational Resources Information Center

    Bons, Danielle; van den Broek, Egon; Scheepers, Floor; Herpers, Pierre; Rommelse, Nanda; Buitelaaar, Jan K.

    2013-01-01

    It is unclear which aspects of empathy are shared and which are uniquely affected in autism spectrum disorder (ASD) and conduct disorder (CD) as are the neurobiological correlates of these empathy impairments. The aim of this systematic review is to describe the overlap and specificity of motor, emotional, and cognitive aspects of empathy in…

  3. Immunoarchitectural patterns in nodal marginal zone B-cell lymphoma: a study of 51 cases.

    PubMed

    Salama, Mohamed E; Lossos, Izidore S; Warnke, Roger A; Natkunam, Yasodha

    2009-07-01

    Nodal marginal zone lymphoma (NMZL) represents a rare and heterogeneous group that lacks markers specific for the diagnosis. We evaluated morphologic and immunoarchitectural features of 51 NMZLs, and the following immunostains were performed: CD20, CD21, CD23, CD5, CD3, CD43, CD10, Ki-67, BCL1, BCL2, BCL6, HGAL, and LMO2. Four immunoarchitectural patterns were evident: diffuse (38 [75%]), well-formed nodular/follicular (5 [10%]), interfollicular (7 [14%]), and perifollicular (1 [2%]). Additional features included a monocytoid component (36 [71%]), admixed large cells (20 [39%]), plasma cells (24 [47%]), compartmentalizing stromal sclerosis (13 [25%]), and prominent blood vessel sclerosis (10 [20%]). CD21 highlighted disrupted follicular dendritic cell meshwork in 35 (71%) of 49 cases, and CD43 coexpression was present in 10 (24%) of 42 cases. A panel of germinal center-associated markers was helpful in eliminating cases of diffuse follicle center lymphoma. Our results highlight the histologic and immunoarchitectural spectrum of NMZL and the usefulness of immunohistochemical analysis for CD43, CD23, CD21, BCL6, HGAL, and LMO2 in the diagnosis of NMZL.

  4. Role of the copper-oxygen defect in cadmium telluride solar cells

    NASA Astrophysics Data System (ADS)

    Corwine, Caroline R.

    Thin-film CdTe is one of the leading materials used in photovoltaic (PV) solar cells. One way to improve device performance and stability is through understanding how various device processing steps alter defect states in the CdTe layer. Photoluminescence (PL) studies can be used to examine radiative defects in materials. This study uses low-temperature PL to probe the defects present in thin-film CdTe deposited for solar cells. One key defect seen in the thin-film CdTe was reproduced in single-crystal (sX) CdTe by systematic incorporation of known impurities in the thin-film growth process, hence demonstrating that both copper and oxygen were necessary for its formation. Polycrystalline (pX) thin-film glass/SnO2:F/CdS/CdTe structures were examined. The CdTe layer was grown via close-spaced sublimation (CSS), vapor transport deposition (VTD), and physical vapor deposition (PVD). After CdTe deposition, followed by a standard CdC12 treatment and a ZnTe:Cu back contact, a PL peak was seen at ˜1.46 eV from the free back surface of all samples (1.456 eV for CSS and PVD, 1.460-1.463 eV for VTD). However, before the Cu-containing contact was added, this peak was not seen from the front of the CdTe (the CdS/CdTe junction region) in any device with CdTe thickness greater than 4 mum. The CdCl2 treatment commonly used to increase CdTe grain size did not enhance or reduce the peak at ˜1.46 eV relative to the rest of the PL spectrum. When the Cu-containing contact was applied, the PL spectra from both the front and back of the CdTe exhibited the peak at 1.456 eV. The PL peak at ˜1.46 eV was present in thin-film CdTe after deposition, when the dominant impurities are expected to be both Cu from the CdTe source material and O introduced in the chamber during growth to assist in CdTe film density. Since Cu and/or O appeared to be involved in this defect, PL studies were done with sX CdTe to distinguish between the separate effects of Cu or O and the combined effect of Cu and O. Photoluminescence on the sX samples revealed a unique transition at 1.456 eV, identical to the one seen in CSS thin-film CdTe, only when both Cu and O were introduced simultaneously. Theoretical calculations indicate that this PL line is likely a transition between the valence band and a Cui-OTe donor complex 150 meV below the conduction band. Formation of a Cui-OT, donor complex was expected to limit the performance of the CdS/CdTe solar cell. However, this was difficult to observe in the prepared devices, likely because other beneficial processes occurred simultaneously, such as formation of CUCd acceptors in the CdTe layer and improvement in the quality of the back contact by including Cu. It was possible to see the theoretical effects of this defect using AMPS--1D numerical simulations. The simulated J-V curves indicated that a donor level 150 meV from the conduction band would reduce the Voc, hence reducing the overall device efficiency. Therefore, despite the lack of direct experimental evidence, it is very plausible that the CU i-OTe defect observed with photoluminescence may serve to limit the possible attainable efficiency in CdS/CdTe solar cells.

  5. CD4 T Cell Responses in Latent and Chronic Viral Infections

    PubMed Central

    Walton, Senta; Mandaric, Sanja; Oxenius, Annette

    2013-01-01

    The spectrum of tasks which is fulfilled by CD4 T cells in the setting of viral infections is large, ranging from support of CD8 T cells and humoral immunity to exertion of direct antiviral effector functions. While our knowledge about the differentiation pathways, plasticity, and memory of CD4 T cell responses upon acute infections or immunizations has significantly increased during the past years, much less is still known about CD4 T cell differentiation and their beneficial or pathological functions during persistent viral infections. In this review we summarize current knowledge about the differentiation, direct or indirect antiviral effector functions, and the regulation of virus-specific CD4 T cells in the setting of persistent latent or active chronic viral infections with a particular emphasis on herpes virus infections for the former and chronic lymphocytic choriomeningitis virus infection for the latter. PMID:23717308

  6. The broadband rotational spectrum of fully deuterated acetaldehyde (CD3CDO) in a CW supersonic expansion

    NASA Astrophysics Data System (ADS)

    Zaleski, Daniel P.; Duan, Chuanxi; Carvajal, Miguel; Kleiner, Isabelle; Prozument, Kirill

    2017-12-01

    The broadband pure rotational spectra of CD3CDO, 13CD3CDO, CD313CDO, and CD3CD18O have been recorded using a BrightSpec W-Band (75-110 GHz) chirped-pulse Fourier transform millimeter wave (CP-FTmmW) spectrometer. The sample was enriched with deuterium, whereas the 13C and 18O isotopologues were observed in natural abundance (with respect to the enriched fully deuterated parent containing 12C and 16O). The analysis of the spectra is described and the derived molecular constants are compared to those of known acetaldehyde isotopologues. Furthermore, we have demonstrated the ability to record rotational spectra in a steady-state "CW" supersonic expansion with a duty cycle of 80%. The advantages and limitations of the segmented chirp spectrometer coupled with a CW molecular source as well as design of the vacuum and pumping system are discussed.

  7. Preparation and characterization of graphene/CdS nanocomposites

    NASA Astrophysics Data System (ADS)

    Wu, Jili; Bai, Song; Shen, Xiaoping; Jiang, Lei

    2010-11-01

    Graphene-based nanocomposites are emerging as a new class of materials that hold promise for many applications. In this paper, we present a facile approach for the preparation of graphene/CdS nanocomposites through simple reflux processes, in which thiourea (CS(NH 2) 2) and thioacetamide (C 2H 5NS) act as a sulphide source, respectively. The samples were characterized by the X-ray diffraction (XRD), transmission electron microscopy (TEM), Fourier transform infrared spectrum (FT-IR), ultraviolet-visible (UV-vis) spectroscopy and thermogravimetry analysis. It was shown that in the nanocomposites, the CdS nanoparticles were densely and uniformly deposited on the graphene sheets, and the sulphide source used has a great influence on the morphology, structure and property of the graphene/CdS nanocomposites. The good distribution of CdS nanoparticles on graphene sheets guarantees the efficient optoelectronic properties of graphene/CdS and would be promising for practical applications in future nanotechnology.

  8. The Value of Ensari’s Proposal in Evaluating the Mucosal Pathology of Childhood Celiac Disease: Old Classification versus New Version

    PubMed Central

    Güreşci, Servet; Hızlı, Şamil; Şimşek, Gülçin Güler

    2012-01-01

    Objective: Small intestinal biopsy remains the gold standard in diagnosing celiac disease (CD); however, the wide spectrum of histopathological states and differential diagnosis of CD is still a diagnostic problem for pathologists. Recently, Ensari reviewed the literature and proposed an update of the histopathological diagnosis and classification for CD. Materials and Methods: In this study, the histopathological materials of 54 children in whom CD was diagnosed at our hospital were reviewed to compare the previous Marsh and Modified Marsh-Oberhuber classifications with this new proposal. Results: In this study, we show that the Ensari classification is as accurate as the Marsh and Modified Marsh classifications in describing the consecutive states of mucosal damage seen in CD. Conclusions: Ensari’s classification is simple, practical and facilitative in diagnosing and subtyping of mucosal pathology of CD. PMID:25207015

  9. Power spectrum scale invariance as a neural marker of cocaine misuse and altered cognitive control.

    PubMed

    Ide, Jaime S; Hu, Sien; Zhang, Sheng; Mujica-Parodi, Lilianne R; Li, Chiang-Shan R

    2016-01-01

    Magnetic resonance imaging (MRI) has highlighted the effects of chronic cocaine exposure on cerebral structures and functions, and implicated the prefrontal cortices in deficits of cognitive control. Recent investigations suggest power spectrum scale invariance (PSSI) of cerebral blood oxygenation level dependent (BOLD) signals as a neural marker of cerebral activity. We examined here how PSSI is altered in association with cocaine misuse and impaired cognitive control. Eighty-eight healthy (HC) and seventy-five age and gender matched cocaine dependent (CD) adults participated in functional MRI of a stop signal task (SST). BOLD images were preprocessed using standard procedures in SPM, including detrending, band-pass filtering (0.01-0.25 Hz), and correction for head motions. Voxel-wise PSSI measures were estimated by a linear fit of the power spectrum with a log-log scale. In group analyses, we examined differences in PSSI between HC and CD, and its association with clinical and behavioral variables using a multiple regression. A critical component of cognitive control is post-signal behavioral adjustment, which is compromised in cocaine dependence. Therefore, we examined the PSSI changes in association with post-signal slowing (PSS) in the SST. Compared to HC, CD showed decreased PSS and PSSI in multiple frontoparietal regions. PSSI was positively correlated with PSS in HC in multiple regions, including the left inferior frontal gyrus (IFG) and right supramarginal gyrus (SMG), which showed reduced PSSI in CD. These findings suggest disrupted connectivity dynamics in the fronto-parietal areas in association with post-signal behavioral adjustment in cocaine addicts. These new findings support PSSI as a neural marker of impaired cognitive control in cocaine addiction.

  10. Energy, angular and spatial distributions of primary electrons inside photoconducting materials for digital mammography: Monte Carlo simulation studies.

    PubMed

    Sakellaris, T; Spyrou, G; Tzanakos, G; Panayiotakis, G

    2007-11-07

    Materials such as a-Se, a-As(2)Se(3), GaSe, GaAs, Ge, CdTe, CdZnTe, Cd(0.8)Zn(0.2)Te, ZnTe, PbO, TlBr, PbI(2) and HgI(2) are potential candidates as photoconductors in direct detectors for digital mammography. The x-ray induced primary electrons inside a photoconductor's bulk comprise the initial signal that propagates and forms the final signal (image) on the detector's electrodes. An already developed model for a-Se has been properly extended to simulate the primary electron production in the materials mentioned. Primary electron characteristics, such as their energy, angular and spatial distributions that strongly influence the characteristics of the final image, were studied for both monoenergetic and polyenergetic x-ray spectra in the mammographic energy range. The characteristic feature in the electron energy distributions for PbI(2) and HgI(2) is the atomic deexcitation peaks, whereas for the rest of the materials their shape can also be influenced by the electrons produced from primary photons. The electrons have a small tendency to be forward ejected whereas they prefer to be ejected perpendicular (theta = pi/2) to the incident beam's axis and at two lobes around phi = 0 and phi = pi. At practical mammographic energies (15-40 keV) a-Se, a-As(2)Se(3) and Ge have the minimum azimuthal uniformity whereas CdZnTe, Cd(0.8)Zn(0.2)Te and CdTe the maximum one. The spatial distributions for a-Se, a-As(2)Se(3), GaSe, GaAs, Ge, PbO and TlBr are almost independent of the polyenergetic spectrum, while those for CdTe, CdZnTe, Cd(0.8)Zn(0.2)Te, ZnTe, PbI(2) and HgI(2) have a spectrum dependence. In the practical mammographic energy range and at this primitive stage of primary electron production, a-Se has the best inherent spatial resolution as compared to the rest of the photoconductors. PbO has the minimum bulk space in which electrons can be produced whereas CdTe has the maximum one.

  11. Partial dynamical symmetry and the vibrational structure of Cd isotopes

    NASA Astrophysics Data System (ADS)

    Leviatan, A.; Gavrielov, N.; García-Ramos, J. E.; Van Isacker, P.

    2018-05-01

    The recently reported deviations of selected non-yrast states in 110Cd from the expected sphericalvibrator behaviour, is addressed by means of an Hamiltonian with U(5) partial dynamical symmetry. The latter preserves the U(5) symmetry in a segment of the spectrum and breaks it in other states. The effect of intruder states is treated in the framework of the interacting boson model with configuration mixing.

  12. Application of Mobility Spectrum Analysis to Modern Multi-layered IR Device Material

    NASA Astrophysics Data System (ADS)

    Brown, Alexander Earl

    Modern detector materials used for infrared (IR) imaging purposes contain complex multi-layered architectures, making more robust characterization techniques necessary. In order to determine mutli-carrier transport properties in the presence of mixed conduction, variable-field Hall characterization can be performed and then analyzed using mobility spectrum analysis to extract parameters of interest. Transport parameters are expected to aid in modeling and simulation of materials and can be used in optimization of particular problem areas. The performances of infrared devices ultimately depend on transport mechanisms, so an accurate determination becomes paramount. This work focuses on the characterization of two materials at the forefront of IR detectors; incumbent, tried and true, HgCdTe technologies and emergent III-V based superlattice structures holding much promise for future detector purposes. Ex-situ doped long-wave planar devices and in-situ doped mid-wave dual-layer heterojunctions (P+/n architecture) HgCdTe structures are explored with regards to substrate choice, namely lattice-matched CdZnTe and lattice-mismatched Si or GaAs. A detailed study of scattering mechanisms reveal that growth on lattice-mismatched substrates leads to dislocation scattering limited mobility at low temperature, correlating with extrinsically limited minority carrier lifetime and excesses diode tunneling current, resulting in overall lower performance. Mobility spectrum analysis proves to be an effective diagnostic on performance as well as providing insight in surface, substrate-interface, and minority carrier transport. Two main issues limiting performance of III-V based superlattices are addressed; high residual doping backgrounds and surface passivation. Mobility spectrum analysis proves to be a reliable method of determining background doping levels. Modest improvements are obtained via post-growth thermal annealing, but results suggest future efforts should be placed upon growth improvements. Passivation efforts using charged electret dielectric show promise but further refinements would be needed. Thiol passivation is identified as a successful passivant of Be-doped p-type InAs/GaSb long-wave absorbers using mobility spectrum analysis, correlating with fabricated device dark current. Mobility spectrum analysis demonstrates it will be indispensable in future development of III-V material.

  13. Probabilistic Perception, Empathy, and Dynamic Homeostasis: Insights in Autism Spectrum Disorders and Conduct Disorders

    PubMed Central

    Guilé, Jean Marc

    2013-01-01

    Homeostasis is not a permanent and stable state but instead results from conflicting forces. Therefore, infants have to engage in dynamic exchanges with their environment, in biological, cognitive, and affective domains. Empathy is an adaptive response to these environmental challenges, which contributes to reaching proper dynamic homeostasis and development. Empathy relies on implicit interactive processes, namely probabilistic perception and synchrony, which will be reviewed in the article. If typically-developed neonates are fully equipped to automatically and synchronously interact with their human environment, conduct disorders (CD) and autism spectrum disorders (ASD) present with impairments in empathetic communication, e.g., emotional arousal and facial emotion processing. In addition sensorimotor resonance is lacking in ASD, and emotional concern and semantic empathy are impaired in CD with Callous-Unemotional traits. PMID:24479115

  14. Gluten-free diet in gluten-related disorders.

    PubMed

    Mulder, Chris J J; van Wanrooij, R L J; Bakker, S F; Wierdsma, N; Bouma, G

    2013-01-01

    A gluten-free diet (GFD) is recommended for all patients with coeliac disease (CD). The spectrum of gluten-related disorders in the early 1980s was simple: CD and dermatitis herpetiformis. In the last few years, wheat allergy, gluten ataxia and noncoeliac gluten sensitivity have become new gluten-related topics. Adherence to GFDs in CD is limited and factors influencing adherence are poorly understood. Noncoeliac gluten sensitivity has stimulated the GFD food industry not only in Australia but all over the world. This article provides an overview of GFD in daily practice. Copyright © 2013 S. Karger AG, Basel.

  15. Solid-phase cadmium speciation in soil using L3-edge XANES spectroscopy with partial least-squares regression.

    PubMed

    Siebers, Nina; Kruse, Jens; Eckhardt, Kai-Uwe; Hu, Yongfeng; Leinweber, Peter

    2012-07-01

    Cadmium (Cd) has a high toxicity and resolving its speciation in soil is challenging but essential for estimating the environmental risk. In this study partial least-square (PLS) regression was tested for its capability to deconvolute Cd L(3)-edge X-ray absorption near-edge structure (XANES) spectra of multi-compound mixtures. For this, a library of Cd reference compound spectra and a spectrum of a soil sample were acquired. A good coefficient of determination (R(2)) of Cd compounds in mixtures was obtained for the PLS model using binary and ternary mixtures of various Cd reference compounds proving the validity of this approach. In order to describe complex systems like soil, multi-compound mixtures of a variety of Cd compounds must be included in the PLS model. The obtained PLS regression model was then applied to a highly Cd-contaminated soil revealing Cd(3)(PO(4))(2) (36.1%), Cd(NO(3))(2)·4H(2)O (24.5%), Cd(OH)(2) (21.7%), CdCO(3) (17.1%) and CdCl(2) (0.4%). These preliminary results proved that PLS regression is a promising approach for a direct determination of Cd speciation in the solid phase of a soil sample.

  16. Spectrum of clinical disease in a series of 135 hospitalised HIV-infected patients from north India

    PubMed Central

    Sharma, SK; Kadhiravan, Tamilarasu; Banga, Amit; Goyal, Tarun; Bhatia, Indrish; Saha, PK

    2004-01-01

    Background Literature on the spectrum of opportunistic disease in human immunodeficiency virus (HIV)-infected patients from developing countries is sparse. The objective of this study was to document the spectrum and determine the frequency of various opportunistic infections (OIs) and non-infectious opportunistic diseases, in hospitalised HIV-infected patients from north India. Methods One hundred and thirty five consecutive, HIV-infected patients (age 34 ± 10 years, females 17%) admitted to a tertiary care hospital in north India, for the evaluation and management of an OI or HIV-related disorder between January 2000 and July 2003, were studied. Results Fever (71%) and weight loss (65%) were the commonest presenting symptoms. Heterosexual transmission was the commonest mode of HIV-acquisition. Tuberculosis (TB) was the commonest OI (71%) followed by candidiasis (39.3%), Pneumocystis jiroveci pneumonia (PCP) (7.4%), cryptococcal meningitis and cerebral toxoplasmosis (3.7% each). Most of the cases of TB were disseminated (64%). Apart from other well-recognised OIs, two patients had visceral leishmaniasis. Two cases of HIV-associated lymphoma were encountered. CD4+ cell counts were done in 109 patients. Majority of the patients (82.6%) had CD4+ counts <200 cells/μL. Fifty patients (46%) had CD4+ counts <50 cells/μL. Only 50 patients (37%) received antiretroviral therapy. Twenty one patients (16%) died during hospital stay. All but one deaths were due to TB (16 patients; 76%) and PCP (4 patients; 19%). Conclusions A wide spectrum of disease, including both OIs and non-infectious opportunistic diseases, is seen in hospitalised HIV-infected patients from north India. Tuberculosis remains the most common OI and is the commonest cause of death in these patients. PMID:15555069

  17. Distinctive distribution of defects in CdZnTe:In ingots and their effects on the photoelectric properties

    NASA Astrophysics Data System (ADS)

    Fu, Xu; Wang, Fang-Bao; Zuo, Xi-Ran; Wang, Ze-Jian; Wang, Qian-Ru; Wang, Ke-Qin; Xu, Ling-Yan; Xu, Ya-Dong; Guo, Rong-Rong; Yu, Hui; Jie, Wan-Qi

    2018-03-01

    Photoelectric properties of CdZnTe:In samples with distinctive defect distributions are investigated using various techniques. Samples cut from the head (T04) and tail (W02) regions of a crystal ingot show distinct differences in Te inclusion distribution. Obvious difference is not observed in Fourier transform infrared (FTIR) spectra, UV–Vis–NIR transmittance spectra, and I–V measurements. However, carrier mobility of the tip sample is higher than that of the tail according to the laser beam induced current (LBIC) measurements. Low temperature photoluminescence (PL) measurement presents sharp emission peaks of D0X and A0X, and relatively large peak of D0X (or A0X) / Dcomplex for T04, indicating a better crystalline quality. Thermally stimulated current (TSC) spectrum shows higher density of shallow point defects, i.e., Cd vacancies, {In}}{{Cd}}+, etc., in W02 sample, which could be responsible for the deterioration of electron mobility. Project supported by the National Natural Science Foundations of China (Grant Nos. 51502244, 51702271, U1631116, and 51372205), the National Key Research and Development Program of China (Grant Nos. 2016YFF0101301 and 2016YFE0115200), the Fund of the State Key Laboratory of Solidification Processing in Northwestern Polytechnical University, China (Grant No. SKLSP201741) the Natural Science Basic Research Plan in Shaanxi Province, China (Grant No. 2016KJXX-09), and the Fundamental Research Funds for the Central Universities, China (Grant No. 3102015BJ(II)ZS014).

  18. Resolution of Site-Specific Conformational Heterogeneity in Proline-Rich Molecular Recognition by Src Homology 3 Domains.

    PubMed

    Horness, Rachel E; Basom, Edward J; Mayer, John P; Thielges, Megan C

    2016-02-03

    Conformational heterogeneity and dynamics are increasingly evoked in models of protein molecular recognition but are challenging to experimentally characterize. Here we combine the inherent temporal resolution of infrared (IR) spectroscopy with the spatial resolution afforded by selective incorporation of carbon-deuterium (C-D) bonds, which provide frequency-resolved absorptions within a protein IR spectrum, to characterize the molecular recognition of the Src homology 3 (SH3) domain of the yeast protein Sho1 with its cognate proline-rich (PR) sequence of Pbs2. The IR absorptions of C-D bonds introduced at residues along a peptide of the Pbs2 PR sequence report on the changes in the local environments upon binding to the SH3 domain. Interestingly, upon forming the complex the IR spectra of the peptides labeled with C-D bonds at either of the two conserved prolines of the PXXP consensus recognition sequence show more absorptions than there are C-D bonds, providing evidence for the population of multiple states. In contrast, the NMR spectra of the peptides labeled with (13)C at the same residues show only single resonances, indicating rapid interconversion on the NMR time scale. Thus, the data suggest that the SH3 domain recognizes its cognate peptide with a component of induced fit molecular recognition involving the adoption of multiples states, which have previously gone undetected due to interconversion between the populated states that is too fast to resolve using conventional methods.

  19. CD-Based Indices for Link Prediction in Complex Network.

    PubMed

    Wang, Tao; Wang, Hongjue; Wang, Xiaoxia

    2016-01-01

    Lots of similarity-based algorithms have been designed to deal with the problem of link prediction in the past decade. In order to improve prediction accuracy, a novel cosine similarity index CD based on distance between nodes and cosine value between vectors is proposed in this paper. Firstly, node coordinate matrix can be obtained by node distances which are different from distance matrix and row vectors of the matrix are regarded as coordinates of nodes. Then, cosine value between node coordinates is used as their similarity index. A local community density index LD is also proposed. Then, a series of CD-based indices include CD-LD-k, CD*LD-k, CD-k and CDI are presented and applied in ten real networks. Experimental results demonstrate the effectiveness of CD-based indices. The effects of network clustering coefficient and assortative coefficient on prediction accuracy of indices are analyzed. CD-LD-k and CD*LD-k can improve prediction accuracy without considering the assortative coefficient of network is negative or positive. According to analysis of relative precision of each method on each network, CD-LD-k and CD*LD-k indices have excellent average performance and robustness. CD and CD-k indices perform better on positive assortative networks than on negative assortative networks. For negative assortative networks, we improve and refine CD index, referred as CDI index, combining the advantages of CD index and evolutionary mechanism of the network model BA. Experimental results reveal that CDI index can increase prediction accuracy of CD on negative assortative networks.

  20. CD-Based Indices for Link Prediction in Complex Network

    PubMed Central

    Wang, Tao; Wang, Hongjue; Wang, Xiaoxia

    2016-01-01

    Lots of similarity-based algorithms have been designed to deal with the problem of link prediction in the past decade. In order to improve prediction accuracy, a novel cosine similarity index CD based on distance between nodes and cosine value between vectors is proposed in this paper. Firstly, node coordinate matrix can be obtained by node distances which are different from distance matrix and row vectors of the matrix are regarded as coordinates of nodes. Then, cosine value between node coordinates is used as their similarity index. A local community density index LD is also proposed. Then, a series of CD-based indices include CD-LD-k, CD*LD-k, CD-k and CDI are presented and applied in ten real networks. Experimental results demonstrate the effectiveness of CD-based indices. The effects of network clustering coefficient and assortative coefficient on prediction accuracy of indices are analyzed. CD-LD-k and CD*LD-k can improve prediction accuracy without considering the assortative coefficient of network is negative or positive. According to analysis of relative precision of each method on each network, CD-LD-k and CD*LD-k indices have excellent average performance and robustness. CD and CD-k indices perform better on positive assortative networks than on negative assortative networks. For negative assortative networks, we improve and refine CD index, referred as CDI index, combining the advantages of CD index and evolutionary mechanism of the network model BA. Experimental results reveal that CDI index can increase prediction accuracy of CD on negative assortative networks. PMID:26752405

  1. Synthesis and spectroscopic study of CdS nanoparticles using hydrothermal method

    NASA Astrophysics Data System (ADS)

    AL-Mamoori, Mohammed H. K.; Mahdi, Dunia K.; Al-Shrefi, Saif M.

    2018-05-01

    In this work, cadmium sulfide nanoparticles (powder) with diameter 50.8 nm was prepared using hydrothermal method. The structural and optical properties of CdS nanoparticles was studied by X-ray diffraction, FESEM, EDS, FTIR, UV-Diffuse Reflectance spectroscopy and Photoluminance spectrum. X-ray diffraction reveal the formation the purity of prepared phase of CdS particles with hexagonal wurtzite structure with particle size 31.8nm by using sheerer equation. The energy dispersion scattering (EDS) examination explains that the sample is composed of a large amount of Cd and S which are exactly CdS nanoparticles and there is a very small trace of (Zn) and (O) element observed because of there is a small pollutions in the measurement place of samples. FESEM shows the spherical shape of nanoparticles with around 50.8 nm diameter. The optical absorption spectral study identified the red shift of the sample in comparison to bulk ZnO in three dimensions. Photoluminance spectrum (PL) at room temperature showed that there are two luminescence peaks at 433.14 nm and 518.21nm. Samples demonstrate a sharp emission band at around 433.18 nm, which is attributed to the typical exciton luminescence. The broad band at 518.21nm which were attributed to the trapped luminescence. The green emission band at 518.21 nm was associated with the emission due to electronic transition from the conduction band to an accepter level due to interstitial sulphur ion.

  2. Hot electron induced NIR detection in CdS films.

    PubMed

    Sharma, Alka; Kumar, Rahul; Bhattacharyya, Biplab; Husale, Sudhir

    2016-03-11

    We report the use of random Au nanoislands to enhance the absorption of CdS photodetectors at wavelengths beyond its intrinsic absorption properties from visible to NIR spectrum enabling a high performance visible-NIR photodetector. The temperature dependent annealing method was employed to form random sized Au nanoparticles on CdS films. The hot electron induced NIR photo-detection shows high responsivity of ~780 mA/W for an area of ~57 μm(2). The simulated optical response (absorption and responsivity) of Au nanoislands integrated in CdS films confirms the strong dependence of NIR sensitivity on the size and shape of Au nanoislands. The demonstration of plasmon enhanced IR sensitivity along with the cost-effective device fabrication method using CdS film enables the possibility of economical light harvesting applications which can be implemented in future technological applications.

  3. Experimental observation of Fano effect in Ag nanoparticle-CdTe quantum dot hybrid system

    NASA Astrophysics Data System (ADS)

    Gurung, Sabina; Jayabalan, J.; Singh, Asha; Khan, Salahuddin; Chari, Rama

    2018-04-01

    We have experimentally measured the optical properties of Ag nanoparticle-CdTe quantum dot hybrid system and compared it with that of bare CdTe quantum dot colloid. It has been shown that the photoluminescence line shape of CdTe quantum dots becomes asymmetric in presence of Ag nanoparticles. The observed changes in the PL spectrum closely match the expected changes in the line shape due to Fano interaction between discrete level and continuum levels. Our experiment shows that a very small fraction of metal nanoparticles in the metal-semiconductor hybrid is sufficient to induce such changes in line shape which is in contrary to the earlier reported theoretical prediction on metal-semiconductor hybrid.

  4. Synthesis and Study of Optical Characteristics of Ti0.91O2/CdS Hybrid Sphere Structures

    NASA Astrophysics Data System (ADS)

    Kong, Lingbin; Xu, Qinfeng; Zhang, Meng; Wang, Dehua; Liu, Mingliang; Zhang, Lei; Jiao, Mengmeng; Wang, Honggang; Yang, Chuanlu

    2018-03-01

    The optical properties of alternating ultrathin Ti0.91O2 nanosheets and CdS nanoparticle hybrid spherical structures designed by the layer-by-layer (LBL) assembly technique are investigated. From the photoluminescence (PL) spectral measurements on the hybrid spherical structures, a spectrum-shifted fluorescence emission occurs in this novel hybrid material. The time-resolved PL measurements exhibit a remarkably increased PL lifetime of 3.75 ns compared with only Ti0.91O2 spheres or CdS nanoparticles. The novel results were attributed to the enhanced electron-hole separation due to the new type II indirect optical transition mechanism between Ti0.91O2 and CdS in a charge-separated configuration.

  5. New Meta Nanomaterials Extension II of Optical Enhancement and Photorefractive Two-Beam Coupling - Synthesis and Fabrication of Quantum Dot NLO Polymer Composites

    DTIC Science & Technology

    2015-07-09

    peaks at -65, which is assigned to Si(- OSi )3. All of these signals are consistent with the functionalization of CdS with MPS. However, another intense...OR CdS S RO 5 Si S OR SiO OR OR CdS S OR Si RO Si O ORRO S CdS S Si S S Si O O O O O O 6 Si Si Si SiSi O Si = OSi n Figure 3. Possible alternative...on this assumption, we attribute the peak in the 29Si SSNMR spectrum at-57 ppm to Si(- OSi )2O(R/H) groups, respectively, where R = CH3 and the weak

  6. Ultraviolet light protection by a sunscreen prevents interferon-driven skin inflammation in cutaneous lupus erythematosus.

    PubMed

    Zahn, Sabine; Graef, Medina; Patsinakidis, Nikolaos; Landmann, Aysche; Surber, Christian; Wenzel, Joerg; Kuhn, Annegret

    2014-07-01

    Irradiation with ultraviolet (UV) light is an important exacerbating factor in cutaneous lupus erythematosus (CLE) and induces various effects in the skin of patients with the disease, such as cell death and inflammation. Recently, we demonstrated the ability of a broad-spectrum sunscreen to prevent UV-induced damage both in patients with CLE and healthy controls (HCs). The aim of this study was to evaluate whether the UV-dependent activation of interferon (IFN)-driven inflammation in CLE can also be prevented by application of the sunscreen. In 20 patients with different subtypes of CLE and 10 HCs, defined areas on the upper back were treated with a broad-spectrum liposomal sunscreen 20 min prior to a combined standardized UVA/UVB irradiation. Immunohistological analyses using antibodies directed against MxA, CD11c, CD123 and CD68 were performed from skin biopsies taken from areas before UV irradiation as well as from sunscreen-treated and sunscreen-untreated areas 24 and 72 h after UV irradiation. The expression of MxA was completely prevented by the sunscreen applied prior to UV irradiation in CLE patients and HCs. Additionally, sunscreen protection significantly diminished the number of the CD11c- and CD123-positive dendritic cells, which are suggested to be a major source of type I/III IFNs, in UV-irradiated skin of patients with CLE. Moreover, the application of the sunscreen prevented the increase in CD68-positive macrophages in both groups 72 h after UV irradiation. The data of this study demonstrate that UV protection reduces lesional tissue damage and inhibits the typical IFN-driven inflammatory response in CLE. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Coeliac disease and the liver: spectrum of liver histology, serology and treatment response at a tertiary referral centre.

    PubMed

    Majumdar, Kaushik; Sakhuja, Puja; Puri, Amarender Singh; Gaur, Kavita; Haider, Aiman; Gondal, Ranjana

    2018-05-01

    Coeliac disease (CD) is a gluten-sensitive enteropathy diagnosed on the basis of ESPGHAN criteria and clinical response to gluten-free diet (GFD). Histological abnormalities on liver biopsy have been noted in CD but have seldom been described. To assess the histological spectrum of 'coeliac hepatitis' and possibility of reversal of such features after a GFD. Twenty-five patients with concomitant CD and hepatic derangement were analysed for clinical profile, laboratory investigations and duodenal and liver biopsy. A histological comparison of pre- and post-GFD duodenal and liver biopsies was carried out, wherever possible. Fifteen patients presenting with CD subsequently developed abnormal liver function tests; 10 patients presenting with liver disease were found to have tissue positive transglutaminase in 70% and antigliadin antibodies in 60%. Serological markers for autoimmune liver disease (AILD) were positive in eight patients. Liver histology ranged from mild reactive hepatitis, chronic hepatitis, steatosis to cirrhosis. Liver biopsies after a GFD were available in six cases, of which five showed a decrease in steatosis, portal and lobular inflammation and fibrosis score. Coeliac hepatitis could be a distinct entity and the patients may present with either CD or secondary hepatic derangement. Evaluation for the presence of CD is recommended for patients presenting with AILD, unexplained transaminasaemia or anaemia. This is one of the very few studies demonstrating the continuum of liver histological changes in 'coeliac hepatitis'. Trial of a GFD may result in clinicopathological improvement of 'coeliac hepatitis'. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  8. Analysis of Hair Trace Elements in Children with Autism Spectrum Disorders and Communication Disorders.

    PubMed

    Skalny, Anatoly V; Simashkova, Natalia V; Klyushnik, Tatiana P; Grabeklis, Andrei R; Radysh, Ivan V; Skalnaya, Margarita G; Tinkov, Alexey A

    2017-06-01

    The primary objective of the present study is analysis of hair trace elements content in children with communication disorder (CD) and autism spectrum disorder (ASD). A total of 99 children from control, CD, and ASD groups (n = 33) were examined. All children were additionally divided into two subgroups according to age. Hair levels of trace elements were assessed using inductively coupled plasma mass spectrometry. The difference was considered significant at p < 0.01. The obtained data demonstrate that children with CD are characterized by significantly increased hair lithium (Li) (96 %; p = 0.008), selenium (Se) (66 %; p < 0.001), arsenic (As) (96 %; p = 0.005), beryllium (Be) (150 %; p < 0.001), and cadmium (Cd) (72 %; p = 0.007) content, being higher than the respective control values. In the ASD group, hair copper (Cu), iodine (I), and Be levels tended to be lower than the control values. In turn, the scalp hair content of Se significantly exceeded the control values (33 %; p = 0.004), whereas the level of iron (Fe) and aluminum (Al) tended to increase. After gradation for age, the most prominent differences in children with CD were detected in the elder group (5-8 years), whereas in the case of ASD-in the younger group (3-4 years old). Taking into account the role of hair as excretory mechanism for certain elements including the toxic ones, it can be proposed that children suffering from ASD are characterized by more profound alteration of metal handling and excretion in comparison to CD.

  9. The surface glycoprotein of feline leukemia virus isolate FeLV-945 is a determinant of altered pathogenesis in the presence or absence of the unique viral long terminal repeat.

    PubMed

    Bolin, Lisa L; Ahmad, Shamim; Lobelle-Rich, Patricia A; Ooms, Tara G; Alvarez-Hernandez, Xavier; Didier, Peter J; Levy, Laura S

    2013-10-01

    Feline leukemia virus (FeLV) is a naturally transmitted gammaretrovirus that infects domestic cats. FeLV-945, the predominant isolate associated with non-T-cell disease in a natural cohort, is a member of FeLV subgroup A but differs in sequence from the FeLV-A prototype, FeLV-A/61E, in the surface glycoprotein (SU) and long terminal repeat (LTR). Substitution of the FeLV-945 LTR into FeLV-A/61E resulted in pathogenesis indistinguishable from that of FeLV-A/61E, namely, thymic lymphoma of T-cell origin. In contrast, substitution of both FeLV-945 LTR and SU into FeLV-A/61E resulted in multicentric lymphoma of non-T-cell origin. These results implicated the FeLV-945 SU as a determinant of pathogenic spectrum. The present study was undertaken to test the hypothesis that FeLV-945 SU can act in the absence of other unique sequence elements of FeLV-945 to determine the disease spectrum. Substitution of FeLV-A/61E SU with that of FeLV-945 altered the clinical presentation and resulted in tumors that demonstrated expression of CD45R in the presence or absence of CD3. Despite the evident expression of CD45R, a typical B-cell marker, T-cell receptor beta (TCRβ) gene rearrangement indicated a T-cell origin. Tumor cells were detectable in bone marrow and blood at earlier times during the disease process, and the predominant SU genes from proviruses integrated in tumor DNA carried markers of genetic recombination. The findings demonstrate that FeLV-945 SU alters pathogenesis, although incompletely, in the absence of FeLV-945 LTR. Evidence demonstrates that FeLV-945 SU and LTR are required together to fully recapitulate the distinctive non-T-cell disease outcome seen in the natural cohort.

  10. Efflux-Mediated Resistance to Tigecycline (GAR-936) in Pseudomonas aeruginosa PAO1

    PubMed Central

    Dean, Charles R.; Visalli, Melissa A.; Projan, Steven J.; Sum, Phaik-Eng; Bradford, Patricia A.

    2003-01-01

    Pseudomonas aeruginosa strains are less susceptible to tigecycline (previously GAR-936; MIC, 8 μg/ml) than many other bacteria (P. J. Petersen, N. V. Jacobus, W. J. Weiss, P. E. Sum, and R. T. Testa, Antimicrob. Agents Chemother. 43:738-744, 1999). To elucidate the mechanism of resistance to tigecycline, P. aeruginosa PAO1 strains defective in the MexAB-OprM and/or MexXY (OprM) efflux pumps were tested for susceptibility to tigecycline. Increased susceptibility to tigecycline (MIC, 0.5 to 1 μg/ml) was specifically associated with loss of MexXY. Transcription of mexX and mexY was also responsive to exposure of cells to tigecycline. To test for the emergence of compensatory efflux pumps in the absence of MexXY-OprM, mutants lacking MexXY-OprM were plated on medium containing tigecycline at 4 or 6 μg/ml. Resistant mutants were readily recovered, and these also had decreased susceptibility to several other antibiotics, suggesting efflux pump recruitment. One representative carbenicillin-resistant strain overexpressed OprM, the outer membrane channel component of the MexAB-OprM efflux pump. The mexAB-oprM repressor gene, mexR, from this strain contained a 15-bp in-frame deletion. Two representative chloramphenicol-resistant strains showed expression of an outer membrane protein slightly larger than OprM. The mexCD-OprJ repressor gene, nfxB, from these mutants contained a 327-bp in-frame deletion and an IS element insertion, respectively. Together, these data indicated drug efflux mediated by MexCD-OprJ. The MICs of the narrower-spectrum semisynthetic tetracyclines doxycycline and minocycline increased more substantially than did those of tigecycline and other glycylcyclines against the MexAB-OprM- and MexCD-OprJ-overexpressing mutant strains. This suggests that glycylcyclines, although they are subject to efflux from P. aeruginosa, are generally inferior substrates for P. aeruginosa efflux pumps than are narrower-spectrum tetracyclines. PMID:12604529

  11. Frequency of Dendritic Cells and Their Expression of Costimulatory Molecules in Children with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Saad, Khaled; Zahran, Asmaa M.; Elsayh, Khalid I.; Abdel-Rahman, Ahmed A.; Al-Atram, Abdulrahman A.; Hussein, Almontaser; El-Gendy, Yasmin G.

    2017-01-01

    The aim of our study was to evaluate the frequencies of myeloid dendritic cells (mDCs) and plasmacytoid dendritic cells (pDCs) in children with ASD. Subjects were 32 children with ASD and 30 healthy children as controls. The numbers of mDCs and pDCs and the expression of CD86 and CD80 on the entire DCs were detected by flow cytometry. ASD children…

  12. Necrotic and inflammatory changes in metal-on-metal resurfacing hip arthroplasties

    PubMed Central

    2009-01-01

    Background Necrosis and inflammation in peri-implant soft tissues have been described in failed second-generation metal-on-metal (MoM) resurfacing hip arthroplasties and in the pseudotumors associated with these implants. The precise frequency and significance of these tissue changes is unknown. Method We analyzed morphological and immunophenotypic changes in the periprosthetic soft tissues and femoral heads of 52 revised MoM arthroplasties (fracture in 21, pseudotumor in 13, component loosening in 9, and other causes in 9 cases). Results Substantial necrosis was observed in the periprosthetic connective tissue in 28 of the cases, including all pseudotumors, and 5 cases of component loosening. A heavy, diffuse inflammatory cell infiltrate composed mainly of HLA-DR+/CD14+/CD68+ macrophages and CD3+ T cells was seen in 45 of the cases. Perivascular lymphoid aggregates composed of CD3+ cells and CD20+ B cells were noted in 27 of the cases, but they were not seen in all cases of component loosening or pseudotumors. Plasma cells were noted in 30 cases. Macrophage granulomas were noted in 6 cases of component loosening. In the bone marrow of the femoral head, a macrophage and T cell response was seen in 31 of the cases; lymphoid aggregates were noted in 19 of the cases and discrete granulomas in 1 case. Interpretation Our findings indicate that there is a spectrum of necrotic and inflammatory changes in response to the deposition of cobalt-chrome (Co-Cr) wear particles in periprosthetic tissues. Areas of extensive coagulative necrosis and a macrophage and T lymphocyte response occur in implant failure and pseudotumors, in which there is also granuloma formation. The pathogenesis of these changes is uncertain but it may involve both a cytotoxic response and a delayed hypersensitivity (type IV) response to Co-Cr particles. PMID:19995315

  13. Decade-Long Safety and Function of Retroviral-Modified Chimeric Antigen Receptor T-cells

    PubMed Central

    Scholler, John; Brady, Troy L.; Binder-Scholl, Gwendolyn; Hwang, Wei-Ting; Plesa, Gabriela; Hege, Kristen M.; Vogel, Ashley N.; Kalos, Michael; Riley, James L.; Deeks, Steven G.; Mitsuyasu, Ronald T.; Bernstein, Wendy B.; Aronson, Naomi E.; Levine, Bruce L.; Bushman, Frederic D.; June, Carl H.

    2015-01-01

    The success of adoptive T cell gene transfer for treatment of cancer and HIV is predicated on generating a response that is both durable and safe. Here we report long term results from three clinical trials to evaluate gammaretroviral vector engineered T-cells for HIV. The vector encoded a chimeric antigen receptor (CAR) comprised of CD4 linked to the CD3-ζ signaling chain (CD4ζ). CAR T-cells were detected in 98% of samples tested for at least 11 years post-infusion at frequencies that exceed average T cell levels after most vaccine approaches. The CD4ζ transgene retained expression and function. There was no evidence of vector-induced immortalization of cells as integration site distributions showed no evidence of persistent clonal expansion or enrichment for integration sites near genes implicated in growth control or transformation. The CD4ζ T cells have stable levels of engraftment, with decay half-lives that exceed 16 years, in marked contrast to previous trials testing engineered T cells. These findings indicate that host immunosuppression prior to T cell transfer is not required in order to achieve long term persistence of gene-modified T cells. Further, our results emphasize the safety of T cells modified by retroviral gene transfer in clinical application, as measured in >500 patient years of follow up. Thus, previous safety issues with integrating viral vectors are hematopoietic stem cell or transgene intrinsic, and not a general feature of retroviral vectors. Engineered T cells are a promising form of synthetic biology for long term delivery of protein based therapeutics. These results provide a framework to guide the therapy of a wide spectrum of human diseases. PMID:22553251

  14. Feedback-Driven Trial-by-Trial Learning in Autism Spectrum Disorders

    PubMed Central

    Solomon, Marjorie; Frank, Michael J.; Ragland, J. Daniel; Smith, Anne C.; Niendam, Tara A.; Lesh, Tyler A.; Grayson, David S.; Beck, Jonathan S.; Matter, John C.; Carter, Cameron S.

    2017-01-01

    Objective Impairments in learning are central to autism spectrum disorders. The authors investigated the cognitive and neural basis of these deficits in young adults with autism spectrum disorders using a well-characterized probabilistic reinforcement learning paradigm. Method The probabilistic selection task was implemented among matched participants with autism spectrum disorders (N=22) and with typical development (N=25), aged 18–40 years, using rapid event-related functional MRI. Participants were trained to choose the correct stimulus in high-probability (AB), medium-probability (CD), and low-probability (EF) pairs, presented with valid feedback 80%, 70%, and 60% of the time, respectively. Whole-brain voxel-wise and parametric modulator analyses examined early and late learning during the stimulus and feedback epochs of the task. Results The groups exhibited comparable performance on medium- and low-probability pairs. Typically developing persons showed higher accuracy on the high-probability pair, better win-stay performance (selection of the previously rewarded stimulus on the next trial of that type), and more robust recruitment of the anterior and medial prefrontal cortex during the stimulus epoch, suggesting development of an intact reward-based working memory for recent stimulus values. Throughout the feedback epoch, individuals with autism spectrum disorders exhibited greater recruitment of the anterior cingulate and orbito-frontal cortices compared with individuals with typical development, indicating continuing trial-by-trial activity related to feedback processing. Conclusions Individuals with autism spectrum disorders exhibit learning deficits reflecting impaired ability to develop an effective reward-based working memory to guide stimulus selection. Instead, they continue to rely on trial-by-trial feedback processing to support learning dependent upon engagement of the anterior cingulate and orbito-frontal cortices. PMID:25158242

  15. Effect of cadmium-selenide quantum dots on the conductivity and photoconductivity of nanocrystalline indium oxide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Il’in, A. S., E-mail: as.ilin@physics.msu.ru; Fantina, N. P.; Martyshov, M. N.

    The effect of cadmium-selenide quantum dots addition on the electrical and photoelectric properties of nanocrystalline indium oxide with nanocrystal dimensions in the range from 7 to 40 nm is studied. By impedance spectroscopy, it is shown that the addition of quantum dots substantially influences the resistance of interfaces between In{sub 2}O{sub 3} crystals. A change in the character of the photoconductivity spectrum of In{sub 2}O{sub 3} upon the addition of CdSe quantum dots is detected, and it is established that this change depends on the In{sub 2}O{sub 3}-nanocrystal dimensions. An energy band diagram is proposed to explain the observed changemore » in the photoconductivity spectrum of In{sub 2}O{sub 3} upon the addition of CdSe quantum dots.« less

  16. Investigation of energy transfer mechanisms between Bi(2+) and Tm(3+) by time-resolved spectrum.

    PubMed

    Li, Yang; Sharafudeen, Kaniyarakkal; Dong, Guoping; Ma, Zhijun; Qiu, Jianrong

    2013-11-01

    Here, we report for the first time the optical properties of Bi(2+) and Tm(3+) co-doped germanate glasses and elucidate the potential of this material as substrates to improve the performance of CdTe solar cell. A strong emission peak at 800nm is observed under the excitation of 450-700nm in this material. The energy transfer processes from the transitions of Bi(2+) [(2)P3/2(1)→(2)P1/2]: Tm(3+) [(3)H6→(3)H4] are investigated by time-resolved luminescence spectroscopy. A cover glass exhibiting an ultra-broadband response spectrum covering the entire solar visible wavelength region is suggested to enhance the conversion efficiency of CdTe solar cells significantly. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Fabrication of Semi-Transparent Photovoltaic Cell by a Cost-Effective Technique

    NASA Astrophysics Data System (ADS)

    Nithyayini, K. N.; Ramasesha, Sheela K.

    2015-09-01

    Semi-transparent inorganic thin film PV cells have been fabricated using n-type (CdS) and p-type (CdTe) semiconductors. Large area devices which can be used as windows and skylights in buildings can be fabricated using cost effective solution processes. The device structure is Glass/TCO/CdTe/CdS/TCO. Chemically stable CdS and CdTe layers are deposited at temperatures 353 K to 373 K (80 °C to 100 °C) under controlled pH. The CdCl2 activation is carried out followed by air annealing. The p-n junction is formed by sintering the device at 673 K to 723 K (400 °C to 450 °C). The characterization of cells is carried out using XRD, SEM, AFM, and UV-Visible spectroscopy. The thickness of the cell is ~600 nm. The band gap values are 2.40 eV for CdS and 1.36 eV for CdTe with transmittance of about 70 pct in the visible region. Under 1.5 AM solar spectrum, V oc, and I sc of the initial device are 3.56e-01 V and 6.20e-04 A, respectively.

  18. Motor function and perception in children with neuropsychiatric and conduct problems: results from a population based twin study.

    PubMed

    Gustafsson, Peik; Kerekes, Nóra; Anckarsäter, Henrik; Lichtenstein, Paul; Gillberg, Christopher; Råstam, Maria

    2014-01-01

    Children with early symptomatic psychiatric disorders such as Attention-Deficit/Hyperactivity Disorder (ADHD) and Autism Spectrum Disorder (ASD) have been found to have high rates of motor and/or perception difficulties. However, there have been few large-scale studies reporting on the association between Conduct Disorder (CD) and motor/perception functions. The aim of the present study was to investigate how motor function and perception relate to measures of ADHD, ASD, and CD. Parents of 16,994 Swedish twins (ages nine and twelve years) were interviewed using the Autism-Tics, ADHD and other Comorbidities inventory (A-TAC), which has been validated as a screening instrument for early onset child psychiatric disorders and symptoms. Associations between categorical variables of scoring above previously validated cut-off values for diagnosing ADHD, ASD, and CD on the one hand and motor and/or perception problems on the other hand were analysed using cross-tabulations, and the Fisher exact test. Associations between the continuous scores for ADHD, ASD, CD, and the subdomains Concentration/Attention, Impulsiveness/Activity, Flexibility, Social Interaction and Language, and the categorical factors age and gender, on the one hand, and the dependent dichotomic variables Motor control and Perception problems, on the other hand, were analysed using binary logistic regression in general estimated equation models. Male gender was associated with increased risk of Motor control and/or Perception problems. Children scoring above the cut-off for ADHD, ASD, and/or CD, but not those who were 'CD positive' but 'ADHD/ASD negative', had more Motor control and/or Perception problems, compared with children who were screen-negative for all three diagnoses. In the multivariable model, CD and Impulsiveness/Activity had no positive associations with Motor control and/or Perception problems. CD symptoms or problems with Impulsiveness/Activity were associated with Motor control or Perception problems only in the presence of ASD symptoms and/or symptoms of inattention. Our results indicate that children with CD but without ASD or inattention do not show a deviant development of motor and perceptual functions. Therefore, all children with CD should be examined concerning motor control and perception. If problems are present, a suspicion of ADHD and/or ASD should be raised.

  19. Measurement of soluble CD59 in CSF in demyelinating disease: Evidence for an intrathecal source of soluble CD59.

    PubMed

    Zelek, Wioleta M; Watkins, Lewis M; Howell, Owain W; Evans, Rhian; Loveless, Sam; Robertson, Neil P; Beenes, Marijke; Willems, Loek; Brandwijk, Ricardo; Morgan, B Paul

    2018-02-01

    CD59, a broadly expressed glycosylphosphatidylinositol-anchored protein, is the principal cell inhibitor of complement membrane attack on cells. In the demyelinating disorders, multiple sclerosis (MS) and neuromyelitis optica spectrum disorder (NMOSD), elevated complement protein levels, including soluble CD59 (sCD59), were reported in cerebrospinal fluid (CSF). We compared sCD59 levels in CSF and matched plasma in controls and patients with MS, NMOSD and clinically isolated syndrome (CIS) and investigated the source of CSF sCD59 and whether it was microparticle associated. sCD59 was quantified using enzyme-linked immunosorbent assay (ELISA; Hycult; HK374-02). Patient and control CSF was subjected to western blotting to characterise anti-CD59-reactive materials. CD59 was localised by immunostaining and in situ hybridisation. CSF sCD59 levels were double those in plasma (CSF, 30.2 ng/mL; plasma, 16.3 ng/mL). Plasma but not CSF sCD59 levels differentiated MS from NMOSD, MS from CIS and NMOSD/CIS from controls. Elimination of microparticles confirmed that CSF sCD59 was not membrane anchored. CSF levels of sCD59 are not a biomarker of demyelinating diseases. High levels of sCD59 in CSF relative to plasma suggest an intrathecal source; CD59 expression in brain parenchyma was low, but expression was strong on choroid plexus (CP) epithelium, immediately adjacent the CSF, suggesting that this is the likely source.

  20. CD30-Positive T-Cell Lymphoproliferative Disease of the Oral Mucosa in Children: A Manifestation of Epstein-Barr Virus-Associated T-Lymphoproliferative Disorder.

    PubMed

    Hong, Mineui; Ko, Young Hyeh

    2015-11-01

    Eosinophilic ulcer of the oral mucosa (EUOM) is a very rare, benign, self-limiting ulcerative lesion of the oral cavity of unknown pathogenesis, and belongs to the same spectrum of CD30(+) T-cell lymphoproliferative disease (LPD) of the oral mucosa. The etiology and pathogenesis of the disease are unknown. We report two cases in children who were initially diagnosed with EUOM and CD30(+) T-cell LPD, respectively. However, retrospective analysis revealed that a majority of infiltrated atypical T cells were positive for Epstein-Barr virus (EBV). The present cases suggest that the pathogenesis and etiology of EUOM or CD30(+) T-cell LPD occurring in children are different from those in adults. EUOM or CD30(+) T-cell LPD in children is a manifestation of EBV-positive T-cell LPD, and should therefore be distinguished from the disease in adults.

  1. Synthesis of nanocrystalline CdS thin film by SILAR and their characterization

    NASA Astrophysics Data System (ADS)

    Mukherjee, A.; Satpati, B.; Bhattacharyya, S. R.; Ghosh, R.; Mitra, P.

    2015-01-01

    Cadmium sulphide (CdS) thin film was prepared by successive ion layer adsorption and reaction (SILAR) technique using ammonium sulphide as anionic precursor. Characterization techniques of XRD, SEM, TEM, FTIR and EDX were utilized to study the microstructure of the films. Structural characterization by x-ray diffraction reveals the polycrystalline nature of the films. Cubic structure is revealed from X-ray diffraction and selected area diffraction (SAD) patterns. The particle size estimated using X-ray line broadening method is approximately 7 nm. Instrumental broadening was taken into account while particle size estimation. TEM shows CdS nanoparticles in the range 5-15 nm. Elemental mapping using EFTEM reveals good stoichiometric composition of CdS. Characteristic stretching vibration mode of CdS was observed in the absorption band of FTIR spectrum. Optical absorption study exhibits a distinct blue shift in band gap energy value of about 2.56 eV which confirms the size quantization.

  2. A facile synthesis of Zn(x)Cd(1-x)S/CNTs nanocomposite photocatalyst for H2 production.

    PubMed

    Wang, Lei; Yao, Zhongping; Jia, Fangzhou; Chen, Bin; Jiang, Zhaohua

    2013-07-21

    The sulfide solid solution has become a promising and important visible-light-responsive photocatalyst for hydrogen production nowadays. Zn(x)Cd(1-x)S/CNT nanocomposites were synthesized to improve the dispersion, adjust the energy band gap, and enhance the separation of the photogenerated electrons and holes. The as-prepared photocatalysts were characterized by scanning electron-microscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS) and UV-visible diffuse reflectance spectra (UV-visible), respectively. And the effects of CNTs on structure, composition and optical absorption property of the sulfide solid solutions were investigated along with their inherent relationships. For Zn0.83Cd0.17S/CNTs, sulfide solid solution is assembled along the CNTs orderly, with a diameter of 100 nm or so. XPS analysis shows that there is bonding effect between the solid solutions and the CNTs due to the strong adsorption of Zn(2+) and Cd(2+) on the surface of CNTs. There are two obvious absorption edges for Zn0.83Cd0.17S/CNTs, corresponding to two kinds of sulfide solid solutions with different molar ratios of Zn/Cd. The hybridization of solid solutions with CNTs makes the absorption spectrum red shift. The photocatalytic property was evaluated by splitting Na2S + Na2SO3 solution into H2, and the highest rate of H2 evolution of 6.03 mmol h(-1) g(-1) was achieved over Zn0.83Cd0.17S/CNTs. The high activity of photocatalytic H2 production is attributed to the following factors: (1) the optimum band gap and a moderate position of the conduction band (which needs to match the irradiation spectrum of the Xe lamp best), (2) the efficient separation of photogenerated electrons and holes by hybridization, and (3) the improvement of the dispersion of nanocomposites by assembling along the CNTs as well.

  3. The broadband rotational spectrum of fully deuterated acetaldehyde (CD 3CDO) in a CW supersonic expansion

    DOE PAGES

    Zaleski, Daniel P.; Duan, Chuanxi; Carvajal, Miguel; ...

    2017-02-09

    The broadband pure rotational spectra of CD 3CDO, 13CD 3CDO, CD 3 13CDO, and CD 3CD 18O have been recorded using a BrightSpec W-Band (75–110 GHz) chirped-pulse Fourier transform millimeter wave (CP-FTmmW) spectrometer. The sample was enriched with deuterium, whereas the 13C and 18O isotopologues were observed in natural abundance (with respect to the enriched fully deuterated parent containing 12C and 16O). The analysis of the spectra is described and the derived molecular constants are compared to those of known acetaldehyde isotopologues. Furthermore, we have demonstrated the ability to record rotational spectra in a steady-state “CW” supersonic expansion with amore » duty cycle of 80%. Finally, the advantages and limitations of the segmented chirp spectrometer coupled with a CW molecular source as well as design of the vacuum and pumping system are discussed.« less

  4. The broadband rotational spectrum of fully deuterated acetaldehyde (CD 3CDO) in a CW supersonic expansion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zaleski, Daniel P.; Duan, Chuanxi; Carvajal, Miguel

    The broadband pure rotational spectra of CD 3CDO, 13CD 3CDO, CD 3 13CDO, and CD 3CD 18O have been recorded using a BrightSpec W-Band (75–110 GHz) chirped-pulse Fourier transform millimeter wave (CP-FTmmW) spectrometer. The sample was enriched with deuterium, whereas the 13C and 18O isotopologues were observed in natural abundance (with respect to the enriched fully deuterated parent containing 12C and 16O). The analysis of the spectra is described and the derived molecular constants are compared to those of known acetaldehyde isotopologues. Furthermore, we have demonstrated the ability to record rotational spectra in a steady-state “CW” supersonic expansion with amore » duty cycle of 80%. Finally, the advantages and limitations of the segmented chirp spectrometer coupled with a CW molecular source as well as design of the vacuum and pumping system are discussed.« less

  5. Commentary: Cognitive and emotional empathy in transdiagnostic research - reflections on Klapwijk et al. (2016).

    PubMed

    Herrington, John D

    2016-06-01

    Evidence across multiple disorders indicates that empathy is a transdiagnostic dimension of psychopathology. Klapwijk et al.'s (2016) functional MRI study examines whether autism spectrum disorder (ASD) and conduct disorder (CD) can be distinguished by the constructs of 'cognitive' and 'emotional' empathy - with the former focusing on accurate emotion perception and the latter on shared affective experience. This commentary examines the implications of the cognitive/emotional empathy distinction, and how it fits with existing accounts of perceptual differences in ASD. Cognitive empathy overlaps substantially with the constructs of emotion perception and Theory of Mind - both well studied among individuals with ASD, but generally viewed as fairly distinct from empathy. CD, on the other hand, is typically not associated with frank perceptual deficits. Although the brain imaging data from this study do not provide strong support for the constructs of cognitive and emotional empathy, the general approach used in this study is precisely the kind needed to test the validity and utility of transdiagnostic mechanisms of psychopathology. © 2016 Association for Child and Adolescent Mental Health.

  6. Far-infrared laser magnetic resonance of vibrationally excited CD2

    NASA Technical Reports Server (NTRS)

    Evenson, K. M.; Sears, T. J.; Mckellar, A. R. W.

    1984-01-01

    The detection of 13 rotational transitions in the first excited bending state (010) of CD2 using the technique of far-infrared laser magnetic resonance spectroscopy is reported. Molecular parameters for this state are determined from these new data together with existing infrared observations of the v(2) band. Additional information on the ground vibrational state (000) is also provided by the observation of a new rotational transition, and this is combined with existing data to provide a refined set of molecular parameters for the CD2 ground state. One spectrum has been observed that is assigned as a rotational transition within the first excited symmetric stretching state (100) of CD2. These data will be of use in refining the structure and the potential function of the methylene radical.

  7. Simultaneous determination of Cu 2+, Zn 2+, Cd 2+, Hg 2+ and Pb 2+ by using second-derivative spectrophotometry method

    NASA Astrophysics Data System (ADS)

    Han, Yanyan; Li, Yan; Si, Wei; Wei, Dong; Yao, Zhenxing; Zheng, Xianpeng; Du, Bin; Wei, Qin

    2011-09-01

    A new method of simultaneous determination of Cu 2+, Zn 2+, Cd 2+, Hg 2+ and Pb 2+ is proposed here by using the second-derivative spectrophotometry method. In pH = 10.35 Borax-NaOH buffer, using meso-tetra (3-methoxyl-4-hydroxylphenyl) porphyrin ([T-(3-MO-4-HP)P]) as chromomeric reagent, micelle solution was formed after Tween-80 surfactant was added into the solution containing Cu 2+, Zn 2+, Cd 2+, Hg 2+ and Pb 2+ ions. The original absorption spectrum of the above complexes was obtained after heating in the boiling water for 25 min. The second-derivative absorption peaks of five metal-porphyrin complexes can be separated from the original absorption spectrum by using chemometric tool. In this way, Cu 2+, Zn 2+, Cd 2+, Hg 2+ and Pb 2+ ions can be determined simultaneously. Under the optimal conditions, the linear ranges of the calibration curve were 0-0.60, 0-0.60, 0-0.40, 0-0.80 and 0-0.48 μg mL -1 for Cu 2+, Zn 2+, Cd 2+, Hg 2+ and Pb 2+, respectively. The molar absorptivity of these color systems were 1.38 × 10 5, 1.01 × 10 5, 3.24 × 10 5, 1.07 × 10 5 and 1.29 × 10 5 L mol -1 cm -1. The method developed in this paper has advantages in selectivity, sensitivity, operation and can effectively resolve spectra overlapping problem. This method has been applied to determine the real samples with satisfactory results.

  8. Toll-like receptor agonist imiquimod facilitates antigen-specific CD8+ T-cell accumulation in the genital tract leading to tumor control through IFNγ.

    PubMed

    Soong, Ruey-Shyang; Song, Liwen; Trieu, Janson; Knoff, Jayne; He, Liangmei; Tsai, Ya-Chea; Huh, Warner; Chang, Yung-Nien; Cheng, Wen-Fang; Roden, Richard B S; Wu, T-C; Trimble, Cornelia L; Hung, Chien-Fu

    2014-11-01

    Imiquimod is a Toll-like receptor 7 agonist used topically to treat external genital warts and basal cell carcinoma. We examined the combination of topical imiquimod with intramuscular administration of CRT/E7, a therapeutic human papillomavirus (HPV) vaccine comprised of a naked DNA vector expressing calreticulin fused to HPV16 E7. Using an orthotopic HPV16 E6/E7(+) syngeneic tumor, TC-1, as a model of high-grade cervical/vaginal/vulvar intraepithelial neoplasia, we assessed if combining CRT/E7 vaccination with cervicovaginal deposition of imiquimod could result in synergistic activities promoting immune-mediated tumor clearance. Imiquimod induced cervicovaginal accumulation of activated E7-specific CD8(+) T cells elicited by CRT/E7 vaccination. Recruitment was not dependent upon the specificity of the activated CD8(+) T cells, but was significantly reduced in mice lacking the IFNγ receptor. Intravaginal imiquimod deposition induced upregulation of CXCL9 and CXCL10 mRNA expression in the genital tract, which are produced in response to IFNγ receptor signaling and attract cells expressing their ligand, CXCR3. The T cells attracted by imiquimod to the cervicovaginal tract expressed CXCR3 as well as CD49a, an integrin involved in homing and retention of CD8(+) T cells at mucosal sites. Our results indicate that intramuscular CRT/E7 vaccination in conjunction with intravaginal imiquimod deposition recruits antigen-specific CXCR3(+) CD8(+) T cells to the genital tract. Several therapeutic HPV vaccination clinical trials using a spectrum of DNA vaccines, including vaccination in concert with cervical imiquimod, are ongoing. Our study identifies a mechanism by which these strategies could provide therapeutic benefit. Our findings support accumulating evidence that manipulation of the tumor microenvironment can enhance the therapeutic efficacy of strategies that induce tumor-specific T cells. ©2014 American Association for Cancer Research.

  9. Enzymatic synthesis and characterizations of cyclic GDP-ribose. A procedure for distinguishing enzymes with ADP-ribosyl cyclase activity.

    PubMed

    Graeff, R M; Walseth, T F; Fryxell, K; Branton, W D; Lee, H C

    1994-12-02

    Cyclic nucleotides such as cAMP and cGMP are second messengers subserving various signaling pathways. Cyclic ADP-ribose (cADPR), a recently discovered member of the family, is derived from NAD+ and is a mediator of Ca2+ mobilization in various cellular systems. The synthesis and degradation of cADPR are, respectively, catalyzed by ADP-ribosyl cyclase and cADPR hydrolase. CD38, a differentiation antigen of B lymphocytes, has recently been shown to be a bifunctional enzyme catalyzing both the formation and hydrolysis of cADPR. The overall reaction catalyzed by CD38 is the formation of ADP-ribose and nicotinamide from NAD+, identical to that catalyzed by NADase. The difficulties in detecting the formation of cADPR have led to frequent identification of CD38 as a classical NADase. In this study, we show that both ADP-ribosyl cyclase and CD38, but not NADase, can cyclize nicotinamide guanine dinucleotide (NGD+) producing a new nucleotide. Analyses by high performance liquid chromatography and mass spectroscopy indicate the product is cyclic GDP-ribose (cGDPR) with a structure similar to cADPR except with guanine replacing adenine. Compared to cADPR, cGDPR is a more stable compound showing 2.8 times more resistance to heat-induced hydrolysis. These results are consistent with a catalytic scheme for CD38 where the cyclization of the substrate precedes the hydrolytic reaction. Spectroscopic analyses show that cGDPR is fluorescent and has an absorption spectrum different from both NGD+ and GDPR, providing a very convenient way for monitoring its enzymatic formation. The use of NGD+ as substrate for assaying the cyclization reaction was found to be applicable to pure enzymes as well as crude tissue extracts making it a useful diagnostic tool for distinguishing CD38-like enzymes from degradative NADases.

  10. Development of low methoxy amidated pectin-based mucoadhesive patches for buccal delivery of triclosan: effect of cyclodextrin complexation.

    PubMed

    Jug, Mario; Kosalec, Ivan; Maestrelli, Francesca; Mura, Paola

    2012-11-06

    A novel mucoadhesive buccal patch formulation of triclosan (TR), a broad spectrum antibacterial agent, was developed using low methoxy amidated pectin (AMP). The integrity of AMP matrix was improved by addition of 20% (w/w) Carbopol (CAR). The efficiency of β-cyclodextrin-epichlorohydrin polymer (EPIβCD) and anionic carboxymethylated β-cyclodextrin-epichlorohydrin polymer (CMEPIβCD) in optimization of TR solubility and release from such a matrix was investigated and confronted to that of parent β-cyclodextrin (βCD). Loading of TR/βCD co-ground complex into AMP/CAR matrix resulted in a biphasic release profile which was sensitive upon the hydration degree of the matrix, due to lower solubilizing efficiency of βCD, while the drug release from patches loaded with TR/EPIβCD complex was significantly faster with a constant release rate. Microbiological studies evidenced faster onset and more pronounced antibacterial action of TR/EPIβCD loaded patches, clearly demonstrating their good therapeutic potential in eradication of Streptococcus mutans, a cariogenic bacteria, from the oral cavity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Optical and FT Infrared spectral studies of vanadium ions in cadmium borate glass and effects of gamma irradiation

    NASA Astrophysics Data System (ADS)

    AbdelAziz, T. D.; EzzElDin, F. M.; El Batal, H. A.; Abdelghany, A. M.

    2014-10-01

    Combined optical and infrared absorption spectra of V2O5-doped cadmium borate glasses were investigated before and after gamma irradiation with a dose of 8 Mrad (=8 × 104 Gy). The undoped base cadmium borate glass reveals a spectrum consisting of strong charge transfer UV absorption bands which are related to the presence of unavoidable contaminated trace iron impurities (mainly Fe3+). The V2O5-doped glasses reveal an extra band at 380 nm and the high V2O5-content glass also shows a further band at about 420 nm. The observed optical spectrum indicates the presence of vanadium ions mainly in the pentavalent state (d0 configuration). The surplus band at 420 nm shows that some trivalent vanadium ions are identified at high V2O5 content. The optical spectra of the glasses after gamma irradiation show small decrease of the intensity of the UV absorption which are interpreted by assuming the transformation of some Fe3+ ions by photochemical reactions with the presence of high content (45 mol%) of heavy massive CdO causing some shielding behavior. FT infrared absorption spectra of the glasses show vibrational bands due to collective presence of triangular and tetrahedral borate groups in their specific wavenumbers. The FTIR spectra are observed to be slightly affected by both the V2O5-dopants being present in modifying low percent or gamma irradiation due to the presence of high content heavy CdO.

  12. Optical and FT Infrared spectral studies of vanadium ions in cadmium borate glass and effects of gamma irradiation.

    PubMed

    AbdelAziz, T D; EzzElDin, F M; El Batal, H A; Abdelghany, A M

    2014-10-15

    Combined optical and infrared absorption spectra of V2O5-doped cadmium borate glasses were investigated before and after gamma irradiation with a dose of 8 Mrad (=8×10(4) Gy). The undoped base cadmium borate glass reveals a spectrum consisting of strong charge transfer UV absorption bands which are related to the presence of unavoidable contaminated trace iron impurities (mainly Fe(3+)). The V2O5-doped glasses reveal an extra band at 380nm and the high V2O5-content glass also shows a further band at about 420nm. The observed optical spectrum indicates the presence of vanadium ions mainly in the pentavalent state (d(0) configuration). The surplus band at 420nm shows that some trivalent vanadium ions are identified at high V2O5 content. The optical spectra of the glasses after gamma irradiation show small decrease of the intensity of the UV absorption which are interpreted by assuming the transformation of some Fe(3+) ions by photochemical reactions with the presence of high content (45mol%) of heavy massive CdO causing some shielding behavior. FT infrared absorption spectra of the glasses show vibrational bands due to collective presence of triangular and tetrahedral borate groups in their specific wavenumbers. The FTIR spectra are observed to be slightly affected by both the V2O5-dopants being present in modifying low percent or gamma irradiation due to the presence of high content heavy CdO. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Synthesis, characterization and antimicrobial activity of some nickel, cadmium and mercury complexes of 5-methyl pyrazole-3yl-N-(2‧-methylthiophenyl) methyleneimine, (MPzOATA) ligand

    NASA Astrophysics Data System (ADS)

    Mandal, Susmita; Mondal, Monojit; Biswas, Jayanta Kumar; Cordes, David B.; Slawin, Alexandra M. Z.; Butcher, Ray J.; Saha, Manan; Chandra Saha, Nitis

    2018-01-01

    Herein, we report the syntheses and structures of Ni(II) complexes, [Ni(MPzOATA)2] (Cl) (PF6) (I), [Ni(MPzOATA)2](ClO4)2.CH3CN (II) & [Ni(MPzOATA)2](BF4)2.H2O (III); Cd(II) complex, [Cd(MPzOATA)Cl2]2 (IV) and a Hg(II) complex, [Hg(MPzOATA)Cl2] (V), of a pyrazole based 'NNS' donor ligand, 5-methylpyrazole-3yl-N-(2‧-methylthiophenyl)methyleneimine, (MPzOATA). The complexes are characterized by elemental analyses, electronic, IR, 1H- NMR (only for IV &V) spectral parameters, conductivity and fluorescence measurements. X-ray crystallographic data of the complexes reveal that the Ni(II) complexes have NiN4S2 octahedral coordination, one of them is a mixed-anion complex having Cl- and PF6- as counter anions; the Cd(II) complex is a chloro bridged binuclear complex with octahedral coordination environment around each metal centre, while the Hg(II) complex is a square pyramidal one. Among the reported complex species, the Ni(II) complexes are non-fluorescent, while the Cd(II) and Hg(II) complexes can be used as potential photoactive materials as indicated from their characteristic emission properties. The reported complexes are screened for their antimicrobial activities against some Gram positive and Gram negative microbial strains, and they are found to be potential antimicrobial agents in broad spectrum against both Gram positive and Gram negative bacteria.

  14. Fabrication of luminescent CdS nanoparticles on short-peptide-based hydrogel nanofibers: tuning of optoelectronic properties.

    PubMed

    Palui, Goutam; Nanda, Jayanta; Ray, Sudipta; Banerjee, Arindam

    2009-07-13

    The pH-induced self-assembly of three synthetic tripeptides in water medium is used to immobilize luminescent CdS nanoparticles. These peptides form a nanofibrillar network structure upon gelation in aqueous medium at basic pH values (pH 11.0-13.0), and the fabrication of CdS nanoparticles on the gel nanofiber confers the luminescent property to these gels. Atomic force microscopy, field-emission scanning electron microscopy, and high-resolution transmission electron microscopy clearly reveal the presence of CdS nanoparticles in a well-defined array on the gel nanofibers. This is a convenient way to make organic nanofiber-inorganic nanoparticle hybrid nanocomposite systems. The size of the CdS nanoparticles remains almost same before and after deposition on the gel nanofiber. Photoluminescence (PL) measurement of the CdS nanoparticles upon deposition on the gel nanofibers shows a significant blue shift in the emission spectrum of the nanoparticles, and there is a considerable change in the PL gap energy of the CdS nanoparticles after immobilization on different gel nanofibrils. This finding suggests that the optoelectronic properties of CdS nanoparticles can be tuned upon deposition on gel nanofibers without changing the size of the nanoparticles.

  15. Photoemf in cadmium sulfide

    NASA Technical Reports Server (NTRS)

    Boeer, K. W.

    1971-01-01

    Theoretical and experimental investigations on CdS single crystals and CuxS:CdS photovoltaic cells prepared from CdS single crystals by a chemical-dip procedure are described. The studies are aimed at clarifying cell mechanisms which affect key cell properties (efficiency, reliability, and lifetime) by examining the properties of intrinsic and extrinsic defects in the junction and surface regions and their effects on carrier transport through these regions. The experimental research described includes studies of thermal, infrared, and field quenching of acceptor-doped CdS crystals; investigation of optical and electrical properties of CuxS:CdS photovoltaic cells (current-voltage characteristics, spectral distribution of photocurrent and photovoltage) and the dependence of these properties on temperature and light intensity; measurement of changes, as a result of heat treatment in ultrahigh vacuum, in the spectral distribution of photoconductivity at room temperature and liquid nitrogen temperature, the luminescence spectrum at liquid nitrogen temperature, and the thermally stimulated current curves of CdS crystals; determination of the effect of irradiation with 150 keV (maximum) X-rays on the spectral distribution of photoconductivity and thermally-stimulated current of CdS crystals; and studies of the effect of growth conditions on the photoconductive properties of CdS crystals.

  16. Design of a Multi-Channel Low-Noise Readout ASIC for CdZnTe-Based X-Ray and γ-Ray Spectrum Analyzer

    NASA Astrophysics Data System (ADS)

    Gan, B.; Wei, T.; Gao, W.; Zheng, R.; Hu, Y.

    2015-10-01

    In this paper, we report on the recent development of a 32-channel low-noise front-end readout ASIC for cadmium zinc telluride (CdZnTe) X-ray and γ-ray detectors. Each readout channel includes a charge sensitive amplifier, a CR-RC shaping amplifier and an analog output buffer. The readout ASIC is implemented using TSMC 0.35 - μm mixed-signal CMOS technology, the die size of the prototype chip is 2.2 mm ×4.8 mm. At room temperature, the equivalent noise level of a typical channel reaches 133 e- (rms) with the input parasitic capacitance of 0 pF for the average power consumption of 2.8 mW per channel. The linearity error is less than ±2% and the input energy dynamic range of the readout ASIC is from 10 keV to 1 MeV. The crosstalk between the channels is less than 0.4%. By connecting the readout ASIC to a CdZnTe detector, we obtained a γ-ray spectrum, the energy resolution is 1.8% at the 662-keV line of 137Cs source.

  17. Modeling and Measuring Charge-Sharing in Hard X-ray Imagers Using HEXITEC CdTe Detectors

    NASA Technical Reports Server (NTRS)

    Ryan, Daniel F.; Christe, Steven D.; Shih, Albert Y.; Baumgartner, Wayne H.; Wilson, Matthew D.; Seller, Paul; Gaskin, Jessica A.; Inglis, Andrew

    2017-01-01

    The Rutherford Appleton Laboratory's HEXITEC ASIC has been designed to provide fine pixelated X-ray spectroscopic imaging in combination with a CdTe or CZT detector layer. Although HEXITEC's small pixels enable higher spatial resolution as well as higher spectral resolution via the small-pixel effect, they also increase the probability of charge sharing, a process which degrades spectral performance by dividing the charge induced by a single photon among multiple pixels. In this paper, we investigate the effect of this process on a continuum X-ray spectrum below the Cd and Te fluorescence energies (23 keV). This is done by comparing laboratory measurements with simulations performed with a custom designed model of the HEXITEC ASIC. We find that the simulations closely match the observations implying that we have an adequate understanding of both charge sharing and the HEXITEC ASIC itself. These results can be used to predict the distortion of a spectrum measured with HEXITEC and will help determine to what extent it can be corrected. They also show that models like this one are important tools in developing and interpreting observations from ASICs like HEXITEC.

  18. High resolution FTIR spectroscopy of the ν7 band of CD3CCH

    NASA Astrophysics Data System (ADS)

    Pal, Ayan Kumar; Kshirsagar, R. J.

    2018-03-01

    The high-resolution Fourier transform spectrum of propyne-d3 (CD3CCH) at room temperature has been recorded in the region of the ν7 band (950-1200 cm-1) at an apodized resolution of 0.004 cm-1. About 2400 lines consisting of a total of 25 sub-bands ranging from KΔK = -13 to 12 have been assigned in the ν7 band of CD3CCH. In the fitting analysis, the ν4 = 1 state to which transitions have not been identified in the experimental spectrum included as a "shadow" state. The data have been analyzed taking into account of the strong x-y Coriolis interaction of the ν7 = 1 state with the ν4 = 1 state. l-type interactions between the ± l components of the ν7 = 1 state, and a weak k-type doubling interaction between ν7 = 1 and ν4 = 1 states have been included in the analysis. The vibration-rotation transitions for K ≥ 8 show fairly large amount of deviation and most likely interacted by other nearby states. The transitions upto K = 7 and Jmax = 61 could be fitted with a standard deviation of 0.0007 cm-1.

  19. Ascorbate, added after irradiation, reduces the mutant yield and alters the spectrum of CD59- mutations in A(L) cells irradiated with high LET carbon ions

    NASA Technical Reports Server (NTRS)

    Ueno, Akiko; Vannais, Diane; Lenarczyk, Marek; Waldren, Charles A.; Chatterjee, A. (Principal Investigator)

    2002-01-01

    It has been reported that X-ray induced HPRT- mutation in cultured human cells is prevented by ascorbate added after irradiation. Mutation extinction is attributed to neutralization by ascorbate, of radiation-induced long-lived radicals (LLR) with half-lives of several hours. We here show that post-irradiation treatment with ascorbate (5 mM added 30 min after radiation) reduces, but does not eliminate, the induction of CD59- mutants in human-hamster hybrid A(L) cells exposed to high-LET carbon ions (LET of 100 KeV/microm). RibCys, [2(R,S)-D-ribo-1',2',3',4'-Tetrahydroxybutyl]-thiazolidene-4(R)-ca riboxylic acid] (4 mM) gave a similar but lesser effect. The lethality of the carbon ions was not altered by these chemicals. Preliminary data are presented that ascorbate also alters the spectrum of CD59- mutations induced by the carbon beam, mainly by reducing the incidence of small mutations and mutants displaying transmissible genomic instability (TGI), while large mutations are unaffected. Our results suggest that LLR are important in initiating TGI.

  20. The Broad Spectrum of Human Natural Killer Cell Diversity.

    PubMed

    Freud, Aharon G; Mundy-Bosse, Bethany L; Yu, Jianhua; Caligiuri, Michael A

    2017-11-21

    Natural killer (NK) cells provide protection against infectious pathogens and cancer. For decades it has been appreciated that two major NK cell subsets (CD56 bright and CD56 dim ) exist in humans and have distinct anatomical localization patterns, phenotypes, and functions in immunity. In light of this traditional NK cell dichotomy, it is now clear that the spectrum of human NK cell diversity is much broader than originally appreciated as a result of variegated surface receptor, intracellular signaling molecule, and transcription factor expression; tissue-specific imprinting; and foreign antigen exposure. The recent discoveries of tissue-resident NK cell developmental intermediates, non-NK innate lymphoid cells, and the capacity for NK cells to adapt and differentiate into long-lived memory cells has added further complexity to this field. Here we review our current understanding of the breadth and generation of human NK cell diversity. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Understanding the features in the ultrafast transient absorption spectra of CdSe quantum dots

    NASA Astrophysics Data System (ADS)

    Zhang, Cheng; Do, Thanh Nhut; Ong, Xuanwei; Chan, Yinthai; Tan, Howe-Siang

    2016-12-01

    We describe a model to explain the features of the ultrafast transient absorption (TA) spectra of CdSe core type quantum dots (QDs). The measured TA spectrum consists of contributions by the ground state bleach (GSB), stimulated emission (SE) and excited state absorption (ESA) processes associated with the three lowest energy transition of the QDs. We model the shapes of the GSB, SE and ESA spectral components after fits to the linear absorption. The spectral positions of the ESA components take into account the biexcitonic binding energy. In order to obtain the correct weightage of the GSB, SE and ESA components to the TA spectrum, we enumerate the set of coherence transfer pathways associated with these processes. From our fits of the experimental TA spectra of 65 Å diameter QDs, biexcitonic binding energies for the three lowest energy transitions are obtained.

  2. Spindle Cell Epithelioma of the Vagina Shows Immunohistochemical Staining Supporting Its Origin From a Primitive/Progenitor Cell Population

    DTIC Science & Technology

    2001-04-01

    broader spectrum of immunohistochemical stains is presented that supports the origin of these tumors from a progenitor cell popula- tion. REPORT OF A CASE ...with S100 protein, with coexpression of cytokeratins and vimentin and expression of estrogen and progesterone receptors, as previously reported in...SCEVs. In addition, diffuse expres- sion of CD34, CD99, and Bcl-2 immunohistochemical stains was found, which has not previously been reported . The

  3. On the nature of the nova-like variable CD-42 deg 14462

    NASA Technical Reports Server (NTRS)

    Guinan, E. F.; Sion, E. M.

    1981-01-01

    Low dispersion long and short wavelength IUE spectra of the nova like system CD-42 deg 14462 were obtained on August 24 U.T. The short wave spectrum exhibits absorption features due to C III (lambda 1175), Lalpha 1216), NV (lambda1240), HeII (lambda 1640), SiIV (lambda1394), NIV (lambda1875) with CIV (lambda1550) as a P Cygni feature with blue shifted absorption suggesting the presence of material leaving the system. Possible interpretations of this object are discussed.

  4. Monte Carlo Treatment of Displacement Damage in Bandgap Engineered HgCdTe Detectors

    NASA Technical Reports Server (NTRS)

    Fodness, Bryan C.; Marshall, Paul W.; Reed, Robert A.; Jordan, Thomas M.; Pickel, James C.; Jun, Insoo; Xapsos, Michael A.; Burke, Edward A.

    2003-01-01

    The conclusion are: 1. Description of NIEL calculation for short, mid, and longwave HgCdTe material compositions. 2. Full recoil spectra details captured and analyzed Importance of variance in high Z materials. 3. Can be applied directly to calculate damage distributions in arrays. 4. Future work will provide comparisons of measured array damage with calculated NIEL and damage energy distributions. 5. Technique to assess the full recoil spectrum behavior is extendable to other materials.

  5. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  6. Confirmation of Pig-a mutation in flow cytometry-identified CD48-deficient T-lymphocytes from F344 rats.

    PubMed

    Revollo, Javier; Pearce, Mason G; Petibone, Dayton M; Mittelstaedt, Roberta A; Dobrovolsky, Vasily N

    2015-05-01

    The Pig-a assay is used for monitoring somatic cell mutation in laboratory animals and humans. The assay detects haematopoietic cells deficient in glycosylphosphatidylinositol (GPI)-anchored protein surface markers using flow cytometry. However, given that synthesis of the protein markers (and the expression of their genes) is independent of the expression of the X-linked Pig-a gene and the function of its enzyme product, the deficiency of markers at the surface of the cells may be caused by a number of events (e.g. by mutation or epigenetic silencing in the marker gene itself or in any of about two dozen autosomal genes involved in the synthesis of GPI). Here we provide direct evidence that the deficiency of the GPI-anchored surface marker CD48 in rat T-cells is accompanied by mutation in the endogenous X-linked Pig-a gene. We treated male F344 rats with N-ethyl-N-nitrosourea (ENU), and established colonies from flow cytometry-identified and sorted CD48-deficient spleen T-lymphocytes. Molecular analysis confirmed that the expanded sorted cells have mutations in the Pig-a gene. The spectrum of Pig-a mutation in our model was consistent with the spectrum of ENU-induced mutation determined in other in vivo models, mostly base-pair substitutions at A:T with the mutated T on the non-transcribed strand of Pig-a genomic DNA. We also used next generation sequencing to derive a similar mutational spectrum from a pool of 64 clones developed from flow-sorted CD48-deficient lymphocytes. Our findings confirm that Pig-a assays detect what they are designed to detect-gene mutation in the Pig-a gene. © The Author 2015. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Broad spectrum antibiotic enrofloxacin modulates contact sensitivity through gut microbiota in a murine model.

    PubMed

    Strzępa, Anna; Majewska-Szczepanik, Monika; Lobo, Francis M; Wen, Li; Szczepanik, Marian

    2017-07-01

    Medical advances in the field of infection therapy have led to an increasing use of antibiotics, which, apart from eliminating pathogens, also partially eliminate naturally existing commensal bacteria. It has become increasingly clear that less exposure to microbiota early in life may contribute to the observed rise in "immune-mediated" diseases, including autoimmunity and allergy. We sought to test whether the change of gut microbiota with the broad spectrum antibiotic enrofloxacin will modulate contact sensitivity (CS) in mice. Natural gut microbiota were modified by oral treatment with enrofloxacin prior to sensitization with trinitrophenyl chloride followed by CS testing. Finally, adoptive cell transfers were performed to characterize the regulatory cells that are induced by microbiota modification. Oral treatment with enrofloxacin suppresses CS and production of anti-trinitrophenyl chloride IgG1 antibodies. Adoptive transfer experiments show that antibiotic administration favors induction of regulatory cells that suppress CS. Flow cytometry and adoptive transfer of purified cells show that antibiotic-induced suppression of CS is mediated by TCR αβ + CD4 + CD25 + FoxP3 + Treg, CD19 + B220 + CD5 + IL-10 + , IL-10 + Tr1, and IL-10 + TCR γδ + cells. Treatment with the antibiotic induces dysbiosis characterized by increased proportion of Clostridium coccoides (cluster XIVa), C coccoides-Eubacterium rectale (cluster XIVab), Bacteroidetes, and Bifidobacterium spp, but decreased segmented filamentous bacteria. Transfer of antibiotic-modified gut microbiota inhibits CS, but this response can be restored through oral transfer of control gut bacteria to antibiotic-treated animals. Oral treatment with a broad spectrum antibiotic modifies gut microbiota composition and promotes anti-inflammatory response, suggesting that manipulation of gut microbiota can be a powerful tool to modulate the course of CS. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  8. Magnetic properties and hyperfine interactions in Cr{sub 8}, Cr{sub 7}Cd, and Cr{sub 7}Ni molecular rings from {sup 19}F-NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bordonali, L.; Borsa, F.; Consorzio INSTM, Via Giusti 9, I-50121 Firenze

    2014-04-14

    A detailed experimental investigation of the {sup 19}F nuclear magnetic resonance is made on single crystals of the homometallic Cr{sub 8} antiferromagnetic molecular ring and heterometallic Cr{sub 7}Cd and Cr{sub 7}Ni rings in the low temperature ground state. Since the F{sup −} ion is located midway between neighboring magnetic metal ions in the ring, the {sup 19}F-NMR spectra yield information about the local electronic spin density and {sup 19}F hyperfine interactions. In Cr{sub 8}, where the ground state is a singlet with total spin S{sub T} = 0, the {sup 19}F-NMR spectra at 1.7 K and low external magnetic fieldmore » display a single narrow line, while when the magnetic field is increased towards the first level crossing field, satellite lines appear in the {sup 19}F-NMR spectrum, indicating a progressive increase in the Boltzmann population of the first excited state S{sub T} = 1. In the heterometallic rings, Cr{sub 7}Cd and Cr{sub 7}Ni, whose ground state is magnetic with S{sub T} = 3/2 and S{sub T} = 1/2, respectively, the {sup 19}F-NMR spectrum has a complicated structure which depends on the strength and orientation of the magnetic field, due to both isotropic and anisotropic transferred hyperfine interactions and classical dipolar interactions. From the {sup 19}F-NMR spectra in single crystals we estimated the transferred hyperfine constants for both the F{sup −}-Ni{sup 2+} and the F{sup −}-Cd{sup 2+} bonds. The values of the hyperfine constants compare well to the ones known for F{sup −}-Ni{sup 2+} in KNiF{sub 3} and NiF{sub 2} and for F{sup −}-Cr{sup 3+} in K{sub 2}NaCrF{sub 6}. The results are discussed in terms of hybridization of the 2s, 2p orbitals of the F{sup −} ion and the d orbitals of the magnetic ion. Finally, we discuss the implications of our results for the electron-spin decoherence.« less

  9. Rational Design and Development of Lanthanide-Doped NaYF4@CdS-Au-RGO as Quaternary Plasmonic Photocatalysts for Harnessing Visible-Near-Infrared Broadband Spectrum.

    PubMed

    Kumar, Ajay; Reddy, Kumbam Lingeshwar; Kumar, Suneel; Kumar, Ashish; Sharma, Vipul; Krishnan, Venkata

    2018-05-09

    Utilization of the total solar spectrum efficiently for photocatalysis has remained a huge challenge for a long time. However, designing a system by rationally combining nanocomponents with complementary properties, such as upconversion nanoparticles, semiconductors, plasmonic metals, and carbonaceous support, offers a promising route for efficient utilization of solar energy by harnessing the broadband spectrum. In this work, a series of novel quaternary plasmonic photocatalysts comprising of lanthanide-doped NaYF 4 @CdS (UC) core-shell nanostructures decorated with Au nanoparticles (Au NPs) supported on reduced graphene oxide (RGO) nanosheets were prepared using the multistep hydrothermal method. The different components of the prepared nanocomposites could be efficiently employed to utilize both the visible and near-infrared (NIR) regions. Specifically in this work, the utility of these quaternary nanocomposites for photocatalytic degradation of a colorless pharmaceutical pollutant, ciprofloxacin, under visible and NIR light irradiations has been demonstrated. In comparison to bare counterparts, our quaternary nanocomposites exhibit an enhanced photocatalytic activity attributable to the synergistic effect of different components arranged in such a way that favors harnessing energy from the broad spectral region and efficient charge separation. The combination of upconversion and plasmonic properties along with the advantages of a carbonaceous support can provide new physical insights for further development of photocatalysts, which could utilize the broadband spectrum.

  10. CD30 expression in follicular lymphoma.

    PubMed

    Gardner, L J; Polski, J M; Evans, H L; Perkins, S L; Dunphy, C H

    2001-08-01

    CD30(+) anaplastic large cell lymphomas were originally described as being of T-cell, null cell, and B-cell origin. CD30, however, is not a specific marker of anaplastic large cell lymphoma and has been found to be expressed in reactive as well as neoplastic populations as a probable activation marker. In addition, CD30(+) cells have also been described in both diffuse large B-cell and follicular lymphomas (FLs), resembling the pattern seen in reactive tonsils and lymph nodes. We report an index case of FL with CD30 expression, which on initial touch preparations and flow cytometric immunophenotyping revealed a prominent population of CD30(+) cells with marked cellular pleomorphism (anaplasia) in a background of typical FL. Immunohistochemistry of the paraffin section for CD30 in our index case confirmed unequivocal CD30(+) pleomorphic cells in the malignant nodules in occasional clusters. This case prompted a study of additional cases of FL for pattern of immunoreactivity with CD30 on paraffin sections. Twenty-two additional cases of FL (grades 1-3) were retrieved for CD30 immunoperoxidase staining as in the index case. This study demonstrated 32% of the additional cases of FL had definitive CD30(+), large, pleomorphic malignant cells by paraffin immunohistochemistry. In 2 cases (9%), the pattern of immunoreactivity with CD30 showed clustering and variable staining of large cells, as our index case. This study underscores the morphologic and immunophenotypic spectrum of FL that includes CD30 staining and cellular pleomorphism.

  11. Characterization of CdTe and (CdZn)Te detectors with different metal contacts

    NASA Astrophysics Data System (ADS)

    Pekárek, J.; Belas, E.; Grill, R.; Uxa, Å.; James, R. B.

    2013-09-01

    In the present work we studied an influence of different types of surface etching and surface passivation of high resistivity CdZnTe-based semiconductor detector material. The aim was to find the optimal conditions to improve the properties of metal-semiconductor contact. The main effort was to reduce the leakage current and thus get better X-ray and gamma-ray spectrum, i.e. to create a detector operating at room temperature based on this semiconductor material with sufficient energy resolution and the maximum charge collection efficiency. Individual surface treatments were characterized by I-V characteristics, spectral analysis and by determination of the profile of the internal electric field.

  12. Interaction study of some macrocyclic inorganic schiff base complexes with calf thymus DNA using spectroscopic and voltammetric methods

    NASA Astrophysics Data System (ADS)

    Bordbar, Maryam; Tavoosi, Fariba; Yeganeh-Faal, Ali; Zebarjadian, Mohammad Hasan

    2018-01-01

    The interaction of Cd(II), Zn(II) and Mn(II)-L (4,8-bis(2-pyridylmethyl)-4,8-diazaundecane-1,11-diamine) transition metal complexes with calf thymus DNA (CT-DNA) has been investigated using electronic, fluorescence and circular dichroism (CD) spectroscopy, thermal denaturation and cyclic voltammetry (CV). Based on the UV-Vis study, binding constants of the complexes with CT-DNA were calculated. Changes in the band of the CD spectrum, DNA melting temperature and in the ipa and ipc of the complexes in the presenceCT-DNA, overall, showed that the studied complex exhibited good DNA interaction ability with partial intercalation mode.

  13. Obstructive uropathy associated with myelomonocytic infiltration of the prostate.

    PubMed

    Hope-Gill, B; Goepel, J R; Collin, R C

    1998-04-01

    A 72 year old man was diagnosed with chronic myelomonocytic leukaemia (CMML) according to the FAB group classification. He presented with symptoms of anaemia, urinary frequency, hesitancy, and nocturia. He was later admitted with acute urinary retention and acute renal failure, which resolved with treatment. A transurethral resection of the prostate was performed. Histological examination showed fibromuscular hyperplasia with dense infiltration by myelomonocytes which stained positively with chloroacetate esterase; immunohistochemical staining was positive for lysozyme, CD43, CD45, and CD68. Following treatment with oral etoposide he transformed to acute myeloid leukaemia and eventually died. Myelomonocytic infiltration of the prostate has not been reported before. This case extends the spectrum of disease previously recognised in CMML.

  14. Narrow Radiative Recombination Continua: A Signature of Ions Crossing the Contact Discontinuity of Astrophysical Shocks

    NASA Technical Reports Server (NTRS)

    Behar, Ehud; Nordon, Raanan; Soker, Noam; Kastner, Joel H.; Yu, Young Sam

    2009-01-01

    X-rays from planetary nebulae (PNs) are believed to originate from a shock driven into the fast stellar wind (v 1000 kilometers per second) as it collides with an earlier circumstellar slow wind (v 10 kilometers per second). In theory, the shocked fast wind (hot hubble) and the ambient cold nebula can remain separated by magnetic fields along a surface referred to as the contact discontinuity (CD) that inhibits diffusion and heat conduction. The CD region is extremely difficult to probe directly owing to its small size and faint emission. This has largely left the study of CDs, stellar-shocks, and the associated micro-physics in the realm of theory. This paper presents spectroscopic evidence for ions from the hot bubble (kT approximately equal to 100 eV) crossing the CD and penetrating the cold nebular gas (kT approximately equal to 1 eV). Specifically, a narrow radiative recombination continuum (RRC) emission feature is identified in the high resolution X-ray spectrum of the PN BD+30degree3639 indicating bare C VII ions are recombining with cool electrons at kT(sub e) = 1.7 plus or minus 1.3 eV. An upper limit to the flux of the narrow RRC of H-like C VI is obtained as well. The RRCs are interpreted as due to C ions from the hot bubble of BD+30degree3639 crossing the CD into the cold nebula, where they ultimately recombine with its cool electrons. The RRC flux ratio of C VII to C VI constrains the temperature jump across the CD to deltakT greater than 80 eV, providing for the first time direct evidence for the stark temperature disparity between the two sides of an astrophysical CD, and constraining the role of magnetic fields and heat conduction accordingly. Two colliding-wind binaries are noted to have similar RRCs suggesting a temperature jump and CD crossing by ions may be common feature of stellar wind shocks.

  15. The effect of regulatory T-cell depletion on the spectrum of organ-specific autoimmune diseases in nonobese diabetic mice at different ages.

    PubMed

    Nakahara, Mami; Nagayama, Yuji; Ichikawa, Tatsuki; Yu, Liping; Eisenbarth, George S; Abiru, Norio

    2011-09-01

    The nonobese diabetic (NOD) mouse spontaneously develops several autoimmune diseases, including type 1 diabetes and to a lesser extent thyroiditis and sialitis. Imbalance between effector T cells (Teffs) and regulatory T cells (Tregs) has recently been proposed as a mechanism for the disease pathogenesis in NOD mice, but previous studies have shown the various outcomes by different timing and methods of Treg-depletion. This study was, therefore, designed to compare the consequences of Treg-depletion by the same method (anti-CD25 antibody) on the spectrum of organ-specific autoimmune diseases in NOD mice of different ages. Treg-depletion by anti-CD25 antibody at 10 days of age accelerated development of all three diseases we examined (insulitis/diabetes, thyroiditis, and sialitis); Treg-depletion at 4 weeks of age accelerated only diabetes but not thyroiditis or sialitis; and Treg-depletion at 12 weeks of age hastened only development of thyroiditis and exhibited little influence on diabetes or sialitis. Increased levels of insulin autoantibodies (IAA) were, however, observed in mice depleted of Tregs at 10 days of age, not in those at 4 weeks. Thus, the consequences of Treg-depletion on the spectrum of organ-specific autoimmune diseases depend on the timing of anti-CD25 antibody injection in NOD mice. Aging gradually tips balance between Teffs and Tregs toward Teff-dominance for diabetes, but this balance for thyroiditis and sialitis likely alters more intricately. Our data also suggest that the levels of IAA are not necessarily correlated with diabetes development.

  16. High-performance Förster resonance energy transfer (FRET)-based dye-sensitized solar cells: rational design of quantum dots for wide solar-spectrum utilization.

    PubMed

    Lee, Eunwoo; Kim, Chanhoi; Jang, Jyongsik

    2013-07-29

    High-performance Förster resonance energy transfer (FRET)-based dye-sensitized solar cells (DSSCs) have been successfully fabricated through the optimized design of a CdSe/CdS quantum-dot (QD) donor and a dye acceptor. This simple approach enables quantum dots and dyes to simultaneously utilize the wide solar spectrum, thereby resulting in high conversion efficiency over a wide wavelength range. In addition, major parameters that affect the FRET interaction between donor and acceptor have been investigated including the fluorescent emission spectrum of QD, and the content of deposited QDs into the TiO2 matrix. By judicious control of these parameters, the FRET interaction can be readily optimized for high photovoltaic performance. In addition, the as-synthesized water-soluble quantum dots were highly dispersed in a nanoporous TiO2 matrix, thereby resulting in excellent contact between donors and acceptors. Importantly, high-performance FRET-based DSSCs can be prepared without any infrared (IR) dye synthetic procedures. This novel strategy offers great potential for applications of dye-sensitized solar cells. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Conformational analysis of a synthetic fish kisspeptin 1 peptide in membrane mimicking environments

    PubMed Central

    Shahi, Neetu; Singh, Atul Kumar; Khangembam, Victoria Chanu; Singh, Arvind Kumar; Kumar, Satish

    2017-01-01

    Kisspeptin 1 is a neuropeptide hormone of the RFamide family, which act as an upstream regulator of brain-pituitary-gonad (BPG) axis in most vertebrates including teleosts. In the present study, a 16 amino acid long putative mature bioactive peptide (kiss 1) from preprokisspeptin 1 of golden mahseer, Tor putitora (Hamilton, 1822), was synthesized and characterized using an integrated (experimental and in silico) approach. The far-UV circular dichroism (CD) spectrum of this peptide was evaluated both in aqueous and membrane mimicking solvents (TFE, HFIP and Dioxane). The results indicate that kiss 1 peptide adopted helical, turn and β conformations in membrane like environments. The near-UV CD spectroscopy was also carried out to examine the tertiary packing around aromatic residues of kiss 1 peptide and the peptide-membrane complex. The kiss 1 peptide exhibited little signal in water, but a prominent negative band was observed at around 275 nm when membrane mimetic solution was added. The observed ordered conformations of kiss 1 peptide in the different solvents indicated its potential biological activity which could enhance the secretion of gonadotropin-releasing hormone (GnRH) at BPG axis. The conformational information generated from the present study reinforces the application prospects of bioactive synthetic peptide analogs of kisspeptin 1 in improving the reproductive performances of important cultivable fish species. PMID:28977030

  18. Stability in MMPI among adoptees with high and low genetic risk for schizophrenia and with low Communication Deviance of their adoptive parents.

    PubMed

    Siira, Virva; Wahlberg, Karl-Erik; Hakko, Helinä; Tienari, Pekka

    2013-11-30

    Stability has been considered an important aspect of vulnerability to schizophrenia. The temporal stability of the scales in the Minnesota Multiphasic Personality Inventory (MMPI) was examined, using adoptees from the Finnish Adoptive Family Study of Schizophrenia. Adoptees who were high-risk (HR) offspring of biological mothers having a schizophrenia spectrum disorder (n=28) and low-risk (LR) controls (n=46) were evaluated using 15 MMPI scales at the initial assessment (HR, mean age 24 years; LR, mean age 23 years) and at the follow-up assessment after a mean interval of 11 years. Stability of the MMPI scales was also assessed in the groups of adoptees, assigned according to the adoptive parents'(n=44) communication style using Communication Deviance (CD) scale as an environmental factor. Initial Lie, Frequency, Correction, Psychopathic Deviate, Schizophrenia, Manifest Hostility, Hypomania, Phobias, Psychoticism, Religious Fundamentalism, Social Maladjustment, Paranoid Schizophrenia, Golden-Meehl Indicators, Schizophrenia Proneness and 8-6 scale scores significantly predicted the MMPI scores at the follow-up assessment indicating stability in the characteristics of thinking, affective expression, social relatedness and volition. Low CD in the family had an effect on the stabilization of personality traits such as social withdrawal and restricted affectivity assessed by Correction and Hostility. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  19. Aryl-Aryl Interactions in Designed Peptide Folds: Spectroscopic Characteristics and Placement Issues for Optimal Structure Stabilization

    PubMed Central

    Anderson, Jordan M.; Kier, Brandon; Jurban, Brice; Byrne, Aimee; Shu, Irene; Eidenschink, Lisa A.; Shcherbakov, Alexander A.; Hudson, Mike; Fesinmeyer, R. M.; Andersen, Niels H.

    2017-01-01

    We have extended our studies of Trp/Trp to other Aryl/Aryl through-space interactions that stabilize hairpins and other small polypeptide folds. Herein we detail the NMR and CD spectroscopic features of these types of interactions. NMR data remains the best diagnostic for characterizing the common T-shape orientation. Designated as an edge-to-face (EtF or FtE) interaction, large ring current shifts are produced at the edge aryl ring hydrogens and, in most cases, large exciton couplets appear in the far UV circular dichroic (CD) spectrum. The preference for the face aryl in FtE clusters is W≫Y≥F (there are some exceptions in the Y/F order); this sequence corresponds to the order of fold stability enhancement and always predicts the amplitude of the lower energy feature of the exciton couplet in the CD spectrum. The CD spectra for FtE W/W, W/Y, Y/W, and Y/Y pairs all include an intense feature at 225–232 nm. An additional couplet feature seen for W/Y, W/F, Y/Y and F/Y clusters, is a negative feature at 197–200 nm. Tyr/Tyr (as well as F/Y and F/F) interactions produce much smaller exciton couplet amplitudes. The Trp-cage fold was employed to search for the CD effects of other Trp/Trp and Trp/Tyr cluster geometries: several were identified. In this account, we provide additional examples of the application of cross-strand aryl/aryl clusters for the design of stable β-sheet models and a scale of fold stability increments associated with all possible FtE Ar/Ar clusters in several structural contexts. PMID:26850220

  20. Polycrystalline Thin Film Photovoltaics: Research, Development, and Technologies: Preprint

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ullal, H. S.; Zweibel, K.; von Roedern, B.

    2002-05-01

    II-VI binary thin-film solar cells based on cadmium telluride (CdTe) and I-III-VI ternary thin-film solar cells based on copper indium diselenide (CIS) and related materials have been the subject of intense research and development in the past few years. Substantial progress has been made thus far in the area of materials research, device fabrication, and technology development, and numerous applications based on CdTe and CIS have been deployed worldwide. World record efficiency of 16.5% has been achieved by NREL scientists for a thin-film CdTe solar cell using a modified device structure. Also, NREL scientists achieved world-record efficiency of 21.1% formore » a thin-film CIGS solar cell under a 14X concentration and AM1.5 global spectrum. When measured under a AM1.5 direct spectrum, the efficiency increases to 21.5%. Pathways for achieving 25% efficiency for tandem polycrystalline thin-film solar cells are elucidated. R&D issues relating to CdTe and CIS are reported in this paper, such as contact stability and accelerated life testing in CdTe, and effects of moisture ingress in thin-film CIS devices. Substantial technology development is currently under way, with various groups reporting power module efficiencies in the range of 7.0% to 12.1% and power output of 40.0 to 92.5 W. A number of lessons learned during the scale-up activities of the technology development for fabrication of thin-film power modules are discussed. The major global players actively involved in the technology development and commercialization efforts using both rigid and flexible power modules are highlighted.« less

  1. Surface defect assisted broad spectra emission from CdSe quantum dots for white LED application

    NASA Astrophysics Data System (ADS)

    Samuel, Boni; Mathew, S.; Anand, V. R.; Correya, Adrine Antony; Nampoori, V. P. N.; Mujeeb, A.

    2018-02-01

    This paper reports, broadband photoluminescence from CdSe quantum dots (QDs) under the excitation of 403 nm using fluorimeter and 403 nm CW laser excitation. The broad spectrum obtained from the colloidal quantum dots was ranges from 450 nm to 800 nm. The broadness of the spectra was attributed to the merging of band edge and defect driven emissions from the QDs. Six different sizes of particles were prepared via kinetic growth method by using CdO and elemental Se as sources of Cd and Se respectively. The particle sizes were measured from TEM images. The size dependent effect on broad emission was also studied and the defect state emission was found to be predominant in very small QDs. The defect driven emission was also observed to be redshifted, similar to the band edge emission, due to quantum confinement effect. The emission corresponding to different laser power was also studied and a linear relation was obtained. In order to study the colour characteristics of the emission, CIE chromaticity coordinate, CRI and CCT of the prepared samples were measured. It is observed that, these values were tunable by the addition of suitable intensity of blue light from the excitation source to yield white light of various colour temperatures. The broad photoluminescence spectrum of the QDs, were compared with that of a commercially available white LED. It was found that the prepared QDs are good alternatives for the phosphor in phosphor converted white LEDs, to provide good spectral tunability.

  2. [Irritable bowel syndrome, celiac disease and gluten].

    PubMed

    Mearin, Fermín; Montoro, Miguel

    2014-08-04

    For many years irritable bowel syndrome (IBS) and celiac disease (CD) have been considered 2 completely separate entities, with CD being clearly related to a permanent gluten intolerance and IBS having no relation with gluten ingestion. However IBS and CD symptoms may be indistinguishable, especially when diarrhea, bloating or abdominal pain predominate. In the last decade several studies have shown that the separation between CD and IBS is not so clear. Thus, some patients who have been diagnosed of IBS suffer in fact from CD. In addition, it seems that there is a group of patients who, without having CD, suffer gluten intolerance that cause them digestive symptoms similar to those of IBS. Gluten sensitivity is defined as the spectrum of morphological, immunological and functional abnormalities that respond to a gluten-free diet. This concept includes histological, immunological and clinical manifestations in the absence of evident morphological abnormalities. Therefore, it is mandatory to establish in a scientific way in which patients a gluten-free diet will be beneficial as well as when this is not justified. Copyright © 2013 Elsevier España, S.L. All rights reserved.

  3. Differences in the response of soil dehydrogenase activity to Cd contamination are determined by the different substrates used for its determination.

    PubMed

    Tan, Xiangping; Liu, Yanju; Yan, Kaihong; Wang, Ziquan; Lu, Guannan; He, Yike; He, Wenxiang

    2017-02-01

    Dehydrogenase activity (DHA) is an important indicator of heavy metal toxicity in contaminated soils. Different instances of DHA were determined using various substrates and which could affect the description of heavy metal toxicity. Currently, too few investigations have been done on selecting appropriate substrates. This study employed indoor simulation to determine soil DHA and its response to external cadmium (Cd) using two substrates (TTC and INT). Hormesis for DHA obtained using the TTC method (DHA-TTC) in low Cd concentration was observed which was quickly inhibited in high Cd concentration. While DHA obtained using the INT method (DHA-INT) decreased slowly when Cd concentration increased. The DHA-TTC and DHA-INT in soils at Cd concentration of 500 mg kg -1 decreased 86% and 53%, respectively, compared to the control. The dose-response relationship of Cd to DHA can be well simulated using the logistic model (p < 0.01), which indicated DHA could be used to indicate soil Cd toxicity. Multiple stepwise regression analysis revealed that total organic matter (TOC) is the major factor influencing the toxicity of Cd to DHA-TTC, while TOC, pH and cation exchange capacity (CEC) are major factors influencing the toxicity of Cd to DHA-INT. The different responses of soil DHA-TTC and DHA-INT to Cd are due to the differences in electron transport chain characteristics between TTC and INT, as well as the influence of soil properties. Although both DHA-TTC and DHA-INT can monitor soil Cd contamination, DHA-INT is recommended as a superior bio-indicator to indicate and assess contamination of Cd in soil. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. CD34-positive infantile myofibromatosis: Case report and review of hemangiopericytoma-like pattern tumors.

    PubMed

    Kiyohara, Takahiro; Maruta, Naoki; Iino, Shiro; Ido, Hideki; Tokuriki, Atsushi; Hasegawa, Minoru

    2016-09-01

    We describe a case of CD34-positive infantile myofibromatosis with hemangiopericytoma-like pattern. A 2-day-old Japanese boy presented with multiple hemispherical nodules on the extremities and back. There was a biphasic histological growth in the dermis, accompanied by a hemangiopericytoma-like pattern with antler-like branching vessels. Tumor cells were oval to spindle-shaped myoid cells with bland appearance. Immunohistochemically, vimentin, calponin and CD34 were positive, while α-smooth muscle actin, h-caldesmon, HHF35 and desmin were negative. Although CD34 was positive, the present case could be diagnosed as infantile myofibromatosis. Myopericytoma, myofibroma/myofibromatosis, glomus tumor, glomangiopericytoma and angioleiomyoma share a continuous spectrum of benign hemangiopericytoma-like pattern tumors. Myofibroma/myofibromatosis is nearly included in myopericytoma among pericytic (perivascular) tumors, and could be positive for CD34. Several immunohistochemical panels of smooth muscle markers are needed for the diagnosis of pericytic (perivascular) tumors. © 2016 Japanese Dermatological Association.

  5. Synthesis and Photoluminescence of Single-Crystalline Fe(III)-Doped CdS Nanobelts.

    PubMed

    Kamran, Muhammad Arshad; Zou, Bingsuo; Majid, A; Alharbil, Thamer; Saeed, M A; Abdullah, Ali; Javed, Qurat-ul-ain

    2016-04-01

    In this paper, we report the synthesis and optical properties of Fe(III) doped CdS nanobelts (NBs) via simple Chemical Vapor Deposition (CVD) technique to explore their potential in nano-optics. The energy dispersive X-ray spectroscopy (EDX) and X-ray diffraction (XRD) analysis manifested the presence of Fe(III) ions in the NBs subsequently confirmed by the peak shifting to lower phonon energies as recorded by Raman spectra and shorter lifetime in ns. Photoluminescence (PL) spectrum investigations of the single Fe(III)-doped CdS NBs depicted an additional PL peak centered at 573 nm (orange emission) in addition to the bandedge(BE) emission. The redshift and decrease in the BE intensity of the PL peaks, as compared to the bulk CdS, confirmed the quenching of spectra upon Fe doping. The synthesis and orange emission for Fe-doped CdS NBs have been observed for the first time and point out their potential in nanoscale devices.

  6. Characterization of CD34+ thymic stromal cells located in the subcapsular cortex of the human thymus.

    PubMed

    Martínez-Cáceres, E; Jaleco, A C; Res, P; Noteboom, E; Weijer, K; Spits, H

    1998-07-01

    In this paper we report that suspensions of human fetal thymocytes contain cells that express high levels of CD34 and Thy-1. These cells were characterized with regard to location within the thymus, phenotype, and function. Confocal laser scan analysis of frozen sections of fetal thymus with anti-CD34 and Thy-1 antibodies revealed that the double-labeled cells were located in the pericortical area. In addition, it was found that the CD34+Thy-1+ cells lacked CD45 and CD50, indicating that these cells are not of hematopoietic origin; this was confirmed by the finding that these cells could be cultured as adherent cells in a medium with cholera toxin and dexamethasone, but failed to grow in mixtures of hematopoietic growth factors. Further analysis indicated that most cultured CD34+Thy-1+ cells expressed cytokeratin (CK) 14 but lacked CK 13, suggesting that these cells are immature epithelial cells. Cultured CD34+Thy-1+ cells were able to induce differentiation of CD1-CD34+CD3-CD4-CD8- thymic precursors into CD4+CD8+ cells in a reaggregate culture in the absence of exogenous cytokines. The CD4+CD8+ cells that developed in these cultures did not express CD3, indicating that CD34+Thy-1+ thymic stromal cells are not capable of completing full T cell differentiation of thymic hematopoietic progenitor cells.

  7. Cleaning and Disinfection of Biofilms Composed of Listeria monocytogenes and Background Microbiota from Meat Processing Surfaces

    PubMed Central

    Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-01-01

    ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and eliminate pathogens. However, the persistence of bacteria is an enduring problem in food processing environments. This study demonstrated that environmental bacteria can survive foam cleaning and disinfection (C&D) at concentrations used in the industrial environment. The phenomenon was replicated in laboratory experiments. Important characteristics of persisting bacteria were a high growth rate at low temperature, a tolerance to the cleaning agent, and the ability to form biofilms. This study also supports other recent research suggesting that strain-to-strain variation cannot explain why certain subtypes of Listeria monocytogenes persist in food processing environments while others are found only sporadically. The present investigation highlights the failure of regular C&D and a need for research on improved agents that efficiently detach the biofilm matrix. PMID:28667108

  8. Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces.

    PubMed

    Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-06-30

    Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas , Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens. Persistence of bacteria is however a withstanding problem in food processing environments. This study demonstrated that environmental bacteria can survive foam cleaning and disinfection (C&D) at user concentrations in the industrial environment. The phenomenon was replicated in laboratory experiments. Important characteristics of persisting bacteria were high growth rate at low temperature, tolerance to the cleaning agent and ability to form biofilm. This study also supports other recent research suggesting that strain-to-strain variation cannot explain why certain subtypes of Listeria monocytogenes persist in food processing environments while others are found only sporadically. The present investigation highlights the failure of regular C&D and a need for research on improved agents efficiently detaching the biofilm matrix. Copyright © 2017 American Society for Microbiology.

  9. A pilot study of high-dose intravenous immunoglobulin 5% for autism: Impact on autism spectrum and markers of neuroinflammation.

    PubMed

    Melamed, Isaac R; Heffron, Melinda; Testori, Alessandro; Lipe, Kellie

    2018-03-01

    Research has shown that a subset of the autism spectrum disorder (ASD) population presents with immune dysregulation. To explore this topic further, we investigated the efficacy and tolerability of intravenous immunoglobulin (IVIG) infusion in children with ASD. In this study, participants were recruited based on a diagnosis of autistic disorder, Asperger's disorder, or pervasive developmental disorder not otherwise specified. Participants also showed evidence of immune dysfunction based on abnormal levels of specific biomarkers, including CD40 ligand (CD154), lymphocyte stimulation, and T or B cell dysfunction. Of 17 screened patients, 14 completed the trial and received IVIG treatment (1 g/kg dose) for ten 21-day treatment cycles. The primary endpoint was disease improvement assessed using standardized cognitive and behavioral tests (Children's Communication Checklist [CCC-2], Social Responsiveness Scale [SRS], Aberrant Behavior Checklist [ABC], Clinical Global Impressions-Severity [CGI-S] and -Improvement [CGI-I], Autism Diagnostic Observation Schedule [ADOS], and Peabody Picture Vocabulary Test [PPVT]). Secondary endpoints included experimental biomarkers such as CD154, toll-like receptor-4, memory B cells, FOXP3, and lymphocyte stimulation. Significant improvements from baseline to study endpoint were observed in several subscales of the CCC-2, SRS, CGI-I, CGI-S, and ADOS, including Associated Maladaptive Behaviors (P ≤ .043), Reciprocal Social Interaction (P = .015), Communication (P < .001), and Stereotyped Behaviors and Repetitive Interests (P ≤ .013). Statistically significant reductions were also seen in numerous secondary outcomes of immunological biomarkers indicative of neuroinflammation. IVIG was well tolerated; no subjects withdrew due to an adverse event, and clinical data showed no evidence of thromboembolic events. Autism Res 2018, 11: 421-433. © 2018 International Society for Autism Research, Wiley Periodicals, Inc. Since research has demonstrated a link between autism spectrum disorder (ASD) and immune dysfunction, this study investigated the efficacy and tolerability of intravenous immunoglobulin (IVIG) infusion in children with ASD. Fourteen patients received IVIG treatment and were assessed using standardized cognitive and behavioral tests. Following treatment with IVIG, significant improvement was observed across several subscales of the clinical tests and significant reductions were seen in the markers of neuroinflammation. These data suggest that inflammatory etiologies may play a role in select cases of autism, and IVIG treatment may exert a positive impact on behaviors and markers of inflammation in ASD. © 2018 International Society for Autism Research, Wiley Periodicals, Inc.

  10. Salivary proline-rich proteins and gluten: Do structural similarities suggest a role in celiac disease?

    PubMed

    Tian, Na; Messana, Irene; Leffler, Daniel A; Kelly, Ciaran P; Hansen, Joshua; Cabras, Tiziana; D'Alessandro, Alfredo; Schuppan, Detlef; Castagnola, Massimo; Helmerhorst, Eva J

    2015-10-01

    Gluten proteins, the culprits in celiac disease (CD), show striking similarities in primary structure with human salivary proline-rich proteins (PRPs). Both are enriched in proline and glutamine residues that often occur consecutively in their sequences. We investigated potential differences in the spectrum of salivary PRPs in health and CD. Stimulated salivary secretions were collected from CD patients, patients with refractory CD, patients with gastrointestinal complaints but no CD, and healthy controls. PRP isoforms/peptides were characterized by anionic and SDS-PAGE, PCR, and LC-ESI-MS. The gene frequencies of the acidic PRP isoforms PIF, Db, Pa, PRP1, and PRP2 did not differ between groups. At the protein level, PRPs peptides showed minor group differences, but these could not differentiate the CD and/or refractory CDs groups from the controls. This extensive study established that salivary PRPs, despite similarity to gluten proteins, show no apparent correlation with CD and thus will not serve as diagnostic markers for the disease. The structural basis for the tolerance to the gluten-like PRP proteins in CD is worthy of further exploration and may lead to the development of gluten-like analogs lacking immunogenicity that could be used therapeutically. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. CD56 Expression in Odontogenic Cysts and Tumors.

    PubMed

    Jaafari-Ashkavandi, Zohreh; Dehghani-Nazhvani, Ali; Razmjouyi, Faranak

    2014-01-01

    Background and aims. Odontogenic cysts and tumors have a wide spectrum of clinical characteristics that lead to the different management strategies. Since definite diagnosis is difficult in some cases, it has been suggested that CD56 may be a candidate marker for definitive diagnosis of some odontogenic tumors. The present study was designed to examine CD56 expression in lesions with histopathological similarities. Materials and methods. In this cross-sectional, analytical study the subjects were 22 ameloblastomas, 13 dentigerous cysts, 10 keratocystic odontogenic tumors (KCOT), 4 adenomatoid odontogenic tumors (AOT), 3 orthokeratinized odonto-genic cysts, 3 calcifying odontogenic cysts (COC) and one glandular odontogenic cyst (GOC). All the samples were examined for CD56 immunoreactivity. Data were analyzed using chi-square test. Results. Twenty cases (91%) of ameloblastomas, 3 (75%) AOT, 4 (40%) KCOT and one case of GOC were positive for CD56. None of the dentigerous cysts, COC and orthokeratinized odontogenic cysts was CD56-positive. There was a significant difference in the CD56 expression between ameloblastoma and dentigerous cyst, as well as COC. Also, KCOT showed significantly higher expression than orthokeratinized odontogenic cyst. Conclusion. In this study CD56 expression was limited to the odontogenic tumors and more aggressive cystic lesions. This marker can be a useful aid for distinguishing cysts and tumors from similar lesions.

  12. A simple method for the computation of first neighbour frequencies of DNAs from CD spectra

    PubMed Central

    Marck, Christian; Guschlbauer, Wilhelm

    1978-01-01

    A procedure for the computation of the first neighbour frequencies of DNA's is presented. This procedure is based on the first neighbour approximation of Gray and Tinoco. We show that the knowledge of all the ten elementary CD signals attached to the ten double stranded first neighbour configurations is not necessary. One can obtain the ten frequencies of an unknown DNA with the use of eight elementary CD signals corresponding to eight linearly independent polymer sequences. These signals can be extracted very simply from any eight or more CD spectra of double stranded DNA's of known frequencies. The ten frequencies of a DNA are obtained by least square fit of its CD spectrum with these elementary signals. One advantage of this procedure is that it does not necessitate linear programming, it can be used with CD data digitalized using a large number of wavelengths, thus permitting an accurate resolution of the CD spectra. Under favorable case, the ten frequencies of a DNA (not used as input data) can be determined with an average absolute error < 2%. We have also observed that certain satellite DNA's, those of Drosophila virilis and Callinectes sapidus have CD spectra compatible with those of DNA's of quasi random sequence; these satellite DNA's should adopt also the B-form in solution. PMID:673843

  13. Molecular dynamics simulation and TDDFT study of the structures and UV-vis absorption spectra of MCT-β-CD and its inclusion complexes.

    PubMed

    Lu, Huijuan; Wang, Yujiao; Xie, Xiaomei; Chen, Feifei; Li, Wei

    2015-01-01

    In this research, the inclusion ratios and inclusion constants of MCT-β-CD/PERM and MCT-β-CD/CYPERM inclusion complexes were measured by UV-vis and fluorescence spectroscopy. The inclusion ratios are both 1:1, and the inclusion constants are 60 and 342.5 for MCT-β-CD/PERM and MCT-β-CD/CYPERM, respectively. The stabilities of inclusion complexes were investigated by MD simulation. MD shows that VDW energy plays a vital role in the stability of inclusion complex, and the destruction of inclusion complex is due to the increasing temperature. The UV-vis absorption spectra of MCT-β-CD and its inclusion complexes were studied by time-dependent density functional theory (TDDFT) method employing BLYP-D3, B3LYP-D3 and M06-2X-D3 functionals. BLYP-D3 well reproduces the UV-vis absorption spectrum and reveals that the absorption bands of MCT-β-CD mainly arise from n→π(∗) and n→σ(∗) transition, and those of inclusion complexes mainly arise from intramolecular charge transfer (ICT). ICT results in the shift of main absorption bands of MCT-β-CD. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Influence of thermally induced structural and morphological changes, and UV irradiation on photoluminescence and optical absorption behavior of CdS nanoparticles

    NASA Astrophysics Data System (ADS)

    Osman, M. A.; El-Said, Waleed A.; Othman, A. A.; Abd-Elrahim, A. G.

    2016-04-01

    Polycrystalline cubic CdS nanoparticles (NPs) with a crystallite size ({{D}\\text{Sch}} ) ~3 nm were synthesized by chemical precipitation method at room temperature. Thermal induced structural and morphological changes have been investigated using x-ray diffraction, high-resolution transmission electron microscope, x-ray fluorescence, Fourier transform infrared and Raman spectroscopy. The influence of these changes on optical absorption and photoluminescence (PL) characteristics have been studied. It was found that increasing annealing temperature (T a), results in structural phase transitions at 300 and 700 °C, increasing {{D}\\text{Sch}} and red shift of the optical band gap (E\\text{g}\\text{opt} ) due to the improvement in crystallinity. The photoluminescence emission spectrum of nonstoichiometric CdS (Cd-rich) nanopowder reveals emission bands at 365, 397, and 434 nm. Furthermore, PL spectrum of colloidal solution exhibits additional green and red emission bands at 535, 570 and 622 nm. To explain the mechanism of PL emission in CdS NPs, trapping and radiative recombination levels have been identified and the corresponding energy band diagrams are suggested. Annealing process results in an overall enhancement in PL intensity due to the improvement in crystallinity associated with the reduction of nonradiative surface state defects. Irradiation of CdS NPs colloidal solution at UV irradiation dose  <13 J cm-2 leads to the enhancement of PL quantum efficiency and blue shift of E\\text{g}\\text{opt} (i.e. photo-brightening) due to the decrease in the particle size deduced from Brus equation ≤ft({{D}\\text{Brus}}\\right) , This behavior is due to UV irradiation effects such as photopolymerization, the formation of CdSO4 passivation layers due to photooxidation and the reduction in {{D}\\text{Brus}} by photocorrosion process. At UV irradiation dose  <13 J cm-2, PL emission intensity continuously enhances without any change in both E\\text{g}\\text{opt} and {{D}\\text{Brus}} . This behavior is discussed in terms of electron filling model. Boltzmann curve fitting successfully describes the dependence of both {{D}\\text{Brus}} and E\\text{g}\\text{opt} on UV irradiation dose.

  15. Update on celiac disease – etiology, differential diagnosis, drug targets, and management advances

    PubMed Central

    Scanlon, Samantha A; Murray, Joseph A

    2011-01-01

    Celiac disease (CD) is an immune-mediated enteropathy triggered by exposure to wheat gluten and similar proteins found in rye and barley that affects genetically susceptible persons. This immune-mediated enteropathy is characterized by villous atrophy, intraepithelial lymphocytosis, and crypt hyperplasia. Once thought a disease that largely presented with malnourished children, the wide spectrum of disease activity is now better recognized and this has resulted in a shift in the presenting symptoms of most patients with CD. New advances in testing, both serologic and endoscopic, have dramatically increased the detection and diagnosis of CD. While the gluten-free diet is still the only treatment for CD, recent investigations have explored alternative approaches, including the use of altered nonimmunogenic wheat variants, enzymatic degradation of gluten, tissue transglutaminase inhibitors, induction of tolerance, and peptides to restore integrity to intestinal tight junctions. PMID:22235174

  16. Genital and reproductive organ complications of Crohn disease: technical considerations as it relates to perianal disease, imaging features, and implications on management.

    PubMed

    Kammann, Steven; Menias, Christine; Hara, Amy; Moshiri, Mariam; Siegel, Cary; Safar, Bashar; Brandes, Steven; Shaaban, Akram; Sandrasegaran, Kumar

    2017-06-01

    A relatively large proportion of patients with Crohn disease (CD) develop complications including abscess formation, stricture, and penetrating disease. A subset of patients will have genital and reproductive organ involvement of CD, resulting in significant morbidity. These special circumstances create unique management challenges that must be tailored to the activity, location, and extent of disease. Familiarity with the epidemiology, pathogenesis, imaging features, and treatment strategies for patients with genital CD can aid imaging diagnoses and guide appropriate patient management. The purpose of this study is to illustrate the spectrum of CD in the genital tract and reproductive organs and discuss the complex management strategies in these patients as it relates to imaging. Given the impact on patient outcome and treatment planning, familiarity with the epidemiology, pathogenesis, imaging features, and treatment of patients with genital Crohn disease can aid radiologic diagnoses and guide appropriate patient management.

  17. Combining ligand-induced quantum-confined stark effect with type II heterojunction bilayer structure in CdTe and CdSe nanocrystal-based solar cells.

    PubMed

    Yaacobi-Gross, Nir; Garphunkin, Natalia; Solomeshch, Olga; Vaneski, Aleksandar; Susha, Andrei S; Rogach, Andrey L; Tessler, Nir

    2012-04-24

    We show that it is possible to combine several charge generation strategies in a single device structure, the performance of which benefits from all methods used. Exploiting the inherent type II heterojunction between layered structures of CdSe and CdTe colloidal quantum dots, we systematically study different ways of combining such nanocrystals of different size and surface chemistry and with different linking agents in a bilayer solar cell configuration. We demonstrate the beneficial use of two distinctly different sizes of NCs not only to improve the solar spectrum matching but also to reduce exciton binding energy, allowing their efficient dissociation at the interface. We further make use of the ligand-induced quantum-confined Stark effect in order to enhance charge generation and, hence, overall efficiency of nanocrystal-based solar cells.

  18. Electronic structure of CdSe-ZnS 2D nanoplatelets

    NASA Astrophysics Data System (ADS)

    Cruguel, Hervé; Livache, Clément; Martinez, Bertille; Pedetti, Silvia; Pierucci, Debora; Izquierdo, Eva; Dufour, Marion; Ithurria, Sandrine; Aubin, Hervé; Ouerghi, Abdelkarim; Lacaze, Emmanuelle; Silly, Mathieu G.; Dubertret, Benoit; Lhuillier, Emmanuel

    2017-04-01

    Among colloidal nanocrystals, 2D nanoplatelets (NPLs) made of cadmium chalcogenides have led to especially well controlled optical features. However, the growth of core shell heterostructures has so far been mostly focused on CdS shells, while more confined materials will be more promising to decouple the emitting quantum states of the core from their external environment. Using k.p simulation, we demonstrate that a ZnS shell reduces by a factor 10 the leakage of the wavefunction into the surrounding medium. Using X-ray photoemission (XPS), we confirm that the CdSe active layer is indeed unoxidized. Finally, we build an effective electronic spectrum for these CdSe/ZnS NPLs on an absolute energy scale which is a critical set of parameters for the future integration of this material into optoelectronic devices. We determine the work function (WF) to be 4.47 eV while the material is behaving as an n-type semiconductor.

  19. Temperature Sensitivity of Water-Soluble CdTe and CdSe/ZnS Quantum Dots Incorporated into Biopolymer Submicron Particles

    NASA Astrophysics Data System (ADS)

    Slyusarenko, N. V.; Gerasimova, M. A.; Slabko, V. V.; Slyusareva, E. A.

    2017-07-01

    Polymer particles with sizes 0.3-0.4 μm are synthesized based on chitosan and chondroitin sulfate with incorporated CdTe (core) and CdSe/ZnS (core-shell) quantum dots. Their morphological and spectral properties are investigated by the methods of dynamic scattering, electron microscopy, and absorption and luminescence spectroscopy at temperatures from 10 to 80°C. Spectral effects associated with a change in temperature (a red shift and a decrease in the amplitude of the photoluminescence spectrum) can be explained by the temperature expansion of the quantum dots and activation of surface traps. It is shown that the temperature sensitivity of spectra of the quantum dots incorporated into the biopolymer particles is not less than in water. To develop an optical temperature sensor, the core quantum dots are more preferable than the core-shell quantum dots.

  20. Magnetic field insensitive photoluminescence decay of ZnSe/CdS core/shell type-II colloidal quantum dots

    NASA Astrophysics Data System (ADS)

    Lee, Woojin; Park, Seongho; Murayama, Akihiro; Lee, Jong-soo; Kyhm, Kwangseuk

    2018-06-01

    We have synthesized ZnSe/CdS core/shell type-II colloidal quantum dots, where an electron and a hole are separated in the CdS shell and the ZnSe core, respectively. Our theoretical model has revealed that absorbance spectrum of bare ZnSe quantum dots in 2 nm radius becomes broadened with a large redshift (∼1.15 eV) when the electron in ZnSe core is separated by 3.2 nm CdS shell. Also, we found that our type-II QDs are insensitive to an external magnetic field up to 5 T in terms of central emission energy, degree of polarization, and photoluminescence decay time. This can be attributed to the electron–hole charge separation in a type-II structure, whereby the suppressed exchange interaction gives rise to a magnetic insensitivity with a small energy difference between the bright and dark exciton states.

  1. Efficacy of a sound-based intervention with a child with an autism spectrum disorder and auditory sensory over-responsivity.

    PubMed

    Gee, Bryan M; Thompson, Kelly; St John, Holly

    2014-03-01

    Sound-based interventions (SBIs) are being used by paediatric occupational therapists to help children with autism spectrum disorders and co-morbid sensory processing disorders. A limited yet growing body of evidence is emerging related to the efficacy of SBIs in reducing sensory processing deficits among paediatric clients with co-morbid conditions. The current study employed an ABA single-subject case-controlled design, implementing The Listening Program® with a 7-year-old child diagnosed with autism spectrum disorder who demonstrated auditory sensory over-responsivity (SOR). The intervention consisted of 10 weeks of psycho-acoustically modified classical music that was delivered using specialized headphones and amplifier and a standard CD player. Repeated measures were conducted during the A(1), B and A(2) phases of the study using the Sensory Processing Measure, a subjective caregiver questionnaire, and the Sensory Over-Responsivity Scales, an examiner-based assessment measure to track changes of the participant's auditory SOR-related behaviours. The results indicated that the participant exhibited a decrease in the number of negative (avoidant, verbal and physical negative) and self-stimulatory behaviours. The decreases in negative and self-stimulatory behaviour may have been due to the therapeutic effect of the repeated exposure to the Sensory Over-Responsivity Scales or The Listening Program SBI. Copyright © 2013 John Wiley & Sons, Ltd.

  2. Biosorption of Cd(II) and Pb(II) ions by aqueous solutions of novel alkalophillic Streptomyces VITSVK5 spp. biomass

    NASA Astrophysics Data System (ADS)

    Saurav, Kumar; Kannabiran, Krishnan

    2011-03-01

    Discharge of heavy metals from metal processing industries is known to have adverse effects on the environment. Biosorption of heavy metals by metabolically inactive biomass of microbial organisms is an innovative and alternative technology for removal of these pollutants from aqueous solution. The search of marine actinobacteria with potential heavy metal biosorption ability resulted in the identification of a novel alkalophilic Streptomyces VITSVK5 species. The biosorption property of Streptomyces VITSVK5 spp. was investigated by absorbing heavy metals Cadmium (Cd) and Lead (Pb). Physiochemical characteristics and trace metal concentration analysis of the backwater showed the concentrations of different metals were lead 13±2.1 μg L-1, cadmium 3.1±0.3μg L-1, zinc 8.4±2.6μg L-1 and copper 0.3±0.1μg L-1, whereas mercury was well below the detection limit. The effect of pH and biomass dosage on removal efficiency of heavy metal ions was also investigated. The optimum pH for maximal biosorption was 4.0 for Cd (II) and 5.0 for Pb (II) with 41% and 84% biosorption respectively. The biosorbent dosage was optimized as 3 g L-1 for both the trace metals. Fourier transform infrared absorption spectrum results indicated the chemical interactions of hydrogen atoms in carboxyl (-COOH), hydroxyl (-CHOH) and amine (-NH2) groups of biomass with the metal ions. This could be mainly involved in the biosorption of Cd (II) and Pb (II) onto Streptomyces VITSVK5 spp. The results of our study revealed Streptomyces metabolites could be used to develop a biosorbent for adsorbing metal ions from aqueous environments.

  3. Previous Exposure to Anesthesia and Autism Spectrum Disorder (ASD): A Puerto Rican Population-Based Sibling Cohort Study.

    PubMed

    Creagh, O; Torres, H; Rivera, K; Morales-Franqui, M; Altieri-Acevedo, G; Warner, D

    2015-01-01

    Autism Spectrum Disorder (ASD) is characterized by impaired social interaction and communication, and by restricted and repetitive behavior, that begins usually before a child is three years old.1 Researchers have shown that prevalence rates in the U.S. may be as high as 1 in 68.52 A number of studies have examined the effects of early exposure to anesthesia on brain development and subsequent impairment in neurocognitive function; yet, little is known about the possible effects of anesthetic agents on social-behavioral functioning. The association between exposure to anesthesia either in uterus, during the first years of life, or later and development of Autistic Spectrum Disorder (ASD) or its severity was determined in a retrospective population based cohort study. Identify if children who had previous exposure to anesthesia either in uterus, first years of life during their developing brain years, or later, are at risk of developing ASD and its severe form of the disease. Data was obtained from structured interviews administered to a sample of 515 parents/guardians distributed in two groups: ASD = 262 children diagnosed with this condition and Non-ASD: 253 children (siblings of ASD group) without diagnosis (p = 0.8069) when comparing exposure to anesthesia in uterus to subsequent severe form of ASD. Of the 262 ASD patients, 99 had exposure to anesthetics before their diagnosis, while in Non-ASD population, 110 had exposure to anesthesia, demonstrating no statistically significant association between both groups (p = 0.2091). Out of 99 ASD patients exposed to anesthesia prior to their diagnosis, 72 were exposed before age 2. When compared to the 110 Non-ASD patients exposed to anesthesia, 86 had exposure during this developing brain period, which indicates no statistically significant association (p = 0.4207). In addition, most of the ASD children exposed to anesthesia during developing brain were diagnosed with mild degree of the disorder when compared to ASD children without any previous exposure to anesthesia (p = 0.9700) during the same period. When the exposure occurred after age 2, ASD children developed mild form of the disorder as compared with ASD children without any previous exposure to anesthesia (p = 0.1699) in that period. Children under early exposure to anesthesia in uterus, first 2 years of life, or later are not more likely to develop neither ASD nor severe form of the disorder. INDEX WORDS: Anesthesia, Autism Spectrum Disorder, Puerto Rico. (95% confidence interval) that freely decided to participate and agreed to a consent form. Variables studied, include: demographics, diagnosis and severity of ASD, exposure to anesthesia, method of childbirth, and age of exposure. Children less than 2 years of age were considered into have developing brain period. Data was analyzed using Chi-square or Fisher exact test. In contrast to non-ASD group, most of the children within ASD group were male, 76% (p = 0.0001). With regards to methods of childbirth, 64% of the ASD population were vaginal delivery (VD; Non-anesthesia exposure group) and 36% cesarean delivery (CD) compared to non-autistic population with 71% VD and 29% CD, which demonstrates no statistical difference between both groups (p = 0.1113). Out of the 36% of ASD population that underwent CD, 7% were performed using general anesthesia and 93% regional anesthesia, while the 29% of the CD of non-ASD, 5% were performed using general anesthesia and 95% regional anesthesia. This reveals no statistical significance (p = 0.7569) with the development of ASD and the type of anesthesia used when comparing ASD with non-ASD patients. In view of severity of autism, in VD, 56% of ASD population had mild form of the disorder, 34% moderate, and 10% severe; while CD had a 54% mild form of the disorder, 33% moderate, and 13% severe. This shows no statistical association.

  4. Pathogenesis of an Infectious Mononucleosis-like Disease Induced by a Murine γ-Herpesvirus: Role for a Viral Superantigen?

    PubMed Central

    Tripp, Ralph A.; Hamilton-Easton, Ann Marie; Cardin, Rhonda D.; Nguyen, Phuong; Behm, Frederick G.; Woodland, David L.; Doherty, Peter C.; Blackman, Marcia A.

    1997-01-01

    The murine γ-herpesvirus 68 has many similarities to EBV, and induces a syndrome comparable to infectious mononucleosis (IM). The frequency of activated CD8+ T cells (CD62Llo) in the peripheral blood increased greater than fourfold by 21 d after infection of C57BL/6J (H-2b) mice, and remained high for at least a further month. The spectrum of T cell receptor usage was greatly skewed, with as many as 75% of the CD8+ T cells in the blood expressing a Vβ4+ phenotype. Interestingly, the Vβ4 dominance was also seen, to varying extents, in H-2k, H-2d, H-2u, and H-2q strains of mice. In addition, although CD4 depletion from day 11 had no effect on the Vβ4 bias of the T cells, the Vβ4+CD8+ expansion was absent in H-2IAb–deficient congenic mice. However, the numbers of cycling cells in the CD4 antibody–depleted mice and mice that are CD4 deficient as a consequence of the deletion of MHC class II, were generally lower. The findings suggest that the IM-like disease is driven both by cytokines provided by CD4+ T cells and by a viral superantigen presented by MHC class II glycoproteins to Vβ4+CD8+ T cells. PMID:9151901

  5. A Facile CD Protocol for Rapid Determination of Enantiomeric Excess and Concentration of Chiral Primary Amines

    PubMed Central

    Nieto, Sonia; Dragna, Justin M.; Anslyn, Eric V.

    2010-01-01

    A protocol for the rapid determination of the absolute configuration and enantiomeric excess of α-chiral primary amines with potential applications in asymmetric reaction discovery has been developed. The protocol requires derivatization of α-chiral primary amines via condensation with pyridine carboxaldehyde to quantitatively yield the corresponding imine. The Cu(I) complex with 2,2'-bis (diphenylphosphino)-1,1'-dinaphthyl (BINAP -CuI) with the imine yields a metal-to-ligand-charge-transfer band (MLCT) in the visible region of the circular dichroism spectrum upon binding. Diastereomeric host-guest complexes give CD signals of the same signs, but different amplitudes, allowing for differentiation of enantiomers. Processing the primary optical data from the CD spectrum with linear discriminant analysis (LDA) allows for the determination of absolute configuration and identification of the amines, and processing with a supervised multi-layer perceptron artifical neural network (MLP-ANN) allows for the simultaneous determination of ee and concentration. The primary optical data necessary to determine the ee of unknown samples is obtained in 2 minutes per sample. To demonstrate the utility of the protocol in asymmetric reaction discovery, the ee's and concentrations for an asymmetric metal catalyzed reaction are determined. The potential of the protocol's application in high-throughput screening (HTS) of ee is discussed. PMID:19946914

  6. Controlled viable release of selectively captured label-free cells in microchannels.

    PubMed

    Gurkan, Umut Atakan; Anand, Tarini; Tas, Huseyin; Elkan, David; Akay, Altug; Keles, Hasan Onur; Demirci, Utkan

    2011-12-07

    Selective capture of cells from bodily fluids in microchannels has broadly transformed medicine enabling circulating tumor cell isolation, rapid CD4(+) cell counting for HIV monitoring, and diagnosis of infectious diseases. Although cell capture methods have been demonstrated in microfluidic systems, the release of captured cells remains a significant challenge. Viable retrieval of captured label-free cells in microchannels will enable a new era in biological sciences by allowing cultivation and post-processing. The significant challenge in release comes from the fact that the cells adhere strongly to the microchannel surface, especially when immuno-based immobilization methods are used. Even though fluid shear and enzymes have been used to detach captured cells in microchannels, these methods are known to harm cells and affect cellular characteristics. This paper describes a new technology to release the selectively captured label-free cells in microchannels without the use of fluid shear or enzymes. We have successfully released the captured CD4(+) cells (3.6% of the mononuclear blood cells) from blood in microfluidic channels with high specificity (89% ± 8%), viability (94% ± 4%), and release efficiency (59% ± 4%). We have further validated our system by specifically capturing and controllably releasing the CD34(+) stem cells from whole blood, which were quantified to be 19 cells per million blood cells in the blood samples used in this study. Our results also indicated that both CD4(+) and CD34(+) cells released from the microchannels were healthy and amenable for in vitro culture. Manual flow based microfluidic method utilizes inexpensive, easy to fabricate microchannels allowing selective label-free cell capture and release in less than 10 minutes, which can also be used at the point-of-care. The presented technology can be used to isolate and purify a broad spectrum of cells from mixed populations offering widespread applications in applied biological sciences, such as tissue engineering, regenerative medicine, rare cell and stem cell isolation, proteomic/genomic research, and clonal/population analyses.

  7. Investigations on the interactions of aurintricarboxylic acid with bovine serum albumin: Steady state/time resolved spectroscopic and docking studies.

    PubMed

    Bardhan, Munmun; Chowdhury, Joydeep; Ganguly, Tapan

    2011-01-10

    In this paper, the nature of the interactions between bovine serum albumin (BSA) and aurintricarboxylic acid (ATA) has been investigated by measuring steady state and time-resolved fluorescence, circular dichroism (CD), FT-IR and fluorescence anisotropy in protein environment under physiological conditions. From the analysis of the steady state and time-resolved fluorescence quenching of BSA in aqueous solution in presence of ATA it has been inferred that the nature of the quenching originates from the combined effect of static and dynamic modes. From the determination of the thermodynamic parameters obtained from temperature-dependent changes in K(b) (binding constant) it was apparent that the combined effect of hydrophobic association and electrostatic attraction is responsible for the interaction of ATA with BSA. The effect of ATA on the conformation of BSA has been examined by analyzing CD spectrum. Though the observed results demonstrate some conformational changes in BSA in presence of ATA but the secondary structure of BSA, predominantly of α-helix, is found to retain its identity. Molecular docking of ATA with BSA also indicates that ATA docks through hydrophobic interaction. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. Analysis of impact/impulse noise for predicting noise induced hearing loss

    NASA Astrophysics Data System (ADS)

    Vipperman, Jeffrey S.; Prince, Mary M.; Flamm, Angela M.

    2003-04-01

    Studies indicate that the statistical properties and temporal structure of the sound signal are important in determining the extent of hearing hazard. As part of a pilot study to examine hearing conservation program effectiveness, NIOSH collected noise samples of impact noise sources in an automobile stamping plant, focusing on jobs with peak sound levels (Lpk) of greater than 120 dB. Digital tape recordings of sounds were collected using a Type I Precision Sound Level Meter and microphone connected to a DAT tape recorder. The events were archived and processed as .wav files to extract single events of interest on CD-R media and CD audio media. A preliminary analysis of sample wavelet files was conducted to characterize each event using metrics such as the number of impulses per unit time, the repetition rate or temporal pattern of these impulses, index of peakedness, crest factor, kurtosis, coefficient of kurtosis, rise time, fall time, and peak time. The spectrum, duration, and inverse of duration for each waveform were also computed. Finally, the data were evaluated with the Auditory Hazard Assessment Algorithm (AHAAH). Improvements to data collection for a future study examining different strategies for evaluating industrial noise exposure will be discussed.

  9. CD30 Expression by B and T Cells: A Frequent Finding in Angioimmunoblastic T-Cell Lymphoma and Peripheral T-Cell Lymphoma-Not Otherwise Specified.

    PubMed

    Onaindia, Arantza; Martínez, Nerea; Montes-Moreno, Santiago; Almaraz, Carmen; Rodríguez-Pinilla, Socorro M; Cereceda, Laura; Revert, Jose B; Ortega, César; Tardio, Antoni; González, Lucía; García, Sonia; Camacho, Francisca I; González-Vela, Carmen; Piris, Miguel A

    2016-03-01

    CD30 expression in peripheral T-cell lymphoma (PTCL) and angioimmunoblastic T-cell lymphoma (AITL) is currently of great interest because therapy targeting CD30 is of clinical benefit, but the clinical and therapeutic relevance of CD30 expression in these neoplasms still remains uncertain. The aim of this study was to better quantify CD30 expression in AITL and PTCL-not otherwise specified (NOS). The secondary objective was to determine whether CD30 cells exhibit a B-cell or a T-cell phenotype. Gene expression profiling was studied in a series of 37 PTCL cases demonstrating a continuous spectrum of TNFRSF8 expression. This prompted us to study CD30 immunohistochemical (IHC) expression and mRNA levels by reverse transcription polymerase chain reaction (RT-PCR) in a different series of 51 cases (43 AITLs and 8 PTCL-NOSs) in routine samples. Double stainings with PAX5/CD30, CD3/CD30, and LEF1/CD30 were performed to study the phenotype of CD30 cells. Most (90%) of the cases showed some level of CD30 expression by IHC (1% to 95%); these levels were high (>50% of tumoral cells) in 14% of cases. CD30 expression was not detected in 10% of the cases. Quantitative RT-PCR results largely confirmed these findings, demonstrating a moderately strong correlation between global CD30 IHC and mRNA levels (r=0.65, P=1.75e-7). Forty-four of the positive cases (98%) contained CD30-positive B cells (PAX5), whereas atypical CD30-positive T cells were detected in 42 cases (93%). In conclusion, our data show that most AITL and PTCL-NOS cases express CD30, exhibiting very variable levels of CD30 expression that may be measured by IHC or RT-PCR techniques.

  10. Cutaneous manifestations of Crohn's disease, its spectrum, and its pathogenesis: intracellular consensus bacterial 16S rRNA is associated with the gastrointestinal but not the cutaneous manifestations of Crohn's disease.

    PubMed

    Crowson, A Neil; Nuovo, Gerard J; Mihm, Martin C; Magro, Cynthia

    2003-11-01

    The classic pathology of skin disease discontinuous from the inflamed gastrointestinal (GI) tract in patients with Crohn's disease (CD) includes pyoderma gangrenosum (PG), erythema nodosum (EN), and so-called metastatic Crohn's disease. The purpose of this study was two-fold: First, we explored the full spectrum of cutaneous lesions associated with Crohn's disease, and second, we sought to explore a potential molecular basis of the skin lesions in patients with CD. In this regard, we analyzed skin and GI tract biopsies from affected patients for the consensus bacterial SrRNA to determine whether direct bacterial infection was associated with either condition. Formalin-fixed, paraffin-embedded sections were studied and correlated to clinical presentation and histories from 33 patients with CD. Consensus bacterial RNA sequences were analyzed using an RT in situ PCR assay on both skin biopsy and GI biopsy material. The GI tract material included biopsies from 3 patients who had skin lesions and from 7 patients in whom there were no known skin manifestations. There were 8 cases of neutrophilic dominant dermal infiltrates, including pyoderma gangrenosum, 6 cases of granuloma annulare/necrobiosis lipoidica-like lesions, 5 cases of sterile neutrophilic folliculitis, 5 cases of panniculitis, 4 cases of vasculitis, 2 cases of psoriasis, 2 cases of lichenoid and granulomatous inflammation, and 1 case of classic metastatic CD. Intracellular bacterial 16S rRNA was detected in 8 of 10 tissues of active CD in the GI tract, of which 3 of the cases tested were from patients who also developed skin lesions at some point in their clinical course; in contrast, none of the skin biopsies had detectable bacterial RNA. The dermatopathological manifestations of CD discontiguous from the involved GI tract mucosa have in common a vascular injury syndrome, typically with a prominent extravascular neutrophilic and/or histiocytic dermal infiltrate. In addition, this study, the first to document in situ intracellular consensus bacterial SrRNA in the GI tract in CD, suggests that hematogenous dissemination of viable microbes is not associated with the cutaneous manifestations of this disease. Bacteria do, however, appear to play a role in bowel lesions of patients with CD.

  11. Proteomic Profiling of the Interactions of Cd/Zn in the Roots of Dwarf Polish Wheat (Triticum polonicum L.)

    PubMed Central

    Wang, Yi; Wang, Xiaolu; Wang, Chao; Wang, Ruijiao; Peng, Fan; Xiao, Xue; Zeng, Jian; Fan, Xing; Kang, Houyang; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong

    2016-01-01

    Cd and Zn have been shown to interact antagonistically or synergistically in various plants. In the present study of dwarf polish wheat (DPW)roots, Cd uptake was inhibited by Zn, and Zn uptake was inhibited by Cd, suggesting that Cd and Zn interact antagonistically in this plant. A study of proteomic changes showed that Cd, Zn, and Cd+Zn stresses altered the expression of 206, 303, and 190 proteins respectively. Among these, 53 proteins were altered significantly in response to all these stresses (Cd, Zn, and Cd+Zn), whereas 58, 131, and 47 proteins were altered in response to individual stresses (Cd, Zn, and Cd+Zn, respectively). Sixty-one differentially expressed proteins (DEPs) were induced in response to both Cd and Zn stresses; 33 proteins were induced in response to both Cd and Cd+Zn stresses; and 57 proteins were induced in response to both Zn and Cd+Zn stresses. These results indicate that Cd and Zn induce differential molecular responses, which result in differing interactions of Cd/Zn. A number of proteins that mainly participate in oxidation-reduction and GSH, SAM, and sucrose metabolisms were induced in response to Cd stress, but not Cd+Zn stress. This result indicates that these proteins participate in Zn inhibition of Cd uptake and ultimately cause Zn detoxification of Cd. Meanwhile, a number of proteins that mainly participate in sucrose and organic acid metabolisms and oxidation-reduction were induced in response to Zn stress but not Cd+Zn stress. This result indicates that these proteins participate in Cd inhibition of Zn uptake and ultimately cause the Cd detoxification of Zn. Other proteins induced in response to Cd, Zn, or Cd+Zn stress, participate in ribosome biogenesis, DNA metabolism, and protein folding/modification and may also participate in the differential defense mechanisms. PMID:27683584

  12. Evolution of oxygenated cadmium sulfide (CdS:O) during high-temperature CdTe solar cell fabrication

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meysing, Daniel M.; Reese, Matthew O.; Warren, Charles W.

    Oxygenated cadmium sulfide (CdS:O) produced by reactive sputtering has emerged as a promising alternative to conventional CdS for use as the n-type window layer in CdTe solar cells. Here, complementary techniques are used to expose the window layer (CdS or CdS:O) in completed superstrate devices and combined with a suite of materials characterization to elucidate its evolution during high temperature device processing. During device fabrication amorphous CdS:O undergoes significant interdiffusion with CdTe and recrystallization, forming CdS1-yTey nanocrystals whose Te fraction approaches solubility limits. Significant oxygen remains after processing, concentrated in sulfate clusters dispersed among the CdS1-yTey alloy phase, accounting formore » ~30% of the post-processed window layer based on cross-sectional microscopy. Interdiffusion and recrystallization are observed in devices with un-oxygenated CdS, but to a much lesser extent. Etching experiments suggest that the CdS thickness is minimally changed during processing, but the CdS:O window layer is reduced from 100 nm to 60-80 nm, which is confirmed by microscopy. Alloying reduces the band gap of the CdS:O window layer to 2.15 eV, but reductions in thickness and areal density improve its transmission spectrum, which is well matched to device quantum efficiency. The changes to the window layer in the reactive environments of device fabrication are profoundly different than what occurs by thermal annealing in an inert environment, which produced films with a band gap of 2.4 eV for both CdS and CdS:O. These results illustrate for the first time the significant changes that occur to the window layer during processing that are critical to the performance of CdTe solar cells.« less

  13. UV-Vis Ratiometric Resonance Synchronous Spectroscopy for Determination of Nanoparticle and Molecular Optical Cross Sections.

    PubMed

    Nettles, Charles B; Zhou, Yadong; Zou, Shengli; Zhang, Dongmao

    2016-03-01

    Demonstrated herein is a UV-vis Ratiometric Resonance Synchronous Spectroscopic (R2S2, pronounced as "R-two-S-two" for simplicity) technique where the R2S2 spectrum is obtained by dividing the resonance synchronous spectrum of a NP-containing solution by the solvent resonance synchronous spectrum. Combined with conventional UV-vis measurements, this R2S2 method enables experimental quantification of the absolute optical cross sections for a wide range of molecular and nanoparticle (NP) materials that range optically from pure photon absorbers or scatterers to simultaneous photon absorbers and scatterers, simultaneous photon absorbers and emitters, and all the way to simultaneous photon absorbers, scatterers, and emitters in the UV-vis wavelength region. Example applications of this R2S2 method were demonstrated for quantifying the Rayleigh scattering cross sections of solvents including water and toluene, absorption and resonance light scattering cross sections for plasmonic gold nanoparticles, and absorption, scattering, and on-resonance fluorescence cross sections for semiconductor quantum dots (Qdots). On-resonance fluorescence quantum yields were quantified for the model molecular fluorophore Eosin Y and fluorescent Qdots CdSe and CdSe/ZnS. The insights and methodology presented in this work should be of broad significance in physical and biological science research that involves photon/matter interactions.

  14. Analysis of Th1, Th17 and regulatory T cells in tuberculosis case contacts.

    PubMed

    García Jacobo, R E; Serrano, C J; Enciso Moreno, J A; Gaspar Ramírez, O; Trujillo Ochoa, J L; Uresti Rivera, E E; Portales Pérez, D P; González-Amaro, R; García Hernández, M H

    2014-01-01

    We have hypothesized that individuals infected with Mycobacteriumtuberculosis that exhibit different patterns of immune reactivity in serial interferon (IFN)-γ release assays (IGRA's) correspond to different status within the immune spectrum of latent tuberculosis (TB). Accordingly, we analyzed the possible association between the consistent results (negative or positive) in an IGRA test and relevant immune parameters, mainly the levels of Th1 and Th17 lymphocytes and T regulatory (Treg) cells in the peripheral blood of TB case contacts. We found that individuals with a persistently positive IGRA showed increased levels of Th1 and Th17 lymphocytes upon in vitro stimulation with MTB antigens. In addition, a significant increase in the proportion of CD4+CTLA-4+ and CD4+Foxp3+ cells was detected in assays with blood samples from these individuals. Our data support that different immune phenotypes can be identified into the spectrum of latent TB, by combining different parameters of immune reactivity against MTB. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Structure investigations on assembled astaxanthin molecules

    NASA Astrophysics Data System (ADS)

    Köpsel, Christian; Möltgen, Holger; Schuch, Horst; Auweter, Helmut; Kleinermanns, Karl; Martin, Hans-Dieter; Bettermann, Hans

    2005-08-01

    The carotenoid r,r-astaxanthin (3R,3‧R-dihydroxy-4,4‧-diketo-β-carotene) forms different types of aggregates in acetone-water mixtures. H-type aggregates were found in mixtures with a high part of water (e.g. 1:9 acetone-water mixture) whereas two different types of J-aggregates were identified in mixtures with a lower part of water (3:7 acetone-water mixture). These aggregates were characterized by recording UV/vis-absorption spectra, CD-spectra and fluorescence emissions. The sizes of the molecular assemblies were determined by dynamic light scattering experiments. The hydrodynamic diameter of the assemblies amounts 40 nm in 1:9 acetone-water mixtures and exceeds up to 1 μm in 3:7 acetone-water mixtures. Scanning tunneling microscopy monitored astaxanthin aggregates on graphite surfaces. The structure of the H-aggregate was obtained by molecular modeling calculations. The structure was confirmed by calculating the electronic absorption spectrum and the CD-spectrum where the molecular modeling structure was used as input.

  16. Marked central nervous system pathology in CD59 knockout rats following passive transfer of Neuromyelitis optica immunoglobulin G.

    PubMed

    Yao, Xiaoming; Verkman, Alan S

    2017-02-17

    Neuromyelitis optica spectrum disorders (herein called NMO) is an inflammatory demyelinating disease of the central nervous system in which pathogenesis involves complement-dependent cytotoxicity (CDC) produced by immunoglobulin G autoantibodies targeting aquaporin-4 (AQP4-IgG) on astrocytes. We reported evidence previously, using CD59 -/- mice, that the membrane-associated complement inhibitor CD59 modulates CDC in NMO (Zhang and Verkman, J. Autoimmun. 53:67-77, 2014). Motivated by the observation that rats, unlike mice, have human-like complement activity, here we generated CD59 -/- rats to investigate the role of CD59 in NMO and to create NMO pathology by passive transfer of AQP4-IgG under conditions in which minimal pathology is produced in normal rats. CD59 -/- rats generated by CRISPR/Cas9 technology showed no overt phenotype at baseline except for mild hemolysis. CDC assays in astrocyte cultures and cerebellar slices from CD59 -/- rats showed much greater sensitivity to AQP4-IgG and complement than those from CD59 +/+ rats. Intracerebral administration of AQP4-IgG in CD59 -/- rats produced marked NMO pathology, with astrocytopathy, inflammation, deposition of activated complement, and demyelination, whereas identically treated CD59 +/+ rats showed minimal pathology. A single, intracisternal injection of AQP4-IgG in CD59 -/- rats produced hindlimb paralysis by 3 days, with inflammation and deposition of activated complement in spinal cord, optic nerves and brain periventricular and surface matter, with most marked astrocyte injury in cervical spinal cord. These results implicate an important role of CD59 in modulating NMO pathology in rats and demonstrate amplification of AQP4-IgG-induced NMO disease with CD59 knockout.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ngu, Thanh T.; Sturzenbaum, Stephen R.; Stillman, Martin J.

    The earthworm Lumbricus rubellus has been found to inhabit cadmium-rich soils and accumulate cadmium within its tissues. Two metallothionein (MT) isoforms (1 and 2) have been identified and cloned from L. rubellus. In this study, we address the metalation status, metal coordination, and structure of recombinant MT-2 from L. rubellus using electrospray ionization mass spectrometry (ESI-MS), UV absorption, and circular dichroism (CD) spectroscopy. This is the first study to show the detailed mass and CD spectral properties for the important cadmium-containing earthworm MT. We report that the 20-cysteine L. rubellus MT-2 binds seven Cd{sup 2+} ions. UV absorption and CDmore » spectroscopy and ESI-MS pH titrations show a distinct biphasic demetalation reaction, which we propose results from the presence of two metal-thiolate binding domains. We propose stoichiometries of Cd{sub 3}Cys{sub 9} and Cd{sub 4}Cys{sub 11} based on the presence of 20 cysteines split into two isolated regions of the sequence with 11 cysteines in the N-terminal and 9 cysteines in the C-terminal. The CD spectrum reported is distinctly different from any other metallothionein known suggesting quite different binding site structure for the peptide.« less

  18. Expansion of CD14+CD16+ monocytes producing TNF-α in complication-free diabetes type 1 juvenile onset patients.

    PubMed

    Myśliwska, Jolanta; Smardzewski, Marcin; Marek-Trzonkowska, Natalia; Myśliwiec, Małgorzata; Raczyńska, Krystyna

    2012-10-01

    We concentrated on the complication-free phase of juvenile onset type 1 diabetes mellitus (T1DM) searching for associations between concentration of inflammatory factors TNF-α, CRP and VEGF and two monocyte subsets the CD14(++)CD16(-) and CD14(+)CD16(+). We analysed a randomly selected group of 150 patients without complications (disease duration 2.74 ± 2.51 years) at the start of the project and 5 years later. They were compared with 24 patients with retinopathy (6.53 ± 3.39 years of disease) and 30 healthy volunteers. Our results indicate that in the complication-free period the concentration of TNF-α significantly increased and continued to increase after retinopathy was established. After 5 years the percentage and absolute number of CD14(+)CD16(+) monocytes doubled in complication-free patients. Our study indicates that the size of CD14(+)CD16(+) monocyte subset may be used alternatively to CRP values as an indicator of inflammation grade. Our results imply the necessity of trials using anti-TNF-α therapy in the complication-free phase of the disease. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Root iron plaque alleviates cadmium toxicity to rice (Oryza sativa) seedlings.

    PubMed

    Fu, Youqiang; Yang, Xujian; Shen, Hong

    2018-06-18

    Iron plaque (IP) on root surface can enhance the tolerance of plants to environmental stresses. However, it remains unclear the impact of Fe 2+ on cadmium (Cd) toxicity to rice (Oryza sativa) seedlings. In this study, the effects of different Fe 2+ and Cd 2+ concentration combinations on rice growth were examined hydroponically. Results indicated that Fe 2+ concentration up to 3.2 mM did not damage rice roots while induced IP formation obviously. Cd 2+ of 10 μM repressed rice growth significantly, while the addition of 0.2 mM Fe 2+ to 10 μM Cd 2+ solution (Cd+Fe) did not damage rice roots, indicating that Fe 2+ could ameliorate Cd toxicity to rice seedlings. Microstructure analysis showed Cd+Fe treatment induced the formation of IP with dense and intricate network structure, Cd adsorption on the root surface was reduced significantly. Cd concentration of rice roots and shoots and Cd translocation from roots to shoots with Fe+Cd treatment were reduced by 34.1%, 36.0% and 20.1%, respectively, in comparison to a single Cd treatment. Noteworthy, the removal of IP resulted in a larger loss of root biomass under Cd treatment. In addition, Cd+Fe treatment increased the activities of root superoxide dismutase and catalase by 105.5% and 177.4%, and decreased H 2 O 2 and O 2 · - accumulation of rice roots by 56.9% and 35.9%, and recovered Cd-triggered electrolyte leakage obviously, when compared with a single Cd treatment. The results from this experiment indicated that the formed dense IP on rice roots decreased Cd absorption and reactive oxygen species accumulation, and Fe 2+ supply alleviated Cd toxicity to rice seedlings. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Toll-like receptors 2, 4, and 9 expressions over the entire clinical and immunopathological spectrum of American cutaneous leishmaniasis due to Leishmania (V.) braziliensis and Leishmania (L.) amazonensis

    PubMed Central

    Campos, Marliane Batista; Lima, Luciana Vieira do Rêgo; de Lima, Ana Carolina Stocco; Vasconcelos dos Santos, Thiago; Ramos, Patrícia Karla Santos; Gomes, Claudia Maria de Castro

    2018-01-01

    Leishmania (V.) braziliensis and Leishmania(L.) amazonensis are the most pathogenic agents of American Cutaneous Leishmaniasis in Brazil, causing a wide spectrum of clinical and immunopathological manifestations, including: localized cutaneous leishmaniasis (LCLDTH+/++), borderline disseminated cutaneous leishmaniasis (BDCLDTH±), anergic diffuse cutaneous leishmaniasis (ADCLDTH-), and mucosal leishmaniasis (MLDTH++++). It has recently been demonstrated, however, that while L. (V.) braziliensis shows a clear potential to advance the infection from central LCL (a moderate T-cell hypersensitivity form) towards ML (the highest T-cell hypersensitivity pole), L. (L.) amazonensis drives the infection in the opposite direction to ADCL (the lowest T-cell hypersensitivity pole). This study evaluated by immunohistochemistry the expression of Toll-like receptors (TLRs) 2, 4, and 9 and their relationships with CD4 and CD8 T-cells, and TNF-α, IL-10, and TGF-β cytokines in that disease spectrum. Biopsies of skin and mucosal lesions from 43 patients were examined: 6 cases of ADCL, 5 of BDCL, and 11 of LCL caused byL. (L.) amazonensis; as well as 10 cases of LCL, 4 of BDCL, and 6 of ML caused byL. (V.) braziliensis. CD4+ T-cells demonstrated their highest expression in ML and, in contrast, their lowest in ADCL. CD8+ T-cells also showed their lowest expression in ADCL as compared to the other forms of the disease. TNF-α+showed increased expression from ADCL to ML, while IL-10+and TGF-β+ showed increased expression in the opposite direction, from ML to ADCL. With regards to TLR2, 4, and 9 expressions, strong interactions of TLR2 and 4 with clinical forms associated with L. (V.) braziliensis were observed, while TLR9, in contrast, showed a strong interaction with clinical forms linked to L. (L.) amazonensis. These findings strongly suggest the ability of L. (V.) braziliensis and L. (L.) amazonensis to interact with those TLRs to promote a dichotomous T-cell immune response in ACL. PMID:29543867

  1. The circular dichroism properties of phi W-14 DNA containing alpha-putrescinylthymine.

    PubMed

    Spetter, S; Chen, C; Warren, R A; Hanlon, S

    1985-03-08

    The circular dichroism properties of phi W-14 DNA containing alpha-putrescinylthymine and its acetylated derivative have been examined in a number of aqueous solvents. Native phi W-14 DNA exhibits a B-type CD spectrum whose characteristics do not entirely conform to what would be expected for its GC content (51%). The conformationally sensitive positive band above 260 nm has a rotational strength greater than that normally found in prokaryotic DNAs of comparable GC content, such as Escherichia coli DNA. The rotational strength of this band in the spectrum of the heat-denatured form of phi W-14 DNA, however, is similar to that of heat denatured E. coli DNA. Abolition of the positive charge on the putrescine residues of native phi W-14 DNA by reaction with CH2O or by acetylation reduces the rotational strength to a level appropriate for its GC content. Increases in the electrolyte content of the solvent have the same effect, although the rotational strength of this band in phi W-14 DNA does not become comparable to that of E. coli DNA until 6-7 M LiCl. Titration to pH 10.6 in solvents of modest electrolyte content, however, fails to appreciably affect the CD spectral properties of either native phi W-14 DNA or the derivative in which half of the secondary and all of the primary amino groups have been acetylated. On the basis of these results we have concluded that the enhanced rotational strength of the positive band above 260 nm in the CD spectrum of phi W-14 DNA is due to a conformational difference caused by an ion-pair interaction of the positively charged primary amino groups of putrescine with the phosphate backbone. The CD spectral properties, however, reveal that these differences, averaged over the entire basepair population, appear to be relatively small. The average conformation, at least in dilute aqueous solutions, seems to be an unexceptional B variant with conformational properties which would be more appropriate for a DNA of higher CG content.

  2. An Ilomastat-CD Eye Drop Formulation to Treat Ocular Scarring.

    PubMed

    Mohamed-Ahmed, Abeer H A; Lockwood, Alastair; Li, He; Bailly, Maryse; Khaw, Peng T; Brocchini, Steve

    2017-07-01

    The purpose of this study was to develop a topical matrix metalloproteinase inhibitor preparation for antiscarring therapy. The broad spectrum matrix metalloproteinase inhibitor ilomastat was formulated using 2-hydroxypropyl-β-cyclodextrin in aqueous solution. In vitro activity of ilomastat-cyclodextrin (ilomastat-CD) was examined using fibroblasts seeded in collagen. Permeation of ilomastat-CD eye drop through pig eye conjunctiva was confirmed using Franz diffusion cells. Ilomastat-CD eye drop was applied to rabbit eyes in vivo, and the distribution of ilomastat in ocular tissues and fluids was determined by liquid chromatography-mass spectroscopy. The aqueous solubility of ilomastat-CD was ∼1000 μg/mL in water and 1400 μg/mL in PBS (pH 7.4), which is greater than ilomastat alone (140 and 160 μg/mL in water and PBS, respectively). The in vitro activity of ilomastat-CD to inhibit collagen contraction in the presence of human Tenon fibroblast cells was unchanged compared to uncomplexed ilomastat. Topically administered ilomastat-CD in vivo to rabbit eyes resulted in a therapeutic concentration of ilomastat being present in the sclera and conjunctiva and within the aqueous humor. Ilomastat-CD has the potential to be formulated as an eye drop for use as an antifibrotic, which may have implications for the prevention of scarring in many settings, for example glaucoma filtration surgery.

  3. Definition of epitopes and antigens recognized by vaccinia specific immune responses: their conservation in variola virus sequences, and use as a model system to study complex pathogens.

    PubMed

    Sette, Alessandro; Grey, Howard; Oseroff, Carla; Peters, Bjoern; Moutaftsi, Magdalini; Crotty, Shane; Assarsson, Erika; Greenbaum, Jay; Kim, Yohan; Kolla, Ravi; Tscharke, David; Koelle, David; Johnson, R Paul; Blum, Janice; Head, Steven; Sidney, John

    2009-12-30

    In the last few years, a wealth of information has become available relating to the targets of vaccinia virus (VACV)-specific CD4(+) T cell, CD8(+) T cell and antibody responses. Due to the large size of its genome, encoding more than 200 different proteins, VACV represents a useful model system to study immunity to complex pathogens. Our data demonstrate that both cellular and humoral responses target a large number of antigens and epitopes. This broad spectrum of targets is detected in both mice and humans. CD4(+) T cell responses target late and structural antigens, while CD8(+) T cells preferentially recognize early antigens. While both CD4(+) and CD8(+) T cell responses target different types of antigens, the antigens recognized by T(H) cells are highly correlated with those recognized by antibody responses. We further show that protein abundance and antibody recognition can be used to predict antigens recognized by CD4(+) T cell responses, while early expression at the mRNA level predicts antigens targeted by CD8(+) T cells. Finally, we find that the vast majority of VACV epitopes are conserved in variola virus (VARV), thus suggesting that the epitopes defined herein also have relevance for the efficacy of VACV as a smallpox vaccine.

  4. Recovery from severe H7N9 disease is associated with diverse response mechanisms dominated by CD8+ T cells

    PubMed Central

    Wang, Zhongfang; Wan, Yanmin; Qiu, Chenli; Quiñones-Parra, Sergio; Zhu, Zhaoqin; Loh, Liyen; Tian, Di; Ren, Yanqin; Hu, Yunwen; Zhang, Xiaoyan; Thomas, Paul G.; Inouye, Michael; Doherty, Peter C.; Kedzierska, Katherine; Xu, Jianqing

    2015-01-01

    The avian origin A/H7N9 influenza virus causes high admission rates (>99%) and mortality (>30%), with ultimately favourable outcomes ranging from rapid recovery to prolonged hospitalization. Using a multicolour assay for monitoring adaptive and innate immunity, here we dissect the kinetic emergence of different effector mechanisms across the spectrum of H7N9 disease and recovery. We find that a diversity of response mechanisms contribute to resolution and survival. Patients discharged within 2–3 weeks have early prominent H7N9-specific CD8+ T-cell responses, while individuals with prolonged hospital stays have late recruitment of CD8+/CD4+ T cells and antibodies simultaneously (recovery by week 4), augmented even later by prominent NK cell responses (recovery >30 days). In contrast, those who succumbed have minimal influenza-specific immunity and little evidence of T-cell activation. Our study illustrates the importance of robust CD8+ T-cell memory for protection against severe influenza disease caused by newly emerging influenza A viruses. PMID:25967273

  5. Strong circular dichroism in a non-chiral metasurface based on an array of metallic V-shaped nanostructures

    NASA Astrophysics Data System (ADS)

    Ardakani, Abbas Ghasempour; Moradi, Khatereh

    2018-02-01

    In this paper, an extrinsic chiral metasurface based on a silver thin film containing a periodic array of V-shaped nanostructures is proposed. The proposed structure is normally and obliquely illuminated by right- and left-handed circularly polarized plane waves and the transmission through the structure is calculated using the frequency domain finite-integration technique. Our simulation results show that the designed metasurface exhibits strong circular dichroism (CD) in the transmission Δ = T_{RCP}- T_{LCP}=0.98 in the near-infrared region under oblique incidence. To our knowledge, this is one of highest CD effects that have been achieved so far in the single-layer metasurface based on metallic nanostructures. The physical mechanism for this strong CD effect is explained in terms of the current density distribution. Furthermore, the effects of change of the incident angle, the refractive index of surrounding medium and structure parameters, such as film thickness and lattice constants on CD spectrum, are investigated. In addition, the CD phenomenon in the structure is analyzed in other frequency regions.

  6. Single molecule quantum-confined Stark effect measurements of semiconductor nanoparticles at room temperature

    NASA Astrophysics Data System (ADS)

    Park, Kyoung Won; Deutsch, Zvicka; Li, J. Jack; Oron, Dan; Weiss, Shimon

    2013-02-01

    We investigate the quantum confined Stark effect (QCSE) of various nanoparticles (NPs) on the single molecule level at room temperature. We tested 8 different NPs with different geometry, material composition and electronic structure, and measured their QCSE by single molecule spectroscopy. This study reveals that suppressing the Coulomb interaction force between electron and hole by asymmetric type-II interface is critical for an enhanced QCSE. For example, ZnSe-CdS and CdSe(Te)-CdS-CdZnSe asymmetric nanorods (type-II) display respectively twice and more than three times larger QCSE than that of simple type-I nanorods (CdSe). In addition, wavelength blue-shift of QCSE and roughly linear Δλ-F (emission wavelength shift vs. the applied electric field) relation are observed for the type-II nanorods. Experimental results (Δλ-F or ΔE-F) are successfully reproduced by self-consistent quantum mechanical calculation. Intensity reduction in blue-shifted spectrum is also accounted for. Both calculations and experiments suggest that the magnitude of the QCSE is predominantly determined by the degree of initial charge separation in these structures.

  7. A multifunctional fluorescence sensor for Cd2+, PO43- and Cr3+ in different system and the practical application.

    PubMed

    Wang, Qingming; Tan, Yingzi; Wang, Nianhua; Lu, Zhixiang; Wang, Wenling

    2018-05-07

    A fluorescence probe based on thiosemicarbazide has been synthesized and well characterized by 1 H NMR, 13 C NMR, Elemental analysis, Electrospray ionization mass spectra. The probe 1 functions as a multitarget ion sensor, detect biologically and ecologically important Cd 2+ , PO 4 3- and Cr 3+ . Meanwhile, probe 1 displays selectivity for Cd 2+ over other metal ions and anions in DMF by emission spectrum. Interestingly, probe 1 has been explored to recognize PO 4 3- in CH 3 OH-H 2 O (v:v = 1:9). The binding stoichiometry of probe 1 with Cd 2+ and PO 4 3- are 2:1 and 1:1, respectively, which are confirmed by Electrospray ionization mass spectra. Probe 1 is selective, sensitive and reversibility/reusability to Cd 2+ and PO 4 3- with the detection limit as low as 0.035 μM and 0.011 μM respectively. Besides, the designed probe 1 has shown potential applications in the area of photo-printing. Copyright © 2018. Published by Elsevier B.V.

  8. Structure-Based Design of a Small Molecule CD4-Antagonist with Broad Spectrum Anti-HIV-1 Activity

    DOE PAGES

    Curreli, Francesca; Kwon, Young Do; Zhang, Hongtao; ...

    2015-08-24

    Earlier we reported the discovery and design of NBD-556 and their analogs which demonstrated their potential as HIV-1 entry inhibitors. However, progress in developing these inhibitors has been stymied by their CD4-agonist properties, an unfavorable trait for use as drug. Here in this paper, we demonstrate the successful conversion of a full CD4-agonist (NBD-556) through a partial CD4-agonist (NBD-09027), to a full CD4-antagonist (NBD-11021) by structure-based modification of the critical oxalamide midregion, previously thought to be intolerant of modification. NBD-11021 showed unprecedented neutralization breath for this class of inhibitors, with pan-neutralization against a panel of 56 Env-pseudotyped HIV-1 representing diversemore » subtypes of clinical isolates (IC 50 as low as 270 nM). The cocrystal structure of NBD-11021 complexed to a monomeric HIV-1 gp120 core revealed its detail binding characteristics. The study is expected to provide a framework for further development of NBD series as HIV-1 entry inhibitors for clinical application against AIDS.« less

  9. Structure-Based Design of a Small Molecule CD4-Antagonist with Broad Spectrum Anti-HIV-1 Activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Curreli, Francesca; Kwon, Young Do; Zhang, Hongtao

    Earlier we reported the discovery and design of NBD-556 and their analogs which demonstrated their potential as HIV-1 entry inhibitors. However, progress in developing these inhibitors has been stymied by their CD4-agonist properties, an unfavorable trait for use as drug. Here in this paper, we demonstrate the successful conversion of a full CD4-agonist (NBD-556) through a partial CD4-agonist (NBD-09027), to a full CD4-antagonist (NBD-11021) by structure-based modification of the critical oxalamide midregion, previously thought to be intolerant of modification. NBD-11021 showed unprecedented neutralization breath for this class of inhibitors, with pan-neutralization against a panel of 56 Env-pseudotyped HIV-1 representing diversemore » subtypes of clinical isolates (IC 50 as low as 270 nM). The cocrystal structure of NBD-11021 complexed to a monomeric HIV-1 gp120 core revealed its detail binding characteristics. The study is expected to provide a framework for further development of NBD series as HIV-1 entry inhibitors for clinical application against AIDS.« less

  10. Supramolecular Inclusion in Cyclodextrins: A Pictorial Spectroscopic Demonstration

    ERIC Educational Resources Information Center

    Haldar, Basudeb; Mallick, Arabinda; Chattopadhyay, Nitin

    2008-01-01

    A spectroscopic experiment is presented that reveals that the hydrophobically end-modified water-soluble polymeric fluorophore, pyrene end-capped poly(ethylene oxide) (PYPY), interacts differently with [alpha], [beta], and [gamma]-cyclodextrins (CD) to form supramolecular inclusion complexes. The emission spectrum of PYPY in aqueous solution shows…

  11. Optical and structural properties of plasma-treated Cordyceps bassiana spores as studied by circular dichroism, absorption, and fluorescence spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Geon Joon, E-mail: gjlee@kw.ac.kr; Sim, Geon Bo; Choi, Eun Ha

    To understand the killing mechanism of fungal spores by plasma treatment, the optical, structural, and biological properties of the insect pathogenic fungus Cordyceps bassiana spores were studied. A nonthermal atmospheric-pressure plasma jet (APPJ) was used to treat the spores in aqueous solution. Optical emission spectra of the APPJ acquired in air indicated emission peaks corresponding to hydroxyl radicals and atomic oxygen. When the APPJ entered the aqueous solution, additional reactive species were derived from the interaction of plasma radicals with the aqueous solution. Fluorescence and absorption spectroscopy confirmed the generation of hydroxyl radicals and hydrogen peroxide in the plasma-activated watermore » (PAW). Spore counting showed that plasma treatment significantly reduced spore viability. Absorption spectroscopy, circular dichroism (CD) spectroscopy, and agarose gel electrophoresis of the DNA extracted from plasma-treated spores showed a reduction in spore DNA content. The magnitude of the dip in the CD spectrum was lower in the plasma-treated spores than in the control, indicating that plasma treatment causes structural modifications and/or damage to cellular components. Tryptophan fluorescence intensity was lower in the plasma-treated spores than in the control, suggesting that plasma treatment modified cell wall proteins. Changes in spore viability and DNA content were attributed to structural modification of the cell wall by reactive species coming from the APPJ and the PAW. Our results provided evidence that the plasma radicals and the derived reactive species play critical roles in fungal spore inactivation.« less

  12. Optical and structural properties of plasma-treated Cordyceps bassiana spores as studied by circular dichroism, absorption, and fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Lee, Geon Joon; Sim, Geon Bo; Choi, Eun Ha; Kwon, Young-Wan; Kim, Jun Young; Jang, Siun; Kim, Seong Hwan

    2015-01-01

    To understand the killing mechanism of fungal spores by plasma treatment, the optical, structural, and biological properties of the insect pathogenic fungus Cordyceps bassiana spores were studied. A nonthermal atmospheric-pressure plasma jet (APPJ) was used to treat the spores in aqueous solution. Optical emission spectra of the APPJ acquired in air indicated emission peaks corresponding to hydroxyl radicals and atomic oxygen. When the APPJ entered the aqueous solution, additional reactive species were derived from the interaction of plasma radicals with the aqueous solution. Fluorescence and absorption spectroscopy confirmed the generation of hydroxyl radicals and hydrogen peroxide in the plasma-activated water (PAW). Spore counting showed that plasma treatment significantly reduced spore viability. Absorption spectroscopy, circular dichroism (CD) spectroscopy, and agarose gel electrophoresis of the DNA extracted from plasma-treated spores showed a reduction in spore DNA content. The magnitude of the dip in the CD spectrum was lower in the plasma-treated spores than in the control, indicating that plasma treatment causes structural modifications and/or damage to cellular components. Tryptophan fluorescence intensity was lower in the plasma-treated spores than in the control, suggesting that plasma treatment modified cell wall proteins. Changes in spore viability and DNA content were attributed to structural modification of the cell wall by reactive species coming from the APPJ and the PAW. Our results provided evidence that the plasma radicals and the derived reactive species play critical roles in fungal spore inactivation.

  13. Coeliac disease screening is suboptimal in a tertiary gastroenterology setting.

    PubMed

    Iskandar, Heba; Gray, Darrell M; Vu, Hongha; Mirza, Faiz; Rude, Mary Katherine; Regan, Kara; Abdalla, Adil; Gaddam, Srinivas; Almaskeen, Sami; Mello, Michael; Marquez, Evelyn; Meyer, Claire; Bolkhir, Ahmed; Kanuri, Navya; Sayuk, Gregory; Gyawali, C Prakash

    2017-08-01

    Coeliac disease (CD) is widely prevalent in North America, but case-finding techniques currently used may not be adequate for patient identification. We aimed to determine the adequacy of CD screening in an academic gastroenterology (GI) practice. Consecutive initial visits to a tertiary academic GI practice were surveyed over a 3-month period as a fellow-initiated quality improvement project. All electronic records were reviewed to look for indications for CD screening according to published guidelines. The timing of screening was noted (before or after referral), as well as the screening method (serology or biopsy). Data were analysed to compare CD screening practices across subspecialty clinics. 616 consecutive patients (49±0.6 years, range 16-87 years, 58.5% females, 94% Caucasian) fulfilled inclusion criteria. CD testing was indicated in 336 (54.5%), but performed in only 145 (43.2%). The need for CD screening was highest in luminal GI and inflammatory bowel disease clinics, followed by biliary and hepatology clinics (p<0.0001); CD screening rate was highest in the luminal GI clinic (p=0.002). Of 145 patients screened, 4 patients (2.4%) had serology consistent with CD, of which 2 were proven by duodenal biopsy. Using this proportion, an additional 5 patients might have been diagnosed in 191 untested patients with indications for CD screening. More than 50% of patients in a tertiary GI clinic have indications for CD screening, but <50% of indicated cases are screened. Case-finding techniques therefore are suboptimal, constituting a gap in patient care and an important target for future quality improvement initiatives. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Identification of contact sites between ankyrin and band 3 in the human erythrocyte membrane.

    PubMed

    Grey, Jesse L; Kodippili, Gayani C; Simon, Katya; Low, Philip S

    2012-08-28

    The red cell membrane is stabilized by a spectrin/actin-based cortical cytoskeleton connected to the phospholipid bilayer via multiple protein bridges. By virtue of its interaction with ankyrin and adducin, the anion transporter, band 3 (AE1), contributes prominently to these bridges. In a previous study, we demonstrated that an exposed loop comprising residues 175-185 of the cytoplasmic domain of band 3 (cdB3) constitutes a critical docking site for ankyrin on band 3. In this paper, we demonstrate that an adjacent loop, comprising residues 63-73 of cdB3, is also essential for ankyrin binding. Data that support this hypothesis include the following. (1) Deletion or mutation of residues within the latter loop abrogates ankyrin binding without affecting cdB3 structure or its other functions. (2) Association of cdB3 with ankyrin is inhibited by competition with the loop peptide. (3) Resealing of the loop peptide into erythrocyte ghosts alters membrane morphology and stability. To characterize cdB3-ankyrin interaction further, we identified their interfacial contact sites using molecular docking software and the crystal structures of D(3)D(4)-ankyrin and cdB3. The best fit for the interaction reveals multiple salt bridges and hydrophobic contacts between the two proteins. The most important ion pair interactions are (i) cdB3 K69-ankyrin E645, (ii) cdB3 E72-ankyrin K611, and (iii) cdB3 D183-ankyrin N601 and Q634. Mutation of these four residues on ankyrin yielded an ankyrin with a native CD spectrum but little or no affinity for cdB3. These data define the docking interface between cdB3 and ankyrin in greater detail.

  15. Identification of contact sites between ankyrin and band 3 in the human erythrocyte membrane

    PubMed Central

    Grey, Jesse L.; Kodippili, Gayani C.; Simon, Katya; Low, Philip S.

    2012-01-01

    The red cell membrane is stabilized by a spectrin/actin-based cortical cytoskeleton connected to the phospholipid-bilayer via multiple protein bridges. By virtue of its interaction with ankyrin and adducin, the anion transporter, band 3 (AE1), contributes prominently to these bridges. In a previous study, we demonstrated that an exposed loop comprising residues 175–185 of the cytoplasmic domain of band 3 (cdB3) constitutes a critical docking site for ankyrin on band 3. In this paper, we demonstrate that an adjacent loop, comprising residues 63–73 of cdB3, is also essential for ankyrin binding. Data in support of this hypothesis include: 1) deletion or mutation of residues within the latter loop abrogates ankyrin binding without affecting cdB3 structure or its other functions, 2) association of cdB3 with ankyrin is inhibited by competition with the loop peptide, and 3) resealing of the loop peptide into erythrocyte ghosts alters membrane morphology and stability. To characterize cdB3-ankyrin interaction further, we identified their interfacial contact sites using molecular docking software and the crystal structures of D3D4-ankyrin and cdB3. The best fit for the interaction reveals multiple salt bridges and hydrophobic contacts between the two proteins. The most important ion pair interactions are: i) cdB3 K69 to ankyrin E645, ii) cdB3 E72 to ankyrin K611, and iii) cdB3 D183 to ankyrin N601 and Q634. Mutation of the above four residues on ankyrin yielded an ankyrin with native CD spectrum, but little or no affinity for cdB3. These data define the docking interface between cdB3 and ankyrin in greater detail. PMID:22861190

  16. Thick-foils activation technique for neutron spectrum unfolding with the MINUIT routine-Comparison with GEANT4 simulations

    NASA Astrophysics Data System (ADS)

    Vagena, E.; Theodorou, K.; Stoulos, S.

    2018-04-01

    Neutron activation technique has been applied using a proposed set of twelve thick metal foils (Au, As, Cd, In, Ir, Er, Mn, Ni, Se, Sm, W, Zn) for off-site measurements to obtain the neutron spectrum over a wide energy range (from thermal up to a few MeV) in intense neutron-gamma mixed fields such as around medical Linacs. The unfolding procedure takes into account the activation rates measured using thirteen (n , γ) and two (n , p) reactions without imposing a guess solution-spectrum. The MINUIT minimization routine unfolds a neutron spectrum that is dominated by fast neutrons (70%) peaking at 0.3 MeV, while the thermal peak corresponds to the 15% of the total neutron fluence equal to the epithermal-resonances area. The comparison of the unfolded neutron spectrum against the simulated one with the GEANT4 Monte-Carlo code shows a reasonable agreement within the measurement uncertainties. Therefore, the proposed set of activation thick-foils could be a useful tool in order to determine low flux neutrons spectrum in intense mixed field.

  17. Preparation of cauliflower-like CdS/ZnS/ZnO nanostructure and its photoelectric properties

    NASA Astrophysics Data System (ADS)

    Liu, Zhifeng; Guo, Keying; Wang, Yun; Zheng, Xuerong; Ya, Jing; Li, Junwei; Han, Li; Liu, Zhichao; Han, Jianhua

    2014-06-01

    Cauliflower-like CdS/ZnS/ZnO nanostructure is fabricated via a simple hydrothermal method. Factors such as concentration of reaction solution, reaction temperature, as well as reaction time in the synthetic process are investigated, and the working mechanism of the nanostructure is suggested. Hydrogen generation efficiency of 4.69 % at 0.29 V versus saturated calomel electrode is achieved using synthesized nanostructure as electrode due to the improved absorption and appropriate energy gap structure, which is confirmed by enhanced absorption spectrum. The expected products have potential application in photoelectrochemical water splitting.

  18. Excitation-Power Dependence of the Near Band-Edge PL Spectra of CdMnTe with High Mn Concentrations

    NASA Astrophysics Data System (ADS)

    Hwang, Younghun; Um, Youngho; Park, Hyoyeol

    2011-12-01

    Temperature and excitation power dependences of photoluminescence (PL) measurements were studied for the CdMnTe crystal grown by the vertical Bridgman method. The near band-edge and intra-Mn2+ emissions were investigated as a function of temperature. The observed band-edge peak of the PL spectrum showed a clear blue-shift with decreasing temperature. However, the peak energy of the intra-Mn2+ transition did not decrease monotonically with changing temperature, as can be seen above 70 K. With increasing the excitation power, the intensity of the emission peak was increased.

  19. Evaluation of Low Melting Halide Systems for Battery Applications.

    DTIC Science & Technology

    1983-04-01

    prominent peak at 95 cm-1 . The spectrum of the other sample exhibits 124 -4 ,4 -4 -44 .. t - CD - 0o - N. 0 uN C)(j QCD oca CD u C 125. the same peaks... lattice with 6-fold coordination about in this region can be drawn. However. his isotherms have aluminum and melts at 192.4 ’C with a AH° of 35.3 kJ the...temperature in the composition of SbC.AICI is favored by the relatively large direction of increasing aluminum bromide content. just as lattice energy of

  20. A Diffusive Gradient-in-Thin-Film Technique for Evaluation of the Bioavailability of Cd in Soil Contaminated with Cd and Pb

    PubMed Central

    Wang, Peifang; Wang, Teng; Yao, Yu; Wang, Chao; Liu, Cui; Yuan, Ye

    2016-01-01

    Management of heavy metal contamination requires accurate information about the distribution of bioavailable fractions, and about exchange between the solid and solution phases. In this study, we employed diffusive gradients in thin-films (DGT) and traditional chemical extraction methods (soil solution, HOAc, EDTA, CaCl2, and NaOAc) to determine the Cd bioavailability in Cd-contaminated soil with the addition of Pb. Two typical terrestrial species (wheat, Bainong AK58; maize, Zhengdan 958) were selected as the accumulation plants. The results showed that the added Pb may enhance the efficiency of Cd phytoextraction which is indicated by the increasing concentration of Cd accumulating in the plant tissues. The DGT-measured Cd concentrations and all the selected traditional extractants measured Cd concentrations all increased with increasing concentration of the addition Pb which were similar to the change trends of the accumulated Cd concentrations in plant tissues. Moreover, the Pearson regression coefficients between the different indicators obtained Cd concentrations and plants uptake Cd concentrations were further indicated significant correlations (p < 0.01). However, the values of Pearson regression coefficients showed the merits of DGT, CaCl2, and Csol over the other three methods. Consequently, the in situ measurement of DGT and the ex situ traditional methods could all reflect the inhibition effects between Cd and Pb. Due to the feature of dynamic measurements of DGT, it could be a robust tool to predict Cd bioavaiability in complex contaminated soil. PMID:27271644

  1. CD147 and CD98 complex-mediated homotypic aggregation attenuates the CypA-induced chemotactic effect on Jurkat T cells.

    PubMed

    Guo, Na; Zhang, Kui; Lv, Minghua; Miao, Jinlin; Chen, Zhinan; Zhu, Ping

    2015-02-01

    Homotypic cell aggregation plays important roles in physiological and pathological processes, including embryogenesis, immune responses, angiogenesis, tumor cell invasion and metastasis. CD147 has been implicated in most of these phenomena, and it was identified as a T cell activation-associated antigen due to its obvious up-regulation in activated T cells. However, the explicit function and mechanism of CD147 in T cells have not been fully elucidated. In this study, large and compact aggregates were observed in Jurkat T cells after treatment with the specific CD147 monoclonal antibody HAb18 or after the expression of CD147 was silenced by RNA interference, which indicated an inhibitory effect of CD147 in T cell homotypic aggregation. Knocking down CD147 expression resulted in a significant decrease in CD98, along with prominent cell aggregation, similar to that treated by CD98 and CD147 monoclonal antibodies. Furthermore, decreased cell chemotactic activity was observed following CD147- and CD98-mediated cell aggregation, and increased aggregation was correlated with a decrease in the chemotactic ability of the Jurkat T cells, suggesting that CD147- and CD98-mediated homotypic cell aggregation plays a negative role in T cell chemotaxis. Our data also showed that p-ERK, p-ZAP70, p-CD3ζ and p-LCK were significantly decreased in the CD147- and CD98-knocked down Jurkat T cells, which suggested that decreased CD147- and/or CD98-induced homotypic T cell aggregation and aggregation-inhibited chemotaxis might be associated with these signaling pathways. A role for CD147 in cell aggregation and chemotaxis was further indicated in primary CD4(+) T cells. Similarly, low expression of CD147 in primary T cells induced prominent cell aggregation and this aggregation attenuated primary T cell chemotactic ability in response to CypA. Our results have demonstrated the correlation between homotypic cell aggregation and the chemotactic response of T cells to CypA, and these data indicate that CD147 and CD98 might play important roles in cyclophilin-induced cell migration. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Elucidation of solution state complexation in wet-granulated oven-dried ibuprofen and beta-cyclodextrin: FT-IR and 1H-NMR studies.

    PubMed

    Ghorab, M K; Adeyeye, M C

    2001-08-01

    The effect of oven-dried wet granulation on the complexation of beta-cyclodextrin with ibuprofen (IBU) in solution was investigated using Fourier transform infrared spectroscopy (FT-IR), proton nuclear magnetic resonance (1H NMR), and molecular modeling. Granulation was carried out using 5 mL of three different granulating solvents; water, ethanol (95% v/v), and isopropanol and the granules were oven-dried at 60 degrees C for 2 h. The granules were compared to oven-dried physical mixture and conventionally prepared complex. Phase solubility study was performed to investigate the stability of the granulation-formed complexes in solution. FT-IR was used to examine the complexation in the granules while 1H NMR, and molecular modeling studies were carried out to determine the mechanism of complexation in the water-prepared granules. The solubility studies suggested a 1:1 complex between IBU and betaCD. It also showed that the stability of the complex in solution was in the following order with respect to the granulating solvents: ethanol > water > isopropanol. The FT-IR study revealed a shift in the carboxylic acid stretching band and decrease in the intensities of the C-H bending bands of the isopropyl group and the out-of-plane aromatic ring, of IBU, in granules compared to the oven-dried physical mixture. This indicated that granules might have some extent of solid state complexation that could further enhance dissolution and the IBU-betaCD solution state complexation. 1H NMR showed that water prepared oven-dried granules had a different 1H NMR spectrum compared to similarly made oven-dried physical mixture, indicative of complexation in the former. The 1H NMR and the molecular modeling studies together revealed that solution state complexation from the granules occurred by inclusion of the isopropyl group together with part of the aromatic ring of IBU into the betaCD cavity probably through its wider side. These results indicate that granulation process induced faster complexation in solution which enhances the solubility and the dissolution rate of poorly soluble drugs. The extent of complexation in the granules was dependent on the type of solvent used.

  3. An alternative resource sharing scheme for land mobile satellite services

    NASA Technical Reports Server (NTRS)

    Yan, Tsun-Yee; Sue, Miles K.

    1990-01-01

    A preliminary comparison between the two competing channelization concepts for the Land Mobile Satellite Services (LMSS), namely frequency division (FD) and code division (CD), is presented. Both random access and demand-assigned approaches are considered under these concepts. The CD concept is compared with the traditional FD concept based on the system consideration and a projected traffic model. It is shown that CD is not particularly attractive for the first generation Mobile Satellite Services because of the spectral occupancy of the network bandwidth. However, the CD concept is a viable alternative for future systems such as the personal access satellite system (PASS) in the Ka-band spectrum where spectral efficiency is not of prime concern. The effects of power robbing and voice activity factor are incorporated. It was shown that the traditional rule of thumb of dividing the number of raw channels by the voice activity factor to obtain the effective number of channels is only valid asymptotically as the aggregated traffic approaches infinity.

  4. Transparent and conductive indium doped cadmium oxide thin films prepared by pulsed filtered cathodic arc deposition

    DOE PAGES

    Zhu, Yuankun; Mendelsberg, Rueben J.; Zhu, Jiaqi; ...

    2012-11-26

    Indium doped cadmium oxide (CdO:In) films with different In concentrations were prepared on low-cost glass substrates by pulsed filtered cathodic arc deposition (PFCAD). In this study, it is shown that polycrystalline CdO:In films with smooth surface and dense structure are obtained. In-doping introduces extra electrons leading to remarkable improvements of electron mobility and conductivity, as well as improvement in the optical transmittance due to the Burstein Moss effect. CdO:In films on glass substrates with thickness near 230 nm show low resistivity of 7.23 x 10 -5 Ωcm, high electron mobility of 142 cm 2/Vs, and mean transmittance over 80% frommore » 500-1250 nm (including the glass substrate). These high quality pulsed arc-grown CdO:In films are potentially suitable for high efficiency multi-junction solar cells that harvest a broad range of the solar spectrum.« less

  5. Photosensitization of ZnO nanowires with CdSe quantum dots for photovoltaic devices.

    PubMed

    Leschkies, Kurtis S; Divakar, Ramachandran; Basu, Joysurya; Enache-Pommer, Emil; Boercker, Janice E; Carter, C Barry; Kortshagen, Uwe R; Norris, David J; Aydil, Eray S

    2007-06-01

    We combine CdSe semiconductor nanocrystals (or quantum dots) and single-crystal ZnO nanowires to demonstrate a new type of quantum-dot-sensitized solar cell. An array of ZnO nanowires was grown vertically from a fluorine-doped tin oxide conducting substrate. CdSe quantum dots, capped with mercaptopropionic acid, were attached to the surface of the nanowires. When illuminated with visible light, the excited CdSe quantum dots injected electrons across the quantum dot-nanowire interface. The morphology of the nanowires then provided the photoinjected electrons with a direct electrical pathway to the photoanode. With a liquid electrolyte as the hole transport medium, quantum-dot-sensitized nanowire solar cells exhibited short-circuit currents ranging from 1 to 2 mA/cm2 and open-circuit voltages of 0.5-0.6 V when illuminated with 100 mW/cm2 simulated AM1.5 spectrum. Internal quantum efficiencies as high as 50-60% were also obtained.

  6. An alternative resource sharing scheme for land mobile satellite services

    NASA Astrophysics Data System (ADS)

    Yan, Tsun-Yee; Sue, Miles K.

    A preliminary comparison between the two competing channelization concepts for the Land Mobile Satellite Services (LMSS), namely frequency division (FD) and code division (CD), is presented. Both random access and demand-assigned approaches are considered under these concepts. The CD concept is compared with the traditional FD concept based on the system consideration and a projected traffic model. It is shown that CD is not particularly attractive for the first generation Mobile Satellite Services because of the spectral occupancy of the network bandwidth. However, the CD concept is a viable alternative for future systems such as the personal access satellite system (PASS) in the Ka-band spectrum where spectral efficiency is not of prime concern. The effects of power robbing and voice activity factor are incorporated. It was shown that the traditional rule of thumb of dividing the number of raw channels by the voice activity factor to obtain the effective number of channels is only valid asymptotically as the aggregated traffic approaches infinity.

  7. On Use of Multi-Chambered Fission Detectors for In-Core, Neutron Spectroscopy

    NASA Astrophysics Data System (ADS)

    Roberts, Jeremy A.

    2018-01-01

    Presented is a short, computational study on the potential use of multichambered fission detectors for in-core, neutron spectroscopy. Motivated by the development of very small fission chambers at CEA in France and at Kansas State University in the U.S., it was assumed in this preliminary analysis that devices can be made small enough to avoid flux perturbations and that uncertainties related to measurements can be ignored. It was hypothesized that a sufficient number of chambers with unique reactants can act as a real-time, foilactivation experiment. An unfolding scheme based on maximizing (Shannon) entropy was used to produce a flux spectrum from detector signals that requires no prior information. To test the method, integral, detector responses were generated for singleisotope detectors of various Th, U, Np, Pu, Am, and Cs isotopes using a simplified, pressurized-water reactor spectrum and fluxweighted, microscopic, fission cross sections, in the WIMS-69 multigroup format. An unfolded spectrum was found from subsets of these responses that had a maximum entropy while reproducing the responses considered and summing to one (that is, they were normalized). Several nuclide subsets were studied, and, as expected, the results indicate inclusion of more nuclides leads to better spectra but with diminishing improvements, with the best-case spectrum having an average, relative, group-wise error of approximately 51%. Furthermore, spectra found from minimum-norm and Tihkonov-regularization inversion were of lower quality than the maximum entropy solutions. Finally, the addition of thermal-neutron filters (here, Cd and Gd) provided substantial improvement over unshielded responses alone. The results, as a whole, suggest that in-core, neutron spectroscopy is at least marginally feasible.

  8. Hyperspectral estimation of soil heavy metals in Guanzhong area, Shaanxi province

    NASA Astrophysics Data System (ADS)

    Liu, Jinbao; Cheng, Jie; Wang, Huanyuan; Tong, Wei; Ma, Zenghui

    2017-10-01

    In this study, the contents of Cr, Mn, Ni, Cu, and Zn, As, Cd, Hg and Pub in 44 soil samples were collected from Fufeng County, Yangling County and Wugong County, Shaanxi Province and were used as data sources. ASD Field Spec HR (350 ˜ 2500 nm), and then the NOR, MSC and SNV of the reflectance were pretreated, the first deviation, second deviation and reflectance reciprocal logarithmic transformation were carried out. The optimal hyper spectral estimation model of nine heavy metal elements of Cr, Mn, Ni, Cu, and Zn, As, Cd, Hg and Pb was established by regression method. Comparing the reflection characteristics of different heavy metal contents and the effect of different pretreatment methods on the establishment of soil heavy metal spectral inversion model. The results show that: (1) the reflectance spectrum improves the signal-to-noise ratio of the reflectance spectrum after the transformation of NOR, MSC and SNV. Combining differential transformation can improve the information of heavy metal elements in the soil, and use the correlation band energy significantly improve the stability and predictability of the model. (2) The modeling accuracy of the optimal model of nine heavy metal spectra of Cr, Mn, Ni, Cu, and Zn, As, Cd, Hg and Pb by PLSR method were 0.7002, 0.7852, 0.687, 0.8036, 0.8619, 0.5765, 0.5451, 0.9912, and 0.6182.

  9. Chemical Analysis of a Carbon-enhanced Very Metal-poor Star: CD-27 14351

    NASA Astrophysics Data System (ADS)

    Karinkuzhi, Drisya; Goswami, Aruna; Masseron, Thomas

    2017-01-01

    We present, for the first time, an abundance analysis of a very metal-poor carbon-enhanced star CD-27 14351 based on a high-resolution (R ˜ 48,000) FEROS spectrum. Our abundance analysis performed using local thermodynamic equilibrium model atmospheres shows that the object is a cool star with stellar atmospheric parameters, effective temperature Teff = 4335 K, surface gravity log g = 0.5, microturbulence ξ = 2.42 km s-1, and metallicity [Fe/H] = -2.6. The star exhibits high carbon and nitrogen abundances with [C/Fe] = 2.89 and [N/Fe] = 1.89. Overabundances of neutron-capture elements are evident in Ba, La, Ce, and Nd, with estimated [X/Fe] > 1, the largest enhancement being seen in Ce with [Ce/Fe] = 2.63. While the first peak s-process elements Sr and Y are found to be enhanced with respect to Fe, ([Sr/Fe] = 1.73 and [Y/Fe] = 1.91), the third peak s-process element Pb could not be detected in our spectrum at the given resolution. Europium, primarily an r-process element also shows an enhancement with [Eu/Fe] = 1.65. With [Ba/Eu] = 0.12, the object CD-27 14351 satisfies the classification criterion for a CEMP-r/s star. The elemental abundance distributions observed in this star are discussed in light of the chemical abundances observed in other CEMP stars in the literature.

  10. Viral Infection of Tumors Overcomes Resistance to PD-1-immunotherapy by Broadening Neoantigenome-directed T-cell Responses.

    PubMed

    Woller, Norman; Gürlevik, Engin; Fleischmann-Mundt, Bettina; Schumacher, Anja; Knocke, Sarah; Kloos, Arnold M; Saborowski, Michael; Geffers, Robert; Manns, Michael P; Wirth, Thomas C; Kubicka, Stefan; Kühnel, Florian

    2015-10-01

    There is evidence that viral oncolysis is synergistic with immune checkpoint inhibition in cancer therapy but the underlying mechanisms are unclear. Here, we investigated whether local viral infection of malignant tumors is capable of overcoming systemic resistance to PD-1-immunotherapy by modulating the spectrum of tumor-directed CD8 T-cells. To focus on neoantigen-specific CD8 T-cell responses, we performed transcriptomic sequencing of PD-1-resistant CMT64 lung adenocarcinoma cells followed by algorithm-based neoepitope prediction. Investigations on neoepitope-specific T-cell responses in tumor-bearing mice demonstrated that PD-1 immunotherapy was insufficient whereas viral oncolysis elicited cytotoxic T-cell responses to a conserved panel of neoepitopes. After combined treatment, we observed that PD-1-blockade did not affect the magnitude of oncolysis-mediated antitumoral immune responses but a broader spectrum of T-cell responses including additional neoepitopes was observed. Oncolysis of the primary tumor significantly abrogated systemic resistance to PD-1-immunotherapy leading to improved elimination of disseminated lung tumors. Our observations were confirmed in a transgenic murine model of liver cancer where viral oncolysis strongly induced PD-L1 expression in primary liver tumors and lung metastasis. Furthermore, we demonstrated that combined treatment completely inhibited dissemination in a CD8 T-cell-dependent manner. Therefore, our results strongly recommend further evaluation of virotherapy and concomitant PD-1 immunotherapy in clinical studies.

  11. Immunohistochemical investigation of the cross-reactivity of selected cell markers in formalin-fixed, paraffin-embedded lymphoid tissues of Franciscana (Pontoporia blainvillei).

    PubMed

    Díaz-Delgado, J; Ressio, R; Groch, K R; Catão-Dias, J L

    2018-06-01

    A considerable amount of knowledge on natural and anthropogenic pathologic conditions affecting different cetacean species has been gained over the last decades. Nonetheless, the immunopathological bases for most of these processes have been poorly documented or remain unknown. Comparative immunopathological investigations in these species are precluded by the limited number of specific antibodies, most of which are not commercially available, and the reduced spectrum of validated and/or cross-reactive ones. To partially fill in this gap of knowledge, a set of commercially available primary antibodies were tested for cross-reactivity against leukocytes and cytokines in formalin-fixed, paraffin-embedded (FFPE) lymphoid tissues (lymph nodes, spleen and thymus) of three bycaught, apparently healthy and fresh Franciscanas (Pontoporia blainvillei) using immunohistochemistry. On the basis of similar region specificity within the lymphoid organs, cellular morphology and staining pattern with human control tissues, 13/19 primary antibodies (caspase 3, CD3, CD57, CD68, FoxP3, HLA-DRα, IFNγ, IgG, IL4, IL10, Lysozyme, TGFβ and PAX-5) exhibited satisfactory cross-reactivity. Our results expand the spectrum of suitable cross-reactive primary antibodies in FFPE cetacean tissues. Further comparative immunopathological studies focused on infectious diseases and ecotoxicology may benefit from establishment of baseline expression of immunologically relevant molecules in various cetaceans species. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Joint toxicity of methamidophos and cadmium acting on Abelmoschus manihot.

    PubMed

    Wang, Xiao-Fei; Zhou, Qi-Xing

    2005-01-01

    Joint toxicity of methamidophos and cadmium (Cd) on the ornamental Abelmoschus manihot was firstly examined and compared with single-factor effects of the two pollutants using ecotoxicological indexes including the inhibitory rate of seed germination, root elongation and inhibitory concentration 50% (IC50). The results indicated that methamidophos and Cd had unobvious( p > 0.05) effects on seed germination of the ornamental. There were significant( p < 0.05) inhibitory effects of Cd on root elongation of the tested plant. When the concentration of added Cd was low( < 20 mg/L), significant antagonistic effects on root elongation were observed. And synergic effects were observed when Cd was added in high dose( > 20 mg/L). However, the analysis of joint effects indicated that there were antagonistic effects between Cd and methamidophos under all the treatments. At the high concentration of Cd, joint toxicity of methamidophos and Cd was more dependent on concentration of Cd.

  13. Microbial activity and community diversity in a variable charge soil as affected by cadmium exposure levels and time*

    PubMed Central

    Shentu, Jia-li; He, Zhen-li; Yang, Xiao-e; Li, Ting-qiang

    2008-01-01

    Effects of cadmium (Cd) on microbial biomass, activity and community diversity were assessed in a representative variable charge soil (Typic Aquult) using an incubation study. Cadmium was added as Cd(NO3)2 to reach a concentration range of 0~16 mg Cd/kg soil. Soil extractable Cd generally increased with Cd loading rate, but decreased with incubation time. Soil microbial biomass was enhanced at low Cd levels (0.5~1 mg/kg), but was inhibited consistently with increasing Cd rate. The ratio of microbial biomass C/N varied with Cd treatment levels, decreasing at low Cd rate (<0.7 mg/kg available Cd), but increasing progressively with Cd loading. Soil respiration was restrained at low Cd loading (<1 mg/kg), and enhanced at higher Cd levels. Soil microbial metabolic quotient (MMQ) was generally greater at high Cd loading (1~16 mg/kg). However, the MMQ is also affected by other factors. Cd contamination reduces species diversity of soil microbial communities and their ability to metabolize different C substrates. Soils with higher levels of Cd contamination showed decreases in indicator phospholipids fatty acids (PLFAs) for Gram-negative bacteria and actinomycetes, while the indicator PLFAs for Gram-positive bacteria and fungi increased with increasing levels of Cd contamination. PMID:18357628

  14. Estimation of construction and demolition waste volume generation in new residential buildings in Spain.

    PubMed

    Villoria Sáez, Paola; del Río Merino, Mercedes; Porras-Amores, César

    2012-02-01

    The management planning of construction and demolition (C&D) waste uses a single indicator which does not provide enough detailed information. Therefore the determination and implementation of other innovative and precise indicators should be determined. The aim of this research work is to improve existing C&D waste quantification tools in the construction of new residential buildings in Spain. For this purpose, several housing projects were studied to determine an estimation of C&D waste generated during their construction process. This paper determines the values of three indicators to estimate the generation of C&D waste in new residential buildings in Spain, itemizing types of waste and construction stages. The inclusion of two more accurate indicators, in addition to the global one commonly in use, provides a significant improvement in C&D waste quantification tools and management planning.

  15. Sandwiched ZnO@Au@CdS nanorod arrays with enhanced visible-light-driven photocatalytical performance

    NASA Astrophysics Data System (ADS)

    Ren, Shoutian; Wang, Yingying; Fan, Guanghua; Gao, Renxi; Liu, Wenjun

    2017-11-01

    The development of high-performance photocatalysts is central to efforts focused on taking advantage of solar energy to overcome environmental and energy crises. Integrating different functional materials artfully into nanostructures can deliver more efficient photocatalytic activity. Here, sandwiched ZnO@Au@CdS nanorod films were synthesized via successive ZnO nanorod electrodeposition, Au sputtering and CdS electrodeposition. The as-synthesized composites were characterized by UV-vis spectrophotometer, x-ray diffractometer, scanning and transmission electron microscopy. Their photocatalytic activity was assessed by degrading Rhodamine B solution under visible light irradiation. ZnO@Au@CdS exhibited better photocatalytic performance than ZnO@CdS throughout the visible light region, and the corresponding enhancement factor of Au nanoparticles was measured as a function of CdS loading amount, and it could reach 190% with CdS deposition for 1 min. The normalized rate constant could reach 0.387 h-1 for ZnO@Au@CdS-1min, which was equivalent to or better than results in reference photocatalysts. The enhancement mechanism of Au nanoparticles was estimated by comparing the monochromatic photocatalytic action spectra with the absorption spectrum of ZnO@Au@CdS, and it was mainly determined by incident photon energy. With selective excitation of Au nanoparticles by incident photons, the excited hot electrons in Au NPs are transferred to the conduction band of ZnO to boost photocatalytic reaction. With selective excitation of CdS, the enhanced interband absorption of CdS and relay station effect of Au nanoparticles should be responsible for the enhanced photocatalytic performance. Our work not only opens the door to the design of efficient supported photocatalysts, but also helps to understand the enhancement mechanism of LSPR effect on the photoelectric conversion of semiconductors.

  16. Ag2S/CdS/TiO2 Nanotube Array Films with High Photocurrent Density by Spotting Sample Method.

    PubMed

    Sun, Hong; Zhao, Peini; Zhang, Fanjun; Liu, Yuliang; Hao, Jingcheng

    2015-12-01

    Ag2S/CdS/TiO2 hybrid nanotube array films (Ag2S/CdS/TNTs) were prepared by selectively depositing a narrow-gap semiconductor-Ag2S (0.9 eV) quantum dots (QDs)-in the local domain of the CdS/TiO2 nanotube array films by spotting sample method (SSM). The improvement of sunlight absorption ability and photocurrent density of titanium dioxide (TiO2) nanotube array films (TNTs) which were obtained by anodic oxidation method was realized because of modifying semiconductor QDs. The CdS/TNTs, Ag2S/TNTs, and Ag2S/CdS/TNTs fabricated by uniformly depositing the QDs into the TNTs via the successive ionic layer adsorption and reaction (SILAR) method were synthesized, respectively. The X-ray powder diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), and X-ray photoelectron spectrum (XPS) results demonstrated that the Ag2S/CdS/TNTs prepared by SSM and other films were successfully prepared. In comparison with the four films of TNTs, CdS/TNTs, Ag2S/TNTs, and Ag2S/CdS/TNTs by SILAR, the Ag2S/CdS/TNTs prepared by SSM showed much better absorption capability and the highest photocurrent density in UV-vis range (320~800 nm). The cycles of local deposition have great influence on their photoelectric properties. The photocurrent density of Ag2S/CdS/TNTs by SSM with optimum deposition cycles of 6 was about 37 times that of TNTs without modification, demonstrating their great prospective applications in solar energy utilization fields.

  17. Inclusion complexes of cypermethrin and permethrin with monochlorotriazinyl-beta-cyclodextrin: A combined spectroscopy, TG/DSC and DFT study

    NASA Astrophysics Data System (ADS)

    Yao, Qi; You, Bin; Zhou, Shuli; Chen, Meng; Wang, Yujiao; Li, Wei

    2014-01-01

    The suitable size hydrophobic cavity and monochlorotriazinyl group as a reactive anchor make MCT-β-CD to be widely used in fabric finishing. In this paper, the inclusion complexes of monochlorotriazinyl-beta-cyclodextrin (MCT-β-CD) with cypermethrin (CYPERM) and permethrin (PERM) are synthesized and analyzed by TG/DSC, FT-IR and Raman spectroscopy. TG/DSC reveals that the decomposed temperatures of inclusion complexes are lower by 25-30 °C than that of physical mixtures. DFT calculations in conjunction with FT-IR and Raman spectral analyses are used to study the structures of MCT-β-CD and their inclusion complexes. Four isomers of trisubstituted MCT-β-CD are designed and DFT calculations reveal that 1,3,5-trisubstituted MCT-β-CD has the lowest energy and can be considered as main component of MCT-β-CD. The ground-state geometries, vibrational wavenumbers, IR and Raman intensities of MCT-β-CD and their inclusion complexes were calculated at B3LYP/6-31G (d) level of theory. Upon examining the optimized geometry of inclusion complex, we find that the CYPERM and PERM are inserted into the toroid of MCT-β-CD from the larger opening. The band at 1646 cm-1 in IR and at 1668 cm-1 in Raman spectrum reveals that monochloroazinyl group of MCT-β-CD exists in ketone form but not in anion form. The noticeable IR and Raman shift of phenyl reveals that these two benzene rings of CYPERM and PERM stays inside the cavity of MCT-β-CD and has weak interaction with MCT-β-CD. This spectroscopy conclusion is consistent with theoretical predicted structure.

  18. Effects of cadmium-spiked sediment on cadmium accumulation and bioturbation by nymphs of the burrowing mayfly Hexagenia bilineata

    USGS Publications Warehouse

    Bartsch, M.R.; Cope, W.G.; Rada, R.G.

    1999-01-01

    We assessed accumulation of cadmium (Cd) and bioturbation by nymphs of the burrowing mayfly Hexagenia bilineata as indicators of exposure to Cd- spiked sediment in a 21-d test. Surficial sediments (top 5 cm) from Pool 7 of the Upper Mississippi River were spiked with Cd to concentrations of 3, 7, and 15 ??g Cd g-1 dry weight. The experimental design was completely randomized, with three Cd-spiked sediment treatments plus an unspiked sediment control (1 ??g Cd g-1 dry weight), and 10 nymphs in each of six replicates per treatment. Nymphs accumulated Cd during the 21-d exposure; mean concentrations varied from 0.22 to 6.24 ??g g-1 dry weight, and tissue concentrations were correlated with Cd concentration in unfiltered test water (r = 0.93, P < 0.01) and test sediment (r = 0.93, P < 0.01). The effect of Cd on bioturbation by nymphs, as indicated by turbidity, differed significantly among treatments (P = 0.045) and over time within treatments (P = 0.01). Turbidity progressively decreased as Cd concentration in the sediment increased, up to 7 ??g g-1; however, turbidity in the 15 ??g g-1 treatment (our greatest exposure concentration) did not differ significantly from the control. Concentrations of Cd in unfiltered, overlying test water increased significantly within treatments during the test, indicating that nymphs mobilized sediment-associated Cd into the overlying water, presumably through burrowing and respiratory activities.

  19. Molecular characterization of α- and β-thalassemia in the Yulin region of Southern China.

    PubMed

    He, Sheng; Li, Jihui; Li, Dong Ming; Yi, Shang; Lu, Xiongcai; Luo, Yudi; Liang, Yi; Feng, Chunfeng; Chen, Biyan; Zheng, Chenguang; Qiu, Xiaoxia

    2018-05-20

    Thalassemia is one of the most common hereditary blood disorders. Epidemiological data regarding the prevalence and distribution of mutations is important for planning a thalassemia control program. To reveal the prevalence of thalassemia and mutation spectrum in the Yulin region of southern China, we screened 130,318 individuals from Yulin region by hematological and genetic analysis. Totally, 24,886 (19.10%) subjects were diagnosed with thalassemia, including 16,308 (12.51%) subjects with α-thalassemia alone, 6658 (5.11%) subjects with β-thalassemia alone and 1920 (1.47%) subjects with both α- and β-thalassemia. Ten α-thalassemia mutations were identified in the α-thalassemia subjects, with the common α-thalassemia mutations being -- SEA mutation (51.91%), -α 3.7 (19.90%), α CS α (10.58%), -α 4.2 (8.13%), α WS α (7.67%). Thirteen β-thalassemia mutations and 31 genotypes were characterized in the β-thalassemia subjects. The seven common mutations [CD41-42 (-CTTT) (43.31%), CD17 (A > T) (34.58%), CD26 (G > A) (6.86%), CD71-72 (+A) (4.25%), -28 (A > G) (3.90%), IVS-II-654 (C > T) (3.53%) and IVS-I-1 (G > T) (2.22%)] accounted for 98.65% of all β-thalassemia defects. Furthermore, 6 cases of α-triplication and 3 cases of mutation -α 2.4 were first identified in this region. Our data illustrated that there was great heterogeneity and extensive spectrum of thalassemias in the Yulin populations. The findings will contribute an available reference for prevention of thalassemia in this region. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. SLC25A13 Gene Analysis in Citrin Deficiency: Sixteen Novel Mutations in East Asian Patients, and the Mutation Distribution in a Large Pediatric Cohort in China

    PubMed Central

    Song, Yuan-Zong; Zhang, Zhan-Hui; Lin, Wei-Xia; Zhao, Xin-Jing; Deng, Mei; Ma, Yan-Li; Guo, Li; Chen, Feng-Ping; Long, Xiao-Ling; He, Xiang-Ling; Sunada, Yoshihide; Soneda, Shun; Nakatomi, Akiko; Dateki, Sumito; Ngu, Lock-Hock; Kobayashi, Keiko; Saheki, Takeyori

    2013-01-01

    Background The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2), and SLC25A13 mutations cause citrin deficiency (CD), a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2) and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD). The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. Methods and Results By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758), were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ2 = 14.93, P<0.01), with the latitude of 30°N as the geographic dividing line in mainland China. Conclusions This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients. PMID:24069319

  1. Physical reasons of emission transformation in infrared CdSeTe/ZnS quantum dots at bioconjugation

    NASA Astrophysics Data System (ADS)

    Torchynska, T. V.

    2015-04-01

    The core/shell CdSeTe/ZnS quantum dots (QDs) with emission at 780-800 nm (1.55-1.60 eV) have been studied by means of photoluminescence (PL) and Raman scattering methods in the nonconjugated state and after conjugation to different antibodies (Ab): (i) mouse monoclonal [8C9] human papilloma virus Ab, anti-HPV 16-E7 Ab, (ii) mouse monoclonal [C1P5] human papilloma virus HPV16 E6+HPV18 E6 Ab, and (iii) pseudo rabies virus (PRV) Ab. The transformations of PL and Raman scattering spectra of QDs, stimulated by conjugated antibodies, have been revealed and discussed. The energy band diagram of core/shell CdSeTe/ZnS QDs has been designed that helps to analyze the PL spectra and their transformations at the bioconjugation. It is shown that the core in CdSeTe/ZnS QDs is complex and including the type II quantum well. The last fact permits to explain the nature of infrared (IR) optical transitions (1.55-1.60 eV) and the high energy PL band (1.88-1.94 eV) in the nonconjugated and bioconjugated QDs. A set of physical reasons has been analyzed with the aim to explain the transformation of PL spectra in bioconjugated QDs. Finally it is shown that two factors are responsible for the PL spectrum transformation at bioconjugation to charged antibodies: (i) the change of energy band profile in QDs and (ii) the shift of QD energy levels in the strong quantum confinement case. The effect of PL spectrum transformation is useful for the study of QD bioconjugation to specific antibodies and can be a powerful technique for early medical diagnostics.

  2. Simultaneous and independent optical impairments monitoring using singular spectrum analysis of asynchronously sampled signal amplitudes

    NASA Astrophysics Data System (ADS)

    Guesmi, Latifa; Menif, Mourad

    2015-09-01

    Optical performance monitoring (OPM) becomes an inviting topic in high speed optical communication networks. In this paper, a novel technique of OPM based on a new elaborated computation approach of singular spectrum analysis (SSA) for time series prediction is presented. Indeed, various optical impairments among chromatic dispersion (CD), polarization mode dispersion (PMD) and amplified spontaneous emission (ASE) noise are a major factors limiting quality of transmission data in the systems with data rates lager than 40 Gbit/s. This technique proposed an independent and simultaneous multi-impairments monitoring, where we used SSA of time series analysis and forecasting. It has proven their usefulness in the temporal analysis of short and noisy time series in several fields, that it is based on the singular value decomposition (SVD). Also, advanced optical modulation formats (100 Gbit/s non-return-to zero dual-polarization quadrature phase shift keying (NRZ-DP-QPSK) and 160 Gbit/s DP-16 quadrature amplitude modulation (DP-16QAM)) offering high spectral efficiencies have been successfully employed by analyzing their asynchronously sampled amplitude. The simulated results proved that our method is efficient on CD, first-order PMD, Q-factor and OSNR monitoring, which enabled large monitoring ranges, the CD in the range of 170-1700 ps/nm.Km and 170-1110 ps/nm.Km for 100 Gbit/s NRZ-DP-QPSK and 160 Gbit/s DP-16QAM respectively, and also the DGD up to 20 ps is monitored. We could accurately monitor the OSNR in the range of 10-40 dB with monitoring error remains less than 1 dB in the presence of large accumulated CD.

  3. Post-Spaceflight (STS-135) Mouse Splenocytes Demonstrate Altered Activation Properties and Surface Molecule Expression

    PubMed Central

    Crucian, Brian; Sams, Clarence

    2015-01-01

    Alterations in immune function have been documented during or post-spaceflight and in ground based models of microgravity. Identification of immune parameters that are dysregulated during spaceflight is an important step in mitigating crew health risks during deep space missions. The in vitro analysis of leukocyte activity post-spaceflight in both human and animal species is primarily focused on lymphocytic function. This report completes a broader spectrum analysis of mouse lymphocyte and monocyte changes post 13 days orbital flight (mission STS-135). Analysis includes an examination in surface markers for cell activation, and antigen presentation and co-stimulatory molecules. Cytokine production was measured after stimulation with T-cell mitogen or TLR-2, TLR-4, or TLR-5 agonists. Splenocyte surface marker analysis immediate post-spaceflight and after in vitro culture demonstrated unique changes in phenotypic populations between the flight mice and matched treatment ground controls. Post-spaceflight splenocytes (flight splenocytes) had lower expression intensity of CD4+CD25+ and CD8+CD25+ cells, lower percentage of CD11c+MHC II+ cells, and higher percentage of CD11c+MHC I+ populations compared to ground controls. The flight splenocytes demonstrated an increase in phagocytic activity. Stimulation with ConA led to decrease in CD4+ population but increased CD4+CD25+ cells compared to ground controls. Culturing with TLR agonists led to a decrease in CD11c+ population in splenocytes isolated from flight mice compared to ground controls. Consequently, flight splenocytes with or without TLR-agonist stimulation showed a decrease in CD11c+MHC I+, CD11c+MHC II+, and CD11c+CD86+ cells compared to ground controls. Production of IFN-γ was decreased and IL-2 was increased from ConA stimulated flight splenocytes. This study demonstrated that expression of surface molecules can be affected by conditions of spaceflight and impaired responsiveness persists under culture conditions in vitro. PMID:25970640

  4. Cadmium Accumulation Characteristics in Turnip Landraces from China and Assessment of Their Phytoremediation Potential for Contaminated Soils.

    PubMed

    Li, Xiong; Zhang, Xiaoming; Yang, Ya; Li, Boqun; Wu, Yuansheng; Sun, Hang; Yang, Yongping

    2016-01-01

    Heavy metal (HM) pollution is a global environmental problem that threatens ecosystem and human health. Cadmium (Cd) pollution is the most prominent HM pollution type because of its high toxicity, strong migration, and the large polluted area globally. Phytoremediation of contaminated soil is frequently practiced because of its cost-effectiveness and operability and because it has no associated secondary pollution. High-accumulation plants, including those identified as hyperaccumulators, play an important role in phytoremediation. Therefore, screening of plants to identify hyperaccumulators is important for continued phytoremediation. In the present study, we investigated the Cd tolerance and accumulation capabilities of 18 turnip landraces from China under a soil experiment with known Cd level. The results indicated that turnip has a high capacity for Cd accumulation. Furthermore, significant differences in Cd tolerance and accumulation characteristics were found among different landraces when they grew at 50 mg kg -1 (dry weight) Cd concentration. Among the studied landraces, five turnip landraces met the requirements of Cd hyperaccumulators and three landraces were identified as potential candidates. However, the total Cd content accumulated by individual plant of different turnip landraces was dependent on both the Cd accumulation capacity and plant biomass. Compared with some reported Cd hyperaccumulators, turnip not only shows a high Cd-accumulation capacity but also has rapid growth and a wide distribution area. These advantages indicate that turnip may have considerable potential for phytoremediation of Cd-contaminated soil. Furthermore, the study also indicates that it is not advisable to consume turnip cultivated in an environment that exceeds safe Cd levels.

  5. T-dependence of the vibrational dynamics of IBP/diME-β-CD in solid state: A FT-IR spectral and quantum chemical study

    NASA Astrophysics Data System (ADS)

    Crupi, V.; Guella, G.; Majolino, D.; Mancini, I.; Rossi, B.; Stancanelli, R.; Venuti, V.; Verrocchio, P.; Viliani, G.

    2010-05-01

    Solid inclusion complex of the non-steroidal anti-inflammatory drug Ibuprofen (IBP, (2-[4-(2-methylpropyl)phenyl]-propanoic acid) with (2,6-dimethyl)-β-cyclodextrin (diME-β-CD) has been investigated by Fourier transform infrared spectroscopy in attenuated total reflectance geometry (FTIR-ATR spectroscopy) and numerical simulation. The complexation-induced changes in the FTIR-ATR spectrum of IBP have been interpreted by comparison with the theoretical vibrational wavenumbers and IR intensities of dimeric structures of IBP, derived from symmetric hydrogen bonding of the two carboxylic groups, computed by using Density Functional Theory (DFT) calculations. From temperature-dependent studies, the enthalpy change ΔH associated with the binding of IBP with diME-β-CD for 1:1 stoichiometry, in solid phase, has been estimated.

  6. Biomarker-specific conjugated nanopolyplexes for the active coloring of stem-like cancer cells

    NASA Astrophysics Data System (ADS)

    Hong, Yoochan; Lee, Eugene; Choi, Jihye; Haam, Seungjoo; Suh, Jin-Suck; Yang, Jaemoon

    2016-06-01

    Stem-like cancer cells possess intrinsic features and their CD44 regulate redox balance in cancer cells to survive under stress conditions. Thus, we have fabricated biomarker-specific conjugated polyplexes using CD44-targetable hyaluronic acid and redox-sensible polyaniline based on a nanoemulsion method. For the most sensitive recognition of the cellular redox at a single nanoparticle scale, a nano-scattering spectrum imaging analyzer system was introduced. The conjugated polyplexes showed a specific targeting ability toward CD44-expressing cancer cells as well as a dramatic change in its color, which depended on the redox potential in the light-scattered images. Therefore, these polyaniline-based conjugated polyplexes as well as analytical processes that include light-scattering imaging and measurements of scattering spectra, clearly establish a systematic method for the detection and monitoring of cancer microenvironments.

  7. Synthesis, characterization and evaluation of the photocatalytic performance of Ag-CdMoO{sub 4} solar light driven plasmonic photocatalyst

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adhikari, Rajesh; Malla, Shova; Gyawali, Gobinda

    2013-09-01

    Graphical abstract: - Highlights: • Ag-CdMoO{sub 4} solar light driven photocatalyst was successfully synthesized. • Photocatalyst exhibited strong absorption in the visible region. • Photocatalytic activity was significantly enhanced. • Enhanced activity was caused by the SPR effect induced by Ag nanoparticles. - Abstract: Ag-CdMoO{sub 4} plasmonic photocatalyst was synthesized in ethanol/water mixture by photo assisted co-precipitation method at room temperature. As synthesized powders were characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM), UV–Vis diffuse reflectance spectroscopy (DRS), X-ray photoelectron spectroscopy (XPS) and Brunauer–Emmett–Teller (BET) surface area analyzer. Photocatalytic activity was evaluated by performing the degradation experiment over methylenemore » blue (MB) and indigo carmine (IC) as model dyes under simulated solar light irradiation. The results revealed that the Ag-CdMoO{sub 4} showed the higher photocatalytic performance as compared to CdMoO{sub 4} nanoparticles. Dispersion of Ag nanoparticles over the surface of CdMoO{sub 4} nanoparticles causes the surface plasmon resonance (SPR) and enhances the broad absorption in the entire visible region of the solar spectrum. Hence, dispersion of Ag nanoparticles over CdMoO{sub 4} nanoparticles could be the better alternative to enhance the absorption of visible light by scheelite crystal family for effective photocatalysis.« less

  8. Oppositional defiant- and conduct disorder-like problems: neurodevelopmental predictors and genetic background in boys and girls, in a nationwide twin study.

    PubMed

    Kerekes, Nóra; Lundström, Sebastian; Chang, Zheng; Tajnia, Armin; Jern, Patrick; Lichtenstein, Paul; Nilsson, Thomas; Anckarsäter, Henrik

    2014-01-01

    Background. Previous research has supported gender-specific aetiological factors in oppositional defiant disorder (ODD) and conduct disorder (CD). The aims of this study were to identify gender-specific associations between the behavioural problems-ODD/CD-like problems-and the neurodevelopmental disorders-attention deficit hyperactivity disorder (ADHD), autism spectrum disorder (ASD)-and to investigate underlying genetic effects. Methods. 17,220 twins aged 9 or 12 were screened using the Autism-Tics, AD/HD and other Comorbidities inventory. The main covariates of ODD- and CD-like problems were investigated, and the relative importance of unique versus shared hereditary and environmental effects was estimated using twin model fitting. Results. Social interaction problems (one of the ASD subdomains) was the strongest neurodevelopmental covariate of the behavioural problems in both genders, while ADHD-related hyperactivity/impulsiveness in boys and inattention in girls stood out as important covariates of CD-like problems. Genetic effects accounted for 50%-62% of the variance in behavioural problems, except in CD-like problems in girls (26%). Genetic and environmental effects linked to ADHD and ASD also influenced ODD-like problems in both genders and, to a lesser extent, CD-like problems in boys, but not in girls. Conclusions. The gender-specific patterns should be considered in the assessment and treatment, especially of CD.

  9. Whole transcriptome profiling reveals major cell types in the cellular immune response against acute and chronic active Epstein-Barr virus infection.

    PubMed

    Zhong, Huaqing; Hu, Xinran; Janowski, Andrew B; Storch, Gregory A; Su, Liyun; Cao, Lingfeng; Yu, Jinsheng; Xu, Jin

    2017-12-19

    Epstein-Barr virus (EBV) is a common human pathogen that infects over 95% of the population worldwide. In the present study, the whole transcriptome microarray data were generated from peripheral blood mononuclear cells from Chinese children with acute infectious mononucleosis (AIM) and chronic active EBV infection (CAEBV) that were also compared with a publicly available microarray dataset from a study of American college students with AIM. Our study characterized for the first time a broad spectrum of molecular signatures in AIM and CAEBV. The key findings from the transcriptome profiling were validated with qPCR and flow cytometry assays. The most important finding in our study is the discovery of predominant γδ TCR expression and γδ T cell expansion in AIM. This finding, in combination with the striking up-regulation of CD3, CD8 and CD94, suggests that CD8+ T cells and CD94+ NK cells may play a major role in AIM. Moreover, the unique up-regulation of CD64A/B and its significant correlation with the monocyte marker CD14 was observed in CAEBV and that implies an important role of monocytes in CAEBV. In conclusion, our study reveals major cell types (particularly γδ T cells) in the host cellular immune response against AIM and CAEBV.

  10. EORTC, ISCL, and USCLC consensus recommendations for the treatment of primary cutaneous CD30-positive lymphoproliferative disorders: lymphomatoid papulosis and primary cutaneous anaplastic large-cell lymphoma*

    PubMed Central

    Pfaltz, Katrin; Vermeer, Maarten H.; Cozzio, Antonio; Ortiz-Romero, Pablo L.; Bagot, Martine; Olsen, Elise; Kim, Youn H.; Dummer, Reinhard; Pimpinelli, Nicola; Whittaker, Sean; Hodak, Emmilia; Cerroni, Lorenzo; Berti, Emilio; Horwitz, Steve; Prince, H. Miles; Guitart, Joan; Estrach, Teresa; Sanches, José A.; Duvic, Madeleine; Ranki, Annamari; Dreno, Brigitte; Ostheeren-Michaelis, Sonja; Knobler, Robert; Wood, Gary; Willemze, Rein

    2011-01-01

    Primary cutaneous CD30+ lymphoproliferative disorders (CD30+ LPDs) are the second most common form of cutaneous T-cell lymphomas and include lymphomatoid papulosis and primary cutaneous anaplastic large-cell lymphoma. Despite the anaplastic cytomorphology of tumor cells that suggest an aggressive course, CD30+ LPDs are characterized by an excellent prognosis. Although a broad spectrum of therapeutic strategies has been reported, these have been limited mostly to small retrospective cohort series or case reports, and only very few prospective controlled or multicenter studies have been performed, which results in a low level of evidence for most therapies. The response rates to treatment, recurrence rates, and outcome have not been analyzed in a systematic review. Moreover, international guidelines for staging and treatment of CD30+ LPDs have not yet been presented. Based on a literature analysis and discussions, recommendations were elaborated by a multidisciplinary expert panel of the Cutaneous Lymphoma Task Force of the European Organization for Research and Treatment of Cancer, the International Society for Cutaneous Lymphomas, and the United States Cutaneous Lymphoma Consortium. The recommendations represent the state-of-the-art management of CD30+ LPDs and include definitions for clinical endpoints as well as response criteria for future clinical trials in CD30+ LPDs. PMID:21841159

  11. Optical Control of Fluorescence through plasmonic eigenmode extinction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Xiaoying; Lin, Shih-Che; Li, Quanshui

    We introduce the concept of optical control of the fluorescence yield of CdSe quantum dots through plasmon-induced structural changes in random semicontinuous nanostructured gold films. We demonstrate that the wavelength- and polarization dependent coupling between quantum dots and the semicontinuous films, and thus the fluorescent emission spectrum, can be controlled and significantly increased through the optical extinction of a selective band of eigenmodes in the films. This optical method of effecting controlled changes in the metal nanostructure allows for versatile functionality in a single sample and opens a pathway to in situ control over the fluorescence spectrum.

  12. An unprecedented up-field shift in the 13C NMR spectrum of the carboxyl carbons of the lantern-type dinuclear complex TBA[Ru2(O2CCH3)4Cl2] (TBA+ = tetra(n-butyl)ammonium cation).

    PubMed

    Hiraoka, Yuya; Ikeue, Takahisa; Sakiyama, Hiroshi; Guégan, Frédéric; Luneau, Dominique; Gillon, Béatrice; Hiromitsu, Ichiro; Yoshioka, Daisuke; Mikuriya, Masahiro; Kataoka, Yusuke; Handa, Makoto

    2015-08-14

    A large up-field shift (-763 ppm) has been observed for the carboxyl carbons of the dichlorido complex TBA[Ru(2)(O(2)CCH(3))(4)Cl(2)] (TBA(+) = tetra(n-butyl)ammonium cation) in the (13)C NMR spectrum (CD(2)Cl(2) at 25 °C). The DFT calculations showed spin delocalization from the paramagnetic Ru(2)(5+) core to the ligands, in agreement with the large up-field shift.

  13. Development of Mirror Modules for the ART-XC Instrument aboard the Spectrum-Roentgen-Gamma Mission

    NASA Technical Reports Server (NTRS)

    Gubarev, Mikhail V.; Ramsey, Brian; O'Dell, Stephen L.; Elsner, Ronald F.; Kilaru, Kiranmayee; Atkins, Carolyn; Pavlinskiy, Mikhail N.; Tkachenko, Alexey V.; Lapshov, Igor Y.

    2013-01-01

    The Marshall Space Flight Center (MSFC) is developing x-ray mirror modules for the Astronomical Roengen Telescope- X-ray Concentrator (ART-XC) instrument on board the Spectrum-Roentgen-Gamma Mission. ART-XC will consist of seven co-aligned x-ray mirror modules with seven corresponding CdTe focal plane detectors. Each module provides an effective area of 65 sq cm at 8 keV, response out to 30 keV, and an angular resolution of 45 arcsec or better HPD. We will present a status of the ART x-ray module development at MSFC.

  14. Optical Control of Fluorescence through plasmonic eigenmode extinction

    DOE PAGES

    Xu, Xiaoying; Lin, Shih-Che; Li, Quanshui; ...

    2015-04-30

    We introduce the concept of optical control of the fluorescence yield of CdSe quantum dots through plasmon-induced structural changes in random semicontinuous nanostructured gold films. We demonstrate that the wavelength- and polarization dependent coupling between quantum dots and the semicontinuous films, and thus the fluorescent emission spectrum, can be controlled and significantly increased through the optical extinction of a selective band of eigenmodes in the films. This optical method of effecting controlled changes in the metal nanostructure allows for versatile functionality in a single sample and opens a pathway to in situ control over the fluorescence spectrum.

  15. Spectrum-shape method and the next-to-leading-order terms of the β -decay shape factor

    NASA Astrophysics Data System (ADS)

    Haaranen, M.; Kotila, J.; Suhonen, J.

    2017-02-01

    Effective values of the axial-vector coupling constant gA have lately attracted much attention due to the prominent role of gA in determining the half-lives of double β decays, in particular their neutrinoless mode. The half-life method, i.e., comparing the calculated half-lives to the corresponding experimental ones, is the most widely used method to access the effective values of gA. The present paper investigates the possibilities offered by a complementary method: the spectrum-shape method (SSM). In the SSM, comparison of the shapes of the calculated and measured β electron spectra of forbidden nonunique β decays yields information on the magnitude of gA. In parallel, we investigate the impact of the next-to-leading-order terms of the β -decay shape function and the radiative corrections on the half-life method and the SSM by analyzing the fourfold forbidden decays of 113Cd and 115In by using three nuclear-structure theory frameworks; namely, the nuclear shell model, the microscopic interacting boson-fermion model, and the microscopic quasiparticle-phonon model. The three models yield a consistent result, gA≈0.92 , when the SSM is applied to the decay of 113Cd for which β -spectrum data are available. At the same time the half-life method yields results which are in tension with each other and the SSM result.

  16. Immunoinformatics Features Linked to Leishmania Vaccine Development: Data Integration of Experimental and In Silico Studies

    PubMed Central

    Brito, Rory C. F.; Guimarães, Frederico G.; Velloso, João P. L.; Corrêa-Oliveira, Rodrigo; Ruiz, Jeronimo C.; Reis, Alexandre B.; Resende, Daniela M.

    2017-01-01

    Leishmaniasis is a wide-spectrum disease caused by parasites from Leishmania genus. There is no human vaccine available and it is considered by many studies as apotential effective tool for disease control. To discover novel antigens, computational programs have been used in reverse vaccinology strategies. In this work, we developed a validation antigen approach that integrates prediction of B and T cell epitopes, analysis of Protein-Protein Interaction (PPI) networks and metabolic pathways. We selected twenty candidate proteins from Leishmania tested in murine model, with experimental outcome published in the literature. The predictions for CD4+ and CD8+ T cell epitopes were correlated with protection in experimental outcomes. We also mapped immunogenic proteins on PPI networks in order to find Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways associated with them. Our results suggest that non-protective antigens have lowest frequency of predicted T CD4+ and T CD8+ epitopes, compared with protective ones. T CD4+ and T CD8+ cells are more related to leishmaniasis protection in experimental outcomes than B cell predicted epitopes. Considering KEGG analysis, the proteins considered protective are connected to nodes with few pathways, including those associated with ribosome biosynthesis and purine metabolism. PMID:28208616

  17. Immunoinformatics Features Linked to Leishmania Vaccine Development: Data Integration of Experimental and In Silico Studies.

    PubMed

    Brito, Rory C F; Guimarães, Frederico G; Velloso, João P L; Corrêa-Oliveira, Rodrigo; Ruiz, Jeronimo C; Reis, Alexandre B; Resende, Daniela M

    2017-02-10

    Leishmaniasis is a wide-spectrum disease caused by parasites from Leishmania genus. There is no human vaccine available and it is considered by many studies as apotential effective tool for disease control. To discover novel antigens, computational programs have been used in reverse vaccinology strategies. In this work, we developed a validation antigen approach that integrates prediction of B and T cell epitopes, analysis of Protein-Protein Interaction (PPI) networks and metabolic pathways. We selected twenty candidate proteins from Leishmania tested in murine model, with experimental outcome published in the literature. The predictions for CD4⁺ and CD8⁺ T cell epitopes were correlated with protection in experimental outcomes. We also mapped immunogenic proteins on PPI networks in order to find Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways associated with them. Our results suggest that non-protective antigens have lowest frequency of predicted T CD4⁺ and T CD8⁺ epitopes, compared with protective ones. T CD4⁺ and T CD8⁺ cells are more related to leishmaniasis protection in experimental outcomes than B cell predicted epitopes. Considering KEGG analysis, the proteins considered protective are connected to nodes with few pathways, including those associated with ribosome biosynthesis and purine metabolism.

  18. Development of near-infrared ratiometric fluorescent probe based on cationic conjugated polymer and CdTe/CdS QDs for label-free determination of glucose in human body fluids.

    PubMed

    Yu, Mengze; Zhao, Kunli; Zhu, Xiaohua; Tang, Shiyun; Nie, Zhou; Huang, Yan; Zhao, Peng; Yao, Shouzhuo

    2017-09-15

    Quantum dots (QDs) have attracted extensive attention in biomedical applications, because of their broad excitation spectra, narrow and symmetric emission peaks etc. Furthermore, near-infrared (NIR) QDs have further advantages including low autofluorescence, good tissue penetration and low phototoxicity. In this work, the electrostatic interaction and fluorescence resonance energy transfer (FRET) between NIR CdTe/CdS QDs and cationic conjugated polymer (CCP) was studied for the first time. Based on the newly discovered phenomena and the result that hydrogen peroxide (H 2 O 2 ) can efficiently quench the fluorescence of NIR CdTe/CdS QDs, a novel NIR ratiometric fluorescent probe for determination of H 2 O 2 and glucose was developed. Under the optimized conditions, the detection limit of H 2 O 2 and glucose assay were 0.1mM and 0.05mM (S/N=3), with a linear range of 0.2-4mM and 0.1-5mM, respectively. Because of the NIR spectrum, this ratiometric probe can be also applied for the determination of glucose in whole blood samples directly, providing a valuable platform for glucose sensing in clinic diagnostic and drug screening. Copyright © 2017. Published by Elsevier B.V.

  19. Energy relay from an unconventional yellow dye to CdS/CdSe quantum dots for enhanced solar cell performance.

    PubMed

    Narayanan, Remya; Das, Amrita; Deepa, Melepurath; Srivastava, Avanish Kumar

    2013-12-02

    A new design for a quasi-solid-state Forster resonance energy transfer (FRET) enabled solar cell with unattached Lucifer yellow (LY) dye molecules as donors and CdS/CdSe quantum dots (QDs) tethered to titania (TiO2 ) as acceptors is presented. The Forster radius is experimentally determined to be 5.29 nm. Sequential energy transfer from the LY dye to the QDs and electron transfer from the QDs to TiO2 is followed by fluorescence quenching and electron lifetime studies. Cells with a donor-acceptor architecture (TiO2 /CdS/CdSe/ZnS-LY/S(2-)-multi-walled carbon nanotubes) show a maximum incident photon-to-current conversion efficiency of 53 % at 530 nm. This is the highest efficiency among Ru-dye free FRET-enabled quantum dot solar cells (QDSCs), and is much higher than the donor or acceptor-only cells. The FRET-enhanced solar cell performance over the majority of the visible spectrum paves the way to harnessing the untapped potential of the LY dye as an energy relay fluorophore for the entire gamut of dye sensitized, organic, or hybrid solar cells. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Investigation of biochemical property changes in activation-induced CD 8 + T cell apoptosis using Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Lee, Young Ju; Ahn, Hyung Joon; Lee, Gi-Ja; Jung, Gyeong Bok; Lee, Gihyun; Kim, Dohyun; Shin, Jae-Ho; Jin, Kyung-Hyun; Park, Hun-Kuk

    2015-07-01

    The study was to investigate the changes in biochemical properties of activated mature CD8+ T cells related to apoptosis at a molecular level. We confirmed the activation and apoptosis of CD8+ T cells by fluorescence-activated cell sorting and atomic force microscopy and then performed Raman spectral measurements on activated mature CD8+ T cells and cellular deoxyribose nucleic acid (DNA). In the activated mature CD8+ T cells, there were increases in protein spectra at 1002 and 1234 cm-1. In particular, to assess the apoptosis-related DNA spectral signatures, we investigated the spectra of the cellular DNA isolated from resting and activated mature CD8+ T cells. Raman spectra at 765 to 786 cm-1 and 1053 to 1087 cm-1 were decreased in activated mature DNA. In addition, we analyzed Raman spectrum using the multivariate statistical method including principal component analysis. Raman spectra of activated mature DNA are especially well-discriminated from those of resting DNA. Our findings regarding the biochemical and structural changes associated with apoptosis in activated mature T cells and cellular DNA according to Raman spectroscopy provide important insights into allospecific immune responses generated after organ transplantation, and may be useful for therapeutic manipulation of the immune response.

  1. Stem cell factor supports migration in canine mesenchymal stem cells.

    PubMed

    Enciso, Nathaly; Ostronoff, Luciana L K; Mejías, Guillermo; León, Leticia G; Fermín, María Luisa; Merino, Elena; Fragio, Cristina; Avedillo, Luis; Tejero, Concepción

    2018-03-01

    Adult Mesenchymal Stem Cells (MSC) are cells that can be defined as multipotent cells able to differentiate into diverse lineages, under appropriate conditions. These cells have been widely used in regenerative medicine, both in preclinical and clinical settings. Initially discovered in bone marrow, MSC can now be isolated from a wide spectrum of adult and foetal tissues. Studies to evaluate the therapeutic potential of these cells are based on their ability to arrive to damaged tissues. In this paper we have done a comparative study analyzing proliferation, surface markers and OCT4, SOX9, RUNX2, PPARG genes expression in MSC cells from Bone marrow (BMMSC) and Adipose tissue (ASC). We also analyzed the role of Stem Cell Factor (SCF) on MSC proliferation and on ASCs metalloproteinases MMP-2, MMP-9 secretion. Healthy dogs were used as BMMSC donors, and ASC were collected from omentum during elective ovariohysterectomy surgery. Both cell types were cultured in IMDM medium with or without SCF, 10% Dog Serum (DS), and incubated at 38 °C with 5% CO2. Growth of BMMSCs and ASCs was exponential until 25-30 days. Flow citometry of MSCs revealed positive results for CD90 and negative for CD34, CD45 and MCH-II. Genes were evaluated by RT-PCR and metalloproteinases by zymografy. Our findings indicate morphological and immunological similarities as well as expression of genes from both origins on analyzed cells. Furthermore, SCF did not affect proliferation of MSCs, however it up-regulated MMP-2 and MMP-9 secretion in ASCs. These results suggest that metalloproteinases are possibly essential molecules pivoting migration.

  2. CD146 positive human dental pulp stem cells promote regeneration of dentin/pulp-like structures.

    PubMed

    Matsui, Mikiko; Kobayashi, Tomoko; Tsutsui, Takeo W

    2018-04-01

    CD146 and STRO-1 are endothelial biomarkers that are co-expressed on the cellular membranes of blood vessels within human dental pulp tissue. This study characterized the percentage of dentin-like structures produced by CD146-positive (CD146 + ) human dental pulp stem cells (DPSCs), compared with their CD146-negative (CD146 - ) counterparts. DPSC populations were enriched using magnetic-activated cell sorting (MACS), yielding CD146 + and CD146 - cells, as well as mixtures composed of 25% CD146 + cells and 75% CD146 - cells (CD146 +/- ). Cell growth assays indicated that CD146 + cells exhibit an approximate 3-4 h difference in doubling time, compared with CD146 - cells. Cell cycle distributions were determined by flow cytometry analysis. The low percentage of CD146 + cells' DNA content in G 0 /G 1 phase were compared with CD146 - and non-separated cells. In contrast to CD146 - and non-separated cells, prompt mineralization was observed in CD146 + cells. Subsequently, qRT-PCR revealed high mRNA expression of CD146 and Alkaline phosphatase in mineralization-induced CD146 + cells. CD146 + cells were also observed high adipogenic ability by Oil red O staining. Histological examinations revealed an increased area of dentin/pulp-like structures in transplanted CD146 + cells, compared with CD146 - and CD146 +/- cells. Immunohistochemical studies detected dentin matrix protein-1 (DMP1) and dentin sialophosphoprotein (DSPP), as well as human mitochondria, in transplanted DPSCs. Co-expression of CD146 and GFP indicated that CD146 was expressed in transplanted CD146 + cells. CD146 + cells may promote mineralization and generate dentin/pulp-like structures, suggesting a role in self-renewal of stem cells and dental pulp regenerative therapy.

  3. Characterization of pancreatic stem cells derived from adult human pancreas ducts by fluorescence activated cell sorting.

    PubMed

    Lin, Han-Tso; Chiou, Shih-Hwa; Kao, Chung-Lan; Shyr, Yi-Ming; Hsu, Chien-Jen; Tarng, Yih-Wen; Ho, Larry L-T; Kwok, Ching-Fai; Ku, Hung-Hai

    2006-07-28

    To isolate putative pancreatic stem cells (PSCs) from human adult tissues of pancreas duct using serum-free, conditioned medium. The characterization of surface phenotype of these PSCs was analyzed by flow cytometry. The potential for pancreatic lineage and the capability of beta-cell differentiation in these PSCs were evaluated as well. By using serum-free medium supplemented with essential growth factors, we attempted to isolate the putative PSCs which has been reported to express nestin and pdx-1. The Matrigel(TM) was employed to evaluate the differential capacity of isolated cells. Dithizone staining, insulin content/secretion measurement, and immunohistochemistry staining were used to monitor the differentiation. Fluorescence activated cell sorting (FACS) was used to detect the phenotypic markers of putative PSCs. A monolayer of spindle-like cells was cultivated. The putative PSCs expressed pdx-1 and nestin. They were also able to differentiate into insulin-, glucagon-, and somatostatin-positive cells. The spectrum of phenotypic markers in PSCs was investigated; a similarity was revealed when using human bone marrow-derived stem cells as the comparative experiment, such as CD29, CD44, CD49, CD50, CD51, CD62E, PDGFR-alpha, CD73 (SH2), CD81, CD105(SH3). In this study, we successfully isolated PSCs from adult human pancreatic duct by using serum-free medium. These PSCs not only expressed nestin and pdx-1 but also exhibited markers attributable to mesenchymal stem cells. Although work is needed to elucidate the role of these cells, the application of these PSCs might be therapeutic strategies for diabetes mellitus.

  4. CD271 Defines a Stem Cell-Like Population in Hypopharyngeal Cancer

    PubMed Central

    Imai, Takayuki; Tamai, Keiichi; Oizumi, Sayuri; Oyama, Kyoko; Yamaguchi, Kazunori; Sato, Ikuro; Satoh, Kennichi; Matsuura, Kazuto; Saijo, Shigeru; Sugamura, Kazuo; Tanaka, Nobuyuki

    2013-01-01

    Cancer stem cells contribute to the malignant phenotypes of a variety of cancers, but markers to identify human hypopharyngeal cancer (HPC) stem cells remain poorly understood. Here, we report that the CD271+ population sorted from xenotransplanted HPCs possesses an enhanced tumor-initiating capability in immunodeficient mice. Tumors generated from the CD271+ cells contained both CD271+ and CD271− cells, indicating that the population could undergo differentiation. Immunohistological analyses of the tumors revealed that the CD271+ cells localized to a perivascular niche near CD34+ vasculature, to invasive fronts, and to the basal layer. In accordance with these characteristics, a stemness marker, Nanog, and matrix metalloproteinases (MMPs), which are implicated in cancer invasion, were significantly up-regulated in the CD271+ compared to the CD271− cell population. Furthermore, using primary HPC specimens, we demonstrated that high CD271 expression was correlated with a poor prognosis for patients. Taken together, our findings indicate that CD271 is a novel marker for HPC stem-like cells and for HPC prognosis. PMID:23626764

  5. Serum levels of soluble CD30 are increased in ulcerative colitis (UC) but not in Crohn's disease (CD)

    PubMed Central

    Giacomelli, R; Passacantando, A; Parzanese, I; Vernia, P; Klidara, N; Cucinelli, F; Lattanzio, R; Santori, E; Cipriani, P; Caprilli, R; Tonietti, G

    1998-01-01

    Imbalance in Th1 and Th2 subsets and their derived cytokines seems to be involved in the immune abnormalities underlying UC and CD. CD30 is a member of the tumour necrosis factor/nerve growth receptor superfamily expressed on T cells producing Th2 cytokines and released as a soluble form. In this study high levels of soluble CD30 were found in sera of UC patients independently of disease activity. Furthermore, increased titres of soluble CD30 molecule were shown, in the same patients, by mitogen-stimulated cultures of peripheral blood mononuclear cells. Our data seem to indicate that an activation of Th2 immune response is involved in the pathogenesis of UC, but not of CD. Furthermore, this finding indicates that serum soluble CD30 measurement may be helpful for differentiating these two forms of inflammatory bowel disease. PMID:9528894

  6. Cells Isolated from Human Periapical Cysts Express Mesenchymal Stem Cell-like Properties

    PubMed Central

    Marrelli, Massimo; Paduano, Francesco; Tatullo, Marco

    2013-01-01

    We provide a detailed description of mesenchymal stem cells (MSCs) isolated from human periapical cysts, which we have termed hPCy-MSCs. These cells have a fibroblast-like shape and adhere to tissue culture plastic surfaces. hPCy-MSCs possess high proliferative potential and self-renewal capacity properties. We characterised the immunophenotype of hPCy-MSCs (CD73+, CD90+, CD105+, CD13+, CD29+, CD44+, CD45-, STRO-1+, CD146+) by flow cytometry and immunofluorescence. hPCy-MSCs possess the potential to differentiate into osteoblast- and adipocyte-like cells in vitro. Multi-potentiality was evaluated with culture-specific staining and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis for osteo/odontogenic and adipogenic markers. This is the first report to indicate that human periapical cysts contain cells with MSC-like properties. Taken together, our findings indicate that human periapical cysts could be a rich source of MSCs. PMID:24250252

  7. Cells isolated from human periapical cysts express mesenchymal stem cell-like properties.

    PubMed

    Marrelli, Massimo; Paduano, Francesco; Tatullo, Marco

    2013-01-01

    We provide a detailed description of mesenchymal stem cells (MSCs) isolated from human periapical cysts, which we have termed hPCy-MSCs. These cells have a fibroblast-like shape and adhere to tissue culture plastic surfaces. hPCy-MSCs possess high proliferative potential and self-renewal capacity properties. We characterised the immunophenotype of hPCy-MSCs (CD73(+), CD90(+), CD105(+), CD13(+), CD29(+), CD44(+), CD45(-), STRO-1(+), CD146(+)) by flow cytometry and immunofluorescence. hPCy-MSCs possess the potential to differentiate into osteoblast- and adipocyte-like cells in vitro. Multi-potentiality was evaluated with culture-specific staining and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis for osteo/odontogenic and adipogenic markers. This is the first report to indicate that human periapical cysts contain cells with MSC-like properties. Taken together, our findings indicate that human periapical cysts could be a rich source of MSCs.

  8. CD20+ T cell numbers are decreased in untreated HIV-1 patients and recover after HAART.

    PubMed

    Förster, Friederike; Singla, Anuj; Arora, Sunil K; Schmidt, Reinhold E; Jacobs, Roland

    2012-08-30

    To elucidate if CD20(+) T cells are affected by HIV-1 infection and may have a prognostic value for the course of disease, numbers of CD20(+) T cells were determined in healthy controls, untreated and HAART-treated HIV-1 patients. Coexpression patterns of CD4, CD8, and CD38 were analysed on CD3(+)CD20(+) and CD3(+)CD20(-) T cells. We found a significant decrease of CD20(+) T cell numbers in untreated HIV-1 patients (1.4%) as compared to healthy controls (2.5%) which recovered under HAART (1.9%). Particularly, the CD8(+) T cell compartment was affected revealing significant differences between healthy controls (3.4%) and both treated (1.7%) and untreated (1.1%) patients. CD38 was expressed on a few CD20(+) T cells but preferentially on CD20(-) cells in all three groups. IFN-γ production was measured upon cell activation using PMA alone or in combination with ionomycin in order to assess functional capacities of the cells. PMA alone was much more effective in CD20(+) cells regardless of CD38 coexpression, indicating a supportive role of CD20 but not CD38 in T cell activation. Here we present data showing that CD3(+)CD20(+) T cells are decreased in untreated HIV-1 patients and normal numbers are restored under HAART. Expression of CD20 and CD38 is independently regulated on T cells. Contrary to CD38, CD20 can substitute ionophores for Ca(2+) flux in early T cell activation and also strongly amplify cell stimulation in the presence of Ca(2+) ionophores, indicating that CD20 contributes to T cell activation. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. ESCMID Study Group for Infections in Compromised Hosts (ESGICH) Consensus Document on the safety of targeted and biological therapies: an infectious diseases perspective (Agents targeting lymphoid or myeloid cells surface antigens [II]: CD22, CD30, CD33, CD38, CD40, SLAMF-7 and CCR4).

    PubMed

    Drgona, L; Gudiol, C; Lanini, S; Salzberger, B; Ippolito, G; Mikulska, M

    2018-03-20

    The present review is part of the ESCMID Study Group for Infections in Compromised Hosts (ESGICH) Consensus Document on the safety of targeted and biological therapies. To review, from an Infectious Diseases perspective, the safety profile of agents targeting CD22, CD30, CD33, CD38, CD40, SLAMF-7 and CCR4 and to suggest preventive recommendations. Computer-based MEDLINE searches with MeSH terms pertaining to each agent or therapeutic family. The risk and spectrum of infections in patients receiving CD22-targeted agents (i.e. inotuzumab ozogamicin) are similar to those observed with anti-CD20 antibodies. Anti-Pneumocystis prophylaxis and monitoring for cytomegalovirus (CMV) infection is recommended for patients receiving CD30-targeted agents (brentuximab vedotin). Due to the scarcity of data, the risk posed by CD33-targeted agents (gemtuzumab ozogamicin) cannot be assessed. Patients receiving CD38-targeted agents (i.e. daratumumab) face an increased risk of varicella-zoster virus (VZV) infection. Therapy with CD40-targeted agents (lucatumumab or dacetuzumab) is associated with opportunistic infections similar to those observed in hyper-IgM syndrome, and prevention strategies (including anti-Pneumocystis prophylaxis and pre-emptive therapy for CMV infection) are warranted. SLAMF-7 (CD319)-targeted agents (elotuzumab) induce lymphopenia and increase the risk of infection (particularly due to VZV). The impact of CCR4-targeted agents (mogamulizumab) on infection susceptibility is difficult to distinguish from the effect of underlying diseases and concomitant therapies. However, anti-Pneumocystis and anti-herpesvirus prophylaxis and screening for chronic hepatitis B virus (HBV) infection are recommended. Specific management strategies should be put in place to reduce the risk and/or the severity of infectious complications associated to the reviewed agents. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  10. Expression of the human NAD(P)-metabolizing ectoenzyme CD38 compromises systemic acquired resistance in Arabidopsis.

    PubMed

    Zhang, Xudong; Mou, Zhonglin

    2012-09-01

    Plant systemic acquired resistance (SAR) is a long-lasting, broad-spectrum immune response that is mounted after primary pathogen infection. Although SAR has been extensively researched, the molecular mechanisms underlying its activation have not been completely understood. We have previously shown that the electron carrier NAD(P) leaks into the plant extracellular compartment upon pathogen attack and that exogenous NAD(P) activates defense gene expression and disease resistance in local treated leaves, suggesting that extracellular NAD(P) [eNAD(P)] might function as a signal molecule activating plant immune responses. To further establish the function of eNAD(P) in plant immunity, we tested the effect of exogenous NAD(P) on resistance gene-mediated hypersensitive response (HR) and SAR. We found that exogenous NAD(P) completely suppresses HR-mediated cell death but does not affect HR-mediated disease resistance. Local application of exogenous NAD(P) is unable to induce SAR in distal tissues, indicating that eNAD(P) is not a sufficient signal for SAR activation. Using transgenic Arabidopsis plants expressing the human NAD(P)-metabolizing ectoenzyme CD38, we demonstrated that altering eNAD(P) concentration or signaling compromises biological induction of SAR. This result suggests that eNAD(P) may play a critical signaling role in activation of SAR.

  11. Classification and clinical behavior of blastic plasmacytoid dendritic cell neoplasms according to their maturation-associated immunophenotypic profile

    PubMed Central

    Martín-Martín, Lourdes; López, Antonio; Vidriales, Belén; Caballero, María Dolores; Rodrigues, António Silva; Ferreira, Silvia Inês; Lima, Margarida; Almeida, Sérgio; Valverde, Berta; Martínez, Pilar; Ferrer, Ana; Candeias, Jorge; Ruíz-Cabello, Francisco; Buadesa, Josefa Marco; Sempere, Amparo; Villamor, Neus

    2015-01-01

    Blastic plasmacytoid dendritic cell neoplasm (BPDCN) is a rare subtype of leukemia/lymphoma, whose diagnosis can be difficult to achieve due to its clinical and biological heterogeneity, as well as its overlapping features with other hematologic malignancies. In this study we investigated whether the association between the maturational stage of tumor cells and the clinico-biological and prognostic features of the disease, based on the analysis of 46 BPDCN cases classified into three maturation-associated subgroups on immunophenotypic grounds. Our results show that blasts from cases with an immature plasmacytoid dendritic cell (pDC) phenotype exhibit an uncommon CD56− phenotype, coexisting with CD34+ non-pDC tumor cells, typically in the absence of extramedullary (e.g. skin) disease at presentation. Conversely, patients with a more mature blast cell phenotype more frequently displayed skin/extramedullary involvement and spread into secondary lymphoid tissues. Despite the dismal outcome, acute lymphoblastic leukemia-type therapy (with central nervous system prophylaxis) and/or allogeneic stem cell transplantation appeared to be the only effective therapies. Overall, our findings indicate that the maturational profile of pDC blasts in BPDCN is highly heterogeneous and translates into a wide clinical spectrum -from acute leukemia to mature lymphoma-like behavior-, which may also lead to variable diagnosis and treatment. PMID:26056082

  12. Anti-leukemic activity and tolerability of anti-human CD47 monoclonal antibodies

    PubMed Central

    Pietsch, E C; Dong, J; Cardoso, R; Zhang, X; Chin, D; Hawkins, R; Dinh, T; Zhou, M; Strake, B; Feng, P-H; Rocca, M; Santos, C Dos; Shan, X; Danet-Desnoyers, G; Shi, F; Kaiser, E; Millar, H J; Fenton, S; Swanson, R; Nemeth, J A; Attar, R M

    2017-01-01

    CD47, a broadly expressed cell surface protein, inhibits cell phagocytosis via interaction with phagocyte-expressed SIRPα. A variety of hematological malignancies demonstrate elevated CD47 expression, suggesting that CD47 may mediate immune escape. We discovered three unique CD47-SIRPα blocking anti-CD47 monoclonal antibodies (mAbs) with low nano-molar affinity to human and cynomolgus monkey CD47, and no hemagglutination and platelet aggregation activity. To characterize the anti-cancer activity elicited by blocking CD47, the mAbs were cloned into effector function silent and competent Fc backbones. Effector function competent mAbs demonstrated potent activity in vitro and in vivo, while effector function silent mAbs demonstrated minimal activity, indicating that blocking CD47 only leads to a therapeutic effect in the presence of Fc effector function. A non-human primate study revealed that the effector function competent mAb IgG1 C47B222-(CHO) decreased red blood cells (RBC), hematocrit and hemoglobin by >40% at 1 mg/kg, whereas the effector function silent mAb IgG2σ C47B222-(CHO) had minimal impact on RBC indices at 1 and 10 mg/kg. Taken together, our findings suggest that targeting CD47 is an attractive therapeutic anti-cancer approach. However, the anti-cancer activity observed with anti-CD47 mAbs is Fc effector dependent as are the side effects observed on RBC indices. PMID:28234345

  13. White/blue-emitting, water-dispersible CdSe quantum dots prepared by counter ion-induced polymer collapse

    NASA Astrophysics Data System (ADS)

    Wang, Jing; Goh, Jane Betty; Goh, M. Cynthia; Giri, Neeraj Kumar; Paige, Matthew F.

    2015-09-01

    The synthesis and characterization of water-dispersible, luminescent CdSe/ZnS semiconductor quantum dots that exhibit nominal "white" fluorescence emission and have potential applications in solid-state lighting is described. The nanomaterials, prepared through counter ion-induced collapse and UV cross-linking of high-molecular weight polyacrylic acid in the presence of appropriate aqueous inorganic ions, were of ∼2-3 nm diameter and could be prepared in gram quantities. The quantum dots exhibited strong luminescence emission in two bands, the first in the blue-region (band edge) of the optical spectrum and the second, a broad emission in the red-region (attributed to deep trap states) of the optical spectrum. Because of the relative strength of emission of the band edge and deep trap state luminescence, it was possible to achieve visible white luminescence from the quantum dots in aqueous solution and in dried, solid films. The optical spectroscopic properties of the nanomaterials, including ensemble and single-molecule spectroscopy, was performed, with results compared to other white-emitting quantum dot systems described previously in the literature.

  14. Effect of electron transport properties on unipolar CdZnTe radiation detectors: LUND, SpectrumPlus, and Coplanar Grid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ralph B. James

    2000-01-07

    Device simulations of (1) the laterally-contacted-unipolar-nuclear detector (LUND), (2) the SpectrumPlus, (3) and the coplanar grid made of Cd{sub 0.9}Zn{sub 0.1}Te (CZT) were performed for {sup 137}Cs irradiation by 662.15 keV gamma-rays. Realistic and controlled simulations of the gamma-ray interactions with the CZT material were done using the MCNP4B2 Monte Carlo program, and the detector responses were simulated using the Sandia three-dimensional multielectrode simulation program (SandTMSP). The simulations were done for the best and the worst expected carrier nobilities and lifetimes of currently commercially available CZT materials for radiation detector applications. For the simulated unipolar devices, the active device volumesmore » were relatively large and the energy resolutions were fairly good, but these performance characteristics were found to be very sensitive to the materials properties. The internal electric fields, the weighting potentials, and the charge induced efficiency maps were calculated to give insights into the operation of these devices.« less

  15. CD73-Generated Adenosine Is Critical for Immune Regulation during Toxoplasma gondii Infection

    PubMed Central

    Mahamed, Deeqa A.; Toussaint, Leon E.

    2014-01-01

    As an obligate intracellular pathogen, the apicomplexan parasite Toxoplasma gondii evades immune system-mediated clearance by undergoing stage differentiation to persist indefinitely in susceptible hosts. Previously, we found that mice deficient in the ectoenzyme CD73, which generates adenosine in the extracellular matrix, were resistant to chronic toxoplasmosis after oral infection with T. gondii. Resistance in CD73 knockout mice was due to a delay in parasite differentiation in the central nervous system (CNS). To further clarify the role of CD73 and extracellular adenosine in T. gondii pathogenesis, we infected wild-type (WT) and CD73−/− mice with T. gondii cysts systemically by the intraperitoneal (i.p.) route. In contrast to oral infection, i.p. infected CD73−/− mice were highly susceptible to immune-mediated pathology, with significantly increased infiltration of neutrophils and T cells into the peritoneal cavity. Administration of the broad-spectrum adenosine receptor agonist 5′-N-ethylcarboxamidoadenosine (NECA) protected CD73−/− mice against T. gondii-induced immunopathology, suggesting that the absence of CD73-generated adenosine led to the increased susceptibility in these mice. Peritoneal exudate cells from infected CD73−/− mice produced higher levels of the inflammatory mediators nitric oxide, tumor necrosis factor alpha (TNF-α), and interleukin-1β (IL-1β), without enhanced parasite killing or clearance. Bone marrow chimeras established that CD73 expression in both hematopoietic and nonhematopoietic compartments contributes to limiting T. gondii-induced immunopathology. In addition, mice deficient in the adenosine receptor A2A were more susceptible to immunopathology during intraperitoneal infection with T. gondii than WT mice. Thus, extracellular adenosine is a key immune regulator that limits collateral tissue damage due to an intracellular pathogen and promotes host survival. PMID:25452548

  16. HIV skews the lineage-defining transcriptional profile of Mycobacterium tuberculosis-specific CD4+ T cells

    PubMed Central

    Riou, Catherine; Strickland, Natalie; Soares, Andreia P.; Corleis, Bjorn; Kwon, Douglas; Wherry, E. John; Wilkinson, Robert J.; Burgers, Wendy A.

    2016-01-01

    HIV-infected persons are at greater risk of developing tuberculosis (TB) even before profound CD4 loss occurs, suggesting that HIV alters CD4+T cell functions capable of containing bacterial replication. An effective immune response to Mycobacterium tuberculosis likely relies on the development of a balanced CD4 response, where distinct CD4+T helper subsets act in synergy to control the infection. To define the diversity of Mtb-specific CD4+Th subsets and determine whether HIV infection impacts such responses, the expression of lineage-defining transcription factors T-bet, Gata3, RORγt and Foxp3 was measured in Mtb-specific CD4+T cells in HIV-uninfected (n=20) and HIV-infected individuals (n=20) with latent TB infection. Our results show that upon 5 day restimulation in vitro, Mtb-specific CD4+T cells from healthy individuals have the ability to exhibit a broad spectrum of T helper subsets, defined by specific patterns of transcription factor co-expression. These transcription factor profiles were skewed in HIV-infected individuals where the proportion of T-bethighFoxp3+ Mtb-specific CD4+T cells was significantly decreased (p=0.002) compared to HIV-uninfected individuals, a change that correlated inversely with HIV viral load (p=0.0007) and plasma TNF-α (p=0.027). Our data demonstrate an important balance in T helper subset diversity defined by lineage-defining transcription factor co-expression profiles that is disrupted by HIV infection and suggest a role for HIV in impairing TB immunity by altering the equilibrium of Mtb-specific CD4+T helper subsets. PMID:26927799

  17. A staggered-grid convolutional differentiator for elastic wave modelling

    NASA Astrophysics Data System (ADS)

    Sun, Weijia; Zhou, Binzhong; Fu, Li-Yun

    2015-11-01

    The computation of derivatives in governing partial differential equations is one of the most investigated subjects in the numerical simulation of physical wave propagation. An analytical staggered-grid convolutional differentiator (CD) for first-order velocity-stress elastic wave equations is derived in this paper by inverse Fourier transformation of the band-limited spectrum of a first derivative operator. A taper window function is used to truncate the infinite staggered-grid CD stencil. The truncated CD operator is almost as accurate as the analytical solution, and as efficient as the finite-difference (FD) method. The selection of window functions will influence the accuracy of the CD operator in wave simulation. We search for the optimal Gaussian windows for different order CDs by minimizing the spectral error of the derivative and comparing the windows with the normal Hanning window function for tapering the CD operators. It is found that the optimal Gaussian window appears to be similar to the Hanning window function for tapering the same CD operator. We investigate the accuracy of the windowed CD operator and the staggered-grid FD method with different orders. Compared to the conventional staggered-grid FD method, a short staggered-grid CD operator achieves an accuracy equivalent to that of a long FD operator, with lower computational costs. For example, an 8th order staggered-grid CD operator can achieve the same accuracy of a 16th order staggered-grid FD algorithm but with half of the computational resources and time required. Numerical examples from a homogeneous model and a crustal waveguide model are used to illustrate the superiority of the CD operators over the conventional staggered-grid FD operators for the simulation of wave propagations.

  18. Markers of activated inflammatory cells correlate with severity of liver damage in children with nonalcoholic fatty liver disease.

    PubMed

    De Vito, Rita; Alisi, Anna; Masotti, Andrea; Ceccarelli, Sara; Panera, Nadia; Citti, Arianna; Salata, Michele; Valenti, Luca; Feldstein, Ariel E; Nobili, Valerio

    2012-07-01

    Concomitantly to the obesity epidemic, nonalcoholic fatty liver disease (NAFLD) has become the leading cause of liver disease in children. NAFLD encompasses a spectrum of histological damage ranging from simple steatosis to nonalcoholic steatohepatitis (NASH), with possible progression to cirrhosis. There is growing evidence that the immune system plays a pivotal role in the initiation and progression to NASH but the cellular nature of the hepatic inflammation is still unknown. The present study includes 34 children with biopsy-proven NAFLD. Liver damage was evaluated by the NAFLD activity score (NAS), and the inflammatory infiltrate was characterized by immunohistochemistry for CD45, CD3 and CD163 which are markers of leukocytes, T cells and activated Kupffer cells/macrophages, respectively. Our results have shown that CD45+ (P<0.0001) and CD163+ (P<0.0001) cells were markedly increased in children with severe histological activity (NAS≥5) compared to children with lower activity (NAS<5), whereas CD3+ cells were significantly lower (P<0.01) in children with severe histological activity. There was a significant association between the numbers of CD45+, CD3+ and CD163+ cells, regarding both the portal tract and liver lobule, and the severity of steatosis, ballooning and fibrosis (P<0.01). These data suggest that the severity and composition of the inflammatory infiltrate correlate with steatosis and the severity of disease in children with NAFLD. Moreover, a decrease in CD3+ cells may be involved in the pathogenesis of liver damage. Future studies should evaluate whether it can predict the progression of liver disease independently of established histological scores.

  19. Assessment of combined toxicity of heavy metals from industrial wastewaters on Photobacterium phosphoreum T3S

    NASA Astrophysics Data System (ADS)

    Zeb, BibiSaima; Ping, Zheng; Mahmood, Qaisar; Lin, Qiu; Pervez, Arshid; Irshad, Muhammad; Bilal, Muhammad; Bhatti, Zulfiqar Ahmad; Shaheen, Shahida

    2017-07-01

    This research work is focusing on the toxicities of heavy metals of industrial origin to anaerobic digestion of the industrial wastewater. Photobacterium phosphoreum T3S was used as an indicator organism. The acute toxicities of heavy metals on P. phosphoreum T3S were assessed during 15-min half inhibitory concentration (IC50) as indicator at pH 5.5-6. Toxicity assays involved the assessment of multicomponent mixtures using TU and MTI approaches. The results of individual toxicity indicated that the toxicity of Cd, Cu and Pb on P. phosphoreum increased with increasing concentrations and there was a linear correlation. The 15-min IC50 values of Cd, Cu and Pb were 0.537, 1.905 and 1.231 mg/L, respectively, and their toxic order was Cd > Pb > Cu. The combined effects of Cd, Cu and Pb were assayed by equivalent concentration mixing method. The results showed that the combined effects of Cd + Cu, Cd + Pb, Cu + Pb, Cd + Cu + Pb were antagonistic, antagonistic and partly additive. The combined effect of three heavy metals was partly additive.

  20. Photoluminescence and contactless electroreflectance characterization of BexCd1-xSe alloys

    NASA Astrophysics Data System (ADS)

    Huang, P. J.; Huang, Y. S.; Firszt, F.; Meczynska, H.; Maksimov, O.; Tamargo, M. C.; Tiong, K. K.

    2007-01-01

    A detailed optical characterization of a Bridgman-grown wurtzite- (WZ-) type Be0.075Cd0.925Se mixed crystal and three zinc-blende (ZB) BexCd1-xSe epilayers grown by MBE on InP substrates has been carried out via photoluminescence (PL) and contactless electroreflectance (CER) in the temperature range of 15-400 K. The PL spectrum of the WZ-BeCdSe at low temperature consists of an exciton line, an edge emission feature due to recombination of donor-acceptor pairs, and a broad band related to recombination through deep-level defects, while the PL emission peaks of the ZB-BeCdSe epilayers show an asymmetric shape with a tail on the low-energy side. Various interband transitions, originating from the band edge and spin-orbit splitting critical points, of the samples have been observed in the CER spectra. The peak positions of the exciton emission lines in the PL spectra correspond quite well to the energies of the fundamental transitions determined from electromodulation data. The parameters that describe the temperature dependence of the fundamental and spin split-off bandgaps and the broadening function of the band-edge exciton are evaluated and discussed.

  1. Enhancing the photovoltaic performance of CdTe/CdS solar cell via luminescent downshifting using K{sub 2}SiF{sub 6}:Mn{sup 4+} phosphors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Talewar, R. A., E-mail: talewarrupesh@gmail.com; Joshi, C. P.; Moharil, S. V.

    2016-05-23

    The efficiency of CdTe/CdS solar cell can be significantly improved by using luminescent down-shifting material on their front surface. Taking this into account a red emitting phosphor K{sub 2}Si{sub 1-x}F{sub 6}:xMn{sup 4+} (x=10 to 25 mol %) has been synthesized through wet chemical method. The as-synthesized materials were characterized by powder x-ray diffraction (XRD) and photoluminescence (PL) techniques. The photoluminescence studies of K{sub 2}SiF{sub 6}:Mn{sup 4+} revealed enhancement in the emission intensity, when Mn{sup 4+} concentration was increased from 10 mol % to 25 mol %. This red emitting phosphor efficiently absorbs the photons typically in the region 300-500 nmmore » and re-emits in the region where the photovoltaic device exhibits significantly better response. The results show the possibility of enhancing the photovoltaic conversion efficiency of CdTe thin film solar cell by modifying the absorption spectra and utilising the energy in the UV-blue part of the solar spectrum.« less

  2. Notizen: Non-coincidence of Isotropic and Anisotropic Raman Spectra of the v3 Mode of the CH3F/CD3F System

    NASA Astrophysics Data System (ADS)

    Newberg, I. L.; Gee, C. M.; Thurmond, G. D.; Yen, H. W.

    1990-12-01

    It has been proved with the aid of CH3F/CD3F mixtures that the remarkably large non-coincidence effect in the Raman scattering spectrum of the v3 mode of liquid methyl fluoride is due to intermolecular vibrational coupling mediated mainly by transition dipole interaction. The amount of the effect and its temperature and mole fraction dependence are - at least qualitatively - in agreement with Logan's theoretical concept. The rather different behaviour of the isotopic species and the asymmetry and narrow width of the isotropic band, however, raise new questions which require further investigations.

  3. Oral lichen planus: An update on pathogenesis and treatment

    PubMed Central

    Lavanya, N; Jayanthi, P; Rao, Umadevi K; Ranganathan, K

    2011-01-01

    Oral lichen planus (OLP) is a chronic inflammatory disease that affects the mucus membrane of the oral cavity. It is a T-cell mediated autoimmune disease in which the cytotoxic CD8+ T cells trigger apoptosis of the basal cells of the oral epithelium. Several antigen-specific and nonspecific inflammatory mechanisms have been put forward to explain the accumulation and homing of CD8+ T cells subepithelially and the subsequent keratinocyte apoptosis. A wide spectrum of treatment modalities is available, from topical corticosteroids to laser ablation of the lesion. In this review, we discuss the various concepts in the pathogenesis and current treatment modalities of OLP. PMID:22529568

  4. Distribution and bioavailability of cadmium in ornithogenic coral-sand sediments of the Xisha archipelago, South China Sea.

    PubMed

    Liu, Xiaodong; Lou, Chuangneng; Xu, Liqiang; Sun, Liguang

    2012-09-01

    Total cadmium (Cd) concentrations in four ornithogenic coral-sand sedimentary profiles displayed a strong positive correlation with guano-derived phosphorus, but had no correlation with plant-originated organic matter in the top sediments. These results indicate that the total Cd distributions were predominantly controlled by guano input. Bioavailable Cd and zinc (Zn) had a greater input rate in the top sediments with respect to total Cd and total Zn, and a positive correlation with total organic carbon (TOC) derived from plant humus. Multi-regression analysis showed that the total Cd and TOC explained over 80% of the variation of bioavailable Cd, suggesting that both guano and plant inputs could significantly influence the distribution of bioavailable Cd, and that plant biocycling processes contribute more to the recent increase of bioavailable Cd. A pollution assessment indicates that the Yongle archipelago is moderately to strongly polluted with guano-derived Cd. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Edwards, Joshua R.; Prozialeck, Walter C.

    Recent epidemiological studies suggest a positive association between exposure to the environmental pollutant cadmium (Cd) and the incidence and severity of diabetes. In this review, we examine the literature suggesting a relationship between Cd exposure, elevated blood glucose levels, and the development of diabetes. In addition we review human and animal studies indicating that Cd potentiates or exacerbates diabetic nephropathy. We also review the various possible cellular mechanisms by which Cd may alter blood glucose levels. In addition, we present some novel findings from our own laboratories showing that Cd elevates fasting blood glucose levels in an animal model ofmore » subchronic Cd exposure before overt signs of renal dysfunction are evident. These studies also show that Cd reduces insulin levels and has direct cytotoxic effects on the pancreas. Together, these findings indicate that Cd may be a factor in the development of some types of diabetes and they raise the possibility that Cd and diabetes-related hyperglycemia may act synergistically to damage the kidney.« less

  6. Expression and prognostic value of soluble CD97 and its ligand CD55 in intrahepatic cholangiocarcinoma.

    PubMed

    Meng, Ze-Wu; Liu, Min-Chao; Hong, Hai-Jie; Du, Qiang; Chen, Yan-Ling

    2017-03-01

    The incidence rate of intrahepatic cholangiocarcinoma is rising, and treatment options are limited. Therefore, new biological markers of intrahepatic cholangiocarcinoma are needed. Immunohistochemistry and enzyme-linked immunosorbent assay were applied to analyze the expressions of CD97, CD55, and soluble CD97 in 71 patients with intrahepatic cholangiocarcinoma and 10 patients with hepatolithiasis. CD97 and CD55 were not expressed in hepatolithiatic tissues, but positive expression was observed in 76.1% (54/71) and 70.4% (50/71) of intrahepatic cholangiocarcinoma patients. The univariate analyses indicated that the positive expressions of CD97 and CD55 were related to short intrahepatic cholangiocarcinoma survival of patients (both p = 0.001). Furthermore, CD97 and CD55 expressions and biliary soluble CD97 levels were significantly associated with histological grade (p = 0.004, 0.002, and 0.012, respectively), lymph node metastases (p = 0.020, 0.038, and 0.001, respectively), and venous invasion (p = 0.003, 0.002, and 0.001, respectively). The multivariate analyses indicated that lymph node metastases (hazard ratio: 2.407, p = 0.003), positive CD55 expression (hazard ratio: 4.096, p = 0.003), and biliary soluble CD97 levels (hazard ratio: 2.434, p = 0.002) were independent risk factors for the intrahepatic cholangiocarcinoma survival. The receiver operating characteristic (ROC) curve analysis indicated that when the cutoff values of biliary soluble CD97 were 1.15 U/mL, the diagnostic value for predicting lymph node metastasis had a sensitivity of 87.5% and a specificity of 51.3%. For intrahepatic cholangiocarcinoma patient death within 60 months at a cutoff value of 0.940 U/mL, the diagnostic value sensitivity was 89.3% and the specificity was 93.3%. Biliary soluble CD97 may be a new biological marker for early diagnosis, prediction of lymph node metastasis and poor prognosis, and discovery of a therapeutic target.

  7. Malate secretion from the root system is an important reason for higher resistance of Miscanthus sacchariflorus to cadmium.

    PubMed

    Guo, Haipeng; Feng, Xue; Hong, Chuntao; Chen, Houming; Zeng, Fanrong; Zheng, Bingsong; Jiang, Dean

    2017-03-01

    Miscanthus is a vigorous perennial Gramineae genus grown throughout the world as a promising bioenergy crop and generally regarded as heavy metal tolerant due to its ability to absorb heavy metals. However, little is known about the mechanism for heavy metal tolerance in Miscanthus. In this study, two Miscanthus species (Miscanthus sacchariflorus and Miscanthus floridulus) exhibiting different cadmium (Cd) sensitivity were used to address the mechanisms of Cd tolerance. Under the same Cd stress, M. sacchariflorus showed higher Cd tolerance with better growth and lower Cd accumulation in both shoots and roots than M. floridulus. The malate (MA) content significantly increased in root exudates of M. sacchariflorus following Cd treatment while it was almost unchanged in M. floridulus. Cellular Cd analysis and flux data showed that exogenous MA application markedly restricted Cd influx and accumulation while an anion-channel inhibitor (phenylglyoxal) effectively blocked Cd-induced MA secretion and increased Cd influx in M. sacchariflorus, indicating that MA secretion could alleviate Cd toxicity by reducing Cd uptake. The genes of malate dehydrogenases (MsMDHs) and Al-activated malate transporter 1 (MsALMT1) in M. sacchariflorus were highly upregulated under Cd stress, compared with that in M. floridulus. The results indicate that Cd-induced MA synthesis and secretion efficiently alleviate Cd toxicity by reducing Cd influx in M. sacchariflorus. © 2016 Scandinavian Plant Physiology Society.

  8. Human Peripheral Blood Mononuclear Cells Exhibit Heterogeneous CD52 Expression Levels and Show Differential Sensitivity to Alemtuzumab Mediated Cytolysis

    PubMed Central

    Rao, Sambasiva P.; Sancho, Jose; Campos-Rivera, Juanita; Boutin, Paula M.; Severy, Peter B.; Weeden, Timothy; Shankara, Srinivas; Roberts, Bruce L.; Kaplan, Johanne M.

    2012-01-01

    Alemtuzumab is a monoclonal antibody that targets cell surface CD52 and is effective in depleting lymphocytes by cytolytic effects in vivo. Although the cytolytic effects of alemtuzumab are dependent on the density of CD52 antigen on cells, there is scant information regarding the expression levels of CD52 on different cell types. In this study, CD52 expression was assessed on phenotypically distinct subsets of lymphoid and myeloid cells in peripheral blood mononuclear cells (PBMCs) from normal donors. Results demonstrate that subsets of PBMCs express differing levels of CD52. Quantitative analysis showed that memory B cells and myeloid dendritic cells (mDCs) display the highest number while natural killer (NK) cells, plasmacytoid dendritic cells (pDCs) and basophils have the lowest number of CD52 molecules per cell amongst lymphoid and myeloid cell populations respectively. Results of complement dependent cytolysis (CDC) studies indicated that alemtuzumab mediated profound cytolytic effects on B and T cells with minimal effect on NK cells, basophils and pDCs, correlating with the density of CD52 on these cells. Interestingly, despite high CD52 levels, mDCs and monocytes were less susceptible to alemtuzumab-mediated CDC indicating that antigen density alone does not define susceptibility. Additional studies indicated that higher expression levels of complement inhibitory proteins (CIPs) on these cells partially contributes to their resistance to alemtuzumab mediated CDC. These results indicate that alemtuzumab is most effective in depleting cells of the adaptive immune system while leaving innate immune cells relatively intact. PMID:22761788

  9. Social anxiety in Cornelia de Lange syndrome.

    PubMed

    Richards, Caroline; Moss, Jo; O'Farrell, Laura; Kaur, Gurmeash; Oliver, Chris

    2009-08-01

    In this study we assessed the behavioral presentation of social anxiety in Cornelia de Lange syndrome (CdLS) using a contrast group of Cri du Chat syndrome (CdCS). Behaviors indicative of social anxiety were recorded in twelve children with CdLS (mean age = 11.00; SD = 5.15) and twelve children with CdCS (8.20; SD = 2.86) during social interaction. Lag sequential analysis revealed that participants with CdLS were significantly more likely to evidence behavior indicative of anxiety in close temporal proximity to the point at which they maintained eye contact or spoke. Individuals with CdLS demonstrate a heightened probability of anxiety related behavior during social interaction but only at the point at which social demand is high.

  10. Chino del tomate virus:Relationships to Other Begomoviruses and Identification of A-Component Variants that Affect Symptom Expression.

    PubMed

    Brown, J K; Ostrow, K M; Idris, A M; Stenger, D C

    2000-05-01

    Phylogenetic and distance analyses place Chino del tomate virus (CdTV) in the New World clade of begomoviruses and indicate that CdTV and Tomato leaf crumple virus (TLCrV) are closely related strains of the same virus. One cloned CdTV A component (pCdTV-H6), when inoculated to tomato with the B component (pCdTV-B52), produced mild symptoms and low DNA titers. Another cloned CdTV A component (pCdTV-H8), when coinoculated to tomato with the B component, produced moderate leaf curling and veinal chlorosis similar to that of TLCrV. Coinoculation of both CdTV A components and the B component to tomato produced wild-type chino del tomate (CdT) disease symptoms consisting of severe leaf curling, veinal and interveinal chlorosis, and stunting. The two CdTV A components were nearly identical, except at nucleotide positions 1,722 and 2,324. The polymorphism at nucleotide 1,722 resulted in a change at Rep amino acid 261. The second polymorphism at nucleotide 2,324 resulted in changes at Rep amino acid 60 and AC4 amino acid 10. Two chimeric A components constructed by reciprocal exchange of a fragment bearing the polymorphic site at nucleotide 1,722 were evaluated for symptom phenotype. One chimeric A component (pCdTV-H86) produced wild-type CdT symptoms when coinoculated to tomato with the B component. The reciprocal chimeric A component (pCdTV-H68), when coin-oculated to tomato with the B component, also produced severe leaf curling, veinal chlorosis, and stunting. However, pCdTV-H68 induced less obvious interveinal chlorosis than wild-type or pCdTV-H86. Examination of A component genotypes recovered from tomato coinoculated with pCdTV-H6 and pCdTV-H8 indicated that recombination occurred to produce a genotype identical to pCdTV-H86. These results indicate that subtle genotypic variation has significant effects on symptom expression and may explain phenotypic differences observed among isolates and cloned DNAs of CdTV and TLCrV.

  11. Comparison of heavy metal contamination during the last decade along the coastal sediment of Pakistan: Multiple pollution indices approach.

    PubMed

    Saher, Noor Us; Siddiqui, Asmat Saleem

    2016-04-15

    Heavy metals concentrations (Fe, Cu, Zn, Ni, Cr, Co, Pb, and Cd) were scrutinized during two monitoring years (2001 and 2011) in the coastal sediment of Pakistan. The status of metal contamination in coastal sediment was interpreted using sediment quality guidelines, and single and combined metal pollution indices. Ni, Cr, and Cd were recognized for their significant (p<0.05) intensification in the sediment during the last decade. Sediment quality guidelines recognized the frequent adverse biological effect of Ni and the occasional adverse biological effect of Cu, Cr, Pb and Cd. Single metal pollution indices (Igeo, EF, CF, and ER) revealed that sediment pollution is predominantly caused by Pb and Cd. Low to moderate contamination was appraised along the coast by multi-metal pollution indices (CD and PERI). Correlation study specifies that heavy metals were presented diverse affiliations and carriers for distribution in the sediment during the last decade. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. The Probiotic Compound VSL#3 Modulates Mucosal, Peripheral, and Systemic Immunity Following Murine Broad-Spectrum Antibiotic Treatment

    PubMed Central

    Ekmekciu, Ira; von Klitzing, Eliane; Fiebiger, Ulrike; Neumann, Christian; Bacher, Petra; Scheffold, Alexander; Bereswill, Stefan; Heimesaat, Markus M.

    2017-01-01

    There is compelling evidence linking the commensal intestinal microbiota with host health and, in turn, antibiotic induced perturbations of microbiota composition with distinct pathologies. Despite the attractiveness of probiotic therapy as a tool to beneficially alter the intestinal microbiota, its immunological effects are still incompletely understood. The aim of the present study was to assess the efficacy of the probiotic formulation VSL#3 consisting of eight distinct bacterial species (including Streptococcus thermophilus, Bifidobacterium breve, B. longum, B. infantis, Lactobacillus acidophilus, L. plantarum, L. paracasei, and L. delbrueckii subsp. Bulgaricus) in reversing immunological effects of microbiota depletion as compared to reassociation with a complex murine microbiota. To address this, conventional mice were subjected to broad-spectrum antibiotic therapy for 8 weeks and perorally reassociated with either VSL#3 bacteria or a complex murine microbiota. VSL#3 recolonization resulted in restored CD4+ and CD8+ cell numbers in the small and large intestinal lamina propria as well as in B220+ cell numbers in the former, whereas probiotic intervention was not sufficient to reverse the antibiotic induced changes of respective cell populations in the spleen. However, VSL#3 application was as efficient as complex microbiota reassociation to attenuate the frequencies of regulatory T cells, activated dendritic cells and memory/effector T cells in the small intestine, colon, mesenteric lymph nodes, and spleen. Whereas broad-spectrum antibiotic treatment resulted in decreased production of cytokines such as IFN-γ, IL-17, IL-22, and IL-10 by CD4+ cells in respective immunological compartments, VSL#3 recolonization was sufficient to completely recover the expression of the anti-inflammatory cytokine IL-10 without affecting pro-inflammatory mediators. In summary, the probiotic compound VSL#3 has an extensive impact on mucosal, peripheral, and systemic innate as well as adaptive immunity, exerting beneficial anti-inflammatory effects in intestinal as well as systemic compartments. Hence, VSL#3 might be considered a therapeutic immunomodulatory tool following antibiotic therapy. PMID:28529928

  13. Association between red blood cell indices and CD4 count in HIV-positive reproductive women

    NASA Astrophysics Data System (ADS)

    Lumbanraja, S. N.; Siregar, D. I. S.

    2018-03-01

    Red blood cell indices, hemoglobin, and hematocrit reflect rapidity of HIV disease progression. This study aims to determine red blood cell indices and CD4 count in HIV-positive reproductive women. This study was a cross sectional study conducted at AIDS outpatient clinic at Haji Adam Malik General Hospital, Medan Indonesia. All seropositive reproductive women within antiretroviral therapy consented for blood count and CD4 examination. Data were collected and analyzed with SPSS 19. In subjects with CD4≤350 mm3, mean hemoglobin was 10.95 ± 2.01, hematocrit was 31.83 ± 5.04%, MCV was 84.17 ± 11.41, MCH was 25.98 ± 2.65, and MCHC was 32.18 ± 2.17. Mean hemoglobin, hematocrit, and MCH value was significantly lower in subjects with CD4 ≤350 mm3 (p=0.014; p=0.001; p=0.01; respectively). Lower Hb, Ht, and MCH associated with thelower CD4 count.

  14. Application of path analysis to urinary findings of cadmium-induced renal dysfunction.

    PubMed

    Abe, T; Kobayashi, E; Okubo, Y; Suwazono, Y; Kido, T; Shaikh, Z A; Nogawa, K

    2001-01-01

    In order to identify some causal relations among various urinary indices of cadmium-induced renal dysfunction, such as glucose, total protein, amino nitrogen, beta 2-microglobulin (beta 2-m), metallothionein (MT), and cadmium (Cd), we applied path analysis method to previous epidemiological studies targeting the residents of the Cd-polluted Kakehashi River basin of Ishikawa Prefecture, Japan. We obtained a diagram-termed path model, representing some causal relations among the above urinary indices. It shows that urinary Cd is located at the beginning point in the diagram, and Cd-induced renal dysfunction develops in the following order: Cd exposure-->increase of beta 2-m and/or MT excretion-->increase of amino-N and/or total protein excretion-->increase of glucose excretion. It was proved mathematically, that in the case of both males and females, increased excretions of beta 2-m and/or MT were the most sensitive urinary indices of the early stage of chronic Cd-induced renal dysfunction.

  15. Sugarcane juice derived carbon dot–graphitic carbon nitride composites for bisphenol A degradation under sunlight irradiation

    PubMed Central

    Wong, Jing Lin; Hak, Chen Hong; Tai, Jun Yan; Leong, Kah Hon; Saravanan, Pichiah

    2018-01-01

    Carbon dots (CDs) and graphitic carbon nitride (g-C3N4) composites (CD/g-C3N4) were successfully synthesized by a hydrothermal method using urea and sugarcane juice as starting materials. The chemical composition, morphological structure and optical properties of the composites and CDs were characterized using various spectroscopic techniques as well as transmission electron microscopy. X-ray photoelectron spectroscopy (XPS) results revealed new signals for carbonyl and carboxyl groups originating from the CDs in CD/g-C3N4 composites while X-ray diffraction (XRD) results showed distortion of the host matrix after incorporating CDs into g-C3N4. Both analyses signified the interaction between g-C3N4 and CDs. The photoluminescence (PL) analysis indicated that the presence of too many CDs will create trap states at the CD/g-C3N4 interface, decelerating the electron (e−) transport. However, the CD/g-C3N4(0.5) composite with the highest coverage of CDs still achieved the best bisphenol A (BPA) degradation rate at 3.87 times higher than that of g-C3N4. Hence, the charge separation efficiency should not be one of the main factors responsible for the enhancement of the photocatalytic activity of CD/g-C3N4. Instead, the light absorption capability was the dominant factor since the photoreactivity correlated well with the ultraviolet–visible diffuse reflectance spectra (UV–vis DRS) results. Although the CDs did not display upconversion photoluminescence (UCPL) properties, the π-conjugated CDs served as a photosensitizer (like organic dyes) to sensitize g-C3N4 and injected electrons to the conduction band (CB) of g-C3N4, resulting in the extended absorption spectrum from the visible to the near-infrared (NIR) region. This extended spectral absorption allows for the generation of more electrons for the enhancement of BPA degradation. It was determined that the reactive radical species responsible for the photocatalytic activity were the superoxide anion radical (O2 •−) and holes (h+) after performing multiple scavenging tests. PMID:29515949

  16. Effects of cadmium-spiked sediment on cadmium accumulation and bioturbation by nymphs of the burrowing mayfly Hexagenia bilineata

    USGS Publications Warehouse

    Bartsch, Michelle; Cope, W. Gregory; Rada, Ronald G.

    1999-01-01

    We assessed accumulation of cadmium (Cd) and bioturbation by nymphs of the burrowing mayfly Hexagenia bilineata as indicators of exposure to Cd-spiked sediment in a 21-d test. Surficial sediments (top 5 cm) from Pool 7 of the Upper Mississippi River were spiked with Cd to concentrations of 3, 7, and 15 µg Cd g-1 dry weight. The experimental design was completely randomized, with three Cd-spiked sediment treatments plus an unspiked sediment control (1 µg Cd g-1 dry weight), and 10 nymphs in each of six replicates per treatment. Nymphs accumulated Cd during the 21-d exposure; mean concentrations varied from 0.22 to 6.24 µg g-1 dry weight, and tissue concentrations were correlated with Cd concentration in unfiltered test water (r = 0.93, P -1 treatment (our greatest exposure concentration) did not differ significantly from the control. Concentrations of Cd in unfiltered, overlying test water increased significantly within treatments during the test, indicating that nymphs mobilized sediment-associated Cd into the overlying water, presumably through burrowing and respiratory activities.

  17. Study on the interaction of antiviral drug 'Tenofovir' with human serum albumin by spectral and molecular modeling methods

    NASA Astrophysics Data System (ADS)

    Shahabadi, Nahid; Hadidi, Saba; Feizi, Foroozan

    2015-03-01

    This study was designed to examine the interaction of Tenofovir (Ten) with human serum albumin (HSA) under physiological conditions. The binding of drugs with human serum albumin is a crucial factor influencing the distribution and bioactivity of drugs in the body. To understand the action mechanisms between Ten and HSA, the binding of Ten with HSA was investigated by a combined experimental and computational approach. UV-vis results confirmed that Ten interacted with HSA to form a ground-state complex and values of the Stern-Volmer quenching constant indicate the presence of a static component in the quenching mechanism. As indicated by the thermodynamic parameters (positive ΔH and ΔS values), hydrophobic interaction plays a major role in the Ten-HSA complex. Through the site marker competitive experiment, Ten was confirmed to be located in site I of HSA. Furthermore, UV-vis absorption spectra, synchronous fluorescence spectrum and CD data were used to investigate the structural change of HSA molecules with addition of Ten, the results indicate that the secondary structure of HSA molecules was changed in the presence of Ten. The experimental results were in agreement with the results obtained via molecular docking study.

  18. Fermi Large Area Telescope Observations Of Misaligned Active Galactic Nuclei

    DOE PAGES

    Abdo, A. A.

    2010-08-13

    Analysis is presented for 15 months of data taken with the Large Area Telescope (LAT) on the Fermi Gamma-ray Space Telescope for 11 non-blazar active galactic nuclei (AGNs), including seven FRI radio galaxies and four FRII radio sources consisting of two FRII radio galaxies and two steep spectrum radio quasars. The broad line FRI radio galaxy 3C 120 is reported here as a γ-ray source for the first time. The analysis is based on directional associations of LAT sources with radio sources in the 3CR, 3CRR, and MS4 (collectively referred to as 3C-MS) catalogs. Seven of the eleven LAT sourcesmore » associated with 3C-MS radio sources have spectral indices larger than 2.3 and, except for the FRI radio galaxy NGC 1275 that shows possible spectral curvature, are well described by a power law. No evidence for time variability is found for any sources other than NGC 1275. The γ-ray luminosities of FRI radio galaxies are significantly smaller than those of the BL Lac objects detected by the LAT, whereas the γ-ray luminosities of the FRII sources are quite similar to those of FSRQs, which could reflect different beaming factors for the γ-ray emission. A core dominance (CD) study of the 3CRR sample indicates that sources closer to the jet axis are preferentially detected with the Fermi LAT, insofar as the γ-ray-detected misaligned AGNs have larger CD at a given average radio flux. The results are discussed in view of the AGN unification scenario.« less

  19. Fermi Large Area Telescope Observations of Misaligned Active Galactic Nuclei

    NASA Astrophysics Data System (ADS)

    Abdo, A. A.; Ackermann, M.; Ajello, M.; Baldini, L.; Ballet, J.; Barbiellini, G.; Bastieri, D.; Bechtol, K.; Bellazzini, R.; Berenji, B.; Blandford, R. D.; Bloom, E. D.; Bonamente, E.; Borgland, A. W.; Bouvier, A.; Brandt, T. J.; Bregeon, J.; Brez, A.; Brigida, M.; Bruel, P.; Buehler, R.; Burnett, T. H.; Buson, S.; Caliandro, G. A.; Cameron, R. A.; Cannon, A.; Caraveo, P. A.; Carrigan, S.; Casandjian, J. M.; Cavazzuti, E.; Cecchi, C.; Çelik, Ö.; Celotti, A.; Charles, E.; Chekhtman, A.; Chen, A. W.; Cheung, C. C.; Chiang, J.; Ciprini, S.; Claus, R.; Cohen-Tanugi, J.; Colafrancesco, S.; Conrad, J.; Davis, D. S.; Dermer, C. D.; de Angelis, A.; de Palma, F.; Silva, E. do Couto e.; Drell, P. S.; Dubois, R.; Favuzzi, C.; Fegan, S. J.; Ferrara, E. C.; Fortin, P.; Frailis, M.; Fukazawa, Y.; Fusco, P.; Gargano, F.; Gasparrini, D.; Gehrels, N.; Germani, S.; Giglietto, N.; Giommi, P.; Giordano, F.; Giroletti, M.; Glanzman, T.; Godfrey, G.; Grandi, P.; Grenier, I. A.; Grove, J. E.; Guillemot, L.; Guiriec, S.; Hadasch, D.; Hayashida, M.; Hays, E.; Horan, D.; Hughes, R. E.; Jackson, M. S.; Jóhannesson, G.; Johnson, A. S.; Johnson, W. N.; Kamae, T.; Katagiri, H.; Kataoka, J.; Knödlseder, J.; Kuss, M.; Lande, J.; Latronico, L.; Lee, S.-H.; Lemoine-Goumard, M.; Llena Garde, M.; Longo, F.; Loparco, F.; Lott, B.; Lovellette, M. N.; Lubrano, P.; Madejski, G. M.; Makeev, A.; Malaguti, G.; Mazziotta, M. N.; McConville, W.; McEnery, J. E.; Michelson, P. F.; Migliori, G.; Mitthumsiri, W.; Mizuno, T.; Monte, C.; Monzani, M. E.; Morselli, A.; Moskalenko, I. V.; Murgia, S.; Naumann-Godo, M.; Nestoras, I.; Nolan, P. L.; Norris, J. P.; Nuss, E.; Ohsugi, T.; Okumura, A.; Omodei, N.; Orlando, E.; Ormes, J. F.; Paneque, D.; Panetta, J. H.; Parent, D.; Pelassa, V.; Pepe, M.; Persic, M.; Pesce-Rollins, M.; Piron, F.; Porter, T. A.; Rainò, S.; Rando, R.; Razzano, M.; Razzaque, S.; Reimer, A.; Reimer, O.; Reyes, L. C.; Roth, M.; Sadrozinski, H. F.-W.; Sanchez, D.; Sander, A.; Scargle, J. D.; Sgrò, C.; Siskind, E. J.; Smith, P. D.; Spandre, G.; Spinelli, P.; Stawarz, Ł.; Stecker, F. W.; Strickman, M. S.; Suson, D. J.; Takahashi, H.; Tanaka, T.; Thayer, J. B.; Thayer, J. G.; Thompson, D. J.; Tibaldo, L.; Torres, D. F.; Torresi, E.; Tosti, G.; Tramacere, A.; Uchiyama, Y.; Usher, T. L.; Vandenbroucke, J.; Vasileiou, V.; Vilchez, N.; Villata, M.; Vitale, V.; Waite, A. P.; Wang, P.; Winer, B. L.; Wood, K. S.; Yang, Z.; Ylinen, T.; Ziegler, M.

    2010-09-01

    Analysis is presented for 15 months of data taken with the Large Area Telescope (LAT) on the Fermi Gamma-ray Space Telescope for 11 non-blazar active galactic nuclei (AGNs), including seven FRI radio galaxies and four FRII radio sources consisting of two FRII radio galaxies and two steep spectrum radio quasars. The broad line FRI radio galaxy 3C 120 is reported here as a γ-ray source for the first time. The analysis is based on directional associations of LAT sources with radio sources in the 3CR, 3CRR, and MS4 (collectively referred to as 3C-MS) catalogs. Seven of the eleven LAT sources associated with 3C-MS radio sources have spectral indices larger than 2.3 and, except for the FRI radio galaxy NGC 1275 that shows possible spectral curvature, are well described by a power law. No evidence for time variability is found for any sources other than NGC 1275. The γ-ray luminosities of FRI radio galaxies are significantly smaller than those of the BL Lac objects detected by the LAT, whereas the γ-ray luminosities of the FRII sources are quite similar to those of FSRQs, which could reflect different beaming factors for the γ-ray emission. A core dominance (CD) study of the 3CRR sample indicates that sources closer to the jet axis are preferentially detected with the Fermi LAT, insofar as the γ-ray-detected misaligned AGNs have larger CD at a given average radio flux. The results are discussed in view of the AGN unification scenario.

  20. Flexible and fragmentable tandem photosensitive nanocrystal skins

    NASA Astrophysics Data System (ADS)

    Akhavan, S.; Uran, C.; Bozok, B.; Gungor, K.; Kelestemur, Y.; Lesnyak, V.; Gaponik, N.; Eychmüller, A.; Demir, H. V.

    2016-02-01

    We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of single monolayers of colloidal water-soluble CdTe and CdHgTe nanocrystals (NCs) in adjacent junctions on a Kapton polymer tape. Owing to the usage of a single NC layer in each junction, noise generation was significantly reduced while keeping the resulting PNS films considerably transparent. In each junction, photogenerated excitons are dissociated at the interface of the semi-transparent Al electrode and the NC layer, with holes migrating to the contact electrode and electrons trapped in the NCs. As a result, the tandem PNSs lead to an open-circuit photovoltage buildup equal to the sum of those of the two single junctions, exhibiting a total voltage buildup of 128.4 mV at an excitation intensity of 75.8 μW cm-2 at 350 nm. Furthermore, we showed that these flexible PNSs could be bent over 3.5 mm radius of curvature and cut out in arbitrary shapes without damaging the operation of individual parts and without introducing any significant loss in the total sensitivity. These findings indicate that the NC skins are promising as building blocks to make low-cost, flexible, large-area UV/visible sensing platforms with highly efficient full-spectrum conversion.We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of single monolayers of colloidal water-soluble CdTe and CdHgTe nanocrystals (NCs) in adjacent junctions on a Kapton polymer tape. Owing to the usage of a single NC layer in each junction, noise generation was significantly reduced while keeping the resulting PNS films considerably transparent. In each junction, photogenerated excitons are dissociated at the interface of the semi-transparent Al electrode and the NC layer, with holes migrating to the contact electrode and electrons trapped in the NCs. As a result, the tandem PNSs lead to an open-circuit photovoltage buildup equal to the sum of those of the two single junctions, exhibiting a total voltage buildup of 128.4 mV at an excitation intensity of 75.8 μW cm-2 at 350 nm. Furthermore, we showed that these flexible PNSs could be bent over 3.5 mm radius of curvature and cut out in arbitrary shapes without damaging the operation of individual parts and without introducing any significant loss in the total sensitivity. These findings indicate that the NC skins are promising as building blocks to make low-cost, flexible, large-area UV/visible sensing platforms with highly efficient full-spectrum conversion. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr05063d

  1. Undocumented water column sink for cadmium in open ocean oxygen-deficient zones

    PubMed Central

    Janssen, David J.; Conway, Tim M.; John, Seth G.; Christian, James R.; Kramer, Dennis I.; Pedersen, Tom F.; Cullen, Jay T.

    2014-01-01

    Cadmium (Cd) is a micronutrient and a tracer of biological productivity and circulation in the ocean. The correlation between dissolved Cd and the major algal nutrients in seawater has led to the use of Cd preserved in microfossils to constrain past ocean nutrient distributions. However, linking Cd to marine biological processes requires constraints on marine sources and sinks of Cd. Here, we show a decoupling between Cd and major nutrients within oxygen-deficient zones (ODZs) in both the Northeast Pacific and North Atlantic Oceans, which we attribute to Cd sulfide (CdS) precipitation in euxinic microenvironments around sinking biological particles. We find that dissolved Cd correlates well with dissolved phosphate in oxygenated waters, but is depleted compared with phosphate in ODZs. Additionally, suspended particles from the North Atlantic show high Cd content and light Cd stable isotope ratios within the ODZ, indicative of CdS precipitation. Globally, we calculate that CdS precipitation in ODZs is an important, and to our knowledge a previously undocumented marine sink of Cd. Our results suggest that water column oxygen depletion has a substantial impact on Cd biogeochemical cycling, impacting the global relationship between Cd and major nutrients and suggesting that Cd may be a previously unidentified tracer for water column oxygen deficiency on geological timescales. Similar depletions of copper and zinc in the Northeast Pacific indicate that sulfide precipitation in ODZs may also have an influence on the global distribution of other trace metals. PMID:24778239

  2. Undocumented water column sink for cadmium in open ocean oxygen-deficient zones.

    PubMed

    Janssen, David J; Conway, Tim M; John, Seth G; Christian, James R; Kramer, Dennis I; Pedersen, Tom F; Cullen, Jay T

    2014-05-13

    Cadmium (Cd) is a micronutrient and a tracer of biological productivity and circulation in the ocean. The correlation between dissolved Cd and the major algal nutrients in seawater has led to the use of Cd preserved in microfossils to constrain past ocean nutrient distributions. However, linking Cd to marine biological processes requires constraints on marine sources and sinks of Cd. Here, we show a decoupling between Cd and major nutrients within oxygen-deficient zones (ODZs) in both the Northeast Pacific and North Atlantic Oceans, which we attribute to Cd sulfide (CdS) precipitation in euxinic microenvironments around sinking biological particles. We find that dissolved Cd correlates well with dissolved phosphate in oxygenated waters, but is depleted compared with phosphate in ODZs. Additionally, suspended particles from the North Atlantic show high Cd content and light Cd stable isotope ratios within the ODZ, indicative of CdS precipitation. Globally, we calculate that CdS precipitation in ODZs is an important, and to our knowledge a previously undocumented marine sink of Cd. Our results suggest that water column oxygen depletion has a substantial impact on Cd biogeochemical cycling, impacting the global relationship between Cd and major nutrients and suggesting that Cd may be a previously unidentified tracer for water column oxygen deficiency on geological timescales. Similar depletions of copper and zinc in the Northeast Pacific indicate that sulfide precipitation in ODZs may also have an influence on the global distribution of other trace metals.

  3. Alanine-170 and proline-172 are critical determinants for extracellular CD20 epitopes; heterogeneity in the fine specificity of CD20 monoclonal antibodies is defined by additional requirements imposed by both amino acid sequence and quaternary structure.

    PubMed

    Polyak, Maria J; Deans, Julie P

    2002-05-01

    In vivo ablation of malignant B cells can be achieved using antibodies directed against the CD20 antigen. Fine specificity differences among CD20 monoclonal antibodies (mAbs) are assumed not to be a factor in determining their efficacy because evidence from antibody-blocking studies indicates limited epitope diversity with only 2 overlapping extracellular CD20 epitopes. However, in this report a high degree of heterogeneity among antihuman CD20 mAbs is demonstrated. Mutation of alanine and proline at positions 170 and 172 (AxP) (single-letter amino acid codes; x indicates the identical amino acid at the same position in the murine and human CD20 sequences) in human CD20 abrogated the binding of all CD20 mAbs tested. Introduction of AxP into the equivalent positions in the murine sequence, which is not otherwise recognized by antihuman CD20 mAbs, fully reconstituted the epitope recognized by B1, the prototypic anti-CD20 mAb. 2H7, a mAb previously thought to recognize the same epitope as B1, did not recognize the murine AxP mutant. Reconstitution of the 2H7 epitope was achieved with additional mutations replacing VDxxD in the murine sequence for INxxN (positions 162-166 in the human sequence). The integrity of the 2H7 epitope, unlike that of B1, further depends on the maintenance of CD20 in an oligomeric complex. The majority of 16 antihuman CD20 mAbs tested, including rituximab, bound to murine CD20 containing the AxP mutations. Heterogeneity in the fine specificity of these antibodies was indicated by marked differences in their ability to induce homotypic cellular aggregation and translocation of CD20 to a detergent-insoluble membrane compartment previously identified as lipid rafts.

  4. CD4+ T-cell clones obtained from cattle chronically infected with Fasciola hepatica and specific for adult worm antigen express both unrestricted and Th2 cytokine profiles.

    PubMed Central

    Brown, W C; Davis, W C; Dobbelaere, D A; Rice-Ficht, A C

    1994-01-01

    The well-established importance of helper T (Th)-cell subsets in immunity and immunoregulation of many experimental helminth infections prompted a detailed study of the cellular immune response against Fasciola hepatica in the natural bovine host. T-cell lines established from two cattle infected with F. hepatica were characterized for the expression of T-cell surface markers and proliferative responses against F. hepatica adult worm antigen. Parasite-specific T-cell lines contained a mixture of CD4+, CD8+, and gamma/delta T-cell-receptor-bearing T cells. However, cell lines containing either fewer than 10% CD8+ T cells or depleted of gamma/delta T cells proliferated vigorously against F. hepatica antigen, indicating that these T-cell subsets are not required for proliferative responses in vitro. Seventeen F. hepatica-specific CD4+ Th-cell clones were examined for cytokine expression following concanavalin A stimulation. Biological assays to measure interleukin-2 (IL-2) or IL-4, gamma interferon (IFN-gamma), and tumor necrosis factor and Northern (RNA) blot analysis to verify the expression of IL-2, IL-4, and IFN-gamma revealed that the Th-cell clones expressed a spectrum of cytokine profiles. Several Th-cell clones were identified as Th2 cells by the strong expression of IL-4 but little or no IL-2 or IFN-gamma mRNA. The majority of Th-cell clones were classified as Th0 cells by the expression of either all three cytokines or combinations of IL-2 and IL-4 or IL-4 and IFN-gamma. No Th1-cell clones were obtained. All of the Th-cell clones expressed a typical memory cell surface phenotype, characterized as CD45Rlow, and all expressed the lymph node homing receptor (L selectin). These results are the first to describe cytokine responses of F. hepatica-specific T cells obtained from infected cattle and extend our previous analysis of Th0 and Th1 cells from cattle immune to Babesia bovis (W. C. Brown, V. M. Woods, D. A. E. Dobbelaere, and K. S. Logan, Infect. Immun. 61:3273-3281, 1993) to include F. hepatica-specific Th2 cells. Images PMID:7509319

  5. Transcriptional Networks in Single Perivascular Cells Sorted from Human Adipose Tissue Reveal a Hierarchy of Mesenchymal Stem Cells.

    PubMed

    Hardy, W Reef; Moldovan, Nicanor I; Moldovan, Leni; Livak, Kenneth J; Datta, Krishna; Goswami, Chirayu; Corselli, Mirko; Traktuev, Dmitry O; Murray, Iain R; Péault, Bruno; March, Keith

    2017-05-01

    Adipose tissue is a rich source of multipotent mesenchymal stem-like cells, located in the perivascular niche. Based on their surface markers, these have been assigned to two main categories: CD31 - /CD45 - /CD34 + /CD146 - cells (adventitial stromal/stem cells [ASCs]) and CD31 - /CD45 - /CD34 - /CD146 + cells (pericytes [PCs]). These populations display heterogeneity of unknown significance. We hypothesized that aldehyde dehydrogenase (ALDH) activity, a functional marker of primitivity, could help to better define ASC and PC subclasses. To this end, the stromal vascular fraction from a human lipoaspirate was simultaneously stained with fluorescent antibodies to CD31, CD45, CD34, and CD146 antigens and the ALDH substrate Aldefluor, then sorted by fluorescence-activated cell sorting. Individual ASCs (n = 67) and PCs (n = 73) selected from the extremities of the ALDH-staining spectrum were transcriptionally profiled by Fluidigm single-cell quantitative polymerase chain reaction for a predefined set (n = 429) of marker genes. To these single-cell data, we applied differential expression and principal component and clustering analysis, as well as an original gene coexpression network reconstruction algorithm. Despite the stochasticity at the single-cell level, covariation of gene expression analysis yielded multiple network connectivity parameters suggesting that these perivascular progenitor cell subclasses possess the following order of maturity: (a) ALDH br ASC (most primitive); (b) ALDH dim ASC; (c) ALDH br PC; (d) ALDH dim PC (least primitive). This order was independently supported by specific combinations of class-specific expressed genes and further confirmed by the analysis of associated signaling pathways. In conclusion, single-cell transcriptional analysis of four populations isolated from fat by surface markers and enzyme activity suggests a developmental hierarchy among perivascular mesenchymal stem cells supported by markers and coexpression networks. Stem Cells 2017;35:1273-1289. © 2017 AlphaMed Press.

  6. Stem Cell Therapy for Autism

    PubMed Central

    Ichim, Thomas E; Solano, Fabio; Glenn, Eduardo; Morales, Frank; Smith, Leonard; Zabrecky, George; Riordan, Neil H

    2007-01-01

    Autism spectrum disorders (ASD) are a group of neurodevelopmental conditions whose incidence is reaching epidemic proportions, afflicting approximately 1 in 166 children. Autistic disorder, or autism is the most common form of ASD. Although several neurophysiological alterations have been associated with autism, immune abnormalities and neural hypoperfusion appear to be broadly consistent. These appear to be causative since correlation of altered inflammatory responses, and hypoperfusion with symptology is reported. Mesenchymal stem cells (MSC) are in late phases of clinical development for treatment of graft versus host disease and Crohn's Disease, two conditions of immune dysregulation. Cord blood CD34+ cells are known to be potent angiogenic stimulators, having demonstrated positive effects in not only peripheral ischemia, but also in models of cerebral ischemia. Additionally, anecdotal clinical cases have reported responses in autistic children receiving cord blood CD34+ cells. We propose the combined use of MSC and cord blood CD34+cells may be useful in the treatment of autism. PMID:17597540

  7. Recent experimental results of KSTAR RF heating and current drive

    NASA Astrophysics Data System (ADS)

    Wang, S. J.; Kim, J.; Jeong, J. H.; Kim, H. J.; Joung, M.; Bae, Y. S.; Kwak, J. G.

    2015-12-01

    The overview of KSTAR activities on ICRH, LHCD and ECH/CD including the last experimental results and future plan aiming for long-pulse high-beta plasma will be presented. Recently we achieved reasonable coupling of ICRF power to H-mode plasma through several efforts to increase system reliability. Power balance will be discussed on this experiment. LHCD is still struggling in the low power regime. Review of antenna spectrum for the higher coupling in H-mode plasma will be tried. ECH/CD provides 41 sec, 0.8 MW of heating power to support high-performance long-pulse discharge. Also, 170 GHz ECH system is integrated with the Plasma Control System (PCS) for the feedback controlling of NTM. Status and plan of ECH/CD will be discussed. Finally, helicon current drive is being prepared for the next stage of KSTAR operation. The hardware preparation and the calculation results of helicon current drive in KSTAR plasma will be discussed.

  8. Low testosterone in non-responsive coeliac disease: A case series, case-control study with comparisons to the National Health and Nutrition Examination Survey.

    PubMed

    Kurada, Satya; Veeraraghavan, Gopal; Kaswala, Dharmesh; Hansen, Josh; Cohen, David; Kelly, Ciaran; Leffler, Daniel

    2016-10-01

    Adults with coeliac disease (CD) often report persistent fatigue, even when CD appears well controlled for unknown reasons. To evaluate common indications for testosterone panel (TP) testing and prevalence of low testosterone (T) in CD. In our case series, we determined common indications for checking TP in CD. Next, we conducted a case-control study to compare TP in CD vs. healthy controls (HC). We compared mean total T (TT), free T (FT) based on serologic, histologic disease activity. Finally, we assessed TT in tissue transglutaminase (tTG)+ vs. tTG- subjects and CD vs. HC obtained from the National Health and Nutrition Examination Survey (NHANES). 53 coeliac males had TP tested. Common indications included osteoporosis and fatigue. Low FT was observed in 7/13 men with osteoporosis and 5/6 with fatigue. In our case-control study (n=26 each), there was no difference in mean TT or FT between CD vs. HC, tTG+ vs tTG- or Marsh 0 vs. Marsh 3 groups. NHANES data showed no difference in mean TT between tTG+ vs tTG- (n=16 each) or CD vs. HC subjects (n=5 each). Low T occurs in CD patients at a similar rate as the general population. Common presentations of low T may mimic non-responsive CD symptoms. Copyright © 2016 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  9. Psychologically adverse work conditions are associated with CD8+ T cell differentiation indicative of immunesenescence.

    PubMed

    Bosch, Jos A; Fischer, Joachim E; Fischer, Johannes C

    2009-05-01

    Numerous studies have demonstrated associations between psychosocial stress and indices of poor health, and much research is now dedicated to identifying the responsible biological mechanisms. The current study examined the hypothesis that stress may impact health by promoting immunesenescence. Participants were 537 factory workers (89% male; mean age 44; range 18-65years). Blood was analyzed for two components of the aging 'immune risk phenotype': the number and proportion of late-differentiated (CD27-CD28-) CD8 T cells (CTLs) and CD4:CD8 ratio. Psychological assessment focussed on work-related stressors which have previously been found to predict morbidity and mortality. This assessment included measures of work load, effort-reward imbalance, and social support at work. High levels of job stress (low reward, high effort-reward imbalance) and low social support at work were associated with a significantly lower CD4:CD8 ratio. Also, the number of CD27-CD28- CTLs was 30% to 50% higher in employees classified in the highest tertile of each stress parameter as compared to employees in the corresponding lowest tertile (p<.01). These associations withstood adjustment for a wide range of demographic, life style, medical, and socio-economic indicators. The associations between CTL phenotype and low social support became stronger with increasing age. These results suggest that psychosocial stress may contribute to immunological aging. Prospective studies should address the long-term consequences of these associations for healthy aging.

  10. Cadmium uptake by Pinus resinosa Ait. pollen and the effect on cation release and membrane permeability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strickland, R.C.; Chaney, W.R.; Lamoreaux, R.J.

    Cadmium uptake by red pine (Pinus resinosa Ait.) pollen from a graded series of Cd/sup 2 +/ solutions (0 to 2.88 microequivalents per 50 milligrams pollen) and its effect on membrane integrity were examined by atomic absorption spectroscopy. Uptake was strongly dependent on Cd/sup 2 +/ concentration and was limited to adsorption and cation exchange in pollen walls during a 3-hour measurement period. Good correlation between measured Cd/sup 2 +/ uptake and that predicted by the Langmuir and Freundlich isotherm equations indicated the adsorptive nature of Cd/sup 2 +/ uptake. While substantial quantities of Ca/sup 2 +/ and Mg/sup 2more » +/ were released by exchange mechanisms concurrent with Cd/sup 2 +/ uptake, there was no evidence for leakage of cations due to membrane impairment as indicated by a poor correlation between Cd/sup 2 +/ uptake and K/sup +/ efflux. Virtually all Cd/sup 2 +/ removed from solution was freely exchangeable with 0.5 millimolar CaCl/sub 2/ and demonstrated that Cd/sup 2 +/ did not readily enter pine pollen but was adsorbed on the pollen wall. Ultraviolet transmission spectra of treatment solutions and analyses of phosphate and reducing sugar efflux also indicated that the potent toxicity of Cd/sup 2 +/ to pollen germination and germ tube elongation was not the result of membrane damage.« less

  11. Inclusion of Paracetamol into β-cyclodextrin nanocavities in solution and in the solid state

    NASA Astrophysics Data System (ADS)

    El-Kemary, Maged; Sobhy, Saffaa; El-Daly, Samy; Abdel-Shafi, Ayman

    2011-09-01

    We report on steady-state UV-visible absorption and emission characteristics of Paracetamol, drug used as antipyretic agent, in water and within cyclodextrins (CDs): β-CD, 2-hydroxypropyl- β-CD (HP- β-CD) and 2,6-dimethyl- β-CD (Me- β-CD). The results reveal that Paracetamol forms a 1:1 inclusion complex with CD. Upon encapsulation, the emission intensity enhances, indicating a confinement effect of the nanocages on the photophysical behavior of the drug. Due to its methyl groups, the Me- β-CD shows the largest effect for the drug. The observed binding constant showing the following trend: Me- β-CD > HP- β-CD > β-CD. The less complexing effectiveness of HP- β-CD is due to the steric effect of the hydroxypropyl-substituents, which can hamper the inclusion of the guest molecules. The solid state inclusion complex was prepared by co-precipitation method and its characterization was investigated by Fourier transform infrared spectroscopy, 1H NMR and X-ray diffractometry. These approaches indicated that Paracetamol was able to form an inclusion complex with CDs, and the inclusion compounds exhibited different spectroscopic features and properties from Paracetamol.

  12. Viral Infection of Tumors Overcomes Resistance to PD-1-immunotherapy by Broadening Neoantigenome-directed T-cell Responses

    PubMed Central

    Woller, Norman; Gürlevik, Engin; Fleischmann-Mundt, Bettina; Schumacher, Anja; Knocke, Sarah; Kloos, Arnold M; Saborowski, Michael; Geffers, Robert; Manns, Michael P; Wirth, Thomas C; Kubicka, Stefan; Kühnel, Florian

    2015-01-01

    There is evidence that viral oncolysis is synergistic with immune checkpoint inhibition in cancer therapy but the underlying mechanisms are unclear. Here, we investigated whether local viral infection of malignant tumors is capable of overcoming systemic resistance to PD-1-immunotherapy by modulating the spectrum of tumor-directed CD8 T-cells. To focus on neoantigen-specific CD8 T-cell responses, we performed transcriptomic sequencing of PD-1-resistant CMT64 lung adenocarcinoma cells followed by algorithm-based neoepitope prediction. Investigations on neoepitope-specific T-cell responses in tumor-bearing mice demonstrated that PD-1 immunotherapy was insufficient whereas viral oncolysis elicited cytotoxic T-cell responses to a conserved panel of neoepitopes. After combined treatment, we observed that PD-1-blockade did not affect the magnitude of oncolysis-mediated antitumoral immune responses but a broader spectrum of T-cell responses including additional neoepitopes was observed. Oncolysis of the primary tumor significantly abrogated systemic resistance to PD-1-immunotherapy leading to improved elimination of disseminated lung tumors. Our observations were confirmed in a transgenic murine model of liver cancer where viral oncolysis strongly induced PD-L1 expression in primary liver tumors and lung metastasis. Furthermore, we demonstrated that combined treatment completely inhibited dissemination in a CD8 T-cell-dependent manner. Therefore, our results strongly recommend further evaluation of virotherapy and concomitant PD-1 immunotherapy in clinical studies. PMID:26112079

  13. Isolation and genome-wide expression and methylation characterization of CD31+ cells from normal and malignant human prostate tissue

    PubMed Central

    Luo, Wei; Hu, Qiang; Wang, Dan; Deeb, Kristin K.; Ma, Yingyu; Morrison, Carl D.; Liu, Song; Johnson, Candace S.; Trump, Donald L.

    2013-01-01

    Endothelial cells (ECs) are an important component involved in the angiogenesis. Little is known about the global gene expression and epigenetic regulation in tumor endothelial cells. The identification of gene expression and epigenetic difference between human prostate tumor-derived endothelial cells (TdECs) and those in normal tissues may uncover unique biological features of TdEC and facilitate the discovery of new anti-angiogenic targets. We established a method for isolation of CD31+ endothelial cells from malignant and normal prostate tissues obtained at prostatectomy. TdECs and normal-derived ECs (NdECs) showed >90% enrichment in primary culture and demonstrated microvascular endothelial cell characteristics such as cobblestone morphology in monolayer culture, diI-acetyl-LDL uptake and capillary-tube like formation in Matrigel®. In vitro primary cultures of ECs maintained expression of endothelial markers such as CD31, von Willebrand factor, intercellular adhesion molecule, vascular endothelial growth factor receptor 1, and vascular endothelial growth factor receptor 2. We then conducted a pilot study of transcriptome and methylome analysis of TdECs and matched NdECs from patients with prostate cancer. We observed a wide spectrum of differences in gene expression and methylation patterns in endothelial cells, between malignant and normal prostate tissues. Array-based expression and methylation data were validated by qRT-PCR and bisulfite DNA pyrosequencing. Further analysis of transcriptome and methylome data revealed a number of differentially expressed genes with loci whose methylation change is accompanied by an inverse change in gene expression. Our study demonstrates the feasibility of isolation of ECs from histologically normal prostate and prostate cancer via CD31+ selection. The data, although preliminary, indicates that there exist widespread differences in methylation and transcription between TdECs and NdECs. Interestingly, only a small proportion of perturbed genes were overlapped between American (AA) and Caucasian American (CA) patients with prostate cancer. Our study indicates that identifying gene expression and/or epigenetic differences between TdECs and NdECs may provide us with new anti-angiogenic targets. Future studies will be required to further characterize the isolated ECs and determine the biological features that can be exploited in the prognosis and therapy of prostate cancer. PMID:23978847

  14. [Analysis of salivary protease spectrum in chronic periodontitis].

    PubMed

    Qian, Li; Xuedong, Zhou; Yaping, Fan; Tengyu, Yang; Songtao, Wu; Yu, Yu; Jiao, Chen; Ping, Zhang; Yun, Feng

    2017-02-01

    This study aimed to investigate the difference in salivary protease expression in patients with chronic periodontitis and normal individuals. The stimulating saliva in patients with chronic periodontitis and normal individuals were collected. Protein chip technology was adapted to analyze salivary protease spectrum. Among the 34 proteases in the chip, disintegrin and metalloproteinase (ADAM)8, matrix metalloproteinase (MMP)-8, MMP-12, neprilysin/CD10, and uridylyl phosphate adenosine/urokinase showed a significantly increased concentration in the saliva of chronic periodontitis patients compared with those in the saliva of normal individuals (P<0.01). By contrast, the concentrations of ADAM9, a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS)1, ADAMTS13, cathepsin B, E, L, V, X/Z/P, kallikrein 6, 7, 11, 13, MMP-9, proteinase 3, presenilin-1, and proprotein convertase 9 sharply decreased (P<0.05). The results demonstrated that protease spectrum in the saliva of chronic periodontitis patients and normal individuals significantly differed. Analysis of salivary protease spectrum is a potential clinical method to examine, diagnose, and monitor chronic periodontitis.

  15. Human mesenchymal stem cells derived from limb bud can differentiate into all three embryonic germ layers lineages.

    PubMed

    Jiao, Fei; Wang, Juan; Dong, Zhao-Lun; Wu, Min-Juan; Zhao, Ting-Bao; Li, Dan-Dan; Wang, Xin

    2012-08-01

    Mesenchymal stem cells (MSCs) have been isolated from many sources, including adults and fetuses. Previous studies have demonstrated that, compared with their adult counterpart, fetal MSCs with several remarkable advantages may be a better resource for clinical applications. In this study, we successfully isolated a rapidly proliferating cell population from limb bud of aborted fetus and termed them "human limb bud-derived mesenchymal stem cells" (hLB-MSCs). Characteristics of their morphology, phenotype, cell cycle, and differentiation properties were analyzed. These adherent cell populations have a typically spindle-shaped morphology. Flow cytometry analysis showed that hLB-MSCs are positive for CD13, CD29, CD90, CD105, and CD106, but negative for CD3, CD4, CD5, CD11b, CD14, CD15, CD34, CD45, CD45RA, and HLA-DR. The detection of cell cycle from different passages indicated that hLB-MSCs have a similar potential for propagation during long culture in vitro. The most novel finding here is that, in addition to their mesodermal differentiation (osteoblasts and adipocytes), hLB-MSCs can also differentiated into extramesenchymal lineages, such as neural (ectoderm) and hepatic (endoderm) progenies. These results indicate that hLB-MSCs have a high level of plasticity and can differentiate into cell lineages from all three embryonic layers in vitro.

  16. Human Mesenchymal Stem Cells Derived From Limb Bud Can Differentiate into All Three Embryonic Germ Layers Lineages

    PubMed Central

    Jiao, Fei; Wang, Juan; Dong, Zhao-lun; Wu, Min-juan; Zhao, Ting-bao; Li, Dan-dan

    2012-01-01

    Abstract Mesenchymal stem cells (MSCs) have been isolated from many sources, including adults and fetuses. Previous studies have demonstrated that, compared with their adult counterpart, fetal MSCs with several remarkable advantages may be a better resource for clinical applications. In this study, we successfully isolated a rapidly proliferating cell population from limb bud of aborted fetus and termed them “human limb bud–derived mesenchymal stem cells” (hLB-MSCs). Characteristics of their morphology, phenotype, cell cycle, and differentiation properties were analyzed. These adherent cell populations have a typically spindle-shaped morphology. Flow cytometry analysis showed that hLB-MSCs are positive for CD13, CD29, CD90, CD105, and CD106, but negative for CD3, CD4, CD5, CD11b, CD14, CD15, CD34, CD45, CD45RA, and HLA-DR. The detection of cell cycle from different passages indicated that hLB-MSCs have a similar potential for propagation during long culture in vitro. The most novel finding here is that, in addition to their mesodermal differentiation (osteoblasts and adipocytes), hLB-MSCs can also differentiated into extramesenchymal lineages, such as neural (ectoderm) and hepatic (endoderm) progenies. These results indicate that hLB-MSCs have a high level of plasticity and can differentiate into cell lineages from all three embryonic layers in vitro. PMID:22775353

  17. Assessment of heavy metal contamination in water and sediments of Trepça and Sitnica rivers, Kosovo, using pollution indicators and multivariate cluster analysis.

    PubMed

    Ferati, Flora; Kerolli-Mustafa, Mihone; Kraja-Ylli, Arjana

    2015-06-01

    The concentrations of As, Cd, Cr, Co, Cu, Ni, Pb, and Zn in water and sediment samples from Trepça and Sitnica rivers were determined to assess the level of contamination. Six water and sediment samples were collected during the period from April to July 2014. Most of the water samples was found within the European and Kosovo permissible limits. The highest concentration of As, Cd, Pb, and Zn originates primarily from anthropogenic sources such discharge of industrial water from mining flotation and from the mine waste eroded from the river banks. Sediment contamination assessment was carried out using the pollution indicators such as contamination factor (CF), degree of contamination (Cd), modified degree of contamination (mCd), pollution load index (PLI), and geo-accumulation index (Igeo). The CF values for the investigated metals indicated a high contaminated nature of sediments, while the Cd values indicated a very high contamination degree of sediments. The mCd values indicate a high degree of contamination of Sitnica river sediment to ultrahigh degree of contamination of Trepça river sediment. The PLI values ranged from 1.89 to 14.1 which indicate that the heavy metal concentration levels in all investigated sites exceeded the background values and sediment quality guidelines. The average values of Igeo revealed the following ranking of intensity of heavy metal contamination of the Trepça and Sitnica river sediments: Cd > As > Pb > Zn > Cu > Co > Cr > Ni. Cluster analysis suggests that As, Cd, Cr, Co, Cu, Ni, Pb, and Zn are derived from anthropogenic sources, particularly discharges from mining flotation and erosion form waste from a zinc mine plant. In order to protect the sediments from further contamination, the designing of a monitoring network and reducing the anthropogenic discharges are suggested.

  18. A new approach way for white organic light-emitting diodes based on single emitting layer and large stokes shift.

    PubMed

    Kim, Beomjin; Park, Youngil; Shin, Yunseop; Lee, Jiwon; Shin, Hwangyu; Park, Jongwook

    2014-07-01

    New red dopant, DPPZ based on porphyrin moiety was synthesized. DPPZ showed UV-Vis and PL maximum values of 412 and 638 nm, indicating the large stokes shift. New blue host compound, TATa was also synthesized and used for co-mixed white emission. TATa exhibited UV-Vis. and PL maximum values of 403 nm and 463 nm in film state. Thus, when two compounds are used as co-mixed emitter in OLED device, there is no energy transfer from blue emission of TATa to DPPZ due to large stokes shift of DPPZ. Based on the PL result, it is available to realize two-colored white in PL and EL spectra. As a result of this, two-mixed compounds showed vivid their own PL emission peaks of 466 and 638 nm in film state. Also, white OLED device using two-mixed compounds system was fabricated. EL spectrum shows 481 and 646 nm peaks and two separate EL peaks. As the operation voltage is increased from 8 to 11 V, EL spectrum does not change the peak shape and maximum wavelength values. EL performance of white device showed 0.041 cd/A, 0.018 Im/W, and CIE (0.457, 0.331) at 8 V.

  19. Study of the Electro-Modulated Reflectance Spectra for MERCURY(1-X-Y)MANGANESE(X)CADMIUM(Y)TELLURIUM and Gallium Arsenide

    NASA Astrophysics Data System (ADS)

    Lu, Chien-Rong

    The optical properties of the semimagnetic semiconducting alloy, Hg_{rm 1-x-y}Mn _{x}Cd _{y}Te, were studied by electrolyte electroreflectance (EER). The analysis of the experimental spectra was based on the theoretical lineshapes for the electroreflectance spectra in the low-field limit. The observed structures in the spectra include the E _0 and E_0 + Delta_0 transitions at the Gamma point and the E_1 and E_1 + Delta_1 transitions on the Lambda axis. The compositional variations of these transitions were compared with the predictions of the virtual crystal approximation. The physical mechanism of another type of electro -modulated spectroscopy, photoreflectance, was also investigated. The materials used in this investigation were GaAs thin films grown by molecular-beam-epitaxy (MBE). The nonuniformity of the internal modulation field in the space charge region was taken into account, for the first time, by a multilayer model. The lineshape calculated from the multilayer model provides a good fit to the experimental spectrum, and more importantly, it permits a measure of the correct transition energy from the spectrum. The temperature dependence of the periods of the Franz-Keldysh oscillations in the photoreflectance spectra indicates that the band bending near the surface decreases with decreasing temperature.

  20. Enhanced chiral response from the Fabry-Perot cavity coupled meta-surfaces

    NASA Astrophysics Data System (ADS)

    Yang, Ze-Jian; Hu, De-Jiao; Gao, Fu-Hua; Hou, Yi-Dong

    2016-08-01

    The circular dichroism (CD) signal of a two-dimensional (2D) chiral meta-surface is usually weak, where the difference between the transmitted (or reflected) right and left circular polarization is barely small. We present a general method to enhance the reflective CD spectrum, by adding a layer of reflective film behind the meta-surface. The light passes through the chiral meta-surface and propagates towards the reflector, where it is reflected back and further interacts with the chiral meta-surface. The light is reflected back and forth between these two layers, forming a Fabry-Perot type resonance, which interacts with the localized surface plasmonic resonance (LSPR) mode and greatly enhances the CD signal of the light wave leaving the meta-surface. We numerically calculate the CD enhancing effect of an L-shaped chiral meta-surface on a gold film in the visible range. Compared with the single layer meta-surface, the L-shaped chiral meta-surface has a CD maximum that is dramatically increased to 1. The analysis of reflection efficiency reveals that our design can be used to realize a reflective circular polarizer. Corresponding mode analysis shows that the huge CD originates from the hybrid mode comprised of FP mode and LSPR. Our results provide a general approach to enhancing the CD signal of a chiral meta-surface and can be used in areas like biosensing, circular polarizer, integrated photonics, etc. Project supported by the National Natural Science Foundation of China (Grant No. 61377054).

  1. Enhanced photoluminescence of corrugated Al2O3 film assisted by colloidal CdSe quantum dots.

    PubMed

    Bai, Zhongchen; Hao, Licai; Zhang, Zhengping; Huang, Zhaoling; Qin, Shuijie

    2017-05-19

    We present the enhanced photoluminescence (PL) of a corrugated Al 2 O 3 film enabled by colloidal CdSe quantum dots. The colloidal CdSe quantum dots are fabricated directly on a corrugated Al 2 O 3 substrate using an electrochemical deposition (ECD) method in a microfluidic system. The photoluminescence is excited by using a 150 nm diameter ultraviolet laser spot of a scanning near-field optical microscope. Owing to the electron transfer from the conduction band of the CdSe quantum dots to that of Al 2 O 3 , the enhanced photoluminescence effect is observed, which results from the increase in the recombination rate of electrons and holes on the Al 2 O 3 surface and the reduction in the fluorescence of the CdSe quantum dots. A periodically-fluctuating fluorescent spectrum was exhibited because of the periodical wire-like corrugated Al 2 O 3 surface serving as an optical grating. The spectral topographic map around the fluorescence peak from the Al 2 O 3 areas covered with CdSe quantum dots was unique and attributed to the uniform deposition of CdSe QDs on the corrugated Al 2 O 3 surface. We believe that the microfluidic ECD system and the surface enhanced fluorescence method described in this paper have potential applications in forming uniform optoelectronic films of colloidal quantum dots with controllable QD spacing and in boosting the fluorescent efficiency of weak PL devices.

  2. Rab3a-Bound CD63 Is Degraded and Rab3a-Free CD63 Is Incorporated into HIV-1 Particles

    PubMed Central

    Kubo, Yoshinao; Masumoto, Hiroshi; Izumida, Mai; Kakoki, Katsura; Hayashi, Hideki; Matsuyama, Toshifumi

    2017-01-01

    CD63, a member of the tetraspanin family, is involved in virion production by human immunodeficiency virus type 1 (HIV-1), but its mechanism is unknown. In this study, we showed that a small GTP-binding protein, Rab3a, interacts with CD63. When Rab3a was exogenously expressed, the amounts of CD63 decreased in cells. The Rab3a-mediated reduction of CD63 was suppressed by lysosomal and proteasomal inhibitors. The amount of CD63 was increased by reducing the endogenous Rab3a level using a specific shRNA. These results indicate that Rab3a binds to CD63 to induce the degradation of CD63. Rab3a is thought to be involved in exocytosis, but we found that another function of Rab3a affects the fate of CD63 in lysosomes. CD63 interacted with Rab3a and was incorporated into HIV-1 particles. However, Rab3a was not detected in HIV-1 virions, thereby indicating that Rab3a-free CD63, but not Rab3a-bound CD63, is incorporated into HIV-1 particles. Overexpression or silencing of Rab3a moderately reduced HIV-1 virion formation. Overexpression of Rab3a decreased CD63 levels, but did not affect the incorporation of CD63 into HIV-1 particles. This study showed that Rab3a binds to CD63 to induce the degradation of CD63, and only Rab3a-free CD63 is incorporated into HIV-1 particles. PMID:28900422

  3. Critical stoichiometric ratio of CD4(+)  CD25(+)  FoxP3(+) regulatory T cells and CD4(+)  CD25(-) responder T cells influence immunosuppression in patients with B-cell acute lymphoblastic leukaemia.

    PubMed

    Bhattacharya, Kaushik; Chandra, Sarmila; Mandal, Chitra

    2014-05-01

    Regulatory T (Treg) cells act to suppress activation of the immune system and thereby maintain immunological homeostasis and tolerance to self-antigens. The frequency and suppressing activity of Treg cells in general are high in different malignancies. We wanted to identify the role and regulation of CD4(+)  CD25(+)  FoxP3(+) Treg cells in B-cell acute lymphoblastic leukaemia (B-ALL). We have included patients at diagnosis (n = 54), patients in clinical remission (n = 32) and normal healthy individuals (n = 35). These diagnosed patients demonstrated a lower number of CD4(+)  CD25(+) cells co-expressing a higher level of FoxP3, interleukin-10, transforming growth factor-β and CD152/CTLA-4 than the normal population. Treg cells from patients showed a higher suppressive capability on CD4(+)  CD25(-) responder T (Tresp) cells than normal. The frequency and immunosuppressive potential of CD4(+)  CD25(+)  FoxP3(+) Treg cells became high with the progression of malignancy in B-ALL. Relative distribution of Tresp and Treg cells was only ~5 : 1 in B-ALL but ~35 : 1 in normal healthy individuals, further confirming the elevated immunosuppression in patients. A co-culture study at these definite ex vivo ratios, indicated that Treg cells from B-ALL patients exhibited higher immunosuppression than Treg cells from normal healthy individuals. After chemotherapy using the MCP841 protocol, the frequency of CD4(+)  CD25(+) cells was gradually enhanced with the reduction of FoxP3, interleukin-10 positivity corresponded with disease presentation, indicating reduced immunosuppression. Taken together, our study indicated that the CD4(+)  CD25(+)  FoxP3(+) Treg cells played an important role in immunosuppression, resulting in a positive disease-correlation in these patients. To the best of our knowledge, this is the first detailed report on the frequency, regulation and functionality of Treg cells in B-ALL. © 2013 John Wiley & Sons Ltd.

  4. Single-hole hollow molecularly imprinted polymer embedded carbon dot for fast detection of tetracycline in honey.

    PubMed

    Li, Huiyu; Zhao, Li; Xu, Yuan; Zhou, Tianyu; Liu, Haochi; Huang, Ning; Ding, Jie; Li, Yi; Ding, Lan

    2018-08-01

    It is difficult to detect tetracycline (TC) in honey sample by using carbon dots (CDs) because the autofluorescence of the matrix of honey sample overlaps with the fluorescence emission spectrum of the large majority of CDs. Herein, single-hole hollow molecularly imprinted polymers embedded carbon dots (HMIP@CD) was prepared via microwave-assisted method. TC in diluted honey sample was adsorbed by the HMIP@CD within 3 min, after which the HMIP@CD absorbed with TC was separated by centrifugation from honey sample and redispersed into phosphate buffer solution. The autofluorescence of honey that interferes with the fluorescence signal of HMIP@CD was avoided. The method exhibited an excellent linearity within 10-200 μg L -1 and a low detection limit of 3.1 μg L -1 . At three spiking levels of TC, the recoveries ranged from 93% to 105% with precisions below 1.6%. This method provides an effective strategy for detecting analyte in complex matrix with autofluorescence interference. Copyright © 2018. Published by Elsevier B.V.

  5. Investigation of 112Cd via the (d,p) Reaction and a Reassessment of the Quadrupole-Octupole Coupled Excitation

    NASA Astrophysics Data System (ADS)

    Jamieson, D. S.; Garrett, P. E.; Ball, G. C.; Demand, G. A.; Faestermann, T.; Finlay, P.; Green, K. L.; Hertenberger, R.; Leach, K. G.; Phillips, A. A.; Sumithrarachchi, C. S.; Svensson, C. E.; Triambak, S.; Wirth, H.-F.; Wong, J.

    The single-particle neutron states in 112Cd have been probed with the 111Cd(d,p) reaction. Beams of up to 1.2 µA of polarized 22 MeV deuterons bombarded 111Cd targets. The reaction protons were momentum analyzed with a Q3D magnetic spectrograph, with spectra were recorded at 10 angles between 10 and 60° with a resolution of 6-7 keV FWHM. In addition to the (d,p) transfer data, (d,d) elastic-scattering data were also obtained and used to ascertain the proper optical model parameters. Cross sections and analyzing powers for all levels observed to be populated were fit to results of DWBA and ADWA calculations, and spectroscopic factors were determined. The 5- level at 2373 keV, previously assigned as a member on the quadrupole-octupole quintuplet set of states because of its enhanced B(E2;5 - to 31 - ) value, was observed to be one of the strongest peaks in the spectrum, and is reassigned as the s1/2 otimes h11/2 two-quasineutron configuration.

  6. Analysis of biogenic amines using corona discharge ion mobility spectrometry.

    PubMed

    Hashemian, Z; Mardihallaj, A; Khayamian, T

    2010-05-15

    A new method based on corona discharge ion mobility spectrometry (CD-IMS) was developed for the analysis of biogenic amines including spermidine, spermine, putrescine, and cadaverine. The ion mobility spectra of the compounds were obtained with and without n-Nonylamine used as the reagent gas. The high proton affinity of n-Nonylamine prevented ion formation from compounds with a proton affinity lower than that of n-Nonylamine and, therefore, enhanced its selectivity. It was also realized that the ion mobility spectrum of n-Nonylamine varied with its concentration. A sample injection port of a gas chromatograph was modified and used as the sample introduction system into the CD-IMS. The detection limits, dynamic ranges, and analytical parameters of the compounds with and without using the reagent gas were obtained. The detection limits and dynamic ranges of the compounds were about 2ng and 2 orders of magnitude, respectively. The wide dynamic range of CD-IMS originates from the high current of the corona discharge. The results revealed the high capability of the CD-IMS for the analysis of biogenic amines.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, Bing; Shen, Chao; Zhang, Mengya

    Green synthesis of CdSe quantum dots for application in the quantum-dots-sensitized solar cells (QDSCs) is investigated in this work. The CdSe QDs were prepared with glycerol as the solvent, with sharp emission peak, full width at half maximum around 30 nm, and absorption peak from 475 nm to 510 nm. The reaction is environmental friendly and energy saving. What's more, the green synthesized CdSe QDs are coherence to the maximum remittance region of the solar spectrum and suitable as sensitizers to assemble onto TiO{sub 2} electrodes for cell devices application. What's more, the dynamic procedure of the carriers' excitation, transportation, and recombination inmore » the QDSCs are discussed. Because the recombination of the electrons from the conduction band of TiO{sub 2}'s to the electrolyte affects the efficiency of the solar cells greatly, 3-Mercaptopropionic acid capped water-dispersible QDs were used to cover the surface of TiO{sub 2}. The resulting green synthesized CdSe QDSCs with Cu{sub 2}S as the electrode show a photovoltaic performance with a conversion efficiency of 3.39%.« less

  8. Polyaniline/carbon nanotube/CdS quantum dot composites with enhanced optical and electrical properties

    NASA Astrophysics Data System (ADS)

    Goswami, Mrinmoy; Ghosh, Ranajit; Maruyama, Takahiro; Meikap, Ajit Kumar

    2016-02-01

    A new kind of polyaniline/carbon nanotube/CdS quantum dot composites have been developed via in-situ polymerization of aniline monomer in the presence of dispersed CdS quantum dots (size: 2.7-4.8 nm) and multi-walled carbon nanotubes (CNT), which exhibits enhanced optical and electrical properties. The existences of 1st order, 2nd order, and 3rd order longitudinal optical phonon modes, strongly indicate the high quality of synthesized CdS quantum dots. The occurrence of red shift of free exciton energy in photoluminescence is due to size dependent quantum confinement effect of CdS. The conductivity of the composites (for example PANI/CNT/CdS (2 wt.% CdS)) is increased by about 7 of magnitude compared to that of pure PANI indicating a charge transfer between CNT and polymer via CdS quantum dots. This advanced material has a great potential for high-performance of electro-optical applications.

  9. Applications of Digitized 3-D Position-Sensitive CdZnTe Spectrometers for National Security and Nuclear Nonproliferation

    NASA Astrophysics Data System (ADS)

    Streicher, Michael W.

    A nuclear weapon detonation remains one of the gravest threats to the global community. Although the likelihood of a nuclear event remains small, the economic and political ramifications of an event are vast. The surest way to reduce the probability of an incident is to account for the special nuclear materials (SNM) which can be used to produce a nuclear weapon. Materials which can be used to manufacture a radiological dispersion device ("dirty bomb") must also be monitored. Rapidly-deployable, commercially-available, room-temperature imaging gamma-ray spectrometers are improving the ability of authorities to intelligently and quickly respond to threats. New electronics which digitally-sample the radiation-induced signals in CdZnTe detectors have expanded the capabilities of these sensors. This thesis explores national security applications where digital readout of CdZnTe detectors significantly enhances capabilities. Radioactive sources can be detected more quickly using digitally-sampled CdZnTe detector due to the improved energy resolution. The excellent energy resolution also improves the accuracy of measurements of uranium enrichment and allows users to measure plutonium grade. Small differences in the recorded gamma-ray energy spectrum can be used to estimate the effective atomic number and mass thickness of materials shielding SNM sources. Improved position resolution of gamma-ray interactions through digital readout allows high resolution gamma-ray images of SNM revealing information about the source configuration. CdZnTe sensors can detect the presence of neutrons, indirectly, through measurement of gamma rays released during capture of thermal neutrons by Cd-113 or inelastic scattering with any constituent nuclei. Fast neutrons, such as those released following fission, can be directly detected through elastic scattering interactions in the detector. Neutrons are a strong indicator of fissile material, and the background neutron rate is much lower than the gamma-ray background rate. Neutrons can more easily penetrate shielding materials as well which can greatly aid in the detection of shielded SNM. Digital CdZnTe readout enables the sensors to maintain excellent energy resolution at high count rates. Pulse pile-up and preamplifier decay can be monitored and corrected for on an event-by-event basis limiting energy resolution degradation in dose rates higher than 100 mR/hr. Finally, new iterations of the digital electronics have enhanced gamma-ray detection capabilities at high photon energies. Currently, gamma rays with energy up to 4.4 MeV have been detected. High-energy photon detection is critical for many proposed active interrogation systems.

  10. Synthesis of CdTe quantum dot-conjugated CC49 and their application for in vitro imaging of gastric adenocarcinoma cells

    NASA Astrophysics Data System (ADS)

    Zhang, Yun-Peng; Sun, Peng; Zhang, Xu-Rui; Yang, Wu-Li; Si, Cheng-Shuai

    2013-06-01

    The purpose of this experiment was to investigate the visible imaging of gastric adenocarcinoma cells in vitro by targeting tumor-associated glycoprotein 72 (TAG-72) with near-infrared quantum dots (QDs). QDs with an emission wavelength of about 550 to 780 nm were conjugated to CC49 monoclonal antibodies against TAG-72, resulting in a probe named as CC49-QDs. A gastric adenocarcinoma cell line (MGC80-3) expressing high levels of TAG-72 was cultured for fluorescence imaging, and a gastric epithelial cell line (GES-1) was used for the negative control group. Transmission electron microscopy indicated that the average diameter of CC49-QDs was 0.2 nm higher compared with that of the primary QDs. Also, fluorescence spectrum analysis indicated that the CC49-QDs did not have different optical properties compared to the primary QDs. Immunohistochemical examination and in vitro fluorescence imaging of the tumors showed that the CC49-QDs probe could bind TAG-72 expressed on MGC80-3 cells.

  11. Assessment of potential soybean cadmium excluder cultivars at different concentrations of Cd in soils.

    PubMed

    Zhi, Yang; He, Kangxin; Sun, Ting; Zhu, Yongqiang; Zhou, Qixing

    2015-09-01

    The selection of cadmium-excluding cultivars has been used to minimize the transfer of cadmium into the human food chain. In this experiment, five Chinese soybean plants were grown in three soils with different concentrations of Cd (0.15, 0.75 and 1.12mg/kg). Variations in uptake, enrichment, and translocation of Cd among these soybean cultivars were studied. The results indicated that the concentration of Cd in seeds that grew at 1.12mg/kg Cd in soils exceeded the permitted maximum levels in soybeans. Therefore, our results indicated that even some soybean cultivars grown on soils with permitted levels of Cd might accumulate higher concentrations of Cd in seeds that are hazardous to human health. The seeds of these five cultivars were further assessed for interactions between Cd and other mineral nutrient elements such as Ca, Cu, Fe, Mg, Mn and Zn. High Cd concentration in soil was found to inhibit the uptake of Mn. Furthermore, Fe and Zn accumulations were found to be enhanced in the seeds of all of the five soybean cultivars in response to high Cd concentration. Cultivar Tiefeng 31 was found to fit the criteria for a Cd-excluding cultivar under different concentrations of Cd in soils. Copyright © 2015. Published by Elsevier B.V.

  12. Assessment of heavy metal pollution and human health risk in urban soils of steel industrial city (Anshan), Liaoning, Northeast China.

    PubMed

    Qing, Xiao; Yutong, Zong; Shenggao, Lu

    2015-10-01

    The purpose of this study was to determine the concentrations and health risk of heavy metals in urban soils from a steel industrial district in China. A total of 115 topsoil samples from Anshan city, Liaoning, Northeast China were collected and analyzed for Cr, Cd, Pb, Zn, Cu, and Ni. The geoaccumulation index (Igeo), pollution index (PI), and potential ecological risk index (PER) were calculated to assess the pollution level in soils. The hazard index (HI) and carcinogenic risk (RI) were used to assess human health risk of heavy metals. The average concentration of Cr, Cd, Pb, Zn, Cu, and Ni were 69.9, 0.86, 45.1, 213, 52.3, and 33.5mg/kg, respectively. The Igeo and PI values of heavy metals were in the descending order of Cd>Zn>Cu>Pb>Ni>Cr. Higher Igeo value for Cd in soil indicated that Cd pollution was moderate. Pollution index indicated that urban soils were moderate to highly polluted by Cd, Zn, Cu, and Pb. The spatial distribution maps of heavy metals revealed that steel industrial district was the contamination hotspots. Principal component analysis (PCA) and matrix cluster analysis classified heavy metals into two groups, indicating common industrial sources for Cu, Zn, Pb, and Cd. Matrix cluster analysis classified the sampling sites into four groups. Sampling sites within steel industrial district showed much higher concentrations of heavy metals compared to the rest of sampling sites, indicating significant contamination introduced by steel industry on soils. The health risk assessment indicated that non-carcinogenic values were below the threshold values. The hazard index (HI) for children and adult has a descending order of Cr>Pb>Cd>Cu>Ni>Zn. Carcinogenic risks due to Cr, Cd, and Ni in urban soils were within acceptable range for adult. Carcinogenic risk value of Cr for children is slightly higher than the threshold value, indicating that children are facing slight threat of Cr. These results provide basic information of heavy metal pollution control and environment management in steel industrial regions. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Cultivating Fluorescent Flowers with Highly Luminescent Carbon Dots Fabricated by a Double Passivation Method.

    PubMed

    Han, Shuai; Chang, Tao; Zhao, Haiping; Du, Huanhuan; Liu, Shan; Wu, Baoshuang; Qin, Shenjun

    2017-07-07

    In this work, we present the fabrication of highly luminescent carbon dots (CDs) by a double passivation method with the assistance of Ca(OH)₂. In the reaction process, Ca 2+ protects the active functional groups from overconsumption during dehydration and carbonization, and the electron-withdrawing groups on the CD surface are converted to electron-donating groups by the hydroxyl ions. As a result, the fluorescence quantum yield of the CDs was found to increase with increasing Ca(OH)₂ content in the reaction process. A blue-shift optical spectrum of the CDs was also found with increasing Ca(OH)₂ content, which could be attributed to the increasing of the energy gaps for the CDs. The highly photoluminescent CDs obtained (quantum yield: 86%) were used to cultivate fluorescent carnations by a water culture method, while the results of fluorescence microscopy analysis indicated that the CDs had entered the plant tissue structure.

  14. [Spectrum characteristics of leaching components from co-contaminated loess in ex-situ column washing reaction].

    PubMed

    Fan, Chun-hui; Zhang, Ying-chao; Du, Bo; He, Lei; Wang, Jia-hong

    2015-02-01

    Soil contamination is regarded as one of the most serious issues to humanity all over the world. It is statistically believed that over one-fifth of the farmland, that is 20 million ha, is found to be contaminated by heavy metals in China. And the related issues, caused by soil contamination, of food safety, human health and eco-environmental quality attract much attention by public with more serious contamination than before. The technological approach for soil remediation is widely investigated. The technology of soil washing is effective for contaminants removal, while the treatment procedure might lead to component leaching from soil system, harmful for soil fertility, physicochemical properties and ecological functions. The study of spectral characteristics on leaching component is significant for decision-making of contaminated sites remediation and ecological function recovery, while the related investigation seems weaker nowadays. The paper mainly revealed the leaching characteristics of component from Pb/Cd contaminated loess in the washing process with Ethylene Diamine Tetraacetic Acid (EDTA) in reaction column, and the research objectives included base cations, loess nutrients, clay minerals and organic matter. The variation of clay minerals was analyzed by X-ray diffraction (XRD) and scanning electron microscope (SEM), and 3D-EEM fluorescence spectrum was used for the identification of dissolved organic matter (DOM). The experimental results showed: the leaching component from loess is detected in the washing reaction. The final removal efficiency (240 min) of Pb and Cd from loess are 49. 86% and 62.25%, respectively. The sodium ions and nitrate nitrogen are the most easily leaching component, and little difference of clay minerals is identified before and after washing reaction. The fulvic acid-like (FA-like) material was firstly (10 min) detected around E(ex/em) = 240-250/320-340 and E(ex/em) = 260-290/450-470 in 3D-EEM fluorescence spectrum, and the humin acid-like (HA-like, E(ex/em) = 290-320/430-490) appeared at 60 min with weaker fluorescence intensity of FA-like (E(ex/em) = 240/320). The decreased fluorescence intensity of FA-like and HA-like, shown after 120 min and 240 min, indicated the component variation of DOM in the leaching solution. The spectroscopy approach is appropriate for characteristics identification of leaching component from co-contaminated loess.

  15. Stable CdS QDs with intense broadband photoluminescence and high quantum yields

    NASA Astrophysics Data System (ADS)

    Mandal, Abhijit; Saha, Jony; De, Goutam

    2011-11-01

    Aqueous synthesis of CdS quantum dots (QDs) using thiolactic acid (TLA) as a capping agent was reported. These QDs exhibited excellent colloidal and photostability over a span of 2 years and showed intense broadband and almost white photoluminescence suitable for solid state lighting devices. The photoluminescence (PL) property of the aqueous CdS QDs is optimized by adjusting various processing parameters. The highest quantum yield (QY) achieved for TLA capped CdS QDs of average size 3.5 nm was ˜50%. Luminescence lifetime measurements of CdS-TLA QDs indicated longer lifetimes and a larger contribution of the surface-related emission, indicating removal of quenching defects.

  16. Cutaneous T cell lymphoma: Current practices in blood assessment and the utility of T-cell receptor Vβ chain restriction

    PubMed Central

    Gibson, Juliet F; Huang, Jing; Liu, Kristina J; Carlson, Kacie R; Foss, Francine; Choi, Jaehyuk; Edelson, Richard; Hussong, Jerry W.; Mohl, Ramsey; Hill, Sally; Girardi, Sally

    2016-01-01

    Background Accurate quantification of malignant cells in the peripheral blood of patients with cutaneous T cell lymphoma (CTCL) is important for early detection, prognosis, and monitoring disease burden. Objective Determine the spectrum of current clinical practices; critically evaluate elements of current ISCL B1 and B2 staging criteria; and assess the potential role of TCR-Vβ analysis by flow cytometry. Methods We assessed current clinical practices by survey, and performed a retrospective analysis of 161 patients evaluated at Yale (2011-2014) to compare the sensitivity, specificity, PPV, and NPV of parameters for ISCL B2 staging. Results There was heterogeneity in clinical practices among institutions. ISCL B1 criteria did not capture five Yale cohort patients with immunophenotypic abnormalities who later progressed. TCR-Vβ testing was more specific than PCR and aided diagnosis in detecting clonality, but was of limited benefit in quantification of tumor burden. Limitations Because of limited follow-up involving a single center, further investigation will be necessary to conclude whether our proposed diagnostic algorithm is of general clinical benefit. Conclusion We propose further study of “modified B1 criteria”: CD4/CD8 ratio ≥5, %CD4+/CD26- ≥ 20%, %CD4+/CD7- ≥ 20%, with evidence of clonality. TCR-Vβ testing should be considered in future diagnostic and staging algorithms. PMID:26874819

  17. Synchronized energy and electron transfer processes in covalently linked CdSe-squaraine dye-TiO2 light harvesting assembly.

    PubMed

    Choi, Hyunbong; Santra, Pralay K; Kamat, Prashant V

    2012-06-26

    Manipulation of energy and electron transfer processes in a light harvesting assembly is an important criterion to mimic natural photosynthesis. We have now succeeded in sequentially assembling CdSe quantum dot (QD) and squaraine dye (SQSH) on TiO(2) film and couple energy and electron transfer processes to generate photocurrent in a hybrid solar cell. When attached separately, both CdSe QDs and SQSH inject electrons into TiO(2) under visible-near-IR irradiation. However, CdSe QD if linked to TiO(2) with SQSH linker participates in an energy transfer process. The hybrid solar cells prepared with squaraine dye as a linker between CdSe QD and TiO(2) exhibited power conversion efficiency of 3.65% and good stability during illumination with global AM 1.5 solar condition. Transient absorption spectroscopy measurements provided further insight into the energy transfer between excited CdSe QD and SQSH (rate constant of 6.7 × 10(10) s(-1)) and interfacial electron transfer between excited SQSH and TiO(2) (rate constant of 1.2 × 10(11) s(-1)). The synergy of covalently linked semiconductor quantum dots and near-IR absorbing squaraine dye provides new opportunities to harvest photons from selective regions of the solar spectrum in an efficient manner.

  18. Growth, characterization and estimation of lattice strain and size in CdS nanoparticles: X-ray peak profile analysis

    NASA Astrophysics Data System (ADS)

    Solanki, Rekha Garg; Rajaram, Poolla; Bajpai, P. K.

    2018-05-01

    This work is based on the growth, characterization and estimation of lattice strain and crystallite size in CdS nanoparticles by X-ray peak profile analysis. The CdS nanoparticles were synthesized by a non-aqueous solvothermal method and were characterized by powder X-ray diffraction (XRD), transmission electron microscopy (TEM), Raman and UV-visible spectroscopy. XRD confirms that the CdS nanoparticles have the hexagonal structure. The Williamson-Hall (W-H) method was used to study the X-ray peak profile analysis. The strain-size plot (SSP) was used to study the individual contributions of crystallite size and lattice strain from the X-rays peaks. The physical parameters such as strain, stress and energy density values were calculated using various models namely, isotropic strain model, anisotropic strain model and uniform deformation energy density model. The particle size was estimated from the TEM images to be in the range of 20-40 nm. The Raman spectrum shows the characteristic optical 1LO and 2LO vibrational modes of CdS. UV-visible absorption studies show that the band gap of the CdS nanoparticles is 2.48 eV. The results show that the crystallite size estimated from Scherrer's formula, W-H plots, SSP and the particle size calculated by TEM images are approximately similar.

  19. Decreased CD8+CD28+/CD8+CD28- T cell ratio can sensitively predict poor outcome for patients with complicated Crohn disease.

    PubMed

    Dai, Shi-Xue; Gu, Hong-Xiang; Lin, Qian-Yi; Wu, Yan-Kun; Wang, Xiao-Yan; Huang, Shao-Zhuo; Xing, Tiao-Si; Chen, Min-Hua; Zhang, Qing-Fang; Zheng, Zhong-Wen; Sha, Wei-Hong

    2017-06-01

    Crohn disease (CD) with complications such as penetrating, stricturing, and perianal disease is called complicated CD. The aim of this study is to test the efficiency with which the CD8CD28/CD8CD28 cell balance can predict a subsequent active stage in patients with newly diagnosed complicated CD.Seventeen patients with complicated CD and 48 CD patients with no complications were enrolled. Blood CD8 T cells were tested from all of the 65 newly diagnosed CD patients upon enrollment. The potential risk factors were compared between the 2 groups. A 30-week follow-up was performed, and the efficiency of the CD8 cell balance at predicting active CD was analyzed using receiver-operating characteristic curves. The cumulative remission lasting rates (CRLRs) were analyzed using the Kaplan-Meier method.Compared with the control CD group, patients with complicated CD were predominantly male and younger in age; they also had lower body mass indices (BMIs), higher Crohn disease activity indices (CDAIs), higher immunosuppressant and steroid prescription rates, and significantly higher surgical rates. The CD8CD28/CD8CD28 balance was associated with BMI, CDAI, steroids, and surgery. The CD8CD28/CD8CD28 ratios were significantly lower at week 0 and on the 6th, 22nd, and 30th week during follow-up with a shorter lasting time of remission for the complicated CD patients. The CD8CD28/CD8CD28 ratio could accurately predict the active stage for the patients with complicated CD, and the highest sensitivity (89.2%) and specificity (85.3%) were found when the ratio was 1.03. Treatment with steroids and surgery, along with a significantly lower CD8CD28/CD8CD28 ratio and lower CRLRs, was closely related to a worse outcome for the patients with complicated CD.Patients requiring steroids and surgery experience more severe disease activity and thus a disequilibrated immunological balance, which could be the main reason for a decreased CD8CD28/CD8CD28 ratio. This ratio can sensitively predict the active stage for patients with complicated CD, and more care should be taken when this ratio is <1.03.

  20. Recent pattern of Co-infection amongst HIV seropositive individuals in tertiary care hospital, Kolkata.

    PubMed

    Saha, Kallol; Firdaus, Rushna; Santra, Poonam; Pal, Jyotirmoy; Roy, Arnab; Bhattacharya, Mihir K; Chakrabarti, Sekhar; Sadhukhan, Provash C

    2011-03-14

    Opportunistic Infections (OIs) and co-infections are the major cause of deaths amongst HIV infected individuals and this mostly depends upon the risk factors, type of exposure and geographic region. The commonest types of infections reported are tuberculosis, chronic diarrhoea, oral candidiasis, herpes simplex virus-2, cytomegalovirus, hepatitis B virus and hepatitis C virus. Due to the scarcity of OIs data available from this region, we had designed a study to determine the frequency of different OIs amongst HIV seropositive patients. Analysis of the different spectrum of OIs/Co-infections were carried out with 204 HIV sero-positive patients (142 males and 62 females) who visited the HIV/AIDS Apex Clinic in a tertiary care hospital from March 2006 to March 2009. The CD4+ count was estimated using FACS Calibur, the routine smear test, serology, nested RT-PCR and DNA sequencing were carried out to determine the different OIs. In this study, HIV seropositive patients were mostly from middle age group (31-40 yrs) with CD4+ counts in majority of symptomatic AIDS patients below 200 cells/mm3. The common co-infections/opportunistic infections were OC (53.43%), CD (47.05%), HSV-2 (36.76%), TB (35.29%), CMV (26.96%), HBV (15.19%) and HCV (7.35%). Dual infections, like HSV-2 & CMV (15.38%), HSV-2 & TB (14.61%), HSV-2 & oral candidiasis (24.61%) and CMV & oral candidiasis (14.61%) were significant in follow-up patients. Triple infections were also common e.g., TB, CD, OC infection occurring frequently in about 14.21% of the study population. Multiple infections like OC, TB, CD amongst the viral co-infected patients with HSV-2, HCV, CMV and HBV are also reported in this study. The genotyping analysis of the HCV co-infected HIV individuals shows that two belonged to HCV genotype 1 and 8 belonged to genotype 3. A wide spectrum of OIs were observed amongst HIV-infected patients in the HIV/AIDS Apex Clinic. Oral candidiasis, CD, CMV and HSV-2, were the common OIs in those patients. This study aims to provide a clearer picture regarding infections occurring amongst HIV seropositive individuals so that the scientific findings could be translated into sustainable prevention programmes and improved public health policies. None.

  1. CD147-CD98hc complex contributes to poor prognosis of non-small cell lung cancer patients through promoting cell proliferation via the PI3K/Akt signaling pathway.

    PubMed

    Fei, Fei; Li, Xiaofei; Xu, Li; Li, Deyang; Zhang, Zhipei; Guo, Xu; Yang, Hushan; Chen, Zhinan; Xing, Jinliang

    2014-12-01

    It has been reported that CD147 and CD98 heavy chain (CD98hc) form a complex on the cell plasma membrane of several cancers; however, whether this complex exists in non-small cell lung cancer (NSCLC) cells and affects the prognosis of patients remains to be elucidated. The expression of CD147 and CD98hc was assessed in tissue samples from 241 NSCLC patients and NSCLC cell lines. The correlation between CD147 and CD98hc expression and their association with the prognosis of NSCLC patients were analyzed. We also evaluated the impact of CD147 and CD98hc on the growth of NSCLC cells as well as Akt phosphorylation. Both CD147 and CD98hc were significantly upregulated in NSCLC cells, and their expression levels were significantly correlated (p < 0.001). Immunoflurenece staining and co-immunoprecipitation demonstrated that CD147 and CD98hc could form a complex on NSCLC cells. Compared with NSCLC patients with CD147-/CD98hc-, those with CD147+/CD98hc+ exhibited a significantly poor overall survival (OS) with a hazard ratio (HR) of 1.92 (p = 0.010), and a significantly increased risk of recurrence with a HR of 1.97 (p = 0.004). Also, we demonstrated that the proliferation of lung cancer cell lines was significantly affected by knockdown and force-expression of the CD147-CD98hc complex. Western blot analysis indicated that the phosphorylation of Akt in NSCLC cells was significantly affected by knockdown and overexpression of either or both CD147 and CD98hc. Our findings indicate that the CD147-CD98hc complex significantly contributes to poor prognosis of NSCLC patients through promoting cell proliferation via the PI3K/Akt pathway.

  2. Soluble CD163 is an indicator of liver inflammation and fibrosis in patients chronically infected with the hepatitis B virus.

    PubMed

    Dultz, G; Gerber, L; Farnik, H; Berger, A; Vermehren, J; Pleli, T; Zeuzem, S; Piiper, A; Kronenberger, B; Waidmann, O

    2015-04-01

    Soluble CD163 (sCD163), a marker for macrophage activation, was found to be associated with the severity of liver cirrhosis. The aim of the current study was to investigate whether serum sCD163 levels correlate with liver inflammation and fibrosis in patients with chronic hepatitis B virus (HBV) infection. In a retrospective cohort study, serum sCD163 levels were assessed by ELISA together with clinical and laboratory data in 186 patients with chronic HBV infection and 15 healthy controls. The relation between parameters for liver fibrosis and necroinflammation and sCD163 levels was analysed. Additionally, sCD163 was quantified in a subset of follow-up serum samples after initiation of antiviral treatment. sCD163 levels differed among phases of chronic HBV infection (P < 0.0001), and sCD163 concentrations were associated with inflammatory activity and fibrosis in the liver. sCD163 levels ≥ 1961 ng/l had a high specificity in the identification of subjects with substantial fibrosis (F ≥ 2). sCD163 concentrations decreased significantly after initiation of antiviral treatment. The correlation of sCD163 levels with necroinflammation and fibrosis and the sCD163 decline under treatment indicates that macrophage activation plays a role in HBV-related liver pathogenesis. © 2014 John Wiley & Sons Ltd.

  3. Cadmium accumulation characteristics of the winter farmland weeds Cardamine hirsuta Linn. and Gnaphalium affine D. Don.

    PubMed

    Lin, Lijin; Shi, Jun; Liu, Qihua; Liao, Ming'an; Mei, Luoyin

    2014-07-01

    In a preliminary study, we found that the cadmium (Cd) concentrations in shoots of the winter farmland weeds Cardamine hirsuta Linn. and Gnaphalium affine D. Don exceeded the critical value of a Cd-hyperaccumulator (100 mg kg(-1)), indicating that these two farmland weeds might be Cd-hyperaccumulators. In this study, we grew these species in soil containing various concentrations of Cd to further evaluate their Cd accumulation characteristics. The biomasses of C. hirsuta and G. affine decreased with increasing Cd concentrations in the soil, while the root/shoot ratio and the Cd concentrations in shoot tissues increased. The Cd concentrations in shoots of C. hirsuta and G. affine reached 121.96 and 143.91 mg kg(-1), respectively, at the soil Cd concentration of 50 mg kg(-1). Both of these concentrations exceeded the critical value of a Cd-hyperaccumulator (100 mg kg(-1)). The shoot bioconcentration factors of C. hirsuta and G. affine were greater than 1. The translocation factor of C. hirsuta was less than 1 and that of G. affine was greater than 1. These findings indicated that C. hirsuta is a Cd-accumulator and G. affine is Cd-hyperaccumulator. Both plants are distributed widely in the field, and they could be used to remediate Cd-contaminated farmland soil in winter.

  4. Persistent conditioned place preference to aggression experience in adult male sexually-experienced CD-1 mice

    PubMed Central

    Golden, Sam A.; Aleyasin, Hossein; Heins, Robert; Flanigan, Meghan; Heshmati, Mitra; Takahashi, Aki; Russo, Scott J.; Shaham, Yavin

    2016-01-01

    We recently developed a conditioned place preference (CPP) procedure, commonly used to study rewarding drug effects, to demonstrate that dominant sexually-experienced CD-1 male mice form CPP to contexts previously associated with defeating subordinate male C57BL/6J mice. Here we further characterized conditioned and unconditioned aggression behavior in CD-1 mice. In Exp. 1 we used CD-1 mice that displayed a variable spectrum of unconditioned aggressive behavior toward younger subordinate C57BL/6J intruder mice. We then trained the CD-1 mice in the CPP procedure where one context was intruder-paired, while a different context was not. We then tested for aggression CPP 1 day after training. In Exp. 2, we tested CD-1 mice for aggression CPP 1 day and 18 days after training. In Exp. 3–4, we trained the CD-1 mice to lever-press for palatable food and tested them for footshock punishment-induced suppression of food-reinforced responding. In Exp. 5, we characterized unconditioned aggression in hybrid CD-1xC57BL/6J D1-Cre or D2-Cre F1 generation crosses. Persistent aggression CPP was observed in CD-1 mice that either immediately attacked C57BL/6J mice during all screening sessions or mice that gradually developed aggressive behavior during the screening phase. In contrast, CD-1 mice that did not attack the C57BL/6J mice during screening didn’t develop CPP to contexts previously paired with C57BL/6J mice. The aggressive phenotype did not predict resistance to punishment-induced suppression of food-reinforced responding. CD-1xD1-Cre or D2-Cre F1 transgenic mice showed strong unconditioned aggression. Our study demonstrates that aggression experience causes persistent CPP and introduces transgenic mice for circuit studies of aggression. PMID:27457669

  5. Persistent conditioned place preference to aggression experience in adult male sexually-experienced CD-1 mice.

    PubMed

    Golden, S A; Aleyasin, H; Heins, R; Flanigan, M; Heshmati, M; Takahashi, A; Russo, S J; Shaham, Y

    2017-01-01

    We recently developed a conditioned place preference (CPP) procedure, commonly used to study rewarding drug effects, to demonstrate that dominant sexually-experienced CD-1 male mice form CPP to contexts previously associated with defeating subordinate male C57BL/6J mice. Here we further characterized conditioned and unconditioned aggression behavior in CD-1 mice. In Exp. 1 we used CD-1 mice that displayed a variable spectrum of unconditioned aggressive behavior toward younger subordinate C57BL/6J intruder mice. We then trained the CD-1 mice in the CPP procedure where one context was intruder-paired, while a different context was not. We then tested for aggression CPP 1 day after training. In Exp. 2, we tested CD-1 mice for aggression CPP 1 day and 18 days after training. In Exp. 3-4, we trained the CD-1 mice to lever-press for palatable food and tested them for footshock punishment-induced suppression of food-reinforced responding. In Exp. 5, we characterized unconditioned aggression in hybrid CD-1 × C57BL/6J D1-Cre or D2-Cre F1 generation crosses. Persistent aggression CPP was observed in CD-1 mice that either immediately attacked C57BL/6J mice during all screening sessions or mice that gradually developed aggressive behavior during the screening phase. In contrast, CD-1 mice that did not attack the C57BL/6J mice during screening did not develop CPP to contexts previously paired with C57BL/6J mice. The aggressive phenotype did not predict resistance to punishment-induced suppression of food-reinforced responding. CD-1 × D1-Cre or D2-Cre F1 transgenic mice showed strong unconditioned aggression. Our study demonstrates that aggression experience causes persistent CPP and introduces transgenic mice for circuit studies of aggression. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  6. Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

    PubMed

    Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

    2017-01-01

    Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

  7. Genomic Alterations Observed in Colitis-Associated Cancers Are Distinct From Those Found in Sporadic Colorectal Cancers and Vary by Type of Inflammatory Bowel Disease.

    PubMed

    Yaeger, Rona; Shah, Manish A; Miller, Vincent A; Kelsen, Judith R; Wang, Kai; Heins, Zachary J; Ross, Jeffrey S; He, Yuting; Sanford, Eric; Yantiss, Rhonda K; Balasubramanian, Sohail; Stephens, Philip J; Schultz, Nikolaus; Oren, Moshe; Tang, Laura; Kelsen, David

    2016-08-01

    Patients with inflammatory bowel diseases, such as Crohn's disease (CD) and ulcerative colitis (UC), are at increased risk for small bowel or colorectal cancers (colitis-associated cancers [CACs]). We compared the spectrum of genomic alterations in CACs with those of sporadic colorectal cancers (CRCs) and investigated differences between CACs from patients with CD vs UC. We studied tumor tissues from patients with CACs treated at Memorial Sloan Kettering Cancer Center or Weill Cornell Medical College from 2003 through 2015. We performed hybrid capture-based next-generation sequencing analysis of >300 cancer-related genes to comprehensively characterize genomic alterations. We performed genomic analyses of 47 CACs (from 29 patients with UC and 18 with CD; 43 primary tumors and 4 metastases). Primary tumors developed in the ileum (n = 2), right colon (n = 18), left colon (n = 6), and rectosigmoid or rectum (n = 21). We found genomic alterations in TP53, IDH1, and MYC to be significantly more frequent, and mutations in APC to be significantly less frequent, than those reported in sporadic CRCs by The Cancer Genome Atlas or Foundation Medicine. We identified genomic alterations that might be targeted by a therapeutic agent in 17 of 47 (36%) CACs. These included the mutation encoding IDH1 R132; amplification of FGFR1, FGFR2, and ERBB2; and mutations encoding BRAF V600E and an EML4-ALK fusion protein. Alterations in IDH1 and APC were significantly more common in CACs from patients with CD than UC. In an analysis of CACs from 47 patients, we found significant differences in the spectrum of genomic alterations in CACs compared with sporadic CRCs. We observed a high frequency of IDH1 R132 mutations in patients with CD but not UC, as well as a high frequency of MYC amplification in CACs. Many genetic alterations observed in CACs could serve as therapeutic targets. Copyright © 2016 AGA Institute. Published by Elsevier Inc. All rights reserved.

  8. Genomic Alterations Observed in Colitis-associated Cancers are Distinct from Those Found in Sporadic Colorectal Cancers and Vary by Type of Inflammatory Bowel Disease

    PubMed Central

    Yaeger, Rona; Shah, Manish A.; Miller, Vincent A.; Kelsen, Judith R.; Wang, Kai; Heins, Zachary J.; Ross, Jeffrey S.; He, Yuting; Sanford, Eric; Yantiss, Rhonda K.; Balasubramanian, Sohail; Stephens, Philip J.; Schultz, Nikolaus; Oren, Moshe; Tang, Laura; Kelsen, David

    2016-01-01

    Background & Aims Patients with inflammatory bowel diseases such as Crohn's disease (CD) or ulcerative colitis (UC) are at increased risk for small bowel or colorectal cancers (colitis-associated cancers, CACs). We compared the spectrum of genomic alterations in CACs with those of sporadic colorectal cancers (CRCs) and investigated differences between CACs from patients with CD vs UC. Methods We studied tumor tissues from patients with CACs, treated at Memorial Sloan Kettering Cancer Center or Weill Cornell Medical College from 2003 through 2015. We performed hybrid capture based next-generation sequencing analysis of over 300 cancer-related genes to comprehensively characterize genomic alterations. Results We performed genomic analyses of 47 CACs (from 29 patients with UC and 18 with CD; 43 primary tumors and 4 metastases). Primary tumors developed in the ileum (n=2), right colon (n=18), left colon (n=6) and rectosigmoid or rectum (n=21). We found genomic alterations in TP53, IDH1, and MYC to be significantly more frequent, and mutations in APC to be significantly less frequent, than those reported in sporadic CRCs by The Cancer Genome Atlas or Foundation Medicine. We identified genomic alterations that might be targeted by a therapeutic agent in 17/47 (36%) of CACs. These included the mutation encoding IDH1 R132; amplification of FGFR1, FGFR2, and ERBB2; and mutations encoding BRAF V600E and an EML4-ALK fusion protein. Alterations in IDH1 and APC were significantly more common in CACs from patients with CD than UC. Conclusions In an analysis of CACs from 47 patients, we found significant differences in the spectrum of genomic alterations in CACs compared to sporadic CRCs. We observed a high frequency of IDH1 R132 mutations in patients with CD but not UC, as well as a high frequency of MYC amplification in CACs. Many genetic alterations observed in CACs could serve as therapeutic targets. PMID:27063727

  9. III-V strain layer superlattice based band engineered avalanche photodiodes (Presentation Recording)

    NASA Astrophysics Data System (ADS)

    Ghosh, Sid

    2015-08-01

    Laser detection and ranging (LADAR)-based systems operating in the Near Infrared (NIR) and Short Wave Infrared (SWIR) have become popular optical sensors for remote sensing, medical, and environmental applications. Sophisticated laser-based radar and weapon systems used for long-range military and astronomical applications need to detect, recognize, and track a variety of targets under a wide spectrum of atmospheric conditions. Infrared APDs play an important role in LADAR systems by integrating the detection and gain stages in a single device. Robust silicon-APDs are limited to visible and very near infrared region (< 1 um), while InGaAs works well up to wavelengths of about 1.5um. Si APDs have low multiplication or excess noise but are limited to below 1um due very poor quantum efficiency above 0.8um. InGaAs and Ge APDs operate up to wavelengths of 1.5um but have poor multiplication or excess noise due to a low impact ionization coefficient ratio between electrons and holes. For the past several decades HgCdTe has been traditionally used in longer wavelength (> 3um) infrared photon detection applications. Recently, various research groups (including Ghosh et. al.) have reported SWIR and MWIR HgCdTe APDs on CdZnTe and Si substrates. However, HgCdTe APDs suffer from low breakdown fields due to material defects, and excess noise increases significantly at high electric fields. During the past decade, InAs/GaSb Strain Layer Superlattice (SLS) material system has emerged as a potential material for the entire infrared spectrum because of relatively easier growth, comparable absorption coefficients, lower tunneling currents and longer Auger lifetimes resulting in enhanced detectivities (D*). Band engineering in type II SLS allows us to engineer avalanche properties of electrons and holes. This is a great advantage over bulk InGaAs and HgCdTe APDs where engineering avalanche properties is not possible. The talk will discuss the evolution of superlattice based avalanche photodiodes and some of the recent results on the work being done at Raytheon on SWIR avalanche photodiodes.

  10. Measuring the spectrum of mutation induced by nitrogen ions and protons in the human-hamster hybrid cell line A(L)C

    NASA Technical Reports Server (NTRS)

    Kraemer, S. M.; Kronenberg, A.; Ueno, A.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

    2000-01-01

    Astronauts can be exposed to charged particles, including protons, alpha particles and heavier ions, during space flights. Therefore, studying the biological effectiveness of these sparsely and densely ionizing radiations is important to understanding the potential health effects for astronauts. We evaluated the mutagenic effectiveness of sparsely ionizing 55 MeV protons and densely ionizing 32 MeV/nucleon nitrogen ions using cells of two human-hamster cell lines, A(L) and A(L)C. We have previously characterized a spectrum of mutations, including megabase deletions, in human chromosome 11, the sole human chromosome in the human-hamster hybrid cell lines A(L)C and A(L). CD59(-) mutants have lost expression of a human cell surface antigen encoded by the CD59 gene located at 11p13. Deletion of genes located on the tip of the short arm of 11 (11p15.5) is lethal to the A(L) hybrid, so that CD59 mutants that lose the entire chromosome 11 die and escape detection. In contrast, deletion of the 11p15.5 region is not lethal in the hybrid A(L)C, allowing for the detection of chromosome loss or other chromosomal mutations involving 11p15.5. The 55 MeV protons and 32 MeV/nucleon nitrogen ions were each about 10 times more mutagenic per unit dose at the CD59 locus in A(L)C cells than in A(L) cells. In the case of nitrogen ions, the mutations observed in A(L)C cells were predominantly due to chromosome loss events or 11p deletions, often containing a breakpoint in the pericentromeric region. The increase in the CD59(-) mutant fraction for A(L)C cells exposed to protons was associated with either translocation of portions of 11q onto a hamster chromosome, or discontinuous or "skipping" mutations. We demonstrate here that A(L)C cells are a powerful tool that will aid in the understanding of the mutagenic effects of different types of ionizing radiation.

  11. Sorption-desorption of cadmium in aqueous palygorskite, sepiolite, and calcite suspensions: isotherm hysteresis.

    PubMed

    Shirvani, Mehran; Kalbasi, Mahmoud; Shariatmadari, Hosein; Nourbakhsh, Farshid; Najafi, Bijan

    2006-12-01

    Sorption isotherms have been widely used to assess the heavy metal retention characteristics of soil particles. Desorption behavior of the retained metals, however, usually differ from that of sorption, leading to a lack of coincidence in the experimentally obtained sorption and desorption isotherms. In this study, we examine the nonsingularity of cadmium (Cd) sorption-desorption isotherms, to check the possible hysteresis and reversibility phenomena, in aqueous palygorskite, sepiolite and calcite systems. Sorption of Cd was carried out using a 24-h batch equilibration experiment with eight different Cd solution concentrations, equivalent to 20-100% of maximum sorption capacity of each mineral. Immediately after sorption, desorption took place using successive dilution method with five consecutive desorption steps. Both Cd sorption and desorption data were adequately described by Freundlich equation (0.81

  12. Colliding Stellar Winds Structure and X-ray Emission

    NASA Astrophysics Data System (ADS)

    Pittard, J. M.; Dawson, B.

    2018-04-01

    We investigate the structure and X-ray emission from the colliding stellar winds in massive star binaries. We find that the opening angle of the contact discontinuity (CD) is overestimated by several formulae in the literature at very small values of the wind momentum ratio, η. We find also that the shocks in the primary (dominant) and secondary winds flare by ≈20° compared to the CD, and that the entire secondary wind is shocked when η ≲ 0.02. Analytical expressions for the opening angles of the shocks, and the fraction of each wind that is shocked, are provided. We find that the X-ray luminosity Lx∝η, and that the spectrum softens slightly as η decreases.

  13. CD147 contains different bioactive epitopes involving the regulation of cell adhesion and lymphocyte activation.

    PubMed

    Chiampanichayakul, Sawitree; Peng-in, Pakorn; Khunkaewla, Panida; Stockinger, Hannes; Kasinrerk, Watchara

    2006-01-01

    CD147 is a leukocyte surface molecule which belongs to the immunoglobulin superfamily. It is broadly expressed on various cell types and is a lymphocyte activation-associated molecule. In order to study the function of CD147, five CD147 monoclonal antibodies (mAbs) were generated: M6-2F9; M6-1D4; M6-1F3; M6-1B9; and M6-1E9. Biochemical characterizations and cross-blocking experiments indicated that M6-1B9 and M6-1E9 recognize the same or contiguous epitopes on CD147. By employing COS transfectants expressing CD147 membrane-distal domain (domain 1) and membrane-proximal domain (domain 2), mAbs M6-2F9, M6-1D4, M6-1B9, and M6-1E9 were shown to recognize epitopes located on domain 1 of the molecule. Functional studies indicated that engagement of CD147 by mAbs M6-1B9 and M6-1E9 strongly inhibited lymphocyte proliferation induced by a CD3 mAb. In contrast, mAbs M6-2F9, M6-1D4, and M6-1F3 induced U937 homotypic cell aggregation. The results indicate that CD147 contains at least two bioactive domains. Epitopes responsible for induction of cell aggregation are different from those regulating lymphocyte activation.

  14. Expression of the rat CD26 antigen (dipeptidyl peptidase IV) on subpopulations of rat lymphocytes.

    PubMed

    Gorrell, M D; Wickson, J; McCaughan, G W

    1991-04-15

    The T cell activation antigen CD26 has been recently identified as the cell surface ectopeptidase dipeptidyl peptidase IV (DPP-IV). DPP-IV is found on many cell types, including lymphocytes, epithelial cells, and certain endothelial cells. The MRC OX61 monoclonal antibody (MAb) which specifically recognises rat DPP-IV was used to examine the expression of CD26/DPP-IV on rat lymphocytes. The molecular nature of the antigen was examined by immunoprecipitation from thymocytes, splenocytes, and hepatocytes. Analysis by one- and two-dimensional gel electrophoresis indicated that the native form of CD26 includes a 220-kDa homodimer. On tissue sections MRC OX61 MAb stained nearly all thymocytes and in the spleen and lymph nodes predominantly stained the T cell areas. However, in immunofluorescence experiments OX61 stained 80 to 87% of lymph node cells and 78 to 85% of spleen cells. Furthermore, two-colour immunofluorescence analysis of the CD4+, CD8+, and Ig+ lymphocyte subsets indicated that only 2 to 5% of each of these subsets lacked OX61 staining. Spleen cells and thymocytes of both CD4+ and CD8+ subsets stained much more intensely with OX61 after these cells were stimulated with phytohemagglutinin. These findings indicate that rat CD26 antigen expression is not confined to the T cell population as has been suggested, but also occurs on B cells, and is increased on T cells following their activation.

  15. Cadmium removal from urban stormwater runoff via bioretention technology and effluent risk assessment for discharge to surface water.

    PubMed

    Wang, Jianlong; Zhang, Pingping; Yang, Liqiong; Huang, Tao

    2016-01-01

    Bioretention technology, a low-impact development stormwater management measure, was evaluated for its ability to remove heavy metals (specifically cadmium, Cd) from urban stormwater runoff. Fine sand, zeolite, sand and quartz sand were selected as composite bioretention media. The effects of these materials on the removal efficiency, chemical forms, and accumulation and migration characteristics of Cd were examined in laboratory scale bioretention columns. Heretofore, few studies have examined the removal of Cd by bioretention. A five-step sequential extraction method, a single-contamination index method, and an empirical migration equation were used in the experiments. The average Cd removal efficiency of quartz sand approached 99%, and removal by the other media all exceeded 90%. The media types markedly affected the forms of Cd found in the columns as well as its vertical migration rate. The Cd accumulated in the four media was mainly in residual form; moreover, accumulation of Cd occurred mainly in the surface layer of the bioretention column. The migration depth of Cd in the four media increased with elapsed time, in the following sequence: zeolite>quartz sand>fine sand>sand. In contrast, the migration rate decreased with elapsed time, and the migration rate of Cd was lowest in sand (0.015 m per annum over the first ten years). The comprehensive risk index analysis indicated that the risk arising from Cd discharge to surface water was "intermediate", and that the degree of risk was lowest in sand, then quartz sand, zeolite, and fine sand in sequence. These results indicate that the adsorption and accumulation of Cd in the four media are more significant than the migration of Cd. In addition, the results of Cd risk assessment for the effluent indicate that each of the four media can serve as long-term adsorption material in a bioretention facility for purifying stormwater runoff. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Determination of the Cd-bearing phases in municipal solid waste and biomass single fly ash particles using SR-microXRF spectroscopy.

    PubMed

    Camerani, Maria Caterina; Somogyi, Andrea; Vekemans, Bart; Ansell, Stuart; Simionovici, Alexandre S; Steenari, Britt-Marie; Panas, Itai

    2007-09-01

    By using an excitation energy of 27.0 keV, synchrotron radiation-induced micro-X-ray fluorescence (SR-microXRF) is employed to extract information regarding the composition and distribution of Cd-bearing phases in municipal solid waste (MSW) and biomass fly ashes. Significance of observation is based on statistics of totally more than 100 individual MSW and biomass fly ash particles from a fluidized bed combustion (FBC) plant. Cd concentrations in the parts-per-million range are determined. In general, although previous leaching studies have indicated Cd to be predominant in the smaller-size ash particles, in the present study Cd is more evenly distributed throughout all the particle sizes. For MSW fly ashes, results indicate the presence of Cd mainly as CdBr2 hot-spots, whereas for biomass fly ashes, which exhibit lower CdX2 concentration, a thin Cd layer on/in the particles is reported. For both ashes, Ca-containing matrixes are found to be the main Cd-bearing phases. Support for this observation is found from independent first-principles periodic density functional theory calculations. The observations are condensed into a schematic mechanism for Cd adsorption on the fly ash particles.

  17. Isolation of a circulating CD45−, CD34dim cell population and validation of their endothelial phenotype

    PubMed Central

    Tropea, Margaret M.; Harper, Bonnie J. A.; Graninger, Grace M.; Phillips, Terry M.; Ferreyra, Gabriela; Mostowski, Howard S.; Danner, Robert L.; Suffredini, Anthony F.; Solomon, Michael A.

    2016-01-01

    Summary Accurately detecting circulating endothelial cells (CECs) is important since their enumeration has been proposed as a biomarker to measure injury to the vascular endothelium. However, there is no single methodology for determining CECs in blood, making comparison across studies difficult. Many methods for detecting CECs rely on characteristic cell surface markers and cell viability indicators, but lack secondary validation. Here, a CEC population in healthy adult human subjects was identified by flow cytometry as CD45−, CD34dim that is comparable to a previously described CD45−, CD31bright population. In addition, nuclear staining with 7-aminoactinomycin D (7-AAD) was employed as a standard technique to exclude dead cells. Unexpectedly, the CD45−, CD34dim, 7-AAD− CECs lacked surface detectable CD146, a commonly used marker of CECs. Furthermore, light microscopy revealed this cell population to be composed primarily of large cells without a clearly defined nucleus. Nevertheless, immunostains still demonstrated the presence of the lectin Ulex europaeus and van Willebrand factor. Ultramicro analytical immunochemistry assays for the endothelial cell proteins CD31, CD34, CD62E, CD105, CD141, CD144 and vWF indicated these cells possess an endothelial phenotype. However, only a small amount of RNA, which was mostly degraded, could be isolated from these cells. Thus the majority of CECs in healthy individuals as defined by CD45−, CD34dim, and 7-AAD− have shed their CD146 surface marker and are senescent cells without an identifiable nucleus and lacking RNA of sufficient quantity and quality for transcriptomal analysis. This study highlights the importance of secondary validation of CEC identification. PMID:25057108

  18. Lewis Lung Cancer Cells Promote SIGNR1(CD209b)-Mediated Macrophages Polarization Induced by IL-4 to Facilitate Immune Evasion.

    PubMed

    Yan, Xiaolong; Li, Wenhai; Pan, Lei; Fu, Enqing; Xie, Yonghong; Chen, Min; Mu, Deguang

    2016-05-01

    Tumor-associated macrophages are a prominent component of lung cancer and contribute to tumor progression by facilitating the immune evasion of cancer cells. DC-SIGN (CD209) assists in the immune evasion of a broad spectrum of pathogens and neoplasms by inhibiting the maturation of DCs and subsequent cytokines production. However, the expression of DC-SIGN in macrophages and its role in mediating immune evasion in lung cancer and the underlying mechanism remain unclear. Our study aimed to identify the immunosuppressive role of SIGNR1 in murine macrophage differentiation and lung cancer progression. We found that SIGNR1-positive RAW264.7 macrophages were enriched in mixed cultures with Lewis lung cancer cells (LLC) (ratio of RAW 264.7 to LLC being 1:1) after stimulation with IL-4. Moreover, LLC-educated macrophages exhibited significantly higher levels of IL-10 but lower IL-12 in response to IL-4 treatment as determined by RT-PCR and ELISA. However, inhibition of SIGNR1 markedly hampered the production of IL-10, indicating that SIGNR1 was indispensable for IL-4+LLC induced macrophage polarization towards the M2 subtype. Furthermore, polarized M2 cells immersed in a tumor microenvironment promoted the migration of LLCs, as measured by transwell assays, but migration was suppressed after blockade of SIGNR1 using CD209b antibody. In addition, IL-4+LLC-educated macrophages reduced the proliferation of the activated T cells and reduced IFN-γ-mediated Th1 response in T cells, while SIGNR1 inhibition rescued Th1 cell functions. In conclusion, murine SIGNR1 expressed in LLC-educated macrophages appears to mediate IL-4-induced RAW264.7 macrophage polarization and thus facilitate lung cancer evasion. © 2015 Wiley Periodicals, Inc.

  19. Electrical characterization of the temperature dependence in CdTe/CdS heterojunctions deposited in-situ by pulsed laser deposition

    NASA Astrophysics Data System (ADS)

    Avila-Avendano, Jesus; Quevedo-Lopez, Manuel; Young, Chadwin

    2018-02-01

    The I-V and C-V characteristics of CdTe/CdS heterojunctions deposited in-situ by Pulsed Laser Deposition (PLD) were evaluated. In-situ deposition enables the study of the CdTe/CdS interface by avoiding potential impurities at the surface and interface as a consequence of exposure to air. The I-V and C-V characteristics of the resulting junctions were obtained at different temperatures, ranging from room temperature to 150 °C, where the saturation current (from 10-8 to 10-4 A/cm2), ideality factor (between 1 and 2), series resistance (from 102 to 105 Ω), built-in potential (0.66-0.7 V), rectification factor (˜106), and carrier concentration (˜1016 cm-3) were obtained. The current-voltage temperature dependence study indicates that thermionic emission is the main transport mechanism at the CdTe/CdS interface. This study also demonstrated that the built-in potential (Vbi) calculated using a thermionic emission model is more accurate than that calculated using C-V extrapolation since C-V plots showed a Vbi shift as a function of frequency. Although CdTe/CdS is widely used for photovoltaic applications, the parameters evaluated in this work indicate that CdTe/CdS heterojunctions could be used as rectifying diodes and junction field effect transistors (JFETs). JFETs require a low PN diode saturation current, as demonstrated for the CdTe/CdS junction studied here.

  20. Monitoring α4β7 integrin expression on circulating CD4+ T cells as a surrogate marker for tracking intestinal CD4+ T cell loss in SIV infection

    PubMed Central

    Wang, Xiaolei; Xu, Huanbin; Gill, Amy F.; Pahar, Bapi; Kempf, Doty; Rasmussen, Terri; Lackner, Andrew A.; Veazey, Ronald S.

    2013-01-01

    Intestinal CD4+ T cells are rapidly and profoundly depleted in HIV-infected patients and SIV-infected macaques. However, monitoring intestinal cells in humans is difficult, and identifying surrogate markers in the blood, which correlate with loss or restoration of intestinal CD4+ T cells could be helpful in monitoring the success of therapeutic strategies and vaccine candidates. Recent studies indicate HIV utilizes the intestinal homing molecule α4β7 for attachment and signaling of CD4+ T cells, suggesting this molecule may play a central role in HIV pathogenesis. Here we compared β7HIGH integrin expression on CD4+ T cells in blood with loss of CD4+ T cells in the intestine of macaques throughout SIV infection. The loss of β7HIGH CD4+ T cells in blood closely paralleled the loss of intestinal CD4+ T cells, and proved to be a more reliable marker of intestinal CD4+ T cell loss than monitoring CCR5+ memory CD4+ T cells. These data are consistent with a recent hypothesis that α4β7 plays a role in the selective depletion of intestinal CD4+ T cells, and indicate that monitoring β7HIGH expression on CD4+ T cells in the blood may be a useful surrogate for estimating intestinal CD4+ T cell loss and restoration in HIV-infected patients. PMID:19710637

  1. Supersensitization of CdS quantum dots with a near-infrared organic dye: toward the design of panchromatic hybrid-sensitized solar cells.

    PubMed

    Choi, Hyunbong; Nicolaescu, Roxana; Paek, Sanghyun; Ko, Jaejung; Kamat, Prashant V

    2011-11-22

    The photoresponse of quantum dot solar cells (QDSCs) has been successfully extended to the near-IR (NIR) region by sensitizing nanostructured TiO(2)-CdS films with a squaraine dye (JK-216). CdS nanoparticles anchored on mesoscopic TiO(2) films obtained by successive ionic layer adsorption and reaction (SILAR) exhibit limited absorption below 500 nm with a net power conversion efficiency of ~1% when employed as a photoanode in QDSC. By depositing a thin barrier layer of Al(2)O(3), the TiO(2)-CdS films were further modified with a NIR absorbing squaraine dye. Quantum dot sensitized solar cells supersensitized with a squariand dye (JK-216) showed good stability during illumination with standard global AM 1.5 solar conditions, delivering a maximum overall power conversion efficiency (η) of 3.14%. Transient absorption and pulse radiolysis measurements provide further insight into the excited state interactions of squaraine dye with SiO(2), TiO(2), and TiO(2)/CdS/Al(2)O(3) films and interfacial electron transfer processes. The synergy of combining semiconductor quantum dots and NIR absorbing dye provides new opportunities to harvest photons from different regions of the solar spectrum. © 2011 American Chemical Society

  2. Recombination by grain-boundary type in CdTe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moseley, John, E-mail: john.moseley@nrel.gov; Ahrenkiel, Richard K.; Colorado School of Mines, 1500 Illinois Street, Golden, Colorado 80401

    2015-07-14

    We conducted cathodoluminescence (CL) spectrum imaging and electron backscatter diffraction on the same microscopic areas of CdTe thin films to correlate grain-boundary (GB) recombination by GB “type.” We examined misorientation-based GB types, including coincident site lattice (CSL) Σ = 3, other-CSL (Σ = 5–49), and general GBs (Σ > 49), which make up ∼47%–48%, ∼6%–8%, and ∼44%–47%, respectively, of the GB length at the film back surfaces. Statistically averaged CL total intensities were calculated for each GB type from sample sizes of ≥97 GBs per type and were compared to the average grain-interior CL intensity. We find that only ∼16%–18% of Σ = 3 GBs are active non-radiativemore » recombination centers. In contrast, all other-CSL and general GBs are observed to be strong non-radiative centers and, interestingly, these GB types have about the same CL intensity. Both as-deposited and CdCl{sub 2}-treated films were studied. The CdCl{sub 2} treatment reduces non-radiative recombination at both other-CSL and general GBs, but GBs are still recombination centers after the CdCl{sub 2} treatment.« less

  3. Modeling of HgCdTe focal plane array spectral inhomogeneities

    NASA Astrophysics Data System (ADS)

    Mouzali, Salima; Lefebvre, Sidonie; Rommeluère, Sylvain; Ferrec, Yann; Primot, Jérôme

    2015-06-01

    Infrared focal plane arrays (IRFPA) are widely used to perform high quality measurements such as spectrum acquisition at high rate, ballistic missile defense, gas detection, and hyperspectral imaging. For these applications, the fixed pattern noise represents one of the major limiting factors of the array performance. This sensor imperfection refers to the nonuniformity between pixels, and is partially caused by disparities of the cut-off wavenumbers. In this work, we focus particularly on mercury cadmium telluride (HgCdTe), which is the most important material of IR cooled detector applications. Among the many advantages of this ternary alloy is the tunability of the bandgap energy with Cadmium composition, as well as the high quantum efficiency. In order to predict and understand spectral inhomogeneities of HgCdTe-based IRFPA, we propose a modeling approach based on the description of optical phenomena inside the pixels. The model considers the p-n junctions as a unique absorbent bulk layer, and derives the sensitivity of the global structure to both Cadmium composition and HgCdTe layer thickness. For this purpose, HgCdTe optical and material properties were necessary to be known at low temperature (80K), in our operating conditions. We therefore achieved the calculation of the real part of the refractive index using subtracti

  4. Patterned mist deposition of tri-colour CdSe/ZnS quantum dot films toward RGB LED devices

    NASA Astrophysics Data System (ADS)

    Pickering, S.; Kshirsagar, A.; Ruzyllo, J.; Xu, J.

    2012-06-01

    In this experiment a technique of mist deposition was explored as a way to form patterned ultra-thin-films of CdSe/ZnS core/shell nanocrystalline quantum dots using colloidal solutions. The objective of this study was to investigate the feasibility of mist deposition as a patterning method for creating multicolour quantum dot light emitting diodes. Mist deposition was used to create three rows of quantum dot light emitting diodes on a single device with each row having a separate colour. The colours chosen were red, green and yellow with corresponding peak wavelengths of 620 nm, 558 nm, and 587 nm. The results obtained from this experiment show that it is possible to create multicolour devices on a single substrate. The peak brightnesses obtained in this experiment for the red, green, and yellow were 508 cd/m, 507 cd/m, and 665 cd/m, respectively. The similar LED brightness is important in display technologies using colloidal quantum dots in a precursor solution to ensure one colour does not dominate the emitted spectrum. Results obtained in-terms of brightness were superior to those achieved with inkjet deposition. This study has shown that mist deposition is a viable method for patterned deposition applied to quantum dot light emitting diode display technologies.

  5. Very Low Threshold ASE and Lasing Using Auger-Suppressed Nanocrystal Quantum Dots

    NASA Astrophysics Data System (ADS)

    Park, Young-Shin; Bae, Wan Ki; Fidler, Andrew; Baker, Tomas; Lim, Jaehoon; Pietryga, Jeffrey; Klimov, Victor

    2015-03-01

    We report amplified spontaneous emission (ASE) and lasing with very low thresholds obtained using thin films made of engineered thick-shell CdSe/CdS QDs that have a CdSeS alloyed layer between the CdSe core and the CdS shell. These ``alloyed'' QDs exhibit considerable reduction of Auger decay rates, which results in high biexciton emission quantum yields (QBX of ~ 12%) and extended biexciton lifetimes (τBX of ~ 4ns). By using a fs laser (400 nm at 1 kHz repetition rate) as a pump source, we measured the threshold intensity of biexciton ASE as low as 5 μJ/cm2, which is about 5 times lower than the lowest ASE thresholds reported for thick-shell QDs without interfacial alloying. Interestingly, we also observed biexciton random lasing from the same QD film. Lasing spectrum comprises several sharp peaks (linewidth ~0.2 nm), and the heights and the spectral positions of these peaks show strong dependence on the exact position of the excitation spot on the QD film. Our study suggests that further suppression of nonradiative Auger decay rates via even finer grading of the core/shell interface could lead to a further reduction in the lasing threshold and potentially realization of lasing under continuous-wave excitation.

  6. Quantitative ROESY analysis of computational models: structural studies of citalopram and β-cyclodextrin complexes by (1) H-NMR and computational methods.

    PubMed

    Ali, Syed Mashhood; Shamim, Shazia

    2015-07-01

    Complexation of racemic citalopram with β-cyclodextrin (β-CD) in aqueous medium was investigated to determine atom-accurate structure of the inclusion complexes. (1) H-NMR chemical shift change data of β-CD cavity protons in the presence of citalopram confirmed the formation of 1 : 1 inclusion complexes. ROESY spectrum confirmed the presence of aromatic ring in the β-CD cavity but whether one of the two or both rings was not clear. Molecular mechanics and molecular dynamic calculations showed the entry of fluoro-ring from wider side of β-CD cavity as the most favored mode of inclusion. Minimum energy computational models were analyzed for their accuracy in atomic coordinates by comparison of calculated and experimental intermolecular ROESY peak intensities, which were not found in agreement. Several least energy computational models were refined and analyzed till calculated and experimental intensities were compatible. The results demonstrate that computational models of CD complexes need to be analyzed for atom-accuracy and quantitative ROESY analysis is a promising method. Moreover, the study also validates that the quantitative use of ROESY is feasible even with longer mixing times if peak intensity ratios instead of absolute intensities are used. Copyright © 2015 John Wiley & Sons, Ltd.

  7. The emission spectroscopy of the B2Σ- -X2 Π system of CD

    NASA Astrophysics Data System (ADS)

    Szajna, W.; Zachwieja, M.; Hakalla, R.

    2016-06-01

    The visible spectrum of CD has been investigated at high resolution between 24,500 and 27,500 cm-1 using a high accuracy dispersive optical spectroscopy technique. The CD molecules were produced and excited in a stainless steel hollow-cathode lamp with two anodes and filled with a mixture of He buffer gas and CD4. The emission from the discharge was observed with a plane grating spectrograph and recorded by a photomultiplier tube. The 0-0, 1-0 and 1-1 bands of the B2Σ- -X2 Π transition have been registered and measured, while 2-0 and 2-1 absorption bands (Herzberg and Johns, 1969) have been reanalyzed. The current data were elaborated with help of recent X2 Π ground state parameters reported by Zachwieja et al. (2012) from investigation of the A2 Δ -X2 Π transition. This way, the improved spectroscopic constants for the B2Σ- state of CD have been provided as follows: νe = 26,050.787 (11) cm-1, ωe = 1653.019 (25) cm-1, ωexe = 123.899 (12) cm-1, Be = 7.08296 (32) cm-1, αe = 0.30741 (84) cm-1, and γe = - 0.10727 (42) cm-1.

  8. Immune and hemorheological changes in Chronic Fatigue Syndrome

    PubMed Central

    2010-01-01

    Background Chronic Fatigue Syndrome (CFS) is a multifactorial disorder that affects various physiological systems including immune and neurological systems. The immune system has been substantially examined in CFS with equivocal results, however, little is known about the role of neutrophils and natural killer (NK) phenotypes in the pathomechanism of this disorder. Additionally the role of erythrocyte rheological characteristics in CFS has not been fully expounded. The objective of this present study was to determine deficiencies in lymphocyte function and erythrocyte rheology in CFS patients. Methods Flow cytometric measurements were performed for neutrophil function, lymphocyte numbers, NK phenotypes (CD56dimCD16+ and CD56brightCD16-) and NK cytotoxic activity. Erythrocyte aggregation, deformability and fibrinogen levels were also assessed. Results CFS patients (n = 10) had significant decreases in neutrophil respiratory burst, NK cytotoxic activity and CD56brightCD16- NK phenotypes in comparison to healthy controls (n = 10). However, hemorheological characteristic, aggregation, deformability, fibrinogen, lymphocyte numbers and CD56dimCD16+ NK cells were similar between the two groups. Conclusion These results indicate immune dysfunction as potential contributors to the mechanism of CFS, as indicated by decreases in neutrophil respiratory burst, NK cell activity and NK phenotypes. Thus, immune cell function and phenotypes may be important diagnostic markers for CFS. The absence of rheological changes may indicate no abnormalities in erythrocytes of CFS patients. PMID:20064266

  9. Interleukin 4-producing CD4+ T cells in the skin of cats with allergic dermatitis.

    PubMed

    Roosje, P J; Dean, G A; Willemse, T; Rutten, V P M G; Thepen, T

    2002-03-01

    Lesional skin of cats with allergic dermatitis has a cellular infiltrate and a CD4/CD8 ratio comparable to that in humans with atopic dermatitis. CD4+ helper T cells and in particular cells belonging to the Th2 subset play an important role in disease pathogenesis in humans. We investigated the cytokine pattern of CD4+ T cells in situ, with special emphasis on the putative presence of cells producing interleukin 4 (IL4), in cats with allergic dermatitis. Immunohistochemical procedures were used to determine that CD4+ T cells in lesional and nonlesional skin of cats with allergic dermatitis can produce IL4, as occurs in humans. Lesional and nonlesional skin of cats with allergic dermatitis had significantly more IL4+ T cells (P = 0.001) than did skin of healthy control cats. Double staining indicated that all IL4+ cells were positive for pan-T or CD4 markers. Double labeling for mast cell chymase and IL4 stained primarily different cells. Western blotting demonstrated cross-reactivity between the antibody against human IL4 and a feline recombinant IL4. These results indicate that IL4 is primarily produced by CD4+ T cells and is also present in clinically uninvolved skin, indicating a role in the pathogenesis of allergic dermatitis in cats.

  10. Immunohistochemical CD271 expression correlates with melanoma progress in a case-control study.

    PubMed

    Nielsen, Patricia Switten; Riber-Hansen, Rikke; Steiniche, Torben

    2018-06-01

    Putative cancer stem cell (CSC) markers have arisen from melanoma mouse and in vitro models, but their expression in paraffin embedded patient samples relative to clinical outcome remains largely unexplored. Rather than cells of the tumour bulk, conceivably, CSC drive tumour progression. Accordingly, complete eradication may prevent melanoma relapse. Because elevated tumour-cell proliferation is an established indicator of aggressive disease, this study aimed to investigate the correlation between melanoma recurrence and proliferation of putative CSC that express CD271, CD166, or CD20. Additionally, the expression of these markers was studied in naevi, melanomas, and their recurrence. In melanoma patients, 30 with relapse (cases) and 30 without (controls) were matched for tumour thickness, ulceration, Clark level, subtype, site, gender, and age. One paraffin-embedded section of the patients' primary melanoma (n = 60), relapse (n = 21), and naevus (n = 17) were immunohistochemically double-stained for Ki-67/MART1 and single-stained for CD271, CD166, and CD20. Their whole slide images were aligned as virtual quadruple stains. Image analysis established proliferation indices of each putative stem cell marker and the tumour bulk in addition to the markers' percentage level in tumour areas and the epidermis. In cases vs controls, median dermal proliferation indices (no./mm 2 ) were 211 vs 103 (p = 0.04) for CD271, 512 vs 227 (p = 0.3) for CD166, 184 vs 97 (p = 0.3) for CD20, and 95 vs 103 (p = 0.6) for the tumour bulk. Of additional interest, epidermal CD271 + keratinocytes totalled 8.8% in naevi and 0.98% in melanomas (p = 0.0007). Even though differences between naevi and melanomas also were observed for CD166 in both the epidermis (p = 0.002) and dermis (p = 0.006), they were visually less apparent. CD20 + MART1 + cells were absent in half of the melanomas, and all naevi and relapses. In conclusion, high levels of CD271 + Ki-67 + MART1 + cells were linked to melanoma relapse as opposed to common Ki-67 indices in this particular case-control study. With further investigation, such cells could be potential targets of therapy. Especially, loss of epidermal CD271 + keratinocytes seemed necessary for melanoma development; hence, identification may serve as a diagnostic tool with additional research. Copyright © 2018 Royal College of Pathologists of Australasia. Published by Elsevier B.V. All rights reserved.

  11. Correlation of CD4 count with cariogenic oral flora indicators and dental caries in HIV-seropositive children undergoing antiretroviral therapy in Mangaluru, South India.

    PubMed

    Muraleedharan, Soumya; Panchmal, Ganesh Shenoy; Shenoy, Rekha P; Jodalli, Praveen; Sonde, Laxminarayan; Pasha, Imran

    2018-05-01

    The aim of the present study was to compare the association of CD4 count with cariogenic oral flora indicators and dental caries in HIV-seropositive children receiving antiretroviral therapy (ART). A descriptive study was conducted among HIV-seropositive children receiving ART at Snehasadan Camillian Care and Support Center HIV/AIDS in Mangaluru, India. Demographic details and r recent CD4 counts were recorded. For dental caries, the Decayed, Missing, Filled Teeth (DMFT)/decayed, missing, filled/decayed, extracted, filled index was used. Data were analyzed using SPSS version 22. Spearman's correlation was used to correlate CD4 count with dental caries and cariogenic oral flora indicators (mutans streptococci and lactobacilli). The study population comprised 35 patients. Dental caries prevalence was 54.1% in deciduous teeth and 41.2% in permanent teeth. Age and DMFT showed a significant, positive correlation; age and dmft showed a negative correlation (P < .05). A weak, negative correlation was found between age and Streptococcus mutans (S. mutans), and also CD4 count; S. mutans and CD4 count and dmft were not found to be statistically significant (P < .05). No statistically-significant correlation was found between CD4 count and cariogenic oral flora indicators in HIV-positive patients. The presence of a minimum number of restored teeth compared to decayed teeth suggests a lack of dental care being given to HIV-positive patients. © 2017 John Wiley & Sons Australia, Ltd.

  12. Previous Exposure to Anesthesia and Autism Spectrum Disorder (ASD): A Puerto Rican Population-Based Sibling Cohort Study.

    PubMed

    Creagh, O; Torres, H; Rivera, K; Morales-Franqui, M; Altieri-Acevedo, G; Warner, D

    2016-01-01

    Autism Spectrum Disorder (ASD) is characterized by impaired social interaction and communication, and by restricted and repetitive behavior, that begins usually before a child is three years old.(1) Researchers have shown that prevalence rates in the U.S. may be as high as 1 in 68.(52) A number of studies have examined the effects of early exposure to anesthesia on brain development and subsequent impairment in neurocognitive function; yet, little is known about the possible effects of anesthetic agents on social-behavioral functioning. The association between exposure to anesthesia either in uterus, during the first years of life, or later and development of Autistic Spectrum Disorder (ASD) or its severity was determined in a retrospective population based cohort study. Identify if children who had previous exposure to anesthesia either in uterus, first years of life during their developing brain years, or later, are at risk of developing ASD and its severe form of the disease. Data was obtained from structured interviews administered to a sample of 515 parents/guardians distributed in two groups: ASD = 262 children diagnosed with this condition and Non-ASD: 253 children (siblings of ASD group) without diagnosis (95% confidence interval) that freely decided to participate and agreed to a consent form. Variables studied include: demographics, diagnosis and severity of ASD, exposure to anesthesia, method of childbirth, and age of exposure Children less than 2 years of age were considered into have developing brain period. Data was analyzed using Chi-square or Fisher exact test. In contrast to non-ASD group, most of the children within ASD group were male, 76% (p=0.0001). With regards to methods of childbirth, 64% of the ASD population were vaginal delivery (VD; Non-anesthesia exposure group) and 36% cesarean delivery (CD) compared to non-autistic population with 71% VD and 29% CD, which demonstrates no statistical difference between both groups (p=0.1113). Out of the 36% of ASD population that underwent CD, 7% were performed using general anesthesia and 93% regional anesthesia, while the 29% of the CD of non-ASD, 5% were performed using general anesthesia and 95% regional anesthesia. This reveals no statistical significance (p=0.7569) with the development of ASD and the type of anesthesia used when comparing ASD with non-ASD patients. In view of severity of autism, in VD, 56% of ASD population had mild form of the disorder, 34% moderate, and 10% severe; while CD had a 54% mild form of the disorder, 33% moderate, and 13% severe. This shows no statistical association (p=0.8069) when comparing exposure to anesthesia in uterus to subsequent severe form of ASD. Of the 262 ASD patients, 99 had exposure to anesthetics before their diagnosis, while in Non-ASD population, 110 had exposure to anesthesia, demonstrating no statistically significant association between both groups (p=0.2091). Out of 99 ASD patients exposed to anesthesia prior to their diagnosis, 72 were exposed before age 2. When compared to the 110 Non-ASD patients exposed to anesthesia, 86 had exposure during this developing brain period, which indicates no statistically significant association (p=0.4207). In addition, most of the ASD children exposed to anesthesia during developing brain were diagnosed with mild degree of the disorder when compared to ASD children without any previous exposure to anesthesia (p=0.9700) during the same period. When the exposure occurred after age 2, ASD children developed mild form of the disorder as compared with ASD children without any previous exposure to anesthesia (p=0.1699) in that period. Children under early exposure to anesthesia in uterus, first 2 years of life, or later are not more likely to develop neither ASD nor severe form of the disorder.

  13. CD19+ B cell subsets in the peripheral blood and skin lesions of psoriasis patients and their correlations with disease severity

    PubMed Central

    Lu, J.; Ding, Y.; Yi, X.; Zheng, J.

    2016-01-01

    T lymphocytes are important in the pathogenesis of psoriasis, and increasing evidence indicates that B cells also play an important role. The mechanisms of action, however, remain unclear. We evaluated the ratios of CD19+ B cells in peripheral blood mononuclear cells (PBMCs) from 157 patients with psoriasis (65 patients with psoriasis vulgaris, 32 patients with erythrodermic psoriasis, 30 patients with arthropathic psoriasis, and 30 patients with pustular psoriasis) and 35 healthy controls (HCs). Ratios of CD19+ B cells in skin lesions were compared with non-lesions in 7 erythrodermic psoriasis patients. The Psoriasis Area Severity Index (PASI) was used to measure disease severity. CD19+ B cell ratios in PBMCs from psoriasis vulgaris (at both the active and stationary stage) and arthropathic psoriasis patients were higher compared with HCs (P<0.01), but ratios were lower in erythrodermic and pustular psoriasis patients (P<0.01). CD19+ B cell ratios in erythrodermic psoriasis skin lesions were higher than in non-lesion areas (P<0.001). Different subsets of CD19+CD40+, CD19+CD44+, CD19+CD80+, CD19+CD86+, CD19+CD11b+, and CD19+HLA-DR+ B cells in PBMCs were observed in different psoriasis clinical subtypes. PASI scores were positively correlated with CD19+ B cell ratios in psoriasis vulgaris and arthropathic psoriasis cases (r=0.871 and r=0.692, respectively, P<0.01), but were negatively correlated in pustular psoriasis (r=-0.569, P<0.01). The results indicated that similar to T cells, B cells activation may also play important roles in different pathological stages of psoriasis. PMID:27532281

  14. CD44 regulates cell migration in human colon cancer cells via Lyn kinase and AKT phosphorylation.

    PubMed

    Subramaniam, Venkateswaran; Vincent, Isabella R; Gardner, Helena; Chan, Emily; Dhamko, Helena; Jothy, Serge

    2007-10-01

    Colon cancer is among the leading causes of cancer death in North America. CD44, an adhesion and antiapoptotic molecule is overexpressed in colon cancer. Cofilin is involved in the directional motility of cells. In the present study, we looked at how CD44 might modulate cell migration in human colon cancer via cofilin. We used a human colon cancer cell line, HT29, which expresses CD44, HT29 where CD44 expression was knocked down by siRNA, SW620, a human colon cancer cell line which does not express CD44, stably transfected exons of CD44 in SW620 cells and the colon from CD44 knockout and wild-type mouse. Western blot analysis of siRNA CD44 lysates showed increased level of AKT phosphorylation and decreased level of cofilin expression. Similar results were also observed with SW620 cells and CD44 knockout mouse colon lysates. Experiments using the AKT phosphorylation inhibitor LY294002 indicate that AKT phosphorylation downregulates cofilin. Immunoprecipitation studies showed CD44 complex formation with Lyn, providing an essential link between CD44 and AKT phosphorylation. LY294002 also stabilized Lyn from phosphorylated AKT, suggesting an interaction between Lyn and AKT phosphorylation. Immunocytochemistry showed that cofilin and Lyn expression were downregulated in siRNA CD44 cells and CD44 knockout mouse colon. siRNA CD44 cells had significantly less migration compared to HT29 vector. Given the well-defined roles of CD44, phosphorylated AKT in apoptosis and cancer, these results indicate that CD44-induced cell migration is dependent on its complex formation with Lyn and its consequent regulation of AKT phosphorylation and cofilin expression.

  15. Thermodynamic analysis of vapor-phase epitaxy of CdTe using a metallic Cd source

    NASA Astrophysics Data System (ADS)

    Iso, Kenji; Murakami, Hisashi; Koukitu, Akinori

    2017-07-01

    Thermodynamic analysis of CdTe growth using cost-effective metallic Cd and dialkyl telluride was performed. The major vapor species at source zone in equilibrium were gaseous Cd for the group-II precursor, and Te2 and H2Te for the group-VI precursors. The driving force for the CdTe deposition was still positive even at 650 °C. This indicates that CdTe formation from gaseous Cd can proceed thermodynamically. Furthermore, the calculations showed that CdTe decomposes at higher temperature and increasing the II/VI ratio increases the limit of the growth temperature, which coincides with the experimental results.

  16. Associations of cadmium, zinc, and lead in soils from a lead and zinc mining area as studied by single and sequential extractions.

    PubMed

    Anju, M; Banerjee, D K

    2011-05-01

    An exploratory study of the area surrounding a historical Pb-Zn mining and smelting area in Zawar, India, detected significant contamination of the terrestrial environment by heavy metals. Soils (n=87) were analyzed for pH, EC, total organic matter (TOM), Pb, Zn, Mn, and Cd levels. The statistical analysis indicated that the frequency distribution of the analyzed parameters for these soils was not normal. The median concentrations of metals in surface soils were: Pb 420.21 μ g/g, Zn 870.25 μ g/g, Mn 696.70 μ g/g, and Cd 2.09 μ g/g. Zn concentrations were significantly correlated with Cd (r=0.867), indicating that levels of Cd are dependent on Zn. However, pH, electrical conductivity and total organic matter were not correlated significantly with Cd, Pb, Zn, and Mn. To assess the potential mobility of Cd, Pb, and Zn in soils, single (EDTA) as well as sequential extraction scheme (modified BCR) were applied to representative (n=23) soil samples. The amount of Cd, Pb, and Zn extracted by EDTA and their total concentrations showed linear positive correlation, which are statistically significant (r values for Cd, Pb, and Zn being 0.901, 0.971, and 0.795, respectively, and P values being <0.001). The correlation coefficients indicate a strong relation between EDTA-extractable metal and total metal. These results appear to justify the use of 'total' metal contents as a useful preliminary indicator of areas where the risks of metal excess or deficiency are high. The EDTA extractability was maximum for Cd followed by Pb and Zn in soils from all the locations. As indicated by single extraction, the apparent mobility and potential bioavailability of metals in soils followed the order: Cd ≥ Pb > > Zn. Soil samples were sequentially extracted (modified BCR) so that solid pools of Cd, Zn, and Pb could be partitioned into four operationally defined fractions viz. acid-soluble, reducible, oxidizable, and residual. Cadmium was present appreciably (39.41%) in the acid-soluble fraction and zinc was predominantly associated (32.42%) with residual fraction. Pb (66.86%) and Zn (30.44%) were present mainly in the reducible fraction. Assuming that the mobility and bioavailability are related to solubility of geochemical forms of metals and decrease in the order of extraction, the apparent mobility and potential metal bioavailability for these contaminated soil samples is Cd > Zn > Pb.

  17. Social Anxiety Predicts Aggression in Children with ASD: Clinical Comparisons with Socially Anxious and Oppositional Youth

    ERIC Educational Resources Information Center

    Pugliese, Cara E.; White, Bradley A.; White, Susan W.; Ollendick, Thomas H.

    2013-01-01

    The present study examined the degree to which social anxiety predicts aggression in children with high functioning autism spectrum disorders (HFASD, n = 20) compared to children with Social Anxiety Disorder (SAD, n = 20) or with Oppositional Defiant Disorder or Conduct Disorder (ODD/CD, n = 20). As predicted, children with HFASD reported levels…

  18. A suitable deposition method of CdS for high performance CdS-sensitized ZnO electrodes: Sequential chemical bath deposition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Haining; Li, Weiping; Liu, Huicong

    2010-07-15

    A suitable deposition method of CdS is necessary for the high performance CdS-sensitized ZnO electrodes. In this paper, chemical bath deposition (CBD) and sequential chemical bath deposition (S-CBD) methods were used to deposit CdS on ZnO mesoporous films for ZnO/CdS electrodes. The analysis results of XRD patterns and UV-vis spectroscopy indicated that CBD deposition method leaded to the dissolving of ZnO mesoporous films in deposition solution and thickness reduction of ZnO/CdS electrodes. Absorption in visible region by the ZnO/CdS electrodes with CdS deposition by S-CBD was enhanced as deposition cycles increased due to the stability of ZnO mesoporous films inmore » the S-CBD deposition solutions. The results of photocurrent-voltage (I-V) measurement showed that the performance of ZnO/CdS electrodes with CdS deposition by CBD first increased and then decreased as deposition time increased, and the greatest short-circuit current (J{sub sc}) was obtained at the deposition time of 4 min. The performance of ZnO/CdS electrodes with CdS deposition by S-CBD increased as deposition cycles increased, and both open-circuit voltage (V{sub oc}) and J{sub sc} were greater than those electrodes with CdS deposition by CBD when the deposition cycles of S-CBD were 10 or greater. These results indicated that S-CBD is a more suitable method for high performance ZnO/CdS electrodes. (author)« less

  19. Effect of SiO 2/Si 3N 4 dielectric distributed Bragg reflectors (DDBRs) for Alq 3/NPB thin-film resonant cavity organic light emitting diodes

    NASA Astrophysics Data System (ADS)

    Lei, Po-Hsun; Wang, Shun-Hsi; Juang, Fuh Shyang; Tseng, Yung-Hsin; Chung, Meng-Jung

    2010-05-01

    In this article, we report on the effect of SiO 2/Si 3N 4 dielectric distributed Bragg reflectors (DDBRs) for Alq 3/NPB thin-film resonant cavity organic light emitting diode (RCOLED) in increasing the light output intensity and reducing the linewidth of spontaneous emission spectrum. The optimum DDBR number is found as 3 pairs. The device performance will be bad by further increasing or decreasing the number of DDBR. As compared to the conventional Alq 3/NPB thin-film organic light emitting diode (OLED), the Alq 3/NPB thin-film RCOLED with 3-pair DDBRs has the superior electrical and optical characteristics including a forward voltage of 6 V, a current efficiency of 3.4 cd/A, a luminance of 2715 cd/m 2 under the injection current density of 1000 A/m 2, and a full width at half maximum (FWHM) of 12 nm for emission spectrum over the 5-9 V bias range. These results represent that the Alq 3/NPB thin-film OLED with DDBRs shows a potential as the light source for plastic optical fiber (POF) communication system.

  20. Infrared detector development for the IASI instrument

    NASA Astrophysics Data System (ADS)

    Royer, Michel; Fleury, Joel; Lorans, Dominique; Pelier, Alain

    1997-10-01

    IASI is an infrared atmospheric sounding interferometer devoted to the operational meteorology and to atmospheric studies and is to be installed on board the ESA/EUMETSAT Polar Platform METOP to be launched in 2002. The required operating lifetime is 5 years. SAGEM/SAT has been developing the cold acquisition unit since 1991. The B-phase study was dedicated to the manufacture of the critical components, among which the IR detectors, optics, cold links and packaging. They concern the 3 types of detectors (InSb, HgCdTe-photovoltaic, HgCdTe- photoconductive) and the assembly technologies. The quantum detectors operate in the IR spectrum, so they are cooled at 100 K. The large spectrum (3.4 to 15.5 micrometer) is divided into 3 spectral bands. After manufacturing of these components, a program of test has been conducted and is reported for the evaluation of the technologies. It shows how the detector focal planes can sustain the space environmental conditions of an operational mission. It comprises two main files of test, mechanical evaluation and electrical evaluation. The detector environment has also been considered with aging and radiation tests, performed successfully. The B- phase is now achieved and all these development and testing activities are here reported.

  1. A polychromatic adaption of the Beer-Lambert model for spectral decomposition

    NASA Astrophysics Data System (ADS)

    Sellerer, Thorsten; Ehn, Sebastian; Mechlem, Korbinian; Pfeiffer, Franz; Herzen, Julia; Noël, Peter B.

    2017-03-01

    We present a semi-empirical forward-model for spectral photon-counting CT which is fully compatible with state-of-the-art maximum-likelihood estimators (MLE) for basis material line integrals. The model relies on a minimum calibration effort to make the method applicable in routine clinical set-ups with the need for periodic re-calibration. In this work we present an experimental verifcation of our proposed method. The proposed method uses an adapted Beer-Lambert model, describing the energy dependent attenuation of a polychromatic x-ray spectrum using additional exponential terms. In an experimental dual-energy photon-counting CT setup based on a CdTe detector, the model demonstrates an accurate prediction of the registered counts for an attenuated polychromatic spectrum. Thereby deviations between model and measurement data lie within the Poisson statistical limit of the performed acquisitions, providing an effectively unbiased forward-model. The experimental data also shows that the model is capable of handling possible spectral distortions introduced by the photon-counting detector and CdTe sensor. The simplicity and high accuracy of the proposed model provides a viable forward-model for MLE-based spectral decomposition methods without the need of costly and time-consuming characterization of the system response.

  2. Cancer stem cell markers in patterning differentiation and in prognosis of oral squamous cell carcinoma.

    PubMed

    Mohanta, Simple; Siddappa, Gangotri; Valiyaveedan, Sindhu Govindan; Dodda Thimmasandra Ramanjanappa, Ravindra; Das, Debashish; Pandian, Ramanan; Khora, Samanta Sekhar; Kuriakose, Moni Abraham; Suresh, Amritha

    2017-06-01

    Differentiation is a major histological parameter determining tumor aggressiveness and prognosis of the patient; cancer stem cells with their slow dividing and undifferentiated nature might be one of the factors determining the same. This study aims to correlate cancer stem cell markers (CD44 and CD147) with tumor differentiation and evaluate their subsequent effect on prognosis. Immunohistochemical analysis in treatment naïve oral cancer patients (n = 53) indicated that the expression of CD147 was associated with poorly differentiated squamous cell carcinoma and moderately differentiated squamous cell carcinoma (p < 0.01). Furthermore, co-expression analysis showed that 45% each of moderately differentiated squamous cell carcinoma and poorly differentiated squamous cell carcinoma patients were CD44 high /CD147 high as compared to only 10% of patients with well-differentiated squamous cell carcinoma. A three-way analysis indicated that differentiation correlated with recurrence and survival (p < 0.05) in only the patients with CD44 high /CD147 high cohort. Subsequently, relevance of these cancer stem cell markers in patterning the differentiation characteristics was evaluated in oral squamous cell carcinoma cell lines originating from different grades of oral cancer. Flowcytometry-based analysis indicated an increase in CD44 + /CD147 + cells in cell lines of poorly differentiated squamous cell carcinoma (94.35 ± 1.14%, p < 0.001) and moderately differentiated squamous cell carcinoma origin (93.49 ± 0.47%, p < 0.001) as compared to cell line of well-differentiated squamous cell carcinoma origin (23.12% ± 0.49%). Expression profiling indicated higher expression of cancer stem cell and epithelial-mesenchymal transition markers in SCC029B (poorly differentiated squamous cell carcinoma originated; p ≤ 0.001), which was further translated into increased spheroid formation, migration, and invasion (p < 0.001) as compared to cell line of well-differentiated squamous cell carcinoma origin. This study suggests that CD44 and CD147 together improve the prognostic efficacy of tumor differentiation; in vitro results further point out that these markers might be determinant of differentiation characteristics, imparting properties of increased self-renewal, migration, and invasion.

  3. Ultrasound-assisted fabrication of nanoporous CdS films.

    PubMed

    Singh, R S; Sanagapalli, S; Jayaraman, V; Singh, V P

    2004-01-01

    A new method for fabricating nanoporous CdS films is reported. It involves exposing the CdS solution with ultrasound waves during the process of dip coating. Indium tin oxide (ITO)-coated glass and plastic (commercial transparency) were used as substrates. In each case three different precursors were used for dip coating. The precursors used were CdCl2 and thiourea in one case and CdS nanoparticles prepared by sonochemical and microwave-assisted methods in the other two cases. X-ray diffraction studies performed on these powders show a phase corresponding to cubic CdS. The Field Emission Scanning Electron Microscopy (FE-SEM) images of the films on plastic showed uniform pores with a diameter of 80 nm for all three methods. Optical absorption measurements indicated a blue shift and multiple peaks in the absorption curve. The FE-SEM observations of the films on an ITO/glass substrate indicated a crystalline film with voids. The UV-vis absorption results indicated a blue shift in the absorption with an absorption edge at 435, 380, and 365 nm for CdS films made by solution growth, sonochemical, and microwave routes, respectively. The magnitude of the absorption is dependent on film thickness, and the observed blue shift in the absorption can be explained on the basis of quantum confinement effects.

  4. In situ stabilization remediation of cadmium contaminated soils of wastewater irrigation region using sepiolite.

    PubMed

    Sun, Yuebing; Sun, Guohong; Xu, Yingming; Wang, Lin; Lin, Dasong; Liang, Xuefeng; Shi, Xin

    2012-01-01

    The effects of immobilization remediation of Cd-contaminated soils using sepiolite on soil pH, enzyme activities and microbial communities, TCLP-Cd (toxicity characteristic leaching procedure-Cd) concentration, and spinach (Spinacia oleracea) growth and Cd uptake and accumulation were investigated. Results showed that the addition of sepiolite could increase soil pH, while the TCLP-Cd concentration in soil was decreased with increasing sepiolite. The changes of soil enzyme activities and bacteria number indicated that a certain metabolic recovery occurred after the sepiolite treatments, and spinach shoot biomass increased by 58.5%-65.5% in comparison with the control group when the concentration of sepiolite was < or = 10 g/kg. However, the Cd concentrations in the shoots and roots of spinach decreased with an increase in the rate of sepiolite, experiencing 38.4%-59.1% and 12.6%-43.6% reduction, respectively, in contrast to the control. The results indicated that sepiolite has the potential for success on a field scale in reducing Cd entry into the food chain.

  5. Effect of soil-added cadmium on several plant species

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miles, L.J.; Parker, G.R.

    Several species (Andropogon scoparius, Rhus radicans, Rudbeckia hirta, Anemone cylindrica, Monarda fistulosa, Poa pratensis, and Liatris spicata) native to northwestern Indiana were grown from seed in the greenhouse for 6 weeks. An uncontaminated sandy soil was utilized as the substrate with four levels of soil-added Cd. The concentrations added ranged from 0 to 100 ..mu..g Cd/g soil and were comparable to surface soil Cd concentration levels found in the urban-industrial region of northwestern Indiana. Data on germination, survival, height, and dry weight were collected. Germination, survival, and weight were found to exhibit a negative response to increasing soil Cd concentrationmore » over all species. Height, however, was not found to be a consistently good indicator of Cd response. While overall species' differences were noted, no differences could be conclusively shown among the species for Cd tolerance, although there were indications that this was the case. All effects noted were of a low level for the soil-added Cd concentrations utilized.« less

  6. Dimmable sunlight-like organic light emitting diodes with ultra-high color rendering index

    NASA Astrophysics Data System (ADS)

    Wu, Jin-Han; Chi, Chien-An; Chiang, Chang-Lin; Chen, Guan-Yu; Lin, Yi-Ping; Chen, Cheng-Chang; Ho, Shu-Yi; Chen, Shih-Pu; Li, Jung-Yu

    2016-05-01

    We propose novel dimmable sunlight-like white organic light-emitting diodes that were fabricated using three luminophores to form an emitting spectrum similar to black body radiation at 2250 K with ultra-high color rendering index (CRI) value of 91, which nearly remained the constant at various luminance values ranging from 100 to more than 2500 cd/m2 at Commission Internationale de l'Eclairage chromaticity coordinates of (0.51, 0.41). Introducing charge modification layers suppressed the energy transfer between the emitting material layers and increased the probability of carrier recombination. Moreover, we reveal that covering long-wavelength ranges played a vital role in achieving high CRI values; the CRI values of a spectrum artificially shifted toward a long-wavelength direction (from 610 to 620 nm) remained constant, whereas those of a spectrum shifted toward a short-wavelength direction (from 610 to 600 nm) dropped to 79.

  7. Computational study of the absorption spectrum of defected ZnS nanoparticles

    NASA Astrophysics Data System (ADS)

    Michos, F. I.; Sigalas, M. M.

    2018-04-01

    Energy levels and absorption spectra of defected ZnS nanoparticles (NPs) were calculated with Density Functional Theory (DFT) and Time Dependent DFT. Several types of defects were examined such as vacancies and substitutions. NPs with S vacancies were found to have their absorption spectra moved to lower energies well inside the visible spectrum with significantly high oscillator strength. Also, NPs with substitution of S atoms with Cl, Br, or I showed significant absorption. In general, this type of defect moves the absorption spectra in lower energies, thus bringing the absorption edge into the visible spectrum, while the unperturbed NPs have absorption edges in the UV region. In addition, ZnS NPs are made from more abundant and less toxic elements than the more commonly used CdSe NPs. For that reason, they may find significant applications in solar cells and other photonic applications, as well as in biosensing applications as biomarkers.

  8. Envelope residue 375 substitutions in simian–human immunodeficiency viruses enhance CD4 binding and replication in rhesus macaques

    PubMed Central

    Li, Hui; Wang, Shuyi; Kong, Rui; Ding, Wenge; Lee, Fang-Hua; Parker, Zahra; Kim, Eunlim; Learn, Gerald H.; Hahn, Paul; Policicchio, Ben; Brocca-Cofano, Egidio; Deleage, Claire; Hao, Xingpei; Chuang, Gwo-Yu; Gorman, Jason; Gardner, Matthew; Lewis, Mark G.; Hatziioannou, Theodora; Santra, Sampa; Apetrei, Cristian; Pandrea, Ivona; Alam, S. Munir; Liao, Hua-Xin; Shen, Xiaoying; Tomaras, Georgia D.; Farzan, Michael; Chertova, Elena; Keele, Brandon F.; Estes, Jacob D.; Lifson, Jeffrey D.; Doms, Robert W.; Montefiori, David C.; Haynes, Barton F.; Sodroski, Joseph G.; Kwong, Peter D.; Hahn, Beatrice H.; Shaw, George M.

    2016-01-01

    Most simian–human immunodeficiency viruses (SHIVs) bearing envelope (Env) glycoproteins from primary HIV-1 strains fail to infect rhesus macaques (RMs). We hypothesized that inefficient Env binding to rhesus CD4 (rhCD4) limits virus entry and replication and could be enhanced by substituting naturally occurring simian immunodeficiency virus Env residues at position 375, which resides at a critical location in the CD4-binding pocket and is under strong positive evolutionary pressure across the broad spectrum of primate lentiviruses. SHIVs containing primary or transmitted/founder HIV-1 subtype A, B, C, or D Envs with genotypic variants at residue 375 were constructed and analyzed in vitro and in vivo. Bulky hydrophobic or basic amino acids substituted for serine-375 enhanced Env affinity for rhCD4, virus entry into cells bearing rhCD4, and virus replication in primary rhCD4 T cells without appreciably affecting antigenicity or antibody-mediated neutralization sensitivity. Twenty-four RMs inoculated with subtype A, B, C, or D SHIVs all became productively infected with different Env375 variants—S, M, Y, H, W, or F—that were differentially selected in different Env backbones. Notably, SHIVs replicated persistently at titers comparable to HIV-1 in humans and elicited autologous neutralizing antibody responses typical of HIV-1. Seven animals succumbed to AIDS. These findings identify Env–rhCD4 binding as a critical determinant for productive SHIV infection in RMs and validate a novel and generalizable strategy for constructing SHIVs with Env glycoproteins of interest, including those that in humans elicit broadly neutralizing antibodies or bind particular Ig germ-line B-cell receptors. PMID:27247400

  9. Characterization of a human anti-tumoral NK cell population expanded after BCG treatment of leukocytes

    PubMed Central

    García-Cuesta, Eva M.; Esteso, Gloria; Ashiru, Omodele; López-Cobo, Sheila; Álvarez-Maestro, Mario; Linares, Ana; Ho, Mei M.; Martínez-Piñeiro, Luis; T. Reyburn, Hugh; Valés-Gómez, Mar

    2017-01-01

    ABSTRACT Immunotherapy, via intra-vesical instillations of BCG, is the therapy of choice for patients with high-risk non-muscle invasive bladder cancer. The subsequent recruitment of lymphocytes and myeloid cells, as well as the release of cytokines and chemokines, is believed to induce a local immune response that eliminates these tumors, but the detailed mechanisms of action of this therapy are not well understood. Here, we have studied the phenotype and function of the responding lymphocyte populations as well as the spectrum of cytokines and chemokines produced in an in vitro model of human peripheral blood mononuclear cells (PBMCs) co-cultured with BCG. Natural killer (NK) cell activation was a prominent feature of this immune response and we have studied the expansion of this lymphocyte population in detail. We show that, after BCG stimulation, CD56dim NK cells proliferate, upregulate CD56, but maintain the expression of CD16 and the ability to mediate ADCC. CD56bright NK cells also contribute to this expansion by increasing CD16 and KIR expression. These unconventional CD56bright cells efficiently degranulated against bladder cancer cells and the expansion of this population required the release of soluble factors by other immune cells in the context of BCG. Consistent with these in vitro data, a small, but significant increase in the intensity of CD16 expression was noted in peripheral blood CD56bright cells from bladder cancer patients undergoing BCG therapy, that was not observed in patients treated with mitomycin-C instillations. These observations suggest that activation of NK cells may be an important component of the anti-tumoral immune response triggered by BCG therapy in bladder cancer. PMID:28507799

  10. Nano-architecture based photoelectrochemical water oxidation efficiency enhancement by CdS photoanodes

    NASA Astrophysics Data System (ADS)

    Pareek, Alka; Kim, Hyun Gyu; Paik, Pradip; Joardar, Joydip; Borse, Pramod H.

    2017-02-01

    In the present work, 2D nanostructuring has been utilized to impart an efficiency improvement to the hexagonal phase CdS films for the photoelectrochemical (PEC) cells those were deposited by spray pyrolysis technique. By controlling the aerosol droplet- size, population and impingement time during the spray pyrolysis deposition, various nano-features viz. randomly aligned nanorods, nanotubes and nanowires of CdS has been demonstrated for the first time. A growth mechanism has been proposed to predict the temporal evolution of the nanostructures. The prominent nanoscale structures show improved optical properties in the visible range of solar spectrum. The structural studies validate the morphological differences of nanostructures in terms of the texture coefficient analysis as well as 2D micro x-ray diffraction imaging. Electrochemical characterization is carried out to understand the effect of nanostructuring on the PEC performance of the CdS photoanodes in the sulphide (0.1 M Na2S  +  0.02 M Na2SO3) electrolyte at applied bias of 0.2 V (versus SCE). The evolution of morphology from randomly aligned rods to nanowire is responsible for improved photocurrent (3.5 times). CdS film morphology can be tuned to nanotubes, nano- rose buds and nanorod bunches even by doping Zn2+ ions in CdS lattice. Nano-structuring of doped CdS has shown enhanced performance of the photoanodes. The nanotubes structures yielded highest photocurrent density of 1.6 mA cm-2. Whereas modifying the 2D-nanostructured CdS film by simple MoO3 spray coating yields the photocurrent enhancement to 2.1 mA cm-2.

  11. Prognostic role of tumour-associated macrophages and regulatory T cells in EBV-positive and EBV-negative nasopharyngeal carcinoma.

    PubMed

    Ooft, Marc L; van Ipenburg, Jolique A; Sanders, Maxime E; Kranendonk, Mariette; Hofland, Ingrid; de Bree, Remco; Koljenović, Senada; Willems, Stefan M

    2018-03-01

    Tumour-associated macrophages (TAMs) and regulatory T cells (Tregs) form a special niche supporting tumour progression, and both correlate with worse survival in head and neck cancers. However, the prognostic role of TAM and Tregs in nasopharyngeal carcinoma (NPC) is still unknown. Therefore, we determined differences in TAMs and Tregs in different NPC subtypes, and their prognostic significance. Tissue of 91 NPCs was assessed for TAMs and Tregs by determination of CD68, CD163, CD206 and FOXP3 expression in the tumour microenvironment. Clinicopathological correlations were assessed using Pearson X 2 test, Fisher's exact test, analysis of variance and Mann-Whitney U test. Survival was analysed using Kaplan-Meier curves and Cox regression. CD68 and FOXP3 counts were higher in Epstein-Barr virus (EBV)-positive NPC, while CD68-/FOXP3-, CD163+/FOXP3- and CD206+/FOXP3- infiltrates were more common in EBV-negative NPC. In the whole NPC group, CD68-/FOXP3- correlated with worse overall survival (OS), and after multivariate analysis high FOXP3 count showed better OS (HR 0.352, 95% CI 0.128 to 0.968). No difference in M2 counts existed between EBV-positive and negative NPC. FOXP3, a Treg marker, seems to be an independent prognostic factor for better OS in the whole NPC group. Therefore, immune-based therapies targeting Tregs should be carefully evaluated. M2 spectrum macrophages are probably more prominent in EBV-negative NPC with also functional differences compared with EBV-positive NPC. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  12. Foliar application with nano-silicon alleviates Cd toxicity in rice seedlings.

    PubMed

    Wang, Shihua; Wang, Fayuan; Gao, Shuangcheng

    2015-02-01

    Nanofertilizers may be more effective than regular fertilizers in improving plant nutrition, enhancing nutrition use efficiency, and protecting plants from environmental stress. A hydroponic pot experiment was conducted to study the role of foliar application with 2.5 mM nano-silicon in alleviating Cd stress in rice seedlings (Oryza sativa L. cv Youyou 128) grown in solution added with or without 20 μM CdCl2. The results showed that Cd treatment decreased the growth and the contents of Mg, Fe, Zn, chlorophyll a, and glutathione (GSH), accompanied by a significant increase in Cd accumulation. However, foliar application with nano-Si improved the growth, Mg, Fe, and Zn nutrition, and the contents of chlorophyll a of the rice seedlings under Cd stress and decreased Cd accumulation and translocation of Cd from root to shoot. Cd treatment produced oxidative stress to rice seedlings indicated by a higher lipid peroxidation level (as malondialdehyde (MDA)) and higher activities of antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), and a lower GSH content. However, those nano-Si-treated plants had lower MDA but higher GSH content and different antioxidant enzyme activities, indicating a higher Cd tolerance in them. The results suggested that nano-Si application alleviated Cd toxicity in rice by decreasing Cd accumulation, Cd partitioning in shoot and MDA level and by increasing content of some mineral elements (Mg, Fe, and Zn) and antioxidant capacity.

  13. Dandelion Taraxacum linearisquameum does not reflect soil metal content in urban localities.

    PubMed

    Kováčik, Jozef; Dudáš, Matej; Hedbavny, Josef; Mártonfi, Pavol

    2016-11-01

    Accumulation of selected heavy metals (Cd, Pb, Ni, Cr, Fe, and Zn) and phenolic metabolites (total soluble phenols, cichoric and caftaric acid) in dandelion organs (leaves, roots, inflorescences/anthodia) collected from six localities within the industrial town Košice (eastern Slovakia) were studied. Localities from the vicinity of a steel factory (Cd, Fe) and heavy traffic (Pb, Ni, Cr, Zn) contained the highest amount of individual metals in the soil but a significant correlation between soil and organ metal content was found only for Cr in the leaves (r 2  = 0.7679). The amount of Cd and partially Pb differed among localities in all organs and especially in the leaves and anthodia, indicating probably the impact of atmospheric pollution. The bioaccumulation factor was <1 for almost all metals, suggesting that given dandelion species is not metal accumulator. Translocation factor did not reach values close to or over 1 only for Cd, indicating a root-to-shoot movement of Pb, Ni and Zn though the impact of air pollution on leaves cannot be excluded. A strong correlation between leaf Cd and leaf total phenols, cichoric and caftaric acids was observed (r 2  = 0.7926, 0.8682 and 0.8830, respectively), indicating that phenolic metabolites act in the protection of dandelion against Cd excess. Overall, our data indicate low pollution of urban soil by Cd (5.53-113.8 ng g -1 ) and partially by Cr and the suitability of above-ground organs of dandelion species for the monitoring of air pollution mainly by Cd. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Ecological Risk Assessment of Metals Contamination in the Sediments of Natural Urban Wetlands in Dry Tropical Climate.

    PubMed

    Rana, Vivek; Maiti, Subodh Kumar; Jagadevan, Sheeja

    2016-09-01

    The pollution load due to metal contamination in the sediments of urban wetlands (Dhanbad, India) due to illegal release of domestic and industrial wastewater was studied by using various geochemical indices, such as contamination factor (Cf), degree of contamination (Cd), modified degree of contamination (mCd), pollution load index (PLI) and geoaccumulation index (Igeo) for Cu, Co, Cd, Cr and Mn. Cluster analysis (CA) and Principal component analysis (PCA) of metals present in wetland sediments were carried out to assess their origin and relationship with each other. The Cf values for different metals in the wetlands under investigation indicated low to very high level of pollution (Cf ranged between 0.02 and 14.15) with highest Cf (14.15) for Cd. The wetland receiving both domestic and industrial wastewater had the highest values of Cd, mCd and PLI as 17.48, 3.49 and 1.03 respectively.

  15. Rituximab monitoring and redosing in pediatric neuromyelitis optica spectrum disorder

    PubMed Central

    Nosadini, Margherita; Alper, Gulay; Riney, Catherine J.; Benson, Leslie A.; Mohammad, Shekeeb S.; Ramanathan, Sudarshini; Nolan, Melinda; Appleton, Richard; Leventer, Richard J.; Deiva, Kumaran; Brilot, Fabienne; Gorman, Mark P.; Waldman, Amy T.; Banwell, Brenda

    2016-01-01

    Objective: To study rituximab in pediatric neuromyelitis optica (NMO)/NMO spectrum disorders (NMOSD) and the relationship between rituximab, B cell repopulation, and relapses in order to improve rituximab monitoring and redosing. Methods: Multicenter retrospective study of 16 children with NMO/NMOSD receiving ≥2 rituximab courses. According to CD19 counts, events during rituximab were categorized as “repopulation,” “depletion,” or “depletion failure” relapses (repopulation threshold CD19 ≥10 × 106 cells/L). Results: The 16 patients (14 girls; mean age 9.6 years, range 1.8–15.3) had a mean of 6.1 events (range 1–11) during a mean follow-up of 6.1 years (range 1.6–13.6) and received a total of 76 rituximab courses (mean 4.7, range 2–9) in 42.6-year cohort treatment. Before rituximab, 62.5% had received azathioprine, mycophenolate mofetil, or cyclophosphamide. Mean time from rituximab to last documented B cell depletion and first repopulation was 4.5 and 6.8 months, respectively, with large interpatient variability. Earliest repopulations occurred with the lowest doses. Significant reduction between pre- and post-rituximab annualized relapse rate (ARR) was observed (p = 0.003). During rituximab, 6 patients were relapse-free, although 21 relapses occurred in 10 patients, including 13 “repopulation,” 3 “depletion,” and 4 “depletion failure” relapses. Of the 13 “repopulation” relapses, 4 had CD19 10–50 × 106 cells/L, 10 had inadequate monitoring (≤1 CD19 in the 4 months before relapses), and 5 had delayed redosing after repopulation detection. Conclusion: Rituximab is effective in relapse prevention, but B cell repopulation creates a risk of relapse. Redosing before B cell repopulation could reduce the relapse risk further. Classification of evidence: This study provides Class IV evidence that rituximab significantly reduces ARR in pediatric NMO/NMOSD. This study also demonstrates a relationship between B cell repopulation and relapses. PMID:26819962

  16. Myeloid dendritic cells frequencies are increased in children with autism spectrum disorder and associated with amygdala volume and repetitive behaviors

    PubMed Central

    Breece, Elizabeth; Paciotti, Brian; Nordahl, Christine Wu; Ozonoff, Sally; Van de Water, Judy A.; Rogers, Sally J.; Amaral, David; Ashwood, Paul

    2012-01-01

    The pathophysiology of Autism Spectrum Disorder (ASD) is not yet known; however, studies suggest that dysfunction of the immune system affects many children with ASD. Increasing evidence points to dysfunction of the innate immune system including activation of microglia and perivascular macrophages, increases in inflammatory cytokines/chemokines in brain tissue and CSF, and abnormal peripheral monocyte cell function. Dendritic cells are major players in innate immunity and have important functions in the phagocytosis of pathogens or debris, antigen presentation, activation of naïve T cells, induction of tolerance and cytokine/chemokine production. In this study, we assessed circulating frequencies of myeloid dendritic cells (defined as Lin-1−BDCA1+CD11c+ and Lin-1−BDCA3+CD123−) and plasmacytoid dendritic cells (Lin-1− BDCA2+CD123+ or Lin-1−BDCA4+ CD11c−) in 57 children with ASD, and 29 typically developing controls of the same age, all of who were enrolled as part of the Autism Phenome Project (APP). The frequencies of dendritic cells and associations with behavioral assessment and MRI measurements of amygdala volume were compared in the same participants. The frequencies of myeloid dendritic cells were significantly increased in children with ASD compared to typically developing controls (p < 0.03). Elevated frequencies of myeloid dendritic cells were positively associated with abnormal right and left amygdala enlargement, severity of gastrointestinal symptoms and increased repetitive behaviors. The frequencies of plasmacytoid dendritic cells were also associated with amygdala volumes as well as developmental regression in children with ASD. Dendritic cells play key roles in modulating immune responses and differences in frequencies or functions of these cells may result in immune dysfunction in children with ASD. These data further implicate innate immune cells in the complex pathophysiology of ASD. PMID:23063420

  17. Spectrum of Pig-a mutations in T lymphocytes of rats treated with procarbazine.

    PubMed

    Revollo, Javier; Bhalli, Javed A; Tebbe, Cameron; Noteboom, Jessica; Thomas, Demetria; McKinzie, Page; Felton, Nicholas; Pearce, Mason G; Dobrovolsky, Vasily N

    2017-12-31

    Procarbazine is a primary component of antineoplastic combination chemotherapy often used for the treatment of Hodgkin's lymphoma. It is believed that cytostatic and cytotoxic properties of procarbazine are mediated via its interaction with genomic DNA. Procarbazine is a carcinogen in animal models; it is classified as Group 2A compound by IARC. Also it is known as an in vitro and in vivo mutagen and genotoxicant. However, the molecular mechanism by which procarbazine induces mutations is not thoroughly understood and the spectrum of procarbazine-induced in vivo mutations is described insufficiently. We employed flow cytometry-based erythrocyte and T lymphocyte assays in order to quantify the frequencies of cells deficient in glycosylphosphatidyl inositol-anchored surface markers CD59 and CD48 (presumed mutants in the endogenous X-linked Pig-a gene) in rats. The rats were treated once daily with 100 mg/kg procarbazine HCl for 3 days. In addition, we sorted mutant-phenotype spleen T cells and immediately analysed their Pig-a gene using next generation sequencing of dual-indexed multiplex libraries and error-correcting data filtering. More than 100-fold increase in the frequencies of CD59-deficient RBCs was observed at Day 29 after the last administration, and a 10-fold increase in the frequency of CD48-deficient T cells was observed at Days 45 to 50. Sequencing revealed that, in T cells from procarbazine-treated rats, mutations in the Pig-a gene occurred predominantly at A:T basepairs when A was located on the non-transcribed DNA strand. A→T transversion was the most common mutation. Our results suggest that, at least for the transcribed X-linked Pig-a gene, in vivo methyl guanine adducts are not the major contributors to mutations induced by procarbazine. © The Author(s) 2017. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Hydrous ferric oxide: evaluation of Cd-HFO surface complexation models combining Cd(K) EXAFS data, potentiometric titration results, and surface site structures identified from mineralogical knowledge.

    PubMed

    Spadini, Lorenzo; Schindler, Paul W; Charlet, Laurent; Manceau, Alain; Vala Ragnarsdottir, K

    2003-10-01

    The surface properties of ferrihydrite were studied by combining wet chemical data, Cd(K) EXAFS data, and a surface structure and protonation model of the ferrihydrite surface. Acid-base titration experiments and Cd(II)-ferrihydrite sorption experiments were performed within 3<-log[H(+)]<10.5 and 0.5<[Cd(t)]<12 mM in 0.3 M NaClO(4) at 25 degrees C, where [Cd(t)] refers to total Cd concentration. Measurements at -5.5triple bond Fe-OH(-1/2),logk((int))=-8.29, assuming the existence of a unique intrinsic microscopic constant, logk((int)), and consequently the existence of a single significant type of acid-base reactive functional groups. The surface structure model indicates that these groups are terminal water groups. The Cd(II) data were modeled assuming the existence of a single reactive site. The model fits the data set at low Cd(II) concentration and up to 50% surface coverage. At high coverage more Cd(II) ions than predicted are adsorbed, which is indicative of the existence of a second type of site of lower affinity. This agrees with the surface structure and protonation model developed, which indicates comparable concentrations of high- and low-affinity sites. The model further shows that for each class of low- and high-affinity sites there exists a variety of corresponding Cd surface complex structure, depending on the model crystal faces on which the complexes develop. Generally, high-affinity surface structures have surface coordinations of 3 and 4, as compared to 1 and 2 for low-affinity surface structures.

  19. Epithelial-mesenchymal transition in breast epithelial cells treated with cadmium and the role of Snail.

    PubMed

    Wei, Zhengxi; Shan, Zhongguo; Shaikh, Zahir A

    2018-04-01

    Epidemiological and experimental studies have implicated cadmium (Cd) with breast cancer. In breast epithelial MCF10A and MDA-MB-231 cells, Cd has been shown to promote cell growth. The present study examined whether Cd also promotes epithelial-mesenchymal transition (EMT), a hallmark of cancer progression. Human breast epithelial cells consisting of non-cancerous MCF10A, non-metastatic HCC 1937 and HCC 38, and metastatic MDA-MB-231 were treated with 1 or 3 μM Cd for 4 weeks. The MCF10A epithelial cells switched to a more mesenchymal-like morphology, which was accompanied by a decrease in the epithelial marker E-cadherin and an increase in the mesenchymal markers N-cadherin and vimentin. In both non-metastatic HCC 1937 and HCC 38 cells, treatment with Cd decreased the epithelial marker claudin-1. In addition, E-cadherin also decreased in the HCC 1937 cells. Even the mesenchymal-like MDA-MB-231 cells exhibited an increase in the mesenchymal marker vimentin. These changes indicated that prolonged treatment with Cd resulted in EMT in both normal and cancer-derived breast epithelial cells. Furthermore, both the MCF10A and MDA-MB-231 cells labeled with Zcad, a dual sensor for tracking EMT, demonstrated a decrease in the epithelial marker E-cadherin and an increase in the mesenchymal marker ZEB-1. Treatment of cells with Cd significantly increased the level of Snail, a transcription factor involved in the regulation of EMT. However, the Cd-induced Snail expression was completely abolished by actinomycin D. Luciferase reporter assay indicated that the expression of Snail was regulated by Cd at the promotor level. Snail was essential for Cd-induced promotion of EMT in the MDA-MB-231 cells, as knockdown of Snail expression blocked Cd-induced cell migration. Together, these results indicate that Cd promotes EMT in breast epithelial cells and does so by modulating the transcription of Snail. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. The cytokine-dependent MUTZ-3 cell line as an in vitro model for the screening of contact sensitizers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azam, Philippe; Peiffer, Jean-Luc; Chamousset, Delphine

    2006-04-01

    Langerhans cells (LC) are key mediators of contact allergenicity in the skin. However, no in vitro methods exist which are based on the activation process of LC to predict the sensitization potential of chemicals. In this study, we have evaluated the performances of MUTZ-3, a cytokine-dependent human monocytic cell line, in its response to sensitizers. First, we compared undifferentiated MUTZ-3 cells with several standard human cells such as THP-1, KG-1, HL-60, K-562, and U-937 in their response to the strong sensitizer DNCB and the irritant SDS by monitoring the expression levels of HLA-DR, CD54, and CD86 by flow cytometry. Onlymore » MUTZ-3 and THP-1 cells show a strong and specific response to sensitizer, while other cell lines showed very variable responses. Then, we tested MUTZ-3 cells against a wider panel of sensitizers and irritants on a broader spectrum of cell surface markers (HLA-DR, CD40, CD54, CD80, CD86, B7-H1, B7-H2, B7-DC). Of these markers, CD86 proved to be the most reliable since it detected all sensitizers, including benzocaine, a classical false negative in local lymph node assay (LLNA) but not irritants. We confirmed the MUTZ-3 response to DNCB by real-time PCR analysis. Taken together, our data suggest that undifferentiated MUTZ-3 cells may represent a valuable in vitro model for the screening of potential sensitizers.« less

  1. Prototyping of MWIR MEMS-based optical filter combined with HgCdTe detector

    NASA Astrophysics Data System (ADS)

    Kozak, Dmitry A.; Fernandez, Bautista; Velicu, Silviu; Kubby, Joel

    2010-02-01

    In the past decades, there have been several attempts to create a tunable optical detector with operation in the infrared. The drive for creating such a filter is its wide range of applications, from passive night vision to biological and chemical sensors. Such a device would combine a tunable optical filter with a wide-range detector. In this work, we propose using a Fabry-Perot interferometer centered in the mid-wave infrared (MWIR) spectrum with an HgCdTe detector. Using a MEMS-based interferometer with an integrated Bragg stack will allow in-plane operation over a wide range. Because such devices have a tendency to warp, creating less-than-perfect optical surfaces, the Fabry-Perot interferometer is prototyped using the SOI-MUMPS process to ensure desirable operation. The mechanical design is aimed at optimal optical flatness of the moving membranes and a low operating voltage. The prototype is tested for these requirements. An HgCdTe detector provides greater performance than a pyroelectic detector used in some previous work, allowing for lower noise, greater detection speed and higher sensitivity. Both a custom HgCdTe detector and commercially available pyroelectric detector are tested with commercial optical filter. In previous work, monolithic integration of HgCdTe detectors with optical filters proved to be problematic. Part of this work investigates the best approach to combining these two components, either monolithically in HgCdTe or using a hybrid packaging approach where a silicon MEMS Fabry-Perot filter is bonded at low temperature to a HgCdTe detector.

  2. Competitive adsorption-desorption reactions of two hazardous heavy metals in contaminated soils.

    PubMed

    Davari, Masoud; Rahnemaie, Rasoul; Homaee, Mehdi

    2015-09-01

    Investigating the interactions of heavy metals is imperative for sustaining environment and human health. Among those, Cd is toxic for organisms at any concentration. While Ni acts as a micronutrient at very low concentration but is hazardous toxic above certain threshold value. In this study, the chemical adsorption and desorption reactions of Ni and Cd in contaminated soils were investigated in both single and binary ion systems. Both Ni and Cd experimental data demonstrated Langmuir type adsorption. In the competitive systems, an antagonistic effect was observed, implying that both ions compete for same type of adsorption sites. Adverse effect of Cd on Ni adsorption was slightly stronger than that of opposite system, consistent with adsorption isotherms in single ion systems. Variation in ionic strength indicated that Ca, a much weaker adsorbate, could also compete with Cd and Ni for adsorption on soil particles. Desorption data indicated that Cd and Ni are adsorbed very tightly such that after four successive desorption steps, less than 0.5 % of initially adsorbed ions released into the soil solution. This implies that Ca, at concentration in equilibrium with calcite mineral, cannot adequately compete with and replace adsorbed Ni and Cd ions. This adsorption behavior was led to considerable hysteresis between adsorption and desorption in both single and binary ion systems. In the binary ion systems, desorption of Cd and Ni was increased by increase in both equilibrium concentration of adsorbed ion and concentration of competitor ion. The overall results obtained in this research indicate that Cd and Ni are strongly adsorbed in calcareous soil and Ca, the major dissolved ion, insignificantly influences metal ions adsorption. Consequently, the contaminated soils by Ni and Cd can simultaneously be remediated by environmentally oriented technologies such as phytoremediation.

  3. Simian immunodeficiency virus selectively infects proliferating CD4+ T cells in neonatal rhesus macaques.

    PubMed

    Wang, Xiaolei; Xu, Huanbin; Pahar, Bapi; Alvarez, Xavier; Green, Linda C; Dufour, Jason; Moroney-Rasmussen, Terri; Lackner, Andrew A; Veazey, Ronald S

    2010-11-18

    Infants infected with HIV have a more severe course of disease and persistently higher viral loads than HIV-infected adults. However, the underlying pathogenesis of this exacerbation remains obscure. Here we compared the rate of CD4(+) and CD8(+) T-cell proliferation in intestinal and systemic lymphoid tissues of neonatal and adult rhesus macaques, and of normal and age-matched simian immunodeficiency virus (SIV)-infected neonates. The results demonstrate infant primates have much greater rates of CD4(+) T-cell proliferation than adult macaques, and that these proliferating, recently "activated" CD4(+) T cells are infected in intestinal and other lymphoid tissues of neonates, resulting in selective depletion of proliferating CD4(+) T cells in acute infection. This depletion is accompanied by a marked increase in CD8(+) T-cell activation and production, particularly in the intestinal tract. The data indicate intestinal CD4(+) T cells of infant primates have a markedly accelerated rate of proliferation and maturation resulting in more rapid and sustained production of optimal target cells (activated memory CD4(+) T cells), which may explain the sustained "peak" viremia characteristic of pediatric HIV infection. Eventual failure of CD4(+) T-cell turnover in intestinal tissues may indicate a poorer prognosis for HIV-infected infants.

  4. Mechanisms involved in synergistic anticancer immunity of anti-4-1BB and anti-CD4 therapy.

    PubMed

    Choi, Beom K; Kim, Young H; Kang, Woo J; Lee, Sun K; Kim, Kwang H; Shin, Su M; Yokoyama, Wayne M; Kim, Tae Y; Kwon, Byoung S

    2007-09-15

    Anti-4-1BB-mediated anticancer effects were potentiated by depletion of CD4+ cells in B16F10 melanoma-bearing C57BL/6 mice. Anti-4-1BB induced the expansion and differentiation of polyclonal tumor-specific CD8+ T cells into IFN-gamma-producing CD11c+CD8+ T cells. The CD4+ cell depletion was responsible for facilitating immune cell infiltration into tumor tissues and removing some regulatory barriers such as T regulatory and indoleamine-2,3-dioxygenase (IDO)+ dendritic cells. Both monoclonal antibodies (mAb) contributed to the efficient induction of MHC class I molecules on the tumor cells in vivo. The effectors that mediated the anti-4-1BB effect were NKG2D+KLRG1+CD11c+CD8+ T cells that accumulated preferentially in the tumor tissues. Blocking NKG2D reduced the therapeutic effect by 20% to 26%, which may indicate that NKG2D contributes partially to tumor killing by the differentiated CD8+ T cells. Our results indicate that the combination of the two mAbs, agonistic anti-4-1BB and depleting anti-CD4, results in enhanced production of efficient tumor-killing CTLs, facilitation of their infiltration, and production of a susceptible tumor microenvironment.

  5. Surface enhanced Raman scattering of new acridine based fluorophore adsorbed on silver electrode

    NASA Astrophysics Data System (ADS)

    Solovyeva, Elena V.; Myund, Liubov A.; Denisova, Anna S.

    2015-10-01

    4,5-Bis(N,N-di(2-hydroxyethyl)iminomethyl)acridine (BHIA) is a new acridine based fluoroionophore and a highly-selective sensor for cadmium ion. The direct interaction of the aromatic nitrogen atom with a surface is impossible since there are bulky substituents in the 4,5-positions of the acridine fragment. Nevertheless BHIA molecule shows a reliable SERS spectrum while adsorbed on a silver electrode. The analysis of SERS spectra pH dependence reveals that BHIA species adsorbed on a surface can exist in both non-protonated and protonated forms. The adsorption of BHIA from alkaline solution is accompanied by carbonaceous species formation at the surface. The intensity of such "carbon bands" turned out to be related with the supporting electrolyte (KCl) concentration. Upon lowering the electrode potential the SERS spectra of BHIA do not undergo changes but the intensity of bands decreases. This indicates that the adsorption mechanism on the silver surface is realized via aromatic system of acridine fragment. In case of such an adsorption mechanism the chelate fragment of the BHIA molecule is capable of interaction with the solution components. Addition of Cd2+ ions to a system containing BHIA adsorbed on a silver electrode in equilibrium with the solution leads to the formation of BHIA/Cd2+ complex which desorption causes the loss of SERS signal.

  6. Structural, physicochemical and antioxidant properties of sodium alginate isolated from a Tunisian brown seaweed.

    PubMed

    Sellimi, Sabrine; Younes, Islem; Ayed, Hanen Ben; Maalej, Hana; Montero, Veronique; Rinaudo, Marguerite; Dahia, Mostefa; Mechichi, Tahar; Hajji, Mohamed; Nasri, Moncef

    2015-01-01

    An original sodium alginate from Tunisian seaweed (Cystoseira barbata) was purified and characterized by circular dichroism (CD) and ATR-FTIR spectroscopies. ATR-FTIR spectrum of C. barbata sodium alginate (CBSA) showed the characteristic bands of mannuronic (M) and guluronic acids (G). The M/G ratio was estimated by CD (M/G = 0.59) indicating that CBSA was composed of 37% mannuronic acid and 63% guluronic acid. The analysis of viscosity of CBSA showed evidence of pseudoplastic fluid behaviour. The emulsifying capacity of CBSA was evaluated at different concentrations (0.25-3%), temperatures (25-100 °C) and pH (3.0-11.0). Compared to most commercial emulsifiers, the emulsion formulated by CBSA was found to be less sensitive to temperature changes and more stable at acidic pH. CBSA was examined for antioxidant properties using various antioxidant assays. CBSA exhibited important DPPH radical-scavenging activity (74% inhibition at a concentration of 0.5 mg/ml) and considerable ferric reducing potential. Effective hydroxyl-radical scavenging activity (82% at a concentration of 5 mg/ml) and potent protection activity against DNA breakage were also recorded for CBSA. However, in the linoleate-β-carotene system, CBSA exerted moderate antioxidant activity (60% at a concentration of 1.5 mg/ml). Therefore, CBSA can be used as a natural ingredient in food industry or in the pharmaceutical field. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Effect of Inoculation with Glomus versiforme on Cadmium Accumulation, Antioxidant Activities and Phytochelatins of Solanum photeinocarpum

    PubMed Central

    Tan, Shi-Yun; Jiang, Qiu-Yun; Zhuo, Feng; Liu, Hui; Wang, Yu-Tao; Li, Shao-Shan; Ye, Zhi-Hong; Jing, Yuan-Xiao

    2015-01-01

    The plant growth, phosphate acquisition, Cd translocation, phytochelatins (PCs) production and antioxidant parameters [superoxide dismutase (SOD), catalase (CAT), guaiacol peroxidase (POD), ascorbate peroxidase (APX), glutathione reductase (GR), glutathione (GSH), ascorbate (ASA) and malonaldehyde (MDA)] were investigated in Cd-hyperaccumulator Solanum photeinocarpum inoculated with Glomus versiforme BGC GD01C (Gv) in Cd-added soils (0, 5, 10, 20, 40 mg Cd kg-1 soil). Mycorrhizal colonization rates were generally high (from 77% to 94%), and hardly affected by Cd. Gv colonization significantly enhanced P acquisition, growth and total Cd uptakes in both shoots and roots of S. photeinocarpum at all Cd levels. Meanwhile, Gv symbiosis significantly increased Cd concentration in the roots, and decreased Cd concentration in the shoots at all Cd levels, which indicates that Gv could promote phytostabilization by enhancing Cd accumulation in the roots to inhibit its translocation to shoots and the “dilution effects” linked to an increase in plant dry matter yield and a reduced Cd partitioning to shoots. Moreover, the improvement of CAT, POD and APX activities in the leaves of mycorrhizal plants infers that Gv symbiosis helped S. photeinocarpum to relieve oxidative damage to biomolecules in Cd-contaminated soil. The evident decline of MDA content in the leaves of mycorrhizal plants indicates that Gv symbiosis evidently improved antioxidant activities, and the enhancement of PCs production in the leaves of mycorrhizal plants suggests that Gv-inoculated plant may be more efficient to relieve Cd phytotoxicity. Therefore, the possible mechanisms of Cd phytotoxicity alleviation by Gv can be concluded as the decline of Cd concentration in the shoots and the improvement of P acquisition, PCs production and activities of CAT, POD, APX in mycorrhizal plants. PMID:26176959

  8. Antigen presenting cells (APCs) from thermally injured and/or septic rats modulate CD4+ T cell responses of naive rat.

    PubMed

    Fazal, Nadeem; Raziuddin, Syed; Khan, Mehdi; Al-Ghoul, Walid M

    2006-01-01

    Regulation of immune response is marked by complex interactions among the cells that recognize and present antigens. Antigen presenting cells (APCs), the antigen presenting cell component of the innate immune response plays an important role in effector CD4+ T cell response. Thermal injury and/or superimposed sepsis in rats' leads to suppressed CD4+ T cell functions. We investigated modulations of CD4+ T cell function by APCs (purified non-T cells) from thermally injured and/or septic rats. Rats were subjected to 30% total body surface area scald burn or exposed to 37 degrees C water (Sham burn) and sepsis was induced by cecal-ligation and puncture (CLP) method. At day 3 post-injury animals were sacrificed and CD4+ T cells and APCs from mesenteric lymph nodes (MLN) were obtained using magnetic microbead isolation procedure. APCs from injured rats were co-cultured with sham rat MLN CD4+ T cells and proliferative responses (thymidine incorporation), phenotypic changes (Flow cytometry), IL-2 production (ELISA) and CTLA-4 mRNA (RT-PCR) were determined in naive rat CD4+ T cells. The data indicate that APCs from thermally injured and/or septic rats when co-cultured with CD4+ T cells suppressed CD4+ T cell effector functions. This lack of CD4+ T cell activation was accompanied with altered co-stimulatory molecules, i.e., CD28 and/or CTLA-4 (CD152). In conclusion, our studies indicated that defective APCs from thermally injured and/or septic rats modulate CD4+ T cell functions via changes in co-stimulatory molecules expressed on naive CD4+ T cells. This altered APC: CD4+ T cell interaction leads to suppressed CD4+ T cell activation of healthy animals.

  9. CHEMICAL ANALYSIS OF A CARBON-ENHANCED VERY METAL-POOR STAR: CD-27 14351

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karinkuzhi, Drisya; Goswami, Aruna; Masseron, Thomas

    2017-01-01

    We present, for the first time, an abundance analysis of a very metal-poor carbon-enhanced star CD-27 14351 based on a high-resolution ( R  ∼ 48,000) FEROS spectrum. Our abundance analysis performed using local thermodynamic equilibrium model atmospheres shows that the object is a cool star with stellar atmospheric parameters, effective temperature T {sub eff} = 4335 K, surface gravity log g  = 0.5, microturbulence ξ  = 2.42 km s{sup −1}, and metallicity [Fe/H] = −2.6. The star exhibits high carbon and nitrogen abundances with [C/Fe] = 2.89 and [N/Fe] = 1.89. Overabundances of neutron-capture elements are evident in Ba, La, Ce, and Nd, with estimated [X/Fe] > 1, the largest enhancementmore » being seen in Ce with [Ce/Fe] = 2.63. While the first peak s -process elements Sr and Y are found to be enhanced with respect to Fe, ([Sr/Fe] = 1.73 and [Y/Fe] = 1.91), the third peak s -process element Pb could not be detected in our spectrum at the given resolution. Europium, primarily an r -process element also shows an enhancement with [Eu/Fe] = 1.65. With [Ba/Eu] = 0.12, the object CD-27 14351 satisfies the classification criterion for a CEMP-r/s star. The elemental abundance distributions observed in this star are discussed in light of the chemical abundances observed in other CEMP stars in the literature.« less

  10. Trichoderma reesei FS10-C enhances phytoremediation of Cd-contaminated soil by Sedum plumbizincicola and associated soil microbial activities

    PubMed Central

    Teng, Ying; Luo, Yang; Ma, Wenting; Zhu, Lingjia; Ren, Wenjie; Luo, Yongming; Christie, Peter; Li, Zhengao

    2015-01-01

    This study aimed to explore the effects of Trichoderma reesei FS10-C on the phytoremediation of Cd-contaminated soil by the hyperaccumulator Sedum plumbizincicola and on soil fertility. The Cd tolerance of T. reesei FS10-C was characterized and then a pot experiment was conducted to investigate the growth and Cd uptake of S. plumbizincicola with the addition of inoculation agents in the presence and absence of T. reesei FS10-C. The results indicated that FS10-C possessed high Cd resistance (up to 300 mg L-1). All inoculation agents investigated enhanced plant shoot biomass by 6–53% of fresh weight and 16–61% of dry weight and Cd uptake by the shoots by 10–53% compared with the control. All inoculation agents also played critical roles in increasing soil microbial biomass and microbial activities (such as biomass C, dehydrogenase activity and fluorescein diacetate hydrolysis activity). Two inoculation agents accompanied by FS10-C were also superior to the inoculation agents, indicating that T. reesei FS10-C was effective in enhancing both Cd phytoremediation by S. plumbizincicola and soil fertility. Furthermore, solid fermentation powder of FS10-C showed the greatest capacity to enhance plant growth, Cd uptake, nutrient release, microbial biomass and activities, as indicated by its superior ability to promote colonization by Trichoderma. The solid fermentation powder of FS10-C might serve as a suitable inoculation agent for T. reesei FS10-C to enhance both the phytoremediation efficiency of Cd-contaminated soil and soil fertility. PMID:26113858

  11. Assessment of trace metals contamination in the coastal sediments of the Egyptian Mediterranean coast

    NASA Astrophysics Data System (ADS)

    El Baz, Sherif M.; Khalil, Mohamed M.

    2018-07-01

    Trace metals contamination has been recently increased in the Egyptian Mediterranean coast owing to the nearby anthropological activities. This investigation aimed to detect the concentrations of six different trace metals (Fe, Mn, Cu, Cd, Pb and Zn) in surface sediments from the central part of the Egyptian Mediterranean coast, and to assess their state of contamination from different indices and risk factor calculations. Mean concentrations of Cu, Pb and Zn were lower and the mean concentration of Cd was higher compared to the background values. The assessment of pollution was mainly based on the contamination indices. Based on the contamination factor, Pb was the most enriched element followed by Cd, Mn, Zn and Cu. Most of the sites show low contamination with respect to Pb, Mn, Cd, Fe, Zn and Cu. The pollution load index also suggests that all the coastal sediments are unpolluted. According to the geoaccumulation index, the sediments were classified into unpolluted with Mn, Cd, Fe and Pb, and unpolluted to moderately polluted with Pb. Risk evaluation revealed that Cd had the greatest ecological risk, followed by Pb, Cu, Mn, while Zn had the lowest risk. With the aid of statistical methods, the origin of metals is classified into two clusters (A and B). Group A consists of Fe, Mn and Cu, whereas group B contains Zn, Pb and Cd. In the first cluster Fe and Mn are joined to each other at a positive and significant similarity (0.68). Fe is recognized as an indicator of lithogenous origin, therefore, its higher similarity with Mn may be indicative of the similar origin for Manganese. In the second cluster Pb and Zn are joined to each other at a positive and significant similarity (0.80). Pb is recognized as an indicator of anthropogenic origin, therefore, its higher similarity with Zn may be indicative of the similar origin for Zinc.

  12. Differential endocytosis of CD4 in lymphocytic and nonlymphocytic cells

    PubMed Central

    1991-01-01

    The endocytosis of the T cell differentiation antigen CD4 has been investigated in CD4-transfected HeLa cells, the promyelocytic HL-60 cell line, and in a number of leukemia- or lymphoma-derived T cell lines. CD4 internalization was followed using radioiodinated antibodies in an acid-elution endocytosis assay, or by covalently modifying cell surface proteins with biotin and analyzing CD4 distributions by immunoprecipitation; both approaches gave equivalent results. The assays demonstrated that in transfected HeLa cells and in HL-60 cells CD4 was constitutively internalized and recycled in the absence of ligand. Immunogold labeling and electron microscopy demonstrated that CD4 enters cells through coated pits. In contrast to the nonlymphocytic cells, T cell lines showed very little endocytosis of CD4. Measurements of fluid phase endocytosis and morphometric analysis of the endosome compartment indicated that the endocytic capacities of HeLa and lymphoid cells are equivalent and suggested that the low level of CD4 uptake in lymphocytic cells is due to exclusion of CD4 from coated pits. This conclusion was supported by experiments using truncated CD4 molecules, lacking the bulk of the cytoplasmic domain, which were internalized equally efficiently in both transfected lymphocytes and HeLa cells. Together, these results indicate that the cytoplasmic domain of CD4 mediates the different interactions with the endocytic apparatus in lymphoid and nonlymphoid cells. We suggest that the CD4- associated lymphocyte-specific protein tyrosine kinase p56lck may be involved in preventing CD4 endocytosis in T cells. PMID:1900077

  13. CD4 T cell-mediated protection from lethal influenza: perforin and antibody-mediated mechanisms give a one-two punch.

    PubMed

    Brown, Deborah M; Dilzer, Allison M; Meents, Dana L; Swain, Susan L

    2006-09-01

    The mechanisms whereby CD4 T cells contribute to the protective response against lethal influenza infection remain poorly characterized. To define the role of CD4 cells in protection against a highly pathogenic strain of influenza, virus-specific TCR transgenic CD4 effectors were generated in vitro and transferred into mice given lethal influenza infection. Primed CD4 effectors conferred protection against lethal infection over a broad range of viral dose. The protection mediated by CD4 effectors did not require IFN-gamma or host T cells, but did result in increased anti-influenza Ab titers compared with untreated controls. Further studies indicated that CD4-mediated protection at high doses of influenza required B cells, and that passive transfer of anti-influenza immune serum was therapeutic in B cell-deficient mice, but only when CD4 effectors were present. Primed CD4 cells also acquired perforin (Pfn)-mediated cytolytic activity during effector generation, suggesting a second mechanism used by CD4 cells to confer protection. Pfn-deficient CD4 effectors were less able to promote survival in intact BALB/c mice and were unable to provide protection in B cell-deficient mice, indicating that Ab-independent protection by CD4 effectors requires Pfn. Therefore, CD4 effectors mediate protection to lethal influenza through at least two mechanisms: Pfn-mediated cytotoxicity early in the response promoted survival independently of Ab production, whereas CD4-driven B cell responses resulted in high titer Abs that neutralized remaining virus.

  14. Bioavailability of Cadmium in Inexpensive Jewelry

    PubMed Central

    Miller, Jennifer; Guinn, Daphne; Pearson, Janna

    2011-01-01

    Objectives: We evaluated the bioavailability of Cd in 86 components of 57 jewelry items found to contain high levels of Cd (> 10,000 ppm) by X-ray fluorescence (XRF), using extractions that simulate mouthing or swallowing of jewelry items. Methods: We screened jewelry for Cd content by XRF. Bioavailability was measured in two ways. Items were placed in saline solution at 37°C for 6 hr to simulate exposures from mouthing of jewelry items. Items were placed in dilute hydrochloric acid (HCl) at 37°C for 6–96 hr, simulating the worst-case scenario of a child swallowing a jewelry item. Damaged pieces of selected samples were also extracted by both methods to determine the effect of breaching the outer plating on bioavailability. Total Cd content of all items was determined by atomic absorption. Results: The 6-hr saline extraction yielded as much as 2,200 µg Cd, and 24-hr dilute HCl extraction yielded a maximum of > 20,000 µg Cd. Leaching of Cd in dilute HCl increased linearly over 6–96 hr, indicating potential for increasing harm the longer an item remains in the stomach. Damage to jewelry by breaching the outer plating generally, but not always, increased Cd release. Bioavailability did not correlate directly with Cd content. Conclusions: These results indicate the potential for dangerous Cd exposures to children who wear, mouth, or accidentally swallow high-Cd jewelry items. PMID:21377949

  15. RNA interference targeting CD147 inhibits metastasis and invasion of human breast cancer MCF-7 cells by downregulating MMP-9/VEGF expression.

    PubMed

    Li, Fang; Zhang, Junping; Guo, Jiqiang; Jia, Yuan; Han, Yaping; Wang, Zhuanhua

    2018-06-12

    Breast cancer is one of the most common malignancies. It is necessary to identify new markers for predicting tumor progression and therapeutic molecular targets. It has been reported that CD147 is one of the most commonly expressed proteins in primary tumors and in metastatic cells. In this study, we investigated the role of CD147 in human breast cancer metastasis and invasion, and examined its underlying molecular mechanisms. Immunohistochemistry results revealed high expression of CD147 in human breast tumor tissues, which was positively correlated with the malignancy of breast cancer. MCF-7 cells were transfected with CD147 siRNA eukaryotic expression vector, which resulted in significant knockdown of CD147. We found that CD147 siRNA dramatically inhibited cell proliferation, metastasis, and invasion. Furthermore, our results demonstrated that CD147 siRNA inhibited the synthesis of matrix metalloproteinase 9 (MMP-9) but had no significant effect on matrix metalloproteinase 2 (MMP-2). In addition, CD147 siRNA significantly inhibited the production of vascular endothelial growth factor (VEGF). Taken together, these data indicate that CD147 promotes breast cancer cell proliferation, metastasis, and invasion by modulating MMP-9 and VEGF expression. Thus, CD147 may be used as an important indicator for the judgment of malignant behavior of breast cancer, and may be a potential novel target for breast cancer therapy.

  16. Root and shoot transcriptome analysis of two ecotypes of Noccaea caerulescens uncovers the role of NcNramp1 in Cd hyperaccumulation

    USDA-ARS?s Scientific Manuscript database

    The Zn/Cd hyperaccumulator, Noccaea caerulescens, has been studied extensively for its ability to accumulate Zn and Cd in its leaves to extremely high levels. Previous studies have indicated that the Zn and Cd hyperaccumulation trait exhibited by this species involves different transport and toleran...

  17. Identification and Characterization of Cells with Cancer Stem Cell Properties in Human Primary Lung Cancer Cell Lines

    PubMed Central

    Suo, Zhenhe; Munthe, Else; Solberg, Steinar; Ma, Liwei; Wang, Mengyu; Westerdaal, Nomdo Anton Christiaan; Kvalheim, Gunnar; Gaudernack, Gustav

    2013-01-01

    Lung cancer (LC) with its different subtypes is generally known as a therapy resistant cancer with the highest morbidity rate worldwide. Therapy resistance of a tumor is thought to be related to cancer stem cells (CSCs) within the tumors. There have been indications that the lung cancer is propagated and maintained by a small population of CSCs. To study this question we established a panel of 15 primary lung cancer cell lines (PLCCLs) from 20 fresh primary tumors using a robust serum-free culture system. We subsequently focused on identification of lung CSCs by studying these cell lines derived from 4 representative lung cancer subtypes such as small cell lung cancer (SCLC), large cell carcinoma (LCC), squamous cell carcinoma (SCC) and adenocarcinoma (AC). We identified a small population of cells strongly positive for CD44 (CD44high) and a main population which was either weakly positive or negative for CD44 (CD44low/−). Co-expression of CD90 further narrowed down the putative stem cell population in PLCCLs from SCLC and LCC as spheroid-forming cells were mainly found within the CD44highCD90+ sub-population. Moreover, these CD44highCD90+ cells revealed mesenchymal morphology, increased expression of mesenchymal markers N-Cadherin and Vimentin, increased mRNA levels of the embryonic stem cell related genes Nanog and Oct4 and increased resistance to irradiation compared to other sub-populations studied, suggesting the CD44highCD90+ population a good candidate for the lung CSCs. Both CD44highCD90+ and CD44highCD90− cells in the PLCCL derived from SCC formed spheroids, whereas the CD44low/− cells were lacking this potential. These results indicate that CD44highCD90+ sub-population may represent CSCs in SCLC and LCC, whereas in SCC lung cancer subtype, CSC potentials were found within the CD44high sub-population. PMID:23469181

  18. Low expression of CD39+/CD45RA+ on regulatory T cells (Treg) cells in type 1 diabetic children in contrast to high expression of CD101+/CD129+ on Treg cells in children with coeliac disease

    PubMed Central

    Åkesson, K; Tompa, A; Rydén, A; Faresjö, M

    2015-01-01

    Type 1 diabetes (T1D) and coeliac disease are both characterized by an autoimmune feature. As T1D and coeliac disease share the same risk genes, patients risk subsequently developing the other disease. This study aimed to investigate the expression of T helper (Th), T cytotoxic (Tc) and regulatory T cells (Treg) in T1D and/or coeliac disease children in comparison to healthy children. Subgroups of T cells (Th : CD4+ or Tc : CD8+); naive (CD27+CD28+CD45RA+CCR7+), central memory (CD27+CD28+CD45RA−CCR7+), effector memory (early differentiated; CD27+CD28+CD45RA−CCR7− and late differentiated; CD27−CD28−CD45RA−CCR7−), terminally differentiated effector cells (TEMRA; CD27−CD28−CD45RA+CCR7−) and Treg (CD4+CD25+FOXP3+CD127−) cells, and their expression of CD39, CD45RA, CD101 and CD129, were studied by flow cytometry in T1D and/or coeliac disease children or without any of these diseases (reference group). Children diagnosed with both T1D and coeliac disease showed a higher percentage of TEMRA CD4+ cells (P < 0·05), but lower percentages of both early and late effector memory CD8+ cells (P < 0·05) compared to references. Children with exclusively T1D had lower median fluorescence intensity (MFI) of forkhead box protein 3 (FoxP3) (P < 0·05) and also a lower percentage of CD39+ and CD45RA+ within the Treg population (CD4+CD25+FOXP3+CD127−) (P < 0·05). Children with exclusively coeliac disease had a higher MFI of CD101 (P < 0·01), as well as a higher percentage of CD129+ (P < 0·05), in the CD4+CD25hi lymphocyte population, compared to references. In conclusion, children with combined T1D and coeliac disease have a higher percentage of differentiated CD4+ cells compared to CD8+ cells. T1D children show signs of low CD39+/CD45RA+ Treg cells that may indicate loss of suppressive function. Conversely, children with coeliac disease show signs of CD101+/CD129+ Treg cells that may indicate suppressor activity. PMID:25421756

  19. Cellular sequestration of cadmium in the hyperaccumulator plant species Sedum alfredii.

    PubMed

    Tian, Shengke; Lu, Lingli; Labavitch, John; Yang, Xiaoe; He, Zhenli; Hu, Hening; Sarangi, Ritimukta; Newville, Matt; Commisso, Joel; Brown, Patrick

    2011-12-01

    Spatial imaging of cadmium (Cd) in the hyperaccumulator Sedum alfredii was investigated in vivo by laser ablation inductively coupled plasma mass spectrometry and x-ray microfluorescence imaging. Preferential Cd accumulation in the pith and cortex was observed in stems of the Cd hyperaccumulating ecotype (HE), whereas Cd was restricted to the vascular bundles in its contrasting nonhyperaccumulating ecotype. Cd concentrations of up to 15,000 μg g(-1) were measured in the pith cells, which was many fold higher than the concentrations in the stem epidermis and vascular bundles in the HE plants. In the leaves of the HE, Cd was mainly localized to the mesophyll and vascular cells rather than the epidermis. The distribution pattern of Cd in both stems and leaves of the HE was very similar to calcium but not zinc, irrespective of Cd exposure levels. Extended x-ray absorption fine structure spectroscopy analysis showed that Cd in the stems and leaves of the HE was mainly associated with oxygen ligands, and a larger proportion (about 70% in leaves and 47% in stems) of Cd was bound with malic acid, which was the major organic acid in the shoots of the plants. These results indicate that a majority of Cd in HE accumulates in the parenchyma cells, especially in stems, and is likely associated with calcium pathways and bound with organic acid (malate), which is indicative of a critical role of vacuolar sequestration of Cd in the HE S. alfredii.

  20. Cadmium tolerance and accumulation in cultivars of a high-biomass tropical tree (Averrhoa carambola) and its potential for phytoextraction.

    PubMed

    Li, J T; Liao, B; Lan, C Y; Ye, Z H; Baker, A J M; Shu, W S

    2010-01-01

    Averrhoa carambola is a high-biomass tropical tree that has been identified as a Cd accumulator. In the present study, field survey, pot, and hydroponic experiments were conducted to investigate the variation of Cd tolerance and accumulation in cultivars of A. carambola as well as its potential for phytoextraction. In the field survey, it was found that concentrations of Cd in aerial tissues of A. carambola varied greatly among sites and cultivars. The Cd bioconcentration factors (BCFs) and Cd removals by the field-grown A. carambola differed significantly among sites but not among cultivars. Nonetheless, all four carambola cultivars investigated were able to accumulate considerably high concentrations of Cd in their shoots, which indicated that the 4-yr-old carambola stands could remove 0.3 to 51.8% of the total Cd content in the top 20-cm soil layer. When cultured in Cd-spiked soils, the carambola cultivar Hua-Di always showed higher Cd tolerance than the other cultivars; however, this tendency was not confirmed by hydroponic experiment. The Cd BCFs of cultivar Thailand grown in soils with 6 and 12 mg Cd kg(-1) were highest among cultivars, whereas this trend was reversed at 120 mg Cd kg(-1) treatment. Nevertheless, the pot- and hydroponics-grown carambola cultivars generally showed higher capacities to tolerate and accumulate Cd, compared with the control species. The present results indicate that a strong ability to tolerate and accumulate Cd seems to be a trait at the species level in A. carambola, although some degree of variances in both Cd tolerance and accumulation exists among cultivars.

  1. Factors influencing intestinal cadmium uptake in pregnant Bangladeshi women-A prospective cohort study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kippler, M.; Goessler, W.; Nermell, B.

    Experimental studies indicate that zinc (Zn) and calcium (Ca) status, in addition to iron (Fe) status, affect gastrointestinal absorption of cadmium (Cd), an environmental pollutant that is toxic to kidneys, bone and endocrine systems. The aim of this study was to evaluate how various nutritional factors influence the uptake of Cd in women, particularly during pregnancy. The study was carried out in a rural area of Bangladesh, where malnutrition is prevalent and exposure to Cd via food appears elevated. The uptake of Cd was evaluated by associations between erythrocyte Cd concentrations (Ery-Cd), a marker of ongoing Cd exposure, and concentrationsmore » of nutritional markers. Blood samples, collected in early pregnancy and 6 months postpartum, were analyzed by inductively coupled plasma mass spectrometry (ICPMS). Ery-Cd varied considerably (range: 0.31-5.4 {mu}g/kg) with a median of 1.1 {mu}g/kg (approximately 0.5 {mu}g/L in whole blood) in early pregnancy. Ery-Cd was associated with erythrocyte manganese (Ery-Mn; positively), plasma ferritin (p-Ft; negatively), and erythrocyte Ca (Ery-Ca; negatively) in decreasing order, indicating common transporters for Cd, Fe and Mn. There was no evidence of Cd uptake via Zn transporters, but the association between Ery-Cd and p-Ft seemed to be dependent on adequate Zn status. On average, Ery-Cd increased significantly by 0.2 {mu}g/kg from early pregnancy to 6 months postpartum, apparently due to up-regulated divalent metal transporter 1 (DMT1). In conclusion, intestinal uptake of Cd appears to be influenced either directly or indirectly by several micronutrients, in particular Fe, Mn and Zn. The negative association with Ca may suggest that Cd inhibits the transport of Ca to blood.« less

  2. Prevalence and clinicopathologic features of CD30-positive de novo diffuse large B-cell lymphoma in Chinese patients: a retrospective study of 232 cases

    PubMed Central

    Gong, Qi-Xing; Lu, Ting-Xun; Liu, Chong; Wang, Zhen; Liang, Jin-Hua; Xu, Wei; Li, Jian-Yong; Zhang, Zhi-Hong; Chen, Qi

    2015-01-01

    Diffuse large B-cell lymphoma (DLBCL) is a heterogeneous disease that great efforts had been made in to build up molecular and immunophenotypic subgroups that could relatively accurate indicate prognosis and give clue to therapy. Recently, CD30 was reported as a useful predictor with favorable clinical outcome. However, CD30 expression patterns and the clinicopathologic features of CD30 positive DLBCL are not well described thus far, especially in Asian patients. Here, we studied 232 cases of de novo DLBCL in East China to investigate the prevalence and clinicopathological features of CD30-positive DLBCL using a panel of immunohistochemical markers. Applying a >0% threshold, CD30 was expressed in approximately 12% patients with Epstein-Barr virus (EBV) negative DLBCL, affecting younger people and showing a lower frequency of BCL2 expression and MYC/BCL2 co-expression. Patients with CD30-positive DLBCLs showed better progression-free survival and overall survival compared with patients with CD30-negative DLBCLs, although the superior outcome of CD30 positivity had minimal effects on BCL2+ DLBCL or DLBCL with MYC/BCL2 co-expression. Moreover, CD30 could express in CD5+ DLBCL. We concluded that CD30 may be useful as a prognostic marker in rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) treated DLBCLs, indicating favorable outcomes in a Chinese population. Further studies with larger samples should be performed to investigate the function of CD30 expression in BCL2+ DLBCLs, DLBCLs with MYC/BCL2 co-expression, and CD5+ DLBCLs, and to evaluate the feasibility of anti-CD30 targeted treatment in DLBCL therapy. PMID:26884853

  3. Current matching using CdSe quantum dots to enhance the power conversion efficiency of InGaP/GaAs/Ge tandem solar cells.

    PubMed

    Lee, Ya-Ju; Yao, Yung-Chi; Tsai, Meng-Tsan; Liu, An-Fan; Yang, Min-De; Lai, Jiun-Tsuen

    2013-11-04

    A III-V multi-junction tandem solar cell is the most efficient photovoltaic structure that offers an extremely high power conversion efficiency. Current mismatching between each subcell of the device, however, is a significant challenge that causes the experimental value of the power conversion efficiency to deviate from the theoretical value. In this work, we explore a promising strategy using CdSe quantum dots (QDs) to enhance the photocurrent of the limited subcell to match with those of the other subcells and to enhance the power conversion efficiency of InGaP/GaAs/Ge tandem solar cells. The underlying mechanism of the enhancement can be attributed to the QD's unique capacity for photon conversion that tailors the incident spectrum of solar light; the enhanced efficiency of the device is therefore strongly dependent on the QD's dimensions. As a result, by appropriately selecting and spreading 7 mg/mL of CdSe QDs with diameters of 4.2 nm upon the InGaP/GaAs/Ge solar cell, the power conversion efficiency shows an enhancement of 10.39% compared to the cell's counterpart without integrating CdSe QDs.

  4. Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.

    PubMed

    Raelson, John V; Little, Randall D; Ruether, Andreas; Fournier, Hélène; Paquin, Bruno; Van Eerdewegh, Paul; Bradley, W E C; Croteau, Pascal; Nguyen-Huu, Quynh; Segal, Jonathan; Debrus, Sophie; Allard, René; Rosenstiel, Philip; Franke, Andre; Jacobs, Gunnar; Nikolaus, Susanna; Vidal, Jean-Michel; Szego, Peter; Laplante, Nathalie; Clark, Hilary F; Paulussen, René J; Hooper, John W; Keith, Tim P; Belouchi, Abdelmajid; Schreiber, Stefan

    2007-09-11

    Genome-wide association (GWA) studies offer a powerful unbiased method for the identification of multiple susceptibility genes for complex diseases. Here we report the results of a GWA study for Crohn's disease (CD) using family trios from the Quebec Founder Population (QFP). Haplotype-based association analyses identified multiple regions associated with the disease that met the criteria for genome-wide significance, with many containing a gene whose function appears relevant to CD. A proportion of these were replicated in two independent German Caucasian samples, including the established CD loci NOD2 and IBD5. The recently described IL23R locus was also identified and replicated. For this region, multiple individuals with all major haplotypes in the QFP were sequenced and extensive fine mapping performed to identify risk and protective alleles. Several additional loci, including a region on 3p21 containing several plausible candidate genes, a region near JAKMIP1 on 4p16.1, and two larger regions on chromosome 17 were replicated. Together with previously published loci, the spectrum of CD genes identified to date involves biochemical networks that affect epithelial defense mechanisms, innate and adaptive immune response, and the repair or remodeling of tissue.

  5. Copy number analysis of NIPBL in a cohort of 510 patients reveals rare copy number variants and a mosaic deletion.

    PubMed

    Cheng, Yu-Wei; Tan, Christopher A; Minor, Agata; Arndt, Kelly; Wysinger, Latrice; Grange, Dorothy K; Kozel, Beth A; Robin, Nathaniel H; Waggoner, Darrel; Fitzpatrick, Carrie; Das, Soma; Del Gaudio, Daniela

    2014-03-01

    Cornelia de Lange syndrome (CdLS) is a genetically heterogeneous disorder characterized by growth retardation, intellectual disability, upper limb abnormalities, hirsutism, and characteristic facial features. In this study we explored the occurrence of intragenic NIPBL copy number variations (CNVs) in a cohort of 510 NIPBL sequence-negative patients with suspected CdLS. Copy number analysis was performed by custom exon-targeted oligonucleotide array-comparative genomic hybridization and/or MLPA. Whole-genome SNP array was used to further characterize rearrangements extending beyond the NIPBL gene. We identified NIPBL CNVs in 13 patients (2.5%) including one intragenic duplication and a deletion in mosaic state. Breakpoint sequences in two patients provided further evidence of a microhomology-mediated replicative mechanism as a potential predominant contributor to CNVs in NIPBL. Patients for whom clinical information was available share classical CdLS features including craniofacial and limb defects. Our experience in studying the frequency of NIBPL CNVs in the largest series of patients to date widens the mutational spectrum of NIPBL and emphasizes the clinical utility of performing NIPBL deletion/duplication analysis in patients with CdLS.

  6. Photoresponse Enhancement in Monolayer ReS2 Phototransistor Decorated with CdSe-CdS-ZnS Quantum Dots.

    PubMed

    Qin, Jing-Kai; Ren, Dan-Dan; Shao, Wen-Zhu; Li, Yang; Miao, Peng; Sun, Zhao-Yuan; Hu, PingAn; Zhen, Liang; Xu, Cheng-Yan

    2017-11-15

    ReS 2 films are considered as a promising candidate for optoelectronic applications due to their direct band gap character and optical/electrical anisotropy. However, the direct band gap in a narrow spectrum and the low absorption of atomically thin flakes weaken the prospect for light-harvesting applications. Here, we developed an efficient approach to enhance the performance of a ReS 2 -based phototransistor by coupling CdSe-CdS-ZnS core-shell quantum dots. Under 589 nm laser irradiation, the responsivity of the ReS 2 phototransistor decorated with quantum dots could be enhanced by more than 25 times (up to ∼654 A/W) and the rising and recovery time can be also reduced to 3.2 and 2.8 s, respectively. The excellent optoelectronic performance is originated from the coupling effect of quantum dots light absorber and cross-linker ligands 1,2-ethanedithiol. Photoexcited electron-hole pairs in quantum dots can separate and transfer efficiently due to the type-II band alignment and charge exchange process at the interface. Our work shows that the simple hybrid zero- and two-dimensional hybrid system can be employed for photodetection applications.

  7. Preparation and Characterization of Nanoparticle β-Cyclodextrin:Geraniol Inclusion Complexes.

    PubMed

    Hadian, Zahra; Maleki, Majedeh; Abdi, Khosro; Atyabi, Fatemeh; Mohammadi, Abdoreza; Khaksar, Ramin

    2018-01-01

    The aim of the present study was to formulate β-cyclodextrin (β-CD) nanoparticles loaded with geraniol (GR) essential oil (EO) with appropriate physicochemical properties. Complexation of GR with β-CD was optimized by evaluation of four formulations, using the co-precipitation method, and the encapsulation efficiency (EE), loading, size, particle size distribution (PDI) and zeta potential were investigated. Further characterization was performed with nuclear magnetic resonance spectroscopy ( 1 H NMR), differential scanning calorimetry (DSC), scanning electron microscopy (SEM) and infra-red (IR) spectroscopy analysis. Results showed that the physicochemical properties of the nanoparticles were affected by GR content in formulations that yielded nanoscale-size particles ranging from 111 to 258 nm. The highest encapsulation efficiency (79.4 ± 5.4%) was obtained when the molar ratio of EO to β-CD was 0.44: 0.13 with negative zeta potential (-21.1 ± 0.5 mV). The 1 H-NMR spectrum confirmed the formation structure of the EO and β-CD nanoparticle complex. Complexation with geraniol resulted in changes of IR profile, NMR chemical shifts, DSC properties, and SEM of β-cyclodextrin. Inclusion complex of essential oil with β-cyclodextrin was considered as promising bioactive materials for designing functional food.

  8. Preparation and Characterization of Nanoparticle β-Cyclodextrin:Geraniol Inclusion Complexes

    PubMed Central

    Hadian, Zahra; Maleki, Majedeh; Abdi, Khosro; Atyabi, Fatemeh; Mohammadi, Abdoreza; Khaksar, Ramin

    2018-01-01

    The aim of the present study was to formulate β-cyclodextrin (β-CD) nanoparticles loaded with geraniol (GR) essential oil (EO) with appropriate physicochemical properties. Complexation of GR with β-CD was optimized by evaluation of four formulations, using the co-precipitation method, and the encapsulation efficiency (EE), loading, size, particle size distribution (PDI) and zeta potential were investigated. Further characterization was performed with nuclear magnetic resonance spectroscopy (1H NMR), differential scanning calorimetry (DSC), scanning electron microscopy (SEM) and infra-red (IR) spectroscopy analysis. Results showed that the physicochemical properties of the nanoparticles were affected by GR content in formulations that yielded nanoscale-size particles ranging from 111 to 258 nm. The highest encapsulation efficiency (79.4 ± 5.4%) was obtained when the molar ratio of EO to β-CD was 0.44: 0.13 with negative zeta potential (-21.1 ± 0.5 mV). The 1H-NMR spectrum confirmed the formation structure of the EO and β-CD nanoparticle complex. Complexation with geraniol resulted in changes of IR profile, NMR chemical shifts, DSC properties, and SEM of β-cyclodextrin. Inclusion complex of essential oil with β-cyclodextrin was considered as promising bioactive materials for designing functional food.

  9. Recent experimental results of KSTAR RF heating and current drive

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, S. J., E-mail: sjwang@nfri.re.kr; Kim, J.; Jeong, J. H.

    2015-12-10

    The overview of KSTAR activities on ICRH, LHCD and ECH/CD including the last experimental results and future plan aiming for long-pulse high-beta plasma will be presented. Recently we achieved reasonable coupling of ICRF power to H-mode plasma through several efforts to increase system reliability. Power balance will be discussed on this experiment. LHCD is still struggling in the low power regime. Review of antenna spectrum for the higher coupling in H-mode plasma will be tried. ECH/CD provides 41 sec, 0.8 MW of heating power to support high-performance long-pulse discharge. Also, 170 GHz ECH system is integrated with the Plasma Control Systemmore » (PCS) for the feedback controlling of NTM. Status and plan of ECH/CD will be discussed. Finally, helicon current drive is being prepared for the next stage of KSTAR operation. The hardware preparation and the calculation results of helicon current drive in KSTAR plasma will be discussed.« less

  10. Luminescence- and nanoparticle-mediated increase of light absorption by photoreceptor cells: Converting UV light to visible light.

    PubMed

    Li, Lei; Sahi, Sunil K; Peng, Mingying; Lee, Eric B; Ma, Lun; Wojtowicz, Jennifer L; Malin, John H; Chen, Wei

    2016-02-10

    We developed new optic devices - singly-doped luminescence glasses and nanoparticle-coated lenses that convert UV light to visible light - for improvement of visual system functions. Tb(3+) or Eu(3+) singly-doped borate glasses or CdS-quantum dot (CdS-QD) coated lenses efficiently convert UV light to 542 nm or 613 nm wavelength narrow-band green or red light, or wide-spectrum white light, and thereby provide extra visible light to the eye. In zebrafish (wild-type larvae and adult control animals, retinal degeneration mutants, and light-induced photoreceptor cell degeneration models), the use of Tb(3+) or Eu(3+) doped luminescence glass or CdS-QD coated glass lenses provide additional visible light to the rod and cone photoreceptor cells, and thereby improve the visual system functions. The data provide proof-of-concept for the future development of optic devices for improvement of visual system functions in patients who suffer from photoreceptor cell degeneration or related retinal diseases.

  11. Dye-sensitization of CdS nano-cage - A density functional theory approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jain, Kalpna; Singh, Kh. S.; Kishor, Shyam

    2016-05-23

    Quantum dots a few nanometer in size exhibit unique properties in comparison to bulk due to quantum confinement. Their properties can be tuned according to their sizes. Dye sensitized quantum dot (DSQD) solar cells are based on the same principle with surface dangling bonds as a challenge. Researches have shown the existence and stability of nano-cages which are assembled such as to minimize the surface dangling bonds and hence maximize stability. Here, we report a first principles DFT study of optical and electronic properties of CdS-cage (Cd{sub 34}S{sub 34}) sensitized with nkx-2388 dye in three different geometric configurations of dyemore » attachment. A significant distortion is found to occur in the geometric structure of the cage when it interacts strongly with the dye. The relative positioning of dye and cage energy levels is found to be different in different configurations. The absorption spectrum has been analyzed with the help of natural transition orbitals (NTO).« less

  12. A New Approach to the GeV Flare of PSR B1259-63/LS2883

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yi, Shu-Xu; Cheng, K. S., E-mail: yishuxu@hku.hk, E-mail: hrspksc@hku.hk

    2017-08-01

    PSR B1259-63/LS2883 is a binary system composed of a pulsar and a Be star. The Be star has an equatorial circumstellar disk (CD). The Fermi satellite discovered unexpected gamma-ray flares around 30 days after the last two periastron passages. The origin of the flares remains puzzling. In this work, we explore the possibility that the GeV flares are consequences of inverse Compton scattering of soft photons by the pulsar wind. The soft photons are from an accretion disk around the pulsar, which is composed of the matter from the CD captured by the pulsar’s gravity at disk-crossing before the periastron.more » At the other disk-crossing after the periastron, the density of the CD is not high enough, so accretion is prevented by the pulsar wind shock. This model can reproduce the observed spectrum energy distributions and light curves satisfactorily.« less

  13. Fine needle aspiration cytology of ALK1(-), CD30+ anaplastic large cell lymphoma post renal transplantation: a case report and literature review.

    PubMed

    Balachandran, Indra; Walker, Joe W; Broman, Jerry

    2010-03-01

    Post transplant lymphoproliferative disorders (PTLD) complicates the course of 0.3 to 3% of renal transplant patients receiving immunosuppression. Epstein-Barr virus (EBV) related non-Hodgkin's lymphomas of B-cell type is more common than those of T-cell origin. CD30 positive Anaplastic Large Cell Lymphoma (ALCL) is a Non-Hodgkin's lymphoma (B or T cell type) that accounts for a small percentage of PTLD's. ALCL of T-cell type are a spectrum of disease ranging from primary cutaneous to systemic nodal ALCL. The systemic nodal ALCL is further subdivided into anaplastic lymphoma kinase-1 (ALK-1) positive or negative. ALK-1 protein is a gene fusion product of translocation (2;5) and carries prognostic implications. We present an unusual manifestation of ALK-1 negative CD30 positive ALCL in a post renal transplant patient in FNA cytology with all supportive adjuvant studies and differential diagnoses and review the cytology literature on this topic.

  14. Localized surface plasmon and exciton interaction in silver-coated cadmium sulphide quantum dots

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, P.; Rustagi, K. C.; Vasa, P.

    2015-05-15

    Localized surface plasmon and exciton coupling has been investigated on colloidal solutions of silver-coated CdS nanoparticles (NPs), synthesized by gamma irradiation. Two broad photoluminescence (PL) bands (blue/red) corresponding to band to band and defect state transitions have been observed for the bare and coated samples. In case of bare CdS NPs, the intensity of the red PL peak is about ten times higher than the blue PL peak intensity. However, on coating the CdS NPs with silver, the peak intensity of the blue PL band gets enhanced and becomes equal to that of the red PL band. High-resolution transmission electronmore » microscopic (HRTEM) images adequately demonstrate size distribution of these metal/semiconductor nanocomposites. UV-Vis absorption studies show quantum confinement effect in these semiconductor quantum dot (SQD) systems. Absorption spectrum of silver-coated SQDs shows signature of surface plasmon-exciton coupling which has been theoretically verified.« less

  15. HAIR HEAVY METAL AND ESSENTIAL TRACE ELEMENT CONCENTRATION IN CHILDREN WITH AUTISM SPECTRUM DISORDER.

    PubMed

    Tabatadze, T; Zhorzholiani, L; Kherkheulidze, M; Kandelaki, E; Ivanashvili, T

    2015-11-01

    Our study aims evaluation of level of essential trace elements and heavy metals in the hair samples of children with autistic spectrum disorder (ASD) and identification of changes that are associated with autistic spectrum disorders. Case-control study was conducted at Child Development Center of Iashvili Children's Central Hospital (LD).We studied 60 children aged from 4 to 5 years old. The concentrations of 28 elements among (Ca,Zn, K, Fe, Cu, Se, Mn, Cr, S, Br, Cl, Co, Ag, V, Ni, Rb, Mo, Sr, Ti, Ba, Pb, As, Hg, Cd, Sb, Zr, Sn, Bi) them trace elements and toxic metals) were determined in scalp hair samples of children (n=30) with autistic spectrum disorder (ASD) and from control group of healthy children (n=30) with matched sex and age. Micro-elemental status was detected in the hair, with roentgen-fluorescence spectrometer method (Method MBИ 081/12-4502-000, Apparatus ALVAX- CIP, USA - UKRAIN) .To achieve the similarity of study and control groups, pre and postnatal as well as family and social history were assessed and similar groups were selected. Children with genetic problems, malnourished children, children from families with social problems were excluded from the study. The diagnosis of ASD were performed by pediatrician and psychologist (using M-CHAT and ADOS) according to DSM IV (Diagnostic and Statistical Manual of Mental Disorders from the American Psychiatric association) criteria. The study was statistically analyzed using computer program SPSS 19. Deficiencies of essential trace microelements revealed in both group, but there was significant difference between control and studied groups. The most deficient element was zinc (92% in target and 20% in control), then - manganese (55% and 8%) and selenium (38% and 4%). In case of cooper study revealed excess concentration of this element only in target group in 50% of cases. The contaminations to heavy metals were detected in case of lead (78% and 16), mercury (43% and 10%) and cadmium (38% and 8%). The study statistical results indicated, that deficient concentrations of trace elements such as zinc, manganese, molybdenum and selenium in hair significantly linked with ASD (Kramer's V was 0,740; 0,537; 0,333; 0,417 accordingly). In case of cooper we got excess levels of this element and this data was highly linked with autism spectrum disorder. We got high associations and significant values between of lead, mercury and cadmium concentrations and ASD. Study results indicate that there are significant differences of hair essential trace elements concentrations in children with autism spectrum disorder comparing with healthy children group. The result obtained also showed high contamination to heavy metals such as lead, mercury and cadmium in ASD children compared to healthy ones. So, our study demonstrated alteration in levels of toxic heavy metals and essential trace elements in children with autistic spectrum disorders as compared to healthy children. This suggests a possible pathophysiological role of heavy metals and trace elements in the genesis of symptoms of autism spectrum disorders.

  16. Core-shell quantum dots tailor the fluorescence of dental resin composites.

    PubMed

    Alves, Leandro P; Pilla, Viviane; Murgo, Dírian O A; Munin, Egberto

    2010-02-01

    We characterized the optical properties, such as absorbance and fluorescence, of dental resins containing quantum dots (QD). We also determined the doping level needed to obtain a broad and nearly flat emission spectrum that provides the perception of white color. The samples studied were resin composites from Charisma (Heraeus Kulzer) prepared with CdSe/ZnS core-shell QD (0.05-0.77 mass%). The results showed that the fluorescence of dental resin composites can be tailored by using CdSe/ZnS core-shell quantum dots. QD core incorporation into dental resins allows the fabrication of restorative materials with fluorescence properties that closely match those of natural human teeth. Copyright 2009 Elsevier Ltd. All rights reserved.

  17. CD47 expression in Epstein-Barr virus-associated gastric carcinoma: coexistence with tumor immunity lowering the ratio of CD8+/Foxp3+ T cells.

    PubMed

    Abe, Hiroyuki; Saito, Ruri; Ichimura, Takashi; Iwasaki, Akiko; Yamazawa, Sho; Shinozaki-Ushiku, Aya; Morikawa, Teppei; Ushiku, Tetsuo; Yamashita, Hiroharu; Seto, Yasuyuki; Fukayama, Masashi

    2018-04-01

    Epstein-Barr virus-associated gastric carcinoma (EBVaGC) frequently harbors dense lymphocytic infiltration, suggesting a specific microenvironment allowing coexistence with tumor immunity. CD47, which mediates the "do not eat me" signal in innate immunity, is also important in adaptive anti-tumor immunity. We investigated the significance of CD47 in EBVaGC compared with EBV-negative gastric cancer and the correlation with various immune cells. By immunohistochemistry of CD47, high, low, and negative expression was observed in 24, 63, and 12% of EBVaGC (n = 41), while 11, 49, and 39% of EBV-negative gastric cancer (n = 262), respectively, indicating that high expression of CD47 in cancer cells was significantly frequent and increased in EBVaGC (P = 0.043). In contrast to EBV-negative gastric carcinoma in which no significant correlation was observed between CD47 and survival, high expression of CD47 correlated significantly with worse disease-specific survival (P = 0.011) and overall survival (P = 0.013) in EBVaGC. To further clarify the role of CD47 expression in EBVaGC, digital image analysis of immune cell infiltration revealed that high CD47 expression was correlated with a lower ratio of CD8 + /Foxp3 + T cells (P = 0.021), a sensitive indicator of tumor immunity. Thus, CD47 lowers anti-tumor immunity in EBVaGC by finely tuning profile of infiltrating T cells, suggesting that CD47 is an additional target for cancer immunotherapy against this virus-driven gastric cancer.

  18. Expression of surface markers on the human monocytic leukaemia cell line, THP-1, as indicators for the sensitizing potential of chemicals.

    PubMed

    An, Susun; Kim, Seoyoung; Huh, Yong; Lee, Tae Ryong; Kim, Han-Kon; Park, Kui-Lea; Eun, Hee Chul

    2009-04-01

    Evaluation of skin sensitization potential is an important part of the safety assessment of cosmetic ingredients and topical drugs. Recently, evaluation of changes in surface marker expression induced in dendritic cells (DC) or DC surrogate cell lines following exposure to chemicals represents one approach for in vitro test methods. The study aimed to test the change of expression patterns of surface markers on THP-1 cells by chemicals as a predictive in vitro method for contact sensitization. We investigated the expression of CD54, CD86, CD83, CD80, and CD40 after a 1-day exposure to sensitizers (1-chloro-2,4-dinitrobenzene; 2,4-dinitrofluorobenzene; benzocaine; 5-chloro-2-methyl-4-isothiazolin-3-one; hexyl cinnamic aldehyde; eugenol; nickel sulfate hexahydrate; potassium dichromate; cobalt sulfate; 2-mercaptobenzothiazole; and ammonium tetrachloroplatinate) and non-sensitizers (sodium lauryl sulfate, benzalkonium chloride, lactic acid, salicylic acid, isopropanol, and dimethyl sulphoxide). The test concentrations were 0.1x, 0.5x, and 1x of the 50% inhibitory concentration, and the relative fluorescence intensity was used as an expression indicator. By evaluating the expression patterns of CD54, CD86, and CD40, we could classify the chemicals as sensitizers or non-sensitizers, but CD80 and CD83 showed non-specific patterns of expression. These data suggest that the THP-1 cells are good model for screening contact sensitizers and CD40 could be a useful marker complementary to CD54 and CD86.

  19. Role of bone marrow-derived CD11c+ dendritic cells in systolic overload-induced left ventricular inflammation, fibrosis and hypertrophy.

    PubMed

    Wang, Huan; Kwak, Dongmin; Fassett, John; Liu, Xiaohong; Yao, Wu; Weng, Xinyu; Xu, Xin; Xu, Yawei; Bache, Robert J; Mueller, Daniel L; Chen, Yingjie

    2017-05-01

    Inflammatory responses play an important role in the development of left ventricular (LV) hypertrophy and dysfunction. Recent studies demonstrated that increased T-cell infiltration and T-cell activation contribute to LV hypertrophy and dysfunction. Dendritic cells (DCs) are professional antigen-presenting cells that orchestrate immune responses, especially by modulating T-cell function. In this study, we investigated the role of bone marrow-derived CD11c + DCs in transverse aortic constriction (TAC)-induced LV fibrosis and hypertrophy in mice. We observed that TAC increased the number of CD11c + cells and the percentage of CD11c + MHCII + (major histocompatibility complex class II molecule positive) DCs in the LV, spleen and peripheral blood in mice. Using bone marrow chimeras and an inducible CD11c + DC ablation model, we found that depletion of bone marrow-derived CD11c + DCs significantly attenuated LV fibrosis and hypertrophy in mice exposed to 24 weeks of moderate TAC. CD11c + DC ablation significantly reduced TAC-induced myocardial inflammation as indicated by reduced myocardial CD45 + cells, CD11b + cells, CD8 + T cells and activated effector CD8 + CD44 + T cells in LV tissues. Moreover, pulsing of autologous DCs with LV homogenates from TAC mice promoted T-cell proliferation. These data indicate that bone marrow-derived CD11c + DCs play a maladaptive role in hemodynamic overload-induced cardiac inflammation, hypertrophy and fibrosis through the presentation of cardiac self-antigens to T cells.

  20. Enzymatic synthesis of dimaltosyl-{beta}-cyclodextrin via a transglycosylation reaction using TreX, a Sulfolobus solfataricus P2 debranching enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, Hee-Kwon; Cha, Hyunju; Yang, Tae-Joo

    2008-02-01

    Di-O-{alpha}-maltosyl-{beta}-cyclodextrin ((G2){sub 2}-{beta}-CD) was synthesized from 6-O-{alpha}-maltosyl-{beta}-cyclodextrin (G2-{beta}-CD) via a transglycosylation reaction catalyzed by TreX, a debranching enzyme from Sulfolobus solfataricus P2. TreX showed no activity toward glucosyl-{beta}-CD, but a transfer product (1) was detected when the enzyme was incubated with maltosyl-{beta}-CD, indicating specificity for a branched glucosyl chain bigger than DP2. Analysis of the structure of the transfer product (1) using MALDI-TOF/MS and isoamylase or glucoamylase treatment revealed it to be dimaltosyl-{beta}-CD, suggesting that TreX transferred the maltosyl residue of a G2-{beta}-CD to another molecule of G2-{beta}-CD by forming an {alpha}-1,6-glucosidic linkage. When [{sup 14}C]-maltose and maltosyl-{beta}-CD were reactedmore » with the enzyme, the radiogram showed no labeled dimaltosyl-{beta}-CD; no condensation product between the two substrates was detected, indicating that the synthesis of dimaltosyl-{beta}-CD occurred exclusively via transglycosylation of an {alpha}-1,6-glucosidic linkage. Based on the HPLC elution profile, the transfer product (1) was identified to be isomers of 6{sup 1},6{sup 3}- and 6{sup 1},6{sup 4}-dimaltosyl-{beta}-CD. Inhibition studies with {beta}-CD on the transglycosylation activity revealed that {beta}-CD was a mixed-type inhibitor, with a K{sub i} value of 55.6 {mu}mol/mL. Thus, dimaltosyl-{beta}-CD can be more efficiently synthesized by a transglycosylation reaction with TreX in the absence of {beta}-CD. Our findings suggest that the high yield of (G2){sub 2}-{beta}-CD from G2-{beta}-CD was based on both the transglycosylation action mode and elimination of the inhibitory effect of {beta}-CD.« less

Top