Overexpression of Telomerase Reverse Transcriptase Induces Autism-like Excitatory Phenotypes in Mice.

PubMed

Kim, Ki Chan; Rhee, Jeehae; Park, Jong-Eun; Lee, Dong-Keun; Choi, Chang Soon; Kim, Ji-Woon; Lee, Han-Woong; Song, Mi-Ryoung; Yoo, Hee Jeong; Chung, ChiHye; Shin, Chan Young

2016-12-01

In addition to its classical role as a regulator of telomere length, recent reports suggest that telomerase reverse transcriptase (TERT) plays a role in the transcriptional regulation of gene expression such as β-catenin-responsive pathways. Silencing or over-expression of TERT in cultured NPCs demonstrated that TERT induced glutamatergic neuronal differentiation. During embryonic brain development, expression of transcription factors involved in glutamatergic neuronal differentiation was increased in mice over-expressing TERT (TERT-tg mice). We observed increased expression of NMDA receptor subunits and phosphorylation of α-CaMKII in TERT-tg mice. TERT-tg mice showed autism spectrum disorder (ASD)-like behavioral phenotypes as well as lowered threshold against electrically induced seizure. Interestingly, the NMDA receptor antagonist memantine restored behavioral abnormalities in TERT-tg mice. Consistent with the alteration in excitatory/inhibitory (E/I) ratio, TERT-tg mice showed autism-like behaviors, abnormal synaptic organization, and function in mPFC suggesting the role of altered TERT activity in the manifestation of ASD, which is further supported by the significant association of certain SNPs in Korean ASD patients.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Dielectric relaxation in undiluted poly (4-chlorostyrene). II. Characteristics of the high frequency tail

NASA Astrophysics Data System (ADS)

Yoshihara, M.; Work, R. N.

1981-05-01

The shape of the principal dielectric relaxation process that occurs just above the glass transition temperature Tg in well annealed, atactic, undiluted poly (4-chlorostyrene) exhibits a small tail at the high frequency end of the spectrum of relaxation times. This high frequency tail (HFT) has been characterized at temperatures varying from 351 to 413 K by using the Havriliak-Negami equation. The glass transition temperature Tg of P4CS is about 400 K. It is suggested that the HFT is distinct from the β relaxation process which occurs in polystyrene at temperatures just below Tg; and that the HFT is experimental evidence of the existence of localized, fast conformational changes. This fast process is presumed to be slowed and broadened by interactions with the surroundings.

Environmentally Benign Repair of Composites Using High Temperature Cyanate Ester Nanocomposites

DTIC Science & Technology

2010-10-01

temperature by magnetic stirring. Thermogravimetric analysis (TG) measurements were performed on a TG model Q50 (TA Instruments, Inc.) to determine the...standard 1259-85. These experiments were also compared with thermogravimetric analysis (TGA) in both dynamic heating and isothermal conditions. The...characterized with thermogravimetric analysis (TG) and Fourier transform infrared spectroscopy (FT-IR). For the TG, about 20 mg of sample was placed in

TG-FTIR analysis on pyrolysis and combustion of marine sediment

NASA Astrophysics Data System (ADS)

Oudghiri, Fatiha; Allali, Nabil; Quiroga, José María; Rodríguez-Barroso, María Rocío

2016-09-01

In this paper, the pyrolysis and combustion of sediment have been compared using thermogravimetric analysis (TG) coupled with Fourier transform infrared spectrometry (TG-FTIR) analysis. The TG results showed that both the pyrolysis and combustion of sediment presented four weight loss stages, each. The evolving gaseous products during pyrolysis were H2O, CO2 and hydrocarbons, while combustion yielded considerable amounts of CO2, in addition to H2O, CO, Cdbnd C, Cdbnd O and NH3. Comparing the pyrolysis and combustion TG-FTIR curves, it is possible to evaluate the effect of oxygen presence in the temperature range of 200-600 °C, which increases the volatilisation rate of organic matter in sediment. For the better detection of organic and inorganic matter in sediment by TG-FTIR analysis it is recommended to work in combustion mode of sediment.

Growth, structural, optical, thermal and mechanical properties of ammonium pentaborate single crystal.

PubMed

Balakrishnan, T; Bhagavannarayana, G; Ramamurthi, K

2008-11-15

Nonlinear optical single crystals of ammonium pentaborate (APB) were grown by the slow cooling method from aqueous solution. Grown crystal was characterized by powder X-ray diffraction (PXRD) and FT-IR spectral analysis. Perfection of the grown crystal was evaluated by high-resolution X-ray diffractometry (HRXRD). The effect of nylon threading on the perfection of the grown bigger crystal was also studied by HRXRD. The range and percentage of optical transmission was ascertained by recording UV-vis-NIR spectrum. Thermal properties were investigated by TG-DTA and DSC analyses. Its mechanical hardness was estimated by Vickers microhardness tester.

Electron Beam Manufacturable Composites for Space Applications

DTIC Science & Technology

1998-03-01

when initiated with a strong acid cation. The chain extension reaction is very rapid and leads to polymer with relatively high Tg even when the...this Effort 5 Initiators for Polymerization Reactions 7 Experimental Procedures 8 E-Beam Exposure Experimental Plan 8 Mold Design for...the reaction product from iodination -39 27. 13C NMR spectrum of propargyl resin with AT-4BrA-P additive 42 28. FTIR spectrum, in the region 2250

Syntheses, structures and luminescent properties of two novel Zn (II) coordination polymers

NASA Astrophysics Data System (ADS)

Huang, Ya-Ru; Gao, Ling-Ling; Wang, Xiao-Qing; Fan, Li-Ming; Hu, Tuo-Ping

2018-02-01

Two new coordination polymers, namely [Zn(TZMB)]n (1) and {[Zn(TZMB)](H2TZMB)]·(C2H5OH)0.5(H2O)2.5}n (2), (H2TZMB = 4,4‧-(1H-1,2,4-triazol-1-yl)methylene-bis(benzonic acid), have been synthesized under hydrothermal conditions and characterized by single-crystal X-ray diffraction analysis, elemental analysis (EA), IR spectrum analysis (IR), powder X-ray diffraction (PXRD), and thermogravimetric (TG) analysis. Single X-ray diffraction analysis reveals that complex 1 is a 3D 3,6-connected net with the point symbol of (6110.84)(63)2 and complex 2 is a 2D 3-connected net with the point symbol of (63). Furthermore, luminescent properties of complexes 1 and 2 were also investigated in detail.

TU-B-304-01: The Aftermath of TG-142

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, E.

2015-06-15

Although published in 2009, the AAPM TG-142 report on accelerator quality assurance still proves a challenge for full clinical implementation. The choice of methodologies to satisfy TG-142 requirements is critical to a successful application. Understanding the philosophy of TG-142 can help in creating an institution-specific QA practice that is both efficient and effective. The concept of maintaining commissioned beam profiles is still found confusing. The physicist must also consider technologies not covered by TG-142 (i.e. arc therapy techniques). On the horizon is TG-198 report on implementing TG-142. Although the community still lacks a final TG-100 report, performing a failure-mode -and-effectsmore » analysis and statistical process control analysis to determine the institution-specific clinical impact of each TG-142 test may be useful for identifying trends for pro-active surveillance. Learning Objectives: To better understand the confusing and controversial aspects of TG-142. To understand what is still missing from TG-142 and how to account for these tests in clinical practice To describe which QA tests in TG-142 yield the largest potential clinical result if not discovered.« less

TU-B-304-02: Quantitative FMEA of TG-142

DOE Office of Scientific and Technical Information (OSTI.GOV)

O’Daniel, J.

2015-06-15

Although published in 2009, the AAPM TG-142 report on accelerator quality assurance still proves a challenge for full clinical implementation. The choice of methodologies to satisfy TG-142 requirements is critical to a successful application. Understanding the philosophy of TG-142 can help in creating an institution-specific QA practice that is both efficient and effective. The concept of maintaining commissioned beam profiles is still found confusing. The physicist must also consider technologies not covered by TG-142 (i.e. arc therapy techniques). On the horizon is TG-198 report on implementing TG-142. Although the community still lacks a final TG-100 report, performing a failure-mode -and-effectsmore » analysis and statistical process control analysis to determine the institution-specific clinical impact of each TG-142 test may be useful for identifying trends for pro-active surveillance. Learning Objectives: To better understand the confusing and controversial aspects of TG-142. To understand what is still missing from TG-142 and how to account for these tests in clinical practice To describe which QA tests in TG-142 yield the largest potential clinical result if not discovered.« less

TU-B-304-00: The Aftermath of TG-142

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

2015-06-15

Although published in 2009, the AAPM TG-142 report on accelerator quality assurance still proves a challenge for full clinical implementation. The choice of methodologies to satisfy TG-142 requirements is critical to a successful application. Understanding the philosophy of TG-142 can help in creating an institution-specific QA practice that is both efficient and effective. The concept of maintaining commissioned beam profiles is still found confusing. The physicist must also consider technologies not covered by TG-142 (i.e. arc therapy techniques). On the horizon is TG-198 report on implementing TG-142. Although the community still lacks a final TG-100 report, performing a failure-mode -and-effectsmore » analysis and statistical process control analysis to determine the institution-specific clinical impact of each TG-142 test may be useful for identifying trends for pro-active surveillance. Learning Objectives: To better understand the confusing and controversial aspects of TG-142. To understand what is still missing from TG-142 and how to account for these tests in clinical practice To describe which QA tests in TG-142 yield the largest potential clinical result if not discovered.« less

Lactobacillus GG prevents recurrence of colitis in HLA-B27 transgenic rats after antibiotic treatment

PubMed Central

Dieleman, L A; Goerres, M S; Arends, A; Sprengers, D; Torrice, C; Hoentjen, F; Grenther, W B; Sartor, R B

2003-01-01

Background and aims: Bacteroides vulgatus induces colitis in gnotobiotic HLA-B27 transgenic (TG) rats while broad spectrum antibiotics prevent and treat colitis in specific pathogen free (SPF) TG rats although disease recurs after treatment ends. Lactobacilli treat human pouchitis and experimental colitis. We investigated if Lactobacillus rhamnosus GG (L GG) can prevent colitis in TG rats monoassociated with B vulgatus and if L GG or Lactobacillus plantarum 299v (LP 299v) can treat established colitis in SPF TG rats and prevent recurrent disease after antibiotics were stopped. Methods: Germfree B27 TG rats were monoassociated with B vulgatus for four weeks following two weeks of colonisation with L GG or no bacteria. SPF B27 TG rats received oral vancomycin and imipenem for two weeks, or water alone, followed by four weeks of treatment with oral L GG, LP 299v, or water only. Disease activity was quantified by blinded gross and histological scores, caecal myeloperoxidase (MPO) activity, and levels of interleukin (IL)-1β, tumour necrosis factor (TNF), transforming growth factor β, and IL-10. Results: L GG did not prevent colitis in B vulgatus co-associated TG rats or treat established disease in SPF rats. However, L GG but not LP 299v prevented colitis relapse in antibiotic treated rats with reduced gross and histological scores, caecal MPO, IL-1β, and TNF whereas caecal IL-10 was increased. Conclusions: L GG does not prevent colitis in gnotobiotic TG rats or treat established disease in SPF rats, but is superior to LP 299v in the prevention of recurrent colitis. These studies suggest that antibiotics and probiotic agents provide synergistic therapeutic effects, perhaps mediated by altered immunomodulation with selective activity of different lactobacillus species. PMID:12584218

Lactobacillus GG prevents recurrence of colitis in HLA-B27 transgenic rats after antibiotic treatment.

PubMed

Dieleman, L A; Goerres, M S; Arends, A; Sprengers, D; Torrice, C; Hoentjen, F; Grenther, W B; Sartor, R B

2003-03-01

Bacteroides vulgatus induces colitis in gnotobiotic HLA-B27 transgenic (TG) rats while broad spectrum antibiotics prevent and treat colitis in specific pathogen free (SPF) TG rats although disease recurs after treatment ends. Lactobacilli treat human pouchitis and experimental colitis. We investigated if Lactobacillus rhamnosus GG (L GG) can prevent colitis in TG rats monoassociated with B vulgatus and if L GG or Lactobacillus plantarum 299v (LP 299v) can treat established colitis in SPF TG rats and prevent recurrent disease after antibiotics were stopped. Germfree B27 TG rats were monoassociated with B vulgatus for four weeks following two weeks of colonisation with L GG or no bacteria. SPF B27 TG rats received oral vancomycin and imipenem for two weeks, or water alone, followed by four weeks of treatment with oral L GG, LP 299v, or water only. Disease activity was quantified by blinded gross and histological scores, caecal myeloperoxidase (MPO) activity, and levels of interleukin (IL)-1 beta, tumour necrosis factor (TNF), transforming growth factor beta, and IL-10. L GG did not prevent colitis in B vulgatus co-associated TG rats or treat established disease in SPF rats. However, L GG but not LP 299v prevented colitis relapse in antibiotic treated rats with reduced gross and histological scores, caecal MPO, IL-1 beta, and TNF whereas caecal IL-10 was increased. L GG does not prevent colitis in gnotobiotic TG rats or treat established disease in SPF rats, but is superior to LP 299v in the prevention of recurrent colitis. These studies suggest that antibiotics and probiotic agents provide synergistic therapeutic effects, perhaps mediated by altered immunomodulation with selective activity of different lactobacillus species.

The Association of Schizophrenia Risk -Amino Acid Oxidase Polymorphisms With Sensorimotor Gating, Working Memory and Personality in Healthy Males

PubMed Central

Roussos, Panos; Giakoumaki, Stella G; Adamaki, Eva; Anastasios, Georgakopoulos; Nikos, Robakis K; Bitsios, Panos

2011-01-01

There is evidence supporting a role for the -amino acid oxidase (DAO) locus in schizophrenia. This study aimed to determine the relationship of five single-nucleotide polymorphisms (SNPs) within the DAO gene identified as promising schizophrenia risk genes (rs4623951, rs2111902, rs3918346, rs3741775, and rs3825251) to acoustic startle, prepulse inhibition (PPI), working memory, and personality dimensions. A highly homogeneous study entry cohort (n=530) of healthy, young male army conscripts (n=703) originating from the Greek LOGOS project (Learning On Genetics Of Schizophrenia Spectrum) underwent PPI of the acoustic startle reflex, working memory, and personality assessment. The QTPHASE from the UNPHASED package was used for the association analysis of each SNP or haplotype data, with p-values corrected for multiple testing by running 10 000 permutations of the data. The rs4623951_T-rs3741775_G and rs4623951_T-rs2111902_T diplotypes were associated with reduced PPI and worse performance in working memory tasks and a personality pattern characterized by attenuated anxiety. Median stratification analysis of the risk diplotype group (ie, those individuals homozygous for the T and G alleles (TG+)) showed reduced PPI and working memory performance only in TG+ individuals with high trait anxiety. The rs4623951_T allele, which is the DAO polymorphism most strongly associated with schizophrenia, might tag a haplotype that affects PPI, cognition, and personality traits in general population. Our findings suggest an influence of the gene in the neural substrate mediating sensorimotor gating and working memory, especially when combined with high anxiety and further validate DAO as a candidate gene for schizophrenia and spectrum disorders. PMID:21471957

Residual transglutaminase in collagen - effects, detection, quantification, and removal.

PubMed

Schloegl, W; Klein, A; Fürst, R; Leicht, U; Volkmer, E; Schieker, M; Jus, S; Guebitz, G M; Stachel, I; Meyer, M; Wiggenhorn, M; Friess, W

2012-02-01

In the present study, we developed an enzyme-linked immunosorbent assay (ELISA) for microbial transglutaminase (mTG) from Streptomyces mobaraensis to overcome the lack of a quantification method for mTG. We further performed a detailed follow-on-analysis of insoluble porcine collagen type I enzymatically modified with mTG primarily focusing on residuals of mTG. Repeated washing (4 ×) reduced mTG-levels in the washing fluids but did not quantitatively remove mTG from the material (p < 0.000001). Substantial amounts of up to 40% of the enzyme utilized in the crosslinking mixture remained associated with the modified collagen. Binding was non-covalent as could be demonstrated by Western blot analysis. Acidic and alkaline dialysis of mTG treated collagen material enabled complete removal the enzyme. Treatment with guanidinium chloride, urea, or sodium chloride was less effective in reducing the mTG content. Copyright © 2011 Elsevier B.V. All rights reserved.

Gender Creative or Transgender Youth and Advanced Nursing Practice.

PubMed

Kirouac, Nicole; Tan, Mabel

2017-06-01

The World Professional Association for Transgender Health (WPATH) defines gender dysphoria as "Discomfort or distress that is caused by a discrepancy between a person's gender identity and that person's sex assigned at birth (and the associated gender role and/or primary and secondary sex characteristics)" (WPATH, 2016). Gender creative (GC) and transgender (TG) youth are at high risk for severe mental health disparities if they don't receive competent and timely gender transitioning care. Although awareness and early care of TG youth in specialty clinics is improving and increasing, there is still much effort that is required to eliminate barriers to care at many levels and thus improve outcomes. Nurses, particularly advanced practice nurses, are poised to lead the way in creating safe, inclusive, family centered spaces for TG and GC children, youth and their families as well as acting as vital mentors for other nurses. The purpose of this paper is to discuss the increasing prevalence of GC and TG youth, the significance of inclusive care for GC and TG youth, treatment guidelines, and the impact parents and advanced practice nurses can have on the journey of these youth as they explore and find their place on the gender spectrum. Copyright© of YS Medical Media ltd.

Evaluating CMA Equalization of SOQPSK-TG for Aeronautical Telemetry

DTIC Science & Technology

2015-03-01

Program through the U.S. Army Program Executive Office for Simulation, Training and Instrumentation (PEO STRI) under contract W900KK-13-C-0026 ( PAQ ...Report: Preamble assisted equalization for aeronautical telemetry ( PAQ ),‖ Brigham Young University, Technical Report, 2014, submitted to the Spectrum

Adsorption behavior and mechanism of acidic blue 25 dye onto cucurbit[8]uril: A spectral and DFT study

NASA Astrophysics Data System (ADS)

Luo, Hanhan; Huang, Xiangyu; Luo, Yuhan; Li, Zhuang; Li, Lan; Gao, Chao; Xiong, Jinyan; Li, Wei

2018-03-01

The acidic blue 25 (AB25) dye was efficiently adsorbed by CB [8]; the saturated adsorption capacity (qexp) reached 434.8 mg/g and was far higher than those of previous reported adsorbents. The Langmuir and Freundich isotherms were used to fit the equilibrium data, and the results showed that the Freundlich isotherm seemed to agree better with the AB25 adsorption. The adsorption kinetics followed the pseudo-second-order model. Calculated thermodynamic parameters showed that the adsorption of AB25 onto CB [8] was a spontaneous and enthalpy-driven process. The adsorption mechanism was explored by N2 adsorption-desorption, TG, FT-IR, UV-vis as well as MD simulation and DFT calculations. TG analysis revealed that a new inclusion complex was produced, and FT-IR,UV-vis spectrum and DFT calculations verify its structure. In this inclusion complex, the AB25 dye molecule inserted into cavities of CB [8] from portal, and the sulfonate and phenyl groups stayed in the hydrophobic cavity. TDDFT calculations indicated that all excitation arisen from π → π* transition.

Effects of copper on the preparation and characterization of Na-Ca-P borate glasses.

PubMed

Shailajha, S; Geetha, K; Vasantharani, P; Sheik Abdul Kadhar, S P

2015-03-05

Glasses in the system Na2O-CaO-B2O3-P2O5: CuO have been prepared by melt quenching at 1200°C and rapidly cooling at room temperature. The structural, optical and thermal properties have been investigated using X-ray diffraction (XRD), ultraviolet-visible (UV-VIS) spectroscopy, thermogravimetric-differential thermal analysis (TG-DTA), Fourier transform infrared (FTIR) spectroscopy, high resolution scanning electron microscopy (HRSEM) with energy dispersive X-ray (EDX) spectroscopy and high resolution transmission electron microscope (HRTEM) with energy dispersive X-ray (EDAX). The amorphous and crystalline nature of these samples was verified by XRD. Glass transition, crystallization and thermal stability were determined by TG-DTA investigations. Direct optical energy band gaps before and after doping with different percents of copper oxide were evaluated from 4.81eV to 2.99eV indicated the role of copper in the glassy matrix by UV spectra. FTIR spectrum reveals characteristic absorption bands due to various groups of triangular and tetrahedral borate network. Due to the amorphous nature, the particles like agglomerates on the glass surface were investigated by the HRSEM analysis. The crystalline nature of the samples in XRD is confirmed by SAED pattern using HRTEM. Copyright © 2014 Elsevier B.V. All rights reserved.

Diagnostic value of Tg and TgAb for metastasis following ablation in patients with differentiated thyroid carcinoma coexistent with Hashimoto thyroiditis.

PubMed

Chai, Hong; Zhu, Zhao-Jin; Chen, Ze-Quan; Yu, Yong-Li

2016-08-01

This study was designed to investigate the clinical value of serum thyroglobulin (Tg) and antithyroglobulin antibody (TgAb) measurements and the cutoff value after ablation in differentiated thyroid carcinoma (DTC) complicated by Hashimoto thyroiditis (HT) with metastasis. We measured serum Tg and TgAb levels and evaluated the disease status in 164 cases of DTC coexistent with HT in pathologically confirmed patients after surgery and post-remnant ablation during a 3-year follow-up. All Tg and TgAb levels were assessed by chemiluminescent immunoassay (IMA). Receiver operating characteristic (ROC) curve analysis was used to evaluate the prognostic value of Tg and TgAb for disease metastasis. The relationship between Tg and TgAb was analyzed using the scatter diagram distribution method. We found that the cutoff values of Tg and TgAb were 1.48 µg/L and 45 kIU/L, respectively. The area under the ROC curve (AUC) of Tg and TgAb was 0.907 and 0.650, respectively. In DTC coexistent with HT patients, the optimal cutoff value correlated with metastasis in Tg and TgAb was 1.48 µg/L and 45 kIU/L, respectively.

Toxoplasma gondii serine-protease inhibitor-1: A new adjuvant candidate for asthma therapy.

PubMed

Soto, Ariadna S; Fenoy, Ignacio M; Sanchez, Vanesa R; March, Florencia; Perrone Sibilia, Matías D; Aldirico, María de Los Angeles; Picchio, Mariano S; Arcon, Nadia; Acosta, Patricio L; Polack, Fernando P; Martin, Valentina; Goldman, Alejandra

2017-01-01

Serine-proteases are important players in the pathogenesis of asthma, promoting inflammation and tissue remodeling. It's also known that many serine protease inhibitors display immunomodulatory properties. TgPI-1 is a Toxoplasma gondii protein that exhibits broad spectrum inhibitory activity against serine proteases. In view of the increased prevalence of atopic disorders and the need to develop new treatment strategies we sought to investigate the potential of TgPI-1 for treating respiratory allergies. For this purpose, we developed a therapeutic experimental model. BALB/c mice were rendered allergic by intraperitoneal ovalbumin-alum sensitization and airway-challenged. Once the asthmatic phenotype was achieved, mice were intranasally treated with rTgPI-1 alone or with a mixture of rTgPI-1 and ovalbumin (OVA). A week later mice were given a secondary aerosol challenge. Treatment with rTgPI-1 alone or co-administered with OVA diminished bronchoalveolar eosinophilia, mucus production and peribronchial lung infiltration. This effect was accompanied by a lung resistance reduction of 26.3% and 50.3% respectively. Both treatments resulted in the production of lower levels of IL-4, IL-5, IFN-γ and regulatory IL-10 by thoracic lymph node cells stimulated with OVA. Interestingly, significant decreases in OVA specific IgE and T cell proliferation, and increases in FoxP3+ T cells at local and systemic levels were only detected when the inhibitor was administered along with OVA. These results show that both rTgPI-1 treatments reduced asthma hallmarks. However, co-administration of the inhibitor with the allergen was more effective. Hence, rTgPI-1 emerges as a novel adjuvant candidate for asthma treatment.

Toxoplasma gondii serine-protease inhibitor-1: A new adjuvant candidate for asthma therapy

PubMed Central

Soto, Ariadna S.; Fenoy, Ignacio M.; Sanchez, Vanesa R.; March, Florencia; Perrone Sibilia, Matías D.; Aldirico, María de los Angeles; Picchio, Mariano S.; Arcon, Nadia; Acosta, Patricio L.; Polack, Fernando P.; Martin, Valentina

2017-01-01

Serine-proteases are important players in the pathogenesis of asthma, promoting inflammation and tissue remodeling. It’s also known that many serine protease inhibitors display immunomodulatory properties. TgPI-1 is a Toxoplasma gondii protein that exhibits broad spectrum inhibitory activity against serine proteases. In view of the increased prevalence of atopic disorders and the need to develop new treatment strategies we sought to investigate the potential of TgPI-1 for treating respiratory allergies. For this purpose, we developed a therapeutic experimental model. BALB/c mice were rendered allergic by intraperitoneal ovalbumin-alum sensitization and airway-challenged. Once the asthmatic phenotype was achieved, mice were intranasally treated with rTgPI-1 alone or with a mixture of rTgPI-1 and ovalbumin (OVA). A week later mice were given a secondary aerosol challenge. Treatment with rTgPI-1 alone or co-administered with OVA diminished bronchoalveolar eosinophilia, mucus production and peribronchial lung infiltration. This effect was accompanied by a lung resistance reduction of 26.3% and 50.3% respectively. Both treatments resulted in the production of lower levels of IL-4, IL-5, IFN-γ and regulatory IL-10 by thoracic lymph node cells stimulated with OVA. Interestingly, significant decreases in OVA specific IgE and T cell proliferation, and increases in FoxP3+ T cells at local and systemic levels were only detected when the inhibitor was administered along with OVA. These results show that both rTgPI-1 treatments reduced asthma hallmarks. However, co-administration of the inhibitor with the allergen was more effective. Hence, rTgPI-1 emerges as a novel adjuvant candidate for asthma treatment. PMID:29073215

Modulation of transglutaminase 2 activity in H9c2 cells by PKC and PKA signalling: a role for transglutaminase 2 in cytoprotection

PubMed Central

Almami, Ibtesam; Dickenson, John M; Hargreaves, Alan J; Bonner, Philip L R

2014-01-01

BACKGROUND AND PURPOSE Tissue transglutaminase (TG2) has been shown to mediate cell survival in many cell types. In this study, we investigated whether the role of TG2 in cytoprotection was mediated by the activation of PKA and PKC in cardiomyocyte-like H9c2 cells. EXPERIMENTAL APPROACH H9c2 cells were extracted following stimulation with phorbol-12-myristate-13-acetate (PMA) and forskolin. Transglutaminase activity was determined using an amine incorporating and a protein crosslinking assay. The presence of TG isoforms (TG1, 2, 3) was determined using Western blot analysis. The role of TG2 in PMA- and forskolin-induced cytoprotection was investigated by monitoring H2O2-induced oxidative stress in H9c2 cells. KEY RESULTS Western blotting showed TG2 >> TG1 protein expression but no detectable TG3. The amine incorporating activity of TG2 in H9c2 cells increased in a time and concentration-dependent manner following stimulation with PMA and forskolin. PMA and forskolin-induced TG2 activity was blocked by PKC (Ro 31-8220) and PKA (KT 5720 and Rp-8-Cl-cAMPS) inhibitors respectively. The PMA- and forskolin-induced increases in TG2 activity were attenuated by the TG2 inhibitors Z-DON and R283. Immunocytochemistry revealed TG2-mediated biotin-X-cadaverine incorporation into proteins and proteomic analysis identified known (β-tubulin) and novel (α-actinin) protein substrates for TG2. Pretreatment with PMA and forskolin reversed H2O2-induced decrease in MTT reduction and release of LDH. TG2 inhibitors R283 and Z-DON blocked PMA- and forskolin-induced cytoprotection. CONCLUSIONS AND IMPLICATIONS TG2 activity was stimulated via PKA- and PKC-dependent signalling pathways in H9c2 cells These results suggest a role for TG2 in cytoprotection induced by these kinases. PMID:24821315

Assessment of triglyceride and cholesterol in overweight people based on multiple linear regression and artificial intelligence model.

PubMed

Ma, Jing; Yu, Jiong; Hao, Guangshu; Wang, Dan; Sun, Yanni; Lu, Jianxin; Cao, Hongcui; Lin, Feiyan

2017-02-20

The prevalence of high hyperlipemia is increasing around the world. Our aims are to analyze the relationship of triglyceride (TG) and cholesterol (TC) with indexes of liver function and kidney function, and to develop a prediction model of TG, TC in overweight people. A total of 302 adult healthy subjects and 273 overweight subjects were enrolled in this study. The levels of fasting indexes of TG (fs-TG), TC (fs-TC), blood glucose, liver function, and kidney function were measured and analyzed by correlation analysis and multiple linear regression (MRL). The back propagation artificial neural network (BP-ANN) was applied to develop prediction models of fs-TG and fs-TC. The results showed there was significant difference in biochemical indexes between healthy people and overweight people. The correlation analysis showed fs-TG was related to weight, height, blood glucose, and indexes of liver and kidney function; while fs-TC was correlated with age, indexes of liver function (P < 0.01). The MRL analysis indicated regression equations of fs-TG and fs-TC both had statistic significant (P < 0.01) when included independent indexes. The BP-ANN model of fs-TG reached training goal at 59 epoch, while fs-TC model achieved high prediction accuracy after training 1000 epoch. In conclusions, there was high relationship of fs-TG and fs-TC with weight, height, age, blood glucose, indexes of liver function and kidney function. Based on related variables, the indexes of fs-TG and fs-TC can be predicted by BP-ANN models in overweight people.

Substitution of a single amino acid residue in the aromatic/arginine selectivity filter alters the transport profiles of tonoplast aquaporin homologs.

PubMed

Azad, Abul Kalam; Yoshikawa, Naoki; Ishikawa, Takahiro; Sawa, Yoshihiro; Shibata, Hitoshi

2012-01-01

Aquaporins are integral membrane proteins that facilitate the transport of water and some small solutes across cellular membranes. X-ray crystallography of aquaporins indicates that four amino acids constitute an aromatic/arginine (ar/R) pore constriction known as the selectivity filter. On the basis of these four amino acids, tonoplast aquaporins called tonoplast intrinsic proteins (TIPs) are divided into three groups in Arabidopsis. Herein, we describe the characterization of two group I TIP1s (TgTIP1;1 and TgTIP1;2) from tulip (Tulipa gesneriana). TgTIP1;1 and TgTIP1;2 have a novel isoleucine in loop E (LE2 position) of the ar/R filter; the residue at LE2 is a valine in all group I TIPs from model plants. The homologs showed mercury-sensitive water channel activity in a fast kinetics swelling assay upon heterologous expression in Pichia pastoris. Heterologous expression of both homologs promoted the growth of P. pastoris on ammonium or urea as sole sources of nitrogen and decreased growth and survival in the presence of H(2)O(2). TgTIP1;1- and TgTIP1;2-mediated H(2)O(2) conductance was demonstrated further by a fluorescence assay. Substitutions in the ar/R selectivity filter of TgTIP1;1 showed that mutants that mimicked the ar/R constriction of group I TIPs could conduct the same substrates that were transported by wild-type TgTIP1;1. In contrast, mutants that mimicked group II TIPs showed no evidence of urea or H(2)O(2) conductance. These results suggest that the amino acid residue at LE2 position is critical for the transport selectivity of the TIP homologs and group I TIPs might have a broader spectrum of substrate selectivity than group II TIPs. Copyright © 2011 Elsevier B.V. All rights reserved.

A modern Monte Carlo investigation of the TG-43 dosimetry parameters for an {sup 125}I seed already having AAPM consensus data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aryal, Prakash; Molloy, Janelle A.; Rivard, Mark J., E-mail: mark.j.rivard@gmail.com

2014-02-15

Purpose: To investigate potential causes for differences in TG-43 brachytherapy dosimetry parameters in the existent literature for the model IAI-125A{sup 125}I seed and to propose new standard dosimetry parameters. Methods: The MCNP5 code was used for Monte Carlo (MC) simulations. Sensitivity of dose distributions, and subsequently TG-43 dosimetry parameters, was explored to reproduce historical methods upon which American Association of Physicists in Medicine (AAPM) consensus data are based. Twelve simulation conditions varying{sup 125}I coating thickness, coating mass density, photon interaction cross-section library, and photon emission spectrum were examined. Results: Varying{sup 125}I coating thickness, coating mass density, photon cross-section library, andmore » photon emission spectrum for the model IAI-125A seed changed the dose-rate constant by up to 0.9%, about 1%, about 3%, and 3%, respectively, in comparison to the proposed standard value of 0.922 cGy h{sup −1} U{sup −1}. The dose-rate constant values by Solberg et al. [“Dosimetric parameters of three new solid core {sup 125}I brachytherapy sources,” J. Appl. Clin. Med. Phys. 3, 119–134 (2002)], Meigooni et al. [“Experimental and theoretical determination of dosimetric characteristics of IsoAid ADVANTAGE™ {sup 125}I brachytherapy source,” Med. Phys. 29, 2152–2158 (2002)], and Taylor and Rogers [“An EGSnrc Monte Carlo-calculated database of TG-43 parameters,” Med. Phys. 35, 4228–4241 (2008)] for the model IAI-125A seed and Kennedy et al. [“Experimental and Monte Carlo determination of the TG-43 dosimetric parameters for the model 9011 THINSeed™ brachytherapy source,” Med. Phys. 37, 1681–1688 (2010)] for the model 6711 seed were +4.3% (0.962 cGy h{sup −1} U{sup −1}), +6.2% (0.98 cGy h{sup −1} U{sup −1}), +0.3% (0.925 cGy h{sup −1} U{sup −1}), and −0.2% (0.921 cGy h{sup −1} U{sup −1}), respectively, in comparison to the proposed standard value. Differences in the radial dose functions between the current study and both Solberg et al. and Meigooni et al. were <10% for r ≤ 5 cm, and increased for r > 5 cm with a maximum difference of 29% at r = 9 cm. In comparison to Taylor and Rogers, these differences were lower (maximum of 2% at r = 9 cm). For the similarly designed model 6711 {sup 125}I seed, differences did not exceed 0.5% for 0.5 ≤ r ≤ 10 cm. Radial dose function values varied by 1% as coating thickness and coating density were changed. Varying the cross-section library and source spectrum altered the radial dose function by 25% and 12%, respectively, but these differences occurred at r = 10 cm where the dose rates were very low. The 2D anisotropy function results were most similar to those of Solberg et al. and most different to those of Meigooni et al. The observed order of simulation condition variables from most to least important for influencing the 2D anisotropy function was spectrum, coating thickness, coating density, and cross-section library. Conclusions: Several MC radiation transport codes are available for calculation of the TG-43 dosimetry parameters for brachytherapy seeds. The physics models in these codes and their related cross-section libraries have been updated and improved since publication of the 2007 AAPM TG-43U1S1 report. Results using modern data indicated statistically significant differences in these dosimetry parameters in comparison to data recommended in the TG-43U1S1 report. Therefore, it seems that professional societies such as the AAPM should consider reevaluating the consensus data for this and others seeds and establishing a process of regular evaluations in which consensus data are based upon methods that remain state-of-the-art.« less

Growth, optical, thermal, mechanical and dielectric studies of sodium succinate hexahydrate (β phase) single crystal: A promising third order NLO material

NASA Astrophysics Data System (ADS)

Mageshwari, P. S. Latha; Priya, R.; Krishnan, S.; Joseph, V.; Das, S. Jerome

2016-11-01

A third order nonlinear optical (NLO)single crystals of sodium succinate hexahydrate (SSH) (β phase) has been grown by a slow evaporation growth technique using aqueous solution at ambient temperature. The lattice parameters and morphology of SSH were determined by single crystal X-ray diffraction analysis. SSH crystallizes in centrosymmetric monoclinic system with space group P 21 / c and the crystalline purity was analyzed by powder X-ray diffraction analysis. The UV-vis-NIR spectrum reveals that the crystal is transparent in the entire visible region. The recorded FT-IR spectrum verified the presence of various functional groups in the material. NMR analysis of the grown crystal confirms the structural elucidation and detects the major and minor functional groups present in the title compound. ICP-OES analysis proved the presence of sodium in SSH. TG-DTA/DSCanalysis was used to investigate the thermal stability of the material. The dielectric permittivity and dielectric loss of SSH were carried out as a function of frequency for different temperatures and the results were discussed. The mechanical stability was evaluated from Vicker's microhardness test. The third order nonlinear optical properties of SSH has been investigated employing Z-scan technique with He-Ne laser operating at 632.8 nm wavelength.

Tg.rasH2 Mice and not CByB6F1 Mice Should Be Used for 28-Day Dose Range Finding Studies Prior to 26-Week Tg.rasH2 Carcinogenicity Studies.

PubMed

Paranjpe, Madhav G; Belich, Jessica; Vidmar, Tom J; Elbekai, Reem H; McKeon, Marie; Brown, Caren

Our recent retrospective analysis of data, collected from 29 Tg.rasH2 mouse carcinogenicity studies, determined how successful the strategy of choosing the high dose for the 26-week studies was based on the estimated maximum tolerated dose (EMTD) derived from earlier 28-day dose range finding (DRF) studies conducted in CByB6F1 mice. Our analysis demonstrated that the high doses applied at EMTD in the 26-week Tg.rasH2 studies failed to detect carcinogenic effects. To investigate why the dose selection process failed in the 26-week carcinogenicity studies, the initial body weights, terminal body weights, body weight gains, food consumption, and mortality from the first 4 weeks of 26-week studies with Tg.rasH2 mice were compared with 28-day DRF studies conducted with CByB6F1 mice. Both the 26-week and the earlier respective 28-day studies were conducted with the exact same vehicle, test article, and similar dose levels. The analysis of our results further emphasizes that the EMTD and subsequent lower doses, determined on the basis of the 28-day studies in CByB6F1 mice, may not be an accurate strategy for selecting appropriate dose levels for the 26-week carcinogenicity studies in Tg.rasH2 mice. Based on the analysis presented in this article, we propose that the Tg.rasH2 mice and not the CByB6F1 mice should be used in future DRF studies. The Tg.rasH2 mice demonstrate more toxicity than the CByB6F1 mice, possibly because of their smaller size compared to CByB6F1 mice. Also, the Tg.rasH2 males appear to be more sensitive than the female Tg.rasH2 mice.

Molecular diversity of tuliposide A-converting enzyme in the tulip.

PubMed

Nomura, Taiji; Tsuchigami, Aya; Ogita, Shinjiro; Kato, Yasuo

2013-01-01

Tuliposide A-converting enzyme (TCEA) catalyzes the conversion of 6-tuliposide A to its lactonized aglycon, tulipalin A, in the tulip (Tulipa gesneriana). The TgTCEA gene, isolated previously from petals, was transcribed in all tulip tissues but not in the bulbs despite the presence of TCEA activity, which allowed prediction of the presence of a TgTCEA isozyme gene preferentially expressed in the bulbs. Here, the TgTCEA-b gene, the TgTCEA homolog, was identified in bulbs. TgTCEA-b polypeptides showed approximately 77% identity to the petal TgTCEA. Functional characterization of the recombinant enzyme verified that TgTCEA-b encoded the TCEA. Moreover, the TgTCEA-b was found to be localized to plastids, as found for the petal TgTCEA. Transcript analysis revealed that TgTCEA-b was functionally transcribed in the bulb scales, unlike the TgTCEA gene, whose transcripts were absent there. In contrast, TgTCEA-b transcripts were in the minority in other tissues where TgTCEA transcripts were dominant, indicating a tissue preference for the transcription of those isozyme genes.

Density Functional Study of the Infrared Spectrum of Glucose and Glucose Monohydrates in the OH Stretch Region

USDA-ARS?s Scientific Manuscript database

Density functional theory (DFT) has been used to calculate the structures and infrared spectra of glucose and glucose monohydrates. Both the alpha and beta anomers were studied, with all possible combinations of hydroxymethyl rotamer (gg, gt, or tg) and hydroxyl orientation (clockwise or counter-cl...

Transgenic Expression of Osteoactivin/gpnmb Enhances Bone Formation In Vivo and Osteoprogenitor Differentiation Ex Vivo.

PubMed

Frara, Nagat; Abdelmagid, Samir M; Sondag, Gregory R; Moussa, Fouad M; Yingling, Vanessa R; Owen, Thomas A; Popoff, Steven N; Barbe, Mary F; Safadi, Fayez F

2016-01-01

Initial identification of osteoactivin (OA)/glycoprotein non-melanoma clone B (gpnmb) was demonstrated in an osteopetrotic rat model, where OA expression was increased threefold in mutant bones, compared to normal. OA mRNA and protein expression increase during active bone regeneration post-fracture, and primary rat osteoblasts show increased OA expression during differentiation in vitro. To further examine OA/gpnmb as an osteoinductive agent, we characterized the skeletal phenotype of transgenic mouse overexpressing OA/gpnmb under the CMV-promoter (OA-Tg). Western blot analysis showed increased OA/gpnmb in OA-Tg osteoblasts, compared to wild-type (WT). In OA-Tg mouse femurs versus WT littermates, micro-CT analysis showed increased trabecular bone volume and thickness, and cortical bone thickness; histomorphometry showed increased osteoblast numbers, bone formation and mineral apposition rates in OA-Tg mice; and biomechanical testing showed higher peak moment and stiffness. Given that OA/gpnmb is also over-expressed in osteoclasts in OA-Tg mice, we evaluated bone resorption by ELISA and histomorphometry, and observed decreased serum CTX-1 and RANK-L, and decreased osteoclast numbers in OA-Tg, compared to WT mice, indicating decreased bone remodeling in OA-Tg mice. The proliferation rate of OA-Tg osteoblasts in vitro was higher, compared to WT, as was alkaline phosphatase staining and activity, the latter indicating enhanced differentiation of OA-Tg osteoprogenitors. Quantitative RT-PCR analysis showed increased TGF-β1 and TGF-β receptors I and II expression in OA-Tg osteoblasts, compared to WT. Together, these data suggest that OA overexpression has an osteoinductive effect on bone mass in vivo and stimulates osteoprogenitor differentiation ex vivo. © 2015 Wiley Periodicals, Inc.

Analytical and clinical performance of thyroglobulin autoantibody assays in thyroid cancer follow-up.

PubMed

Katrangi, Waddah; Grebe, Stephan K G; Algeciras-Schimnich, Alicia

2017-10-26

While thyroglobulin autoantibodies (TgAb) can result in false low serum thyroglobulin (Tg) immunoassay (IA) measurements, they might also be indicators of disease persistence/recurrence. Hence, accurate TgAb measurement, in addition to Tg quantification, is crucial for thyroid cancer monitoring. We compared the analytical and clinical performance of four commonly used TgAb IAs. We measured Tg by mass spectrometry (Tg-MS) and by four pairs of Tg and TgAb IAs (Beckman, Roche, Siemens, Thermo) in 576 samples. Limit of quantitation (LOQ) and manufacturers' upper reference interval cut-off (URI) were used for comparisons. Clinical performance was assessed by receiving operator characteristics (ROC) curve analysis. Quantitative and qualitative agreement between TgAb-IAs was moderate with R2 of 0.20-0.70 and κ from 0.41-0.66 using LOQ and 0.47-0.71 using URI. In samples with TgAb interference, detection rates of TgAb were similar using LOQ and URI for Beckman, Siemens, and Thermo, but much lower for the Roche TgAb-IA when the URI was used. In TgAb positive cases, the ROC areas under the curve (AUC) for the TgAb-IAs were 0.59 (Beckman), 0.62 (Siemens), 0.59 (Roche), and 0.59 (Thermo), similar to ROC AUCs achieved with Tg. Combining Tg and TgAb measurements improved the ROC AUCs compared to Tg or TgAb alone. TgAb-IAs show significant qualitative and quantitative differences. For 2 of the 4 TgAb-IAs, using the LOQ improves the detection of interfering TgAbs. All assays showed suboptimal clinical performance when used as surrogate markers of disease, with modest improvements when Tg and TgAb were combined.

Evaluation of glass transition temperature and dynamic mechanical properties of autopolymerized hard direct denture reline resins.

PubMed

Takase, Kazuma; Watanabe, Ikuya; Kurogi, Tadafumi; Murata, Hiroshi

2015-01-01

This study assessed methods for evaluation of glass transition temperature (Tg) of autopolymerized hard direct denture reline resins using dynamic mechanical analysis and differential scanning calorimetry in addition to the dynamic mechanical properties. The Tg values of 3 different reline resins were determined using a dynamic viscoelastometer and differential scanning calorimeter, and rheological parameters were also determined. Although all materials exhibited higher storage modulus and loss modulus values, and a lower loss tangent at 37˚C with a higher frequency, the frequency dependence was not large. Tg values obtained by dynamic mechanical analysis were higher than those by differential scanning calorimetry and higher frequency led to higher Tg, while more stable Tg values were also obtained by that method. These results suggest that dynamic mechanical analysis is more advantageous for characterization of autopolymerized hard direct denture reline resins than differential scanning calorimetry.

Conformations of n-butyl imidazole: matrix isolation infrared and DFT studies.

PubMed

Ramanathan, N; Sundararajan, K; Sankaran, K

2015-03-15

Conformations of n-butyl imidazole (B-IMID) were studied using matrix isolation infrared spectroscopy by trapping in argon, xenon and nitrogen matrixes using an effusive nozzle source. The experimental studies were supported by DFT computations performed at the B3LYP/6-311++G(d,p) level. Computations identified nine unique minima for B-IMID, corresponding to conformers with tg(±)tt, tg(±)g(∓)t, tg(±)g(±)t, tg(±)tg(±), tg(±)tg(∓), tg(±)g(∓)g(∓), tg(±)g(±)g(±), tg(±)g(∓)g(±) and tg(±)g(±)g(∓) structures, given in order of increasing energy. Computations of the transition state structures connecting the higher energy conformers to the global minimum, tg(±)tt structure were carried out. The barriers for the conformer inter-conversion were found to be ∼2 kcal/mol. Natural Bond Orbital (NBO) analysis was performed to understand the reasons for conformational preferences in B-IMID. Copyright © 2014 Elsevier B.V. All rights reserved.

Characterization of potassium bromide crystals grown in the aqueous solution of picric acid

NASA Astrophysics Data System (ADS)

Maheswari, J. Uma; Krishnan, C.; Kalyanaraman, S.; Selvarajan, P.

2016-12-01

Potassium bromide crystals were grown in the aqueous solution of picric acid by slow evaporation technique at room temperature. X-ray Diffraction (XRD) analysis ensures that the grown sample is in Fm3m space group and FCC structure. Energy Dispersive X-ray Spectroscopy (EDX) reveals the presence of elements in the title compound. UV-Vis-NIR spectrum reveals that the grown sample is a promising nonlinear optical (NLO) material. FTIR analysis confirms the functional groups present in the sample. The thermogravimetric (TG) and differential thermogravimetric (DTA) analyses ensure that the sample material is thermally stable up to 160 °C. The second harmonic efficiency of the sample is 1.3 times greater than that of standard KDP. The mechanical strength of the grown sample is estimated by Vickers microhardness tester. The electrical properties were investigated by impedance analysis and the results of various studies of the grown crystals are discussed.

Crystal growth and characterization of third order nonlinear optical piperazinium bis(4-hydroxybenzenesulphonate) (P4HBS) single crystal

NASA Astrophysics Data System (ADS)

Pichan, Karuppasamy; Muthu, Senthil Pandian; Perumalsamy, Ramasamy

2017-09-01

The organic single crystal of piperazinium bis(4-hydroxybenzenesulphonate) (P4HBS) was grown by slow evaporation solution technique (SEST) at room temperature. The lattice parameters of the grown crystal were confirmed by single crystal X-ray diffraction analysis. Functional groups of P4HBS crystal were confirmed by FTIR spectrum analysis. The optical quality of the grown crystal was identified by the UV-Vis NIR spectrum analysis. The grown crystal has good optical transmittance in the range of 410-1100 nm. In photoluminescence spectrum, sharp emission peaks are observed, which indicates the ultraviolet (UV) emission. The photoconductivity study reveals that the grown crystal has negative photoconductive nature. The thermal behaviour of the P4HBS crystal was investigated by thermogravimetric and differential thermal analysis (TG-DTA). The mechanical stability of grown crystal was analyzed and the indentation size effect (ISE) was explained by Hays-Kendall's (HK) approach and proportional specimen resistance model (PSRM). Chemical etching study was carried out and the etch pit density (EPD) was calculated. The dielectric constant (ε‧) and dielectric loss (tan δ) as a function of frequency were measured for the grown crystal. The solid state parameters such as valence electron, plasma energy, Penn gap and Fermi energy were evaluated theoretically for the P4HBS using the empirical relation. The estimated values are used to calculate the electronic polarizability. The third-order nonlinear optical properties such as nonlinear refractive index (n2), absorption co-efficient (β) and susceptibility (χ(3)) were studied by Z-scan technique at 632.8 nm using He-Ne laser.

Studies on the synthesis, spectral, optical and thermal properties of l-Valine Zinc Sulphate: an organic inorganic hybrid nonlinear optical crystal.

PubMed

Puhal Raj, A; Ramachandra Raja, C

2012-11-01

Nonlinear optical (NLO) organic inorganic hybrid l-Valine Zinc Sulphate (LVZS) was synthesized and single crystals were obtained from saturated aqueous solution by slow evaporation method at 36°C using a constant temperature bath (CTB) with an accuracy of ±0.01°C. This crystal is reported with its characterization by single crystal and powder XRD, FTIR, UV-Vis-NIR, TG/DTA analysis and SHG test. Single crystal XRD study reveals that LVZS crystallizes in monoclinic system with the lattice constants a=9.969(3) Å, b=7.238(3) Å, c=24.334(9) Å and cell volume is 1736.00Å(3). Sharp peaks observed in powder X-ray diffraction studies confirm the high degree of crystallinity of grown crystal. The incorporation of sulphate ion with l-valine is confirmed by FTIR spectrum in LVZS crystal(.) A remarkable increase in optical transparency has been observed in LVZS when compared to l-valine and zinc sulphate heptahydrate Thermal properties of LVZS have been reported by using TG/DTA analysis. Kurtz powder second harmonic generation (SHG) test confirms NLO property of the crystal and SHG efficiency of LVZS was found to be 1.34 times more than pure l-valine. Copyright © 2012 Elsevier B.V. All rights reserved.

Molecular Analysis of Congenital Hypothyroidism in Saudi Arabia: SLC26A7 Mutation Is a Novel Defect in Thyroid Dyshormonogenesis.

PubMed

Zou, Minjing; Alzahrani, Ali S; Al-Odaib, Ali; Alqahtani, Mohammad A; Babiker, Omer; Al-Rijjal, Roua A; BinEssa, Huda A; Kattan, Walaa E; Al-Enezi, Anwar F; Al Qarni, Ali; Al-Faham, Manar S A; Baitei, Essa Y; Alsagheir, Afaf; Meyer, Brian F; Shi, Yufei

2018-05-01

Congenital hypothyroidism (CH) is the most common neonatal endocrine disorder, affecting one in 3000 to 4000 newborns. Since the introduction of a newborn screening program in 1988, more than 300 cases have been identified. The underlying genetic defects have not been systematically studied. To identify the mutation spectrum of CH-causing genes. Fifty-five patients from 47 families were studied by next-generation exome sequencing. Mutations were identified in 52.7% of patients (29 of 55) in the following 11 genes: TG, TPO, DUOX2, SLC26A4, SLC26A7, TSHB, TSHR, NKX2-1, PAX8, CDCA8, and HOXB3. Among 30 patients with thyroid dyshormonogenesis, biallelic TG mutations were found in 12 patients (40%), followed by biallelic mutations in TPO (6.7%), SLC26A7 (6.7%), and DUOX2 (3.3%). Monoallelic SLC26A4 mutations were found in two patients, one of them coexisting with two tandem biallelic deletions in SLC26A7. In 25 patients with thyroid dysgenesis, biallelic mutations in TSHR were found in six patients (24%). Biallelic mutations in TSHB, PAX 8, NKX2-1, or HOXB3 were found once in four different patients. A monoallelic CDCA8 mutation was found in one patient. Most mutations were novel, including three TG, two TSHR, and one each in DUOX2, TPO, SLC26A7, TSHB, NKX2-1, PAX8, CDCA8, and HOXB3. SLC26A7 and HOXB3 were novel genes associated with thyroid dyshormonogenesis and dysgenesis, respectively. TG and TSHR mutations are the most common genetic defects in Saudi patients with CH. The prevalence of other disease-causing mutations is low, reflecting the consanguineous nature of the population. SLC26A7 mutations appear to be associated with thyroid dyshormonogenesis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, G; Nishino, T; Greene, T

Purpose: To determine the consistency of digital detector (DR) tests recommended by AAPM TG150 and tests provided by commercially available DirectView Total Quality Tool (TQT). Methods: The DR tests recommended by the TG150 Detector Subgroup[1] were performed on 4 new Carestream DRX-Revolution and one Carestream DRX1C retrofit of a GE AMX-4 that had been in service for three years. After detector calibration, flat-field images plus images of two bar patterns oriented parallel and perpendicular to the A-C axis, were acquired at conditions recommended by TG150. Raw images were harvested and then analyzed using a MATLAB software previously validated[2,3,4]. Data weremore » analyzed using ROIs of two different dimensions: 1) 128 x 128 ROIs matching the detector electronics; and 2) 256 x 256 ROIs, each including 4 adjacent smaller ROIs. TG150 metrics from 128 x 128 ROIs were compared to TQT metrics, which are also obtained from 128 x 128 ROIs[5]. Results: The results show that both TG150 and TQT measurements were consistent among these detectors. Differences between TG150 and TQT values appear systematic. Compared with 128 x 128 ROIs, noise and SNR non-uniformity were lower with 256 x 256 ROIs, although signal non-uniformity was similar, indicating detectors were appropriately calibrated for gain and offset. MTF of the retrofit unit remained essentially the same between 2012 and 2015, but was inferior to the new units. The older generator focal spot is smaller (0.75mm vs. 1.2mm), and the SID for acquisition is 182cm as well, so focal spot dimensions cannot explain the difference. The difference in MTF may be secondary to differences in generator X-ray spectrum or by unannounced changes in detector architecture. Further investigation is needed. Conclusion: The study shows that both TG150 and TQT tests are consistent. The numerical value of some metrics are dependent on ROI size.« less

The Short-term Prognostic Value of the Triglyceride-to-high-density Lipoprotein Cholesterol Ratio in Acute Ischemic Stroke

PubMed Central

Wang, Huan; Lei, Leix; Zhang, Han-Qing; Gu, Zheng-Tian; Xing, Fang-Lan; Yan, Fu-Ling

2018-01-01

The triglyceride (TG)-to-high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) is a simple approach to predicting unfavorable outcomes in cardiovascular disease. The influence of TG/HDL-C on acute ischemic stroke remains elusive. The purpose of this study was to investigate the precise effect of TG/HDL-C on 3-month mortality after acute ischemic stroke (AIS). Patients with AIS were enrolled in the present study from 2011 to 2017. A total of 1459 participants from a single city in China were divided into retrospective training and prospective test cohorts. Medical records were collected periodically to determine the incidence of fatal events. All participants were followed for 3 months. Optimal cutoff values were determined using X-tile software to separate the training cohort patients into higher and lower survival groups based on their lipid levels. A survival analysis was conducted using Kaplan-Meier curves and a Cox proportional hazards regression model. A total of 1459 patients with AIS (median age 68.5 years, 58.5% male) were analyzed. Univariate Cox regression analysis confirmed that TG/HDL-C was a significant prognostic factor for 3-month survival. X-tile identified 0.9 as an optimal cutoff for TG/HDL-C. In the univariate analysis, the prognosis of the TG/HDL-C >0.9 group was markedly superior to that of TG/HDL-C ≤0.9 group (P<0.001). A multivariate Cox regression analysis showed that TG/HDL-C was independently correlated with a reduced risk of mortality (hazard ratio [HR], 0.39; 95% confidence interval [CI], 0.24-0.62; P<0.001). These results were confirmed in the 453 patients in the test cohort. A nomogram was constructed to predict 3-month case-fatality, and the c-indexes of predictive accuracy were 0.684 and 0.670 in the training and test cohorts, respectively (P<0.01). The serum TG/HDL-C ratio may be useful for predicting short-term mortality after AIS. PMID:29896437

The Short-term Prognostic Value of the Triglyceride-to-high-density Lipoprotein Cholesterol Ratio in Acute Ischemic Stroke.

PubMed

Deng, Qi-Wen; Li, Shuo; Wang, Huan; Lei, Leix; Zhang, Han-Qing; Gu, Zheng-Tian; Xing, Fang-Lan; Yan, Fu-Ling

2018-06-01

The triglyceride (TG)-to-high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) is a simple approach to predicting unfavorable outcomes in cardiovascular disease. The influence of TG/HDL-C on acute ischemic stroke remains elusive. The purpose of this study was to investigate the precise effect of TG/HDL-C on 3-month mortality after acute ischemic stroke (AIS). Patients with AIS were enrolled in the present study from 2011 to 2017. A total of 1459 participants from a single city in China were divided into retrospective training and prospective test cohorts. Medical records were collected periodically to determine the incidence of fatal events. All participants were followed for 3 months. Optimal cutoff values were determined using X-tile software to separate the training cohort patients into higher and lower survival groups based on their lipid levels. A survival analysis was conducted using Kaplan-Meier curves and a Cox proportional hazards regression model. A total of 1459 patients with AIS (median age 68.5 years, 58.5% male) were analyzed. Univariate Cox regression analysis confirmed that TG/HDL-C was a significant prognostic factor for 3-month survival. X-tile identified 0.9 as an optimal cutoff for TG/HDL-C. In the univariate analysis, the prognosis of the TG/HDL-C >0.9 group was markedly superior to that of TG/HDL-C ≤0.9 group (P<0.001). A multivariate Cox regression analysis showed that TG/HDL-C was independently correlated with a reduced risk of mortality (hazard ratio [HR], 0.39; 95% confidence interval [CI], 0.24-0.62; P<0.001). These results were confirmed in the 453 patients in the test cohort. A nomogram was constructed to predict 3-month case-fatality, and the c-indexes of predictive accuracy were 0.684 and 0.670 in the training and test cohorts, respectively (P<0.01). The serum TG/HDL-C ratio may be useful for predicting short-term mortality after AIS.

Comparative kinetic analysis on thermal degradation of some cephalosporins using TG and DSC data

PubMed Central

2013-01-01

Background The thermal decomposition of cephalexine, cefadroxil and cefoperazone under non-isothermal conditions using the TG, respectively DSC methods, was studied. In case of TG, a hyphenated technique, including EGA, was used. Results The kinetic analysis was performed using the TG and DSC data in air for the first step of cephalosporin’s decomposition at four heating rates. The both TG and DSC data were processed according to an appropriate strategy to the following kinetic methods: Kissinger-Akahira-Sunose, Friedman, and NPK, in order to obtain realistic kinetic parameters, even if the decomposition process is a complex one. The EGA data offer some valuable indications about a possible decomposition mechanism. The obtained data indicate a rather good agreement between the activation energy’s values obtained by different methods, whereas the EGA data and the chemical structures give a possible explanation of the observed differences on the thermal stability. A complete kinetic analysis needs a data processing strategy using two or more methods, but the kinetic methods must also be applied to the different types of experimental data (TG and DSC). Conclusion The simultaneous use of DSC and TG data for the kinetic analysis coupled with evolved gas analysis (EGA) provided us a more complete picture of the degradation of the three cephalosporins. It was possible to estimate kinetic parameters by using three different kinetic methods and this allowed us to compare the Ea values obtained from different experimental data, TG and DSC. The thermodegradation being a complex process, the both differential and integral methods based on the single step hypothesis are inadequate for obtaining believable kinetic parameters. Only the modified NPK method allowed an objective separation of the temperature, respective conversion influence on the reaction rate and in the same time to ascertain the existence of two simultaneous steps. PMID:23594763

Conversion of Monogalactosyldiacylglycerols to Triacylglycerols in Ozone-Fumigated Spinach Leaves

PubMed Central

Sakaki, Takeshi; Saito, Kazuki; Kawaguchi, Akihiko; Kondo, Noriaki; Yamada, Mitsuhiro

1990-01-01

Molecular species and fatty acid distribution of triacylglycerol (TG) accumulated in spinach (Spinacia oleracea L.) leaves fumigated with ozone (0.5 microliter per liter) were compared with those of monogalactosyldiacylglycerol (MGDG). Analysis of positional distribution of the fatty acids in MGDG and the accumulated TG by the enzymatic digestion method showed that hexadecatrienoate (16:3) was restricted to sn-2 position of the glycerol backbone in both MGDG and TG, whereas α-linolenate (18:3) was preferentially located at sn-1 position in MGDG, and sn-1 and/or sn-3 positions in TG, suggesting that 1,2-diacylglycerol moieties of MGDG are the direct precursor of TG in ozonefumigated leaves. Further analysis of TG molecular species by argentation chromatography and mass spectrometry showed that TG increased with ozone fumigation consisted of approximately an equal molar ratio of sn-1,3-18:3-2-16:3 and sn-1,2,3-18:3. Because the molecular species of MGDG in spinach leaves is composed of a similar molar ratio of sn-1-18:3-2-16:3 and sn-1,2-18:3, we concluded that MGDG was converted to 1,2-diacylglycerol and acylated with 18:3 to TG in ozone-fumigated spinach leaves. Images Figure 1 PMID:16667777

Tissue transglutaminase regulates focal adhesion kinase/AKT activation by modulating PTEN expression in pancreatic cancer cells.

PubMed

Verma, Amit; Guha, Sushovan; Wang, Huamin; Fok, Jansina Y; Koul, Dimpy; Abbruzzese, James; Mehta, Kapil

2008-04-01

Pancreatic ductal adenocarcinoma (PDAC) progresses rapidly and exhibits profound resistance to treatment. We recently reported that a great majority of PDAC tumors and tumor cell lines express elevated levels of tissue transglutaminase (TG2). Here, we provide first evidence that TG2 expression in PDAC cells results in constitutive activation of focal adhesion kinase/AKT by modulating the expression of the tumor suppressor phosphatase PTEN. Using PDAC cell lines, we determined the effect of TG2 overexpression on PTEN stability and functions. We confirmed the correlation between TG2 expression and PTEN levels in a few (n=51) PDAC tumor samples. We observed that expression of TG2 is inversely correlated with PTEN expression in PDAC cells. Ectopic expression of TG2 inhibited PTEN phosphorylation and promoted its degradation by ubiquitin-proteasomal pathway. Conversely, down-regulation of TG2 by small interfering RNA up-regulated PTEN expression. Clinical relevance of these results was evident in an athymic nude mouse model where down-regulation of endogenous TG2 caused a significant retardation in PDAC xenograft growth. Importantly, the analysis of 51 tumor samples from patients with stage II PDAC revealed that overexpression of TG2 was associated with loss of PTEN expression (P=0.023; odds ratio, 4.1). In multivariate analysis, TG2-mediated loss of PTEN was a prognostic factor for overall survival in patients with stage II pancreatic ductal carcinoma independent of tumor stage/lymph node status and tumor differentiation (P=0.01). TG2 expression in PDAC promotes degradation of PTEN by ubiquitin-proteasomal pathway and results in constitutive activation of focal adhesion kinase/AKT cell survival signaling.

Probing thyroglobulin in undiluted human serum based on pattern recognition and competitive adsorption of proteins

NASA Astrophysics Data System (ADS)

Wang, Ran; Huang, Shuai; Li, Jing; Chae, Junseok

2014-10-01

Thyroglobulin (Tg) is a sensitive indicator of persistent or recurrent differentiated thyroid cancer of follicular cell origin. Detection of Tg in human serum is challenging as bio-receptors, such as anti-Tg, used in immunoassay have relatively weak binding affinity. We engineer sensing surfaces using the competitive adsorption of proteins, termed the Vroman Effect. Coupled with Surface Plasmon Resonance, the "cross-responsive" interactions of Tg on the engineered surfaces produce uniquely distinguishable multiple signature patterns, which are discriminated using Linear Discriminant Analysis. Tg-spiked samples, down to 2 ng/ml Tg in undiluted human serum, are sensitively and selectively discriminated from the control (undiluted human serum).

Transglutaminase 2 expression in acute myeloid leukemia: Association with adhesion molecule expression and leukemic blast motility

PubMed Central

Meyer, Stefan; Ravandi-Kashani, Farhad; Borthakur, Gautam; Coombes, Kevin R.; Zhang, Nianxiang; Kornblau, Steven

2016-01-01

Acute myeloid leukemia (AML) is a heterogenous disease with differential oncogene association, outcome and treatment regimens. Treatment strategies for AML have improved outcome but despite increased molecular biological information AML is still associated with poor prognosis. Proteomic analysis on the effects of a range of leukemogenic oncogenes showed that the protein transglutaminase 2 (TG2) is expressed at greater levels as a consequence of oncogenic transformation. Further analysis of this observation was performed with 511 AML samples using reverse phase proteomic arrays, demonstrating that TG2 expression was higher at relapse than diagnosis in many cases. In addition elevated TG2 expression correlated with increased expression of numerous adhesion proteins and many apoptosis regulating proteins, two processes related to leukemogenesis. TG2 has previously been linked to drug resistance in cancer and given the negative correlation between TG2 levels and peripheral blasts observed increased TG2 levels may lead to the protection of the leukemic stem cell due to increased adhesion/reduced motility. TG2 may therefore form part of a network of proteins that define poor outcome in AML patients and potentially offer a target to sensitize AML stem cells to drug treatment. PMID:23576428

Broadband spectral analysis of non-Debye dielectric relaxation in percolating heterostructures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tuncer, Enis; Bellatar, J; Achour, M E

2011-01-01

In this study, the main features of dielectric relaxation in carbon black epoxy composites are discussed using several types of complementary modelling (i.e., the Cole-Cole phenomenological equation, Jonscher s universal dielectric response, and an approach that relies on a continuous distribution of relaxation times). These methods of characterizing the relaxation were conducted below Tg. Through the numerical model we can obtain the characteristic effective relaxation time and exponents straightforwardly. However, the true relaxation spectrum can be obtained from the distribution of relaxation times calculated from the complex dielectric permittivity. Over the compositional range explored, relaxation occurs by a Vogel-Tammam-Fulcher-like temperaturemore » dependence within the limits of experimental accuracy.« less

Mechanism of lipid mobilization by the small intestine after transport blockade

DOE Office of Scientific and Technical Information (OSTI.GOV)

Halpern, J.; Tso, P.; Mansbach, C.M. II

1988-07-01

The nonionic detergent, Pluronic L-81 (L-81) has been shown to block the transport of intestinal mucosal triacylglycerol (TG) in chylomicrons. This results in large lipid masses within the enterocyte that are greater in diameter than chylomicrons. On removal of L-81, mucosal TG is rapidly mobilized and appears in the lymph. We questioned whether the blocked TG requires partial or complete hydrolysis before its transport. Rats were infused intraduodenally with (3H)glyceryl, (14C)oleoyl trioleate (TO) and 0.5 mg L-81/h for 8 h, followed by 120 mumol/h linoleate for 18 h. Mesenteric lymph was collected and analyzed for TG content and radioactivity. Anmore » HPLC method was developed to separate TG on the basis of its acyl group species. The assumed acyl group composition was confirmed by gas liquid chromatography analysis. TG lymphatic output was low for the first 8 h but increased to 52 mumol/h at the 11th h of infusion (3 h after stopping L-81). 38% of the infused TO was retained in the mucosa after the 8-h infusion. 95% of mucosal TG was TO, 92% of the radioactivity was in TG, and 2.4% of the 14C disintegrations per minute was in fatty acid. HPLC analysis of lymph at 6, 10, 12, and 14.5 h of infusion showed a progressive rise in TG composed of one linoleate and two oleates, to 39%; and in TG composed of two linoleates and one oleate to 20% at 14.5 h of infusion. On a mass basis, however, 80% of the TG acyl groups were oleate. 3H/14C ratios in the various TG acyl group species reflected the decrease in oleate. We conclude that first, unlike liver, most mucosal TG is not hydrolyzed before transport. The mechanism of how the large lipid masses present in mucosal cells after L-81 infusion are converted to the much smaller chylomicrons is unknown. Second, the concomitant infusion of linoleate did not impair lymph TG delivery after L-81 blockade.« less

Pretreatment TG/HDL-C Ratio Is Superior to Triacylglycerol Level as an Independent Prognostic Factor for the Survival of Triple Negative Breast Cancer Patients.

PubMed

Dai, Danian; Chen, Bo; Wang, Bin; Tang, Hailin; Li, Xing; Zhao, Zhiping; Li, Xuan; Xie, Xiaoming; Wei, Weidong

2016-01-01

Previous studies have reported that the triacylglycerol (TG) level and high-density lipoprotein cholesterol (HDL-C) are connected with breast cancer. However, the prognostic utility of the TG level and the TG/HDL-C ratio (THR) as conventional biomarkers in patients with triple negative breast cancer (TNBC) has not been elucidated. In this research, we investigate and compare the predictive value of the pretreatment serum TG level and THR in TNBC patients. We evaluated 221 patients with TNBC who had pretreatment conventional blood biochemical examinations and calculated the THR. Univariate and multivariate logistic regression analyses were used to assess the effect of the TG level and the THR on overall survival (OS) and disease-free survival (DFS). The optimal cutoff values of the TG level and the THR were determined to be 0.935 mmol/L and 0.600, respectively. As shown in a Kaplan-Meier analysis, TNBC patients with a high TG level and THR had shorter OS and DFS than patients in the low-level groups ( p < 0.05). The multivariate analysis suggested that the pretreatment THR level is an independent prognostic factor of OS (HR: 1.935; 95%CI: 1.032-3.629; p = 0.040) in TNBC patients. In conclusion, our data indicate that a high THR is an independent predictor and is superior to the TG level for predicting poor clinical outcomes in TNBC patients.

Physical transformation of niclosamide solvates in pharmaceutical suspensions determined by DSC and TG analysis.

PubMed

de Villiers, M M; Mahlatji, M D; Malan, S F; van Tonder, E C; Liebenberg, W

2004-07-01

This study reports the preparation of four niclosamide solvates and the determination of the stability of the crystal forms in different suspension vehicles by DSC and TG analysis. Thermal analysis showed that the niclosamide solvates were extremely unstable in a PVP-vehicle and rapidly changed to monohydrated crystals. A suspension in propylene glycol was more stable and TG analysis showed that crystal transformation was less rapid. In this vehicle, the crystals transformed to the anhydrate, rather than the monohydrate, since the vehicle was non-aqueous. The TEG-hemisolvate was the most stable in suspension and offered the best possibility of commercial exploitation.

Association between Triglyceride to HDL-C Ratio (TG/HDL-C) and Insulin Resistance in Chinese Patients with Newly Diagnosed Type 2 Diabetes Mellitus.

PubMed

Ren, Xingxing; Chen, Zeng Ai; Zheng, Shuang; Han, Tingting; Li, Yangxue; Liu, Wei; Hu, Yaomin

2016-01-01

To explore the association between the triglyceride to HDL-C ratio (TG/HDL-C) and insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus. Patients with newly diagnosed type 2 diabetes mellitus (272 men and 288 women) were enrolled and divided into three groups according to TG/HDL-C tertiles. Insulin resistance was defined by homeostatic model assessment of insulin resistance (HOMA-IR). Demographic information and clinical characteristics were obtained. Spearman's correlation was used to estimate the association between TG/HDL-C and other variables. Multiple logistic regression analyses were adopted to obtain probabilities of insulin resistance. A receiver operating characteristic analysis was conducted to evaluate the ability of TG/HDL-C to discriminate insulin resistance. TG/HDL-C was associated with insulin resistance in Chinese patients with newly diagnosed T2DM (Spearman's correlation coefficient = 0.21, P < 0.01). Patients in the higher tertiles of TG/HDL-C had significantly higher HOMA-IR values than patients in the lower tertiles [T1: 2.68(1.74-3.70); T2: 2.96(2.29-4.56); T3: 3.09(2.30-4.99)]. Multiple logistic regression analysis showed that TG/HDL-C was significantly associated with HOMA-IR, and patients in the higher TG/HDL-C tertile had a higher OR than those in the lower TG/HDL-C tertile, after adjusting for multiple covariates including indices for central obesity [T1: 1; T2: 4.02(1.86-8.71); T3: 4.30(1.99-9.29)]. Following stratification of waist circumference into quartiles, the effect of TG/HDL-C on insulin resistance remained significant irrespective of waist circumference. TG/HDL-C was associated with insulin resistance independent of waist circumference. Whether it could be a surrogate marker for insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus still needs to be confirmed by more researches.

Application of Fourier-transform infrared (FT-IR) spectroscopy for simple and easy determination of chylomicron-triglyceride and very low density lipoprotein-triglyceride.

PubMed

Sato, Kenichi; Seimiya, Masanori; Kodera, Yoshio; Kitamura, Akihide; Nomura, Fumio

2010-02-01

Fourier-transform infrared (FT-IR) spectroscopy is a simple and reagent-free physicochemical analysis method, and is a potential alternative to more time-consuming and labor-intensive procedures. In this study, we aimed to use FT-IR spectroscopy to determine serum concentrations of chylomicron-triglyceride (TG) and very low density lipoprotein (VLDL)-TG. We analyzed a chylomicron fraction and VLDL fraction, which had been obtained by ultracentrifugation, to search for wavelengths to designate to each fraction. Then, partial least square (PLS) calibrations were developed using a training set of samples, for which TG concentrations had been determined by conventional procedures. Validation was conducted with another set of samples using the PLS model to predict serum TG concentrations on the basis of the samples' IR spectra. We analyzed a total of 150 samples. Serum concentrations of chylomicron-TG and VLDL-TG estimated by FT-IR spectroscopy agreed well with those obtained by the reference method (r=0.97 for both lipoprotein fractions). FT-IR spectrometric analysis required 15mul of serum and was completed within 1min. Serum chylomicron-TG and VLDL-TG concentrations can be determined with FT-IR spectroscopy. This rapid and simple test may have a great impact on the management of patients with dyslipidemia. Copyright 2009. Published by Elsevier B.V.

Production of transgenic pigs using a pGFAP-CreERT2/EGFP LoxP inducible system for central nervous system disease models.

PubMed

Hwang, Seon-Ung; Eun, Kiyoung; Yoon, Junchul David; Kim, Hyunggee; Hyun, Sang-Hwan

2018-05-31

Transgenic (TG) pigs are important in biomedical research and are used in disease modeling, pharmaceutical toxicity testing, and regenerative medicine. In this study, we constructed two vector systems by using the promoter of the pig glial fibrillary acidic protein ( pGFAP ) gene, which is an astrocyte cell marker. We established donor TG fibroblasts with pGFAP-CreER T2 /LCMV-EGFP LoxP and evaluated the effect of the transgenes on TG-somatic cell nuclear transfer (SCNT) embryo development. Cleavage rates were not significantly different between control and transgene-donor groups. Embryo transfer was performed thrice just before ovulation of the surrogate sows. One sow delivered 5 TG piglets at 115 days after pregnancy. Polymerase chain reaction (PCR) analysis with genomic DNA isolated from skin tissues of TG pigs revealed that all 5 TG pigs had the transgenes. EGFP expression in all organs tested was confirmed by immunofluorescence staining and PCR. Real-time PCR analysis showed that pGFAP promoter-driven Cre fused to the mutated human ligand-binding domain of the estrogen receptor ( CreER T2 ) mRNA was highly expressed in the cerebrum. Semi-nested PCR analysis revealed that CreER T2 -mediated recombination was induced in cerebrum and cerebellum but not in skin. Thus, we successfully generated a TG pig with a 4-hydroxytamoxifen (TM)-inducible pGFAP-CreER T2 /EGFP LoxP recombination system via SCNT.

Clinical applicability of Tokyo guidelines 2018/2013 in diagnosis and severity evaluation of acute cholangitis and determination of a new severity model.

PubMed

Gravito-Soares, Elisa; Gravito-Soares, Marta; Gomes, Dário; Almeida, Nuno; Tomé, Luís

2018-03-01

To determine the diagnostic accuracy of Tokyo guidelines (TG) 2018/2013 (TG18/TG13) and predictors of poor prognosis in acute cholangitis. Retrospective 1-year study of consecutive hospital admissions for acute cholangitis. Prognosis was defined in terms of 30 d in-hospital mortality. Of the 183 patients with acute cholangitis, diagnostic accuracy based on Charcot's triad, TG07 and TG18/TG13 was 67.8, 86.9 and 92.3% (p < .001), respectively. Regarding severity based on TG18/TG13, 30.6% of cases were severe. A poor prognosis was found in 10.9% of patients. After multivariate analysis, systolic blood pressure <90 mmHg (OR 11.010; p < .001), serum albumin <3 g/dL (OR 1.355; p = .006), active oncology disease (OR 3.818; p = .006) and malignant aetiology of obstructive jaundice (OR 2.224; p = .021) were independent predictors of poor prognosis. The discriminative ability of the model with these four variables was high (AUROC 0.842; p < .001), being superior to TG18/TG13 (AUROC 0.693; p = .005). TG18/TG13 showed high diagnostic accuracy in acute cholangitis. Compared with TG18/TG13, the simplified severity model ≥2 allows easy selection of patients who will benefit from admission to the intensive care unit and early biliary decompression.

Brain and Brown Adipose Tissue Metabolism in Transgenic Tg2576 Mice Models of Alzheimer Disease Assessed Using 18F-FDG PET Imaging

PubMed Central

Coleman, Robert A.; Liang, Christopher; Patel, Rima; Ali, Sarah

2017-01-01

Objective: Imaging animal models of Alzheimer disease (AD) is useful for the development of therapeutic drugs and understanding AD. Transgenic Swedish hAPPswe Tg2576 mice are a good model of β-amyloid plaques. We report 18F-fluoro-2-deoxyglucose (18F-FDG) positron emission tomography (PET) imaging of brain and intrascapular brown adipose tissue (IBAT) in transgenic mice 2576 (Tg2576) and wild-type (WT) mice. Methods: Transgenic Tg2576 mice and WT mice, >18 months were injected intraperitonally with ≈ 25 to 30 MBq 18F-FDG while awake. After 60 minutes, they were anesthetized with isoflurane (2.5%) and imaged with Inveon MicroPET. Select mice were killed, imaged ex vivo, and 20 µm sections cut for autoradiography. 18F-FDG uptake in brain and IBAT PET and brain autoradiographs were analyzed. Results: Fasting blood glucose levels averaged 120 mg/dL for WT and 100 mg/dL for Tg2576. Compared to WT, Tg2576 mice exhibited a decrease in SUVglc in the various brain regions. Average reductions in the cerebrum regions were as high as −20%, while changes in cerebellum were −3%. Uptake of 18F-FDG in IBAT decreased by −60% in Tg2576 mice and was found to be significant. Intrascapular brown adipose tissue findings in Tg2576 mice are new and not previously reported. Use of blood glucose for PET data analysis and corpus callosum as reference region for autoradiographic analysis were important to detect change in Tg2576 mice. Conclusion: Our results suggest that 18F-FDG uptake in the Tg2576 mice brain show 18F-FDG deficits only when blood glucose is taken into consideration. PMID:28654383

The use of tibial tuberosity-trochlear groove indices based on joint size in lower limb evaluation.

PubMed

Ferlic, Peter Wilhelm; Runer, Armin; Dirisamer, Florian; Balcarek, Peter; Giesinger, Johannes; Biedermann, Rainer; Liebensteiner, Michael Christian

2018-05-01

The correlation between tibial tuberosity-trochlear groove distance (TT-TG) and joint size, taking into account several different parameters of knee joint size as well as lower limb dimensions, is evaluated in order to assess whether TT-TG indices should be used in instead of absolute TT-TG values. This study comprised a retrospective analysis of knee CT scans, including 36 cases with patellofemoral instability (PFI) and 30 controls. Besides TT-TG, five measures of knee joint size were evaluated in axial CT slices: medio-lateral femur width, antero-posterior lateral condylar height, medio-lateral width of the tibia, width of the patella and the proximal-distal joint size (TT-TE). Furthermore, the length of the femur, the tibia and the total leg length were measured in the CT scanogram. Correlation analysis of TT-TG and the other parameters was done by calculating the Spearman correlation coefficient. In the PFI group lateral condylar height (r = 0.370), tibia width (r = 0.406) and patella width (r = 0.366) showed significant moderate correlations (p < 0.03) with TT-TG. Furthermore, we found a significant correlation between TT-TG and tibia length (r = 0.371) and total leg length (r = 381). The control group showed no significant correlation between TT-TG and knee joint size or between TT-TG and measures of lower limb length. Tibial tuberosity-trochlear groove distance correlates with several parameters of knee joint size and leg length in patients with patellofemoral instability. Application of indices determining TT-TG as a ratio of joint size could be helpful in establishing the indication for medial transfer of the tibial tuberosity in patients with PFI. Level III.

Structural characterization and Hirshfeld surface analysis of racemic baclofen

NASA Astrophysics Data System (ADS)

Maniukiewicz, Waldemar; Oracz, Monika; Sieroń, Lesław

2016-11-01

The crystal structure of baclofen, (R,S) [4-amino-3-(4-chlorophenyl)butanoic acid], (C10H12ClNO2, Mr = 213.66) has been determined by single crystal X-ray diffraction analysis. The title compound crystallizes in the orthorhombic space group Pbca (No. 61) with a = 9.2704(5), b = 7.0397(4), c = 30.4015(15) Å, V = 1984.0(2) Å3 and Z = 8. The molecules exist as zwitterions, adopting a gauche conformation with respect to the Cαsbnd Cβ bond, and held in a cross-linked chain arrangement by strong Nsbnd H⋯O hydrogen bonds and Csbnd Cl⋯π interactions. The electrostatic molecular potential as well as the intermolecular interactions of the title compound were analyzed by the Hirshfeld surfaces. The FT-IR spectrum is also reported. The DTA, TG and DTG results indicate that baclofen is stable up to 205 °C.

N-propyl nitrate vibrational spectrum analysis using DFT B3LYP quantum-chemical method

NASA Astrophysics Data System (ADS)

Shaikhullina, R. M.; Hrapkovsky, G. M.; Shaikhullina, M. M.

2018-05-01

Calculation of a molecular structure, conformation and related vibrational spectra of the n- propyl nitrate C3H7NO3 was carried out by means of density functional theory (DFT) by employing the Gaussian 03 package. The molecular geometries were fully optimized by using the Becker's three-parameter hybrid exchange functional combined with the Lee–Yang–Parr correlation functional (B3LYP) and using the 6-31G(d) basis set. By scanning the dihedral angles around C-O and C-C bonds, five energetically most favorable conformers of n-propyl nitrate - TG, TT, GT, GG and G´G forms were found. Vibrational spectra of the most energetically favorable conformers were calculated. The comparative analysis of calculated and experimental spectra is carried out, the spectral features of the conformational state of n-propyl nitrate and the spectral effects of formation of intramolecular hydrogen bonds are established.

Cost-utility analysis of a telehealth programme for patients with severe chronic obstructive pulmonary disease treated with long-term oxygen therapy.

PubMed

Jódar-Sánchez, Francisco; Ortega, Francisco; Parra, Carlos; Gómez-Suárez, Cristina; Bonachela, Patricia; Leal, Sandra; Pérez, Pablo; Jordán, Ana; Barrot, Emilia

2014-09-01

We conducted a cost-utility analysis of a telehealth programme for patients with severe chronic obstructive pulmonary disease (COPD) compared with usual care. A randomized controlled trial was carried out over four months with 45 patients treated with long-term oxygen therapy, 24 in the telehealth group (TG) and 21 in the control group (CG). The analysis took into account whether the severity of comorbidity (defined as the presence of additional chronic diseases co-occurring with COPD) was associated with differences in costs and/or quality-adjusted life years (QALYs). Results of cost-utility analysis were expressed in terms of the incremental cost-effectiveness ratio (ICER). The average total cost was €2300 for the TG and €1103 for the CG, and the average QALY gain was 0.0059 for the TG and 0.0006 for the CG (resulting an ICER of 223,726 €/QALY). For patients without comorbidity, the average total cost was €855 for the TG and €1354 for the CG, and the average QALY gain was 0.0288 for the TG and 0.0082 for the CG (resulting in the telehealth programme being the dominant strategy). For patients with comorbidity, the average total cost was €2782 for the TG and €949 for the CG, and the average QALY gain was -0.0017 for the TG and -0.0041 for the CG (resulting an ICER of 754,592 €/QALY). The telehealth programme may not have been cost-effective compared to usual care, although it could be considered cost-effective for patients without comorbidity. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Thioredoxin-1 attenuates sepsis-induced cardiomyopathy after cecal ligation and puncture in mice.

PubMed

Wilson, Rickesha L; Selvaraju, Vaithinathan; Lakshmanan, Rajesh; Thirunavukkarasu, Mahesh; Campbell, Jacob; McFadden, David W; Maulik, Nilanjana

2017-12-01

Sepsis is a leading cause of mortality among patients in intensive care units across the USA. Thioredoxin-1 (Trx-1) is an essential 12 kDa cytosolic protein that, apart from maintaining the cellular redox state, possesses multifunctional properties. In this study, we explored the possibility of controlling adverse myocardial depression by overexpression of Trx-1 in a mouse model of severe sepsis. Adult C57BL/6J and Trx-1 Tg/+ mice were divided into wild-type sham (WTS), wild-type cecal ligation and puncture (WTCLP), Trx-1 Tg/+ sham (Trx-1 Tg/+ S), and Trx-1 Tg/+ CLP groups. Cardiac function was evaluated before surgery, 6 and 24 hours after CLP surgery. Immunohistochemical and Western blot analysis were performed after 24 hours in heart tissue sections. Echocardiography analysis showed preserved cardiac function in the Trx-1 Tg/+ CLP group compared with the WTCLP group. Similarly, Western blot analysis revealed increased expression of Trx-1, heme oxygenase-1 (HO-1), survivin (an inhibitor of apoptosis [IAP] protein family), and decreased expression of thioredoxin-interacting protein (TXNIP), caspase-3, and 3- nitrotyrosine in the Trx-1 Tg/+ CLP group compared with the WTCLP group. Immunohistochemical analysis showed reduced 4-hydroxynonenal, apoptosis, and vascular leakage in the cardiac tissue of Trx-1 Tg/+ CLP mice compared with mice in the WTCLP group. Our results indicate that overexpression of Trx-1 attenuates cardiac dysfunction during CLP. The mechanism of action may involve reduction of oxidative stress, apoptosis, and vascular permeability through activation of Trx-1/HO-1 and anti-apoptotic protein survivin. Copyright © 2017 Elsevier Inc. All rights reserved.

Spectral, thermal, kinetic, molecular modeling and eukaryotic DNA degradation studies for a new series of albendazole (HABZ) complexes

NASA Astrophysics Data System (ADS)

El-Metwaly, Nashwa M.; Refat, Moamen S.

2011-01-01

This work represents the elaborated investigation for the ligational behavior of the albendazole ligand through its coordination with, Cu(II), Mn(II), Ni(II), Co(II) and Cr(III) ions. Elemental analysis, molar conductance, magnetic moment, spectral studies (IR, UV-Vis and ESR) and thermogravimetric analysis (TG and DTG) have been used to characterize the isolated complexes. A deliberate comparison for the IR spectra reveals that the ligand coordinated with all mentioned metal ions by the same manner as a neutral bidentate through carbonyl of ester moiety and NH groups. The proposed chelation form for such complexes is expected through out the preparation conditions in a relatively acidic medium. The powder XRD study reflects the amorphous nature for the investigated complexes except Mn(II). The conductivity measurements reflect the non-electrolytic feature for all complexes. In comparing with the constants for the magnetic measurements as well as the electronic spectral data, the octahedral structure was proposed strongly for Cr(III) and Ni(II), the tetrahedral for Co(II) and Mn(II) complexes but the square-pyramidal for the Cu(II) one. The thermogravimetric analysis confirms the presence or absence of water molecules by any type of attachments. Also, the kinetic parameters are estimated from DTG and TG curves. ESR spectrum data for Cu(II) solid complex confirms the square-pyramidal state is the most fitted one for the coordinated structure. The albendazole ligand and its complexes are biologically investigated against two bacteria as well as their effective effect on degradation of calf thymus DNA.

Evidence for a gene influencing the TG/HDL-C ratio on chromosome 7q32.3-qter: a genome-wide scan in the Framingham study.

PubMed

Shearman, A M; Ordovas, J M; Cupples, L A; Schaefer, E J; Harmon, M D; Shao, Y; Keen, J D; DeStefano, A L; Joost, O; Wilson, P W; Housman, D E; Myers, R H

2000-05-22

Some studies show that plasma triglyceride (TG) levels are a significant independent risk factor for cardiovascular disease (CVD). TG levels are inversely correlated with high density lipoprotein cholesterol (HDL-C) levels, and their metabolism may be closely interrelated. Therefore, the TG/HDL-C ratio may be a relevant CVD risk factor. Our analysis of families in the Framingham Heart Study gave a genetic heritability estimate for log(TG) of 0.40 and for log(TG/HDL-C) of 0.49, demonstrating an important genetic component for both. A 10 cM genome-wide scan for log(TG) level and log(TG/HDL-C) was carried out for the largest 332 extended families of the Framingham Heart Study (1702 genotyped individuals). The highest multipoint variance component LOD scores obtained for both log(TG) and log(TG/HDL-C) were on chromosome 7 (at 155 cM), where the results for the two phenotypes were 1.8 and 2.5, respectively. The 7q32.3-qter region contains several candidate genes. Four other regions with multipoint LOD scores greater than one were identified on chromosome 3 [LOD score for log(TG/HDL-C) = 1.8 at 140 cM], chromosome 11 [LOD score for log(TG/HDL-C) = 1.1 at 125 cM], chromosome 16 [LOD score for log(TG) = 1.5 at 70 cM, LOD score for log(TG/HDL-C) = 1.1 at 75 cM] and chromosome 20 [LOD score for log(TG/HDL-C) = 1.7 at 35 cM, LOD score for log(TG) = 1.3 at 40 cM]. These results identify loci worthy of further study.

The Relationship between the Triglyceride to High-Density Lipoprotein Cholesterol Ratio and Metabolic Syndrome.

PubMed

Shin, Hyun-Gyu; Kim, Young-Kwang; Kim, Yong-Hwan; Jung, Yo-Han; Kang, Hee-Cheol

2017-11-01

Metabolic syndrome is associated with cardiovascular diseases and is characterized by insulin resistance. Recent studies suggest that the triglyceride/high-density lipoprotein cholesterol (TG/HDLC) ratio predicts insulin resistance better than individual lipid levels, including TG, total cholesterol, low-density lipoprotein cholesterol (LDLC), or HDLC. We aimed to elucidate the relationship between the TG/HDLC ratio and metabolic syndrome in the general Korean population. We evaluated the data of adults ≥20 years old who were enrolled in the Korean National Health and Nutrition Examination Survey in 2013 and 2014. Subjects with angina pectoris, myocardial infarction, stroke, or cancer were excluded. Metabolic syndrome was defined by the harmonized definition. We examined the odds ratios (ORs) of metabolic syndrome according to TG/HDLC ratio quartiles using logistic regression analysis (SAS ver. 9.4; SAS Institute Inc., Cary, NC, USA). Weighted complex sample analysis was also conducted. We found a significant association between the TG/HDLC ratio and metabolic syndrome. The cutoff value of the TG/HDLC ratio for the fourth quartile was ≥3.52. After adjustment, the OR for metabolic syndrome in the fourth quartile compared with that of the first quartile was 29.65 in men and 20.60 in women (P<0.001). The TG/HDLC ratio is significantly associated with metabolic syndrome.

Fasting Lipoprotein Lipase Protein Levels Can Predict a Postmeal Increment of Triglyceride Levels in Fasting Normohypertriglyceridemic Subjects.

PubMed

Tsuzaki, Kokoro; Kotani, Kazuhiko; Yamada, Kazunori; Sakane, Naoki

2016-09-01

Although a postprandial increment in triglyceride (TG) levels is considered to be a risk factor for atherogenesis, tests (e.g., fat load) to assess postprandial changes in TG levels cannot be easily applied to clinical practice. Therefore, fasting markers that predict postprandial TG states are needed to be developed. One current candidate is lipoprotein lipase (LPL) protein, a molecule that hydrides TGs. This study investigated whether fasting LPL levels could predict postprandial TG levels. A total of 17 subjects (11 men, 6 women, mean age 52 ± 11 years) with normotriglyceridemia during fasting underwent the meal test. Several fasting parameters, including LPL, were measured for the area under the curve of postprandial TGs (AUC-TG). The subjects' mean fasting TG level was 1.30 mmol/l, and their mean LPL level was 41.6 ng/ml. The subjects' TG levels increased after loading (they peaked after two postprandial hours). Stepwise multiple regression analysis demonstrated that fasting TG levels were a predictor of the AUC-TG. In addition, fasting LPL mass levels were found to be a predictor of the AUC-TG (β = 0.65, P < 0.01), and this relationship was independent of fasting TG levels. Fasting LPL levels may be useful to predict postprandial TG increment in this population. © 2015 Wiley Periodicals, Inc.

Biosynthesis of silver nanoparticles using Alternanthera sessilis (Linn.) extract and their antimicrobial, antioxidant activities.

PubMed

Niraimathi, K L; Sudha, V; Lavanya, R; Brindha, P

2013-02-01

The present work focuses the use of the aqueous extract of Alternanthera sessilis Linn. (Amaranthaceae) in producing silver nanoparticles (AgNPs) from silver nitrate aqueous. Phytochemical analysis of the extract revealed the presence of alkaloid, tannins, ascorbic acid, carbohydrates and proteins and they serve as effective reducing and capping agents for converting silver nitrate into nanoparticles. The synthesized silver nanoparticles (AgNPs) were also tested for proteins and ascorbic acid. Its pH was also determined (5.63). The AgNPs obtained was characterized by UV-vis spectroscopy, FT-IR spectroscopy, SEM, Zeta sizer and TG-DSC. SEM images which revealed the presence of various shapes and sizes. FT-IR spectrum showed the AgNPs having a coating of proteins indicating a dual role of bio-molecules responsible for capping and efficient stabilization of the silver nanoparticles. Presence of impurities and melting point profile were screened by TG-DSC analyzer. AgNPs were synthesized from the silver nitrate through the reducing power of ascorbic acid present in A. sessilis leaves. In this study, we also investigated antimicrobial and antioxidant activity of green synthesized AgNPs. The antimicrobial activity is investigated by Bauer et al.'s method. Antioxidant activity was done by DPPH method. Copyright © 2012 Elsevier B.V. All rights reserved.

The Contribution of GWAS Loci in Familial Dyslipidemias

PubMed Central

Söderlund, Sanni; Surakka, Ida; Matikainen, Niina; Pirinen, Matti; Pajukanta, Päivi; Service, Susan K.; Laurila, Pirkka-Pekka; Ehnholm, Christian; Salomaa, Veikko; Wilson, Richard K.; Palotie, Aarno; Freimer, Nelson B.; Taskinen, Marja-Riitta; Ripatti, Samuli

2016-01-01

Familial combined hyperlipidemia (FCH) is a complex and common familial dyslipidemia characterized by elevated total cholesterol and/or triglyceride levels with over five-fold risk of coronary heart disease. The genetic architecture and contribution of rare Mendelian and common variants to FCH susceptibility is unknown. In 53 Finnish FCH families, we genotyped and imputed nine million variants in 715 family members with DNA available. We studied the enrichment of variants previously implicated with monogenic dyslipidemias and/or lipid levels in the general population by comparing allele frequencies between the FCH families and population samples. We also constructed weighted polygenic scores using 212 lipid-associated SNPs and estimated the relative contributions of Mendelian variants and polygenic scores to the risk of FCH in the families. We identified, across the whole allele frequency spectrum, an enrichment of variants known to elevate, and a deficiency of variants known to lower LDL-C and/or TG levels among both probands and affected FCH individuals. The score based on TG associated SNPs was particularly high among affected individuals compared to non-affected family members. Out of 234 affected FCH individuals across the families, seven (3%) carried Mendelian variants and 83 (35%) showed high accumulation of either known LDL-C or TG elevating variants by having either polygenic score over the 90th percentile in the population. The positive predictive value of high score was much higher for affected FCH individuals than for similar sporadic cases in the population. FCH is highly polygenic, supporting the hypothesis that variants across the whole allele frequency spectrum contribute to this complex familial trait. Polygenic SNP panels improve identification of individuals affected with FCH, but their clinical utility remains to be defined. PMID:27227539

Polycyclovorans algicola gen. nov., sp. nov., an aromatic-hydrocarbon-degrading marine bacterium found associated with laboratory cultures of marine phytoplankton.

PubMed

Gutierrez, Tony; Green, David H; Nichols, Peter D; Whitman, William B; Semple, Kirk T; Aitken, Michael D

2013-01-01

A strictly aerobic, halotolerant, rod-shaped bacterium, designated strain TG408, was isolated from a laboratory culture of the marine diatom Skeletonema costatum (CCAP1077/1C) by enrichment with polycyclic aromatic hydrocarbons (PAHs) as the sole carbon source. 16S rRNA gene sequence analysis placed this organism within the order Xanthomonadales of the class Gammaproteobacteria. Its closest relatives included representatives of the Hydrocarboniphaga-Nevskia-Sinobacter clade (<92% sequence similarity) in the family Sinobacteraceae. The strain exhibited a narrow nutritional spectrum, preferring to utilize aliphatic and aromatic hydrocarbon compounds and small organic acids. Notably, it displayed versatility in degrading two- and three-ring PAHs. Moreover, catechol 2,3-dioxygenase activity was detected in lysates, indicating that this strain utilizes the meta-cleavage pathway for aromatic compound degradation. Cells produced surface blebs and contained a single polar flagellum. The predominant isoprenoid quinone of strain TG408 was Q-8, and the dominant fatty acids were C(16:0), C(16:1) ω7c, and C(18:1) ω7c. The G+C content of the isolate's DNA was 64.3 mol% ± 0.34 mol%. On the basis of distinct phenotypic and genotypic characteristics, strain TG408 represents a novel genus and species in the class Gammaproteobacteria for which the name Polycyclovorans algicola gen. nov., sp. nov., is proposed. Quantitative PCR primers targeting the 16S rRNA gene of this strain were developed and used to show that this organism is found associated with other species of marine phytoplankton. Phytoplankton may be a natural biotope in the ocean where new species of hydrocarbon-degrading bacteria await discovery and which contribute significantly to natural remediation processes.

Identification of the key molecules involved in chronic copper exposure-aggravated memory impairment in transgenic mice of Alzheimer's disease using proteomic analysis.

PubMed

Yu, Jun; Luo, Xiaobin; Xu, Hua; Ma, Quan; Yuan, Jianhui; Li, Xuling; Chang, Raymond Chuen-Chung; Qu, Zhongsen; Huang, Xinfeng; Zhuang, Zhixiong; Liu, Jianjun; Yang, Xifei

2015-01-01

Alzheimer's disease (AD) is the most common neurodegenerative disease characterized by a progressive impairment of cognitive functions including spatial learning and memory. Excess copper exposure accelerates the development of AD; however, the potential mechanisms by which copper exacerbates the symptoms of AD remain unknown. In this study, we explored the effects of chronic copper exposure on cognitive function by treating 6 month-old triple AD transgenic (3xTg-AD) mice with 250 ppm copper sulfate in drinking water for 6 months, and identified several potential key molecules involved in the effects of chronic copper exposure on memory by proteomic analysis. The behavioral test showed that chronic copper exposure aggravated memory impairment of 3xTg-AD mice. Two-dimensional fluorescence difference gel electrophoresis (2D-DIGE) coupled with mass spectrometry revealed a total of 44 differentially expressed proteins (18 upregulated and 26 down-regulated) in hippocampus between the wild-type (WT) mice and non-exposed 3xTg-AD mice. A total of 40 differentially expressed proteins were revealed (20 upregulated and 20 down-regulated) in hippocampus between copper exposed and non-exposed 3xTg-AD mice. Among these differentially expressed proteins, complexin-1 and complexin-2, two memory associated proteins, were significantly decreased in hippocampus of 3xTg-AD mice compared with the WT mice. Furthermore, the expression of these two proteins was further down-regulated in 3xTg-AD mice when exposed to copper. The abnormal expression of complexin-1 and complexin-2 identified by proteomic analysis was verified by western blot analysis. Taken together, our data showed that chronic copper exposure accelerated memory impairment and altered the expression of proteins in hippocampus in 3xTg-AD mice. The functional analysis on the differentially expressed proteins suggested that complexin-1 and complexin-2 may be the key molecules involved in chronic copper exposure-aggravated memory impairment in AD.

Phosphorylation of p38 in Trigeminal Ganglion Neurons Contributes to Tongue Heat Hypersensitivity in Mice.

PubMed

Maruno, Mitsuru; Shinoda, Masamichi; Honda, Kuniya; Ito, Reio; Urata, Kentaro; Watanabe, Masahiro; Okada, Shinji; Lee, Jun; Gionhaku, Nobuhito; Iwata, Koichi

2017-01-01

To develop a tongue pain model with no mucosal pathologic changes and to examine whether phosphorylation of p38 in trigeminal ganglion (TG) neurons innervating the tongue is associated with tongue heat hypersensitivity in mice. Tongue heat sensitivity in mice was assessed following application of the irritant 2,4,6-trinitrobenzene sulfonic acid (TNBS) to the tongue. After TNBS application, the expressions of p38, phosphorylated p38 (pp38), and transient receptor potential vanilloid 1 (TRPV1) were examined in TG neurons innervating the tongue. To further assess changes in tongue heat sensitivity and TRPV1 expression, a specific inhibitor of p38 phosphorylation (SB203580) was also administered into the TG. Student t test or two-way repeated-measures analysis of variance followed by Sidak multiple comparison test were used for statistical analysis, and P < .05 was considered statistically significant. TNBS application to the tongue induced noninflammatory heat hypersensitivity accompanied by the enhancement of p38 phosphorylation in TG neurons innervating the tongue and by an increase in the number of TRPV1 and pp38-immunoreactive (IR) TG neurons innervating the tongue. Intra-TG administration of SB203580 suppressed the increase in the TRPV1 and pp38-IR TG neurons and alleviated the noninflammatory tongue heat hypersensitivity induced by TNBS. p38 signaling cascades are involved in tongue heat hyperalgesia in association with TRPV1 upregulation in TG neurons innervating the TNBS-treated tongue.

Sol-gel synthesis and characterizations of crystalline NaGd(WO4)2 powder for anisotropic transparent ceramic laser application

NASA Astrophysics Data System (ADS)

Durairajan, A.; Thangaraju, D.; Balaji, D.; Moorthy Babu, S.

2013-02-01

NaGd(WO4)2 powders were synthesized at different pH (3.5, 4.5, 5.5, 6.5 and 7.5) values by conventional Pechini method. Sodium and gadolinium nitrate salts and ammonium paratungstate are used as starting precursors. Metal cations were chelated by citric acid and individual citrates were bound together with ethylene glycol. Synthesized gel was analyzed using differential thermal analysis (DTA), thermo gravimetric (TG) and FT-IR spectroscopy to understand the degradation of gel and formation of metal citrates. Calcined powders (250, 600, 700 and 800 °C) were characterized by powder XRD, FT-IR, Raman and FE-SEM analysis. The temperature dependent phase formation was examined by powder XRD. The morphological changes at different pH derived powders were observed with FE-SEM micrographs. Stepwise organic liberation with respect to temperature and presence of carbon content in the pre-fired powder were analyzed using FT-IR analysis. Raman spectrum reveals disordered tungstate vibrations in the NGW matrix.

Genome-wide meta-analysis identifies novel gender specific loci associated with thyroid antibodies level in Croatians.

PubMed

Matana, Antonela; Popović, Marijana; Boutin, Thibaud; Torlak, Vesela; Brdar, Dubravka; Gunjača, Ivana; Kolčić, Ivana; Boraska Perica, Vesna; Punda, Ante; Polašek, Ozren; Hayward, Caroline; Barbalić, Maja; Zemunik, Tatijana

2018-04-18

Autoimmune thyroid diseases (AITD) are multifactorial endocrine diseases most frequently accompanied by Tg and TPO autoantibodies. Both antibodies have a higher prevalence in females and act under a strong genetic influence. To identify novel variants underlying thyroid antibody levels, we performed GWAS meta-analysis on the plasma levels of TgAb and TPOAb in three Croatian cohorts, as well as gender specific GWAS and a bivariate analysis. No significant association was detected with the level of TgAb and TPOAb in the meta-analysis of GWAS or bivariate results for all individuals. The bivariate analysis in females only revealed a genome-wide significant association for the locus near GRIN3A (rs4457391, P = 7.76 × 10 -9 ). The same locus had borderline association with TPOAb levels in females (rs1935377, P = 8.58 × 10 -8 ). In conclusion, we identified a novel gender specific locus associated with TgAb and TPOAb levels. Our findings provide a novel insight into genetic and gender differences associated with thyroid antibodies. Copyright © 2018 Elsevier Inc. All rights reserved.

Low-dose proton radiation effects in a transgenic mouse model of Alzheimer's disease - Implications for space travel.

PubMed

Rudobeck, Emil; Bellone, John A; Szücs, Attila; Bonnick, Kristine; Mehrotra-Carter, Shalini; Badaut, Jerome; Nelson, Gregory A; Hartman, Richard E; Vlkolinský, Roman

2017-01-01

Space radiation represents a significant health risk for astronauts. Ground-based animal studies indicate that space radiation affects neuronal functions such as excitability, synaptic transmission, and plasticity, and it may accelerate the onset of Alzheimer's disease (AD). Although protons represent the main constituent in the space radiation spectrum, their effects on AD-related pathology have not been tested. We irradiated 3 month-old APP/PSEN1 transgenic (TG) and wild type (WT) mice with protons (150 MeV; 0.1-1.0 Gy; whole body) and evaluated functional and biochemical hallmarks of AD. We performed behavioral tests in the water maze (WM) before irradiation and in the WM and Barnes maze at 3 and 6 months post-irradiation to evaluate spatial learning and memory. We also performed electrophysiological recordings in vitro in hippocampal slices prepared 6 and 9 months post-irradiation to evaluate excitatory synaptic transmission and plasticity. Next, we evaluated amyloid β (Aβ) deposition in the contralateral hippocampus and adjacent cortex using immunohistochemistry. In cortical homogenates, we analyzed the levels of the presynaptic marker synaptophysin by Western blotting and measured pro-inflammatory cytokine levels (TNFα, IL-1β, IL-6, CXCL10 and CCL2) by bead-based multiplex assay. TG mice performed significantly worse than WT mice in the WM. Irradiation of TG mice did not affect their behavioral performance, but reduced the amplitudes of population spikes and inhibited paired-pulse facilitation in CA1 neurons. These electrophysiological alterations in the TG mice were qualitatively different from those observed in WT mice, in which irradiation increased excitability and synaptic efficacy. Irradiation increased Aβ deposition in the cortex of TG mice without affecting cytokine levels and increased synaptophysin expression in WT mice (but not in the TG mice). Although irradiation with protons increased Aβ deposition, the complex functional and biochemical results indicate that irradiation effects are not synergistic to AD pathology.

Association between Triglyceride to HDL-C Ratio (TG/HDL-C) and Insulin Resistance in Chinese Patients with Newly Diagnosed Type 2 Diabetes Mellitus

PubMed Central

Ren, Xingxing; Chen, Zeng.ai; Zheng, Shuang; Han, Tingting; Li, Yangxue; Liu, Wei; Hu, Yaomin

2016-01-01

Objectives To explore the association between the triglyceride to HDL-C ratio (TG/HDL-C) and insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus. Methods Patients with newly diagnosed type 2 diabetes mellitus (272 men and 288 women) were enrolled and divided into three groups according to TG/HDL-C tertiles. Insulin resistance was defined by homeostatic model assessment of insulin resistance (HOMA-IR). Demographic information and clinical characteristics were obtained. Spearman’s correlation was used to estimate the association between TG/HDL-C and other variables. Multiple logistic regression analyses were adopted to obtain probabilities of insulin resistance. A receiver operating characteristic analysis was conducted to evaluate the ability of TG/HDL-C to discriminate insulin resistance. Results TG/HDL-C was associated with insulin resistance in Chinese patients with newly diagnosed T2DM (Spearman’s correlation coefficient = 0.21, P < 0.01). Patients in the higher tertiles of TG/HDL-C had significantly higher HOMA-IR values than patients in the lower tertiles [T1: 2.68(1.74–3.70); T2: 2.96(2.29–4.56); T3: 3.09(2.30–4.99)]. Multiple logistic regression analysis showed that TG/HDL-C was significantly associated with HOMA-IR, and patients in the higher TG/HDL-C tertile had a higher OR than those in the lower TG/HDL-C tertile, after adjusting for multiple covariates including indices for central obesity [T1: 1; T2: 4.02(1.86–8.71); T3: 4.30(1.99–9.29)]. Following stratification of waist circumference into quartiles, the effect of TG/HDL-C on insulin resistance remained significant irrespective of waist circumference. Conclusions TG/HDL-C was associated with insulin resistance independent of waist circumference. Whether it could be a surrogate marker for insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus still needs to be confirmed by more researches. PMID:27115999

Synthesis, crystal structure and DFT studies of a dual fluorescent ketamine: Structural changes in the ground and excited states

NASA Astrophysics Data System (ADS)

Latha, V.; Balakrishnan, C.; Neelakantan, M. A.

2015-07-01

A fluorescent probe 2Z,2‧Z-3,3‧-(4,4‧-methylenebis(4,1-phenylene) bis(azanediyl))bis (1,3-diphenylprop-2-en-1-one) (L) was synthesized and characterized by IR, 1H NMR, ESI-mass, UV-visible and fluorescence spectral techniques. The single crystal analysis illustrates the existence of L in ketamine form. The crystal structure is stabilized by intramolecular and intermolecular hydrogen bonding. The thermal stability of L was studied by TG analysis. The fluorescence spectrum of L shows dual emission, and is due to excited state intramolecular proton transfer (ESIPT) process. This is supported by the high Stokes shift value. Electronic structure calculations of L in the ground and excited state have been carried out using DFT and TD-DFT at B3LYP/6-31G (d,p) level, respectively. The vibrational spectrum was computed at this level and compared with experimental values. Major orbital contributions for the electronic transitions were assigned with the help of TD-DFT. The changes in the Mulliken charge, bond lengths and bond angles between the ground and excited states of the tautomers demonstrate that twisted intramolecular charge transfer (TICT) process occurs along with ESIPT in the excited state.

Genomic and transcriptomic predictors of triglyceride response to regular exercise

PubMed Central

Sarzynski, Mark A; Davidsen, Peter K; Sung, Yun Ju; Hesselink, Matthijs K C; Schrauwen, Patrick; Rice, Treva K; Rao, D C; Falciani, Francesco; Bouchard, Claude

2015-01-01

Aim We performed genome-wide and transcriptome-wide profiling to identify genes and single nucleotide polymorphisms (SNPs) associated with the response of triglycerides (TG) to exercise training. Methods Plasma TG levels were measured before and after a 20-week endurance training programme in 478 white participants from the HERITAGE Family Study. Illumina HumanCNV370-Quad v3.0 BeadChips were genotyped using the Illumina BeadStation 500GX platform. Affymetrix HG-U133+2 arrays were used to quantitate gene expression levels from baseline muscle biopsies of a subset of participants (N=52). Genome-wide association study (GWAS) analysis was performed using MERLIN, while transcriptomic predictor models were developed using the R-package GALGO. Results The GWAS results showed that eight SNPs were associated with TG training-response (ΔTG) at p<9.9×10−6, while another 31 SNPs showed p values <1×10−4. In multivariate regression models, the top 10 SNPs explained 32.0% of the variance in ΔTG, while conditional heritability analysis showed that four SNPs statistically accounted for all of the heritability of ΔTG. A molecular signature based on the baseline expression of 11 genes predicted 27% of ΔTG in HERITAGE, which was validated in an independent study. A composite SNP score based on the top four SNPs, each from the genomic and transcriptomic analyses, was the strongest predictor of ΔTG (R2=0.14, p=3.0×10−68). Conclusions Our results indicate that skeletal muscle transcript abundance at 11 genes and SNPs at a number of loci contribute to TG response to exercise training. Combining data from genomics and transcriptomics analyses identified a SNP-based gene signature that should be further tested in independent samples. PMID:26491034

Association between ADIPOQ +45T>G Polymorphism and Type 2 Diabetes: A Systematic Review and Meta-Analysis

PubMed Central

Fan, Yaofu; Wang, Kun; Xu, Shuhang; Chen, Guofang; Di, Hongjie; Cao, Meng; Liu, Chao

2014-01-01

Recently, a number of studies have reported the association between the single nucleotide polymorphisms (SNPs) +45T>G polymorphism in the adiponectin (ADIPOQ) gene and type 2 diabetes mellitus (T2DM) risk, though the results are inconsistent. In order to obtain a more precise estimation of the relationship, a meta-analysis was performed. In this current study, the Medline, Embase, Pubmed, ISI Web of Knowledge, Ovid, Science Citation Index Expanded Database, Wanfang Database, and China National Knowledge Infrastructure were searched for eligible studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to estimate the strength of association. Forty-five publications were included in the final meta-analysis with 9986 T2DM patients and 16,222 controls for ADIPOQ +45T>G polymorphism according to our inclusion and exclusion criteria. The +45T>G polymorphism was associated with an overall significantly increased risk of T2DM (G vs. T: OR = 1.18, 95% CI = 1.06–1.32; The dominant model: OR = 1.18, 95% CI = 1.03–1.33; The recessive model: OR = 1.47, 95% CI = 1.20–1.78; The homozygous model: OR = 1.62, 95% CI = 1.25–2.09; Except the heterozygous model: OR = 1.11, 95% CI = 0.98–1.24). Subgroup analysis revealed a significant association between the +45T>G polymorphism and T2D in an Asian population. Thus, this meta-analysis indicates that the G allele of the ADIPOQ +45T>G polymorphisms associated with a significantly increased risk of T2DM in the Asian population. PMID:25561226

In vivo determination of triglyceride (TG) secretion in rats fed different dietary saturated fats using (2- sup 3 H)-glycerol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lai, H.C.; Yang, H.; Lasekan, J.

1990-02-26

Male, Sprague-Dawley rats (154{plus minus}1 g) were fed diets containing 2% corn oil (CO) + 14% butterfat (BF), beef tallow (BT), olive oil (OO) or coconut oil (CN) vs a 16% CO control diet for 5 weeks. Changes in plasma TG specific activity (dpm/mg TG) were determined in individual unanesthetized rats after injection of 100 {mu}Ci (2-{sup 3}H)-glycerol via a carotid cannula. Fractional rate constants were obtained using a 2-compartment model and nonlinear regression analysis. Results demonstrated no difference in the fractional rate constants among dietary groups; but, differences in the rates of hepatic TG secretion were noted. Rats fedmore » BT showed a higher rate of hepatic TG secretion than rats fed CO. Rats fed BF, OO or CN showed somewhat higher rates of hepatic TG secretion than CO. VLDL TG, phospholipid, and apolipoprotein B and E levels were higher with saturated fats vs CO. The data suggest that the higher plasma TG levels noted in response to feeding saturated fats vs corn oil can be explained, in part, by an increased flux of hepatic TG secretion.« less

New Nanomedicine Approaches Using Gold-thioguanine Nanoconjugates as Metallo-ligands

PubMed Central

Sleightholm, Lee; Zambre, Ajit; Chanda, Nripen; Afrasiabi, Zahra; Katti, Kattesh; Kannan, Raghuraman

2011-01-01

Gold-thioguanine nanoconjugates (AuNP-TG) of size 3–4 nm were synthesized and the ratio between gold and 6-Thioguanine (TG) was estimated as ~1:1.5 using a cyanide digestion method and confirmed by flame atomic absorption spectroscopic analysis. AuNP-TG constructs showed high in vitro stability under different pH conditions and biologically relevant solutions for a period of 24 hours. Reaction of AuNP-TG with europium or platinum salts resulted in the formation of organized self-assembled metallo-networks. PMID:21709763

Structural and Functional Divergence of the Aldolase Fold in Toxoplasma gondii

DOE PAGES

Tonkin, Michelle L.; Halavaty, Andrei S.; Ramaswamy, Raghavendran; ...

2014-10-02

Parasites of the phylum Apicomplexa are highly successful pathogens of humans and animals worldwide. As obligate intracellular parasites, they have significant energy requirements for invasion and gliding motility that are supplied by various metabolic pathways. Aldolases have emerged as key enzymes involved in these pathways, and all apicomplexans express one or both of fructose 1,6-bisphosphate (F16BP) aldolase and 2-deoxyribose 5-phosphate (dR5P) aldolase (DERA). Intriguingly, Toxoplasma gondii, a highly successful apicomplexan parasite, expresses F16BP aldolase (TgALD1), d5RP aldolase (TgDERA), and a divergent dR5P aldolase-like protein (TgDPA) exclusively in the latent bradyzoite stage. While the importance of TgALD1 in glycolysis is wellmore » established and TgDERA is also likely to be involved in parasite metabolism, the detailed function of TgDPA remains elusive. Here, to gain mechanistic insight into the function of different T. gondii aldolases, we first determined the crystal structures of TgALD1 and TgDPA. Structural analysis revealed that both aldolases adopt a TIM barrel fold accessorized with divergent secondary structure elements. Structural comparison of TgALD1 and TgDPA with members of their respective enzyme families revealed that, while the active-site residues are conserved in TgALD1, key catalytic residues are absent in TgDPA. Consistent with this observation, biochemical assays showed that, while TgALD1 was active on F16BP, TgDPA was inactive on dR5P. In conclusion, intriguingly, both aldolases are competent to bind polymerized actin in vitro. Altogether, structural and biochemical analyses of T. gondii aldolase and aldolase-like proteins reveal diverse functionalization of the classic TIM barrel aldolase fold.« less

Structural and functional divergence of the aldolase fold in Toxoplasma gondii.

PubMed

Tonkin, Michelle L; Halavaty, Andrei S; Ramaswamy, Raghavendran; Ruan, Jiapeng; Igarashi, Makoto; Ngô, Huân M; Boulanger, Martin J

2015-02-27

Parasites of the phylum Apicomplexa are highly successful pathogens of humans and animals worldwide. As obligate intracellular parasites, they have significant energy requirements for invasion and gliding motility that are supplied by various metabolic pathways. Aldolases have emerged as key enzymes involved in these pathways, and all apicomplexans express one or both of fructose 1,6-bisphosphate (F16BP) aldolase and 2-deoxyribose 5-phosphate (dR5P) aldolase (DERA). Intriguingly, Toxoplasma gondii, a highly successful apicomplexan parasite, expresses F16BP aldolase (TgALD1), d5RP aldolase (TgDERA), and a divergent dR5P aldolase-like protein (TgDPA) exclusively in the latent bradyzoite stage. While the importance of TgALD1 in glycolysis is well established and TgDERA is also likely to be involved in parasite metabolism, the detailed function of TgDPA remains elusive. To gain mechanistic insight into the function of different T. gondii aldolases, we first determined the crystal structures of TgALD1 and TgDPA. Structural analysis revealed that both aldolases adopt a TIM barrel fold accessorized with divergent secondary structure elements. Structural comparison of TgALD1 and TgDPA with members of their respective enzyme families revealed that, while the active-site residues are conserved in TgALD1, key catalytic residues are absent in TgDPA. Consistent with this observation, biochemical assays showed that, while TgALD1 was active on F16BP, TgDPA was inactive on dR5P. Intriguingly, both aldolases are competent to bind polymerized actin in vitro. Altogether, structural and biochemical analyses of T. gondii aldolase and aldolase-like proteins reveal diverse functionalization of the classic TIM barrel aldolase fold. Copyright © 2014 Elsevier Ltd. All rights reserved.

Analytical and between-subject variation of thrombin generation measured by calibrated automated thrombography on plasma samples.

PubMed

Kristensen, Anne F; Kristensen, Søren R; Falkmer, Ursula; Münster, Anna-Marie B; Pedersen, Shona

2018-05-01

The Calibrated Automated Thrombography (CAT) is an in vitro thrombin generation (TG) assay that holds promise as a valuable tool within clinical diagnostics. However, the technique has a considerable analytical variation, and we therefore, investigated the analytical and between-subject variation of CAT systematically. Moreover, we assess the application of an internal standard for normalization to diminish variation. 20 healthy volunteers donated one blood sample which was subsequently centrifuged, aliquoted and stored at -80 °C prior to analysis. The analytical variation was determined on eight runs, where plasma from the same seven volunteers was processed in triplicates, and for the between-subject variation, TG analysis was performed on plasma from all 20 volunteers. The trigger reagents used for the TG assays included both PPP reagent containing 5 pM tissue factor (TF) and PPPlow with 1 pM TF. Plasma, drawn from a single donor, was applied to all plates as an internal standard for each TG analysis, which subsequently was used for normalization. The total analytical variation for TG analysis performed with PPPlow reagent is 3-14% and 9-13% for PPP reagent. This variation can be minimally reduced by using an internal standard but mainly for ETP (endogenous thrombin potential). The between-subject variation is higher when using PPPlow than PPP and this variation is considerable higher than the analytical variation. TG has a rather high inherent analytical variation but considerable lower than the between-subject variation when using PPPlow as reagent.

Evaluation of the effects of electrical stimulation on cartilage repair in adult male rats.

PubMed

Zuzzi, Denise Cristina; Ciccone, Carla de Campos; Neves, Lia Mara Grosso; Mendonça, Josué Sampaio; Joazeiro, Paulo Pinto; Esquisatto, Marcelo Augusto Marretto

2013-08-01

This study describes the organization of mature hyaline xiphoid cartilage during repair in animals submitted to electrical current stimulation. Twenty male Wistar rats, 90 days old, were divided into a control group (CG) and a treated group (TG). A cylindrical full-thickness cartilage defects were created with a 3-mm punch in anesthetized animals. After 24h, TG received daily applications of a continuous electrical current (1Hz/20μA) for 5min. The animals were sacrificed after 7, 21 and 35 days for structural analysis. In CG, the repair tissue presented fibrous characteristics, with fibroblastic cells being infiltrated and permeated by blood vessels. Basophilic foci of cartilage tissue were observed on day 35. In TG, the repair tissue also presented fibrous characteristics, but a larger number of thick collagen fibers were seen on day 21. A large number of cartilaginous nests were observed on day 35. Cell numbers were significantly higher in TG. Calcification points were detected in TG on day 35. There was no difference in elastic fibers between groups. Ultrastructural analysis revealed the presence of chondrocyte-like cells in CG at all time points, but only on days 21 and 35 in TG. The amount of cuprolinic blue-stained proteoglycans was higher in TG on day 35. Microcurrent stimulation accelerates the repair process in non-articular hyaline cartilage. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Dietary Factors Associated with Plasma Thyroid Peroxidase and Thyroglobulin Antibodies.

PubMed

Matana, Antonela; Torlak, Vesela; Brdar, Dubravka; Popović, Marijana; Lozić, Bernarda; Barbalić, Maja; Perica, Vesna Boraska; Punda, Ante; Polašek, Ozren; Hayward, Caroline; Zemunik, Tatijana

2017-10-28

The knowledge about dietary habits and their influence in the development of autoimmune thyroid disease is insufficient. The aim of this study was to analyse the association of dietary factors and plasma thyroid peroxidase antibodies (TPO-Ab) and/or thyroglobulin antibodies (Tg-Ab). The study enrolled 1887 participants originating from the South Croatia. Participants with elevated plasma TPO-Ab and/or Tg-Ab were defined as cases ( n = 462) and those with TPO-Ab and/or Tg-Ab within referent values were defined as controls ( n = 1425). Dietary intake was evaluated according to a food frequency questionnaire containing 58 food items. Principal component analysis was used to group food items into dietary groups. We used logistic regression analysis to examine dietary groups associated with positive plasma TPO-Ab and/or Tg-Ab. The results indicate that the dietary group with frequent consumption of animal fats and butter is associated with positive plasma TPO-Ab and/or Tg-Ab ( p = 0.01). The dietary group with frequent consumption of vegetables as well as the dietary group with high consumption of dried fruit, nuts, and muesli are associated with negative findings of TPO-Ab and/or Tg-Ab ( p = 0.048 and p = 0.02, respectively). We showed that the anti-inflammatory dietary groups are associated with the negative findings of plasma TPO-Ab and/or Tg-Ab.

Rapid identification of lettuce seed germination mutants by bulked segregant analysis and whole genome sequencing.

PubMed

Huo, Heqiang; Henry, Isabelle M; Coppoolse, Eric R; Verhoef-Post, Miriam; Schut, Johan W; de Rooij, Han; Vogelaar, Aat; Joosen, Ronny V L; Woudenberg, Leo; Comai, Luca; Bradford, Kent J

2016-11-01

Lettuce (Lactuca sativa) seeds exhibit thermoinhibition, or failure to complete germination when imbibed at warm temperatures. Chemical mutagenesis was employed to develop lettuce lines that exhibit germination thermotolerance. Two independent thermotolerant lettuce seed mutant lines, TG01 and TG10, were generated through ethyl methanesulfonate mutagenesis. Genetic and physiological analyses indicated that these two mutations were allelic and recessive. To identify the causal gene(s), we applied bulked segregant analysis by whole genome sequencing. For each mutant, bulked DNA samples of segregating thermotolerant (mutant) seeds were sequenced and analyzed for homozygous single-nucleotide polymorphisms. Two independent candidate mutations were identified at different physical positions in the zeaxanthin epoxidase gene (ABSCISIC ACID DEFICIENT 1/ZEAXANTHIN EPOXIDASE, or ABA1/ZEP) in TG01 and TG10. The mutation in TG01 caused an amino acid replacement, whereas the mutation in TG10 resulted in alternative mRNA splicing. Endogenous abscisic acid contents were reduced in both mutants, and expression of the ABA1 gene from wild-type lettuce under its own promoter fully complemented the TG01 mutant. Conventional genetic mapping confirmed that the causal mutations were located near the ZEP/ABA1 gene, but the bulked segregant whole genome sequencing approach more efficiently identified the specific gene responsible for the phenotype. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Multicentre clinical evaluation of the new highly sensitive Elecsys® thyroglobulin II assay in patients with differentiated thyroid carcinoma.

PubMed

Trimboli, P; Imperiali, M; Piccardo, A; CampennÌ, A; Giordani, I; Ruggeri, R M; Baldari, S; Orlandi, F; Giovanella, L

2018-02-01

A highly sensitive thyroglobulin assay (Elecsys® Tg II, Roche Diagnostics, Penzberg, Germany) has become available for monitoring patients with differentiated thyroid cancer (DTC). Here, we evaluated the clinical performance of Elecsys® Tg II assay in a multicentre patients series and compare it with the established Access® Tg assay (Beckman Coulter, Brea, CA, USA). Retrospective analysis on prospectively selected patients in four thyroid cancer referral centres with uniform DTC management. All DTC cases diagnosed, treated and followed up in four tertiary referral centres for thyroid cancer since January 2005 (n = 1456) were retrieved, and predefined selection criteria were applied to prevent relevant enrolment biases. A series of 204 patients was finally selected for this study. Samples had been stored at -80°C. Tg was measured by fully automated immunometric Elecsys® Tg II and Access® Tg assays in a centralized laboratory. Two hundred and four DTC were finally included. Of these, 10.8% had structural recurrence (sREC), and 81.4% showed no evidence of disease (NED) at the end of follow-up. There was a significant analytical bias between methods that cannot be used interchangeably. Using ROC curve analysis, the best basal and rhTSH-stimulated Tg cut-offs to detect sREC were 0.41 μg/L and 1.82 μg/L for Elecsys® and 0.36 μg/L and 1.62 μg/L for Access® assay, respectively. Using Cox proportional hazard regression, Tg was the only independent predictor of cancer relapse. Using appropriate assay-specific cut-offs, the clinical performance of the Elecsys® Tg II assay was comparable to that provided by the well-established Access® Tg assay. © 2017 John Wiley & Sons Ltd.

Production of novel microbial flocculants by Klebsiella sp. TG-1 using waste residue from the food industry and its use in defecating the trona suspension.

PubMed

Liu, Zhan-Ying; Hu, Zhi-Quan; Wang, Tao; Chen, Yan-Ying; Zhang, Jianbin; Yu, Jing-Ran; Zhang, Tong; Zhang, Yong-Feng; Li, Yong-Li

2013-07-01

A microbial-flocculants-producing (MBF-producing) bacterium, named TG-1, was isolated from waste water of a starch factory, and identified as Klebsiella sp. TG-1. The microbial flocculants (MBF) produced by TG-1, named as MBF-TG-1, was applied to defecating the strong basic trona suspension in the trona industry. After optimizing medium and culturing conditions with single-factor and orthogonal designs, the highest flocculation rate of 86.9% was achieved. Chemical analysis showed that the purified microbial flocculants (MBF-TG-1) was mainly composed of polysaccharides (84.6%), with a small amount of protein or amino acid (11.1%). Bridging mechanism was supposed as the main flocculation mechanism by analyzing the flocculation process and the biochemistry properties of MBF-TG-1. The high flocculation rate (84%) was also achieved with a low-cost medium (the solid residue of tofu production from food industry). Copyright © 2013 Elsevier Ltd. All rights reserved.

MRI Proton Density Fat Fraction Is Robust Across the Biologically Plausible Range of Triglyceride Spectra in Adults With Nonalcoholic Steatohepatitis

PubMed Central

Hong, Cheng William; Mamidipalli, Adrija; Hooker, Jonathan C.; Hamilton, Gavin; Wolfson, Tanya; Chen, Dennis H.; Dehkordy, Soudabeh Fazeli; Middleton, Michael S.; Reeder, Scott B.; Loomba, Rohit; Sirlin, Claude B.

2017-01-01

Background Proton density fat fraction (PDFF) estimation requires spectral modeling of the hepatic triglyceride (TG) signal. Deviations in the TG spectrum may occur, leading to bias in PDFF quantification. Purpose To investigate the effects of varying six-peak TG spectral models on PDFF estimation bias. Study Type Retrospective secondary analysis of prospectively acquired clinical research data. Population Forty-four adults with biopsy-confirmed nonalcoholic steatohepatitis. Field Strength/Sequence Confounder-corrected chemical-shift-encoded 3T MRI (using a 2D multiecho gradient-recalled echo technique with magnitude reconstruction) and MR spectroscopy. Assessment In each patient, 61 pairs of colocalized MRI-PDFF and MRS-PDFF values were estimated: one pair used the standard six-peak spectral model, the other 60 were six-peak variants calculated by adjusting spectral model parameters over their biologically plausible ranges. MRI-PDFF values calculated using each variant model and the standard model were compared, and the agreement between MRI-PDFF and MRS-PDFF was assessed. Statistical Tests MRS-PDFF and MRI-PDFF were summarized descriptively. Bland–Altman (BA) analyses were performed between PDFF values calculated using each variant model and the standard model. Linear regressions were performed between BA biases and mean PDFF values for each variant model, and between MRI-PDFF and MRS-PDFF. Results Using the standard model, mean MRS-PDFF of the study population was 17.9±8.0% (range: 4.1–34.3%). The difference between the highest and lowest mean variant MRI-PDFF values was 1.5%. Relative to the standard model, the model with the greatest absolute BA bias overestimated PDFF by 1.2%. Bias increased with increasing PDFF (P < 0.0001 for 59 of the 60 variant models). MRI-PDFF and MRS-PDFF agreed closely for all variant models (R2=0.980, P < 0.0001). Data Conclusion Over a wide range of hepatic fat content, PDFF estimation is robust across the biologically plausible range of TG spectra. Although absolute estimation bias increased with higher PDFF, its magnitude was small and unlikely to be clinically meaningful. Level of Evidence 3 Technical Efficacy Stage 2 PMID:28851124

Alzheimer disease in a mouse model: MR imaging-guided focused ultrasound targeted to the hippocampus opens the blood-brain barrier and improves pathologic abnormalities and behavior.

PubMed

Burgess, Alison; Dubey, Sonam; Yeung, Sharon; Hough, Olivia; Eterman, Naomi; Aubert, Isabelle; Hynynen, Kullervo

2014-12-01

To validate whether repeated magnetic resonance (MR) imaging-guided focused ultrasound treatments targeted to the hippocampus, a brain structure relevant for Alzheimer disease ( AD Alzheimer disease ), could modulate pathologic abnormalities, plasticity, and behavior in a mouse model. All animal procedures were approved by the Animal Care Committee and are in accordance with the Canadian Council on Animal Care. Seven-month-old transgenic (TgCRND8) (Tg) mice and their nontransgenic (non-Tg) littermates were entered in the study. Mice were treated weekly with MR imaging-guided focused ultrasound in the bilateral hippocampus (1.68 MHz, 10-msec bursts, 1-Hz burst repetition frequency, 120-second total duration). After 1 month, spatial memory was tested in the Y maze with the novel arm prior to sacrifice and immunohistochemical analysis. The data were compared by using unpaired t tests and analysis of variance with Tukey post hoc analysis. Untreated Tg mice spent 61% less time than untreated non-Tg mice exploring the novel arm of the Y maze because of spatial memory impairments (P < .05). Following MR imaging-guided focused ultrasound, Tg mice spent 99% more time exploring the novel arm, performing as well as their non-Tg littermates. Changes in behavior were correlated with a reduction of the number and size of amyloid plaques in the MR imaging-guided focused ultrasound-treated animals (P < .01). Further, after MR imaging-guided focused ultrasound treatment, there was a 250% increase in the number of newborn neurons in the hippocampus (P < .01). The newborn neurons had longer dendrites and more arborization after MR imaging-guided focused ultrasound, as well (P < .01). Repeated MR imaging-guided focused ultrasound treatments led to spatial memory improvement in a Tg mouse model of AD Alzheimer disease . The behavior changes may be mediated by decreased amyloid pathologic abnormalities and increased neuronal plasticity. © RSNA, 2014.

Osteoblast-Specific Overexpression of Human WNT16 Increases Both Cortical and Trabecular Bone Mass and Structure in Mice

PubMed Central

Alkhouli, Mohammed; Gerard-O'Riley, Rita L.; Wright, Weston B.; Acton, Dena; Gray, Amie K.; Patel, Bhavmik; Reilly, Austin M.; Lim, Kyung-Eun; Robling, Alexander G.; Econs, Michael J.

2016-01-01

Previous genome-wide association studies have identified common variants in genes associated with bone mineral density (BMD) and risk of fracture. Recently, we identified single nucleotide polymorphisms (SNPs) in Wingless-type mouse mammary tumor virus integration site (WNT)16 that were associated with peak BMD in premenopausal women. To further identify the role of Wnt16 in bone mass regulation, we created transgenic (TG) mice overexpressing human WNT16 in osteoblasts. We compared bone phenotypes, serum biochemistry, gene expression, and dynamic bone histomorphometry between TG and wild-type (WT) mice. Compared with WT mice, WNT16-TG mice exhibited significantly higher whole-body areal BMD and bone mineral content (BMC) at 6 and 12 weeks of age in both male and female. Microcomputer tomography analysis of trabecular bone at distal femur revealed 3-fold (male) and 14-fold (female) higher bone volume/tissue volume (BV/TV), and significantly higher trabecular number and trabecular thickness but lower trabecular separation in TG mice compared with WT littermates in both sexes. The cortical bone at femur midshaft also displayed significantly greater bone area/total area and cortical thickness in the TG mice in both sexes. Serum biochemistry analysis showed that male TG mice had higher serum alkaline phosphatase, osteocalcin, osteoprotegerin (OPG), OPG to receptor activator of NF-kB ligand (tumor necrosis family ligand superfamily, number 11; RANKL) ratio as compared with WT mice. Also, lower carboxy-terminal collagen cross-link (CTX) to tartrate-resistant acid phosphatase 5, isoform b (TRAPc5b) ratio was observed in TG mice compared with WT littermates in both male and female. Histomorphometry data demonstrated that both male and female TG mice had significantly higher cortical and trabecular mineralizing surface/bone surface and bone formation rate compared with sex-matched WT mice. Gene expression analysis demonstrated higher expression of Alp, OC, Opg, and Opg to Rankl ratio in bone tissue in the TG mice compared with WT littermates. Our data indicate that WNT16 is critical for positive regulation of both cortical and trabecular bone mass and structure and that this molecule might be targeted for therapeutic interventions to treat osteoporosis. PMID:26584014

Bile acid signaling in lipid metabolism: Metabolomic and lipidomic analysis of lipid and bile acid markers linked to anti-obesity and anti-diabetes in mice

PubMed Central

Qi, Yunpeng; Jiang, Changtao; Cheng, Jie; Krausz, Kristopher W.; Li, Tiangang; Ferrell, Jessica M.; Gonzalez, Frank J.; Chiang, John Y.L.

2014-01-01

Bile acid synthesis is the major pathway for catabolism of cholesterol. Cholesterol 7α-hydroxylase (CYP7A1) is the rate-limiting enzyme in the bile acid biosynthetic pathway in the liver and plays an important role in regulating lipid, glucose and energy metabolism. Transgenic mice overexpressing CYP7A1 (CYP7A1-tg mice) were resistant to high-fat diet (HFD)-induced obesity, fatty liver, and diabetes. However the mechanism of resistance to HFD-induced obesity of CYP7A1-tg mice has not been determined. In this study, metabolomic and lipidomic profiles of CYP7A1-tg mice were analyzed to explore the metabolic alterations in CYP7A1-tg mice that govern the protection against obesity and insulin resistance by using ultra-performance liquid chromatography-coupled with electrospray ionization quadrupole time-of-flight mass spectrometry combined with multivariate analyses. Lipidomics analysis identified seven lipid markers including lysophosphatidylcholines, phosphatidylcholines, sphingomyelins and ceramides that were significantly decreased in serum of HFD-fed CYP7A1-tg mice. Metabolomics analysis identified 13 metabolites in bile acid synthesis including taurochenodeoxycholic acid, taurodeoxycholic acid, tauroursodeoxycholic acid, taurocholic acid, and tauro-β-muricholic acid (T-β-MCA) that differed between CYP7A1-tg and wild-type mice. Notably, T-β-MCA, an antagonist of the farnesoid X receptor (FXR) was significantly increased in intestine of CYP7A1-tg mice. This study suggests that reducing 12α-hydroxylated bile acids and increasing intestinal T-β-MCA may reduce high fat diet-induced increase of phospholipids, sphingomyelins and ceramides, and ameliorate diabetes and obesity. PMID:24796972

Gelation and thermal characteristics of microwave extracted fish gelatin-natural gum composite gels.

PubMed

Binsi, P K; Nayak, Natasha; Sarkar, P C; Joshy, C G; Ninan, George; Ravishankar, C N

2017-02-01

In this study, the gelation and thermal characteristics of microwave extracted fish scale gelatin blended with natural gums such as gum arabic (AG), xanthan gum (XG), guar gum (GG), and tragacanth gum (TG) was evaluated. The nature of interaction and behavior of gelatin in presence of various gums was confirmed by particle size analysis, viscosity profile, FT-IR analysis and turbidity measurements. DSC data revealed that addition of AG, TG and GG remarkably improved the thermal stability of fish gelatin gel. The composite gels of TG, AG, and XG exhibited higher hardness and bloom strength values as compared to pure fish gelatin implying its textural synergy. Based on qualitative descriptive analysis, TG was found to be superior in improving the stability of fish gelatin gel, closely followed by AG. The results suggest that addition of these gums can reduce syneresis and retard melting of gelatin gels at ambient temperature, which are otherwise soft and thermally unstable.

Postprandial lipemia in men with metabolic syndrome, hypertensives and healthy subjects

PubMed Central

Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Pavlidis, Antonis N; Salpea, Klelia D; Iraklianou, Stella A; Tsarpalis, Konstantinos; Damaskos, Dimitris S; Manolis, Athanasios; Cokkinos, Dennis V

2005-01-01

Background The metabolic syndrome (MetS), as well as postprandial hypertriglyceridemia, is associated with coronary heart disease. This study aimed to evaluate the postprandial lipemia after oral fat tolerance test (OFTT) in subjects with MetS and compare them to hypertensive (HTN) and healthy subjects. Results OFTT was given to 33 men with MetS (defined by the Adult Treatment Panel III), 17 HTN and 14 healthy men. The MetS group was further divided according to fasting triglycerides (TG) into TG ≥ 150 [MetS+TG, (n = 22)] or <150 mg/dl [MetS-TG (n = 11)], and into those with or without hypertension [MetS+HTN (n = 24), MetS-HTN (n = 9), respectively]. TG concentrations were measured before and at 4, 6 and 8 h after OFTT and the postprandial response was quantified using the area under the curve (AUC) for TG. The postprandial response was significantly higher in MetS compared to HTN and healthy men [AUC (SD) in mg/dl/h; 2534 ± 1016 vs. 1620 ± 494 and 1019 ± 280, respectively, p ≤ 0.001]. The TG levels were increased significantly in MetS+TG compared to MetS-TG subjects at 4 (p = 0.022), 6 (p < 0.001) and 8 hours (p < 0.001). The TG were increased significantly in MetS-TG compared to healthy subjects at 4 (p = 0.011), 6 (p = 0.001) and 8 hours (p = 0.015). In linear regression analysis only fasting TG levels were a significant predictor of the AUC (Coefficient B = 8.462, p < 0.001). Conclusion Fasting TG concentration is the main determinant of postprandial lipemia. However, an exaggeration of TG postprandialy was found in normotriglyceridemic MetS and HTN compared to healthy subjects. This suggests that intervention to lower fasting TG levels should be recommended in MetS subjects. PMID:16197542

Postprandial lipemia in men with metabolic syndrome, hypertensives and healthy subjects.

PubMed

Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Pavlidis, Antonis N; Salpea, Klelia D; Iraklianou, Stella A; Tsarpalis, Konstantinos; Damaskos, Dimitris S; Manolis, Athanasios; Cokkinos, Dennis V

2005-09-30

The metabolic syndrome (MetS), as well as postprandial hypertriglyceridemia, is associated with coronary heart disease. This study aimed to evaluate the postprandial lipemia after oral fat tolerance test (OFTT) in subjects with MetS and compare them to hypertensive (HTN) and healthy subjects. OFTT was given to 33 men with MetS (defined by the Adult Treatment Panel III), 17 HTN and 14 healthy men. The MetS group was further divided according to fasting triglycerides (TG) into TG > or = 150 [MetS+TG, (n = 22)] or < 150 mg/dl [MetS-TG (n = 11)], and into those with or without hypertension [MetS+HTN (n = 24), MetS-HTN (n = 9), respectively]. TG concentrations were measured before and at 4, 6 and 8 h after OFTT and the postprandial response was quantified using the area under the curve (AUC) for TG. The postprandial response was significantly higher in MetS compared to HTN and healthy men [AUC (SD) in mg/dl/h; 2534 +/- 1016 vs. 1620 +/- 494 and 1019 +/- 280, respectively, p < or = 0.001]. The TG levels were increased significantly in MetS+TG compared to MetS-TG subjects at 4 (p = 0.022), 6 (p < 0.001) and 8 hours (p < 0.001). The TG were increased significantly in MetS-TG compared to healthy subjects at 4 (p = 0.011), 6 (p = 0.001) and 8 hours (p = 0.015). In linear regression analysis only fasting TG levels were a significant predictor of the AUC (Coefficient B = 8.462, p < 0.001). Fasting TG concentration is the main determinant of postprandial lipemia. However, an exaggeration of TG postprandialy was found in normotriglyceridemic MetS and HTN compared to healthy subjects. This suggests that intervention to lower fasting TG levels should be recommended in MetS subjects.

An analysis of the carbon balance of the Arctic Basin from 1997 to 2006

USGS Publications Warehouse

McGuire, A.D.; Hayes, D.J.; Kicklighter, D.W.; Manizza, M.; Zhuang, Q.; Chen, M.; Follows, M.J.; Gurney, K.R.; McClelland, J.W.; Melillo, J.M.; Peterson, B.J.; Prinn, R.G.

2010-01-01

This study used several model-based tools to analyse the dynamics of the Arctic Basin between 1997 and 2006 as a linked system of land-ocean-atmosphere C exchange. The analysis estimates that terrestrial areas of the Arctic Basin lost 62.9 Tg C yr-1 and that the Arctic Ocean gained 94.1 Tg C yr-1. Arctic lands and oceans were a net CO2 sink of 108.9 Tg C yr-1, which is within the range of uncertainty in estimates from atmospheric inversions. Although both lands and oceans of the Arctic were estimated to be CO2 sinks, the land sink diminished in strength because of increased fire disturbance compared to previous decades, while the ocean sink increased in strength because of increased biological pump activity associated with reduced sea ice cover. Terrestrial areas of the Arctic were a net source of 41.5 Tg CH4 yr-1 that increased by 0.6 Tg CH4 yr-1 during the decade of analysis, a magnitude that is comparable with an atmospheric inversion of CH4. Because the radiative forcing of the estimated CH4 emissions is much greater than the CO2 sink, the analysis suggests that the Arctic Basin is a substantial net source of green house gas forcing to the climate system.

Biomass Thermogravimetric Analysis: Uncertainty Determination Methodology and Sampling Maps Generation

PubMed Central

Pazó, Jose A.; Granada, Enrique; Saavedra, Ángeles; Eguía, Pablo; Collazo, Joaquín

2010-01-01

The objective of this study was to develop a methodology for the determination of the maximum sampling error and confidence intervals of thermal properties obtained from thermogravimetric analysis (TG), including moisture, volatile matter, fixed carbon and ash content. The sampling procedure of the TG analysis was of particular interest and was conducted with care. The results of the present study were compared to those of a prompt analysis, and a correlation between the mean values and maximum sampling errors of the methods were not observed. In general, low and acceptable levels of uncertainty and error were obtained, demonstrating that the properties evaluated by TG analysis were representative of the overall fuel composition. The accurate determination of the thermal properties of biomass with precise confidence intervals is of particular interest in energetic biomass applications. PMID:20717532

Changes in lipid fluidity and fatty acid composition with altered culture temperature in Tetrahymena pyriformis-NT1.

PubMed

Connolly, J G; Brown, I D; Lee, A G; Kerkut, G A

1985-01-01

Cultures of T. pyriformis-NT1 were grown at 20 degrees C (Tg 20 degrees C) and 38 degrees C (Tg 38 degrees C). G.L.C. analysis and D.P.H. fluorescence polarization measurements in extracted phospholipids indicated that there was increased saturation of fatty acids and relatively reduced fluidity as growth temperature was increased. Breakpoints occurred in the Arrhenius plots of fluorescence polarization at 16 degrees C for Tg 38 degrees C total extracted phospholipids and 9 degrees C for Tg 20 degrees C lipids.

Discovery of Potent and Specific Dihydroisoxazole Inhibitors of Human Transglutaminase 2

PubMed Central

2015-01-01

Transglutaminase 2 (TG2) is a ubiquitously expressed enzyme that catalyzes the posttranslational modification of glutamine residues on protein or peptide substrates. A growing body of literature has implicated aberrantly regulated activity of TG2 in the pathogenesis of various human inflammatory, fibrotic, and other diseases. Taken together with the fact that TG2 knockout mice are developmentally and reproductively normal, there is growing interest in the potential use of TG2 inhibitors in the treatment of these conditions. Targeted-covalent inhibitors based on the weakly electrophilic 3-bromo-4,5-dihydroisoxazole (DHI) scaffold have been widely used to study TG2 biology and are well tolerated in vivo, but these compounds have only modest potency, and their selectivity toward other transglutaminase homologues is largely unknown. In the present work, we first profiled the selectivity of existing inhibitors against the most pertinent TG isoforms (TG1, TG3, and FXIIIa). Significant cross-reactivity of these small molecules with TG1 was observed. Structure–activity and −selectivity analyses led to the identification of modifications that improved potency and isoform selectivity. Preliminary pharmacokinetic analysis of the most promising analogues was also undertaken. Our new data provides a clear basis for the rational selection of dihydroisoxazole inhibitors as tools for in vivo biological investigation. PMID:25333388

Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

PubMed

Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

2004-01-01

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

Simultaneous Quantification of Free Cholesterol, Cholesteryl Esters, and Triglycerides without Ester Hydrolysis by UHPLC Separation and In-Source Collision Induced Dissociation Coupled MS/MS

NASA Astrophysics Data System (ADS)

Gardner, Michael S.; McWilliams, Lisa G.; Jones, Jeffrey I.; Kuklenyik, Zsuzsanna; Pirkle, James L.; Barr, John R.

2017-08-01

We demonstrate the application of in-source nitrogen collision-induced dissociation (CID) that eliminates the need for ester hydrolysis before simultaneous analysis of esterified cholesterol (EC) and triglycerides (TG) along with free cholesterol (FC) from human serum, using normal phase liquid chromatography (LC) coupled to atmospheric pressure chemical ionization (APCI) tandem mass spectrometry (MS/MS). The analysis requires only 50 μL of 1:100 dilute serum with a high-throughput, precipitation/evaporation/extraction protocol in one pot. Known representative mixtures of EC and TG species were used as calibrators with stable isotope labeled analogs as internal standards. The APCI MS source was operated with nitrogen source gas. Reproducible in-source CID was achieved with the use of optimal cone voltage (declustering potential), generating FC, EC, and TG lipid class-specific precursor fragment ions for multiple reaction monitoring (MRM). Using a representative mixture of purified FC, CE, and TG species as calibrators, the method accuracy was assessed with analysis of five inter-laboratory standardization materials, showing -10% bias for Total-C and -3% for Total-TG. Repeated duplicate analysis of a quality control pool showed intra-day and inter-day variation of 5% and 5.8% for FC, 5.2% and 8.5% for Total-C, and 4.1% and 7.7% for Total-TG. The applicability of the method was demonstrated on 32 serum samples and corresponding lipoprotein sub-fractions collected from normolipidemic, hypercholesterolemic, hypertriglyceridemic, and hyperlipidemic donors. The results show that in-source CID coupled with isotope dilution UHPLC-MS/MS is a viable high precision approach for translational research studies where samples are substantially diluted or the amounts of archived samples are limited. [Figure not available: see fulltext.

Association between hypertriglyceridemia and protein oxidation and proinflammatory markers in normocholesterolemic and hypercholesterolemic individuals.

PubMed

Klafke, Jonatas Zeni; Porto, Fernando Garcez; Batista, Roselaine; Bochi, Guilherme Vargas; Moresco, Rafael Noal; da Luz, Protásio Lemos; Viecili, Paulo Ricardo Nazário

2015-08-25

Although hypercholesterolemia is a well-established risk factor for coronary heart disease, evidence suggests that increased triglyceride (TG) concentrations are also an independent risk factor. TG concentrations >150mg/dl are observed nearly twice as often in subjects with atherosclerosis. We assessed the association between hypertriglyceridemia and protein oxidation and proinflammatory markers in normocholesterolemic and hypercholesterolemic individuals. We included 127 volunteers enrolled in Cruz Alta, RS, Brazil. The patients were stratified based on total cholesterol and TG concentrations for analysis of associations with inflammation (high-sensitivity C-reactive protein - hs-CRP), endothelial dysfunction (nitric oxide - NOx) and oxidative stress (advanced oxidation protein products - AOPPs; ischemia-modified albumin - IMA). Correlations between variables were determined and multiple regression analysis was employed to investigate whether some variables correlate with TG concentrations. Hypertriglyceridemia was related to oxidative stress and proinflammatory markers in individuals independent of total cholesterol concentrations. Moreover, the results indicate a stronger association of tested biomarkers with TG concentrations than with total cholesterol. The results indicate a positive correlation between oxidative stress and TG concentrations in the sera of hypercholesterolemia subjects. AOPPs and IMA concentrations were associated with the presence of hypertriglyceridemia in a manner that was independent of age, gender, hypertension and diabetes mellitus disease, smoking habits, sedentary lifestyle, BMI, waist circumference, LDL, HDL and total cholesterol concentrations. We speculate that TG concentrations can reflect the enhancement of protein oxidation and proinflammation. Copyright © 2015 Elsevier B.V. All rights reserved.

Analysis of motor function in 6-month-old male and female 3xTg-AD mice.

PubMed

Stover, Kurt R; Campbell, Mackenzie A; Van Winssen, Christine M; Brown, Richard E

2015-03-15

The 3xTg-AD mouse has high validity as a model of Alzheimer's disease (AD) because it develops both amyloid beta plaques and neurofibrillary tangles. Human patients with AD typically develop motor deficits, which worsen as the disease progresses, but 3xTg-AD mice have been reported to show enhanced motor abilities. We investigated the motor behaviour phenotype of male and female 3xTg-AD and B6129SF2 wildtype mice on a battery of motor behaviours at 6 months of age. Compared to wildtype mice, the 3xTg-AD mice had enhanced motor performance on the Rotarod, but worse performance on the grid suspension task. In gait analysis 3xTg-AD mice had a longer stride length and made more foot slips on the balance beam than wildtype mice. There was no overall difference in voluntary wheel-running activity between genotypes, but there was a disruption in circadian activity rhythm in 3xTg-AD mice. In some motor tasks, such as the Rotarod and balance beam, females appeared to perform better than males, but this sex differences was accounted for by differences in body weight. Our results indicate that while the 3xTg-AD mice show enhanced performance on the Rotarod, they have poorer performance on other motor behaviour tasks, indicating that their motor behaviour phenotype is more complex than previously reported. The presence of the P301L transgene may explain the enhancement of Rotarod performance but the poorer performance on other motor behaviour tasks may be due to other transgenes. Copyright © 2014 Elsevier B.V. All rights reserved.

Bone Mass and Strength are Significantly Improved in Mice Overexpressing Human WNT16 in Osteocytes.

PubMed

Alam, Imranul; Reilly, Austin M; Alkhouli, Mohammed; Gerard-O'Riley, Rita L; Kasipathi, Charishma; Oakes, Dana K; Wright, Weston B; Acton, Dena; McQueen, Amie K; Patel, Bhavmik; Lim, Kyung-Eun; Robling, Alexander G; Econs, Michael J

2017-04-01

Recently, we demonstrated that osteoblast-specific overexpression of human WNT16 increased both cortical and trabecular bone mass and structure in mice. To further identify the cell-specific role of Wnt16 in bone homeostasis, we created transgenic (TG) mice overexpressing human WNT16 in osteocytes using Dmp1 promoter (Dmp1-hWNT16 TG) on C57BL/6 (B6) background. We analyzed bone phenotypes and serum bone biomarkers, performed gene expression analysis and measured dynamic bone histomorphometry in Dmp1-hWNT16 TG and wild-type (WT) mice. Compared to WT mice, Dmp1-hWNT16 TG mice exhibited significantly higher whole-body, spine and femoral aBMD, BMC and trabecular (BV/TV, Tb.N, and Tb.Th) and cortical (bone area and thickness) parameters in both male and female at 12 weeks of age. Femur stiffness and ultimate force were also significantly improved in the Dmp1-hWNT16 TG female mice, compared to sex-matched WT littermates. In addition, female Dmp1-hWNT16 TG mice displayed significantly higher MS/BS, MAR and BFR/BS compared to the WT mice. Gene expression analysis demonstrated significantly higher mRNA level of Alp in both male and female Dmp1-hWNT16 TG mice and significantly higher levels of Osteocalcin, Opg and Rankl in the male Dmp1-hWNT16 TG mice in bone tissue compared to sex-matched WT mice. These results indicate that WNT16 plays a critical role for acquisition of both cortical and trabecular bone mass and strength. Strategies designed to use WNT16 as a target for therapeutic interventions will be valuable to treat osteoporosis and other low bone mass conditions.

Bone Mass and Strength are Significantly Improved in Mice Overexpressing Human WNT16 in Osteocytes

PubMed Central

Alam, Imranul; Reilly, Austin M.; Alkhouli, Mohammed; Gerard-O’Riley, Rita L.; Kasipathi, Charishma; Oakes, Dana K.; Wright, Weston B.; Acton, Dena; McQueen, Amie K.; Patel, Bhavmik; Lim, Kyung-Eun; Robling, Alexander G.; Econs, Michael J.

2017-01-01

Recently, we demonstrated that osteoblast-specific overexpression of human WNT16 increased both cortical and trabecular bone mass and structure in mice. To further identify the cell-specific role of Wnt16 in bone homeostasis, we created transgenic (TG) mice over-expressing human WNT16 in osteocytes using Dmp1 promoter (Dmp1-hWNT16 TG) on C57BL/6 (B6) background. We analyzed bone phenotypes and serum bone biomarkers, performed gene expression analysis and measured dynamic bone histomorphometry in Dmp1-hWNT16 TG and wild-type (WT) mice. Compared to WT mice, Dmp1-hWNT16 TG mice exhibited significantly higher whole body, spine and femoral aBMD, BMC and trabecular (BV/TV, Tb.N, and Tb.Th) and cortical (bone area and thickness) parameters in both male and female at 12 weeks of age. Femur stiffness and ultimate force were also significantly improved in the Dmp1-hWNT16 TG female mice, compared to sex-matched WT littermates. In addition, female Dmp1-hWNT16 TG mice displayed significantly higher MS/BS, MAR and BFR/BS compared to the WT mice. Gene expression analysis demonstrated significantly higher mRNA level of Alp in both male and female Dmp1-hWNT16 TG mice and significantly higher levels of Osteocalcin, Opg and Rankl in the male Dmp1-hWNT16 TG mice in bone tissue compared to sex-matched WT mice. These results indicate that WNT16 plays a critical role for acquisition of both cortical and trabecular bone mass and strength. Strategies designed to use WNT16 as a target for therapeutic interventions will be valuable to treat osteoporosis and other low bone mass conditions. PMID:28013361

Spectral, optical, thermal, Hirshfeld analysis and computational calculations of a new organic proton transfer crystal, 1H-benzo[d][1,2,3]triazol-3-ium-3,5-dinitrobenzoate

NASA Astrophysics Data System (ADS)

Sathya, K.; Dhamodharan, P.; Dhandapani, M.

2018-05-01

A molecular complex, 1H-benzo[d][1,2,3]triazol-3-ium-3,5-dinitrobenzoate, (BTDB), was synthesized, crystallized and characterized by CHN analysis and 1H, 13C NMR spectral studies. The crystal is transparent in entire visible region as evidenced by UV-Vis-NIR spectrum. TG/DTA analysis shows that BTDB is stable up to 150 °C. Single crystal XRD analysis was carried out to ascertain the molecular structure and BTDB crystallizes in the monoclinic system with space group P21/n. Computational studies that include optimization of molecular geometry, natural bond analysis (NBO), Mulliken population analysis and HOMO-LUMO analysis were performed using Gaussian 09 software by B3LYP method at 6-311G(d,p) level. Hirshfeld surfaces and 2D fingerprint plots revealed that O⋯H, H⋯H and O⋯C interactions are the most prevalent. The first order hyperpolarizability (β) of BITB is 44 times greater than urea. The results show that the BTDB may be used for various opto-electronic applications.

Expression profiles of aquaporin homologues and petal movement during petal development in Tulipa gesneriana.

PubMed

Azad, Abul Kalam; Hanawa, Ryosuke; Ishikawa, Takahiro; Sawa, Yoshihiro; Shibata, Hitoshi

2013-07-01

Previously, we have characterized two tonoplast intrinsic proteins (TIPs) and four plasma membrane intrinsic proteins (PIPs) from the 2-day-old petals of tulip (Tulipa gesneriana). In this study, we analyzed the development of tulip petals and stems, temperature-dependent petal movement, the amount of ³H₂O transported into petals and stems during petal movement, and the transcript levels of two TIP (TgTIP1;1 and TgTIP1;2) and four TgPIP genes in petals and stems, from the first day of petal opening to day 12. The development of the petals and stems was completed by days 6 and 9, respectively, after the first day of petal opening. Temperature-dependent petal movement and the amount of ³H₂O that was transported into petals could be detected at significant levels up to day 6 with petal movement reaching a peak at day 3. Real-time reverse transcription-polymerase chain reaction analysis revealed that TgTIP1;1 and TgTIP1;2 were expressed ubiquitously in petals, stems, leaves, bulbs and roots. However, the expression level of TgTIP1;2 was very low in bulbs. The expression of both TgTIP1 genes was upregulated in close association with the development of petals but not with that of the stem. The four TgPIP genes were expressed at almost the same level during the development of the petals and the stem. However, the levels of the TgTIP1 and TgPIP transcripts in petals decreased during the course of petal wilting from day 9 onwards. These results suggest that TgTIP1;1 and TgTIP1;2 may contribute to petal development. Copyright © Physiologia Plantarum 2012.

G protein, phosphorylated-GATA4 and VEGF expression in the hearts of transgenic mice overexpressing β1- and β2-adrenergic receptors

PubMed Central

Tae, Hyun-Jin; Petrashevskaya, Natalia; Kim, In Hye; Park, Joon Ha; Lee, Jae-Chul; Won, Moo-Ho; Kim, Yang Hee; Ahn, Ji Hyeon; Park, Jinseu; Choi, Soo Young; Jeon, Yong Hwan

2017-01-01

β1- and β2-adrenergic receptors (ARs) regulate cardiac contractility, calcium handling and protein phosphorylation. The present study aimed to examine the expression levels of vascular endothelial growth factor A (VEGF-A) and several G proteins, and the phosphorylation of transcription factor GATA binding protein 4 (GATA4), by western blot analysis, using isolated hearts from 6 month-old transgenic (TG) mice that overexpress β1AR or β2AR. Cardiac contractility/relaxation and heart rate was increased in both β1AR TG and β2AR TG mouse hearts compared with wild type; however, no significant differences were observed between the β1- and β2AR TG mouse hearts. Protein expression levels of inhibitory guanine nucleotide-binding protein (Gi) 2, Gi3 and G-protein-coupled receptor kinase 2 were upregulated in both TG mice, although the upregulation of Gi2 was more prominent in the β2AR TG mice. VEGF-A expression levels were also increased in both TG mice, and were highest in the β1AR TG mice. In addition, the levels of phosphorylated-GATA4 expression were increased in β1- and β2AR TG mice. In conclusion, the present study demonstrated that cardiac contractility/relaxation and heart rate is increased in β1AR TG and β2AR TG mice, and indicated that this increase may be related to the overexpression of G proteins and G-protein-associated proteins. PMID:28487987

Intravenous lipid infusion and total plasma fatty acids positively modulate plasma acylated ghrelin in vivo.

PubMed

Barazzoni, R; Gortan Cappellari, G; Semolic, A; Ius, M; Dore, F; Giacca, M; Zanetti, M; Vinci, P; Guarnieri, G

2017-06-01

Ghrelin is a gastric orexigenic hormone whose activating acylation plays a relevant role in the regulation of energy balance. Nutritional modulators of ghrelin acylation and plasma acylated ghrelin (AG) concentration remain however largely undefined. We aimed at investigating whether circulating free fatty acids (FFA) contribute to regulate plasma AG and its ratio (AG/TG) to total hormone (TG). Plasma FFA, TG, AG and AG/TG were measured in a primary outpatient care setting in a community-based population cohort of 850 individuals (age 54 ± 10 years, M/F: 408/442) from the North-East Italy MoMa study. 150-min intravenous lipid infusions in rodents (10% lipids, 600 μl/h) were used to investigate the potential causal role of FFA in the regulation of plasma ghrelin profile. Plasma FFA were associated positively with AG and AG/TG while negatively with TG (P < 0.01). Associations between FFA, AG and AG/TG remained statistically significant (P < 0.02) in multiple regression analysis including HOMA insulin resistance and metabolic confounders, and both AG and AG/TG but not TG increased through plasma FFA quartiles (P < 0.01). Consistent with these findings, intravenous lipid infusion with plasma FFA elevation caused elevations of AG and AG/TG (P < 0.05) with no TG modifications. The current findings demonstrate a novel role for circulating FFA availability to up-regulate plasma AG, which could involve FFA-induced stimulation of ghrelin acylation. Copyright © 2016 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

A Disposable Tear Glucose Biosensor—Part 4

PubMed Central

Engelschall, Erica; Lan, Kenneth; Shah, Pankti; Saez, Neil; Maxwell, Stephanie; Adamson, Teagan; Abou-Eid, Michelle; McAferty, Kenyon; Patel, Dharmendra R.; Cook, Curtiss B.

2014-01-01

Objective: A prototype tear glucose (TG) sensor was tested in New Zealand white rabbits to assess eye irritation, blood glucose (BG) and TG lag time, and correlation with BG. Methods: A total of 4 animals were used. Eye irritation was monitored by Lissamine green dye and analyzed using image analysis software. Lag time was correlated with an oral glucose load while recording TG and BG readings. Correlation between TG and BG were plotted against one another to form a correlation diagram, using a Yellow Springs Instrument (YSI) and self-monitoring of blood glucose as the reference measurements. Finally, TG levels were calculated using analytically derived expressions. Results: From repeated testing carried over the course of 12 months, little to no eye irritation was detected. TG fluctuations over time visually appeared to trace the same pattern as BG with an average lag times of 13 minutes. TG levels calculated from the device current measurements ranged from 4 to 20 mg/dL and correlated linearly with BG levels of 75-160 mg/dL (TG = 0.1723 BG = 7.9448 mg/dL; R2 = .7544). Conclusion: The first steps were taken toward preliminary development of a sensor for self-monitoring of tear glucose (SMTG). No conjunctival irritation in any of the animals was noted. Lag time between TG and BG was found to be noticeable, but a quantitative modeling to correlate lag time in this study is unnecessary. Measured currents from the sensors and the calculated TG showed promising correlation to BG levels. Previous analytical bench marking showed BG and TG levels consistent with other literature. PMID:24876546

Tibial tuberosity to trochlear groove distance and its association with patellofemoral osteoarthritis-related structural damage worsening: data from the osteoarthritis initiative.

PubMed

Haj-Mirzaian, Arya; Guermazi, Ali; Hakky, Michael; Sereni, Christopher; Zikria, Bashir; Roemer, Frank W; Tanaka, Miho J; Cosgarea, Andrew J; Demehri, Shadpour

2018-04-30

To determine whether the tibial tuberosity-to-trochlear groove (TT-TG) distance is associated with concurrent patellofemoral joint osteoarthritis (OA)-related structural damage and its worsening on 24-month follow-up magnetic resonance imaging (MRI) in participants in the Osteoarthritis Initiative (OAI). Six hundred subjects (one index knee per participant) were assessed. To evaluate patellofemoral OA-related structural damage, baseline and 24-month semiquantitative MRI Osteoarthritis Knee Score (MOAKS) variables for cartilage defects, bone marrow lesions (BMLs), osteophytes, effusion, and synovitis were extracted from available readings. The TT-TG distance was measured in all subjects using baseline MRIs by two musculoskeletal radiologists. The associations between baseline TT-TG distance and concurrent baseline MOAKS variables and their worsening in follow-up MRI were investigated using regression analysis adjusted for variables associated with tibiofemoral and patellofemoral OA. At baseline, increased TT-TG distance was associated with concurrent lateral patellar and trochlear cartilage damages, BML, osteophytes, and knee joint effusion [cross-sectional evaluations; overall odds ratio 95% confidence interval (OR 95% CI): 1.098 (1.045-1.154), p < 0.001]. In the longitudinal analysis, increased TT-TG distance was significantly related to lateral patellar and trochlear cartilage, BML, and joint effusion worsening (overall OR 95% CI: 1.111 (1.056-1.170), p < 0.001). TT-TG distance was associated with simultaneous lateral patellofemoral OA-related structural damage and its worsening over 24 months. Abnormally lateralized tibial tuberosity may be considered as a risk factor for future patellofemoral OA worsening. • Excessive TT-TG distance on MRI is an indicator/predictor of lateral-patellofemoral-OA. • TT-TG is associated with simultaneous lateral-patellofemoral-OA (6-17% chance-increase for each millimeter increase). • TT-TG is associated with longitudinal (24-months) lateral-patellofemoral-OA (5-15% chance-increase for each millimeter).

Acute Cholangitis After Bilioenteric Anastomosis for Bile Duct Injuries.

PubMed

Ortiz-Brizuela, Edgar; Sifuentes-Osornio, José; Manzur-Sandoval, Daniel; Terán-Ellis, Santiago Mier Y; Ponce-de-León, Sergio; Torres-González, Pedro; Mercado, Miguel Ángel

2017-10-01

The study aims to describe the clinical features, microbiology, and associated factors of acute cholangitis (AC) after bilioenteric anastomosis (BEA) for biliary duct injury (BDI). Additionally, we assessed the performance of the Tokyo Guidelines 2013 (TG13) recommendations in these patients. We conducted a case-control study of 524 adults with a history of BEA for BDI from January 2000 to January 2014. A propensity score adjustment was performed for the analysis of the independent role of the main factors identified during the univariate logistic regression procedure. We identified 117 episodes of AC in 70 patients; 51.3% were definitive AC according to the TG13 diagnostic criteria, and 39.3% did not fulfill the imaging criteria of AC. A history of post-operative biliary complications (OR 2.55, 95% CI 1.38-4.70) and the bile duct confluence preservation (OR 0.46, 95% CI 0.24-0.87) were associated with AC. Eighty-nine percent of the microorganisms were Enterobacteriaceae; of them, 28% were extended spectrum β-lactamase (ESBL) producers. AC is a common complication after BEA and must be suspected even in the absence of imaging findings, particulary in patients with a history of post-operative biliary complications, and/or without bile duct confluence preserved. An empirical treatment for ESBL-producing Enterobacteriaceae may be appropriate in patients living in countries with a high rate of bacterial drug resistance.

Synthesis and investigation of proton conductivity for intercalated kaolinite with 4-amidinopyridinium chloride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Li-Te; College of Materials Science and Engineering, Nanjing Tech University, Nanjing 210009; Li, Xiao-Pei

2015-12-15

The proton-conducting materials have potential application in devices such as fuel cells. In this study, a mineral kaolinite-based proton conducting material, kaolinite-4-amidinopyridinium hydrochloride (K-4-APy–HCl), was synthesized by the intercalated compound kaolinite-4-amidinopyridine (K-4-APy) adsorbing volatilizing HCl. The thermogravimetric analysis (TG), powder X-ray diffraction (PXRD) and IR spectrum confirmed the HCl successfully inserting into the interlayer space of kaolinite and the 4-aminopyridine being protonated. The intercalation efficiency is estimated to be ca. 85.6%. With respect to K-4-APy, the interlayer space expends by 1.53 Å. The thermal decomposition mechanism was studied by PXRD and TG techniques. The K-4-APy–HCl shows proton conductivity with σ=3.379×10{supmore » −8} S cm{sup −1} at 373 K and E{sub a}=1.159 eV in the anhydrous condition, which are comparable to MOFs-based proton conducting materials. - Graphical abstract: The intercalated hybrid of mineral kaolinite with 4-amidinopyridinium hydrochloride is prepared to use as proton conducting material. - Highlights: • A new strategy is proposed for preparation of kaolinite-based proton conductor. • Intercalatied hybrid was prepared by sequentially inserting 4-amidinopyridine and adsorbing HCl. • The proton conductivity of intercalated hybrid is comparable to MOFs-based proton-conductors.« less

One-step immunochromatographic visual assay for anti-transglutaminase detection in organ culture system: An easy and prompt method to simplify the in vitro diagnosis of celiac disease.

PubMed

Di Tola, Marco; Marino, Mariacatia; Casale, Rossella; Borghini, Raffaele; Tiberti, Antonio; Donato, Giuseppe; Occhiuzzi, Umberto; Picarelli, Antonio

2018-01-01

Anti-tissue transglutaminase (anti-tTG) and endomysium antibodies (EMA) are detectable in duodenal culture media of celiac disease (CD) patients. To improve the management of this organ culture system, we evaluated the anti-tTG occurrence by immunochromatographic assay (ICA). A total of 103 CD patients and 41 disease controls underwent duodenal biopsy for the organ culture. In culture supernatants, IgA anti-tTG were tested by both enzyme-linked immunosorbent assay (ELISA) and ICA, IgA EMA were searched by indirect immunofluorescence analysis (iIFA). Endomysium antibodies and anti-tTG measured by ELISA were positive in culture media of all CD patients, while anti-tTG detected by ICA were positive in culture media of 87/103 CD patients. Anti-tTG ICA scores significantly correlated with anti-tTG ELISA values (r=.71, P<.0001). Sensitivity, specificity and diagnostic accuracy of anti-tTG detected by ICA were 84.5%, 100% and 88.9%, respectively. Using ICA, anti-tTG are detectable in duodenal culture media of most CD patients and the intensity of indicative lines depends on the anti-tTG concentration. Sensitivity and diagnostic accuracy achieved with ICA are lower than those obtained with ELISA but, given that the first is a more easy and prompt method, data suggest the possibility of utilizing it in the in vitro diagnosis of CD. © 2017 Wiley Periodicals, Inc.

Triglyceride to high-density lipoprotein cholesterol (HDL-C) ratio and arterial stiffness in Japanese population: a secondary analysis based on a cross-sectional study.

PubMed

Chen, Chi; Dai, Jia-Lin

2018-05-29

Previous studies have revealed that triglyceride to high-density lipoprotein cholesterol (HDL-C) ratio (henceforth TG/HDL-C) is one of major risk factors of cardiovascular diseases, insulin resistance and metabolism syndrome. However, there are fewer scientific dissertations about the correlation between TG/HDL-C and bapWV. This study was undertaken to investigate the relationship between Triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio and brachial-ankle pulse wave velocity (baPWV) in Japanese. The present study was a cross-sectional study. 912 Japanese men and women, aging 24-84 years old, received a health medical a health check-up program including the results from baPWV inspection and various standardized questionnaire in a health examination Center in Japan. Main outcome measures included TG/HDL-C ratio, baPWV, fatty liver, postmenopausal status. Abdominal ultrasonography was used to diagnose fatty liver. Postmenopausal state was defined as beginning 1 year after the cessation of menses. It was noted that the entire study was completed by Fukuda et al., and uploaded the data to the DATADRYAD website. The author only used this data for secondary analysis. After adjusting potential confounders (age, sex, BMI, SBP, DBP, AST, ALT, GGT, uric acid, fasting glucose, TC, LDL, eGFR, smoking and exercise status, fatty liver, alcohol consumption and ABI), non-linear relationship was detected between TG/HDL-C and baPWV, whose point was 5.6. The effect sizes and the confidence intervals on the left and right sides of inflection point were 12.7 (1.9 to 23.5) and - 16.7 (- 36.8 to 3.3), respectively. Subgroup analysis showed, in participants with excessive alcohol consumption (more than 280 g/week), that TG/HDL-C had a negative correlation with BAPWV (β = - 30.7, 95%CI (- 53.1, - 8.4)), and the P for interaction was less than 0.05, CONCLUSION: The relationship between TG/HDL-C and baPWV is non-linear. TG/HDL-C was positively related with baPWV when TG/HDL-C is less than 5.6. In addition, while the trend is opposite in excessive alcoholic subjects.

Characterization of four plasma membrane aquaporins in tulip petals: a putative homolog is regulated by phosphorylation.

PubMed

Azad, Abul Kalam; Katsuhara, Maki; Sawa, Yoshihiro; Ishikawa, Takahiro; Shibata, Hitoshi

2008-08-01

We suggested previously that temperature-dependent tulip (Tulipa gesneriana) petal movement that is concomitant with water transport is regulated by reversible phosphorylation of an unidentified plasma membrane intrinsic protein (PIP). In this study, four full-length cDNAs of PIPs from tulip petals were identified and cloned. Two PIPs, namely TgPIP1;1 and TgPIP1;2, are members of the PIP1 subfamily, and the remaining two PIPs, namely TgPIP2;1 and TgPIP2;2, belong to the PIP2 subfamily of aquaporins and were named according to the nomenclature of PIP genes in plants. Of these four homologs, only TgPIP2;2 displayed significant water channel activity in the heterologous expression assay using Xenopus laevis oocytes. The water channel activity of this functional isoform was abolished by mercury and was affected by inhibitors of protein kinase and protein phosphatase. Using a site-directed mutagenesis approach to substitute several serine residues with alanine, and assessing water channel activity using the methylotrophic yeast Pichia pastoris expression assay, we showed that Ser35, Ser116 and Ser274 are the putative phosphorylation sites of TgPIP2;2. Real-time reverse transcription-PCR analysis revealed that the transcript levels of TgPIP1;1 and TgPIP1;2 in tulip petals, stems, leaves, bulbs and roots are very low when compared with those of TgPIP2;1 and TgPIP2;2. The transcript level of TgPIP2;1 is negligible in roots, and TgPIP2;2 is ubiquitously expressed in all organs with significant transcript levels. From the data reported herein, we suggest that TgPIP2;2 might be modulated by phosphorylation and dephosphorylation for regulating water channel activity, and may play a role in transcellular water transport in all tulip organs.

A1 adenosine receptor-induced phosphorylation and modulation of transglutaminase 2 activity in H9c2 cells: A role in cell survival.

PubMed

Vyas, Falguni S; Hargreaves, Alan J; Bonner, Philip L R; Boocock, David J; Coveney, Clare; Dickenson, John M

2016-05-01

The regulation of tissue transglutaminase (TG2) activity by the GPCR family is poorly understood. In this study, we investigated the modulation of TG2 activity by the A1 adenosine receptor in cardiomyocyte-like H9c2 cells. H9c2 cells were lysed following stimulation with the A1 adenosine receptor agonist N(6)-cyclopentyladenosine (CPA). Transglutaminase activity was determined using an amine incorporating and a protein cross linking assay. TG2 phosphorylation was assessed via immunoprecipitation and Western blotting. The role of TG2 in A1 adenosine receptor-induced cytoprotection was investigated by monitoring hypoxia-induced cell death. CPA induced time and concentration-dependent increases in amine incorporating and protein crosslinking activity of TG2. CPA-induced increases in TG2 activity were attenuated by the TG2 inhibitors Z-DON and R283. Responses to CPA were blocked by PKC (Ro 31-8220), MEK1/2 (PD 98059), p38 MAPK (SB 203580) and JNK1/2 (SP 600125) inhibitors and by removal of extracellular Ca(2+). CPA triggered robust increases in the levels of TG2-associated phosphoserine and phosphothreonine, which were attenuated by PKC, MEK1/2 and JNK1/2 inhibitors. Fluorescence microscopy revealed TG2-mediated biotin-X-cadaverine incorporation into proteins and proteomic analysis identified known (Histone H4) and novel (Hexokinase 1) protein substrates for TG2. CPA pre-treatment reversed hypoxia-induced LDH release and decreases in MTT reduction. TG2 inhibitors R283 and Z-DON attenuated A1 adenosine receptor-induced cytoprotection. TG2 activity was stimulated by the A1 adenosine receptor in H9c2 cells via a multi protein kinase dependent pathway. These results suggest a role for TG2 in A1 adenosine receptor-induced cytoprotection. Copyright © 2016 Elsevier Inc. All rights reserved.

Pretherapeutic FDG-PET total metabolic tumor volume predicts response to induction therapy in pediatric Hodgkin's lymphoma.

PubMed

Rogasch, Julian M M; Hundsdoerfer, Patrick; Hofheinz, Frank; Wedel, Florian; Schatka, Imke; Amthauer, Holger; Furth, Christian

2018-05-03

Standardized treatment in pediatric patients with Hodgkin's lymphoma (HL) follows risk stratification by tumor stage, erythrocyte sedimentation rate and tumor bulk. We aimed to identify quantitative parameters from pretherapeutic FDG-PET to assist prediction of response to induction chemotherapy. Retrospective analysis in 50 children with HL (f:18; m:32; median age, 14.8 [4-18] a) consecutively treated according to EuroNet-PHL-C1 (n = 42) or -C2 treatment protocol (n = 8). Total metabolic tumor volume (MTV) in pretherapeutic FDG-PET was defined using a semi-automated, background-adapted threshold. Metabolic (SUVmax, SUVmean, SUVpeak, total lesion glycolysis [MTV*SUVmean]) and heterogeneity parameters (asphericity [ASP], entropy, contrast, local homogeneity, energy, and cumulative SUV-volume histograms) were derived. Early response assessment (ERA) was performed after 2 cycles of induction chemotherapy according to treatment protocol and verified by reference rating. Prediction of inadequate response (IR) in ERA was based on ROC analysis separated by stage I/II (1 and 26 patients) and stage III/IV disease (7 and 16 patients) or treatment group/level (TG/TL) 1 to 3. IR was seen in 28/50 patients (TG/TL 1, 6/12 patients; TG/TL 2, 10/17; TG/TL 3, 12/21). Among all PET parameters, MTV best predicted IR; ASP was the best heterogeneity parameter. AUC of MTV was 0.84 (95%-confidence interval, 0.69-0.99) in stage I/II and 0.86 (0.7-1.0) in stage III/IV. In patients of TG/TL 1, AUC of MTV was 0.92 (0.74-1.0); in TG/TL 2 0.71 (0.44-0.99), and in TG/TL 3 0.85 (0.69-1.0). Patients with high vs. low MTV had IR in 86 vs. 0% in TG/TL 1, 80 vs. 29% in TG/TL 2, and 90 vs. 27% in TG/TL 3 (cut-off, > 80 ml, > 160 ml, > 410 ml). In this explorative study, high total MTV best predicted inadequate response to induction therapy in pediatric HL of all pretherapeutic FDG-PET parameters - in both low and high stages as well as the 3 different TG/TL. Ethics committee number: EA2/151/16 (retrospectively registered).

New insights into thyroglobulin gene: molecular analysis of seven novel mutations associated with goiter and hypothyroidism.

PubMed

Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2013-01-30

The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Temperature-induced sol-gel transition and microgel formation in α-actinin cross-linked actin networks: A rheological study

NASA Astrophysics Data System (ADS)

Tempel, M.; Isenberg, G.; Sackmann, E.

1996-08-01

We have studied the sol-gel transition, the viscoelastic and the structural properties of networks constituted of semiflexible actin filaments cross-linked by α-actinin. Cross-linking was regulated in a reversible way by varying the temperature through the association-dissociation equilibrium of the actin-α-actinin system. Viscoelastic parameters [shear storage modulus G'(ω), phase shift tan(Φ)(ω), creep compliance J(t)] were measured as a function of temperature and actin-to-cross-linker ratio by a magnetically driven rotating disc rheometer. G'(ω) and tan(Φ)(ω) were studied at a frequency ω corresponding to the elastic plateau regime of the G'(ω) versus ω spectrum of the purely entangled solution. The microstructure of the networks was viewed by negative staining electron microscopy (EM). The phase shift tan(Φ) (or equivalently the viscosity η) diverges and reaches a maximum when approaching the apparent gel point from lower and higher temperatures, and the maximum defines the gel point (temperature Tg). The elastic plateau modulus G'N diverges at temperatures beyond this gel point TTg. The cross-linking transition (corresponding to a sol-gel transition at zero frequency) is interpreted in terms of a percolation model and the divergence of G'N at TTg), (2) that microscopic segregation takes place at T<=Tg leading to local formation of clusters (a state termed microgel), and (3) that at low actin-α-actinin ratios (rAα<=10) and low temperatures (T<=10 °C) macroscopic segregation into bundles of cross-linked actin filaments and a diluted solution of actin filaments is observed. The three regimes of network structure are represented by an equivalent phase diagram.

Multiple SNPs in Intron 41 of Thyroglobulin Gene Are Associated with Autoimmune Thyroid Disease in the Japanese Population

PubMed Central

Ban, Yoshiyuki; Tozaki, Teruaki; Taniyama, Matsuo; Skrabanek, Luce; Nakano, Yasuko; Ban, Yoshio; Hirano, Tsutomu

2012-01-01

Background The etiology of the autoimmune thyroid diseases (AITDs), Graves' disease (GD) and Hashimoto's thyroiditis (HT), is largely unknown. However, genetic susceptibility is believed to play a major role. Two whole genome scans from Japan and from the US identified a locus on chromosome 8q24 that showed evidence for linkage with AITD and HT. Recent studies have demonstrated an association between thyroglobulin (Tg) polymorphisms and AITD in Caucasians, suggesting that Tg is a susceptibility gene on 8q24. Objectives The objective of the study was to refine Tg association with AITD, by analyzing a panel of 25 SNPs across an extended 260 kb region of the Tg. Methods We studied 458 Japanese AITD patients (287 GD and 171 HT patients) and 221 matched Japanese control subjects in association studies. Case-control association studies were performed using 25 Tg single nucleotide polymorphisms (SNPs) chosen from a database of the Single Nucleotide Polymorphism Database (dbSNP). Haplotype analysis was undertaken using the computer program SNPAlyze version 7.0. Principal Findings and Conclusions In total, 5 SNPs revealed association with GD (P<0.05), with the strongest SNP associations at rs2256366 (P = 0.002) and rs2687836 (P = 0.0077), both located in intron 41 of the Tg gene. Because of the strong LD between these two strongest associated variants, we performed the haplotype analysis, and identified a major protective haplotype for GD (P = 0.001).These results suggested that the Tg gene is involved in susceptibility for GD and AITD in the Japanese. PMID:22662162

Polymer brushes: a controllable system with adjustable glass transition temperature of fragile glass formers.

PubMed

Xie, Shi-Jie; Qian, Hu-Jun; Lu, Zhong-Yuan

2014-01-28

We present results of molecular dynamics simulations for coarse-grained polymer brushes in a wide temperature range to investigate the factors that affect the glass transition in these systems. We focus on the influences of free surface, polymer-substrate interaction strength, grafting density, and chain length not only on the change of glass transition temperature Tg, but also the fragility D of the glass former. It is found that the confinement can enhance the dependence of the Tg on the cooling rate as compared to the bulk melt. Our layer-resolved analysis demonstrates that it is possible to control the glass transition temperature Tg of polymer brushes by tuning the polymer-substrate interaction strength, the grafting density, and the chain length. Moreover, we find quantitative differences in the influence range of the substrate and the free surface on the density and dynamics. This stresses the importance of long range cooperative motion in glass formers near the glass transition temperature. Furthermore, the string-like cooperative motion analysis demonstrates that there exists a close relation among glass transition temperature Tg, fragility D, and string length ⟨S⟩. The polymer brushes that possess larger string length ⟨S⟩ tend to have relatively higher Tg and smaller D. Our results suggest that confining a fragile glass former through forming polymer brushes changes not only the glass transition temperature Tg, but also the very nature of relaxation process.

Triacylglycerol secretion in rats: validation of a tracer method employing radioactive glycerol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bird, M.; Williams, M.A.; Baker, N.

1984-10-01

A two-compartment model was developed to analyze the temporal changes in plasma triacylglycerol (TG)-specific radioactivity after injection of (2-/sup 3/H)glycerol into rats. The analysis, which yielded fractional rate constants of TG secretion, was tested in rats fed diets either adequate or deficient in essential fatty acids (EFA) and containing either glucose, fructose or sucrose as the dietary carbohydrate. The method of analysis appeared valid, first, because of a close agreement between experimental and computer-fitted TG-specific radioactivity curves, and second, because the fractional rate constants obtained were quite similar to fractional rate constants determined previously by the Triton WR-1339 technique inmore » rats maintained on identical diets. The results show that EFA deficiency increased the fractional rate constant of TG secretion 1.7-, 1.8- and 3.3-fold and the rate of TG secretion 1.8-, 1.6- and 1.4-fold when the dietary carbohydrate was glucose, sucrose and fructose, respectively, in comparison with control rats fed diets supplying these same carbohydrates but adequate in EFA. In the latter groups, the rates of plasma TG secretion were in the range of 0.14-0.17 mg/min per 100 g body weight, and the rate of secretion in the fructose-fed rats was only 20% higher than in the glucose-fed rats.« less

Growth, structural, spectral, optical, and thermal studies on amino acid based new NLO single crystal: L-phenylalanine-4-nitrophenol.

PubMed

Prakash, M; Lydia Caroline, M; Geetha, D

2013-05-01

A new organic nonlinear optical single crystal, L-phenylalanine-4-nitrophenol (LPAPN) belonging to the amino acid group has been successfully grown by slow evaporation technique. The lattice parameters of the grown crystal have been determined by X-ray diffraction studies. FT-IR spectrum was recorded to identify the presence of functional group and molecular structure was confirmed by NMR spectrum. Thermal strength of the grown crystal has been studied using TG-DTA analyses. The grown crystals were found to be transparent in the entire visible region. The existence of second harmonic generation signals was observed using Nd:YAG laser with fundamental wavelength of 1064 nm. Copyright © 2013 Elsevier B.V. All rights reserved.

A Toxoplasma gondii Class XIV Myosin, Expressed in Sf9 Cells with a Parasite Co-chaperone, Requires Two Light Chains for Fast Motility*

PubMed Central

Bookwalter, Carol S.; Kelsen, Anne; Leung, Jacqueline M.; Ward, Gary E.; Trybus, Kathleen M.

2014-01-01

Many diverse myosin classes can be expressed using the baculovirus/Sf9 insect cell expression system, whereas others have been recalcitrant. We hypothesized that most myosins utilize Sf9 cell chaperones, but others require an organism-specific co-chaperone. TgMyoA, a class XIVa myosin from the parasite Toxoplasma gondii, is required for the parasite to efficiently move and invade host cells. The T. gondii genome contains one UCS family myosin co-chaperone (TgUNC). TgMyoA expressed in Sf9 cells was soluble and functional only if the heavy and light chain(s) were co-expressed with TgUNC. The tetratricopeptide repeat domain of TgUNC was not essential to obtain functional myosin, implying that there are other mechanisms to recruit Hsp90. Purified TgMyoA heavy chain complexed with its regulatory light chain (TgMLC1) moved actin in a motility assay at a speed of ∼1.5 μm/s. When a putative essential light chain (TgELC1) was also bound, TgMyoA moved actin at more than twice that speed (∼3.4 μm/s). This result implies that two light chains bind to and stabilize the lever arm, the domain that amplifies small motions at the active site into the larger motions that propel actin at fast speeds. Our results show that the TgMyoA domain structure is more similar to other myosins than previously appreciated and provide a molecular explanation for how it moves actin at fast speeds. The ability to express milligram quantities of a class XIV myosin in a heterologous system paves the way for detailed structure-function analysis of TgMyoA and identification of small molecule inhibitors. PMID:25231988

Thioredoxin-1 Selectively Activates Transglutaminase 2 in the Extracellular Matrix of the Small Intestine

PubMed Central

Plugis, Nicholas M.; Palanski, Brad A.; Weng, Chih-Hisang; Albertelli, Megan; Khosla, Chaitan

2017-01-01

Transglutaminase 2 (TG2) catalyzes transamidation or deamidation of its substrates and is ordinarily maintained in a catalytically inactive state in the intestine and other organs. Aberrant TG2 activity is thought to play a role in celiac disease, suggesting that a better understanding of TG2 regulation could help to elucidate the mechanistic basis of this malady. Structural and biochemical analysis has led to the hypothesis that extracellular TG2 activation involves reduction of an allosteric disulfide bond by thioredoxin-1 (TRX), but cellular and in vivo evidence for this proposal is lacking. To test the physiological relevance of this hypothesis, we first showed that macrophages exposed to pro-inflammatory stimuli released TRX in sufficient quantities to activate their extracellular pools of TG2. By using the C35S mutant of TRX, which formed a metastable mixed disulfide bond with TG2, we demonstrated that these proteins specifically recognized each other in the extracellular matrix of fibroblasts. When injected into mice and visualized with antibodies, we observed the C35S TRX mutant bound to endogenous TG2 as its principal protein partner in the small intestine. Control experiments showed no labeling of TG2 knock-out mice. Intravenous administration of recombinant TRX in wild-type mice, but not TG2 knock-out mice, led to a rapid rise in intestinal transglutaminase activity in a manner that could be inhibited by small molecules targeting TG2 or TRX. Our findings support the potential pathophysiological relevance of TRX in celiac disease and establish the Cys370–Cys371 disulfide bond of TG2 as one of clearest examples of an allosteric disulfide bond in mammals. PMID:28003361

β2-adrenoceptor-induced modulation of transglutaminase 2 transamidase activity in cardiomyoblasts.

PubMed

Vyas, Falguni S; Nelson, Carl P; Freeman, Fiona; Boocock, David J; Hargreaves, Alan J; Dickenson, John M

2017-10-15

Tissue transglutaminase 2 (TG2) is modulated by protein kinase A (PKA) mediated phosphorylation: however, the precise mechanism(s) of its modulation by G-protein coupled receptors coupled to PKA activation are not fully understood. In the current study we investigated the potential regulation of TG2 activity by the β 2 -adrenoceptor in rat H9c2 cardiomyoblasts. Transglutaminase transamidation activity was assessed using amine-incorporating and protein cross-linking assays. TG2 phosphorylation was determined via immunoprecipitation and Western blotting. The long acting β 2 -adrenoceptor agonist formoterol induced time- and concentration-dependent increases in TG2 transamidation. Increases in TG2 activity were reduced by the TG2 inhibitors Z-DON (Benzyloxycarbonyl-(6-Diazo-5-oxonorleucinyl)-L-valinyl-L-prolinyl-L-leucinmethylester) and R283 ((1,3,dimethyl-2[2-oxo-propyl]thio)imidazole chloride). Responses to formoterol were blocked by pharmacological inhibition of PKA, extracellular signal-regulated kinase 1 and 2 (ERK1/2), or phosphatidylinositol 3-kinase (PI-3K) signalling. Furthermore, the removal of extracellular Ca 2+ also attenuated formoterol-induced TG2 activation. Fluorescence microscopy demonstrated TG2-induced biotin-X-cadaverine incorporation into proteins. Formoterol increased the levels of TG2-associated phosphoserine and phosphothreonine, which were blocked by inhibition of PKA, ERK1/2 or PI-3K signalling. Subsequent proteomic analysis identified known (e.g. lactate dehydrogenase A chain) and novel (e.g. Protein S100-A6) protein substrates for TG2. Taken together, the data obtained suggest that β 2 -adrenoceptor-induced modulation of TG2 represents a novel paradigm in β 2 -adrenoceptor cell signalling, expanding the repertoire of cellular functions responsive to catecholamine stimulation. Copyright © 2017 Elsevier B.V. All rights reserved.

A Disposable Tear Glucose Biosensor-Part 4: Preliminary Animal Model Study Assessing Efficacy, Safety, and Feasibility.

PubMed

La Belle, Jeffrey T; Engelschall, Erica; Lan, Kenneth; Shah, Pankti; Saez, Neil; Maxwell, Stephanie; Adamson, Teagan; Abou-Eid, Michelle; McAferty, Kenyon; Patel, Dharmendra R; Cook, Curtiss B

2014-01-01

A prototype tear glucose (TG) sensor was tested in New Zealand white rabbits to assess eye irritation, blood glucose (BG) and TG lag time, and correlation with BG. A total of 4 animals were used. Eye irritation was monitored by Lissamine green dye and analyzed using image analysis software. Lag time was correlated with an oral glucose load while recording TG and BG readings. Correlation between TG and BG were plotted against one another to form a correlation diagram, using a Yellow Springs Instrument (YSI) and self-monitoring of blood glucose as the reference measurements. Finally, TG levels were calculated using analytically derived expressions. From repeated testing carried over the course of 12 months, little to no eye irritation was detected. TG fluctuations over time visually appeared to trace the same pattern as BG with an average lag times of 13 minutes. TG levels calculated from the device current measurements ranged from 4 to 20 mg/dL and correlated linearly with BG levels of 75-160 mg/dL (TG = 0.1723 BG = 7.9448 mg/dL; R 2 = .7544). The first steps were taken toward preliminary development of a sensor for self-monitoring of tear glucose (SMTG). No conjunctival irritation in any of the animals was noted. Lag time between TG and BG was found to be noticeable, but a quantitative modeling to correlate lag time in this study is unnecessary. Measured currents from the sensors and the calculated TG showed promising correlation to BG levels. Previous analytical bench marking showed BG and TG levels consistent with other literature. © 2014 Diabetes Technology Society.

Genome-Wide Association Study Reveals Four Loci for Lipid Ratios in the Korean Population and the Constitutional Subgroup.

PubMed

Kim, Taehyeung; Park, Ah Yeon; Baek, Younghwa; Cha, Seongwon

2017-01-01

Circulating lipid ratios are considered predictors of cardiovascular risks and metabolic syndrome, which cause coronary heart diseases. One constitutional type of Korean medicine prone to weight accumulation, the Tae-Eum type, predisposes the consumers to metabolic syndrome, hypertension, diabetes mellitus, etc. Here, we aimed to identify genetic variants for lipid ratios using a genome-wide association study (GWAS) and followed replication analysis in Koreans and constitutional subgroups. GWASs in 5,292 individuals of the Korean Genome and Epidemiology Study and replication analyses in 2,567 subjects of the Korea medicine Data Center were performed to identify genetic variants associated with triglyceride (TG) to HDL cholesterol (HDLC), LDL cholesterol (LDLC) to HDLC, and non-HDLC to HDLC ratios. For subgroup analysis, a computer-based constitution analysis tool was used to categorize the constitutional types of the subjects. In the discovery stage, seven variants in four loci, three variants in three loci, and two variants in one locus were associated with the ratios of log-transformed TG:HDLC (log[TG]:HDLC), LDLC:HDLC, and non-HDLC:HDLC, respectively. The associations of the GWAS variants with lipid ratios were replicated in the validation stage: for the log[TG]:HDLC ratio, rs6589566 near APOA5 and rs4244457 and rs6586891 near LPL; for the LDLC:HDLC ratio, rs4420638 near APOC1 and rs17445774 near C2orf47; and for the non-HDLC:HDLC ratio, rs6589566 near APOA5. Five of these six variants are known to be associated with TG, LDLC, and/or HDLC, but rs17445774 was newly identified to be involved in lipid level changes in this study. Constitutional subgroup analysis revealed effects of variants associated with log[TG]:HDLC and non-HDLC:HDLC ratios in both the Tae-Eum and non-Tae-Eum types, whereas the effect of the LDLC:HDLC ratio-associated variants remained only in the Tae-Eum type. In conclusion, we identified three log[TG]:HDLC ratio-associated variants, two LDLC:HDLC ratio-associated variants, and one non-HDLC:HDLC-associated variant in Koreans and the constitutional subgroups.

Genome-Wide Association Study Reveals Four Loci for Lipid Ratios in the Korean Population and the Constitutional Subgroup

PubMed Central

Kim, Taehyeung; Park, Ah Yeon; Baek, Younghwa

2017-01-01

Circulating lipid ratios are considered predictors of cardiovascular risks and metabolic syndrome, which cause coronary heart diseases. One constitutional type of Korean medicine prone to weight accumulation, the Tae-Eum type, predisposes the consumers to metabolic syndrome, hypertension, diabetes mellitus, etc. Here, we aimed to identify genetic variants for lipid ratios using a genome-wide association study (GWAS) and followed replication analysis in Koreans and constitutional subgroups. GWASs in 5,292 individuals of the Korean Genome and Epidemiology Study and replication analyses in 2,567 subjects of the Korea medicine Data Center were performed to identify genetic variants associated with triglyceride (TG) to HDL cholesterol (HDLC), LDL cholesterol (LDLC) to HDLC, and non-HDLC to HDLC ratios. For subgroup analysis, a computer-based constitution analysis tool was used to categorize the constitutional types of the subjects. In the discovery stage, seven variants in four loci, three variants in three loci, and two variants in one locus were associated with the ratios of log-transformed TG:HDLC (log[TG]:HDLC), LDLC:HDLC, and non-HDLC:HDLC, respectively. The associations of the GWAS variants with lipid ratios were replicated in the validation stage: for the log[TG]:HDLC ratio, rs6589566 near APOA5 and rs4244457 and rs6586891 near LPL; for the LDLC:HDLC ratio, rs4420638 near APOC1 and rs17445774 near C2orf47; and for the non-HDLC:HDLC ratio, rs6589566 near APOA5. Five of these six variants are known to be associated with TG, LDLC, and/or HDLC, but rs17445774 was newly identified to be involved in lipid level changes in this study. Constitutional subgroup analysis revealed effects of variants associated with log[TG]:HDLC and non-HDLC:HDLC ratios in both the Tae-Eum and non-Tae-Eum types, whereas the effect of the LDLC:HDLC ratio-associated variants remained only in the Tae-Eum type. In conclusion, we identified three log[TG]:HDLC ratio-associated variants, two LDLC:HDLC ratio-associated variants, and one non-HDLC:HDLC-associated variant in Koreans and the constitutional subgroups. PMID:28046027

Poster - 19: Investigation of Electron Reference Dosimetry Based on Optimal Chamber Shift

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhan, Lixin; Jiang, Runqing; Liu, Baochang

An addendum/revision to AAPM TG-51 electron reference dosimetry is highly expected to meet the clinical requirement with the increasing usage of new ion chambers not covered in TG-51. A recent study, Med. Phys. 41, 111701, proposed a new fitting equation for the beam quality conversion factor k’{sub Q} to a wide spectrum of chambers. In the study, an optimal Effective Point of Measurement (EPOM) from Monte Carlo calculations was recommended and the fitting parameters to k’{sub Q} was based on it. We investigated the absolute dose obtained based on the optimal EPOM method and the original TG-51 method with k’{submore » R50} determined differently. The results showed that using the Markus curve is a better choice than the well-guarded chamber fitting for an IBA PPC-05 parallel plate chamber if we need to strictly follow the AAPM TG-51 protocol. We also examined the usage of the new fitting equation with measurement performed at the physical EPOM, instead of the optimal EPOM. The former is more readily determined and more practical in clinics. Our study indicated that the k’{sub Q} fitting based on the optimal EPOM can be used to measurement at the physical EPOM with no significant clinical impact. The inclusion of Farmer chamber gradient correction P{sub gr} in k’{sub Q}, as in the mentioned study, asks for the precise positioning of chamber center at dref. It is not recommended in clinics to avoid over-correction for low electron energies, especially for an institute having matching Linacs implemented.« less

Clinical usefulness of lipid ratios, visceral adiposity indicators, and the triglycerides and glucose index as risk markers of insulin resistance.

PubMed

Du, Tingting; Yuan, Gang; Zhang, Muxun; Zhou, Xinrong; Sun, Xingxing; Yu, Xuefeng

2014-10-20

To directly compare traditional lipid ratios (total cholesterol [TC]/high density lipoprotein cholesterol [HDL-C], non-HDL-C/HDL-C, low density lipoprotein cholesterol [LDL-C]/HDL-C, and triglycerides [TG]/HDL-C), apolipoprotein B (apoB)/apolipoprotein A-I (apoA-I) ratio, visceral adiposity index (VAI), lipid accumulation product (LAP), and the product of TG and fasting glucose (TyG) for strength and independence as risk factors for insulin resistance (IR). We conducted a cross-sectional analysis of 7629 Chinese adults using data from the China Health and Nutrition Survey 2009. For all lipid ratios (traditional lipid ratios and apoB/apoA-I), among both sexes, TG/HDL-C explained the most additional percentage of variation in HOMA-IR (2.9% in men, and 2.3% in women); for all variables of interest, the variability in HOMA-IR explained by VAI and TG/HDL-C were comparable; TyG had the most significant association with HOMA-IR, which explained 9.1% for men and 7.8% for women of the variability in HOMA-IR. Logistic regression analysis showed the similar patterns. Receiver operating characteristic (ROC) curve analysis showed that, among both sexes, TG/HDL-C was a better discriminator of IR than apoB/apoA-I; the area under the ROC curve (AUC) for VAI (0.695 in men and 0.682 in women) was greater than that for TG/HDL-C (AUC 0.665 in men and 0.664 in women); TyG presented the greatest value of AUC (0.709 in men and 0.711 in women). The apoB/apoA-I performs no better than any of the traditional lipid ratios in correlating with IR. The TG/HDL-C, VAI and TyG are better markers for early identification of IR individuals.

Proximal gastrectomy versus total gastrectomy for proximal gastric carcinoma. A meta-analysis on postoperative complications, 5-year survival, and recurrence rate.

PubMed

Pu, Yu-Wei; Gong, Wei; Wu, Yong-You; Chen, Qiang; He, Teng-Fei; Xing, Chun-Gen

2013-12-01

To compare proximal gastrectomy (PG) with total gastrectomy (TG) for proximal gastric carcinoma, through the 5-year survival rate, recurrence rate, postoperative complications, and long-term life quality. The meta-analysis was carried out in the General Surgery Department of the Second Affiliated Hospital of Soochow University, Suzhou, Jiangsu Province, China. We searched Medline, EMBASE, and the Cochrane Library from June to November 2012. The literature searches were carried out using medical subject headings and free-text word: `proximal gastrectomy` `total gastrectomy` `partial gastrectomy` `stomach neoplasms` and `gastric cancer`. Two different reviewers carried out the search and evaluated studies independently. Two randomized controlled trials and 9 retrospective studies were included. A total of 1364 patients were included in our study. Our analysis showed that there is no statistically significant difference in 5-year survival rate between PG and TG (60.9% versus 64.4%). But, the recurrence is higher in the PG group than the TG (38.7% versus 24.4%). The anastomotic stenosis rate is also higher in the PG than the TG (27.4% versus 7.4%). Proximal gastrectomy is an option for upper third gastric cancer in terms of safety. However, it is associated with high risk of reflux symptoms and anastomotic stenosis. Therefore, TG should be the first choice for proximal gastric cancer to prevent reflux symptoms.

Social skills training for children with autism spectrum disorder using a robotic behavioral intervention system.

PubMed

Yun, Sang-Seok; Choi, JongSuk; Park, Sung-Kee; Bong, Gui-Young; Yoo, HeeJeong

2017-07-01

We designed a robot system that assisted in behavioral intervention programs of children with autism spectrum disorder (ASD). The eight-session intervention program was based on the discrete trial teaching protocol and focused on two basic social skills: eye contact and facial emotion recognition. The robotic interactions occurred in four modules: training element query, recognition of human activity, coping-mode selection, and follow-up action. Children with ASD who were between 4 and 7 years old and who had verbal IQ ≥ 60 were recruited and randomly assigned to the treatment group (TG, n = 8, 5.75 ± 0.89 years) or control group (CG, n = 7; 6.32 ± 1.23 years). The therapeutic robot facilitated the treatment intervention in the TG, and the human assistant facilitated the treatment intervention in the CG. The intervention procedures were identical in both groups. The primary outcome measures included parent-completed questionnaires, the Autism Diagnostic Observation Schedule (ADOS), and frequency of eye contact, which was measured with the partial interval recording method. After completing treatment, the eye contact percentages were significantly increased in both groups. For facial emotion recognition, the percentages of correct answers were increased in similar patterns in both groups compared to baseline (P > 0.05), with no difference between the TG and CG (P > 0.05). The subjects' ability to play, general behavioral and emotional symptoms were significantly diminished after treatment (p < 0.05). These results showed that the robot-facilitated and human-facilitated behavioral interventions had similar positive effects on eye contact and facial emotion recognition, which suggested that robots are useful mediators of social skills training for children with ASD. Autism Res 2017,. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism Res 2017, 10: 1306-1323. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

Identification and characterization of a novel DGAT1 missense mutation associated with congenital diarrhea[S

PubMed Central

Gluchowski, Nina L.; Chitraju, Chandramohan; Picoraro, Joseph A.; Mejhert, Niklas; Pinto, Shirly; Xin, Winnie; Kamin, Daniel S.; Winter, Harland S.; Chung, Wendy K.; Walther, Tobias C.; Farese, Robert V.

2017-01-01

Acyl-CoA:diacylglycerol acyltransferase (DGAT)1 and DGAT2 catalyze triglyceride (TG) biosynthesis in humans. Biallelic loss-of-function mutations in human DGAT1 result in severe congenital diarrhea and protein-losing enteropathy. Additionally, pharmacologic inhibition of DGAT1 led to dose-related diarrhea in human clinical trials. Here we identify a previously unknown DGAT1 mutation in identical twins of South Asian descent. These male patients developed watery diarrhea shortly after birth, with protein-losing enteropathy and failure to thrive. Exome sequencing revealed a homozygous recessive mutation in DGAT1, c.314T>C, p.L105P. We show here that the p.L105P DGAT1 enzyme produced from the mutant allele is less abundant, resulting in partial loss of TG synthesis activity and decreased formation of lipid droplets in patient-derived primary dermal fibroblasts. Thus, in contrast with complete loss-of-function alleles of DGAT1, the p.L105P missense allele partially reduces TG synthesis activity and causes a less severe clinical phenotype. Our findings add to the growing recognition of DGAT1 deficiency as a cause of congenital diarrhea with protein-losing enteropathy and indicate that DGAT1 mutations result in a spectrum of diseases. PMID:28373485

Spectroscopic studies and quantum chemical investigations of (3,4-dimethoxybenzylidene) propanedinitrile

NASA Astrophysics Data System (ADS)

Gupta, Ujval; Kumar, Vinay; Singh, Vivek K.; Kant, Rajni; Khajuria, Yugal

2015-04-01

The Fourier Transform Infrared (FTIR), Ultra-Violet Visible (UV-Vis) spectroscopy and Thermogravimetric (TG) analysis of (3,4-dimethoxybenzylidene) propanedinitrile have been carried out and investigated using quantum chemical calculations. The molecular geometry, harmonic vibrational frequencies, Mulliken charges, natural atomic charges and thermodynamic properties in the ground state have been investigated by using Hartree Fock Theory (HF) and Density Functional Theory (DFT) using B3LYP functional with 6-311G(d,p) basis set. Both HF and DFT methods yield good agreement with the experimental data. Vibrational modes are assigned with the help of Vibrational Energy Distribution Analysis (VEDA) program. UV-Visible spectrum was recorded in the spectral range of 190-800 nm and the results are compared with the calculated values using TD-DFT approach. Stability of the molecule arising from hyperconjugative interactions, charge delocalization have been analyzed using natural bond orbital (NBO) analysis. The results obtained from the studies of Highest Occupied Molecular Orbital (HOMO) and Lowest Unoccupied Molecular Orbital (LUMO) are used to calculate molecular parameters like ionization potential, electron affinity, global hardness, electron chemical potential and global electrophilicity.

Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

PubMed

Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

2010-01-01

Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

Redox Proteomic Profiling of Specifically Carbonylated Proteins in the Serum of Triple Transgenic Alzheimer's Disease Mice.

PubMed

Shen, Liming; Chen, Youjiao; Yang, Aochu; Chen, Cheng; Liao, Liping; Li, Shuiming; Ying, Ming; Tian, Jing; Liu, Qiong; Ni, Jiazuan

2016-04-12

Oxidative stress is a key event in the onset and progression of neurodegenerative diseases, including Alzheimer's disease (AD). To investigate the role of oxidative stress in AD and to search for potential biomarkers in peripheral blood, serums were collected in this study from the 3-, 6-, and 12-month-old triple transgenic AD mice (3×Tg-AD mice) and the age- and sex-matched non-transgenic (non-Tg) littermates. The serum oxidized proteins were quantified by slot-blot analysis and enzyme-linked immunosorbent assay (ELISA) to investigate the total levels of serum protein carbonyl groups. Western blotting, in conjunction with two-dimensional gel electrophoresis (2D-Oxyblot), was employed to identify and quantify the specifically-carbonylated proteins in the serum of 3×Tg-AD mice. The results showed that the levels of serum protein carbonyls were increased in the three month old 3×Tg-AD mice compared with the non-Tg control mice, whereas no significant differences were observed in the six and 12 months old AD mice, suggesting that oxidative stress is an early event in AD progression. With the application of 2D-Oxyblot analysis, (immunoglobin) Ig gamma-2B chain C region (IGH-3), Ig lambda-2 chain C region (IGLC2), Ig kappa chain C region (IGKC), and Ig kappa chain V-V region HP R16.7 were identified as significantly oxidized proteins compared with the control. Among them IGH-3 and IGKC were validated via immunoprecipitation and Western blot analysis. Identification of oxidized proteins in the serums of 3×Tg-AD mice can not only reveal potential roles of those proteins in the pathogenesis of AD but also provide potential biomarkers of AD at the early stage.

Tulipa gesneriana and Lilium longiflorum PEBP Genes and Their Putative Roles in Flowering Time Control.

PubMed

Leeggangers, Hendrika A C F; Rosilio-Brami, Tamar; Bigas-Nadal, Judit; Rubin, Noam; van Dijk, Aalt D J; Nunez de Caceres Gonzalez, Francisco F; Saadon-Shitrit, Shani; Nijveen, Harm; Hilhorst, Henk W M; Immink, Richard G H; Zaccai, Michele

2018-01-01

Floral induction in Tulipa gesneriana and Lilium longiflorum is triggered by contrasting temperature conditions, high and low temperature, respectively. In Arabidopsis, the floral integrator FLOWERING LOCUS T (FT), a member of the PEBP (phosphatidyl ethanolamine-binding protein) gene family, is a key player in flowering time control. In this study, one PEBP gene was identified and characterized in lily (LlFT) and three PEBP genes were isolated from tulip (TgFT1, TgFT2 and TgFT3). Overexpression of these genes in Arabidopsis thaliana resulted in an early flowering phenotype for LlFT and TgFT2, but a late flowering phenotype for TgFT1 and TgFT3. Overexpression of LlFT in L. longiflorum also resulted in an early flowering phenotype, confirming its proposed role as a flowering time-controlling gene. The tulip PEBP genes TgFT2 and TgFT3 have a similar expression pattern in tulip, but show opposite effects on the timing of flowering in Arabidopsis. Therefore, the difference between these two proteins was further investigated by interchanging amino acids thought to be important for the FT function. This resulted in the conversion of phenotypes in Arabidopsis upon overexpressing the substituted TgFT2 and TgFT3 genes, revealing the importance of these interchanged amino acid residues. Based on all obtained results, we hypothesize that LlFT is involved in creating meristem competence to flowering-related cues in lily, and TgFT2 is considered to act as a florigen involved in the floral induction in tulip. The function of TgFT3 remains unclear, but, based on our observations and phylogenetic analysis, we propose a bulb-specific function for this gene. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Early Cognitive/Social Deficits and Late Motor Phenotype in Conditional Wild-Type TDP-43 Transgenic Mice.

PubMed

Alfieri, Julio A; Silva, Pablo R; Igaz, Lionel M

2016-01-01

Frontotemporal Dementia (FTD) and amyotrophic lateral sclerosis (ALS) are two neurodegenerative diseases associated to mislocalization and aggregation of TAR DNA-binding protein 43 (TDP-43). To investigate in depth the behavioral phenotype associated with this proteinopathy, we used as a model transgenic (Tg) mice conditionally overexpressing human wild-type TDP 43 protein (hTDP-43-WT) in forebrain neurons. We previously characterized these mice at the neuropathological level and found progressive neurodegeneration and other features that evoke human TDP-43 proteinopathies of the FTD/ALS spectrum. In the present study we analyzed the behavior of mice at multiple domains, including motor, social and cognitive performance. Our results indicate that young hTDP-43-WT Tg mice (1 month after post-weaning transgene induction) present a normal motor phenotype compared to control littermates, as assessed by accelerated rotarod performance, spontaneous locomotor activity in the open field test and a mild degree of spasticity shown by a clasping phenotype. Analysis of social and cognitive behavior showed a rapid installment of deficits in social interaction, working memory (Y-maze test) and recognition memory (novel object recognition test) in the absence of overt motor abnormalities. To investigate if the motor phenotype worsen with age, we analyzed the behavior of mice after long-term (up to 12 months) transgene induction. Our results reveal a decreased performance on the rotarod test and in the hanging wire test, indicating a motor phenotype that was absent in younger mice. In addition, long-term hTDP-43-WT expression led to hyperlocomotion in the open field test. In sum, these results demonstrate a time-dependent emergence of a motor phenotype in older hTDP-43-WT Tg mice, recapitulating aspects of clinical FTD presentations with motor involvement in human patients, and providing a complementary animal model for studying TDP-43 proteinopathies.

Future methane emissions from animals

NASA Astrophysics Data System (ADS)

Anastasi, C.; Simpson, V. J.

1993-04-01

The future global emission of CH4 from enteric fermentation in animals has been estimated for cattle, sheep, and buffalo, which together contribute approximately 91% of the total CH4 emitted from domesticated animals at present. A simple model has been used to relate livestock levels to the national human populations for each country involved in breeding the three species included in this analysis. United Nations population predictions to 2025 were then included in the model to estimate future CH4 emissions. A variational analysis was carried out to investigate the effect of future changes in both the land available for grazing and the nutritional content of feedstocks. Results suggest that the total emission of CH4 from enteric fermentation in domestic animals will increase from 84 Tg CH4 per year (Tg = 1012 g) in 1990 to 119 (±12) Tg CH4 yr-1 by 2025. These values correspond to an average rate of increase over the next 35 years of 1.0 Tg CH4 yr-1.

Local lymph node assay: how testing laboratories apply OECD TG 429 for REACH purposes.

PubMed

Rovida, Costanza

2011-01-01

The Local Lymph Node Assay (LLNA) is the official method for assessing the allergic contact dermatitis potential of chemicals for the purposes of REACH regulation. The LLNA went through a validation process that allowed the delineation of a robust protocol for performing new tests. The OECD accepted this method in 2002 and published OECD TG 429. The European Chemical Agency (ECHA) recently published data that were submitted in the registration dossiers of chemicals. This database was analysed to determine how testing laboratories apply OECD TG 429. This analysis comes after a detailed analysis of four full study reports that were also prepared for REACH purposes. Although the majority of the tests are fully compliant with OECD TG 429, some showed major deviations, and a number of others used more animals than necessary. This suggests that in vivo tests need to be planned more carefully and consciously to obtain meaningful results with the minimum animal number necessary.

TG study of the Li0.4Fe2.4Zn0.2O4 ferrite synthesis

NASA Astrophysics Data System (ADS)

Lysenko, E. N.; Nikolaev, E. V.; Surzhikov, A. P.

2016-02-01

In this paper, the kinetic analysis of Li-Zn ferrite synthesis was studied using thermogravimetry (TG) method through the simultaneous application of non-linear regression to several measurements run at different heating rates (multivariate non-linear regression). Using TG-curves obtained for the four heating rates and Netzsch Thermokinetics software package, the kinetic models with minimal adjustable parameters were selected to quantitatively describe the reaction of Li-Zn ferrite synthesis. It was shown that the experimental TG-curves clearly suggest a two-step process for the ferrite synthesis and therefore a model-fitting kinetic analysis based on multivariate non-linear regressions was conducted. The complex reaction was described by a two-step reaction scheme consisting of sequential reaction steps. It is established that the best results were obtained using the Yander three-dimensional diffusion model at the first stage and Ginstling-Bronstein model at the second step. The kinetic parameters for lithium-zinc ferrite synthesis reaction were found and discussed.

Triglyceride-to-high-density-lipoprotein-cholesterol ratio is an index of heart disease mortality and of incidence of type 2 diabetes mellitus in men.

PubMed

Vega, Gloria Lena; Barlow, Carolyn E; Grundy, Scott M; Leonard, David; DeFina, Laura F

2014-02-01

High triglyceride (TG) and low high-density lipoprotein cholesterol (HDL-C) impart risk for heart disease. This study examines the relationships of TG/HDL-C ratio to mortality from all causes, coronary heart disease (CHD), or cardiovascular disease (CVD). Survival analysis was done in 39,447 men grouped by TG/HDL-C ratio cut point of 3.5 and for metabolic syndrome. National Death Index International Classification of Diseases (ICD-9 and ICD-10) codes were used for CVD and CHD deaths occurring from 1970 to 2008. Incidence of type 2 diabetes mellitus (DM) according to ratio was estimated in 22,215 men. Triglyceride/HDL-C ratio and cross-product of TG and fasting blood glucose (TyG index) were used in analysis. Men were followed up for 581,194 person-years. Triglyceride/HDL-C ratio predicted CHD, CVD, and all-cause mortality after adjustment for established risk factors and non-HDL-C. Mortality rates were higher in individuals with a high ratio than in those with a low ratio. Fifty-five percent of men had metabolic syndrome that was also predictive of CHD, CVD, and all-cause mortality. Annual incidence of DM was 2 times higher in men with high TG/HDL-C ratio than in those with a low ratio. Individuals with high TG/HDL-C ratio had a higher incidence of DM than those with a low ratio. The TyG index was not equally predictive of causes of mortality to TG/HDL-C, but both were equally predictive of diabetes incidence. Triglyceride/HDL-C ratio predicts CHD and CVD mortality as well as or better than do metabolic syndrome in men. Also, a high ratio predisposes to DM. The TyG index does not predict CHD, CVD, or all-cause mortality equally well, but like TG/HDL-C ratio, it predicts DM incidence.

Association of the triglycerides to high-density lipoprotein cholesterol ratio with the risk of chronic kidney disease: analysis in a large Japanese population.

PubMed

Tsuruya, Kazuhiko; Yoshida, Hisako; Nagata, Masaharu; Kitazono, Takanari; Hirakata, Hideki; Iseki, Kunitoshi; Moriyama, Toshiki; Yamagata, Kunihiro; Yoshida, Hideaki; Fujimoto, Shouichi; Asahi, Koichi; Kurahashi, Issei; Ohashi, Yasuo; Watanabe, Tsuyoshi

2014-03-01

To investigate the relationship between triglycerides to high-density lipoprotein cholesterol ratio (TG/HDL-C) and chronic kidney disease (CKD). We used data from 216,007 Japanese adults who participated in a nationwide health checkup program. Men (n = 88,516) and women (n = 127,491) were grouped into quartiles based on their TG/HDL-C levels (<1.26, 1.26-1.98, 1.99-3.18, and >3.18 in men; <0.96, 0.96-1.44, 1.45-2.22, and >2.22 in women). We cross-sectionally assessed the association of TG/HDL-C levels with CKD [defined as an estimated glomerular filtration rate (eGFR) of <60 mL/min/1.73 m(2) (low eGFR) and/or proteinuria (defined as urinary protein ≥ 1+ on dipstick testing)], low eGFR, and proteinuria. The prevalence of CKD, low eGFR, and proteinuria increased significantly with elevating quartiles of TG/HDL-C in both genders (all P for trend <0.001). Participants in the highest quartile of TG/HDL-C had a significantly greater risk of CKD than those in the lowest quartile after adjustment for the relevant confounding factors (odds ratio: 1.57, 95% confidence interval: 1.49-1.65 in men; 1.41, 1.34-1.48 in women, respectively). Furthermore, there were significant associations with low eGFR and proteinuria. In stratified analysis, the risk of CKD increased linearly with greater TG/HDL-C levels in participants with and without hypertension, diabetes, and obesity. Moreover, higher TG/HDL-C levels were relevant for CKD, especially in participants with hypertension and diabetes (P for interaction <0.001, respectively). An elevated TG/HDL-C is associated with the risk of CKD in the Japanese population. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Inverse association between triglycerides-to-HDL-cholesterol ratio and alcohol drinking in middle-aged Japanese men.

PubMed

Wakabayashi, Ichiro

2012-11-01

Triglycerides-to-high-density-lipoprotein (HDL)-cholesterol ratio (TG/HDL-C ratio) has been proposed to be a useful predictor of cardiovascular disease. Habitual alcohol drinking causes elevation of triglycerides and HDL cholesterol levels. The purpose of this study was to determine how the TG/HDL-C ratio is influenced by alcohol intake. Subjects were 21,572 Japanese men (age range: 35-60 years) who were divided into non-, light (<22 g ethanol/day), heavy (≥22 but <44 g ethanol/day), and very heavy (≥44 g ethanol/day) drinkers. The relationship between alcohol intake and TG/HDL-C ratio was investigated by using analysis of covariance and logistic regression analysis. Log-transformed TG/HDL-C ratio was significantly lower in light, heavy, and very heavy drinkers than in nondrinkers and was lowest in light drinkers. Odds ratios for high TG/HDL-C ratios in light and heavy drinkers versus nondrinkers were significantly lower than a reference level of 1.00 (light drinkers: 0.63, 95% CI [0.57, 0.71],p < .01); heavy drinkers: 0.75, 95% CI [0.69, 0.81],p < .01]). Odds ratios for high waist-to-height ratio of subjects with versus subjects without high TG/HDL-C ratios were significantly higher than the reference level in non-, light, heavy, and very heavy drinkers and were significantly lower in heavy and very heavy drinkers than in nondrinkers (nondrinkers: 3.84 [3.42,4.31]; light drinkers: 3.65 [2.97,4.48]; heavy drinkers: 3.17 [2.84, 3.54],p < .05 compared with nondrinkers; very heavy drinkers: 2.61 [2.29, 2.97],p < .01 compared with nondrinkers). Alcohol drinking is inversely associated with TG/ HDL-C ratio and confounds the relationship between TG/HDL-C ratio and obesity.

Origin of a Fungal Symbiont of Perennial Ryegrass by Interspecific Hybridization of a Mutualist with the Ryegrass Choke Pathogen, Epichloe Typhina

PubMed Central

Schardl, C. L.; Leuchtmann, A.; Tsai, H. F.; Collett, M. A.; Watt, D. M.; Scott, D. B.

1994-01-01

Seed-borne fungal symbionts (endophytes) provide many cool-season grass species with biological protection from biotic and abiotic stresses. The endophytes are asexual, whereas closely related sexual species of genus Epichloe (Clavicipitales) cause grass choke disease. Perennial ryegrass (Lolium perenne) is a host of two endophyte taxa, LpTG-1 (L. perenne endophyte taxonomic grouping one = Acremonium lolii) and LpTG-2, as well as the choke pathogen, Epichloe typhina (represented by isolate E8). Relationships among these fungi and other Epichloe species were investigated by analysis of gene sequences, DNA polymorphisms and allozymes. The results indicate that LpTG-2 is a heteroploid derived from an interspecific hybrid. The LpTG-2 isolates had two copies each of nine out of ten genes analyzed (the exception being the rRNA gene locus), and the profiles for seven of these were composites of those from E. typhina E8 and A. lolii isolate Lp5. Molecular phylogenetic analysis grouped the two β-tubulin genes of LpTG-2 into separate clades. One (tub2-1) was related to that of E. typhina E8, and the other (tub2-2) to that of A. lolii. The mitochondrial DNA profile of LpTG-2 was similar to that of A. lolii, but its rRNA gene sequence grouped it with E. typhina E8. A proposed model for the evolution of LpTG-2 involves infection of a L. perenne-A. lolii symbiotum by E. typhina, followed by hybridization of the two fungi. Such interspecific hybridization may be a common and important mechanism for genetic variation in Epichloe endophytes. PMID:8013907

Dust Transport, Deposition and Radiative Effects Observed from MODIS

NASA Technical Reports Server (NTRS)

Kaufman, Y. J.; Koren, I.; Remer, L. A.; Tanre, D.; Ginoux, P.; Fan, S.

2003-01-01

Carlson (1977) used satellite (AVHRR) observation of dust episodes 3 estimate that 90 tg of dust are emitted from Africa (0-30 N) to the Atlantic Ocean between June and August. MODIS systematic measurements of aerosol optical thickness (AOT) and the fraction of the AOT (f) due to the fine mode (see Remer et al abstract), are used to derive the column concentration, flux and deposition of African dust over the Atlantic Ocean. The main data set is for 2001 but the results are consistent with MODIS measurements from 2002. The analysis first determines the properties of maritime baseline aerosol (AOT=0.06, f=0.5); followed by linear scaling of the dust AOT and the anthropogenic AOT, based on MODIS measured values of the fraction "f" being 0.9 for anthropogenic aerosol and 0.5 for dust. NCEP winds are used in the analysis and are evaluated against observed dust movements between the Terra and Aqua passes (see Koren et al. abstract). Monthly values of dust transport and deposition are calculated. Preliminary results show that 280 tg of dust are emitted annually from Africa to the Atlantic Ocean between 20s and 30N, with 40 tg returning to Africa and Europe between 30N and 50N. 85 tg reach the Americas, with 130-150 tg are deposited in the Atlantic Ocean. The results are compared with dust transport models that indicate 110-230 tg of dust being deposited in the Ocean. It is interesting to note that the early estimates of Carlson (1977) and Carlson & Prosper0 (1972) are very close to our estimate from MODIS of 100 tg for the same latitude range and monthly period.

Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia

PubMed Central

Manteniotis, Stavros; Lehmann, Ramona; Flegel, Caroline; Vogel, Felix; Hofreuter, Adrian; Schreiner, Benjamin S. P.; Altmüller, Janine; Becker, Christian; Schöbel, Nicole; Hatt, Hanns; Gisselmann, Günter

2013-01-01

The specific functions of sensory systems depend on the tissue-specific expression of genes that code for molecular sensor proteins that are necessary for stimulus detection and membrane signaling. Using the Next Generation Sequencing technique (RNA-Seq), we analyzed the complete transcriptome of the trigeminal ganglia (TG) and dorsal root ganglia (DRG) of adult mice. Focusing on genes with an expression level higher than 1 FPKM (fragments per kilobase of transcript per million mapped reads), we detected the expression of 12984 genes in the TG and 13195 in the DRG. To analyze the specific gene expression patterns of the peripheral neuronal tissues, we compared their gene expression profiles with that of the liver, brain, olfactory epithelium, and skeletal muscle. The transcriptome data of the TG and DRG were scanned for virtually all known G-protein-coupled receptors (GPCRs) as well as for ion channels. The expression profile was ranked with regard to the level and specificity for the TG. In total, we detected 106 non-olfactory GPCRs and 33 ion channels that had not been previously described as expressed in the TG. To validate the RNA-Seq data, in situ hybridization experiments were performed for several of the newly detected transcripts. To identify differences in expression profiles between the sensory ganglia, the RNA-Seq data of the TG and DRG were compared. Among the differentially expressed genes (> 1 FPKM), 65 and 117 were expressed at least 10-fold higher in the TG and DRG, respectively. Our transcriptome analysis allows a comprehensive overview of all ion channels and G protein-coupled receptors that are expressed in trigeminal ganglia and provides additional approaches for the investigation of trigeminal sensing as well as for the physiological and pathophysiological mechanisms of pain. PMID:24260241

Behavioural inflexibility in a comorbid rat model of striatal ischemic injury and mutant hAPP overexpression.

PubMed

Levit, Alexander; Regis, Aaron M; Garabon, Jessica R; Oh, Seung-Hun; Desai, Sagar J; Rajakumar, Nagalingam; Hachinski, Vladimir; Agca, Yuksel; Agca, Cansu; Whitehead, Shawn N; Allman, Brian L

2017-08-30

Alzheimer disease (AD) and stroke coexist and interact; yet how they interact is not sufficiently understood. Both AD and basal ganglia stroke can impair behavioural flexibility, which can be reliably modeled in rats using an established operant based set-shifting test. Transgenic Fischer 344-APP21 rats (TgF344) overexpress pathogenic human amyloid precursor protein (hAPP) but do not spontaneously develop overt pathology, hence TgF344 rats can be used to model the effect of vascular injury in the prodromal stages of Alzheimer disease. We demonstrate that the injection of endothelin-1 (ET1) into the dorsal striatum of TgF344 rats (Tg-ET1) produced an exacerbation of behavioural inflexibility with a behavioural phenotype that was distinct from saline-injected wildtype & TgF344 rats as well as ET1-injected wildtype rats (Wt-ET1). In addition to profiling the types of errors made, interpolative modeling using logistic exposure-response regression provided an informative analysis of the timing and efficiency of behavioural flexibility. During set-shifting, Tg-ET1 committed fewer perseverative errors than Wt-ET1. However, Tg-ET1 committed significantly more regressive errors and had a less efficient strategy change than all other groups. Thus, behavioural flexibility was more vulnerable to striatal ischemic injury in TgF344 rats. Copyright © 2017 Elsevier B.V. All rights reserved.

Triglyceride to HDL-C ratio and increased arterial stiffness in children, adolescents, and young adults.

PubMed

Urbina, Elaine M; Khoury, Philip R; McCoy, Connie E; Dolan, Lawrence M; Daniels, Stephen R; Kimball, Thomas R

2013-04-01

Lipid levels are linked to early atherosclerosis. Risk stratification may be improved by using triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C), which relates to arterial stiffness in adults. We tested whether TG/HDL-C was an independent predictor of arterial stiffness in youth. Subjects 10 to 26 years old (mean 18.9 years, 39% male, 56% non-Caucasian, n = 893) had laboratory, anthropometric, blood pressure, and arterial stiffness data collected (brachial distensibility, augmentation index, carotid-femoral pulse-wave velocity). Subjects were stratified into tertiles of TG/HDL-C (low, n = 227; mid, n = 288; high, n = 379). There was a progressive rise in cardiovascular (CV) risk factors and arterial stiffness across TG/HDL-C ratio. The high TG/HDL-C ratio group had the stiffest vessels (all P < .03 by analysis of variance). TG/HDL-C as a continuous variable was an independent determinant of brachial distensibility in CV risk factor adjusted model and for carotid-femoral pulse-wave velocity in obese subjects, with trend for higher augmentation index. TG/HDL-C, an estimate of small, dense low-density lipoprotein cholesterol, is an independent determinant of arterial stiffness in adolescents and young adults, especially in obese youth. These data suggest that use of TG/HDL-C may be helpful in identifying young adults requiring aggressive intervention to prevent atherosclerotic CV diseases.

Triglyceride to HDL-C Ratio and Increased Arterial Stiffness in Children, Adolescents, and Young Adults

PubMed Central

Khoury, Philip R.; McCoy, Connie E.; Dolan, Lawrence M.; Daniels, Stephen R.; Kimball, Thomas R.

2013-01-01

BACKGROUND AND OBJECTIVE: Lipid levels are linked to early atherosclerosis. Risk stratification may be improved by using triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C), which relates to arterial stiffness in adults. We tested whether TG/HDL-C was an independent predictor of arterial stiffness in youth. METHODS: Subjects 10 to 26 years old (mean 18.9 years, 39% male, 56% non-Caucasian, n = 893) had laboratory, anthropometric, blood pressure, and arterial stiffness data collected (brachial distensibility, augmentation index, carotid-femoral pulse-wave velocity). Subjects were stratified into tertiles of TG/HDL-C (low, n = 227; mid, n = 288; high, n = 379). RESULTS: There was a progressive rise in cardiovascular (CV) risk factors and arterial stiffness across TG/HDL-C ratio. The high TG/HDL-C ratio group had the stiffest vessels (all P < .03 by analysis of variance). TG/HDL-C as a continuous variable was an independent determinant of brachial distensibility in CV risk factor adjusted model and for carotid-femoral pulse-wave velocity in obese subjects, with trend for higher augmentation index. CONCLUSIONS: TG/HDL-C, an estimate of small, dense low-density lipoprotein cholesterol, is an independent determinant of arterial stiffness in adolescents and young adults, especially in obese youth. These data suggest that use of TG/HDL-C may be helpful in identifying young adults requiring aggressive intervention to prevent atherosclerotic CV diseases. PMID:23460684

An analysis of the carbon balance of the Arctic Basin from 1997 to 2006

Treesearch

A.D. McGuire; D.J. Hayes; D.W. Kicklighter; M. Manizza; Q. Zhuang; M. Chen; M.J. Follows; K.R. Gurney; J.W. McClelland; J.M. Melillo; B.J. Peterson; R.G. Prinn

2010-01-01

This study used several model-based tools to analyze the dynamics of the Arctic Basin between 1997 and 2006 as a linked system of land-ocean-atmosphere C exchange. The analysis estimates that terrestrial areas of the Arctic Basin lost 62.9 Tg C yr-1 and that the Arctic Ocean gained 94.1 Tg C yr-1. Arctic lands and oceans...

Maternally derived trypsin may have multiple functions in the early development of turbot (Scopthalmus maximus).

PubMed

Chi, Liang; Liu, Qinghua; Xu, Shihong; Xiao, Zhizhong; Ma, Daoyuan; Li, Jun

2015-10-01

Trypsin is an important serine protease that is considered to be involved in digestion of protein in teleost fish. Nevertheless, studies on trypsin/trypsinogen in fish embryos are very limited. In this study, the trypsinogen of turbot (Scophthalmus maximus) (tTG) was identified and the expression patterns and activity of trypsinogen/trypsin were investigated. The results showed that the tTG mRNA was evenly distributed in the oocytes and was also expressed along the yolk periphery in early embryos. At later embryo stages and 1 days after hatching (dph), the tTG mRNA concentrated at the alimentary tract and head. Quantitative expression analysis showed that the tTG transcripts decreased after fertilization until the gastrula stage, then increased with the embryo and larvae development. This result was also confirmed by the specific activity analysis of trypsin and in-situ-hybridization (ISH). All of the results indicated that tTG in early embryo stages was maternally derived and expressed by itself after gastrula stages. Additionally, location of tTG mRNA in embryos and larvae was investigated; we considered that trypsin may have multiple functions during the embryo development process. Based on our results regarding trypsinogen in embryos and early development, we concluded that the trypsin/trypsinogen in turbot embryos was inherited from a maternal source and we suggested that trypsin in early development has multiple functions in the process of development. Copyright © 2015 Elsevier Inc. All rights reserved.

Changes in thoracic gas volume with air-displacement plethysmography after a weight loss program in overweight and obese women.

PubMed

Minderico, C S; Silva, A M; Fields, D A; Branco, T L; Martins, S S; Teixeira, P J; Sardinha, L B

2008-03-01

This study was designed to compare measured and predicted thoracic gas volume (V (TG)) after weight loss and to analyze the effect of body composition confounders such as waist circumference (WC) on measured V (TG) changes. Prospective intervention study. Outpatient University Laboratory, Lisbon, Portugal. Eighty-five overweight and obese women (body mass index = 30.0+/-3.5 kg/m(2); age = 39.0+/-5.7 years) participating in a 16-month university-based weight control program designed to increase physical activity and improve diet. Body weight (Wb), body volume (Vb), body density (Db), fat mass (FM), percent fat mass (%FM) and fat-free mass (FFM) were assessed by air-displacement plethysmography (ADP) at baseline and at post-intervention (16 months). The ADP assessment included a protocol to measure V (TG) and a software-based predicted V (TG). Dual-energy X-ray absorptiometry (DXA) (Hologic QDR 1500) was also used to estimate FM, %FM and FFM. Maximal oxygen uptake (VO(2) max) was assessed with a modified Balke cardiopulmonary exercise testing protocol with a breath-by-breath gas analysis. Significant differences between the baseline and post-weight loss intervention were observed for body weight and composition (Vb, Db, %FM, FM and FFM), and measures of V (TG) (measured: Delta=0.2 l, P<0.001; predicted: Delta=0.01 l, P<0.010) variables. Measured V (TG) change was negatively associated with the change in the WC (P=0.008), controlling for VO(2) max and age (P=0.007, P=0.511 and P=0.331). Linear regression analysis results indicated that %FM and FM using the measured and predicted V (TG) explained 72 and 76%, and 86 and 90% respectively, of the variance in %FM and FM changes using dual-energy x-ray absorptiometry. After weight loss, measured V (TG) increased significantly, which was partially attributed to changes is an indicator of body fat distribution such as WC. Consequently, measured and predicted V (TG) should not be used interchangeably when tracking changes in body composition. The mechanisms relating the reduction of an upper body fat distribution with an increase measured V (TG) are worthy of future investigation.

Effect of transglutaminase on some properties of cake enriched with various protein sources.

PubMed

Alp, H; Bilgiçli, N

2008-06-01

The effect of transglutaminase (TG) enzyme addition (0% and 0.09%) on batter and cake properties, prepared with different protein sources (nonfat dry milk [NFDM], soy flour, and soymilk) and flour types (type A with 11.4% protein and type B with 8.6% protein), was investigated. Specific gravity and pH of cake batters were determined, and physical and chemical analysis of the cake samples was performed. Soy products improved cake weight, volume, softness, protein, and fat contents. NFDM increased the crust redness and crumb lightness more than the other protein sources. TG enzyme addition affected the volume, softness, crust, and crumb color of the cake samples significantly (P < 0.05). The combination of TG enzyme and flour B with lower protein gave more puffed, symmetrical, and softer cake samples. TG had a potential application with different protein sources in cake production. Especially interactions between TG with soy flour and TG and wheat flour with high protein content were important in cake formulations due to the softening effect on crumb.

Synergistic association of changes in serum uric acid and triglycerides with changes in insulin resistance after walking exercise in community-dwelling older women.

PubMed

Kawamoto, Ryuichi; Katoh, Takeaki; Ninomiya, Daisuke; Kumagi, Teru; Abe, Masanori; Kohara, Katsuhiko

2016-05-01

Serum uric acid (SUA) and triglyceride (TG) levels are strongly correlated with insulin resistance; however, the association after a walking exercise program in community-dwelling older women has not been investigated. The present study included 100 postmenopausal women (mean ± standard deviation, 68 ± 7 years) from a rural village in Japan. The Nordic walking program of 120 min per week was performed for 12 weeks. Before and after the intervention, SUA, TG, various relevant factors and homeostasis model assessment of insulin resistance (HOMA-IR) were measured. Multivariate linear regression analysis showed that baseline TG and γ-glutamyltransferase (GGT) were significantly associated with baseline HOMA-IR. After the 12-week training program, changes in TG, SUA and GGT were significantly associated with changes in HOMA-IR. In addition to their direct associations, we observed a synergistic association between changes in TG and SUA and changes in HOMA-IR. Participants were divided into three groups (tertiles) according to changes in TG and SUA. The tertiles of changes in SUA correlated significantly with changes in HOMA-IR in participants in the tertile with the greatest decrease in TG (r = 0.525, p = 0.001), but not in the other two tertiles of change in TG (r = 0.049, p = 0.699). There was a significant interaction between SUA and TG for changes in HOMA-IR (β = 0.281, p = 0.005). These results suggest that changes in TG and SUA are synergistic factors associated with changes in insulin resistance after a 12-week walking exercise program in community-dwelling older women.

The effect of plant sterols on serum triglyceride concentrations is dependent on baseline concentrations: a pooled analysis of 12 randomised controlled trials.

PubMed

Demonty, Isabelle; Ras, Rouyanne T; van der Knaap, Henk C M; Meijer, Linsie; Zock, Peter L; Geleijnse, Johanna M; Trautwein, Elke A

2013-02-01

Plant sterols (PS) are well known for their low-density lipoprotein cholesterol-lowering effect. Until recently, they were believed to have little or no impact on blood triglycerides (TG). However, studies taken individually were possibly lacking statistical power to detect modest TG decreases. This study was performed to quantify the TG-lowering effect of PS by pooling individual subject data from 12 randomised controlled trials that investigated the effects of PS on blood lipids. The main outcome variable was the control-adjusted PS effect on relative (%) and absolute (mmol/L) changes in TG. The relative and absolute changes in high-density lipoprotein cholesterol (HDL-C) were also assessed. Differences in changes of serum lipid concentrations between PS and control treatments were estimated by an ANCOVA using a random effect model which included PS intake (active or control), study and predefined subject characteristics. The twelve randomised controlled trials included in total 935 hypercholesterolaemic subjects not preselected based on their baseline TG concentrations. In most studies, the PS dose ranged between 1.6 and 2.5 g/day. PS intake significantly lowered serum TG by 6.0% (95% CI: -10.7, -1.2) or 0.12 mmol/L (95% CI: -0.20, -0.04). No significant interaction was observed between PS intake and baseline TG concentrations on relative changes, but, on absolute changes, interaction was significant with larger TG decreases observed with higher TG concentrations at baseline. No effects were observed on HDL-C concentrations. These results show that PS exert a modest TG-lowering effect which is dependent on baseline concentrations.

Multimarker Analysis for New Biomarkers in Relation to Central Arterial Stiffness and Hemodynamics in a Chinese Community-Dwelling Population.

PubMed

Fu, Shihui; Luo, Leiming; Ye, Ping; Xiao, Wenkai

2015-11-01

Central arterial stiffness and hemodynamics independently reflect the risk of cardiovascular events. This Chinese community-based analysis was performed to evaluate the relationships of new biomarkers with central arterial stiffness and hemodynamics by a multimarker method. This analysis consisted of 1540 participants who were fully tested for the new biomarkers including N-terminal prohormone of brain natriuretic peptide, lipid accumulation product, triglyceride-high-density lipoprotein cholesterol (TG-HDL-c) ratio, uric acid, high-sensitivity C-reactive protein, and homocysteine. Carotid-femoral pulse wave velocity (cfPWV), central pulse pressure (cPP), and central augmentation index (cAIx) were measured. The median (range) age of entire cohort was 62 years (21-96 years), and 40.5% were males. The median (interquartile range) of cfPWV, cPP, and cAIx was 11.0 m/s (9.6-13.0 m/s), 42 mm Hg (35-52 mm Hg), and 28% (21%-33%), respectively. In multivariate analysis, participants with higher cfPWV had significantly higher age, peripheral pulse pressure, TG, TG-HDL-c ratio, and homocysteine levels compared with others (P < .05 for all). Multimarker analysis in a Chinese community-dwelling population reinforced the potential clinical value of plasma TG-HDL-c ratio and homocysteine levels as the biomarkers of increased arterial stiffness. © The Author(s) 2015.

Relevance of the triglyceride-to-high-density lipoprotein cholesterol ratio as an important lipid fraction in apparently healthy, young, and middle-aged Indian men

PubMed Central

Kohli, Aparna; Siddhu, Anupa; Pandey, Ravindra M.; Reddy, K. Srinath

2017-01-01

Context: Cardiovascular disease (CVD) is the largest cause of mortality in Indians. Insulin resistance and related dyslipidemia of increased triglyceride (TG), small dense low-density lipoprotein (sd-LDL) particles, and decreased high-density lipoprotein-cholesterol (HDL-C) are associated with increased risk of CVD. TG/HDL-C ratio could be a potential surrogate marker for this South Asian phenotype. Data are scarce on the relevance of TG/HDL-C ratio as a useful lipid marker among Indians. Aims: To study the prevalence of TG/HDL-C ratio among healthy, young, and middle-aged Indian men (25–44 years) and its relationship with other lipid and nonlipid factors. Subjects and Methods: In this cross-sectional analysis, fasting blood samples from 236 healthy participants recruited from an urban community setting were tested for TG/HDL-C ratio, HDL-C, TG, total cholesterol (TC), non-HDL-C, TC/HDL-C, high-sensitivity C-reactive protein, body mass index (BMI), and body fat. Results: Mean (standard deviation) age of participants was 34.7 (7.7) years; median (interquartile range) TG/HDL-C ratio was 4 (2.85-5.2). More than half (51.3%) the participants (n = 121) recorded abnormal TG/HDL-C ratio (≥4.0). Across tertiles of TG/HDL-C ratio, there was a significant trend of higher conventional lipid parameters such as non-HDL-C*, TC/HDL-C ratio*, TG*, HDL-C*, TC**; and non-lipid parameters body-fat* and BMI*** (*P < 0.001, **P = 0.015, ***P = 0.002). LDL-C showed moderate and nonsignificant (P = 0.646) increase across tertiles. Conclusion: In a sample of apparently healthy, young, and middle-aged Indian men abnormal TG/HDL-C ratio levels were observed among more than half the participants. The TG/HDL-C ratio was closely associated with other lipid parameters and measures of adiposity, such as BMI and body fat, apart from its previously documented unique association with sd-LDL particles. TG/HDL-C ratio should be evaluated in future for risk prediction of incident CVD among Indians. PMID:28217509

Relevance of the triglyceride-to-high-density lipoprotein cholesterol ratio as an important lipid fraction in apparently healthy, young, and middle-aged Indian men.

PubMed

Kohli, Aparna; Siddhu, Anupa; Pandey, Ravindra M; Reddy, K Srinath

2017-01-01

Cardiovascular disease (CVD) is the largest cause of mortality in Indians. Insulin resistance and related dyslipidemia of increased triglyceride (TG), small dense low-density lipoprotein (sd-LDL) particles, and decreased high-density lipoprotein-cholesterol (HDL-C) are associated with increased risk of CVD. TG/HDL-C ratio could be a potential surrogate marker for this South Asian phenotype. Data are scarce on the relevance of TG/HDL-C ratio as a useful lipid marker among Indians. To study the prevalence of TG/HDL-C ratio among healthy, young, and middle-aged Indian men (25-44 years) and its relationship with other lipid and nonlipid factors. In this cross-sectional analysis, fasting blood samples from 236 healthy participants recruited from an urban community setting were tested for TG/HDL-C ratio, HDL-C, TG, total cholesterol (TC), non-HDL-C, TC/HDL-C, high-sensitivity C-reactive protein, body mass index (BMI), and body fat. Mean (standard deviation) age of participants was 34.7 (7.7) years; median (interquartile range) TG/HDL-C ratio was 4 (2.85-5.2). More than half (51.3%) the participants ( n = 121) recorded abnormal TG/HDL-C ratio (≥4.0). Across tertiles of TG/HDL-C ratio, there was a significant trend of higher conventional lipid parameters such as non-HDL-C*, TC/HDL-C ratio*, TG*, HDL-C*, TC**; and non-lipid parameters body-fat* and BMI*** (* P < 0.001, ** P = 0.015, *** P = 0.002). LDL-C showed moderate and nonsignificant ( P = 0.646) increase across tertiles. In a sample of apparently healthy, young, and middle-aged Indian men abnormal TG/HDL-C ratio levels were observed among more than half the participants. The TG/HDL-C ratio was closely associated with other lipid parameters and measures of adiposity, such as BMI and body fat, apart from its previously documented unique association with sd-LDL particles. TG/HDL-C ratio should be evaluated in future for risk prediction of incident CVD among Indians.

Aged Tg2576 mice are impaired on social memory and open field habituation tests.

PubMed

Deacon, R M J; Koros, E; Bornemann, K D; Rawlins, J N P

2009-02-11

In a previous publication [Deacon RMJ, Cholerton LL, Talbot K, Nair-Roberts RG, Sanderson DJ, Romberg C, et al. Age-dependent and -independent behavioral deficits in Tg2576 mice. Behav Brain Res 2008;189:126-38] we found that very few cognitive tests were suitable for demonstrating deficits in Tg2576 mice, an amyloid over-expression model of Alzheimer's disease, even at 23 months of age. However, in a retrospective analysis of a separate project on these mice, tests of social memory and open field habituation revealed large cognitive impairments. Controls showed good open field habituation, but Tg2576 mice were hyperactive and failed to habituate. In the test of social memory for a juvenile mouse, controls showed considerably less social investigation on the second meeting, indicating memory of the juvenile, whereas Tg2576 mice did not show this decrement.As a control for olfactory sensitivity, on which social memory relies, the ability to find a food pellet hidden under wood chip bedding was assessed. Tg2576 mice found the pellet as quickly as controls. As this test requires digging ability, this was independently assessed in tests of burrowing and directly observed digging. In line with previous results and the hippocampal dysfunction characteristic of aged Tg2576 mice, they both burrowed and dug less than controls.

Transgenic Expression of the Vitamin D Receptor Restricted to the Ileum, Cecum, and Colon of Vitamin D Receptor Knockout Mice Rescues Vitamin D Receptor-Dependent Rickets.

PubMed

Dhawan, Puneet; Veldurthy, Vaishali; Yehia, Ghassan; Hsaio, Connie; Porta, Angela; Kim, Ki-In; Patel, Nishant; Lieben, Liesbet; Verlinden, Lieve; Carmeliet, Geert; Christakos, Sylvia

2017-11-01

Although the intestine plays the major role in 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] action on calcium homeostasis, the mechanisms involved remain incompletely understood. The established model of 1,25(OH)2D3-regulated intestinal calcium absorption postulates a critical role for the duodenum. However, the distal intestine is where 70% to 80% of ingested calcium is absorbed. To test directly the role of 1,25(OH)2D3 and the vitamin D receptor (VDR) in the distal intestine, three independent knockout (KO)/transgenic (TG) lines expressing VDR exclusively in the ileum, cecum, and colon were generated by breeding VDR KO mice with TG mice expressing human VDR (hVDR) under the control of the 9.5-kb caudal type homeobox 2 promoter. Mice from one TG line (KO/TG3) showed low VDR expression in the distal intestine (<50% of the levels observed in KO/TG1, KO/TG2, and wild-type mice). In the KO/TG mice, hVDR was not expressed in the duodenum, jejunum, kidney, or other tissues. Growth arrest, elevated parathyroid hormone level, and hypocalcemia of the VDR KO mice were prevented in mice from KO/TG lines 1 and 2. Microcomputed tomography analysis revealed that the expression of hVDR in the distal intestine of KO/TG1 and KO/TG2 mice rescued the bone defects associated with systemic VDR deficiency, including growth plate abnormalities and altered trabecular and cortical parameters. KO/TG3 mice showed rickets, but less severely than VDR KO mice. These findings show that expression of VDR exclusively in the distal intestine can prevent abnormalities in calcium homeostasis and bone mineralization associated with systemic VDR deficiency. Copyright © 2017 Endocrine Society.

The triglyceride-to-high density lipoprotein cholesterol ratio in overweight Korean children and adolescents.

PubMed

Yoo, Dong-Yoon; Kang, Yu Sun; Kwon, Eun Byul; Yoo, Eun-Gyong

2017-09-01

The triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio has recently been reported as a biomarker of cardiometabolic risk in obese children and adolescents. The purpose of this study is to describe the TG/HDL-C ratio and related factors in overweight and normal weight Korean children and to evaluate whether the high TG/HDL-C ratio is associated with insulin resistance in overweight children and adolescents. Data from 255 overweight (aged 8.7±2.0 years) and 514 normal weight (aged 8.9±1.8 years) children and adolescents were evaluated. Glucose, insulin, total cholesterol (TC), HDL-C and TG levels were measured after overnight fasting, and the TG/HDL-C ratio, non-HDL-C and the homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. The TG/HDL-C ratio was higher in overweight group compared to normal weight group (P<0.001). Among overweight children and adolescents, alanine aminotransferase (P=0.018), non-HDL-C (P<0.001), and HOMA-IR (P=0.004) were different between the TG/HDL-C ratio tertile groups. The prevalence of elevated HOMA-IR was increased with increasing TG/HDL-C ratio tertiles (P for trend=0.003). On regression analysis adjusted for age and sex, the BMI (β=0.402, P=0.001) and TG/HDL-C ratio (β=0.251, P=0.014) were independently associated with HOMA-IR (adjusted R2=0.324). The TG/HDL-C ratio of 2.0 or more showed higher sensitivity (55.6%) and specificity (72.9%), when compared to TC (≥200 mg/dL), non-HDL-C (≥145 mg/dL), and LDL-C (≥130 mg/dL) for identifying overweight children with elevated HOMA-IR. The TG/HDL-C ratio is independently associated with insulin resistance in overweight children and adolescents, and it can be useful in identifying those at higher cardiometabolic risk.

Triglyceride to high-density lipoprotein cholesterol ratio predicts worse outcomes after acute ischaemic stroke.

PubMed

Deng, Q-W; Wang, H; Sun, C-Z; Xing, F-L; Zhang, H-Q; Zuo, L; Gu, Z-T; Yan, F-L

2017-02-01

The effect of the triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) on clinical outcomes of acute ischaemic stroke (AIS) patients is unclear. This study sought to determine whether the TG/HDL-C ratio in AIS patients is associated with worse outcomes at 3 months. Acute ischaemic stroke patients who were admitted from 2011 to 2014 were enrolled in this study. TG, total cholesterol (TC), HDL-C and low-density lipoprotein cholesterol (LDL-C) were collected on admission. Three end-points were defined according to the modified Rankin scale (mRS) score at 3 months after symptom onset (excellent outcome, mRS 0-1; good outcome, mRS 0-2; and death, mRS 6). In all, 1006 patients were included (median age 68.5 years; 58.2% male). Higher TG, non-HDL-C and TG/HDL-C were strongly associated with the three end-points after adjustments: excellent [odds ratio (OR) = 1.39, OR 1.89 and OR 2.34, respectively] and good (OR 1.48, OR 2.90 and OR 4.12) outcomes, and death (OR 0.59, OR 0.29 and OR 0.26). According to receiver operating characteristic (ROC) analysis, the best discriminating factor was a TG/HDL-C ≥ 0.87 for excellent outcomes [area under the ROC curve (AUC) 0.596; sensitivity 73.3%; specificity 42.7%] and non-death (AUC 0.674; sensitivity 67.8%; specificity 60.6%) as well as a TG/HDL-C ≥ 1.01 for a good outcome (AUC 0.652; sensitivity 61.6%; specificity 63.2%). Patients with a TG/HDL-C < 0.87 had a 2.94-fold increased risk of death (95% confidence interval 1.89-4.55) compared with patients with a TG/HDL-C ≥ 0.87. A lower TG/HDL-C was independently associated with death and worse outcome at 3 months in AIS. © 2016 EAN.

Relationship of the triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio to the remainder of the lipid profile: The Very Large Database of Lipids-4 (VLDL-4) study.

PubMed

Quispe, Renato; Manalac, Raoul J; Faridi, Kamil F; Blaha, Michael J; Toth, Peter P; Kulkarni, Krishnaji R; Nasir, Khurram; Virani, Salim S; Banach, Maciej; Blumenthal, Roger S; Martin, Seth S; Jones, Steven R

2015-09-01

High levels of the triglycerides to high-density lipoprotein cholesterol (TG/HDL-C) ratio are associated with obesity, metabolic syndrome, and insulin resistance. We evaluated variability in the remaining lipid profile, especially remnant lipoprotein particle cholesterol (RLP-C) and its components (very low-density lipoprotein cholesterol subfraction 3 and intermediate-density lipoprotein cholesterol), with variability in the TG/HDL-C ratio in a very large study cohort representative of the general U.S. We examined data from 1,350,908 US individuals who were clinically referred for lipoprotein cholesterol ultracentrifugation (Atherotech, Birmingham, AL) from 2009 to 2011. Demographic information other than age and sex was not available. Changes to the remaining lipid profile across percentiles of the TG/HDL-C ratio were quantified, as well as by three TG/HDL-C cut-off points previously proposed in the literature: 2.5 (male) and 2 (female), 3.75 (male) and 3 (female), and 3.5 (male and female). The mean age of our study population was 58.7 years, and 48% were men. The median TG/HDL-C ratio was 2.2. Across increasing TG/HDL-C ratios, we found steadily increasing levels of RLP-C, non-HDL-C and LDL density. Among the lipid parameters studied, RLP-C and LDL density had the highest relative increase when comparing individuals with elevated TG/HDL-C levels to those with lower TG/HDL-C levels using established cut-off points. Approximately 47% of TG/HDL-C ratio variance was attributable to RLP-C. In the present analysis, a higher TG/HDL-C ratio was associated with an increasingly atherogenic lipid phenotype, characterized by higher RLP-C along with higher non-HDL-C and LDL density. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The triglyceride-to-high density lipoprotein cholesterol ratio in overweight Korean children and adolescents

PubMed Central

Yoo, Dong-Yoon; Kang, Yu Sun; Kwon, Eun Byul

2017-01-01

Purpose The triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio has recently been reported as a biomarker of cardiometabolic risk in obese children and adolescents. The purpose of this study is to describe the TG/HDL-C ratio and related factors in overweight and normal weight Korean children and to evaluate whether the high TG/HDL-C ratio is associated with insulin resistance in overweight children and adolescents. Methods Data from 255 overweight (aged 8.7±2.0 years) and 514 normal weight (aged 8.9±1.8 years) children and adolescents were evaluated. Glucose, insulin, total cholesterol (TC), HDL-C and TG levels were measured after overnight fasting, and the TG/HDL-C ratio, non–HDL-C and the homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. Results The TG/HDL-C ratio was higher in overweight group compared to normal weight group (P<0.001). Among overweight children and adolescents, alanine aminotransferase (P=0.018), non–HDL-C (P<0.001), and HOMA-IR (P=0.004) were different between the TG/HDL-C ratio tertile groups. The prevalence of elevated HOMA-IR was increased with increasing TG/HDL-C ratio tertiles (P for trend=0.003). On regression analysis adjusted for age and sex, the BMI (β=0.402, P=0.001) and TG/HDL-C ratio (β=0.251, P=0.014) were independently associated with HOMA-IR (adjusted R2=0.324). The TG/HDL-C ratio of 2.0 or more showed higher sensitivity (55.6%) and specificity (72.9%), when compared to TC (≥200 mg/dL), non–HDL-C (≥145 mg/dL), and LDL-C (≥130 mg/dL) for identifying overweight children with elevated HOMA-IR. Conclusions The TG/HDL-C ratio is independently associated with insulin resistance in overweight children and adolescents, and it can be useful in identifying those at higher cardiometabolic risk. PMID:29025201

Characterization of Paroxysmal Gluten‐Sensitive Dyskinesia in Border Terriers Using Serological Markers

PubMed Central

Garden, O.A.; Hadjivassiliou, M.; Sanders, D.S.; Powell, R.; Garosi, L.

2018-01-01

Background Paroxysmal gluten‐sensitive dyskinesia (PGSD) in border terriers (BTs) results from an immunologic response directed against transglutaminase (TG)2 and gliadin. Recent evidence suggests that PGSD is only one aspect of a range of possible manifestations of gluten sensitivity in the breed. Hypothesis/Objectives Gluten sensitivity in BTs is a heterogeneous disease process with a diverse clinical spectrum; to characterize the phenotype of PGSD using TG2 and gliadin autoantibodies as diagnostic markers. Animals One hundred twenty‐eight client‐owned BTs with various disorders. Methods Prospective study. BTs with paroxysmal episodes and a normal interictal examination were phenotyped using footage of a representative episode and assigned to 3 groups: idiopathic epilepsy (IE), paroxysmal dyskinesia (PD), or other. Owners of each dog completed a questionnaire to obtain information regarding clinical signs. Healthy BTs formed a control group. Serum antibodies against TG2 and AGA were measured in all dogs. Results One hundred twenty‐eight BTs were enrolled; 45 with PD, 28 with IE, 35 with other conditions, and 20 controls. Three overlapping phenotypes were identified; PD, signs suggestive of gastrointestinal disease, and dermatopathy. AGA‐IgG concentrations were increased in PD, compared with IE (P = 0.012), controls (P < 0.0001) and other (P = 0.018) conditions. Anti‐canine TG2‐IgA concentrations were increased in PD, compared with IE (P < 0.0001), controls (P < 0.0001) and other (P = 0.012) conditions. Serological markers are highly specific for PGSD but lack sensitivity. Conclusions PGSD appears part of a syndrome of gluten intolerance consisting of episodes of transient dyskinesia, signs suggestive of gastrointestinal disease, and dermatological hypersensitivity. PMID:29424456

The genetic characteristics of congenital hypothyroidism in China by comprehensive screening of 21 candidate genes.

PubMed

Sun, Feng; Zhang, Jun-Xiu; Yang, Chang-Yi; Gao, Guan-Qi; Zhu, Wen-Bin; Han, Bing; Zhang, Le-Le; Wan, Yue-Yue; Ye, Xiao-Ping; Ma, Yu-Ru; Zhang, Man-Man; Yang, Liu; Zhang, Qian-Yue; Liu, Wei; Guo, Cui-Cui; Chen, Gang; Zhao, Shuang-Xia; Song, Ke-Yi; Song, Huai-Dong

2018-06-01

Congenital hypothyroidism (CH), the most common neonatal metabolic disorder, is characterized by impaired neurodevelopment. Although several candidate genes have been associated with CH, comprehensive screening of causative genes has been limited. One hundred ten patients with primary CH were recruited in this study. All exons and exon-intron boundaries of 21 candidate genes for CH were analyzed by next-generation sequencing. And the inheritance pattern of causative genes was analyzed by the study of family pedigrees. Our results showed that 57 patients (51.82%) carried biallelic mutations (containing compound heterozygous mutations and homozygous mutations) in six genes ( DUOX2 , DUOXA2 , DUOXA1 , TG , TPO and TSHR ) involved in thyroid hormone synthesis. Autosomal recessive inheritance of CH caused by mutations in DUOX2 , DUOXA2 , TG and TPO was confirmed by analysis of 22 family pedigrees. Notably, eight mutations in four genes ( FOXE1 , NKX2-1 , PAX8 and HHEX ) that lead to thyroid dysgenesis were identified in eight probands. These mutations were heterozygous in all cases and hypothyroidism was not observed in parents of these probands. Most cases of congenital hypothyroidism in China were caused by thyroid dyshormonogenesis rather than thyroid dysgenesis. This study identified previously reported causative genes for 57/110 Chinese patients and revealed DUOX2 was the most frequently mutated gene in these patients. Our study expanded the mutation spectrum of CH in Chinese patients, which was significantly different from Western countries. © 2018 The authors.

PAH/Aromatic Tar and Coke Precursor Formation in the Early Stages of Triglyceride (Triolein) Pyrolysis.

PubMed

Alhroub, Ibrahim; Kozliak, Evguenii; Kubátová, Alena; Sulkes, Mark

2018-03-29

There has been a limited understanding of high MW polycyclic aromatic hydrocarbon (PAH) product chemistry in the pyrolysis of triglycerides (TGs), though the subject has important implications for both fuel production from TGs and food science. Previous TG pyrolysis studies have been able to identify only relatively low MW GC-elutable aromatics occurring in the bulk liquid phase; products occurring in the solid phase have remained inaccessible to chemical analysis. In contrast, cold gas expansion molecular beam methods, where pyrolysis products are analyzed in real time as they are entrained in gas expansions, remove product collection difficulties, thereby allowing for analysis of coke/tar PAH precursors. In this study, the model TG triolein was heated and the ensuing products in the molecular beam were soft photoionized, enabling time-of-flight mass detection. Use of 266 nm pulses enabled selective photoionization of aromatic products. Unlike previous work on analysis of the liquid phase TG cracking products, a different and distinct pattern of rather large PAHs, up to 444 amu, was observed, at nontrivial relative product fractions. With an increase of temperature to ∼350 °C, a small number of PAHs with MW ≥ 276 amu increasingly dominated the aromatic product distribution. Surprisingly, PAH product detection ensued at rather low temperatures, as low as ∼260 °C. For tentative PAH product identification and product chemistry rationalization, we observed the product homology pattern and applied a stoichiometric analysis. The latter, combined with the known homology profiles of TG cracking products, indicated specific patterns of intermediate fragment association that facilitated large-MW PAH formation as a result of TG cracking.

Thyroglobulin (Tg) Testing Revisited: Tg Assays, TgAb Assays, and Correlation of Results With Clinical Outcomes.

PubMed

Netzel, Brian C; Grebe, Stefan K G; Carranza Leon, B Gisella; Castro, M Regina; Clark, Penelope M; Hoofnagle, Andrew N; Spencer, Carole A; Turcu, Adina F; Algeciras-Schimnich, Alicia

2015-08-01

Measurement of thyroglobulin (Tg) by mass spectrometry (Tg-MS) is emerging as a tool for accurate Tg quantification in patients with anti-Tg autoantibodies (TgAbs). The objective of the study was to perform analytical and clinical evaluations of two Tg-MS assays in comparison with immunometric Tg assays (Tg-IAs) and Tg RIAs (Tg-RIAs) in a cohort of thyroid cancer patients. A total of 589 samples from 495 patients, 243 TgAb-/252 TgAb+, were tested by Beckman, Roche, Siemens-Immulite, and Thermo-Brahms Tg and TgAb assays, two Tg-RIAs, and two Tg-MS assays. The frequency of TgAb+ was 58%, 41%, 27%, and 39% for Roche, Beckman, Siemens-Immulite, and Thermo-Brahms, respectively. In TgAb- samples, clinical sensitivities and specificities of 100% and 74%-100%, respectively, were observed across all assays. In TgAb+ samples, all Tg-IAs demonstrated assay-dependent Tg underestimation, ranging from 41% to 86%. In TgAb+ samples, the use of a common cutoff (0.5 ng/mL) for the Tg-MS, three Tg-IAs, and the USC-RIA improved the sensitivity for the Tg-MSs and Tg-RIAs when compared with the Tg-IAs. In up to 20% of TgAb+ cases, Tg-IAs failed to detect Tg that was detectable by Tg-MS. In Tg-RIAs false-high biases were observed in TgAb+ samples containing low Tg concentrations. Tg-IAs remain the method of choice for Tg quantitation in TgAb- patients. In TgAb+ patients with undetectable Tg by immunometric assay, the Tg-MS will detect Tg in up to 20% additional cases. The Tg-RIA will detect Tg in approximately 35% cases, but a significant proportion of these will be clinical false-positive results. The undetectable Tg-MS seen in approximately 40% of TgAb+ cases in patients with disease need further evaluation.

Coagulation factor XII genetic variation, ex vivo thrombin generation, and stroke risk in the elderly: results from the Cardiovascular Health Study.

PubMed

Olson, N C; Butenas, S; Lange, L A; Lange, E M; Cushman, M; Jenny, N S; Walston, J; Souto, J C; Soria, J M; Chauhan, G; Debette, S; Longstreth, W T; Seshadri, S; Reiner, A P; Tracy, R P

2015-10-01

The relationships of thrombin generation (TG) with cardiovascular disease risk are underevaluated in population-based cohorts. To evaluate the relationships of TG influenced by the contact and tissue factor coagulation pathways ex vivo with common single-nucleotide polymorphisms (SNPs) and incident cardiovascular disease and stroke. We measured peak TG (pTG) in baseline plasma samples of Cardiovascular Health Study participants (n = 5411), both with and without inhibitory anti-factor XIa antibody (pTG/FXIa(-) ). We evaluated their associations with ~ 50 000 SNPs by using the IBCv2 genotyping array, and with incident cardiovascular disease and stroke events over a median follow-up of 13.2 years. The minor allele for an SNP in the FXII gene (F12), rs1801020, was associated with lower pTG in European-Americans (β = - 34.2 ± 3.5 nm; P = 3.3 × 10(-22) ; minor allele frequency [MAF] = 0.23) and African-Americans (β = - 31.1 ± 7.9 nm; P = 9.0 × 10(-5) ; MAF = 0.42). Lower FXIa-independent pTG (pTG/FXIa(-) ) was associated with the F12 rs1801020 minor allele, and higher pTG/FXIa(-) was associated with the ABO SNP rs657152 minor allele (β = 16.3 nm; P = 4.3 × 10(-9) ; MAF = 0.37). The risk factor-adjusted ischemic stroke hazard ratios were 1.09 (95% confidence interval CI 1.01-1.17; P = 0.03) for pTG, 1.06 (95% CI 0.98-1.15; P = 0.17) for pTG/FXIa(-) , and 1.11 (95% CI 1.02-1.21; P = 0.02) for FXIa-dependent pTG (pTG/FXIa(+) ), per one standard deviation increment (n = 834 ischemic strokes). In a multicohort candidate gene analysis, rs1801020 was not associated with incident ischemic stroke (β = - 0.02; standard error = 0.08; P = 0.81). These results support the importance of contact activation pathway-dependent TG as a risk factor for ischemic stroke, and indicate the importance of F12 SNPs for TG ex vivo and in vivo. © 2015 International Society on Thrombosis and Haemostasis.

Impact of apolipoprotein A5 (APOA5) polymorphisms on serum triglyceride levels in schizophrenic patients under long-term atypical antipsychotic treatment.

PubMed

Hong, Chen-Jee; Chen, Tzu-Ting; Bai, Ya Mei; Liou, Ying-Jay; Tsai, Shih-Jen

2012-01-01

Schizophrenic patients treated with clozapine or olanzapine often develop hypertriglyceridemia. The apolipoprotein A5 gene (APOA5), which affects VLDL production and lipolysis, has been implicated in the triglyceride (TG) metabolism. This study examined the association of common APOA5 genetic variants and TG levels in chronically institutionalized schizophrenic patients, on a stable dose of atypical antipsychotic (clozapine, olanzapine or risperidone. The TG levels in 466 schizophrenic patients treated with clozapine (n = 182), olanzapine (n = 89) or risperidone (n = 195) were measured. Patients were genotyped for the three APOA5 single nucleotide polymorphisms (SNPs) rs662799 (-1131T > C), rs651821 (3A > G) and rs2266788 (1891T > C). A gene × drug interaction with TG levels was observed. In single-marker-based analysis, the minor alleles of the two polymorphisms (-1131C and -3G) were observed to be associated with increased TGs in patients treated with risperidone, but not with clozapine or olanzapine. Haplotype analysis further revealed that carriers of the haplotype constructed with the three minor alleles had higher TG levels than those who did not carry this haplotype in patients taking risperidone (CGC((+/+)) vs. = 125.4 ± 59.1 vs. 82.2 ± 65.8, P = 0.015; CGC((-/+ )) vs. CGC((-/-)) = 113.7 ± 80.4 vs. 82.2 ± 65.8, P = 0.012). Our findings extend and add new information to the existing data regarding the association between APOA5 and TG regulation during long-term atypical antipsychotic treatment.

Gradual Phenotype Development in Huntington Disease Transgenic Minipig Model at 24 Months of Age.

PubMed

Vidinská, Daniela; Vochozková, Petra; Šmatlíková, Petra; Ardan, Taras; Klíma, Jiří; Juhás, Štefan; Juhásová, Jana; Bohuslavová, Božena; Baxa, Monika; Valeková, Ivona; Motlík, Jan; Ellederová, Zdenka

2018-06-05

Huntington disease (HD) is an incurable neurodegenerative disease caused by the expansion of a polyglutamine sequence in a gene encoding the huntingtin (Htt) protein, which is expressed in almost all cells of the body. In addition to small animal models, new therapeutic approaches (including gene therapy) require large animal models as their large brains are a more realistic model for translational research. In this study, we describe phenotype development in transgenic minipigs (TgHD) expressing the N-terminal part of mutated human Htt at the age of 24 months. TgHD and wild-type littermates were compared. Western blot analysis and subcellular fractionation of different tissues was used to determine the fragmentation of Htt. Immunohistochemistry and optical analysis of coronal sections measuring aggregates, Htt expression, neuroinflammation, and myelination was applied. Furthermore, the expression of Golgi protein acyl-CoA binding domain containing 3 (ACBD3) was analyzed. We found age-correlated Htt fragmentation in the brain. Among various tissues studied, the testes displayed the highest fragmentation, with Htt fragments detectable even in cell nuclei. Also, Golgi protein ACBD3 was upregulated in testes, which is in agreement with previously reported testicular degeneration in TgHD minipigs. Nevertheless, the TgHD-specific mutated Htt fragments were also present in the cytoplasm of striatum and cortex cells. Moreover, microglial cells were activated and myelination was slightly decreased, suggesting the development of a premanifest stage of neurodegeneration in TgHD minipigs. The gradual development of a neurodegenerative phenotype, ac-companied with testicular degeneration, is observed in 24- month-old TgHD minipigs. © 2018 S. Karger AG, Basel.

Cell surface localization of the 78 kD glucose regulated protein (GRP 78) induced by thapsigargin.

PubMed

Delpino, A; Piselli, P; Vismara, D; Vendetti, S; Colizzi, V

1998-01-01

In the present study it was found that the synthesis of the 78 kD glucose-regulated protein (GRP 78 or BIP) is vigorously induced in human rabdomiosarcoma cells (TE 671/RD) following both short-term (1 h) and prolonged (18 h) exposure to 100 nM thapsigargin (Tg). Flow cytometric analysis with a specific anti-GRP 78 polyclonal antibody showed that Tg-treated cells express the GRP 78 on the plasma membrane. Cell surface localization of the Tg-induced GRP 78 was confirmed by biotinylation of membrane-exposed proteins and subsequent isolation of the biotin-labelled proteins by streptavidin/agarose affinity chromatography. It was found that a fraction of the Tg-induced GRP 78 is present among the biotin-labelled, surface-exposed, proteins. Conversely, the GRP 78 immunoprecipitated from unfractionated lysates of Tg-treated and biotin-reacted cells was found to be biotinylated. This is the first report demonstrating surface expression of GRP 78 in cells exposed to a specific GRP 78-inducing stimulus.

Mutation spectrum of hepatocellular carcinoma from eastern-European patients betrays the impact of a complex exposome.

PubMed

Tanase, Anna-Maria; Marchio, Agnès; Dumitrascu, Traian; Dima, Simona; Herlea, Vlad; Oprisan, Gabriela; Dejean, Anne; Popescu, Irinel; Pineau, Pascal

2015-05-01

Genomic analysis of hepatocellular carcinoma (HCC) has been shown to provide clues about local risk factors. In the last decades, the mortality from malignant liver tumors increased sharply in Romania, where both hepatitis viruses and environmental pollutants are known to be highly prevalent. To date, HCC from this country has not been subject to molecular characterization. We analyzed a series of 48 consecutive HCC cases. Point mutations were searched in 9 nuclear genes and the mitochondrial D-loop. Oxidative stress response was monitored through measurement of gene expression (NRF2, KEAP1, SRXN1, and CES1) by qRT-PCR. An atypical mutation spectrum was observed, as more than 40% of DNA changes were oxidative stress-associated T>C or T>G lesions (T>S). These mutations affected primarily genes encoding for β-catenin and NRF2 (P<0.0001). Besides, tumors from patients born in Greater Bucharest carried TP53 mutations more frequently than others (45 vs 10%, P=0.02). Finally, a R249S mutation of TP53, well-known hallmark of aflatoxin B1 exposure, was found. Our findings indicate, therefore, that distinct mutagenic processes affect Romanian patients with HCC. Further analyses are now warranted in order to identify causal lifestyle or environmental factors.

Yeast three-hybrid screen identifies TgBRADIN/GRA24 as a negative regulator of Toxoplasma gondii bradyzoite differentiation.

PubMed

Odell, Anahi V; Tran, Fanny; Foderaro, Jenna E; Poupart, Séverine; Pathak, Ravi; Westwood, Nicholas J; Ward, Gary E

2015-01-01

Differentiation of the protozoan parasite Toxoplasma gondii into its latent bradyzoite stage is a key event in the parasite's life cycle. Compound 2 is an imidazopyridine that was previously shown to inhibit the parasite lytic cycle, in part through inhibition of parasite cGMP-dependent protein kinase. We show here that Compound 2 can also enhance parasite differentiation, and we use yeast three-hybrid analysis to identify TgBRADIN/GRA24 as a parasite protein that interacts directly or indirectly with the compound. Disruption of the TgBRADIN/GRA24 gene leads to enhanced differentiation of the parasite, and the TgBRADIN/GRA24 knockout parasites show decreased susceptibility to the differentiation-enhancing effects of Compound 2. This study represents the first use of yeast three-hybrid analysis to study small-molecule mechanism of action in any pathogenic microorganism, and it identifies a previously unrecognized inhibitor of differentiation in T. gondii. A better understanding of the proteins and mechanisms regulating T. gondii differentiation will enable new approaches to preventing the establishment of chronic infection in this important human pathogen.

Postural Stability of Special Warfare Combatant-Craft Crewmen With Tactical Gear.

PubMed

Morgan, Paul M; Williams, Valerie J; Sell, Timothy C

The US Naval Special Warfare's Special Warfare Combatant-Craft Crewmen (SWCC) operate on small, high-speed boats while wearing tactical gear (TG). The TG increases mission safety and success but may affect postural stability, potentially increasing risk for musculoskeletal injury. Therefore, the purpose of this study was to examine the effects of TG on postural stability during the Sensory Organization Test (SOT). Eight SWCC performed the SOT on NeuroCom's Balance Manager with TG and with no tactical gear (NTG). The status of gear was performed in randomized order. The SOT consisted of six different conditions that challenge sensory systems responsible for postural stability. Each condition was performed for three trials, resulting in a total of 18 trials. Overall performance, each individual condition, and sensory system analysis (somatosensory, visual, vestibular, preference) were scored. Data were not normally distributed therefore Wilcoxon signed-rank tests were used to compare each variable (ρ = .05). No significant differences were found between NTG and TG tests. No statistically significant differences were detected under the two TG conditions. This may be due to low statistical power, or potentially insensitivity of the assessment. Also, the amount and distribution of weight worn during the TG conditions, and the SWCC's unstable occupational platform, may have contributed to the findings. The data from this sample will be used in future research to better understand how TG affects SWCC. The data show that the addition of TG used in our study did not affect postural stability of SWCC during the SOT. Although no statistically significant differences were observed, there are clinical reasons for continued study of the effect of increased load on postural stability, using more challenging conditions, greater surface perturbations, dynamic tasks, and heavier loads. 2016.

Relative contribution of variation within the APOC3/A4/A5 gene cluster in determining plasma triglycerides.

PubMed

Talmud, Philippa J; Hawe, Emma; Martin, Steve; Olivier, Michael; Miller, George J; Rubin, Edward M; Pennacchio, Len A; Humphries, Steve E

2002-11-15

Since triglycerides (TG) are a major independent risk factor for coronary heart disease, understanding their genetic and environmental determinants is of major importance. Mouse models indicate an inverse relationship between levels of the newly identified apolipoprotein AV (APOAV) and TG concentrations. We have examined the relative influence of human APOA5 variants on plasma lipids, compared to the impact of variation in APOC3 and APOA4 which lie in the same cluster. Single nucleotide polymorphisms (SNPs) in APOA5 (S19W, -1131T>C) and APOA4 (T347S, Q360H) and an APOA4/A5 intergenic T>C SNP were examined in a large study of healthy middle-aged men (n=2808). APOA5 19WW and -1131CC men had 52% and 40% higher TG (P<0.003) compared to common allele homozygotes, respectively, effects which were independent and additive. APOA4 347SS men had 23% lower TG compared to TT men (P<0.002). Haplotype analysis was carried out to identify TG-raising alleles and included, in addition, four previously genotyped APOC3 SNPs (-2845T>G, -482C>T, 1100C>T, and 3238C>G). The major TG-raising alleles were defined by APOA5 W19 and APOC3 -482T. This suggests that the TG-lowering effect of APOA4 S347 might merely reflect the strong negative linkage disequilibrium with the common alleles of these variants. Thus variation in APOA5 is associated with differences in TGs in healthy men, independent of those previously reported for APOC3, while association between APOA4 and TG reflects linkage disequilibrium with these sites. The molecular mechanisms for these effects remain to be determined.

Transgenic rat model of childhood-onset dermatitis by overexpressing telomerase reverse transcriptase (TERT).

PubMed

Kaneko, Ryosuke; Sato, Atsuko; Hamada, Shun; Yagi, Takeshi; Ohsawa, Ichiro; Ohtsuki, Mamitaro; Kobayashi, Eiji; Hirabayashi, Masumi; Murakami, Takashi

2016-08-01

Childhood-onset dermatitis is one of the most common skin disorders in children. Although various mouse models that mirror aspects of dermatitis have become available, there is still a need for an animal model that develops dermatitis in childhood and is more suitable for performing tissue transplantation experiments. There is emerging evidence that peripheral blood T lymphocytes from patients with dermatitis have significantly increased telomerase activity. Here, we developed telomerase reverse transcriptase (TERT)-expressing transgenic (Tg) rats that spontaneously developed eczematous skin inflammation in childhood. Newborn TERT-Tg rats developed visible dermatitis in 56 % of cases, and the skin lesions microscopically showed spongiosis and acanthosis with infiltration of lymphocytes, eosinophils and mast cells. TERT-Tg rats with dermatitis exhibited increased CD4 (2.5-fold) and CD8 (fivefold) T cell numbers compared with dermatitis-free TERT-Tg rats. Stronger TERT activity was observed in the peripheral lymphocytes of dermatitis-positive TERT-Tg rats than those of dermatitis-free TERT-Tg rats. RT-PCR analysis revealed that IL-4 was markedly elevated in the spleen of dermatitis-positive TERT-Tg rats, and that interferon-gamma was increased in the dermatitis lesions. Moreover, skin grafting of TERT-Tg rats with dermatitis onto T cell-deficient nude rats demonstrated that the inflamed skin lesions could not be maintained. Taken together, the results suggest that TERT activation in T lymphocytes is one of the potential predisposing factors for dermatitis. Moreover, our results demonstrated that the TERT-Tg rats mirror aspects of human childhood-onset dermatitis and that these animals represent a potential animal model system for studying childhood-onset dermatitis.

The Relationship of Static Tibial Tubercle-Trochlear Groove Measurement and Dynamic Patellar Tracking.

PubMed

Carlson, Victor R; Sheehan, Frances T; Shen, Aricia; Yao, Lawrence; Jackson, Jennifer N; Boden, Barry P

2017-07-01

The tibial tubercle to trochlear groove (TT-TG) distance is used for screening patients with a variety of patellofemoral joint disorders to determine who may benefit from patellar medialization using a tibial tubercle osteotomy. Clinically, the TT-TG distance is predominately based on static imaging with the knee in full extension; however, the predictive ability of this measure for dynamic patellar tracking patterns is unknown. To determine whether the static TT-TG distance can predict dynamic lateral displacement of the patella. Cohort study (Diagnosis); Level of evidence, 2. The static TT-TG distance was measured at full extension for 70 skeletally mature subjects with (n = 32) and without (n = 38) patellofemoral pain. The dynamic patellar tracking patterns were assessed from approximately 45° to 0° of knee flexion by use of dynamic cine-phase contrast magnetic resonance imaging. For each subject, the value of dynamic lateral tracking corresponding to the exact knee angle measured in the static images for that subject was identified. Linear regression analysis determined the predictive ability of static TT-TG distance for dynamic patellar lateral displacement for each cohort. The static TT-TG distance measured with the knee in full extension cannot accurately predict dynamic lateral displacement of the patella. There was weak predictive ability among subjects with patellofemoral pain ( r 2 = 0.18, P = .02) and no predictive capability among controls. Among subjects with patellofemoral pain and static TT-TG distances 15 mm or more, 8 of 13 subjects (62%) demonstrated neutral or medial patellar tracking patterns. The static TT-TG distance cannot accurately predict dynamic lateral displacement of the patella. A large percentage of patients with patellofemoral pain and pathologically large TT-TG distances may have neutral to medial maltracking patterns.

The triglyceride-to-HDL cholesterol ratio: association with insulin resistance in obese youths of different ethnic backgrounds.

PubMed

Giannini, Cosimo; Santoro, Nicola; Caprio, Sonia; Kim, Grace; Lartaud, Derek; Shaw, Melissa; Pierpont, Bridget; Weiss, Ram

2011-08-01

We evaluated whether the triglyceride-to-HDL cholesterol (TG/HDL-C) ratio is associated with insulin resistance (IR) in a large multiethnic cohort of obese youths. Obese youths (1,452) had an oral glucose tolerance test and a fasting lipid profile. Insulin sensitivity was estimated using the whole body insulin sensitivity index (WBISI) and homeostasis model assessment (HOMA)-IR and evaluated, in a subgroup of 146 obese youths, by the hyperinsulinemic-euglycemic clamp. The cohort was divided by ethnicity (612 whites, 357 Hispanics, and 483 African Americans) and then stratified into ethnicity-specific tertiles of TG/HDL-C ratio. Differences across tertiles were evaluated, and the association between the TG/HDL-C ratio and insulin sensitivity (WBISI) was defined by a multiple stepwise linear regression analysis. The area under the receiver operating characteristic (ROC) curve (AUC) was determined to calculate the TG/HDL-C ratio cutoff to identify insulin-resistant subjects by ethnicity. In each ethnic group and across rising tertiles of TG/HDL-C ratio, insulin sensitivity (WBISI) progressively decreased, whereas 2-h glucose and the AUC-glucose progressively increased. The cutoff for TG/HDL-C ratio was 2.27, and the odds of presenting with IR, in youths with TG/HDL-C ratio higher than the cutoff, was 6.023 (95% CI 2.798-12.964; P < 0.001) in white girls and boys, whereas for both Hispanics and African Americans the AUC-ROCs were not significant, thus not allowing the calculation of an optimal cutoff TG/HDL-C value. The TG/HDL-C ratio is associated with IR mainly in white obese boys and girls and thus may be used with other risk factors to identify subjects at increased risk of IR-driven morbidity.

The Triglyceride-to-HDL Cholesterol Ratio

PubMed Central

Giannini, Cosimo; Santoro, Nicola; Caprio, Sonia; Kim, Grace; Lartaud, Derek; Shaw, Melissa; Pierpont, Bridget; Weiss, Ram

2011-01-01

OBJECTIVE We evaluated whether the triglyceride-to-HDL cholesterol (TG/HDL-C) ratio is associated with insulin resistance (IR) in a large multiethnic cohort of obese youths. RESEARCH DESIGN AND METHODS Obese youths (1,452) had an oral glucose tolerance test and a fasting lipid profile. Insulin sensitivity was estimated using the whole body insulin sensitivity index (WBISI) and homeostasis model assessment (HOMA)-IR and evaluated, in a subgroup of 146 obese youths, by the hyperinsulinemic-euglycemic clamp. The cohort was divided by ethnicity (612 whites, 357 Hispanics, and 483 African Americans) and then stratified into ethnicity-specific tertiles of TG/HDL-C ratio. Differences across tertiles were evaluated, and the association between the TG/HDL-C ratio and insulin sensitivity (WBISI) was defined by a multiple stepwise linear regression analysis. The area under the receiver operating characteristic (ROC) curve (AUC) was determined to calculate the TG/HDL-C ratio cutoff to identify insulin-resistant subjects by ethnicity. RESULTS In each ethnic group and across rising tertiles of TG/HDL-C ratio, insulin sensitivity (WBISI) progressively decreased, whereas 2-h glucose and the AUC-glucose progressively increased. The cutoff for TG/HDL-C ratio was 2.27, and the odds of presenting with IR, in youths with TG/HDL-C ratio higher than the cutoff, was 6.023 (95% CI 2.798–12.964; P < 0.001) in white girls and boys, whereas for both Hispanics and African Americans the AUC-ROCs were not significant, thus not allowing the calculation of an optimal cutoff TG/HDL-C value. CONCLUSIONS The TG/HDL-C ratio is associated with IR mainly in white obese boys and girls and thus may be used with other risk factors to identify subjects at increased risk of IR-driven morbidity. PMID:21730284

Identification of cardiometabolic risk: visceral adiposity index versus triglyceride/HDL cholesterol ratio.

PubMed

Salazar, Martin R; Carbajal, Horacio A; Espeche, Walter G; Aizpurúa, Marcelo; Maciel, Pablo M; Reaven, Gerald M

2014-02-01

The plasma concentration ratio of triglyceride (TG)/high-density lipoprotein cholesterol (HDL-C) can identify cardiometabolic risk and cardiovascular disease. The visceral adiposity index is a sex-specific index, in which measurements of body mass index and waist circumference are combined with TG and HDL-C concentrations. The current analysis was initiated to see if the visceral adiposity index would improve the ability of the TG/HDL-C to identify increased cardiometabolic risk and outcome. Cardiometabolic data were obtained in 2003 from 926 apparently healthy individuals, 796 of whom were evaluated in 2012 for evidence of incident cardiovascular disease. The relationship between TG/HDL-C and values for visceral adiposity index was evaluated by Pearson's correlation coefficient. The relative risks for first cardiovascular event between individuals above and below the TG/HDL-C sex-specific cut points, and in the top quartile of visceral adiposity index versus the remaining 3 quartiles, were estimated using Cox proportional hazard models. TG/HDL-C concentration and visceral adiposity index were highly correlated (r = 0.99) in both men and women. Although more men (133 vs121) and women (73 vs 59) were identified as being at "high risk" by an elevated TG/HDL-C ratio, the individual cardiometabolic risk factors were essentially identical with either index used. However, the hazard ratio of developing cardiovascular disease was significantly increased in individuals with an elevated TG/HDL-C, whereas it was not the case when the visceral adiposity index was used to define "high risk." The visceral adiposity index does not identify individuals with an adverse cardiometabolic profile any better than the TG/HDL-C. Copyright © 2014 Elsevier Inc. All rights reserved.

A novel mutation in the TG gene (G2322S) causing congenital hypothyroidism in a Sudanese family: a case report.

PubMed

Watanabe, Y; Sharwood, E; Goodwin, B; Creech, M K; Hassan, H Y; Netea, M G; Jaeger, M; Dumitrescu, A; Refetoff, S; Huynh, T; Weiss, R E

2018-05-02

Congenital hypothyroidism (CH) has an incidence of approximately 1:3000, but only 15% have mutations in the thyroid hormone synthesis pathways. Genetic analysis allows for the precise diagnosis. A 3-week old girl presented with a large goiter, serum TSH > 100 mIU/L (reference range: 0.7-5.9 mIU/L); free T 4  < 3.2 pmol/L (reference range: 8.7-16 pmol/L); thyroglobulin (TG) 101 μg/L. Thyroid Tc-99 m scan showed increased radiotracer uptake. One brother had CH and both affected siblings have been clinically and biochemically euthyroid on levothyroxine replacement. Another sibling had normal thyroid function. Both Sudanese parents reported non-consanguinity. Peripheral blood DNA from the proposita was subjected to whole exome sequencing (WES). WES identified a novel homozygous missense mutation of the TG gene: c.7021G > A, p.Gly2322Ser, which was subsequently confirmed by Sanger sequencing and present in one allele of both parents. DNA samples from 354 alleles in four Sudanese ethnic groups (Nilotes, Darfurians, Nuba, and Halfawien) failed to demonstrate the presence of the mutant allele. Haplotyping showed a 1.71 centiMorgans stretch of homozygosity in the TG locus suggesting that this mutation occurred identical by descent and the possibility of common ancestry of the parents. The mutation is located in the cholinesterase-like (ChEL) domain of TG. A novel rare missense mutation in the TG gene was identified. The ChEL domain is critical for protein folding and patients with CH due to misfolded TG may present without low serum TG despite the TG gene mutations.

Estimation of true serum thyroglobulin concentration using simultaneous measurement of serum antithyroglobulin antibody.

PubMed

Ahn, Byeong-Cheol; Lee, Won Kee; Jeong, Shin Young; Lee, Sang-Woo; Lee, Jaetae

2013-01-01

We investigated the analytical interference of antithyroglobulin antibody (TgAb) to thyroglobulin (Tg) measurement and tried to convert measured Tg concentration to true Tg concentration using a mathematical equation which includes a concentration of TgAb. Methods. Tg was measured by immunoradiometric assay and TgAb by radioimmunoassy. Experimental samples were produced by mixing Tg and TgAb standard solutions or mixing patients' serum with high Tg or high TgAb. Mathematical equations for prediction of expected Tg concentration with measured Tg and TgAb concentrations were deduced. The Tg concentration calculated using the equations was compared with the expected Tg concentration. Results. Measured Tg concentrations of samples having high TgAb were significantly lower than their expected Tg concentration. Magnitude of TgAb interference with the Tg assay showed a positive correlation with concentration of TgAb. Mathematical equations for estimation of expected Tg concentration using measured Tg and TgAb concentrations were successfully deduced and the calculated Tg concentration showed excellent correlation with expected Tg concentration. Conclusions. A mathematic equation for estimation of true Tg concentration using measured Tg and TgAb concentration was deduced. Tg concentration calculated by use of the equation might be more valuable than measured Tg concentration in patients with differentiated thyroid cancer.

Molecular mechanisms by which oxidative DNA damage promotes telomerase activity.

PubMed

Lee, Hui-Ting; Bose, Arindam; Lee, Chun-Ying; Opresko, Patricia L; Myong, Sua

2017-11-16

Telomeres are highly susceptible to oxidative DNA damage, which if left unrepaired can lead to dysregulation of telomere length homeostasis. Here we employed single molecule FRET, single molecule pull-down and biochemical analysis to investigate how the most common oxidative DNA lesions, 8-oxoguanine (8oxoG) and thymine glycol (Tg), regulate the structural properties of telomeric DNA and telomerase extension activity. In contrast to 8oxoG which disrupts the telomeric DNA structure, Tg exhibits substantially reduced perturbation of G-quadruplex folding. As a result, 8oxoG induces high accessibility, whereas Tg retains limited accessibility, of telomeric G-quadruplex DNA to complementary single stranded DNA and to telomere binding protein POT1. Surprisingly, the Tg lesion stimulates telomerase loading and activity to a similar degree as an 8oxoG lesion. We demonstrate that this unexpected stimulation arises from Tg-induced conformational alterations and dynamics in telomeric DNA. Despite impacting structure by different mechanisms, both 8oxoG and Tg enhance telomerase binding and extension activity to the same degree, potentially contributing to oncogenesis. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Tests for Serum Transglutaminase and Endomysial Antibodies Do Not Detect Most Patients With Celiac Disease and Persistent Villous Atrophy on Gluten-free Diets: a Meta-analysis.

PubMed

Silvester, Jocelyn A; Kurada, Satya; Szwajcer, Andrea; Kelly, Ciarán P; Leffler, Daniel A; Duerksen, Donald R

2017-09-01

Tests to measure serum endomysial antibodies (EMA) and antibodies to tissue transglutaminase (tTG) were developed to screen for celiac disease in patients consuming gluten. However, they are commonly used to monitor patients on a gluten-free diet (GFD). We conducted a meta-analysis to assess the sensitivity and specificity of tTG IgA and EMA IgA assays in identifying patients with celiac disease who have persistent villous atrophy despite a GFD. We searched PUBMED, EMBASE, BIOSIS, SCOPUS, clinicaltrials.gov, Science Citation Index, and Cochrane Library databases through November 2016. Inclusion criteria were studies of subjects with biopsy-confirmed celiac disease, follow-up biopsies, and measurement of serum antibodies on a GFD, biopsy performed on subjects regardless of symptoms, or antibody test results. Our analysis excluded subjects with refractory celiac disease, undergoing gluten challenge, or consuming a prescribed oats-containing GFD. Tests were considered to have positive or negative findings based on manufacturer cut-off values. Villous atrophy was defined as a Marsh 3 lesion or villous height:crypt depth ratio below 3.0. We constructed forest plots to determine the sensitivity and specificity of detection for individual studies. For the meta-analysis, a bivariate random effects model was used to jointly model sensitivity and specificity. Our search identified 5408 unique citations. Following review of abstracts, 442 articles were reviewed in detail. Only 26 studies (6 of tTG assays, 15 of EMA assays, and 5 of tTG and EMA assays) met our inclusion criteria. The most common reason studies were excluded from our analysis was inability to cross-tabulate histologic and serologic findings. The serum assays identified patients with persistent villous atrophy with high levels of specificity: 0.83 for the tTG IgA assay (95% CI, 0.79-0.87) and 0.91 for the EMA IgA assay (95% CI, 0.87-0.94). However, they detected villous atrophy with low levels of sensitivity: 0.50 for the tTG IgA assay (95% CI, 0.41-0.60) and 0.45 for the EMA IgA assay (95% CI, 0.34-0.57). The tests had similar levels of performance in pediatric and adult patients. In a meta-analysis of patients with biopsy-confirmed celiac disease undergoing follow-up biopsy on a GFD, we found that tests for serum tTG IgA and EMA IgA levels had low sensitivity (below 50%) in detection of persistent villous atrophy. We need more-accurate non-invasive markers of mucosal damage in children and adults with celiac disease who are following a GFD. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

Cerebrolysin modulates pronerve growth factor/nerve growth factor ratio and ameliorates the cholinergic deficit in a transgenic model of Alzheimer's disease.

PubMed

Ubhi, Kiren; Rockenstein, Edward; Vazquez-Roque, Ruben; Mante, Michael; Inglis, Chandra; Patrick, Christina; Adame, Anthony; Fahnestock, Margaret; Doppler, Edith; Novak, Philip; Moessler, Herbert; Masliah, Eliezer

2013-02-01

Alzheimer's disease (AD) is characterized by degeneration of neocortex, limbic system, and basal forebrain, accompanied by accumulation of amyloid-β and tangle formation. Cerebrolysin (CBL), a peptide mixture with neurotrophic-like effects, is reported to improve cognition and activities of daily living in patients with AD. Likewise, CBL reduces synaptic and behavioral deficits in transgenic (tg) mice overexpressing the human amyloid precursor protein (hAPP). The neuroprotective effects of CBL may involve multiple mechanisms, including signaling regulation, control of APP metabolism, and expression of neurotrophic factors. We investigate the effects of CBL in the hAPP tg model of AD on levels of neurotrophic factors, including pro-nerve growth factor (NGF), NGF, brain-derived neurotrophic factor (BDNF), neurotropin (NT)-3, NT4, and ciliary neurotrophic factor (CNTF). Immunoblot analysis demonstrated that levels of pro-NGF were increased in saline-treated hAPP tg mice. In contrast, CBL-treated hAPP tg mice showed levels of pro-NGF comparable to control and increased levels of mature NGF. Consistently with these results, immunohistochemical analysis demonstrated increased NGF immunoreactivity in the hippocampus of CBL-treated hAPP tg mice. Protein levels of other neurotrophic factors, including BDNF, NT3, NT4, and CNTF, were unchanged. mRNA levels of NGF and other neurotrophins were also unchanged. Analysis of neurotrophin receptors showed preservation of the levels of TrKA and p75(NTR) immunoreactivity per cell in the nucleus basalis. Cholinergic cells in the nucleus basalis were reduced in the saline-treated hAPP tg mice, and treatment with CBL reduced these cholinergic deficits. These results suggest that the neurotrophic effects of CBL might involve modulation of the pro-NGF/NGF balance and a concomitant protection of cholinergic neurons. Copyright © 2012 Wiley Periodicals, Inc.

Additive effects of LPL, APOA5 and APOE variant combinations on triglyceride levels and hypertriglyceridemia: results of the ICARIA genetic sub-study

PubMed Central

2010-01-01

Background Hypertriglyceridemia (HTG) is a well-established independent risk factor for cardiovascular disease and the influence of several genetic variants in genes related with triglyceride (TG) metabolism has been described, including LPL, APOA5 and APOE. The combined analysis of these polymorphisms could produce clinically meaningful complementary information. Methods A subgroup of the ICARIA study comprising 1825 Spanish subjects (80% men, mean age 36 years) was genotyped for the LPL-HindIII (rs320), S447X (rs328), D9N (rs1801177) and N291S (rs268) polymorphisms, the APOA5-S19W (rs3135506) and -1131T/C (rs662799) variants, and the APOE polymorphism (rs429358; rs7412) using PCR and restriction analysis and TaqMan assays. We used regression analyses to examine their combined effects on TG levels (with the log-transformed variable) and the association of variant combinations with TG levels and hypertriglyceridemia (TG ≥ 1.69 mmol/L), including the covariates: gender, age, waist circumference, blood glucose, blood pressure, smoking and alcohol consumption. Results We found a significant lowering effect of the LPL-HindIII and S447X polymorphisms (p < 0.0001). In addition, the D9N, N291S, S19W and -1131T/C variants and the APOE-ε4 allele were significantly associated with an independent additive TG-raising effect (p < 0.05, p < 0.01, p < 0.001, p < 0.0001 and p < 0.001, respectively). Grouping individuals according to the presence of TG-lowering or TG-raising polymorphisms showed significant differences in TG levels (p < 0.0001), with the lowest levels exhibited by carriers of two lowering variants (10.2% reduction in TG geometric mean with respect to individuals who were homozygous for the frequent alleles of all the variants), and the highest levels in carriers of raising combinations (25.1% mean TG increase). Thus, carrying two lowering variants was protective against HTG (OR = 0.62; 95% CI, 0.39-0.98; p = 0.042) and having one single raising polymorphism (OR = 1.20; 95% CI, 1.39-2.87; p < 0.001) or more (2 or 3 raising variants; OR = 2.90; 95% CI, 1.56-5.41; p < 0.001) were associated with HTG. Conclusion Our results showed a significant independent additive effect on TG levels of the LPL polymorphisms HindIII, S447X, D9N and N291S; the S19W and -1131T/C variants of APOA5, and the ε4 allele of APOE in our study population. Moreover, some of the variant combinations studied were significantly associated with the absence or the presence of hypertriglyceridemia. PMID:20429872

The Role of Plasma Triglyceride/High-Density Lipoprotein Cholesterol Ratio to Predict New Cardiovascular Events in Essential Hypertensive Patients.

PubMed

Turak, Osman; Afşar, Barış; Ozcan, Fırat; Öksüz, Fatih; Mendi, Mehmet Ali; Yayla, Çagrı; Covic, Adrian; Bertelsen, Nathan; Kanbay, Mehmet

2016-08-01

Triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) has been suggested as a simple method to identify unfavorable cardiovascular outcomes in the general population. The effect of the TG/HDL-C ratio on essential hypertensive patients is unclear. About 900 consecutive essential hypertensive patients (mean age 52.9±12.6 years, 54.2% male) who visited our outpatient hypertension clinic were analyzed. Participants were divided into quartiles based on baseline TG/HDL-C ratio and medical records were obtained periodically for the occurrence of fatal events and composite major adverse cardiovascular events (MACEs) including transient ischemic attack, stroke, aortic dissection, acute coronary syndrome, and death. Participants were followed for a median of 40 months (interquartile range, 35-44 months). Overall, a higher quartile of TG/HDL-C ratio at baseline was significantly linked with higher incidence of fatal and nonfatal cardiovascular events. Using multivariate Cox regression analysis, plasma TG/HDL-C ratio was independently associated with increased risk of fatal events (hazard ratio [HR], 1.25; 95% confidence interval [CI], 1.13-1.37; P≤.001] and MACEs (HR, 1.13; 95% CI, 1.06-1.21; P≤.001). Increased plasma TG/HDL-C ratio was associated with more fatal events and MACEs in essential hypertensive patients. © 2015 Wiley Periodicals, Inc.

Tumor Necrosis Factor Alpha Signaling in Trigeminal Ganglion Contributes to Mechanical Hypersensitivity in Masseter Muscle During Temporomandibular Joint Inflammation.

PubMed

Ito, Reio; Shinoda, Masamichi; Honda, Kuniya; Urata, Kentaro; Lee, Jun; Maruno, Mitsuru; Soma, Kumi; Okada, Shinji; Gionhaku, Nobuhito; Iwata, Koichi

To determine the involvement of tumor necrosis factor alpha (TNFα) signaling in the trigeminal ganglion (TG) in the mechanical hypersensitivity of the masseter muscle during temporomandibular joint (TMJ) inflammation. A total of 55 male Sprague-Dawley rats were used. Following injection of Complete Freund's Adjuvant into the TMJ, the mechanical sensitivities of the masseter muscle and the overlying facial skin were measured. Satellite glial cell (SGC) activation and TNFα expression in the TG were investigated immunohistochemically, and the effects of their inhibition on the mechanical hypersensitivity of the masseter muscle were also examined. Student t test or two-way repeated-measures analysis of variance followed by Bonferroni multiple comparisons test were used for statistical analyses. P < .05 was considered to reflect statistical significance. Mechanical allodynia in the masseter muscle was induced without any inflammatory cell infiltration in the muscle after TMJ inflammation. SGC activation and an increased number of TNFα-immunoreactive cells were induced in the TG following TMJ inflammation. Intra-TG administration of an inhibitor of SGC activity or of TNFα-neutralizing antibody depressed both the increased number of TG cells encircled by activated SGCs and the mechanical hypersensitivity of the masseter following TMJ inflammation. These findings suggest that persistent masseter hypersensitivity associated with TMJ inflammation was mediated by SGC-TG neuron interactions via TNFα signaling in the TG.

Trend analysis of body weight parameters, mortality, and incidence of spontaneous tumors in Tg.rasH2 mice.

PubMed

Paranjpe, Madhav G; Denton, Melissa D; Vidmar, Tom; Elbekai, Reem H

2014-01-01

Carcinogenicity studies have been performed in conventional 2-year rodent studies for at least 3 decades, whereas the short-term carcinogenicity studies in transgenic mice, such as Tg.rasH2, have only been performed over the last decade. In the 2-year conventional rodent studies, interlinked problems, such as increasing trends in the initial body weights, increased body weight gains, high incidence of spontaneous tumors, and low survival, that complicate the interpretation of findings have been well established. However, these end points have not been evaluated in the short-term carcinogenicity studies involving the Tg.rasH2 mice. In this article, we present retrospective analysis of data obtained from control groups in 26-week carcinogenicity studies conducted in Tg.rasH2 mice since 2004. Our analysis showed statistically significant decreasing trends in initial body weights of both sexes. Although the terminal body weights did not show any significant trends, there was a statistically significant increasing trend toward body weight gains, more so in males than in females, which correlated with increasing trends in the food consumption. There were no statistically significant alterations in mortality trends. In addition, the incidence of all common spontaneous tumors remained fairly constant with no statistically significant differences in trends. © The Author(s) 2014.

MrBayes tgMC3++: A High Performance and Resource-Efficient GPU-Oriented Phylogenetic Analysis Method.

PubMed

Ling, Cheng; Hamada, Tsuyoshi; Gao, Jingyang; Zhao, Guoguang; Sun, Donghong; Shi, Weifeng

2016-01-01

MrBayes is a widespread phylogenetic inference tool harnessing empirical evolutionary models and Bayesian statistics. However, the computational cost on the likelihood estimation is very expensive, resulting in undesirably long execution time. Although a number of multi-threaded optimizations have been proposed to speed up MrBayes, there are bottlenecks that severely limit the GPU thread-level parallelism of likelihood estimations. This study proposes a high performance and resource-efficient method for GPU-oriented parallelization of likelihood estimations. Instead of having to rely on empirical programming, the proposed novel decomposition storage model implements high performance data transfers implicitly. In terms of performance improvement, a speedup factor of up to 178 can be achieved on the analysis of simulated datasets by four Tesla K40 cards. In comparison to the other publicly available GPU-oriented MrBayes, the tgMC 3 ++ method (proposed herein) outperforms the tgMC 3 (v1.0), nMC 3 (v2.1.1) and oMC 3 (v1.00) methods by speedup factors of up to 1.6, 1.9 and 2.9, respectively. Moreover, tgMC 3 ++ supports more evolutionary models and gamma categories, which previous GPU-oriented methods fail to take into analysis.

Genome-wide association study of triglyceride response to a high-fat meal among participants of the NHLBI Genetics of Lipid Lowering Drugs and Diet Network (GOLDN).

PubMed

Wojczynski, Mary K; Parnell, Laurence D; Pollin, Toni I; Lai, Chao Q; Feitosa, Mary F; O'Connell, Jeff R; Frazier-Wood, Alexis C; Gibson, Quince; Aslibekyan, Stella; Ryan, Kathy A; Province, Michael A; Tiwari, Hemant K; Ordovas, Jose M; Shuldiner, Alan R; Arnett, Donna K; Borecki, Ingrid B

2015-10-01

The triglyceride (TG) response to a high-fat meal (postprandial lipemia, PPL) affects cardiovascular disease risk and is influenced by genes and environment. Genes involved in lipid metabolism have dominated genetic studies of PPL TG response. We sought to elucidate common genetic variants through a genome-wide association (GWA) study in the Genetics of Lipid Lowering Drugs and Diet Network (GOLDN). The GOLDN GWAS discovery sample consisted of 872 participants within families of European ancestry. Genotypes for 2,543,887 variants were measured or imputed from HapMap. Replication of our top results was performed in the Heredity and Phenotype Intervention (HAPI) Heart Study (n = 843). PPL TG response phenotypes were constructed from plasma TG measured at baseline (fasting, 0 hour), 3.5 and 6 hours after a high-fat meal, using a random coefficient regression model. Association analyses were adjusted for covariates and principal components, as necessary, in a linear mixed model using the kinship matrix; additional models further adjusted for fasting TG were also performed. Meta-analysis of the discovery and replication studies (n = 1715) was performed on the top SNPs from GOLDN. GOLDN revealed 111 suggestive (p < 1E-05) associations, with two SNPs meeting GWA significance level (p < 5E-08). Of the two significant SNPs, rs964184 demonstrated evidence of replication (p = 1.20E-03) in the HAPI Heart Study and in a joint analysis, was GWA significant (p = 1.26E-09). Rs964184 has been associated with fasting lipids (TG and HDL) and is near ZPR1 (formerly ZNF259), close to the APOA1/C3/A4/A5 cluster. This association was attenuated upon additional adjustment for fasting TG. This is the first report of a genome-wide significant association with replication for a novel phenotype, namely PPL TG response. Future investigation into response phenotypes is warranted using pathway analyses, or newer genetic technologies such as metabolomics. Copyright © 2015 Elsevier Inc. All rights reserved.

GENOME-WIDE ASSOCIATION STUDY OF TRIGLYCERIDE RESPONSE TO A HIGH-FAT MEAL AMONG PARTICIPANTS OF THE NHLBI GENETICS OF LIPID LOWERING DRUGS AND DIET NETWORK (GOLDN)

PubMed Central

Wojczynski, M.K.; Parnel, L.D.; Pollin, T.I.; Lai, C.Q.; Feitosa, M.F.; O’Connell, J.R.; Frazier-Wood, A.C.; Gibson, Q.; Aslibekyan, S.; Ryan, K.A.; Province, M.A.; Tiwari, H.K.; Ordovas, J.M.; Shuldiner, A.R.; Arnett, D.K.; Borecki, I.B.

2015-01-01

Objective The triglyceride (TG) response to a high-fat meal (postprandial lipemia, PPL) affects cardiovascular disease risk and is influenced by genes and environment. Genes involved in lipid metabolism have dominated genetic studies of PPL TG response. We sought to elucidate common genetic variants through a genome-wide association (GWA) study in the Genetics of Lipid Lowering Drugs and Diet Network (GOLDN). Methods The GOLDN GWAS discovery sample consisted of 872 participants within families of European ancestry. Genotypes for 2,543,887 variants were measured or imputed from HapMap. Replication of our top results was performed in the Heredity and Phenotype Intervention (HAPI) Heart Study (n=843). PPL TG response phenotypes were constructed from plasma TG measured at baseline (fasting, 0 hour), 3.5 and 6 hours after a high-fat meal, using a random coefficient regression model. Association analyses were adjusted for covariates and principal components, as necessary, in a linear mixed model using the kinship matrix; additional models further adjusted for fasting TG were also performed. Meta-analysis of the discovery and replication studies (n=1,715) was performed on the top SNPs from GOLDN. Results GOLDN revealed 111 suggestive (p<1E-05) associations, with two SNPs meeting GWA significance level (p<5E-08). Of the two significant SNPs, rs964184 demonstrated evidence of replication (p=1.20E-03) in the HAPI Heart Study and in a joint analysis, was GWA significant (p=1.26E-09). Rs964184 has been associated with fasting lipids (TG and HDL) and is near ZPR1 (formerly ZNF259), close to the APOA1/C3/A4/A5 cluster. This association was attenuated upon additional adjustment for fasting TG. Conclusion This is the first report of a genome-wide significant association with replication for a novel phenotype, namely PPL TG response. Future investigation into response phenotypes is warranted using pathway analyses, or newer genetic technologies such as metabolomics. PMID:26256467

Changes in triglycerides and high-density lipoprotein cholesterol may precede peripheral insulin resistance, with 2-h insulin partially mediating this unidirectional relationship: a prospective cohort study.

PubMed

Han, Tianshu; Cheng, Yu; Tian, Shuang; Wang, Li; Liang, Xi; Duan, Wei; Na, Lixin; Sun, Changhao

2016-11-04

Results of longitudinal researches regarding the temporal relationship between dyslipidemia and insulin resistance (IR) are inconsistent. This study assessed temporal relationships of blood lipids with IR and determined whether there are any mediating effects existed in these temporal relationships. This study examined a longitudinal cohort of 3325 subjects aged 20-74 years from China with an average of 4.2 years follow-up. Measurements of fasting blood lipids, as well as fasting and 2-h serum glucose and insulin, were obtained at two time points. The Gutt index and HOMA-IR were calculated as indicators of peripheral IR and hepatic IR. A cross-lagged path analysis was performed to examine the temporal relationships between blood lipids and IR. A mediation analysis was used to examine mediating effect. After adjusting for covariates, the cross-lagged path coefficients from baseline TG and HDL-C to follow-up Gutt index were significantly greater than those from baseline Gutt index to follow-up TG and HDL-C (β 1  = -0.131 vs β 2  = -0.047, P < 0.001 for TG; β 1  = 0.134 vs β 2  = 0.023, P < 0.001 for HDL-C). The path coefficients from baseline TG and HDL-C to follow-up 2-h insulin were significantly greater than those from baseline 2-h insulin to follow-up TG and HDL-C (β 1  = 0.125 vs β 2  = 0.040, P < 0.001 for TG; β 1  = -0.112 vs β 2  = -0.026, P < 0.001 for HDL-C). 2-h insulin partially mediated the effect of TG/HDL-C on Gutt index with a 59.3% mediating effect for TG and 61.0% for HDL-C. These findings provide strong evidence that dyslipidemia probably precede peripheral IR and that 2-h insulin partially mediates this unidirectional temporal relationship.

Polyunsaturated fatty acids effect on serum triglycerides concentration in presence of metabolic syndrome components. The Alaska-Siberia Project

PubMed Central

Lopez-Alvarenga, Juan C.; Ebbesson, Sven O E; Ebbesson, Lars O E; Tejero, M Elizabeth; Voruganti, V. Saroja; Comuzzie, Anthony G

2009-01-01

Serum fatty acids (FA) have wide effects on metabolism: Serum saturated fatty acids (SFA) increase triglyceride (TG) levels in plasma while polyunsaturated fatty acids (PUFA) reduce them. Traditionally, Eskimos have a high consumption of omega -3 fatty acids (ω–3 FA), but the westernization of their food habits have increased their dietary SFAs, partly reflected in their serum concentrations. We studied the joint effect of serum SFAs and PUFAs on circulating levels of TG in the presence of metabolic syndrome components. We included 212 men and 240 women (age 47.9±15.7 y, BMI 26.9±5.3) from four villages located in Alaska for a cross sectional study. Generalized linear models were employed to build surface responses of TG as in functions of SFAs and PUFAs measured in blood samples adjusting by sex, BMI and village. The effects of individual FAs were assessed by multiple linear regression analysis and partial correlations (r) were calculated. The most important predictors for TG levels were glucose tolerance (r = 0.116, p = 0.018) and BMI (r = 0.42, p<0.001). TG concentration showed negative associations with 20:3ω-6 (r =− 0.16, p = 0.001), 20:4ω-6 (r = −0.14, p=0.005), 20:5ω-3 (r = −0.17, p<0.001) and 22:5ω-3 (r = −0.26, p<0.001), and positive associations with palmitic acid (r = 0.16, p<0.001) and 18:3ω-3 (r = 0.15, p<0.001). The surface response analysis suggested that the effect of palmitic acid on TG is blunted in different degrees according to the PUFA chemical structure. The long chain ω-3, even in presence of high levels of SF, was associated with lower triglyceride levels. Eicosapentanoic acid (20:5ω3) had the strongest effect against palmitic acid on TG. The total FA showed moderate association with levels of TG, while SFA was positively associated, and large chain PUFA negatively. The westernized dietary habits among Eskimos are likely to change their metabolic profile and increase comorbidities related to metabolic disease. PMID:19766268

Involvement of cell surface TG2 in the aggregation of K562 cells triggered by gluten.

PubMed

Feriotto, G; Calza, R; Bergamini, C M; Griffin, M; Wang, Z; Beninati, S; Ferretti, V; Marzola, E; Guerrini, R; Pagnoni, A; Cavazzini, A; Casciano, F; Mischiati, C

2017-03-01

Gluten-induced aggregation of K562 cells represents an in vitro model reproducing the early steps occurring in the small bowel of celiac patients exposed to gliadin. Despite the clear involvement of TG2 in the activation of the antigen-presenting cells, it is not yet clear in which compartment it occurs. Herein we study the calcium-dependent aggregation of these cells, using either cell-permeable or cell-impermeable TG2 inhibitors. Gluten induces efficient aggregation when calcium is absent in the extracellular environment, while TG2 inhibitors do not restore the full aggregating potential of gluten in the presence of calcium. These findings suggest that TG2 activity is not essential in the cellular aggregation mechanism. We demonstrate that gluten contacts the cells and provokes their aggregation through a mechanism involving the A-gliadin peptide 31-43. This peptide also activates the cell surface associated extracellular TG2 in the absence of calcium. Using a bioinformatics approach, we identify the possible docking sites of this peptide on the open and closed TG2 structures. Peptide docks with the closed TG2 structure near to the GTP/GDP site, by establishing molecular interactions with the same amino acids involved in stabilization of GTP binding. We suggest that it may occur through the displacement of GTP, switching the TG2 structure from the closed to the active open conformation. Furthermore, docking analysis shows peptide binding with the β-sandwich domain of the closed TG2 structure, suggesting that this region could be responsible for the different aggregating effects of gluten shown in the presence or absence of calcium. We deduce from these data a possible mechanism of action by which gluten makes contact with the cell surface, which could have possible implications in the celiac disease onset.

Molecular identification of tuliposide B-converting enzyme: a lactone-forming carboxylesterase from the pollen of tulip.

PubMed

Nomura, Taiji; Murase, Tatsunori; Ogita, Shinjiro; Kato, Yasuo

2015-07-01

6-Tuliposides A (PosA) and B (PosB), which are the major secondary metabolites in tulip (Tulipa gesneriana), are enzymatically converted to the antimicrobial lactonized aglycons, tulipalins A (PaA) and B (PaB), respectively. We recently identified a PosA-converting enzyme (TCEA) as the first reported member of the lactone-forming carboxylesterases. Herein, we describe the identification of another lactone-forming carboxylesterase, PosB-converting enzyme (TCEB), which preferentially reacts with PosB to give PaB. This enzyme was isolated from tulip pollen, which showed high PosB-converting activity. Purified TCEB exhibited greater activity towards PosB than PosA, which was contrary to that of the TCEA. Novel cDNA (TgTCEB1) encoding the TCEB was isolated from tulip pollen. TgTCEB1 belonged to the carboxylesterase family and was approximately 50% identical to the TgTCEA polypeptides. Functional characterization of the recombinant enzyme verified that TgTCEB1 catalyzed the conversion of PosB to PaB with an activity comparable with the native TCEB. RT-qPCR analysis of each part of plant revealed that TgTCEB1 transcripts were limited almost exclusively to the pollen. Furthermore, the immunostaining of the anther cross-section using anti-TgTCEB1 polyclonal antibody verified that TgTCEB1 was specifically expressed in the pollen grains, but not in the anther cells. N-terminal transit peptide of TgTCEB1 was shown to function as plastid-targeted signal. Taken together, these results indicate that mature TgTCEB1 is specifically localized in plastids of pollen grains. Interestingly, PosB, the substrate of TgTCEB1, accumulated on the pollen surface, but not in the intracellular spaces of pollen grains. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

Antitissue Transglutaminase Normalization Postdiagnosis in Children With Celiac Disease.

PubMed

Isaac, Daniela Migliarese; Rajani, Seema; Yaskina, Maryna; Huynh, Hien Q; Turner, Justine M

2017-08-01

Limited pediatric data exist examining the trend and predictors of antitissue transglutaminase (atTG) normalization over time in children with celiac disease (CD). We aimed to evaluate time to normalization of atTG in children after CD diagnosis, and to assess for independent predictors affecting this duration. A retrospective chart review was completed in pediatric patients with CD diagnosed from 2007 to 2014 at the Stollery Children's Hospital Celiac Clinic (Edmonton, Alberta, Canada). The clinical predictors assessed for impact on time to atTG normalization were initial atTG, Marsh score at diagnosis, gluten-free diet compliance (GFDC), age at diagnosis, sex, ethnicity, medical comorbidities, and family history of CD. Kaplan-Meier survival analysis was completed to assess time to atTG normalization, and Cox regression to assess for independent predictors of this time. A total of 487 patients met inclusion criteria. Approximately 80.5% of patients normalized atTG levels. Median normalization time was 407 days for all patients (95% confidence interval [CI: 361-453]), and 364 days for gluten-free diet compliant patients (95% CI [335-393]). Type 1 diabetes mellitus (T1DM) patients took significantly longer to normalize at 1204 days (95% CI [199-2209], P < 0.001). Cox regression demonstrated T1DM (hazard ratio = 0.36 [0.24-0.55], P < 0.001) and higher baseline atTG (hazard ratio = 0.52 [0.43-0.63], P < 0.001) were significant predictors of longer atTG normalization time. GFDC was a significant predictor of earlier normalization (OR = 13.91 [7.86-24.62], P < 0.001). GFDC and lower atTG at diagnosis are predictors of earlier normalization. Patients with T1DM are less likely to normalize atTG levels, with longer normalization time. Additional research and education for higher-risk populations are needed.

Effects of blood triglycerides on cardiovascular and all-cause mortality: a systematic review and meta-analysis of 61 prospective studies

PubMed Central

2013-01-01

The relationship of triglycerides (TG) to the risk of death remains uncertain. The aim of this study was to determine the associations between blood triglyceride levels and cardiovascular diseases (CVDs) mortality and all-cause mortality. Four databases were searched without language restriction for relevant studies: PubMed, ScienceDirect, EMBASE, and Google Scholar. All prospective cohort studies reporting an association between TG and CVDs or all-cause mortality published before July 2013 were included. Risk ratios (RRs) with 95% confidence intervals (CIs) were extracted and pooled according to TG categories, unit TG, and logarithm of TG using a random-effects model with inverse-variance weighting. We identified 61 eligible studies, containing 17,018 CVDs deaths in 726,030 participants and 58,419 all-cause deaths in 330,566 participants. Twelve and fourteen studies, respectively, reported the effects estimates of CVDs and total mortality by TG categories. Compared to the referent (90–149 mg/dL), the pooled RRs (95% CI) of CVDs mortality for the lowest (< 90 mg/dL), borderline-high (150–199 mg/dL), and high TG (≥ 200 mg/dL) groups were 0.83 (0.75 to 0.93), 1.15 (1.03 to 1.29), and 1.25 (1.05 to 1.50); for total mortality they were 0.94 (0.85 to 1.03), 1.09 (1.02 to 1.17), and 1.20 (1.04 to 1.38), respectively. The risks of CVDs and all-cause deaths were increased by 13% and 12% (p < 0.001) per 1-mmol/L TG increment in twenty-two and twenty-two studies reported RRs per unit TG, respectively. In conclusion, elevated blood TG levels were dose-dependently associated with higher risks of CVDs and all-cause mortality. PMID:24164719

Topical ocular sodium 4-phenylbutyrate rescues glaucoma in a myocilin mouse model of primary open-angle glaucoma.

PubMed

Zode, Gulab S; Bugge, Kevin E; Mohan, Kabhilan; Grozdanic, Sinisa D; Peters, Joseph C; Koehn, Demelza R; Anderson, Michael G; Kardon, Randy H; Stone, Edwin M; Sheffield, Val C

2012-03-01

Mutations in the myocilin gene (MYOC) are the most common known genetic cause of primary open-angle glaucoma (POAG). The purpose of this study was to determine whether topical ocular sodium 4-phenylbutyrate (PBA) treatment rescues glaucoma phenotypes in a mouse model of myocilin-associated glaucoma (Tg-MYOC(Y437H) mice). Tg-MYOC(Y437H) mice were treated with PBA eye drops (n = 10) or sterile PBS (n = 8) twice daily for 5 months. Long-term safety and effectiveness of topical PBA (0.2%) on glaucoma phenotypes were examined by measuring intraocular pressure (IOP) and pattern ERG (PERG), performing slit lamp evaluation of the anterior chamber, analyzing histologic sections of the anterior segment, and comparing myocilin levels in the aqueous humor and trabecular meshwork of Tg-MYOC(Y437H) mice. Tg-MYOC(Y437H) mice developed elevated IOP at 3 months of age when compared with wild-type (WT) littermates (n = 24; P < 0.0001). Topical PBA did not alter IOP in WT mice. However, it significantly reduced elevated IOP in Tg-MYOC(Y437H) mice to the level of WT mice. Topical PBA-treated Tg-MYOC(Y437H) mice also preserved PERG amplitudes compared with vehicle-treated Tg-MYOC(Y437H) mice. No structural abnormalities were observed in the anterior chamber of PBA-treated WT and Tg-MYOC(Y437H) mice. Analysis of the myocilin in the aqueous humor and TM revealed that PBA significantly improved the secretion of myocilin and reduced myocilin accumulation as well as endoplasmic reticulum (ER) stress in the TM of Tg-MYOC(Y437H) mice. Furthermore, topical PBA reduced IOP elevated by induction of ER stress via tunicamycin injections in WT mice. Topical ocular PBA reduces glaucomatous phenotypes in Tg-MYOC(Y437H) mice, most likely by reducing myocilin accumulation and ER stress in the TM. Topical ocular PBA could become a novel treatment for POAG patients with myocilin mutations.

Triglycerides to high-density lipoprotein cholesterol ratio is an independent predictor of incident fatty liver; a population-based cohort study.

PubMed

Fukuda, Yukiko; Hashimoto, Yoshitaka; Hamaguchi, Masahide; Fukuda, Takuya; Nakamura, Naoto; Ohbora, Akihiro; Kato, Takahiro; Kojima, Takao; Fukui, Michiaki

2016-05-01

Triglycerides (TG) to high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) has been recommended for surrogates of insulin resistance. However, it remains to be elucidated the association between TG/HDL-C and incident fatty liver. To investigate the association between TG/HDL-C and incident fatty liver. We performed population-based historical cohort study consisted with 4518 healthy Japanese who received yearly health-checkup programmes over decade. Fatty liver was diagnosed using ultrasonography. During the observation periods, 38.8% (case/N = 1023/2637) of men and 17.2% (case/N = 324/1881) of women developed fatty liver. Adjusting odds ratio of TG/HDL-C for incident fatty liver were 1.59 (95% confidence interval (CI) 1.42-1.79, P < 0.0001) in men and 2.50 (95% CI 1.80-3.51, P < 0.0001) in women. In addition, adjusting odds ratio of TG/HDL-C for incident non-alcoholic fatty liver disease were 1.55 (95% CI 1.35-1.77, P < 0.0001) in men and 2.72 (95% CI 1.88-3.95, P < 0.0001) in women. According to the receiver operator characteristic (ROC) analysis, the optimal cut-off point of TG/HDL-C for incident fatty liver was 0.88 (area under the ROC curve (AUC) 0.67 [95% CI 0.65-0.69], sensitivity = 0.64, specificity = 0.60, P < 0.0001) in men and 0.64 (AUC 0.69 [95% CI 0.66-0.72], sensitivity = 0.50, specificity = 0.78, P < 0.0001) in women. The TG/HDL-C could predict the incident fatty liver. Thus, it is important to check TG/HDL-C and lifestyles modification is needed for preventing future fatty liver disease in patients with high TG/HDL-C. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Does (131)I Radioactivity Interfere with Thyroglobulin Measurement in Patients Undergoing Radioactive Iodine Therapy with Recombinant Human TSH?

PubMed

Park, Sohyun; Bang, Ji-In; Lee, Ho-Young; Kim, Sang-Eun

2015-06-01

Recombinant human thyroid-stimulating hormone (rhTSH) is widely used in radioactive iodine therapy (RIT) to avoid side effects caused by hypothyroidism during the therapy. Owing to RIT with rhTSH, serum thyroglobulin (Tg) is measured with high (131)I concentrations. It is of concern that the relatively high energy of (131)I could interfere with Tg measurement using the immunoradiometric assay (IRMA). We investigated the effect of (131)I administration on Tg measurement with IRMA after RIT. A total of 67 patients with thyroid cancer were analysed retrospectively. All patients had undergone rhTSH stimulation for RIT. The patients' sera were sampled 2 days after (131)I administration and divided into two portions: for Tg measurements on days 2 and 32 after (131)I administration. The count per minute (CPM) of whole serum (200 μl) was also measured at each time point. Student's paired t-test and Pearson's correlation analyses were performed for statistical analysis. Serum Tg levels were significantly concordant between days 2 and 32, irrespective of the serum CPM. Subgroup analysis was performed by classification based on the (131)I dose. No difference was noted between the results of the two groups. IRMA using (125)I did not show interference from (131)I in the serum of patients stimulated by rhTSH.

Inhibition of elastase-pulmonary emphysema in dominant-negative MafB transgenic mice.

PubMed

Aida, Yasuko; Shibata, Yoko; Abe, Shuichi; Inoue, Sumito; Kimura, Tomomi; Igarashi, Akira; Yamauchi, Keiko; Nunomiya, Keiko; Kishi, Hiroyuki; Nemoto, Takako; Sato, Masamichi; Sato-Nishiwaki, Michiko; Nakano, Hiroshi; Sato, Kento; Kubota, Isao

2014-01-01

Alveolar macrophages (AMs) play important roles in the pathogenesis of chronic obstructive pulmonary disease (COPD). We previously demonstrated upregulation of the transcription factor MafB in AMs of mice exposed to cigarette smoke. The aim of this study was to elucidate the roles of MafB in the development of pulmonary emphysema. Porcine pancreatic elastase was administered to wild-type (WT) and dominant-negative (DN)-MafB transgenic (Tg) mice in which MafB activity was suppressed only in macrophages. We measured the mean linear intercept and conducted cell differential analysis of bronchoalveolar lavage (BAL) cells, surface marker analysis using flow cytometry, and immunohistochemical staining using antibodies to matrix metalloproteinase (MMP)-9 and MMP-12. Airspace enlargement of the lungs was suppressed significantly in elastase-treated DN-MafB Tg mice compared with treated WT mice. AMs with projected pseudopods were decreased in DN-MafB Tg mice. The number of cells intermediately positive for F4/80 and weakly or intermediately positive for CD11b, which are considered cell subsets of matured AMs, decreased in the BAL of DN-MafB Tg mice. Furthermore, MMP-9 and -12 were significantly downregulated in BAL cells of DN-MafB Tg mice. Because MMPs exacerbate emphysema, MafB may be involved in pulmonary emphysema development through altered maturation of macrophages and MMP expression.

[The role of hormone analysis in the nosologic diagnosis and in the control of treatment of congenital primary hypothyroidism].

PubMed

Shilin, D E; Shvora, N M; Pykov, M I; Ibragimova, G V; Krotkov, F F; Riabykh, A V; Ponkratova, T S; Kasatkina, E P

2003-08-01

A total of 125 children and teenagers, aged 1 to 15 (including 74 patients with primary congenital hypothyroidism--CH--and 51 healthy children), were investigated in the city of Moscow for the purpose of elaborating new approaches towards the differentiated diagnostics of CH and of optimizing the assessment of the adequacy of its substitutive hormonal therapy (SHT). The concentrations of the thyrotropic hormone (TTH), free fractions of triiodothyronine and thyroxin (cT3 and cT4), thyreoglobulin (Tg) and of thyreoid peroxidase (hard-phase test-tube method, electro-chemiluminescent reaction, i.e. magnetic microparticles, based on the streptovidin-biotin technology; ruthenium mark at the "Elecsys 1010" analyzer with reagents manufactured by "F. Hoffman--La Rosh Ltd.", Switzerland.) were determined early in the morning on the empty stomach. On the basis of the above mentioned, the thyroid reserve index (TRI = Tg/TG), integral thyroid index (ITI = [cT3 + cT4]/TTG), and the integral of peripheral conversion (IPC = cT3/cT4) were calculated. The thyroid gland (TG) was visualized by the "Acuson-128 XP" ultrasonic device, "Acuson Corp.", USA, with a linear sensor of 10 Mhz, as well as by the "Toshiba-90B" gamma-chamber, Japan, with a low-energy collimator in 24 hours after an oral intake of sodium iodide marked by the iodine 123-isotope with an activity of 50 Mbc and after the cessation of SHT 3 to 5 weeks before. The complex diagnosis revealed 8 variations of primary CH; aplasia and TG dystopia and defects of the synthesis of the sodium-iodine symporter or Tg-concentration were found to belong to the most severe disease types according to hormonal parameters. As for Tg, in 52% of cases it was normal, undeterminable--23% and higher--25%. A simultaneously implemented ultrasonic scanning (USS) ensured a final diagnosis in subgroups, respectively, in all cases, in 25% and in 75% of patients. On the whole, after the two diagnostic stages (Tg + USS/ITR), the indications for isotope scanning left only for 23% of CH patients, i.e. a) if the Tg values could not be determined because the organ was not located in its typical place (17%); or b) if the Tg level was higher or if there was a goiter at the TG normal volume (6%). An in-depth hormonal analysis showed that, should CHT be monitored less than once in three months, it failed to secure a total compensation of the disease in above one third of CH children (39%). Therefore, a three-stage algorithm of nosological diagnostics is recommended for primary CH; it should comprise the determination of Tg level, and USS (for all patients) as well as TG scanning (according to rare indications). The result point at the necessity of hormonal monitoring of CH children and teenagers at least one in 2-3 months. The objectivity degree of CHT goes up as a number of estimated indices, i.e. ITI and IPC, are used alongside with absolute hormonal values.

Synthesis, structural and spectral characterization of a novel NLO crystal N,N‧-diphenylguanidinium picrate: diacetone solvate

NASA Astrophysics Data System (ADS)

Shanmugavadivu, T.; Dhandapani, M.; Naveen, S.; Lokanath, N. K.

2017-09-01

An organic NLO active material N,N‧-diphenylguanidinium picrate: diacetone solvate (C13H14N3+. C6H2N3O7-. 2C3H6O) (DPGPD) was synthesized and single crystals were grown by slow evaporation-solution growth technique at room temperature. DPGPD crystallizes in monoclinic crystal system with noncentrosymmetric space group, Cc confirmed by single crystal X-ray diffraction analysis. The presence of various functional groups was identified from FT-IR spectral analysis and the proton transfer during the formation of compound was confirmed by NMR spectroscopic techniques. The thermal stability was investigated by TG/DTA analyses. Optical transmittance was measured by UV-Vis-NIR spectroscopy and band gap energy was calculated. Photoluminescence spectrum was used to explore its applicability towards laser diodes. Dielectric property of the material was ascertained at different temperatures and it is found that the grown crystal has higher dielectric constant in low frequencies. Photoconductivity study revealed that DPGPD exhibits positive photoconductivity. SHG property was found to be 0.6 times higher than that of KDP.

The association between triglyceride high density lipoprotein cholesterol ratio and benign prostate hyperplasia in non-diabetic patients:a cross-sectional study.

PubMed

Besiroglu, Huseyin; Dursun, Murat; Otunctemur, Alper; Ozbek, Emin

2017-09-01

To assess the association between triglyceride (TG)/high density lipoprotein (HDL) ratio and benign prostate hyperplasia/lower urinary tract symptoms (BPH/LUTS). Four hundred patients who were admitted to the Urology Clinic between January and December 2014 with complaints of BPH/LUTS were enrolled in this cross-sectional study. Patients were divided into two groups according to their International Prostate Symptom Score and prostate volume (PV). They were compared in terms of age, body mass index (BMI), PV, PSA, post micturional residual volume, uroflowmetry Q max value, fasting blood sugar, TG and high density lipoprotein-cholesterol (HDL-C) level and TG/HDL ratio. Although univariate analyses reveal that age, BMI, waist circumference (WC), FBS, TG, HDL-C level, and TG/HDL ratio were correlated with PV, only age [1.125 OR (1.088-1.164), p = .00001], BMI [1.119 OR (1.040-1.204), p = .003], TG [(1.043 OR (1.016-1.071), p = .002], HDL-C [(0.923 OR (0.860-0.990), p = .025], and TG/HDL ratio [(1.224 OR (1.130-1.315), p = .014] were statistically significant in multivariate analysis. The calculated area under the curve (AUC) for PV of 30 ml, 40 ml, and 50 ml was 0.668 (0.608-0.727), 0.617 (0.561-0.673), and 0.592 (0.530-0.654), respectively. Our results indicate that the TG/HDL ratio correlates with enhancement in PV. Further studies are warranted to better evaluate this relationship.

Relationship between Triglyceride and HDL-C ratio with Acute Coronary Syndrome.

PubMed

Islam, M Z; Islam, M N; Bhowmik, T K; Saha, B; Hossain, M S; Ahmed, H; Ali, M S; Shakil, S S; Paul, P K

2018-04-01

Cardiovascular diseases (CVD) is the leading cause of death worldwide, responsible for one third of death, coronary artery disease (CAD) is the most common cause. Dyslipidaemiais one of the major contributors increased of CAD risk. This study was aimed to find out the relationship between triglyceride and HDL cholesterol ratio with acute coronary syndrome. This cross sectional study was conducted in the department of Cardiology, Mymensingh Medical College Hospital from August 2009 to May 2010. Smoking, hypertension, serum total cholesterol level, serum HDL-C, LDL-C, triglyceride (TG) level were important variable considered. A total number of 100 respondents consisted of 50 cases (patient) and 50 healthy persons (control). Investigations included ECG, Troponin-I, FBS and lipid profile. The data was analyzed by computer with the help of SPSS; Chi-square test, 't' test, ANOVA test used as test of significance. The mean level in cases of TG 168.2±88.0 vs. HDL 41.3±5.1 in control level TG 141.2±45.3 and HDL 34.2±3.4. TG/HDL ratio cases 4.2±1.7 and control 4.1±1.3. This ratio >4 is atherogenic for CAD. Unadjusted odds ratio TG/HDL ratio level high (>1). In multivariable regression analysis, TG/HDL ratio was strong relation with ACS. The study reflected that high TG/HDL ratio is associated with ACS. Categorization of patient with ACS on the basis of high TG/HDL ratio will be helpful for risk stratification and management.

Hydrogen bonded supra-molecular framework in inorganic-organic hybrid compounds: Syntheses, structures, and photoluminescent properties

NASA Astrophysics Data System (ADS)

Yan, Li; Liu, Wei; Li, Chuanbi; Wang, Yifei; Ma, Li; Dong, Qinqin

2013-03-01

Two novel compounds constructed from aromatic acid and N-Heterocyclic ligands have been synthesized by hydrothermal reaction: [Cd(mip)(1,8-NDC)(H2O)]2 (1) [mip = 2-(3-methoxyphenyl)-1H-imidazo[4,5-f][1,10]phenanthroline, 1,8-NDC = naphthalene-1,8-dicarboxylic acid] and Cd(mip)2(NTC)2 (2) [NTC = nicotinic acid]. Compounds 1 and 2 are characterized by elemental analysis, IR, single crystal X-ray diffraction and thermogravimetric analysis (TGA). Single-crystal X-ray investigation reveals that compounds 1-2 are 0 dimensional (0D) structures, and the existence of hydrogen bonds and π-π interactions lead the 0D to 2D novel framework. Hydrogen bonds and π-π interactions are powerful non-covalent intermolecular interactions for directing supra-molecular architectures. TG analysis shows clear courses of weight loss, which corresponds to the decomposition of different ligands. At room temperature, compound 1 exhibits emission at 449 nm upon excitation at 325 nm, and compound 2 shows a strong emission at 656 nm upon excitation at 350 nm. Fluorescent spectrum displays that compounds 1 and 2 are potential luminescent materials.

Spectroscopic studies and quantum chemical investigations of (3,4-dimethoxybenzylidene) propanedinitrile.

PubMed

Gupta, Ujval; Kumar, Vinay; Singh, Vivek K; Kant, Rajni; Khajuria, Yugal

2015-04-05

The Fourier Transform Infrared (FTIR), Ultra-Violet Visible (UV-Vis) spectroscopy and Thermogravimetric (TG) analysis of (3,4-dimethoxybenzylidene) propanedinitrile have been carried out and investigated using quantum chemical calculations. The molecular geometry, harmonic vibrational frequencies, Mulliken charges, natural atomic charges and thermodynamic properties in the ground state have been investigated by using Hartree Fock Theory (HF) and Density Functional Theory (DFT) using B3LYP functional with 6-311G(d,p) basis set. Both HF and DFT methods yield good agreement with the experimental data. Vibrational modes are assigned with the help of Vibrational Energy Distribution Analysis (VEDA) program. UV-Visible spectrum was recorded in the spectral range of 190-800nm and the results are compared with the calculated values using TD-DFT approach. Stability of the molecule arising from hyperconjugative interactions, charge delocalization have been analyzed using natural bond orbital (NBO) analysis. The results obtained from the studies of Highest Occupied Molecular Orbital (HOMO) and Lowest Unoccupied Molecular Orbital (LUMO) are used to calculate molecular parameters like ionization potential, electron affinity, global hardness, electron chemical potential and global electrophilicity. Copyright © 2014 Elsevier B.V. All rights reserved.

TH-EF-BRC-00: TG-100 Workshop

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

2016-06-15

This Hands-on Workshop will be focused on providing participants with experience with the principal tools of TG 100 and hence start to build both competence and confidence in the use of risk-based quality management techniques. The three principal tools forming the basis of TG 100’s risk analysis: Process mapping, Failure-Modes and Effects Analysis and fault-tree analysis will be introduced with a 5 minute refresher presentation and each presentation will be followed by a 30 minute small group exercise. An exercise on developing QM from the risk analysis follows. During the exercise periods, participants will apply the principles in 2 differentmore » clinical scenarios. At the conclusion of each exercise there will be ample time for participants to discuss with each other and the faculty their experience and any challenges encountered. Learning Objectives: To review the principles of Process Mapping, Failure Modes and Effects Analysis and Fault Tree Analysis. To gain familiarity with these three techniques in a small group setting. To share and discuss experiences with the three techniques with faculty and participants. Director, TreatSafely, LLC. Director, Center for the Assessment of Radiological Sciences. Occasional Consultant to the IAEA and Varian.« less

Simultaneous analysis of thiamphenicol and its prodrug thiamphenicol glycinate in human plasma and urine by high performance liquid chromatography: application to pharmacokinetic study.

PubMed

Chen, Xijing; Yang, Bing; Ni, Liang; Wang, Guangji

2006-06-07

A simple and sensitive method for simultaneous determination of the active compound, thiamphenicol (TAP) and its prodrug, thiamphenicol glycinate (TG) in human plasma and urine is described. The procedure involved extraction of TG and TAP with ethyl acetate (plasma) or 100-fold dilution with the mobile phase (urine) followed by determination by reversed-phase high performance liquid chromatography (HPLC) with UV detection at 224 nm. Separation of the compounds was achieved on a column packed with Hypersil ODS2. The mobile phase consisted of acetonitrile-water containing 0.003 M tetrabutyl ammonium bromide and 0.056 M ammonium acetate (87:13, v/v) with a flow rate of 1.0 ml/min. The chromatograms did not contain interfering peaks due to the suitable extraction procedure and chromatographic conditions. The calibration curves of TG and TAP were linear ranging from 0.78 to 100 microg/ml in plasma and in urine. The intra-day and inter-day relative standard deviations (S.D.) were less than 10%. The recoveries of TG and TAP in plasma and urine were above 80%. TG was not stable in plasma samples and after extraction at ambient temperature or in freeze-thaw cycles, and hence the samples for injection on HPLC column should be stored in refrigerator or under ice cooling prior to analysis, and the plasma samples should not experience the freeze-thaw cycle more than one time. Unlike TAP, TG could not be detected in most urine samples. Application of this method demonstrated that it was feasible for the clinical pharmacokinetic study.

Discrete associations of the GCKR variant with metabolic risk in a Chinese population: longitudinal change analysis.

PubMed

Xu, Min; Lv, Xiaofei; Xie, Lan; Huang, Xiaolin; Huang, Ya; Chen, Ying; Peng, Kui; Wang, Po; Wang, Weiqing; Qi, Lu; Bi, Yufang; Sun, Yimin; Ning, Guang

2016-02-01

Glucokinase regulatory protein gene (GCKR) variant rs780092 is a novel genetic variant associated with serum triacylglycerol (TG) identified in a genome-wide association study in East Asians. We aimed to investigate associations of rs780092 with incident type 2 diabetes and dyslipidaemia, and the longitudinal changes in glucose and lipid levels. A community-based prospective cohort study was conducted at baseline in 2008, including 5,613 non-diabetic participants (37% male, mean age 57.6 years) with 5 years of follow-up. Blood glucose and lipid was measured at baseline and follow-up. Each rs780092 T-allele was associated with a 17% lower risk of incident type 2 diabetes (HR 0.83 [95% CI 0.73, 0.95]) and 36% higher risk of incident hypertriacylglycerolaemia (OR 1.36 [95% CI 1.08, 1.72]), after adjustment for baseline fasting glucose and TG and other confounders. The T-allele was associated with a 5 year increasing level of log10 TG (β ± SE, 0.01 ± 0.004, p = 0.005). Mediation analysis showed that both baseline TG and the 5 year increase in log10 TG were significant mediators in the associations of rs780092 with risk of diabetes. The risk of incident type 2 diabetes associated with 1 SD increase in total and LDL-cholesterol was 35% and 22% lower in TT carriers compared with CC carriers, respectively (both p for interaction ≤ 0.04). The GCKR rs780092 variant showed opposite-directional associations with type 2 diabetes and hypertriacylglycerolaemia in a Chinese population. Both baseline level and 5 year change in serum TG were mediators of the association between the genetic variant and type 2 diabetes.

Triglyceride-to-HDL-cholesterol ratio and metabolic syndrome as contributors to cardiovascular risk in overweight patients.

PubMed

Marotta, Teodoro; Russo, Barbara F; Ferrara, L Aldo

2010-08-01

Insulin resistance increases cardiovascular risk of obese patients. Triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL) >or=3.0 (in mg/dl) is a marker of insulin resistance in overweight persons. We aimed at assessing cardiovascular risk profile in 301 overweight elderly Neapolitan outpatients, according to TG/HDL ratio and metabolic syndrome (MS), diagnosed by National Cholesterol Education Program (NCEP) and International Diabetes Federation (IDF) criteria. TG/HDL ratio was >or=3.0 in 97 patients (group A) and <3.0 in 204 (group B). Overall, 93-97% of group A patients and 38-51% of group B patients had MS, depending on the diagnostic criterion. Group A patients with MS had significantly higher waist-to-hip ratio, total and non-HDL cholesterol than group B patients with MS. In group B, MS and non-MS patients had similar waist-to-hip ratio, blood pressure, total and non-HDL cholesterol. Ten year coronary risk, calculated by the Framingham equations (n = 243), was 10.3 +/- 5% in group B, non-MS patients; 13.1 +/- 6% in group B, MS patients; 19.9 +/- 8% in group A (F = 32.8; P < 0.001). At the multiple regression analysis, TG/HDL ratio was associated with coronary risk (r(2) = 0.227) more closely than gender, blood pressure, waist-to-hip ratio, non HDL cholesterol, and MS considered as a whole. A separate regression analysis showed that the logarithmically transformed TG/HDL ratio, an index of the HDL cholesterol esterification rate, is also associated with coronary risk (r(2) = 0.252). Thus, TG/HDL ratio could help to characterize high-risk overweight patients deserving a special therapeutic effort. Cardiovascular risk profile of insulin-sensitive patients, identified by lower values of this parameter, is only moderately affected by MS.

On tolerability and safety of a maintenance treatment with 6-thioguanine in azathioprine or 6-mercaptopurine intolerant IBD patients

PubMed Central

de Boer, Nanne KH; Derijks, Luc JJ; Gilissen, Lennard PL; Hommes, Daniel W; Engels, Leopold GJB; de Boer, Sybrand Y; den Hartog, Gijsbertus; Hooymans, Piet M; Mäkelburg, Anja BU; Westerveld, Barend D; Naber, Anton HJ; Mulder, Chris JJ; de Jong, Dirk J

2005-01-01

AIM: To determine the tolerability and safety profile of a low-dose maintenance therapy with 6-TG in azathioprine (AZA) or 6-mercaptopurine (6-MP) intolerant inflammatory bowel disease (IBD) patients over a treatment period of at least 1 year. METHODS: Database analysis. RESULTS: Twenty out of ninety-five (21%) patients discontinued 6-TG (mean dose 24.6 mg; mean 6-TGN level 540 pmol/8×108 RBC) within 1 year. Reasons for discontinuation were GI complaints (31%), malaise (15%) and hepatotoxicity (15%). Hematological events occurred in three patients, one discontinued treatment. In the 6-TG-tolerant group, 9% (7/75) could be classified as hepatotoxicity. An abdominal ultrasound was performed in 54% of patients, one patient had splenomegaly. CONCLUSION: The majority of AZA or 6-MP-intolerant IBD patients (79%) is able to tolerate maintenance treatment with 6-TG (dosages between 0.3 and 0.4 mg/kg per d). 6-TG may still be considered as an escape maintenance immunosuppressant in this difficult to treat group of patients, taking into account potential toxicity and efficacy of other alternatives. The recently reported hepatotoxicity is worrisome and 6-TG should therefore be administered only in prospective trials. PMID:16222751

Two key cathepsins, TgCPB and TgCPL, are targeted by the vinyl sulfone inhibitor K11777 in in vitro and in vivo models of toxoplasmosis

PubMed Central

Chaparro, Juan D.; Cheng, Timmy; Tran, Uyen Phuong; Andrade, Rosa M.; Brenner, Sara B. T.; Hwang, Grace; Cohn, Shara; Hirata, Ken; McKerrow, James H.

2018-01-01

Although toxoplasmosis is one of the most common parasitic infections worldwide, therapeutic options remain limited. Cathepsins, proteases that play key roles in the pathogenesis of toxoplasmosis and many other protozoan infections, are important potential therapeutic targets. Because both TgCPB and TgCPL play a role in T. gondii invasion, we evaluated the efficacy of the potent, irreversible vinyl sulfone inhibitor, K11777 (N-methyl-piperazine-Phe-homoPhe-vinylsulfone-phenyl). The inhibitor’s toxicity and pharmacokinetic profile have been well-studied because of its in vitro and in vivo activity against a number of parasites. We found that it inhibited both TgCPB (EC50 = 114 nM) and TgCPL (EC50 = 71 nM) in vitro. K11777 also inhibited invasion of human fibroblasts by RH tachyzoites by 71% (p = 0.003) and intracellular replication by >99% (p<0.0001). In vivo, a single dose of K11777 led to 100% survival of chicken embryos in an model of acute toxoplasmosis (p = 0.015 Cox regression analysis). Therefore, K11777 shows promise as a novel therapeutic agent in the treatment of toxoplasmosis, and may prove to be a broadly effective anti-parasitic agent. PMID:29565998

Immunological response and protection of mice immunized with plasmid encoding Toxoplasma gondii glycolytic enzyme malate dehydrogenase.

PubMed

Hassan, I A; Wang, S; Xu, L; Yan, R; Song, X; XiangRui, L

2014-12-01

Toxoplasma gondii Malate dehydrogenase (TgMDH) plays an important role as part of the energy production cycle. In this investigation, immunological changes and protection efficiency of this protein delivered as a DNA vaccine have been evaluated. Mice were intramuscularly immunized with pTgMDH, followed by challenge with virulent T. gondii RH strain, 2 weeks after the booster immunization. Compared to the control groups, the results showed that pTgMDH has stimulated specific humoral response as demonstrated by significant high titers of total IgG and subclasses IgG1 and IgG2a , beside IgA and IgM, but not IgE. Analysis of cytokine profiles revealed significant increases of IFN-γ, IL-4 and IL-17, while no significant changes were detected in TGF-β1. In cell-mediated response, both T lymphocytes subpopulations CD4(+) and CD8(+) were positively recruited as significant percentages were recorded in response to immunization with TgMDH. Significant long survival rate, 17 days, has been observed in the TgMDH vaccinated group, in contrast with control groups which died within 8-9 days after challenge. These results demonstrated that TgMDH could induce significant immunological responses leading to a considerable level of protection against acute toxoplasmosis infection. © 2014 John Wiley & Sons Ltd.

Is In-Stent Restenosis After a Successful Coronary Stent Implantation Due to Stable Angina Associated With TG/HDL-C Ratio?

PubMed

Kundi, Harun; Korkmaz, Ahmet; Balun, Ahmet; Cicekcioglu, Hulya; Kiziltunc, Emrullah; Gursel, Koray; Cetin, Mustafa; Ornek, Ender; Ileri, Mehmet

2017-10-01

We examined the impact of the preprocedural triglyceride (TG)/high-density lipoprotein cholesterol (HDL-C) ratio on risk of in-stent restenosis (ISR). Patients with typical anginal symptoms and/or positive treadmill or myocardial perfusion scintigraphy test results who underwent successful coronary stent implantation due to stable angina were examined; 1341 patients were enrolled. The hospital files of the patients were used to gather data. Cox regression analysis showed that the TG/HDL-C ratio was independently associated with the presence of ISR ( P < .001). Moreover, diabetes mellitus ( P = .007), smaller stent diameter ( P = .046), and smoking status ( P = .001) were also independently associated with the presence of ISR. Using a cutoff of 3.8, the TG/HDL-C ratio predicted the presence of ISR with a sensitivity of 71% and a specificity of 68%. Also, the highest quartile of TG/HDL-C ratio had the highest rate of ISR ( P < .001). Measuring preprocedural TG/HDL-C ratio, in fasting or nonfasting samples, could be beneficial for the risk assessment of ISR. However, further large-scale prospective studies are required to establish the exact role of this simple, easily calculated, and reproducible parameter in the pathogenesis of ISR.

[Morphological analysis of the hippocampal region associated with an innate behaviour task in the transgenic mouse model (3xTg-AD) for Alzheimer disease].

PubMed

Orta-Salazar, E; Feria-Velasco, A; Medina-Aguirre, G I; Díaz-Cintra, S

2013-10-01

Different animal models for Alzheimer disease (AD) have been designed to support the hypothesis that the neurodegeneration (loss of neurons and synapses with reactive gliosis) associated with Aβ and tau deposition in these models is similar to that in the human brain. These alterations produce functional changes beginning with decreased ability to carry out daily and social life activities, memory loss, and neuropsychiatric disorders in general. Neuronal alteration plays an important role in early stages of the disease, especially in the CA1 area of hippocampus in both human and animal models. Two groups (WT and 3xTg-AD) of 11-month-old female mice were used in a behavioural analysis (nest building) and a morphometric analysis of the CA1 region of the dorsal hippocampus. The 3xTg-AD mice showed a 50% reduction in nest quality associated with a significant increase in damaged neurons in the CA1 hippocampal area (26%±6%, P<.05) compared to the WT group. The decreased ability to carry out activities of daily living (humans) or nest building (3xTg-AD mice) is related to the neuronal alterations observed in AD. These alterations are controlled by the hippocampus. Post-mortem analyses of the human hippocampus, and the CA1 region in 3xTg-AD mice, show that these areas are associated with alterations in the deposition of Aβ and tau proteins, which start accumulating in the early stages of AD. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.

Physical Activity and Lipid Profile in the ELSA-Brasil Study

PubMed Central

da Silva, Raquel Caroline; Diniz, Maria de Fátima Haueisen Sander; Alvim, Sheila; Vidigal, Pedro Guatimosim; Fedeli, Ligia Maria Giongo; Barreto, Sandhi Maria

2016-01-01

Background Regular physical activity (PA) induces desirable changes in plasma levels of high- and low-density lipoproteins (HDL and LDL, respectively) and triglycerides (TG), important risk factors for cardiometabolic diseases. However, doubts whether intensity and duration have equivalent benefits remain. Objective To assess the association of PA intensity and duration with HDL, LDL and TG levels. Methods Cross-sectional study with 12,688 participants from the Brazilian Longitudinal Study of Adult Health (ELSA-Brasil) baseline, who were not on lipid-lowering medication. After adjustment for important covariates, multiple linear regression was used to assess the association of PA intensity and duration with HDL, LDL and TG (natural logarithm) levels. Results Both moderate and vigorous PA and PA practice ≥ 150 min/week were significantly associated with higher HDL and lower TG levels. Vigorous PA was associated with lower LDL only on univariate analysis. After adjustments, moderate and vigorous PA increased mean HDL level by 0.89 mg/dL and 1.71 mg/dL, respectively, and reduced TG geometric mean by 0.98 mg/dL and 0.93 mg/dL, respectively. PA practice ≥ 150 min/week increased mean HDL level by 1.05 mg/dL, and decreased TG geometric mean by 0.98 mg/dL. Conclusion Our findings reinforce the benefits of both PA parameters studied on HDL and TG levels, with a slight advantage for vigorous PA as compared to the recommendation based only on PA duration. PMID:27355470

Tissue transglutaminase contributes to the all-trans-retinoic acid-induced differentiation syndrome phenotype in the NB4 model of acute promyelocytic leukemia.

PubMed

Csomós, Krisztián; Német, István; Fésüs, László; Balajthy, Zoltán

2010-11-11

Treatment of acute promyelocytic leukemia (APL) with all-trans-retinoic acid (ATRA) results in terminal differentiation of leukemic cells toward neutrophil granulocytes. Administration of ATRA leads to massive changes in gene expression, including down-regulation of cell proliferation-related genes and induction of genes involved in immune function. One of the most induced genes in APL NB4 cells is transglutaminase 2 (TG2). RNA interference-mediated stable silencing of TG2 in NB4 cells (TG2-KD NB4) coupled with whole genome microarray analysis revealed that TG2 is involved in the expression of a large number of ATRA-regulated genes. The affected genes participate in granulocyte functions, and their silencing lead to reduced adhesive, migratory, and phagocytic capacity of neutrophils and less superoxide production. The expression of genes related to cell-cycle control also changed, suggesting that TG2 regulates myeloid cell differentiation. CC chemokines CCL2, CCL3, CCL22, CCL24, and cytokines IL1B and IL8 involved in the development of differentiation syndrome are expressed at significantly lower level in TG2-KD NB4 than in wild-type NB4 cells upon ATRA treatment. Based on our results, we propose that reduced expression of TG2 in differentiating APL cells may suppress effector functions of neutrophil granulocytes and attenuate the ATRA-induced inflammatory phenotype of differentiation syndrome.

In situ delivery of thermosensitive gel-mediated 5-fluorouracil microemulsion for the treatment of colorectal cancer

PubMed Central

Wang, Lu-Lu; Huang, Shuai; Guo, Hui-Hui; Han, Yan-Xing; Zheng, Wen-Sheng; Jiang, Jian-Dong

2016-01-01

In situ administration of 5-fluorouracil (5FU) “thermosensitive” gel effectively reduced systemic side effects in treating colon rectal cancer; however, the penetration efficacy of the formulation was considerably low due to the poor lipid solubility of 5FU. The aim of this study was to develop thermosensitive gel-mediated 5FU water-in-oil microemulsion (TG-5FU-ME) for improving the infiltration of 5FU. An in vitro release test showed that TG-5FU-ME sustained the drug’s release up to 10 hours. TG-5FU-ME exhibited good stability, and the microemulsion entrapped did not show any change in morphology and 5FU content during the 4-month storage. Transportation test in the Caco-2 cell monolayer showed that TG-5FU-ME had a permeability 6.3 times higher than that of 5FU thermosensitive gel, and the intracellular uptake of 5FU increased by 5.4-fold compared to that of 5FU thermosensitive gel. In vivo tissue distribution analysis exhibited that the TG-5FU-ME group had drug levels in rectal tissue and mesenteric lymph nodes, which were significantly higher than those of 5FU thermosensitive gel group, with very low blood levels of 5FU in both groups. Furthermore, TG-5FU-ME was not associated with detectable morphological damage to the rectal tissue. Conclusively, TG-5FU-ME might be an efficient rectal delivery system to treat colorectal cancer. PMID:27660416

Regulation of Endothelial Cell Inflammation and Lung PMN Infiltration by Transglutaminase 2

PubMed Central

Bijli, Kaiser M.; Kanter, Bryce G.; Minhajuddin, Mohammad; Leonard, Antony; Xu, Lei; Fazal, Fabeha; Rahman, Arshad

2014-01-01

We addressed the role of transglutaminase2 (TG2), a calcium-dependent enzyme that catalyzes crosslinking of proteins, in the mechanism of endothelial cell (EC) inflammation and lung PMN infiltration. Exposure of EC to thrombin, a procoagulant and proinflammatory mediator, resulted in activation of the transcription factor NF-κB and its target genes, VCAM-1, MCP-1, and IL-6. RNAi knockdown of TG2 inhibited these responses. Analysis of NF-κB activation pathway showed that TG2 knockdown was associated with inhibition of thrombin-induced DNA binding as well as serine phosphorylation of RelA/p65, a crucial event that controls transcriptional capacity of the DNA-bound RelA/p65. These results implicate an important role for TG2 in mediating EC inflammation by promoting DNA binding and transcriptional activity of RelA/p65. Because thrombin is released in high amounts during sepsis and its concentration is elevated in plasma and lavage fluids of patients with Acute Respiratory Distress Syndrome (ARDS), we determined the in vivo relevance of TG2 in a mouse model of sepsis-induced lung PMN recruitment. A marked reduction in NF-κB activation, adhesion molecule expression, and lung PMN sequestration was observed in TG2 knockout mice compared to wild type mice exposed to endotoxemia. Together, these results identify TG2 as an important mediator of EC inflammation and lung PMN sequestration associated with intravascular coagulation and sepsis. PMID:25057925

Use of the plasma triglyceride/high-density lipoprotein cholesterol ratio to identify cardiovascular disease in hypertensive subjects.

PubMed

Salazar, Martin R; Carbajal, Horacio A; Espeche, Walter G; Aizpurúa, Marcelo; Leiva Sisnieguez, Carlos E; Leiva Sisnieguez, Betty C; March, Carlos E; Stavile, Rodolfo N; Balbín, Eduardo; Reaven, Gerald M

2014-10-01

This analysis evaluated the hypothesis that the plasma triglyceride (TG)/high-density lipoprotein cholesterol (HDL-C) concentration ratio can help identify patients with essential hypertension who are insulin-resistant, with the cardiovascular disease (CVD) risk profile associated with that defect. Data from a community-based study developed between 2003 and 2012 were used to compare CVD risk factors and outcome. Plasma TG/HDL-C cut-points of 2.5 (women) and 3.5 (men) subdivided normotensive (n = 574) and hypertensive (n = 373) subjects into "high" and "low" risk groups. Metabolic syndrome criteria (MetS) were also used to identify "high" and "low" risk groups. The baseline cardio-metabolic profile was significantly more adverse in 2003 in "high" risk subgroups, irrespective of BP classification or definition of risk (TG/HDL-C ratio vs. MetS criteria). Crude incidence of combined CVD events increased across risk groups, ranging from 1.9 in normotensive-low TG/HDL-C subjects to 19.9 in hypertensive-high TG/HDL-C ratio individuals (P for trends <.001). Adjusted hazard ratios for CVD events also increased with both hypertension and TG/HDL-C. Comparable findings were seen when CVD outcome was predicted by MetS criteria. The TG/HDL-C concentration ratio and the MetS criteria identify to a comparable degree hypertensive subjects who are at greatest cardio-metabolic risk and develop significantly more CVD.

Analysis of the N-glycans of recombinant human Factor IX purified from transgenic pig milk

PubMed Central

Gil, Geun-Cheol; Velander, William H; Van Cott, Kevin E

2008-01-01

Glycosylation of recombinant proteins is of particular importance because it can play significant roles in the clinical properties of the glycoprotein. In this work, the N-glycan structures of recombinant human Factor IX (tg-FIX) produced in the transgenic pig mammary gland were determined. The majority of the N-glycans of transgenic pig-derived Factor IX (tg-FIX) are complex, bi-antennary with one or two terminal N-acetylneuraminic acid (Neu5Ac) moieties. We also found that the N-glycan structures of tg-FIX produced in the porcine mammary epithelial cells differed with respect to N-glycans from glycoproteins produced in other porcine tissues. tg-FIX contains no detectable Neu5Gc, the sialic acid commonly found in porcine glycoproteins produced in other tissues. Additionally, we were unable to detect glycans in tg-FIX that have a terminal Galα(1,3)Gal disaccharide sequence, which is strongly antigenic in humans. The N-glycan structures of tg-FIX are also compared to the published N-glycan structures of recombinant human glycoproteins produced in other transgenic animal species. While tg-FIX contains only complex structures, antithrombin III (goat), C1 inhibitor (rabbit), and lactoferrin (cow) have both high mannose and complex structures. Collectively, these data represent a beginning point for the future investigation of species-specific and tissue/cell-specific differences in N-glycan structures among animals used for transgenic animal bioreactors. PMID:18456721

Map-based analysis of the tenacious glume gene Tg-B1 of wild emmer and its role in wheat domestication

USDA-ARS?s Scientific Manuscript database

The domestication of wheat was instrumental in spawning the civilization of humankind, and it occurred through genetic mutations that gave rise to types with non-fragile rachises, soft glumes, and free-threshing seed. The Tg-D1 gene on chromosome 2D of Aegilops tauschii, the D-genome progenitor of ...

Overexpression of bone sialoprotein leads to an uncoupling of bone formation and bone resorption in mice.

PubMed

Valverde, Paloma; Zhang, Jin; Fix, Amanda; Zhu, Ji; Ma, Wenli; Tu, Qisheng; Chen, Jake

2008-11-01

The purpose of this study was to determine the effects of bone sialoprotein (BSP) overexpression in bone metabolism in vivo by using a homozygous transgenic mouse line that constitutively overexpresses mouse BSP cDNA driven by the cytomegalovirus (CMV) promoter. CMV-BSP transgenic (TG) mice and wildtype mice were weighed, and their length, BMD, and trabecular bone volume were measured. Serum levels of RANKL, osteocalcin, osteoprotegerin (OPG), TRACP5b, and PTH were determined. Bone histomorphometry, von Kossa staining, RT-PCR analysis, Western blot, MTS assay, in vitro mineralization assay, and TRACP staining were also performed to delineate phenotypes of this transgenic mouse line. Compared with wildtype mice, adult TG mice exhibit mild dwarfism, lower values of BMD, and lower trabecular bone volume. TG mice serum contained increased calcium levels and decreased PTH levels, whereas the levels of phosphorus and magnesium were within normal limits. TG mice serum also exhibited lower levels of osteoblast differentiation markers and higher levels of markers, indicating osteoclastic activity and bone resorption. H&E staining, TRACP staining, and bone histomorphometry showed that adult TG bones were thinner and the number of giant osteoclasts in TG mice was higher, whereas there were no significant alterations in osteoblast numbers between TG mice and WT mice. Furthermore, the vertical length of the hypertrophic zone in TG mice was slightly enlarged. Moreover, ex vivo experiments indicated that overexpression of BSP decreased osteoblast population and increased osteoclastic activity. Partly because of its effects in enhancing osteoclastic activity and decreasing osteoblast population, BSP overexpression leads to an uncoupling of bone formation and resorption, which in turn results in osteopenia and mild dwarfism in mice. These findings are expected to help the development of therapies to metabolic bone diseases characterized by high serum level of BSP.

TgTKL1 Is a Unique Plant-Like Nuclear Kinase That Plays an Essential Role in Acute Toxoplasmosis

PubMed Central

Varberg, Joseph M.; Coppens, Isabelle; Arrizabalaga, Gustavo

2018-01-01

ABSTRACT In the protozoan parasite Toxoplasma gondii, protein kinases have been shown to play key roles in regulating parasite motility, invasion, replication, egress, and survival within the host. The tyrosine kinase-like (TKL) family of proteins are an unexplored set of kinases in Toxoplasma. Of the eight annotated TKLs in the Toxoplasma genome, a recent genome-wide loss-of-function screen showed that six are important for tachyzoite fitness. By utilizing an endogenous tagging approach, we showed that these six T. gondii TKLs (TgTKLs) localize to various subcellular compartments, including the nucleus, the cytosol, the inner membrane complex, and the Golgi apparatus. To gain insight into the function of TKLs in Toxoplasma, we first characterized TgTKL1, which contains the plant-like enhanced disease resistance 1 (EDR1) domain and localizes to the nucleus. TgTKL1 knockout parasites displayed significant defects in progression through the lytic cycle; we show that the defects were due to specific impairment of host cell attachment. Transcriptomics analysis identified over 200 genes of diverse functions that were differentially expressed in TgTKL1 knockout parasites. Importantly, numerous genes implicated in host cell attachment and invasion were among those most significantly downregulated, resulting in defects in microneme secretion and processing. Significantly, all of the mice inoculated intraperitoneally with TgTKL1 knockout parasites survived the infection, suggesting that TgTKL1 plays an essential role in acute toxoplasmosis. Together, these findings suggest that TgTKL1 mediates a signaling pathway that regulates the expression of multiple factors required for parasite virulence, underscoring the potential of this kinase as a novel therapeutic target. PMID:29559568

Antibodies against deamidated gliadin peptides identify adult coeliac disease patients negative for antibodies against endomysium and tissue transglutaminase.

PubMed

Dahle, C; Hagman, A; Ignatova, S; Ström, M

2010-07-01

This study was done to evaluate the diagnostic utility of antibodies against deamidated gliadin peptides compared to traditional markers for coeliac disease. To evaluate diagnostic utility of antibodies against deamidated gliadin peptide (DGP). Sera from 176 adults, referred for endoscopy without previous analysis of antibodies against tissue transglutaminase (tTG) or endomysium (EmA), were retrospectively analysed by ELISAs detecting IgA/IgG antibodies against DGP or a mixture of DGP and tTG, and compared with IgA-tTG and EmA. Seventy-nine individuals were diagnosed with coeliac disease. Receiver operating characteristic analyses verified the manufacturers' cut-off limits except for IgA/IgG-DGP/tTG. In sera without IgA deficiency, the sensitivity was higher for IgA/IgG-DGP (0.85-0.87) compared with IgA-tTg (0.76) and EmA (0.61). All tests showed high specificity (0.95-1.00). Eighteen coeliac disease-sera were negative regarding IgA-tTG, nine of which were positive for IgA/IgG-DGP. Sera from coeliac disease-patients >70 years were more often negative for IgA-tTG (50%) and IgA/IgG-DGP (36%) than younger patients (15% and 8% respectively) (P < 0.01). Three of the four IgA-deficient patients were positive in the IgA/IgG-DGP assay. In this study of patients unselected regarding IgA-tTg/EmA, thus unbiased in this respect, IgA/IgG-DGP identified adult coeliac disease patients negative for antibodies against endomysium and tissue transglutaminase. Serology is often negative in elderly patients with coeliac disease; a small bowel biopsy should therefore be performed generously before coeliac disease is excluded.

Microglial response to Alzheimer's disease is differentially modulated by voluntary wheel running and enriched environments.

PubMed

Rodríguez, J J; Noristani, H N; Verkhratsky, A

2015-03-01

Alzheimer's disease (AD) is an untreatable neurodegenerative disease that deteriorates memory. Increased physical/cognitive activity reduces dementia risk by promoting neuronal and glial response. Although few studies have investigated microglial response in wild-type rodents following exposure to physical/cognitive stimulation, environmental-induced changes of microglia response to AD have been neglected. We investigated effects of running (RUN) and enriched (ENR) environments on numerical density (N v, #/mm(3)) and morphology of microglia in a triple transgenic (3×Tg-AD) mouse model of AD that closely mimics AD pathology in humans. We used immunohistochemical approach to characterise microglial domain by measuring their overall cell surface, volume and somata volume. 3×Tg-AD mice housed in standard control (STD) environment showed significant increase in microglial N v (11.7 %) in CA1 stratum lacunosum moleculare (S.Mol) of the hippocampus at 12 months compared to non-transgenic (non-Tg) animals. Exposure to combined RUN and ENR environments prevented an increase in microglial N v in 3×Tg-AD and reduced microglial numbers to non-Tg control levels. Interestingly, 3×Tg-AD mice housed solely in ENR environment displayed significant decrease in microglial N v in CA1 subfield (9.3 % decrease), stratum oriens (11.5 % decrease) and S.Mol (7.6 % decrease) of the hippocampus compared to 3×Tg-AD mice housed in STD environment. Morphological analysis revealed microglial hypertrophy due to pronounced increase in microglia surface, volume and somata volume (61, 78 and 41 %) in 3×Tg-AD mice housed in RUN (but not in ENR) compared to STD environment. These results indicate that exposure to RUN and ENR environments have differential effects on microglial density and activation-associated changes in microglial morphology.

Association of dietary pattern and physical activity level with triglyceride to high-density lipoprotein cholesterol ratio among adults in Jiangsu, China: a cross-sectional study with sex-specific differences.

PubMed

Lyu, Shurong; Su, Jian; Xiang, Quanyong; Wu, Ming

2014-08-01

Our study aims to explore the association between dietary patterns and physical activity levels (PAL) with a triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio, and to examine whether the association is sex dependent among Chinese adults. In this cross-sectional study, data were collected through questionnaires, anthropometric measurement, and biochemical tests. Four food patterns ("meat," "healthy," "high-energy," and "traditional Chinese") were established through factor analysis. Physical activity level was categorized as "active," "moderate," and "inactive." Logistic regression models were used to determine the associations between food patterns and PAL with TG/HDL-C ratio. Compared with quartile 1, quartiles 2 and 3 of meat pattern among men were found to be associated with lower risk of high TG/HDL-C ratio (the highest quartile of TG/HDL-C ratio). Similar decreased risk of high TG/HDL-C ratio was also observed in the highest quartile 4 of healthy pattern among women. Active PAL was protective against high TG/HDL-C ratio among both men (odds ratio [OR], 0.69; 95% confidence interval [CI], 0.55-0.86) and women (OR, 0.77; 95% CI, 0.62-0.96). Although no statistically significant interaction was observed, we found that individuals with active PAL and low healthy diet had a similar OR with those with inactive PAL and high healthy diet (0.62 vs 0.68). In conclusion, dietary patterns were associated with TG/HDL-C ratio in a sex-specific way, and active PAL was consistently related to decreased risk of high TG/HDL-C ratio across genders. Copyright © 2014 Elsevier Inc. All rights reserved.

Does Lipid Profile Affect Thrombin Generation During Ramadan Fasting in Patients With Cardiovascular Risks?

PubMed

Sassi, Mouna; Chakroun, Taher; Chouchène, Saoussen; Hellara, Ilhem; Boubaker, Hamdi; Grissa, Mohamed Habib; Khochtali, Ines; Hassine, Mohsen; Addad, Faouzi; Elalamy, Ismail; Nouira, Semir

2017-11-01

There is evidence that diet and variation in lipid metabolism can influence blood coagulation, but little is known about the effect of Ramadan fasting on plasmatic coagulation pattern. We investigated the effect of Ramadan fasting on thrombin generation (TG) in patients with cardiovascular disease (CVD) risks, and we aimed to assess the effect of lipid profile on TG parameters. The study was conducted in 36 adults having at least 2 CVD risks and in 30 healthy controls. Coagulation pattern was assessed by both classical clotting times and TG test. A complete lipid profile was performed simultaneously. Patients were invited 2 times: 1 week before Ramadan and during the last week of the Ramadan. The TG parameters were not different in patients with CVD risks compared to healthy controls. Fasting had no effect on plasmatic coagulation parameters and on TG profile. Individual analysis of the mean rate index (MRI) of TG revealed 3 groups: group 1 with no modification of MRI, group 2 with a significant increase in MRI (81.64 nM/min vs 136.07 nM/min; P < .001), and group 3 with a significant decrease in MRI (125.27 nM/min vs 73.18 nM/min; P = .001). Only in group 2, a significant increase was observed in total cholesterol and low-density lipoprotein cholesterol. Changes in lipid profile during Ramadan fasting did not influence the global coagulation pattern in patients with CVD risks. Whereas, a significant increase in the propagation phase of TG was associated with a significant increase in cholesterol levels, which was not found with the other TG parameters.

Comparison of linkage analysis methods for genome-wide scanning of extended pedigrees, with application to the TG/HDL-C ratio in the Framingham Heart Study

PubMed Central

Horne, Benjamin D; Malhotra, Alka; Camp, Nicola J

2003-01-01

Background High triglycerides (TG) and low high-density lipoprotein cholesterol (HDL-C) jointly increase coronary disease risk. We performed linkage analysis for TG/HDL-C ratio in the Framingham Heart Study data as a quantitative trait, using methods implemented in LINKAGE, GENEHUNTER (GH), MCLINK, and SOLAR. Results were compared to each other and to those from a previous evaluation using SOLAR for TG/HDL-C ratio on this sample. We also investigated linked pedigrees in each region using by-pedigree analysis. Results Fourteen regions with at least suggestive linkage evidence were identified, including some that may increase and some that may decrease coronary risk. Ten of the 14 regions were identified by more than one analysis, and several of these regions were not previously detected. The best regions identified for each method were on chromosomes 2 (LOD = 2.29, MCLINK), 5 (LOD = 2.65, GH), 7 (LOD = 2.67, SOLAR), and 22 (LOD = 3.37, LINKAGE). By-pedigree multi-point LOD values in MCLINK showed linked pedigrees for all five regions, ranging from 3 linked pedigrees (chromosome 5) to 14 linked pedigrees (chromosome 7), and suggested localizations of between 9 cM and 27 cM in size. Conclusion Reasonable concordance was found across analysis methods. No single method identified all regions, either by full sample LOD or with by-pedigree analysis. Concordance across methods appeared better at the pedigree level, with many regions showing by-pedigree support in MCLINK when no evidence was observed in the full sample. Thus, investigating by-pedigree linkage evidence may provide a useful tool for evaluating linkage regions. PMID:14975161

Comparison of linkage analysis methods for genome-wide scanning of extended pedigrees, with application to the TG/HDL-C ratio in the Framingham Heart Study.

PubMed

Horne, Benjamin D; Malhotra, Alka; Camp, Nicola J

2003-12-31

High triglycerides (TG) and low high-density lipoprotein cholesterol (HDL-C) jointly increase coronary disease risk. We performed linkage analysis for TG/HDL-C ratio in the Framingham Heart Study data as a quantitative trait, using methods implemented in LINKAGE, GENEHUNTER (GH), MCLINK, and SOLAR. Results were compared to each other and to those from a previous evaluation using SOLAR for TG/HDL-C ratio on this sample. We also investigated linked pedigrees in each region using by-pedigree analysis. Fourteen regions with at least suggestive linkage evidence were identified, including some that may increase and some that may decrease coronary risk. Ten of the 14 regions were identified by more than one analysis, and several of these regions were not previously detected. The best regions identified for each method were on chromosomes 2 (LOD = 2.29, MCLINK), 5 (LOD = 2.65, GH), 7 (LOD = 2.67, SOLAR), and 22 (LOD = 3.37, LINKAGE). By-pedigree multi-point LOD values in MCLINK showed linked pedigrees for all five regions, ranging from 3 linked pedigrees (chromosome 5) to 14 linked pedigrees (chromosome 7), and suggested localizations of between 9 cM and 27 cM in size. Reasonable concordance was found across analysis methods. No single method identified all regions, either by full sample LOD or with by-pedigree analysis. Concordance across methods appeared better at the pedigree level, with many regions showing by-pedigree support in MCLINK when no evidence was observed in the full sample. Thus, investigating by-pedigree linkage evidence may provide a useful tool for evaluating linkage regions.

Polyimides with pendant alkyl groups

NASA Technical Reports Server (NTRS)

Jensen, B. J.; Young, P. R.

1982-01-01

The effect on selected polyimide properties when pendant alkyl groups were attached to the polymer backbone was investigated. A series of polymers were prepared using benzophenone tetracarboxylic acid dianhydride (BTDA) and seven different p-alkyl-m,p'-diaminobenzophenone monomers. The alkyl groups varied in length from C(1) (methyl) to C(9) (nonyl). The polyimide prepared from BTDA and m,p'-diaminobenzophenone was included as a control. All polymers were characterized by various chromatographic, spectroscopic, thermal, and mechanical techniques. Increasing the length of the pendant alkyl group resulted in a systematic decrease in glass transition temperature (Tg) for vacuum cured films. A 70 C decrease in Tg to 193 C was observed for the nonyl polymer compared to the Tg for the control. A corresponding systematic increase in Tg indicative of crosslinking, was observed for air cured films. Thermogravimetric analysis revealed a slight sacrifice in thermal stability with increasing alkyl length. No improvement in film toughness was observed.

Polyimide characterization studies - Effect of pendant alkyl groups

NASA Technical Reports Server (NTRS)

Jensen, B. J.; Young, P. R.

1984-01-01

The effect on selected polyimide properties when pendant alkyl groups were attached to the polymer backbone was investigated. A series of polymers were prepared using benzophenone tetracarboxylic acid dianhydride (BTDA) and seven different p-alkyl-m,p'-diaminobenzophenone monomers. The alkyl groups varied in length from C(1) (methyl) to C(9) (nonyl). The polyimide prepared from BTDA and m,p'-diaminobenzophenone was included as a control. All polymers were characterized by various chromatographic, spectroscopic, thermal, and mechanical techniques. Increasing the length of the pendant alkyl group resulted in a systematic decrease in glass transition temperature (Tg) for vacuum cured films. A 70 C decrease in Tg to 193 C was observed for the nonyl polymer compared to the Tg for the control. A corresponding systematic increase in Tg indicative of crosslinking, was observed for air cured films. Thermogravimetric analysis revealed a slight sacrifice in thermal stability with increasing alkyl length. No improvement in film toughness was observed.

Kinetics of thermolysis of lanthanum nitrate with hexamethylenetetramine: Crystal structure, TG-DSC, impact and friction sensitivity studies, Part-96

NASA Astrophysics Data System (ADS)

Nibha; Baranwal, B. P.; Singh, Gurdip; Singh, C. P.; Daniliuc, Constantin G.; Soni, P. K.; Nath, Yogeshwar

2014-11-01

The development of high energetic materials includes process ability and the ability to attain insensitive munitions (IM). This paper investigates the preparation of lanthanum metal nitrate complex of hexamethylenetetramine in water at room temperature. This complex of molecular formulae [La (NO3)2(H2O)6] (2HMTA) (NO3-) (H2O) was characterized by X-ray crystallography. Thermal decomposition was investigated using TG, TG-DSC and ignition delay measurements. Kinetic analysis of isothermal TG data has been investigated using model fitting methods as well as model free isoconversional methods. The sensitivity measurements towards mechanical destructive stimuli such as impact and friction were carried out and the complex was found to be insensitive. In order to identify the end product of thermolysis, X-ray diffraction patterns of end product was carried out which proves the formation of La2O3.

Insight to the Thermal Decomposition and Hydrogen Desorption Behaviors of NaNH2-NaBH4 Hydrogen Storage Composite.

PubMed

Pei, Ziwei; Bai, Ying; Wang, Yue; Wu, Feng; Wu, Chuan

2017-09-20

The lightweight compound material NaNH 2 -NaBH 4 is regarded as a promising hydrogen storage composite due to the high hydrogen density. Mechanical ball milling was employed to synthesize the composite NaNH 2 -NaBH 4 (2/1 molar ratio), and the samples were investigated utilizing thermogravimetric-differential thermal analysis-mass spectroscopy (TG-DTA-MS), X-ray diffraction (XRD), and Fourier transform infrared spectroscopy (FTIR) analyses. The full-spectrum test (range of the ratio of mass to charge: 0-200) shows that the released gaseous species contain H 2 , NH 3 , B 2 H 6 , and N 2 in the heating process from room temperature to 400 °C, and possibly the impurity gas B 6 H 12 also exists. The TG/DTA analyses show that the composite NaNH 2 -NaBH 4 (2/1 molar ratio) is conductive to generate hydrogen so that the dehydrogenation process can be finished before 400 °C. Moreover, the thermal decomposition process from 200 to 400 °C involves two-step dehydrogenation reactions: (1) Na 3 (NH 2 ) 2 BH 4 hydride decomposes into Na 3 BN 2 and H 2 (200-350 °C); (2) remaining Na 3 (NH 2 ) 2 BH 4 reacts with NaBH 4 and Na 3 BN 2 , generating Na, BN, NH 3 , N 2 , and H 2 (350-400 °C). The better mechanism understanding of the thermal decomposition pathway lays a foundation for tailoring the hydrogen storage performance of the composite complex hydrides system.

Revealing the glass transition in shape memory polymers using Brillouin spectroscopy

NASA Astrophysics Data System (ADS)

Steelman, Zachary A.; Weems, Andrew C.; Traverso, Andrew J.; Szafron, Jason M.; Maitland, Duncan J.; Yakovlev, Vladislav V.

2017-12-01

Emerging medical devices which employ shape memory polymers (SMPs) require precise measurements of the glass transition temperature (Tg) to ensure highly controlled shape recovery kinetics. Conventional techniques like differential scanning calorimetry (DSC) and dynamic mechanical analysis (DMA) have limitations that prevent utilization for certain devices, including limited accuracy and the need for sacrificial samples. In this report, we employ an approach based on Brillouin spectroscopy to probe the glass transition of SMPs rapidly, remotely, and nondestructively. Further, we compare the Tg obtained from Brillouin scattering with DMA- and DSC-measured Tg to demonstrate the accuracy of Brillouin scattering for this application. We conclude that Brillouin spectroscopy is an accurate technique for obtaining the glass transition temperature of SMPs, aligning closely with the most common laboratory standards while providing a rapid, remote, and nondestructive method for the analysis of unique polymeric medical devices.

A new type of natural bispecific antibody with potential protective effect in Hashimoto thyroiditis.

PubMed

Li, Wenli; Fan, Gaowei; Chen, Lida; Zhang, Rui; Zhang, Kuo; Sun, Yu; Lin, Guigao; Xie, Jiehong; Wang, Lunan; Li, Jinming

2014-09-01

As a new antibody concept, natural bispecific antibodies (nBsAbs) have been detected in long-term passive immunization and some diseases, but their potential immunomodulatory role remains unclear. Hashimoto thyroiditis (HT) appears to fulfill the condition for nBsAb production but has not yet been characterized. The objective of the study was to identify a new nBsAb against thyroid peroxidase (TPO) and thyroglobulin (Tg) in HT patients and to preliminarily explore its immunomodulatory role. Serum samples were obtained from 136 HT patients, 92 diseased controls, and 99 healthy controls for anti-TPO/Tg nBsAb detection. The relationship between anti-TPO/Tg nBsAb and other clinical parameters was also analyzed. The anti-TPO/Tg nBsAb was detected using a double-antigen sandwich ELISA. Higher nBsAb levels were found to be associated with decreased inflammation in HT patients. The prevalence of anti-TPO/Tg nBsAb in HT was 44.9% (61 of 136), significantly higher than that of diseased controls (2.2%, 2 of 92) (P < .0001) and healthy controls (0%, 0 of 99) (P < .0001). HT patients who were nBsAb positive were prone to have significantly lower levels of serum C-reactive protein and TNF-α compared with the nBsAb-negative individuals (P < .05). The serum amyloid A and interferon-γ levels also showed a similar trend in the two groups. The IgG subclass of anti-TPO/Tg nBsAb was IgG4. Further analysis showed a negative correlation between anti-TPO/Tg nBsAb and serum total IgG4 (r = -0.697, P = .025) in IgG4 thyroiditis patients. A new type of nBsAb against TPO and Tg in HT patients is identified. Our data also indicate a protective effect of anti-TPO/Tg nBsAb in the pathogenesis of HT and extend prior knowledge about nBsAb in diseases.

Ability of the rhTSH stimulation test to predict relapse in patients with differentiated thyroid carcinoma, after long-term follow-up

PubMed Central

MARCELINO, MAFALDA; LOPES, ANA FILIPA; MADUREIRA, DEOLINDA; FERREIRA, TERESA C.; LIMBERT, EDWARD; LEITE, VALERIANO

2015-01-01

The analysis of serum thyroglobulin (Tg) following thyroid-stimulating hormone (TSH) stimulation (sTg) has been recommended in the follow-up of differentiated thyroid carcinoma (DTC) patients, however, its routine use remains controversial. The aim of the current study was to evaluate the accuracy of sTg testing following recombinant human (rh) TSH stimulation in DTC patients, with a follow-up of 12.4 years. Retrospective studies were conducted of 125 DTC patients, who underwent rhTSH stimulation testing between 1999 and 2002. The exclusion criteria were: Patients with anti-Tg antibodies, Tg levels >1 ng/ml under TSH suppression and the absence of radioactive iodine (RAI) ablation therapy following surgery. In total, 49 patients were included in the study and all had been previously treated with total or near total thyroidectomy (with or without central neck dissection) and RAI, postoperatively. The Tg functional sensitivity was 1.0 ng/ml. The follow-up for patients was performed annually. During the median follow-up of 12.4 years after the rhTSH stimulation test, nine patients exhibited recurrence (18.4%). Of the nine patients, six exhibited sTg levels >2 ng/ml (positive result) and three exhibited levels <2 ng/ml (negative result). Relapse occurred at a mean of 5.9 years following the rhTSH stimulation test. The positive predictive value and negative predictive value (NPV) of positive sTg were 50 and 91.9%, respectively, with a sensitivity of 66.6% and a specificity of 85.0%. The rhTSH-stimulated Tg levels have a high NPV, allowing the identification of the patients who are free of the tumour. These results are consistent with the previously published data; however, to the best of our knowledge, this is the study with the longest follow-up duration after rhTSH stimulation. PMID:25663898

[Results of duplex scanning of brachiocephalic arteries and estimation of the lipid spectrum in coronary heart disease and arterial hypertension in indigenous and alien population of Yamalo-Nenetsky Autonomous District].

PubMed

Gapon, L I; Sereda, T V; Leont'eva, A V; Gul'tiaeva, E P

2013-01-01

The work aimed at studying atherosclerotic lesions in brachiocephalic arteries and lipid spectrum in coronary heart disease (CHD) and arterial hypertension (AH) in indigenous and alien population of Yamalo-Nenetsky Autonomous District. It included 200 patients with CHD and AH (men and women aged 21-55 years, mean 48.2 +/- 07 yr). They were allocated to indigenous and alien groups (100 persons each). The patients matched for age and sex were examined by duplex scanning based at an outpatient facility (Salekhard). The indigenous population showed more pronounced thickening of the intima-media complex (IMC) of the common carotid artery (p = 0.001) and more frequent lesions of the main head arteries with stenosis of different severity (especially in internal carotid arteries). Total cholesterol, LDLP and atherogenicity index were similar in both groups and higher than normal. Indigenous subjects had less atherogenic structure of the lipid spectrum due to lower TG and VLDLP but higher HDLP levels.

Risk of type 2 diabetes mellitus associated with plasma lipid levels: The rural Chinese cohort study.

PubMed

Zhang, Ming; Zhou, Junmei; Liu, Yu; Sun, Xizhuo; Luo, Xinping; Han, Chengyi; Zhang, Lu; Wang, Bingyuan; Ren, Yongcheng; Zhao, Yang; Zhang, Dongdong; Liu, Xuejiao; Hu, Dongsheng

2018-01-01

To investigate the association of type 2 diabetes mellitus (T2DM) risk and plasma lipid levels in rural Chinese. Each lipid variable was divided into quartiles and dichotomized by clinical cutoff points. Cox proportional-hazards model was used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for the association of T2DM risk and plasma lipid levels and explore the interaction between plasma lipid levels and other risk factors. 11,929 participants were included in the analysis. We documented 720 incident cases of T2DM over 70,720.84 person-years of follow-up, for an incidence of 10.18/1,000 person-years. In the multivariable-adjusted model, risk of T2DM was increased with the highest versus lowest quartiles of total cholesterol (TC) and triglycerides (TG) levels and TC/high-density lipoprotein-cholesterol (HDL-C) and TG/HDL-C ratios. The HRs (95% CIs) for the fourth quartiles, for example, were 1.34 (1.03-1.74), 2.32 (1.73-3.13), 1.66 (1.23-2.25), and 1.84 (1.38-2.45), respectively. In addition, risk of T2DM was increased with high TG level and TC/HDL-C and TG/HDL-C ratios by clinical cutoffs. The HRs (95% CIs) were 1.50 (1.25-1.80), 1.24 (1.03-1.48), and 1.44 (1.18-1.75), respectively. Risk of T2DM was associated with interactions between all lipid variables and age and BMI. TG level and TG/HDL-C ratio additionally interacted with gender (all P interaction  < 0.0001). Risk of T2DM was increased with elevated serum levels of TC and TG and TC/HDL-C and TG/HDL-C ratios and also with interactions between high TC and TG levels and TC/HDL-C and TG/HDL-C ratios and age and BMI in a rural Chinese population. Copyright © 2017 Elsevier B.V. All rights reserved.

High Triglycerides Predicts Arteriogenic Erectile Dysfunction and Major Adverse Cardiovascular Events in Subjects With Sexual Dysfunction.

PubMed

Corona, Giovanni; Cipriani, Sarah; Rastrelli, Giulia; Sforza, Alessandra; Mannucci, Edoardo; Maggi, Mario

2016-09-01

The atherogenic role of triglycerides (TG) remains controversial. The aim of the present study is to analyze the contribution of TG in the pathogenesis of erectile dysfunction (ED) and to verify the value of elevated TG in predicting major adverse cardiovascular events (MACE). An unselected series of 3,990 men attending our outpatient clinic for sexual dysfunction was retrospectively studied. A subset of this sample (n = 1,687) was enrolled in a longitudinal study. Several clinical, biochemical, and instrumental (penile color Doppler ultrasound; PCDU) factors were evaluated. Among the patients studied, after adjustment for confounders, higher TG levels were associated with arteriogenic ED and a higher risk of clinical and biochemical hypogonadism. Conversely, no association between TG and other sexual dysfunctions was observed. When pathological PCDU parameters-including flaccid acceleration (<1.17 m/sec(2)) or dynamic peak systolic velocity (PSV <35 cm/sec)-were considered, the negative association between impaired penile flow and higher TG levels was confirmed, even when subjects taking lipid-lowering drugs or those with diabetes were excluded from the analysis (OR = 6.343 [1.243;32.362], P = .026 and 3.576 [1.104;11.578]; P = .34 for impaired acceleration and PSV, respectively). Similarly, when the same adjusted models were applied, TG levels were associated with a higher risk of hypogonadism, independently of the definition criteria (OR = 2.892 [1.643;5.410], P < .0001 and 4.853 [1.965;11.990]; P = .001 for total T <12 and 8 nM, respectively). In the longitudinal study, after adjusting for confounders, elevated TG levels (upper quartile: 162-1686 mg/dL) were independently associated with a higher incidence of MACE (HR = 2.469 [1.019;5.981]; P = .045), when compared to the rest of the sample. Our data suggest an association between elevated TG and arteriogenic ED and its cardiovascular (CV) risk stratification. Whether the use of TG lowering drugs might improve ED and its associated CV risk must be confirmed through specific trials. Copyright © 2016 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.

Synthesis, Optical and Electrochemical Properties of Y2O3 Nanoparticles Prepared by Co-Precipitation Method.

PubMed

Saravanan, Thulasingam; Raj, Srinivasan Gokul; Chandar, Nagamuthu Raja Krishna; Jayavel, Ramasamy

2015-06-01

Y2O3 nanoparticles were synthesized by co-precipitation route using yttrium nitrate hexahydrate and ammonium hydroxide as precursors. The prepared sample was calcined at 500 degrees C and subjected to various characterization studies like thermal analysis (TG/DTA), X-ray diffraction (XRD), transmission electron microscope (TEM), UV-visible (UV-Vis) and photoluminescence (PL) spectroscopy. The XRD pattern showed the cubic fluorite structure of Y2O3 without any impurity peaks, revealing high purity of the prepared sample. TEM images revealed that the calcined Y2O3 nanoparticles consist of spherical-like morphology with an average particle size of 12 nm. The absorption spectrum of calcined samples shows blue-shift compared to the as-prepared sample, which was further confirmed by PL studies. The possible formation mechanism of Y2O3 nanoparticles has been discussed based on the experimental results. Electrochemical behavior of Y2O3 nanoparticles was studied by cyclic voltammetry to assess their suitability for supercapacitor applications.

Study on structural, morphological, optical and thermal properties of guanidine carbonate doped nickel sulfate hexahydrate crystal.

PubMed

Silambarasan, A; Rajesh, P; Ramasamy, P

2015-01-05

The single crystal of guanidine carbonate doped nickel sulfate hexahydrate was grown from solution for ultraviolet filters. The single crystal XRD confirms that the grown single crystal belongs to the tetragonal system with the space group of P4₁2₁2. The crystallinity of the grown crystal was estimated by powder X-ray diffraction studies. The optical transmission and thermal stability of as-grown guanidine carbonate doped nickel sulfate single crystals have been studied. The optical transmission spectrum demonstrates the characteristics of ultraviolet filters. The TG/DTA studies confirm the thermal properties of grown crystals. Thermo-gravimetric analysis showed that the dehydration temperature of the guanidine carbonate doped nickel sulfate crystal is about 100 °C, which is much higher than that of pure nickel sulfate hexahydrate (NSH) crystals which is 72 °C. The growth behaviors and dislocation density were detected under the high resolution XRD and etching studies respectively. Copyright © 2014 Elsevier B.V. All rights reserved.

Enhanced optical, thermal and piezoelectric behavior in dye doped potassium acid phthalate (KAP) single crystal

NASA Astrophysics Data System (ADS)

Rao, G. Babu; Rajesh, P.; Ramasamy, P.

2017-06-01

Dye inclusion crystals have attracted researchers in the context of crystal growth for applications in solid state lasers. Pure and 0.1 mol% amaranth doped KAP single crystals, were grown from aqueous solutions by slow evaporation technique at room temperature. The grown crystals are up to the dimension of 12×10×3 mm3. Attempt is made to improve the growth rate, optical, piezoelectric and photoconductive properties of pure KAP single crystal with addition of amaranth dye as a dopant. Various characterization studies were made for both pure and dye doped KAP. Thermal stability of the crystals is tested from thermogravimetric and differential thermal analysis (TG/DTA). There is only one endothermic peak indicating decomposition point. Higher optical transparency for dye doped KAP crystal was identified from the UV-vis spectrum. Etching studies showed an improvement in the optical quality of the KAP crystal after doping with amaranth dye. The positive photoconductive nature is observed from both pure and amaranth doped KAP.

Hardware Model of a Shipboard Generator

DTIC Science & Technology

2009-05-19

controller output PM motor power RM motor resistance Td derivative time constant Tf1 fuel valve time constant Tg1 governor time constant Tg2 governor...in speed, sending a response signal to the fuel valve that regulates gas turbine power. At this point, there is an inherent variation between the...basic response analysis [5]. 29 Electrical Power Rotor Inertia Amplifiers Fuel Valve Turbine Dynamics Rotational Friction and Windage

The correlation between serum free thyroxine and regression of dyslipidemia in adult males: A 4.5-year prospective study.

PubMed

Wang, Haoyu; Liu, Aihua; Zhou, Yingying; Xiao, Yue; Yan, Yumeng; Zhao, Tong; Gong, Xun; Pang, Tianxiao; Fan, Chenling; Zhao, Jiajun; Teng, Weiping; Shan, Zhongyan; Lai, Yaxin

2017-09-01

Elevated free thyroxine (FT4) levels may play a protective role in development of dyslipidemia. However, few prospective studies have been performed to definite the effects of thyroid hormones on the improvement of dyslipidemia and its components. Thus, this study aims to clarify the association between thyroid hormones within normal range and reversal of dyslipidemia in the absence of intervention.A prospective analysis including 134 adult males was performed between 2010 and 2014. Anthropometric parameters, thyroid function, and lipid profile were measured at baseline and during follow-up. Logistic regression and receiver operating characteristic (ROC) analysis were conducted to identify the variables in forecasting the reversal of dyslipidemia and its components.During 4.5-year follow-up, 36.6% (49/134) patients resolved their dyslipidemia status without drug intervention. Compared with the continuous dyslipidemia group, subjects in reversal group had elevated FT4 and high-density lipoprotein cholesterol (HDL-C) levels, as well as decreased total cholesterol (TC), triglycerides (TG), and low-density lipoprotein cholesterol (LDL-C) levels at baseline. Furthermore, baseline FT4 is negatively associated with the change percentages of TG (r = -0.286, P = .001), while positively associated with HDL-C (r = 0.227, P = .008). However, no correlation of lipid profile change percentages with FT3 and TSH were observed. Furthermore, the improving effects of baseline FT4 on dyslipidemia, high TG, and low HDL-C status were still observed after multivariable adjustment. In ROC analysis, areas under curve (AUCs) for FT4 in predicting the reversal of dyslipidemia, high TG, and low HDL-C were 0.666, 0.643, and 0.702, respectively (P = .001 for dyslipidemia, .018 for high TG, and .001 for low HDL-C).Higher FT4 value within normal range may ameliorate the dyslipidemia, especially high TG and low HDL-C status, in males without drug intervention. This suggests that a more flexible lipid-lowering therapy may be appropriate for patients with high-normal FT4.

Bivalent transition metal complexes of o-hydroxyacetophenone [N-(3-hydroxy-2-naphthoyl)] hydrazone: Spectroscopic, antibacterial, antifungal activity and thermogravimetric studies

NASA Astrophysics Data System (ADS)

Zaky, R. R.; Ibrahim, K. M.; Gabr, I. M.

2011-10-01

Schiff base complexes of Cu(II), Ni(II) and Zn(II) with the o-hydroxyacetophenone [N-(3-hydroxy-2-naphthoyl)] hydrazone (H 2o-HAHNH) containing N and O donor sites have been synthesized. Both ligand and its metal complexes were characterized by different physicochemical methods, elemental analysis, molar conductivity ( 1H NMR, 13C NMR, IR, UV-visible, ESR, MS spectra) and also thermal analysis (TG and DTG) techniques. The discussion of the outcome data of the prepared complexes indicates that the ligand behave as a bidentate and/or tridentate ligand. The electronic spectra of the complexes as well as their magnetic moments suggest octahedral geometries for all isolated complexes. The room temperature solid state ESR spectrum of the Cu(II) complex shows d x2- y2 as a ground state, suggesting tetragonally distorted octahedral geometry around Cu(II) centre. The molar conductance measurements proved that the complexes are non-electrolytes. The kinetic thermodynamic parameters such as: E#, Δ H#, Δ G#, Δ S# are calculated from the DTG curves, for the [Ni(H O-HAHNH) 2] and [Zn(H 2 O-HAHNH)(OAc) 2]·H 2O complexes using the Coats-Redfern equation. Also, the antimicrobial properties of all compounds were studied using a wide spectrum of bacterial and fungal strains. The [Cu(H o-HAHNH)(OAc)(H 2O) 2] complex was the most active against all strains, including Aspergillus sp., Stemphylium sp. and Trichoderma sp. Fungi; E. coli and Clostridium sp. Bacteria.

Optimal cutoff of the triglyceride to high-density lipoprotein cholesterol  ratio to detect cardiovascular risk factors among Han adults in Xinjiang.

PubMed

Li, Hua-Yin; Chen, Bang-Dang; Ma, Yi-Tong; Yang, Yi-Ning; Ma, Xiang; Liu, Fen; Fu, Zhen-Yan; Xie, Xiang; Li, Xiao-Mei; Pan, Shuo; He, Chun-Hui; Zheng, Ying-Ying; Wu, Yun; Tao, Jing; Dong, Chun-Lan; Wu, Ting-Ting

2016-09-01

To determine whether TG/HDL-C ratio, which has been shown to be an indicator of the metabolic syndrome (MetS) and insulin resistance (IR), can predict cardiovascular risk factors in the Chinese Han population in Xinjiang. The cardiovascular risk survey (CRS) was conducted from October 2007 to March 2010. A total of 14,618 representative participants were selected using a four-stage stratified sampling method. A total of 5757 Han participants were included in the study. The present statistical analysis was restricted to the 5595 Han subjects who had complete anthropometric data. The sensitivity, specificity, and distance on the receiver operating characteristic (ROC) curve in each TG/HDL level were calculated. The shortest distance in the ROC curves was used to determine the optimal cutoff of the TG/HDL-C ratio for detecting cardiovascular risk factors. The prevalence of hypertension, hypercholesterolemia, and hypertriglyceridemia was higher with higher TG/HDL-C ratio for both men and women. The TG/HDL-C ratio was positively associated with systolic blood pressure, diastolic blood pressure, and serum concentrations of total cholesterol. The optimal TG/HDL-C ratio cutoffs for predicting hypertension, dyslipidemia, diabetes, and ≥2 of these risk factors for Han adults in Xinjiang were 1.3, 1.3, 1.4, and 1.4 in men and 0.9, 1.0, 1.0, and 1.1 in women, respectively. The evaluation of TG/HDL-C ratio should be considered for one of cardiovascular risk factor predictors among Han adults in Xinjiang.

Effect of a counterion on the glass transition temperature (T(g)') during lyophilization of ganciclovir salt forms.

PubMed

Kumar, Lokesh; Baheti, Ankit; Bansal, Arvind K

2011-02-07

This manuscript deals with the effect of a counterion on the glass transition temperature for lyophilization of ganciclovir salts. Salt forms of ganciclovir, namely, sodium, potassium, rubidium, and cesium salts, were prepared by an in situ technique and analyzed by modulated differential scanning calorimetry (MDSC) for the determination of the critical process parameter for lyophilization. Nonionized ganciclovir and its salt forms showed a glass transition (T(g)') in the reversing MDSC signal, confirming their amorphous nature. T(g)' of the nonionized ganciclovir and ganciclovir sodium, potassium, rubidium, and cesium salts followed the order: sodium salt (-34.94°C) > nonionized ganciclovir (-40.15°C) > potassium salt (-46.23°C) > rubidium salt (-49.95°C) > cesium salt (-53.62°C). The analysis of the freezable water content for ganciclovir and its salts showed the trend: pure water > nonionized ganciclovir > potassium salt ∼ sodium salt > rubidium salt > cesium salt. This showed that a majority of water in the salts is present as an unfrozen fraction, thus leading to a lowering of T(g)' because of the plasticizing effect of unfrozen water. Density functional theory (DFT) further suggested a positive contribution of the strength of intra- and intermolecular force of interactions to the T(g)' value, with a higher intramolecular and intermolecular force of interaction leading to a higher T(g)'.

Effects of Taylor-Görtler vortices on turbulent flows in a spanwise-rotating channel

NASA Astrophysics Data System (ADS)

Dai, Yijun; Huang, Weixi; Xu, Chunxiao

2016-11-01

Fully developed turbulent channel flow with spanwise rotation has been studied by direct numerical simulation at Rem = 2800, 7000 and 20000 with rotation number 0 <= Rom <= 0.5. The width of the computational box is adjusted for each case to contain two pairs of Taylor-Görtler (TG) vortices. Under a low rotation rate, the turbulent vortical structures are strongly affected by the TG vortices. A conditional average method is employed to investigate the effects. In the upwash region where the fluid is pumped away from the pressure wall by the TG vortices, turbulence is enhanced, while the reverse is the case in the downwash region. Through budget analysis of the transport equation of vorticity fluctuation, it is revealed that the stretching along the wall-normal direction caused by the TG vortices plays an important role in initiating the difference of turbulence intensity between the two regions, which is further augmented by the Coriolis force in the streamwise direction. The effects of TG vortices is weakened at higher Reynolds number. Meanwhile, the shear stress on the suction wall is observed to fluctuate in a quasi-periodic manner at Rem = 7000 and Rom = 0.3, which is induced by the TG vortices. The work is supported by National Natural Science Foundation of China (Project No. 11490551, 11472154, 11322221, 11132005).

Improving transgender health by building safe clinical environments that promote existing resilience: Results from a qualitative analysis of providers.

PubMed

Torres, Carlos G; Renfrew, Megan; Kenst, Karey; Tan-McGrory, Aswita; Betancourt, Joseph R; López, Lenny

2015-11-18

Transgender (TG) individuals experience discordance between their sex at birth and their gender identity. To better understand the health care needs and characteristics of TG youth that contribute to resilience, we conducted a qualitative study with clinical and non-clinical providers. In-depth interviews were conducted of providers (n = 11) of TG youth (ages 13-21). Convenience and purposive sampling were used to recruit participants in the Boston area. All interviews were audio-recorded and transcribed verbatim. An interview guide of 14 open-ended questions was used to guide the discussion. A grounded theory approach was utilized to code and analyze the data, including double-coding to address issues of inter-rater reliability. Five primary themes emerged: 1) resilience of TG youth 2) lack of access to services that influence health, 3) the critical role of social support, 4) challenges in navigating the health care system, and 5) the need for trans-affirming competency training for providers and frontline staff. The findings of this study show that providers recognize multiple barriers and challenges in the care of TG youth. However, they also identify the resilience exhibited by many youth. We propose that providers can further enhance the resilience of TG youth and help them flourish by offering them necessary resources via the creation of safe and welcoming clinical environments.

The peculiar behavior of the glass transition temperature of amorphous drug-polymer films coated on inert sugar spheres.

PubMed

Dereymaker, Aswin; Van Den Mooter, Guy

2015-05-01

Fluid bed coating has been proposed in the past as an alternative technology for manufacturing of drug-polymer amorphous solid dispersions, or so-called glass solutions. It has the advantage of being a one-step process, and thus omitting separate drying steps, addition of excipients, or manipulation of the dosage form. In search of an adequate sample preparation method for modulated differential scanning calorimetry analysis of beads coated with glass solutions, glass transition broadening and decrease of the glass transition temperature (Tg ) were observed with increasing particle size of crushed coated beads and crushed isolated films of indomethacin (INDO) and polyvinylpyrrolidone (PVP). Substituting INDO with naproxen gave comparable results. When ketoconazole was probed or the solvent in INDO-PVP films was switched to dichloromethane (DCM) or a methanol-DCM mixture, two distinct Tg regions were observed. Small particle sizes had a glass transition in the high Tg region, and large particle sizes had a glass transition in the low Tg region. This particle size-dependent glass transition was ascribed to different residual solvent amounts in the bulk and at the surface of the particles. A correlation was observed between the deviation of the Tg from that calculated from the Gordon-Taylor equation and the amount of residual solvent at the Tg of particles with different sizes. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

Partial pathogen protection by tick-bite sensitization and epitope recognition in peptide-immunized HLA DR3 transgenic mice.

PubMed

Shattuck, Wendy M C; Dyer, Megan C; Desrosiers, Joe; Fast, Loren D; Terry, Frances E; Martin, William D; Moise, Leonard; De Groot, Anne S; Mather, Thomas N

2014-01-01

Ticks are notorious vectors of disease for humans, and many species of ticks transmit multiple pathogens, sometimes in the same tick bite. Accordingly, a broad-spectrum vaccine that targets vector ticks and pathogen transmission at the tick/host interface, rather than multiple vaccines against every possible tickborne pathogen, could become an important tool for resolving an emerging public health crisis. The concept for such a tick protective vaccine comes from observations of an acquired tick resistance (ATR) that can develop in non-natural hosts of ticks following sensitization to tick salivary components. Mice are commonly used as models to study immune responses to human pathogens but normal mice are natural hosts for many species of ticks and fail to develop ATR. We evaluated HLA DR3 transgenic (tg) "humanized" mice as a potential model of ATR and assessed the possibility of using this animal model for tick protective vaccine discovery studies. Serial tick infestations with pathogen-free Ixodes scapularis ticks were used to tick-bite sensitize HLA DR3 tg mice. Sensitization resulted in a cytokine skew favoring a Th2 bias as well as partial (57%) protection to infection with Lyme disease spirochetes (Borrelia burgdorferi) following infected tick challenge when compared to tick naïve counterparts. I. scapularis salivary gland homogenate (SGH) and a group of immunoinformatic-predicted T cell epitopes identified from the I. scapularis salivary transcriptome were used separately to vaccinate HLA DR3 tg mice, and these mice also were assessed for both pathogen protection and epitope recognition. Reduced pathogen transmission along with a Th2 skew resulted from SGH vaccination, while no significant protection and a possible T regulatory bias was seen in epitope-vaccinated mice. This study provides the first proof-of-concept for using HLA DR tg "humanized" mice for studying the potential tick protective effects of immunoinformatic- or otherwise-derived tick salivary components as tickborne disease vaccines.

Heterologous expression of tulip petal plasma membrane aquaporins in Pichia pastoris for water channel analysis.

PubMed

Azad, Abul Kalam; Sawa, Yoshihiro; Ishikawa, Takahiro; Shibata, Hitoshi

2009-05-01

Water channels formed by aquaporins (AQPs) play an important role in the control of water homeostasis in individual cells and in multicellular organisms. Plasma membrane intrinsic proteins (PIPs) constitute a subclass of plant AQPs. TgPIP2;1 and TgPIP2;2 from tulip petals are members of the PIP family. In this study, we overexpressed TgPIP2;1 and TgPIP2;2 in Pichia pastoris and monitored their water channel activity (WCA) either by an in vivo spheroplast-bursting assay performed after hypo-osmotic shock or by growth assay. Osmolarity, pH, and inhibitors of AQPs, protein kinases (PKs), and protein phosphatases (PPs) affect the WCA of heterologous AQPs in this expression system. The WCA of TgPIP2;2-expressing spheroplasts was affected by inhibitors of PKs and PPs, which indicates that the water channel of this homologue is regulated by phosphorylation in P. pastoris. From the results reported herein, we suggest that P. pastoris can be employed as a heterologous expression system to assay the WCA of PIPs and to monitor the AQP-mediated channel gating mechanism, and it can be developed to screen inhibitors/effectors of PIPs.

Atmospheric nitrogen deposition to China: A model analysis on nitrogen budget and critical load exceedance

NASA Astrophysics Data System (ADS)

Zhao, Yuanhong; Zhang, Lin; Chen, Youfan; Liu, Xuejun; Xu, Wen; Pan, Yuepeng; Duan, Lei

2017-03-01

We present a national-scale model analysis on the sources and processes of inorganic nitrogen deposition over China using the GEOS-Chem model at 1/2° × 1/3° horizontal resolution. Model results for 2008-2012 are evaluated with an ensemble of surface measurements of wet deposition flux and gaseous ammonia (NH3) concentration, and satellite measurements of tropospheric NO2 columns. Annual total inorganic nitrogen deposition fluxes are simulated to be generally less than 10 kg N ha-1 a-1 in western China (less than 2 kg N ha-1 a-1 over Tibet), 15-50 kg N ha-1 a-1 in eastern China, and 16.4 kg N ha-1 a-1 averaged over China. Annual total deposition to China is 16.4 Tg N, with 10.2 Tg N (62%) from reduced nitrogen (NHx) and 6.2 Tg N from oxidized nitrogen (NOy). Domestic anthropogenic sources contribute 86% of the total deposition; foreign anthropogenic sources 7% and natural sources 7%. Annually 23% of domestically emitted NH3 and 36% for NOx are exported outside the terrestrial land of China. We find that atmospheric nitrogen deposition is about half of the nitrogen input from fertilizer application (29.6 Tg N a-1), and is much higher than that from natural biological fixation (7.3 Tg N a-1) over China. A comparison of nitrogen deposition with critical load estimates for eutrophication indicates that about 15% of the land over China experiences critical load exceedances, demonstrating the necessity of nitrogen emission controls to avoid potential negative ecological effects.

Lipoprotein lipase variants associated with an endophenotype of hypertension: hypertension combined with elevated triglycerides.

PubMed

Chen, Pei; Jou, Yuh-Shan; Fann, Cathy S J; Chen, Jaw-Wen; Chung, Chia-Min; Lin, Chin-Yu; Wu, Sheng-Yeu; Kang, Mei-Jyh; Chen, Ying-Chuang; Jong, Yuh-Shiun; Lo, Huey-Ming; Kang, Chih-Sen; Chen, Chien-Chung; Chang, Huan-Cheng; Huang, Nai-Kuei; Wu, Yi-Lin; Pan, Wen-Harn

2009-01-01

Previously, we observed that young-onset hypertension was independently associated with elevated plasma triglyceride(s) (TG) levels to a greater extent than other metabolic risk factors. Thus, focusing on the endophenotype--hypertension combined with elevated TG--we designed a family-based haplotype association study to explore its genetic connection with novel genetic variants of lipoprotein lipase gene (LPL), which encodes a major lipid metabolizing enzyme. Young-onset hypertension probands and their families were recruited, numbering 1,002 individuals from 345 families. Single-nucleotide polymorphism discovery for LPL, linkage disequilibrium (LD) analysis, transmission disequilibrium tests (TDT), bin construction, haplotype TDT association and logistic regression analysis were performed. We found that the CC- haplotype (i) spanning from intron 2 to intron 4 and the ACATT haplotype (ii) spanning from intron 5 to intron 6 were significantly associated with hypertension-related phenotypes: hypertension (ii, P=0.05), elevated TG (i, P=0.01), and hypertension combined with elevated TG (i, P=0.001; ii, P<0.0001), according to TDT. The risk of this hypertension subtype increased with the number of risk haplotypes in the two loci, using logistic regression model after adjusting within-family correlation. The relationships between LPL variants and hypertension-related disorders were also confirmed by an independent association study. Finally, we showed a trend that individuals with homozygous risk haplotypes had decreased LPL expression after a fatty meal, as opposed to those with protective haplotypes. In conclusion, this study strongly suggests that two LPL intronic variants may be associated with development of the hypertension endophenotype with elevated TG. Copyright 2008 Wiley-Liss, Inc.

Fluorine-19 magnetic resonance imaging probe for the detection of tau pathology in female rTg4510 mice.

PubMed

Yanagisawa, Daijiro; Ibrahim, Nor Faeizah; Taguchi, Hiroyasu; Morikawa, Shigehiro; Kato, Tomoko; Hirao, Koichi; Shirai, Nobuaki; Sogabe, Takayuki; Tooyama, Ikuo

2018-05-01

Aggregation of tau into neurofibrillary tangles (NFTs) is characteristic of tauopathies, including Alzheimer's disease. Recent advances in tau imaging have attracted much attention because of its potential contributions to early diagnosis and monitoring of disease progress. Fluorine-19 magnetic resonance imaging ( 19 F-MRI) may be extremely useful for tau imaging once a high-quality probe has been formulated. In this investigation, a novel fluorine-19-labeling compound has been developed as a probe for tau imaging using 19 F-MRI. This compound is a buta-1,3-diene derivative with a polyethylene glycol side chain bearing a CF 3 group and is known as Shiga-X35. Female rTg4510 mice (a mouse model of tauopathy) and wild-type mice were intravenously injected with Shiga-X35, and magnetic resonance imaging of each mouse's head was conducted in a 7.0-T horizontal-bore magnetic resonance scanner. The 19 F-MRI in rTg4510 mice showed an intense signal in the forebrain region. Analysis of the signal intensity in the forebrain region revealed a significant accumulation of fluorine-19 magnetic resonance signal in the rTg4510 mice compared with the wild-type mice. Histological analysis showed fluorescent signals of Shiga-X35 binding to the NFTs in the brain sections of rTg4510 mice. Data collected as part of this investigation indicate that 19 F-MRI using Shiga-X35 could be a promising tool to evaluate tau pathology in the brain. © 2017 Wiley Periodicals, Inc.

Serum lipids, recent suicide attempt and recent suicide status in patients with major depressive disorder.

PubMed

Baek, Ji Hyun; Kang, Eun-Suk; Fava, Maurizio; Mischoulon, David; Nierenberg, Andrew A; Yu, Bum-Hee; Lee, Dongsoo; Jeon, Hong Jin

2014-06-03

Major depressive disorder (MDD) is associated with suicide. Although several studies have reported its association with low serum lipid, few studies have investigated relationships between current suicidality and lipid profiles, comparing with other blood measures in MDD patients. The study population consisted of 555 subjects with MDD who were ≥ 18 years old, evaluated by the Mini International Neuropsychiatric Interview (MINI) with the suicidality module. At the evaluation visit, we measured serum lipid profiles including total cholesterol, triglycerides (TG), low-density lipoprotein (LDL), high-density lipoprotein (HDL), and very low-density lipoprotein (VLDL), and blood measures such as fasting glucose, total protein, albumin, blood urea nitrogen, creatinine, thyroid hormones, red and white blood cells, platelet count, hemoglobin, and hematocrit. Recent attempters who had attempted suicide within the past month showed significantly lower TG and higher HDL levels than lifetime and never attempters, using Tukey's post-hoc analysis. Recent attempters exhibited lower TG and higher HDL than those with recent suicide ideation and wish to self-harm and those without previous attempt. Linear regression analysis revealed that TG was negatively associated with current suicidality scores (β = -0.187, p = 0.039), whereas VLDL was positively associated with the recent suicide status (β = 0.198, p = 0.032) after controlling for age and sex. There were no significant differences between the groups in terms of other serum lipid profiles and blood measures. Low serum TG, high HDL and VLDL levels are associated with recent suicide attempt or recent suicide status in patients with MDD. Copyright © 2014 Elsevier Inc. All rights reserved.

Digging Deeper: An Analysis of Student Loan Debt in Texas. A Report to the 82nd Regular Session of the Texas Legislature

ERIC Educational Resources Information Center

Shook, Melissa; Webster, Jeff; Fletcher, Carla

2010-01-01

In 2006, TG estimated that 47,000 bachelor's degrees would be lost in Texas due to financial barriers experienced by college-qualified high school graduates from the class of 2004. With more current data, TG now estimates that the number will be 52,800. "Digging Deeper" explores how students who enroll in college continue to experience…

Predicting bioactive glass properties from the molecular chemical composition: glass transition temperature.

PubMed

O'Donnell, Matthew D

2011-05-01

The glass transition temperature (T(g)) of inorganic glasses is an important parameter than can be used to correlate with other glass properties, such as dissolution rate, which governs in vitro and in vivo bioactivity. Seven bioactive glass compositional series reported in the literature (77 in total) were analysed here with T(g) values obtained by a number of different methods: differential thermal analysis, differential scanning calorimetry and dilatometry. An iterative least-squares fitting method was used to correlate T(g) from thermal analysis of these compositions with the levels of individual oxide and fluoride components in the glasses. When all seven series were fitted a reasonable correlation was found between calculated and experimental values (R(2)=0.89). When the two compositional series that were designed in weight percentages (the remaining five were designed in molar percentage) were removed from the model an improved fit was achieved (R(2)=0.97). This study shows that T(g) for a wide range in compositions (e.g. SiO(2) content of 37.3-68.4 mol.%) can be predicted to reasonable accuracy enabling processing parameters to be predicted such as annealing, fibre-drawing and sintering temperatures. Copyright © 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

RNA-Seq Analysis of Human Trigeminal and Dorsal Root Ganglia with a Focus on Chemoreceptors

PubMed Central

Flegel, Caroline; Schöbel, Nicole; Altmüller, Janine; Becker, Christian; Tannapfel, Andrea; Hatt, Hanns; Gisselmann, Günter

2015-01-01

The chemosensory capacity of the somatosensory system relies on the appropriate expression of chemoreceptors, which detect chemical stimuli and transduce sensory information into cellular signals. Knowledge of the complete repertoire of the chemoreceptors expressed in human sensory ganglia is lacking. This study employed the next-generation sequencing technique (RNA-Seq) to conduct the first expression analysis of human trigeminal ganglia (TG) and dorsal root ganglia (DRG). We analyzed the data with a focus on G-protein coupled receptors (GPCRs) and ion channels, which are (potentially) involved in chemosensation by somatosensory neurons in the human TG and DRG. For years, transient receptor potential (TRP) channels have been considered the main group of receptors for chemosensation in the trigeminal system. Interestingly, we could show that sensory ganglia also express a panel of different olfactory receptors (ORs) with putative chemosensory function. To characterize OR expression in more detail, we performed microarray, semi-quantitative RT-PCR experiments, and immunohistochemical staining. Additionally, we analyzed the expression data to identify further known or putative classes of chemoreceptors in the human TG and DRG. Our results give an overview of the major classes of chemoreceptors expressed in the human TG and DRG and provide the basis for a broader understanding of the reception of chemical cues. PMID:26070209

Expression of Vesicular Glutamate Transporters VGLUT1 and VGLUT2 in the Rat Dental Pulp and Trigeminal Ganglion following Inflammation

PubMed Central

Hong, Jae Hyun; Kim, Yun Sook; Choi, So Young; Kim, Tae Heon; Cho, Yi Sul; Bae, Yong Chul

2014-01-01

Background There is increasing evidence that peripheral glutamate signaling mechanism is involved in the nociceptive transmission during pathological conditions. However, little is known about the glutamate signaling mechanism and related specific type of vesicular glutamate transporter (VGLUT) in the dental pulp following inflammation. To address this issue, we investigated expression and protein levels of VGLUT1 and VGLUT2 in the dental pulp and trigeminal ganglion (TG) following complete Freund’s adjuvant (CFA) application to the rat dental pulp by light microscopic immunohistochemistry and Western blot analysis. Results The density of VGLUT2− immunopositive (+) axons in the dental pulp and the number of VGLUT2+ soma in the TG increased significantly in the CFA-treated group, compared to control group. The protein levels of VGLUT2 in the dental pulp and TG were also significantly higher in the CFA-treated group than control group by Western blot analysis. The density of VGLUT1+ axons in the dental pulp and soma in the TG remained unchanged in the CFA-treated group. Conclusions These findings suggest that glutamate signaling that is mediated by VGLUT2 in the pulpal axons may be enhanced in the inflamed dental pulp, which may contribute to pulpal axon sensitization leading to hyperalgesia following inflammation. PMID:25290694

Expression of vesicular glutamate transporters VGLUT1 and VGLUT2 in the rat dental pulp and trigeminal ganglion following inflammation.

PubMed

Yang, Eun Sun; Jin, Myoung Uk; Hong, Jae Hyun; Kim, Yun Sook; Choi, So Young; Kim, Tae Heon; Cho, Yi Sul; Bae, Yong Chul

2014-01-01

There is increasing evidence that peripheral glutamate signaling mechanism is involved in the nociceptive transmission during pathological conditions. However, little is known about the glutamate signaling mechanism and related specific type of vesicular glutamate transporter (VGLUT) in the dental pulp following inflammation. To address this issue, we investigated expression and protein levels of VGLUT1 and VGLUT2 in the dental pulp and trigeminal ganglion (TG) following complete Freund's adjuvant (CFA) application to the rat dental pulp by light microscopic immunohistochemistry and Western blot analysis. The density of VGLUT2- immunopositive (+) axons in the dental pulp and the number of VGLUT2+ soma in the TG increased significantly in the CFA-treated group, compared to control group. The protein levels of VGLUT2 in the dental pulp and TG were also significantly higher in the CFA-treated group than control group by Western blot analysis. The density of VGLUT1+ axons in the dental pulp and soma in the TG remained unchanged in the CFA-treated group. These findings suggest that glutamate signaling that is mediated by VGLUT2 in the pulpal axons may be enhanced in the inflamed dental pulp, which may contribute to pulpal axon sensitization leading to hyperalgesia following inflammation.

Production and characterization of soluble human TNFRI-Fc and human HO-1(HMOX1) transgenic pigs by using the F2A peptide.

PubMed

Park, Sol Ji; Cho, Bumrae; Koo, Ok Jae; Kim, Hwajung; Kang, Jung Taek; Hurh, Sunghoon; Kim, Su Jin; Yeom, Hye Jung; Moon, Joonho; Lee, Eun Mi; Choi, Ji Yei; Hong, Ju Ho; Jang, Goo; Hwang, Joing-Ik; Yang, Jaeseok; Lee, Byeong Chun; Ahn, Curie

2014-06-01

Generation of transgenic pigs for xenotransplantation is one of the most promising technologies for resolving organ shortages. Human heme oxygenase-1 (hHO-1/HMOX1) can protect transplanted organs by its strong anti-oxidative, anti-apoptotic, and anti-inflammatory effects. Soluble human TNFRI-Fc (shTNFRI-Fc) can inhibit the binding of human TNF-α (hTNF-α) to TNF receptors on porcine cells, and thereby, prevent hTNF-α-mediated inflammation and apoptosis. Herein, we successfully generated shTNFRI-Fc-F2A-HA-hHO-1 transgenic (TG) pigs expressing both shTNFRI-Fc and hemagglutinin-tagged-human heme oxygenase-1 (HA-hHO-1) by using an F2A self-cleaving peptide. shTNFRI-Fc and HA-hHO-1 transgenes containing the F2A peptide were constructed under the control of the CAG promoter. Transgene insertion and copy number in the genome of transgenic pigs was confirmed by polymerase chain reaction (PCR) and Southern blot analysis. Expressions of shTNFRI-Fc and HA-hHO-1 in TG pigs were confirmed using PCR, RT-PCR, western blot, ELISA, and immunohistochemistry. shTNFRI-Fc and HA-hHO-1 were expressed in various organs, including the heart, lung, and spleen. ELISA assays detected shTNFRI-Fc in the sera of TG pigs. For functional analysis, fibroblasts isolated from a shTNFRI-Fc-F2A-HA-hHO-1 TG pig (i.e., #14; 1 × 10(5) cells) were cultured with hTNF-α (20 ng/mL) and cycloheximide (10 μg/mL). The viability of shTNFRI-Fc-F2A-HA-hHO-1 TG pig fibroblasts was significantly higher than that of the wild type (wild type vs. shTNFRI-Fc-F2A-HA-hHO-1 TG at 24 h, 31.6 ± 3.2 vs. 60.4 ± 8.3 %, respectively; p < 0.05). Caspase-3/-7 activity of the shTNFRI-Fc-F2A-HA-hHO-1 TG pig fibroblasts was lower than that of the wild type pig fibroblasts (wild type vs. shTNFRI-Fc-F2A-HA-hHO-1 TG at 12 h, 812,452 ± 113,078 RLU vs. 88,240 ± 10,438 RLU, respectively; p < 0.05). These results show that shTNFRI-Fc and HA-hHO-1 TG pigs generated by the F2A self-cleaving peptide express both shTNFRI-Fc and HA-hHO-1 molecules, which provides protection against oxidative and inflammatory injury. Utilization of the F2A self-cleaving peptide is a promising tool for generating multiple TG pigs for xenotransplantation.

Clinical Impact of Detectable Antithyroglobulin Antibodies Below the Reference Limit (Borderline) in Patients with Papillary Thyroid Carcinoma with Undetectable Serum Thyroglobulin and Normal Neck Ultrasonography After Ablation: A Prospective Study.

PubMed

Côrtes, Marina Carvalho Souza; Rosario, Pedro Weslley; Oliveira, Luís Fernando Faria; Calsolari, Maria Regina

2018-02-01

Interference of antithyroglobulin antibodies (TgAb) with serum thyroglobulin (Tg) can occur even at detectable TgAb concentrations below the reference limit (borderline TgAb). Thus, borderline TgAb is considered as TgAb positivity in patients with thyroid cancer. This prospective study evaluated patients with papillary thyroid carcinoma with undetectable Tg and normal neck ultrasonography (US) after total thyroidectomy and ablation with 131 I, and compared tumor persistence/recurrence and long-term Tg and TgAb behavior in those with borderline versus undetectable TgAb. A total of 576 patients were evaluated, divided into two groups: group A with undetectable TgAb (n = 420), and group B with borderline TgAb (n = 156). Groups A and B were similar in terms of patient and tumor characteristics. The time of follow-up ranged from 24 to 120 months. During follow-up, 11 (2.6%) patients in group A and 5 (3.2%) in group B developed a recurrence (p = 0.77). In group A, recurrences occurred in 9/390 patients who continued to have undetectable TgAb and in 1/9 patients who progressed to borderline TgAb. In group B, recurrences were detected in 1/84 patients who progressed to have undetectable TgAb, in 1/45 who still had borderline TgAb, and in 3/12 who developed elevated TgAb. In the presence of Tg levels <0.2 ng/mL, recurrences were detected in 2/486 patients with undetectable TgAb, in 0/67 with borderline TgAb, and in 3/12 with elevated TgAb. The results of post-therapy whole-body scanning (RxWBS) of 216 patients with Tg ≤0.2 ng/mL and normal US at the time of ablation were also analyzed. In low-risk patients, none of the 40 patients with borderline TgAb and none of the 94 with undetectable TgAb exhibited ectopic uptake on RxWBS. In intermediate-risk patients, lymph node metastases were detected by RxWBS in 1/25 (4%) with borderline TgAb and in 2/57 (3.5%) with undetectable TgAb. The results suggest that among low- or intermediate-risk patients with undetectable Tg and normal US after thyroidectomy, those with borderline TgAb are at no greater risk of tumor persistence or recurrence than those with undetectable TgAb. When undetectable Tg levels persist, recurrence should be suspected in the case of a TgAb elevation above the reference limit.

MO-PIS-Exhibit Hall-01: Tools for TG-142 Linac Imaging QA I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clements, M; Wiesmeyer, M

2014-06-15

Partners in Solutions is an exciting new program in which AAPM partners with our vendors to present practical “hands-on” information about the equipment and software systems that we use in our clinics. The therapy topic this year is solutions for TG-142 recommendations for linear accelerator imaging QA. Note that the sessions are being held in a special purpose room built on the Exhibit Hall Floor, to encourage further interaction with the vendors. Automated Imaging QA for TG-142 with RIT Presentation Time: 2:45 – 3:15 PM This presentation will discuss software tools for automated imaging QA and phantom analysis for TG-142.more » All modalities used in radiation oncology will be discussed, including CBCT, planar kV imaging, planar MV imaging, and imaging and treatment coordinate coincidence. Vendor supplied phantoms as well as a variety of third-party phantoms will be shown, along with appropriate analyses, proper phantom setup procedures and scanning settings, and a discussion of image quality metrics. Tools for process automation will be discussed which include: RIT Cognition (machine learning for phantom image identification), RIT Cerberus (automated file system monitoring and searching), and RunQueueC (batch processing of multiple images). In addition to phantom analysis, tools for statistical tracking, trending, and reporting will be discussed. This discussion will include an introduction to statistical process control, a valuable tool in analyzing data and determining appropriate tolerances. An Introduction to TG-142 Imaging QA Using Standard Imaging Products Presentation Time: 3:15 – 3:45 PM Medical Physicists want to understand the logic behind TG-142 Imaging QA. What is often missing is a firm understanding of the connections between the EPID and OBI phantom imaging, the software “algorithms” that calculate the QA metrics, the establishment of baselines, and the analysis and interpretation of the results. The goal of our brief presentation will be to establish and solidify these connections. Our talk will be motivated by the Standard Imaging, Inc. phantom and software solutions. We will present and explain each of the image quality metrics in TG-142 in terms of the theory, mathematics, and algorithms used to implement them in the Standard Imaging PIPSpro software. In the process, we will identify the regions of phantom images that are analyzed by each algorithm. We then will discuss the process of the creation of baselines and typical ranges of acceptable values for each imaging quality metric.« less

Adoptive transfer of nontransgenic mesenteric lymph node cells induces colitis in athymic HLA-B27 transgenic nude rats

PubMed Central

Hoentjen, F; Tonkonogy, S L; Liu, B; Sartor, R B; Taurog, J D; Dieleman, L A

2006-01-01

HLA-B27 transgenic (TG) rats develop spontaneous colitis when colonized with intestinal bacteria, whereas athymic nude (rnu/rnu) HLA-B27 TG rats remain disease free. The present study was designed to determine whether or not HLA-B27 expression on T cells is required for development of colitis after transfer of mesenteric lymph node (MLN) cells into rnu/rnu HLA-B27 recipients. Athymic nontransgenic (non-TG) and HLA-B27 TG recipients received MLN cells from either TG or non-TG rnu/+ heterozygous donor rats that contain T cells. HLA-B27 TG rnu/rnu recipients receiving either non-TG or TG MLN cells developed severe colitis and had higher caecal MPO and IL-1β levels, and their MLN cells produced more IFN-γ and less IL-10 after in vitro stimulation with caecal bacterial lysate compared to rnu/rnu non-TG recipients that remained disease free after receiving either TG or non-TG cells. Interestingly, proliferating donor TG T cells were detectable one week after adoptive transfer into rnu/rnu TG recipients but not after transfer into non-TG recipients. T cells from either non-TG or TG donors induce colitis in rnu/rnu TG but not in non-TG rats, suggesting that activation of effector T cells by other cell types that express HLA-B27 is pivotal for the pathogenesis of colitis in this model. PMID:16487247

Detection of c. -32T>G (IVS1-13T>G) mutation of Pompe disease by real-time PCR in dried blood spot specimen.

PubMed

Bobillo Lobato, Joaquin; Sánchez Peral, Blas A; Durán Parejo, Pilar; Jiménez Jiménez, Luis M

2013-03-15

Pompe disease, or acid maltase deficiency, is a genetic muscle disorder caused by mutations in the gene encoding the acid alpha-glucosidase (GAA) enzyme, which is essential for the degradation of glycogen to glucose in lysosomes. The wide clinical variability is resulted from genetic heterogeneity, and many different mutations of the GAA gene have been reported. Some of these mutations are associated with specific phenotypes, such as the c. -32T>G (IVS1-13T>G) mutation seen in late-onset Pompe disease. We used a real-time PCR, after genomic DNA extraction isolated from DBS (dried blood spots) and PCR amplification. Our results successfully detected in controls and patients have been 100% concordant with sequencing results. This assay combines simple sample processing and rapid analysis and it allows to detect the patients with a milder form and slower progression of this disease with a high reliability. Copyright © 2013 Elsevier B.V. All rights reserved.

Structural, thermal, optical and nonlinear optical properties of ethylenediaminium picrate single crystals

NASA Astrophysics Data System (ADS)

Indumathi, C.; T. C., Sabari Girisun; Anitha, K.; Alfred Cecil Raj, S.

2017-07-01

A new organic optical limiting material, ethylenediaminium picrate (EDAPA) was synthesized through acid base reaction and grown as single crystals by solvent evaporation method. Single crystal XRD analysis showed that EDAPA crystallizes in orthorhombic system with Cmca as space group. The formation of charge transfer complex during the reaction of ethylenediamine and picric acid was strongly evident through the recorded Fourier Transform Infra Red (FTIR), Raman and Nuclear Magnetic Resonance (NMR) spectrum. Thermal (TG-DTA and DSC) curves indicated that the material possesses high thermal stability with decomposition temperature at 243 °C. Optical (UV-Visible-NIR) analysis showed that the grown crystal was found to be transparent in the entire visible and NIR region. Z-scan studies with intense short pulse (532 nm, 5 ns, 100 μJ) excitations, revealed that EDAPA exhibited two photon absorption behaviour and the nonlinear absorption coefficient was found to be two orders of magnitude higher than some of the known optical limiter like Cu nano glasses. EDAPA exhibited a strong optical limiting action with low limiting threshold which make them a potential candidate for eye and photosensitive component protection against intense short pulse lasers.

The usefulness of fluorine-18 fluorodeoxyglucose PET in the detection of recurrence in patients with differentiated thyroid cancer with elevated thyroglobulin and negative radioiodine whole-body scan.

PubMed

Stangierski, Adam; Kaznowski, Jaroslaw; Wolinski, Kosma; Jodlowska, Elzbieta; Michaliszyn, Piotr; Kubiak, Katarzyna; Czepczynski, Rafal; Ruchala, Marek

2016-09-01

PET/computed tomography (CT) using fluorine-18 fluorodeoxyglucose (F-FDG) has been used in the diagnosis of recurrence and metastases of differentiated thyroid cancer (DTC) in cases of negative whole-body scan (WBS) despite elevated concentrations of stimulated thyroglobulin (Tg). To assess the utility of PET/CT in the detection of recurrence among patients with DTC with increased Tg levels and negative results of WBS. PET/CT results were retrospectively analyzed in patients with DTC with increased Tg and negative results of WBS as well as negative cervical ultrasonography and chest radiography. PET-CT was performed 1-2 weeks after recent diagnostics under conditions of endogenous or exogenous thyroid-stimulating hormone stimulation. PET/CT was performed using a Discovery ST scanner 1 h after an intravenously F-FDG injection (activity 4-5 MBq/kg). To determine the cutoff value of Tg, receiver operating characteristic curves were analyzed. Sixty-nine patients with DTC (48 women, 21 men) aged 22-83 years (mean 50.9±17.5 years) were qualified. In 44 patients (63.8%), PET/CT indicated lesions of DTC. Thirty (43.5%) patients had F-FDG positive findings. In the remaining 14 patients (20.3%), lesions were found in CT only. Patients with a positive PET/CT scan had significantly higher Tg values than patients with a negative PET/CT (mean 143.8 vs. 26.5 ng/ml, P=0.03). The cutoff value of Tg concentration measured with the receiver operating characteristic analysis was 32.9 ng/ml. PET/CT is a useful tool in the detection of recurrence among thyroid cancer patients in cases of conflicting results of standard procedures, particularly for those with high Tg levels and negative WBS. The probability of obtaining a positive PET-CT result increases with the level of Tg.

Overexpression of Bone Sialoprotein Leads to an Uncoupling of Bone Formation and Bone Resorption in Mice

PubMed Central

Valverde, Paloma; Zhang, Jin; Fix, Amanda; Zhu, Ji; Ma, Wenli; Tu, Qisheng; Chen, Jake

2008-01-01

The purpose of this study was to determine the effects of bone sialoprotein (BSP) overexpression in bone metabolism in vivo by using a homozygous transgenic mouse line that constitutively overexpresses mouse BSP cDNA driven by the cytomegalovirus (CMV) promoter. CMV-BSP transgenic (TG) mice and wildtype mice were weighed, and their length, BMD, and trabecular bone volume were measured. Serum levels of RANKL, osteocalcin, osteoprotegerin (OPG), TRACP5b, and PTH were determined. Bone histomorphometry, von Kossa staining, RT-PCR analysis, Western blot, MTS assay, in vitro mineralization assay, and TRACP staining were also performed to delineate phenotypes of this transgenic mouse line. Compared with wildtype mice, adult TG mice exhibit mild dwarfism, lower values of BMD, and lower trabecular bone volume. TG mice serum contained increased calcium levels and decreased PTH levels, whereas the levels of phosphorus and magnesium were within normal limits. TG mice serum also exhibited lower levels of osteoblast differentiation markers and higher levels of markers, indicating osteoclastic activity and bone resorption. H&E staining, TRACP staining, and bone histomorphometry showed that adult TG bones were thinner and the number of giant osteoclasts in TG mice was higher, whereas there were no significant alterations in osteoblast numbers between TG mice and WT mice. Furthermore, the vertical length of the hypertrophic zone in TG mice was slightly enlarged. Moreover, ex vivo experiments indicated that overexpression of BSP decreased osteoblast population and increased osteoclastic activity. Partly because of its effects in enhancing osteoclastic activity and decreasing osteoblast population, BSP overexpression leads to an uncoupling of bone formation and resorption, which in turn results in osteopenia and mild dwarfism in mice. These findings are expected to help the development of therapies to metabolic bone diseases characterized by high serum level of BSP. PMID:18597627

An inventory-based analysis of Canada's managed forest carbon dynamics, 1990 to 2008

PubMed Central

Stinson, G; Kurz, W A; Smyth, C E; Neilson, E T; Dymond, C C; Metsaranta, J M; Boisvenue, C; Rampley, G J; Li, Q; White, T M; Blain, D

2011-01-01

Canada's forests play an important role in the global carbon (C) cycle because of their large and dynamic C stocks. Detailed monitoring of C exchange between forests and the atmosphere and improved understanding of the processes that affect the net ecosystem exchange of C are needed to improve our understanding of the terrestrial C budget. We estimated the C budget of Canada's 2.3 × 106 km2 managed forests from 1990 to 2008 using an empirical modelling approach driven by detailed forestry datasets. We estimated that average net primary production (NPP) during this period was 809 ± 5 Tg C yr−1 (352 g C m−2 yr−1) and net ecosystem production (NEP) was 71 ± 9 Tg C yr−1 (31 g C m−2 yr−1). Harvesting transferred 45 ± 4 Tg C yr−1 out of the ecosystem and 45 ± 4 Tg C yr−1 within the ecosystem (from living biomass to dead organic matter pools). Fires released 23 ± 16 Tg C yr−1 directly to the atmosphere, and fires, insects and other natural disturbances transferred 52 ± 41 Tg C yr−1 from biomass to dead organic matter pools, from where C will gradually be released through decomposition. Net biome production (NBP) was only 2 ± 20 Tg C yr−1 (1 g C m−2 yr−1); the low C sequestration ratio (NBP/NPP=0.3%) is attributed to the high average age of Canada's managed forests and the impact of natural disturbances. Although net losses of ecosystem C occurred during several years due to large fires and widespread bark beetle outbreak, Canada's managed forests were a sink for atmospheric CO2 in all years, with an uptake of 50 ± 18 Tg C yr−1 [net ecosystem exchange (NEE) of CO2=−22 g C m−2 yr−1].

Association of fasting triglyceride concentration and postprandial triglyceride response with the carotid intima-media thickness in the middle aged: The Netherlands Epidemiology of Obesity study.

PubMed

Christen, Tim; de Mutsert, Renée; Gast, Karin B; Rensen, Patrick C N; de Koning, Eelco; Rosendaal, Frits R; Trompet, Stella; Jukema, J Wouter

People are in a postprandial state for the majority of the day, postprandial triglyceride (TG) response may be more important in the etiology of atherosclerosis than fasting TGs. The objective of the study was to investigate the associations of fasting TG concentration (TGc) and postprandial TG response after a meal challenge with subclinical atherosclerosis, measured by intima-media thickness (IMT) in a middle-aged population. A total of 5574 participants (57% women) with a mean (standard deviation [SD]) age of 56 (6) years were included in this cross-sectional analysis of baseline measurements of The Netherlands Epidemiology of Obesity study. Serum TGc was measured fasting and 30 and 150 minutes after a liquid mixed meal, and the incremental area under the curve (TGiAUC) was calculated. With linear regression analyses, we calculated the differences in IMT with 95% confidence intervals, adjusted for confounding factors, and additionally for TGc or TGiAUC. Per SD of TGc (0.82 mmol/L), IMT was 8.5 μm (2.1, 14.9) greater after adjustment for TGiAUC and confounding factors. Per SD of TGiAUC (24.0 mmol/L × min), the difference in IMT was -1.7 μm (-8.5, 5.0) after adjustment for fasting TG and confounding factors. The association between TG response after a mixed meal and IMT disappeared after adjusting for TGc. The association between fasting TG concentration and IMT persisted after adjustment for postprandial TG response. These findings imply that it is not useful to perform a meal challenge in cardiovascular risk stratification. Our results support use of fasting TGc instead of postprandial TG responses for cardiovascular risk stratification in clinical practice. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Transglutaminase 2 expression is enhanced synergistically by interferon-γ and tumour necrosis factor-α in human small intestine

PubMed Central

Bayardo, M; Punzi, F; Bondar, C; Chopita, N; Chirdo, F

2012-01-01

Transglutaminase 2 (TG2) is expressed ubiquitously, has multiple physiological functions and has also been associated with inflammatory diseases, neurodegenerative disorders, autoimmunity and cancer. In particular, TG2 is expressed in small intestine mucosa where it is up-regulated in active coeliac disease (CD). The aim of this work was to investigate the induction of TG2 expression by proinflammatory cytokines [interleukin (IL)-1, IL-6, tumour necrosis factor (TNF)-α, interferon (IFN)-γ and IL-15] and the signalling pathways involved, in human epithelial and monocytic cells and in intestinal tissue from controls and untreated CD patients. Here we report that IFN-γ was the most potent inducer of TG2 expression in the small intestinal mucosa and in four [Caco-2, HT-29, Calu-6 and human acute monocytic leukaemia cell line (THP-1)] of five cell lines tested. The combination of TNF-α and IFN-γ produced a strong synergistic effect. The use of selective inhibitors of signalling pathways revealed that induction of TG2 by IFN-γ was mediated by phosphoinositide 3-kinase (PI3K), while c-Jun N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (MAPK) were required for TNF-α activation. Quantitative polymerase chain reaction (PCR), flow cytometry and Western blot analysis showed that TG2 expression was blocked completely when stimulation by either TNF-α or IFN-γ was performed in the presence of nuclear factor (NF)-κB inhibitors (sulphasalazine and BAY-117082). TG2 was up-regulated substantially by TNF-α and IFN-γ in intestinal mucosa in untreated CD compared with controls. This study shows that IFN-γ, a dominant cytokine in intestinal mucosa in active CD, is the most potent inducer of TG2, and synergism with TNF-α may contribute to exacerbate the pathogenic mechanism of CD. Selective inhibition of signalling pathways may be of therapeutic benefit. PMID:22385244

Comparative clinical evaluation on herbal formulation Pepsil, Safoof-e-Katira and Omeprazole in gastro esophageal reflux disease.

PubMed

Toseef, Muhammad Umar; Saeed, Aftab; Mohi-Ud-Din, Ejaz; Usmanghani, Khan; Nazar, Halima; Nawaz, Allah; Ahmad, Irshad; Siddiqui, Faheem Ahmed

2015-05-01

This study was conducted to evaluate the role of Unani herbal drugs Pepsil and Safoof-e-katira on the gastro esophageal reflux disease (GERD). This was multicentre randomized case control study conducted at Matab Hakeem Muhammad Noor-ud-din, Burewala; Aziz Muhammad din Medical and Surgical Centre, Burewala and Shifa-ul-mulk Memorial Hospital, Hamdard University Karachi. The patients were selected according to inclusion and exclusion criteria. In test group-1 the male female ratio was 40%, 60%; test group-2 was 42%, 58% and in control group was 44%, 56% respectively. The observed symptoms in the study were increased appetite (TG-1-95%, TG-2-95% and CG-89%), difficulty in swallowing (TG-1-93%, TG-2-96% and TC-94%), belching/burping (TG-1-97%, TG-2-97% and CG-95%), vomiting (TG-1-90%, TG-2-96% and CG-89%), heart burn (TG-1-100%, TG-2-100% and CG-98%), palpitation (TG-1-100%, TG-2-100% and CG-97%), epigastric pain (TG-1-97%, TG-2-97% and CG-90%), abdominal cramps (TG-1-97%, TG-2-98% and CG-95%), tenesmus (TG-1-100%, TG-2-100% and CG-97%), flatulence (TG-1-100%, TG-2-75% and CG-95%), wakeup during sleep (TG-1-94%, TG-2-87% and CG-94%). The p-value of the results of the symptoms was 0.000 except flatulence where the value was 0.001. The statistical results of the study prescribed that all the drugs studied (Pepsil, Safoof-e-katira and Omeprazole) are highly significant. The herbal coded drug Pepsil showed no side effects and unani herbal drug safoof-e-katira showed minimum result of 75% in the patients while Omeprazole resulted with some side effects. In the result it can be concluded that the herbal coded drug Pepsil is a potent herbal drug for gastro esophageal reflux disease.

Relationship between insulin sensitivity and the triglyceride-HDL-C ratio in overweight and obese postmenopausal women: a MONET study.

PubMed

Karelis, Antony D; Pasternyk, Stephanie M; Messier, Lyne; St-Pierre, David H; Lavoie, Jean-Marc; Garrel, Dominique; Rabasa-Lhoret, Rémi

2007-12-01

The objective of this cross-sectional study was to examine the relationship between the triglyceride-HDL-cholesterol ratio (TG:HDL-C) and insulin sensitivity in overweight and obese sedentary postmenopausal women. The study population consisted of 131 non-diabetic overweight and obese sedentary postmenopausal women (age; 57.7+/-5.0 y; body mass index (BMI), 32.2+/-4.3 kg/m2). Subjects were characterized by dividing the entire cohort into tertiles based on the TG:HDL-C (T1<0.86 vs. T2=0.86 to 1.35 vs. T3>1.35, respectively). We measured (i) insulin sensitivity (using the hyperinsulinenic-euglycemic clamp and homeostasis model assessment (HOMA)), (ii) body composition (using dual-energy X-ray absorptiometry), (iii) visceral fat (using computed tomography), (iv) plasma lipids, C-reactive protein, 2 h glucose concentration during an oral glucose tolerance test (2 h glucose), as well as fasting glucose and insulin, (v) peak oxygen consumption, and (vi) lower-body muscle strength (using weight training equipment). Significant correlations were observed between the TG:HDL-C and the hyperinsulinemic-euglycemic clamp (r=-0.45; p<0.0001), as well as with HOMA (r=0.42; p<0.0001). Moreover, the TG:HDL-C significantly correlated with lean body mass, visceral fat, 2 h glucose, C-reactive protein, and muscle strength. Stepwise regression analysis showed that the TG:HDL-C explained 16.4% of the variation in glucose disposal in our cohort, which accounted for the greatest source of unique variance. Other independent predictors of glucose disposal were 2 h glucose (10.1%), C-reactive protein (CRP; 7.6%), and peak oxygen consumption (5.8%), collectively (including the TG:HDL-C) explaining 39.9% of the unique variance. In addition, the TG:HDL-C was the second predictor for HOMA, accounting for 11.7% of the variation. High levels of insulin sensitivity were associated with low levels of the TG:HDL-C. In addition, the TG:HDL-C was a predictor for glucose disposal rates and HOMA values in our cohort of overweight and obese postmenopausal women.

TriGlycerides and high-density lipoprotein cholesterol ratio compared with homeostasis model assessment insulin resistance indexes in screening for metabolic syndrome in the chinese obese children: a cross section study.

PubMed

Liang, Jianfeng; Fu, Junfen; Jiang, Youyun; Dong, Guanping; Wang, Xiumin; Wu, Wei

2015-09-28

Metabolic Syndrome (MS) is prevalant in China, especially according to the pediatric obesity group. Based on the MS-CHN2012 definition for Chinese children and adolescents the need to explore and establish a convienent MS screening become imminent. This study aims to investigate the optimal cut-off values, compare the accuracy for the (TriGlycerides (TG) to High-Density Lipoprotein Cholesterol (HDL-C)) (TG/HDL-C) ratio and Homeostasis Model Assessment Insulin Resistance (HOMA-IR) indexs to identify Metabolic Syndrome in obese pediatric population in China. A total sample of 976 children (female 286 male 690, BMI > = 95 percentile) aged from 6-16 years underwent a medical assessment including a physical examination and investigations of total cholesterol, high-density lipoprotein, low-density lipoprotein, triglycerides, insulin, glucose, and oral glucose tolerance test to identify the components of Metabolic Syndrome. The validity and accuracy between TG/HDL-C ratio and HOMA-IR were compared by Receiver Operating Characteristics analysis (ROC). TG/HDL-C ratio achieved a larger ROC Area under Curve (AUC = 0.843) than HOMA-IR indexes (0.640, 0.625 for HOMA1-IR, HOMA2-IR respectively) to screen for Metabolic Syndrome. The cut-off values for MS were: TG/HDL-C ratio > 1.25 (sensitivity: 80%; specificity: 75%), HOMA1-IR > 4.59 (sensitivity: 58.7%; specificity: 65.5%) and HOMA2-IR > 2.76 (sensitivity: 53.2%; specificity: 69.5%). The results kept robust after stratified by gender, age group and pubertal stage. TG/HDL-C ratio was a better indicator than the HOMA-IR to screen for a positive diagnosis for MS. Furthermore, the TG/HDL-C ratio was superior to the HOMA-IR indexes even after the control of possible confusions from the gender, age group and puberty stage. TG/HDL-C ratio proved a better index than HOMA-IR in screening for MS in obese children and adolescents. TG/HDL-C ratio has a discriminatory power in detecting potential MS in the Chinese obese pediatric population.

Dysregulated luminal bacterial antigen-specific T-cell responses and antigen-presenting cell function in HLA-B27 transgenic rats with chronic colitis

PubMed Central

Qian, Bi-Feng; Tonkonogy, Susan L; Hoentjen, Frank; Dieleman, Levinus A; Sartor, R Balfour

2005-01-01

HLA-B27/β2 microglobulin transgenic (TG) rats spontaneously develop T-cell-mediated colitis when colonized with normal commensal bacteria, but remain disease-free under germ-free conditions. We investigated regulation of in vitro T-cell responses to enteric bacterial components. Bacterial lysates prepared from the caecal contents of specific pathogen-free (SPF) rats stimulated interferon-γ (IFN-γ) production by TG but not non-TG mesenteric lymph node (MLN) cells. In contrast, essentially equivalent amounts of interleukin-10 (IL-10) were produced by TG and non-TG cells. However, when cells from MLNs of non-TG rats were cocultured with TG MLN cells, no suppression of IFN-γ production was noted. Both non-TG and TG antigen-presenting cells (APC) pulsed with caecal bacterial lysate were able to induce IFN-γ production by TG CD4+ cells, although non-TG APC were more efficient than TG APC. Interestingly, the addition of exogenous IL-10 inhibited non-TG APC but not TG APC stimulation of IFN-γ production by cocultured TG CD4+ lymphocytes. Conversely, in the presence of exogenous IFN-γ, production of IL-10 was significantly lower in the supernatants of TG compared to non-TG APC cultures. We conclude that commensal luminal bacterial components induce exaggerated in vitro IFN-γ responses in HLA-B27 TG T cells, which may in turn inhibit the production of regulatory molecules, such as IL-10. Alterations in the production of IFN-γ, and in responses to this cytokine, as well as possible resistance of TG cells to suppressive regulation could together contribute to the development of chronic colitis in TG rats. PMID:16108823

RNA Interference Directed against the Transglutaminase Gene Triggers Dysbiosis of Gut Microbiota in Drosophila*

PubMed Central

Sekihara, Sanae; Shibata, Toshio; Hyakkendani, Mai; Kawabata, Shun-ichiro

2016-01-01

We recently reported that transglutaminase (TG) suppresses immune deficiency pathway-controlled antimicrobial peptides (IMD-AMPs), thereby conferring immune tolerance to gut microbes, and that RNAi of the TG gene in flies decreases the lifespan compared with non-TG-RNAi flies. Here, analysis of the bacterial composition of the Drosophila gut by next-generation sequencing revealed that gut microbiota comprising one dominant genus of Acetobacter in non-TG-RNAi flies was shifted to that comprising two dominant genera of Acetobacter and Providencia in TG-RNAi flies. Four bacterial strains, including Acetobacter persici SK1 and Acetobacter indonesiensis SK2, Lactobacillus pentosus SK3, and Providencia rettgeri SK4, were isolated from the midgut of TG-RNAi flies. SK1 exhibited the highest resistance to the IMD-AMPs Cecropin A1 and Diptericin among the isolated bacteria. In contrast, SK4 exhibited considerably lower resistance against Cecropin A1, whereas SK4 exhibited high resistance to hypochlorous acid. The resistance of strains SK1–4 against IMD-AMPs in in vitro assays could not explain the shift of the microbiota in the gut of TG-RNAi flies. The lifespan was reduced in gnotobiotic flies that ingested both SK4 and SK1, concomitant with the production of reactive oxygen species and apoptosis in the midgut, whereas the survival rate was not altered in gnotobiotic flies that mono-ingested either SK4 or SK1. Interestingly, significant amounts of reactive oxygen species were detected in the midgut of gnotobiotic flies that ingested SK4 and SK2, concomitant with no significant apoptosis in the midgut. In gnotobiotic flies that co-ingested SK4 and SK1, an additional unknown factor(s) may be required to cause midgut apoptosis. PMID:27760824

Relationship between Lipids Levels of Serum and Seminal Plasma and Semen Parameters in 631 Chinese Subfertile Men

PubMed Central

Yao, Qi; Fan, Kai; Wang, Guo-Hong; Feng, Rui-Xiang; Liang, Yuan-Jiao; Chen, Li; Ge, Yi-Feng; Yao, Bing

2016-01-01

Objective This prospective study was designed to investigate the relationship between lipids levels in both serum and seminal plasma and semen parameters. Methods 631 subfertile men were enrolled. Their obesity-associated markers were measured, and semen parameters were analyzed. Also, seminal plasma and serum TC, TG, HDL and LDL and serum FFA, FSH, LH, total testosterone (TT), estradiol (E2) and SHBG levels were detected. Results Seminal plasma and serum TG, TC and LDL levels were positively related to age. Serum TC, TG and LDL were positively related to obesity-associated markers (P < 0.001), while only seminal plasma TG was positively related to them (P < 0.05). For lipids levels in serum and seminal plasma, only TG level had slightly positive correlation between them (r = 0.081, P = 0.042). There was no significant correlation between serum lipids levels and semen parameters. However, seminal plasma TG, TC, LDL and HDL levels were negatively related to one or several semen parameters, including semen volume (SV), sperm concentration (SC), total sperm count (TSC), sperm motility, progressive motility (PR) and total normal-progressively motile sperm counts (TNPMS). Moreover, seminal plasma TG, TC, LDL and HDL levels in patients with oligospermatism, asthenospermia and teratozoospermia were higher than those with normal sperm concentration, motility or morphology. After adjusting age and serum LH, FSH, TT, E2 and SHBG levels, linear regression analysis showed that SV was still significantly correlated with seminal plasma LDL (P = 0.012), both of SC and TSC with seminal plasma HDL (P = 0.028 and 0.002), and both of PR and sperm motility with seminal plasma TC (P = 0.012 and 0.051). Conclusion The abnormal metabolism of lipids in male reproductive system may contribute to male factor infertility. PMID:26726884

Perceptual and acoustic outcomes of voice therapy for male-to-female transgender individuals immediately after therapy and 15 months later.

PubMed

Gelfer, Marylou Pausewang; Tice, Ruthanne M

2013-05-01

The present study examined how effectively listeners' perceptions of gender could be changed from male to female for male-to-female (MTF) transgender (TG) clients based on the voice signal alone, immediately after voice therapy and at long-term follow-up. Short- and long-term changes in masculinity and femininity ratings and acoustic measures of speaking fundamental frequency (SFF) and vowel formant frequencies were also investigated. Prospective treatment study. Five MTF TG clients, five control female speakers, and five control male speakers provided a variety of speech samples for later analysis. The TG clients then underwent 8 weeks of voice therapy. Voice samples were collected immediately at the termination of therapy and again 15 months later. Two groups of listeners were recruited to evaluate gender and provide masculinity and femininity ratings. Perceptual results revealed that TG subjects were perceived as female 1.9% of the time in the pretest, 50.8% of the time in the immediate posttest, and 33.1% of the time in the long-term posttest. The TG speakers were also perceived as significantly less masculine and more feminine in the immediate posttest and the long-term posttest compared with the pre-test. Some acoustic measures showed significant differences between the pretest and the immediate posttest and long-term posttest. It appeared that 8 weeks of voice therapy could result in vocal changes in MTF TG individuals that persist at least partially for up to 15 months. However, some TG subjects were more successful with voice feminization than others. Copyright © 2013 The Voice Foundation. Published by Mosby, Inc. All rights reserved.

Feasibility and nutritional impact of laparoscopy-assisted subtotal gastrectomy for early gastric cancer in the upper stomach.

PubMed

Kosuga, Toshiyuki; Hiki, Naoki; Nunobe, Souya; Noma, Hisashi; Honda, Michitaka; Tanimura, Shinya; Sano, Takeshi; Yamaguchi, Toshiharu

2014-06-01

Laparoscopy-assisted total gastrectomy (LATG) is commonly performed for early gastric cancer (EGC) in the upper stomach; however, the incidence of anastomotic complications remains high, and postoperative nutritional status is not satisfactory. This study aimed to evaluate the feasibility and nutritional impact of a novel surgical procedure, laparoscopy-assisted subtotal gastrectomy (LAsTG). This was a retrospective study of 167 patients with EGC in the upper stomach. Of these, 57 patients underwent LAsTG, while 110 patients underwent LATG. Postoperative change in body weight, and serum concentration of albumin (Alb) and total protein (TP) were compared between the LAsTG and LATG groups. Analysis of covariance (ANCOVA) was used to assess the influence of potential confounding factors. Frequency of anastomotic complications was significantly higher in the LATG group (16.3 %) than in the LAsTG group (5.3 %, P = 0.040). Postoperative recovery of body weight at 12 months after surgery was significantly better in the LAsTG group (89.8 ± 1.4 %) than in the LATG group (82.1 ± 1.0 %, P < 0.001). By ANCOVA, adjusted mean differences of Alb and TP at 12 months after surgery between the LAsTG and LATG groups were 0.226 g/dl (95 % CI 0.141-0.312; P < 0.001) and 0.380 g/dl (95 % CI 0.265-0.495; P < 0.001); thus, the surgical procedure was significantly associated with the postoperative Alb and TP levels. LAsTG could be a better choice than LATG for EGC in the upper stomach as a result of improvements in the incidence of anastomotic complications and postoperative nutritional status.

Tokyo Guidelines 2018: flowchart for the management of acute cholecystitis.

PubMed

Okamoto, Kohji; Suzuki, Kenji; Takada, Tadahiro; Strasberg, Steven M; Asbun, Horacio J; Endo, Itaru; Iwashita, Yukio; Hibi, Taizo; Pitt, Henry A; Umezawa, Akiko; Asai, Koji; Han, Ho-Seong; Hwang, Tsann-Long; Mori, Yasuhisa; Yoon, Yoo-Seok; Huang, Wayne Shih-Wei; Belli, Giulio; Dervenis, Christos; Yokoe, Masamichi; Kiriyama, Seiki; Itoi, Takao; Jagannath, Palepu; Garden, O James; Miura, Fumihiko; Nakamura, Masafumi; Horiguchi, Akihiko; Wakabayashi, Go; Cherqui, Daniel; de Santibañes, Eduardo; Shikata, Satoru; Noguchi, Yoshinori; Ukai, Tomohiko; Higuchi, Ryota; Wada, Keita; Honda, Goro; Supe, Avinash Nivritti; Yoshida, Masahiro; Mayumi, Toshihiko; Gouma, Dirk J; Deziel, Daniel J; Liau, Kui-Hin; Chen, Miin-Fu; Shibao, Kazunori; Liu, Keng-Hao; Su, Cheng-Hsi; Chan, Angus C W; Yoon, Dong-Sup; Choi, In-Seok; Jonas, Eduard; Chen, Xiao-Ping; Fan, Sheung Tat; Ker, Chen-Guo; Giménez, Mariano Eduardo; Kitano, Seigo; Inomata, Masafumi; Hirata, Koichi; Inui, Kazuo; Sumiyama, Yoshinobu; Yamamoto, Masakazu

2018-01-01

We propose a new flowchart for the treatment of acute cholecystitis (AC) in the Tokyo Guidelines 2018 (TG18). Grade III AC was not indicated for straightforward laparoscopic cholecystectomy (Lap-C). Following analysis of subsequent clinical investigations and drawing on Big Data in particular, TG18 proposes that some Grade III AC can be treated by Lap-C when performed at advanced centers with specialized surgeons experienced in this procedure and for patients that satisfy certain strict criteria. For Grade I, TG18 recommends early Lap-C if the patients meet the criteria of Charlson comorbidity index (CCI) ≤5 and American Society of Anesthesiologists physical status classification (ASA-PS) ≤2. For Grade II AC, if patients meet the criteria of CCI ≤5 and ASA-PS ≤2, TG18 recommends early Lap-C performed by experienced surgeons; and if not, after medical treatment and/or gallbladder drainage, Lap-C would be indicated. TG18 proposes that Lap-C is indicated in Grade III patients with strict criteria. These are that the patients have favorable organ system failure, and negative predictive factors, who meet the criteria of CCI ≤3 and ASA-PS ≤2 and who are being treated at an advanced center (where experienced surgeons practice). If the patient is not considered suitable for early surgery, TG18 recommends early/urgent biliary drainage followed by delayed Lap-C once the patient's overall condition has improved. Free full articles and mobile app of TG18 are available at: http://www.jshbps.jp/modules/en/index.php?content_id=47. Related clinical questions and references are also included. © 2017 Japanese Society of Hepato-Biliary-Pancreatic Surgery.

Influence of Adiponectin Gene Polymorphisms on Adiponectin Level and Insulin Resistance Index in Response to Dietary Intervention in Overweight-Obese Patients With Impaired Fasting Glucose or Newly Diagnosed Type 2 Diabetes

PubMed Central

Chung, Hye Kyung; Chae, Jey Sook; Hyun, Yae Jung; Paik, Jean Kyung; Kim, Ji Young; Jang, Yangsoo; Kwon, Hyuck Moon; Song, Young Duk; Lee, Hyun Chul; Lee, Jong Ho

2009-01-01

OBJECTIVE The aim of this study was to determine the effect of common adiponectin gene polymorphisms on dietary intervention-mediated changes in adiponectin levels and homeostasis model assessment of insulin resistance (HOMA-IR) indexes. RESEARCH DESIGN AND METHODS A total of 363 subjects with impaired fasting glucose (IFG) or newly diagnosed type 2 diabetes followed a dietary intervention (replacement of cooked refined rice with whole grains and an increase in vegetable intake) and regular walking for 12 weeks without any medication. Adiponectin gene single nucleotide polymorphisms (SNPs) (45, 276, and −11377) were examined in these subjects. RESULTS After this dietary intervention, fasting glucose levels decreased in all three SNP 45T>G genotype groups. Subjects with the SNP 45TT genotype showed increased adiponectin levels and decreased HOMA-IR indexes. Haplotype analysis revealed that homozygous carriers of the TG haplotype (45TT and 276GG) and heterozygous carriers of the TG haplotype (TG/X) showed a reduction in the HOMA-IR index after adjustment for baseline levels. Significant differences were observed in changes in HOMA-IR indexes and adiponectin concentrations according to the 45-276 TG haplotype in overweight-obese, but not in normal-weight subjects: the greatest decrease in HOMA-IR indexes and the greatest increase in adiponectin levels were shown in overweight-obese subjects with the TG/TG haplotype. CONCLUSIONS ADIPOQ genetic variants can affect circulating adiponectin levels and insulin resistance indexes in subjects with IFG or newly diagnosed type 2 diabetes in response to dietary intervention. PMID:19131459

Acquisition and long-term retention of spatial learning in the human immunodeficiency virus-1 transgenic rat: Effects of repeated nicotine treatment

PubMed Central

Vigorito, Michael; Cao, Junran; Li, Ming D.; Chang, Sulie L.

2013-01-01

The HIV-1 transgenic (HIV-1Tg) rat shows a deficit in learning to locate a submerged platform in a multiple-trial water maze task compared to transgenic littermate and F344 control rats (Vigorito et al. 2008; Lashomb et al. 2009). Nicotine is known to have neuroprotective effects possibly by minimizing cytotoxic effects of glutamate or by modulating a cholinergic anti-inflammatory pathway. Nicotine also improves performance in a variety of learning tasks by enhancing attention and short-term memory (STM). The purpose of this study was to determine if the learning deficit in HIV-1Tg is ameliorated by repeated nicotine treatment independent of its effects on STM. HIV-1Tg and F344 rats were treated (subcutaneous) with nicotine (0.25mg/kg/injection) or saline twice daily and tested in a single-trial-per-day procedure which precludes the impact of STM on the acquisition of the spatial learning task. HIV-1Tg rats showed a deficit in the acquisition of the task and in the long-term retention for the platform location in a probe test. Nicotine did not ameliorate the deficit in HIV-1Tg rats and slightly worsened performance during acquisition. Analysis of individual differences in performance during the probe test suggested that nicotine improved performance in some F344 rats but not in HIV-1Tg rats. These results indicate that a deficit in the consolidation of long-term memory (LTM) contributes to the acquisition deficit of HIV1-Tg rats. The results, however, do not provide any evidence of the amelioration of the learning deficit observed in this behavioral model at least with the nicotine dose tested. PMID:23456952

Global deficits in development, function, and gene expression in the endocrine pancreas in a deletion mouse model of Prader-Willi syndrome.

PubMed

Stefan, Mihaela; Simmons, Rebecca A; Bertera, Suzanne; Trucco, Massimo; Esni, Farzad; Drain, Peter; Nicholls, Robert D

2011-05-01

Prader-Willi syndrome (PWS) is a multisystem disorder caused by genetic loss of function of a cluster of imprinted, paternally expressed genes. Neonatal failure to thrive in PWS is followed by childhood-onset hyperphagia and obesity among other endocrine and behavioral abnormalities. PWS is typically assumed to be caused by an unknown hypothalamic-pituitary dysfunction, but the underlying pathogenesis remains unknown. A transgenic deletion mouse model (TgPWS) has severe failure to thrive, with very low levels of plasma insulin and glucagon in fetal and neonatal life prior to and following onset of progressive hypoglycemia. In this study, we tested the hypothesis that primary deficits in pancreatic islet development or function may play a fundamental role in the TgPWS neonatal phenotype. Major pancreatic islet hormones (insulin, glucagon) were decreased in TgPWS mice, consistent with plasma levels. Immunohistochemical analysis of the pancreas demonstrated disrupted morphology of TgPWS islets, with reduced α- and β-cell mass arising from an increase in apoptosis. Furthermore, in vivo and in vitro studies show that the rate of insulin secretion is significantly impaired in TgPWS β-cells. In TgPWS pancreas, mRNA levels for genes encoding all pancreatic hormones, other secretory factors, and the ISL1 transcription factor are upregulated by either a compensatory response to plasma hormone deficiencies or a primary effect of a deleted gene. Our findings identify a cluster of imprinted genes required for the development, survival, coordinate regulation of genes encoding hormones, and secretory function of pancreatic endocrine cells, which may underlie the neonatal phenotype of the TgPWS mouse model.

Correlation of the tibial tuberosity-trochlear groove distance with the Q-angle.

PubMed

Dickschas, Jörg; Harrer, Jörg; Bayer, Thomas; Schwitulla, Judith; Strecker, Wolf

2016-03-01

The Q-angle has been used for years to quantify lateralization of the patella. The tibial tuberosity-trochlea groove distance (TT-TG distance) was introduced to analyse patellar tracking. Does a significant correlation exist between these two parameters? Do other significant interrelations exist between the Q-angle/TT-TG distance, torsion of the femur and tibia, the frontal axis, overall leg length, gender, former patellar dislocation, BMI? One hundred knees in 55 patients with patellofemoral symptoms were included in a prospective study. All patients underwent clinical examination, including measurement of the Q-angle. A torsional CT was obtained from all patients. The correlation coefficient was 0.33/0.34 (left/right leg), showing that the TT-TG distance tends to rise in direct ratio to a rising Q-angle. Thus, a significant correlation was found (p = 0.017). Femoral and tibial torsion had a positive effect on the TT-TG distance, but showed no significant correlation. Leg length had a significant effect on the TT-TG distance (p = 0.04). The frontal axis had a nonsignificant influence on the Q-angle or TT-TG distance. On average, the Q-angle in women was 2.38° greater than it was in men, but the difference was not significant. A significant correlation was noted between the Q-angle and the TT-TG distance. Both depend on various parameters and must be assessed for the analysis of patellofemoral maltracking. The Q-angle did not differ significantly between men and women; thus, the conclusion is that no different ranges need not be used. Diagnostic study, Level III.

The role of the daily feeding rhythm in the regulation of the day/night rhythm in triglyceride secretion in rats.

PubMed

Su, Yan; Foppen, Ewout; Mansur Machado, Frederico Sander; Fliers, Eric; Kalsbeek, Andries

2018-02-15

Plasma triglyceride (TG) levels show a clear daily rhythm, however, thus far it is still unknown whether this rhythm results from a daily rhythm in TG production, TG uptake or both. Previous studies have shown that feeding activity affects plasma TG concentrations, but it is not clear how the daily rhythm in feeding activity affects plasma TG concentrations. In the present study, we measured plasma TG concentrations and TG secretion rates in rats at 6 Zeitgeber times to investigate whether plasma TG concentrations and TG secretion show a daily rhythm. We found that plasma TG concentrations and TG secretion show a significant day/night rhythm. Next, we removed the daily rhythm in feeding behavior by introducing a 6-meals-a-day (6M) feeding schedule to investigate whether the daily rhythm in feeding behavior is necessary to maintain the daily rhythm in TG secretion. We found that the day/night rhythm in TG secretion was abolished under 6M feeding conditions. Hepatic apolipoprotein B (ApoB) and microsomal TG transfer protein (Mttp), which are both involved in TG secretion, also lost their daily rhythmicity under 6M feeding conditions. Together, these results indicate that: (1) the daily rhythm in TG secretion contributes to the formation of a day/night rhythm in plasma TG levels and (2) a daily feeding rhythm is essential for maintaining the daily rhythm in TG secretion.

Synthesis, growth, structural, optical, luminescence, surface and HOMO LUMO analysis of 2-[2-(4-cholro-phenyl)-vinyl]-1-methylquinolinium naphthalene-2-sulfonate organic single crystals grown by a slow evaporation technique

NASA Astrophysics Data System (ADS)

Karthigha, S.; Kalainathan, S.; Maheswara Rao, Kunda Uma; Hamada, Fumio; Yamada, Manabu; Kondo, Yoshihiko

2016-02-01

Single crystals of 2-[2-(4-cholro-phenyl)-vinyl]-1-methylquinolinium naphthalene-2-sulfonate (4CLNS) were grown by a slow evaporation technique. The formation of molecule was confirmed from 1H NMR and FTIR analysis. The confirmation of crystal structure was done by single crystal XRD and atomic packing of grown crystal was identified. The grown single crystal crystallized in triclinic structure with centrosymmetric space group P-1. The crystalline nature of the synthesised material was recorded by powder XRD. The optical absorption properties of the grown crystals were analyzed by UV-vis spectral studies. The thermal behaviour of the title material has been studied by TG/DTA analysis which revealed the stability of the compound till its melting point 276.7 °C. The third order nonlinear optical property of 4CLNS was investigated in detail by Z scan technique and it confirms that the title crystal is suitable for photonic devices and NLO optical applications. Emissions at 519 nm in green region of the EM spectrum were found by photoluminescence studies. The charge transfer occurring within the molecule is explained by the calculated HOMO and LUMO energies.

[The value of fasting plasma glucose and lipid profiles between 7 and 15 gestational weeks in the prediction of gestational diabetes mellitus].

PubMed

Zhao, M; Li, G H

2016-11-25

Objective: To explore the value of using fasting plasma glucose (FPG) and lipid profiles between 7 and 15 gestational weeks to predict gestational diabetes mellitus (GDM). Methods: The medical records of 2 138 pregnant women who had prenatal care in Beijing Obstetrics and Gynecology Hospital from August 2011 to February 2012 were analyzed retrospectively. According to results of the oral glucose tolerance tests, women were devided into the GDM group ( n =240) and the normal group ( n= 1 898). Maternal characteristics, FPG and lipid levels between 7 and 15 gestational weeks were compared between the two groups. Logistic regression analysis and receiver operator characteristics(ROC) curve were used in the analysis. Results: Potential markers for the prediction of GDM included total cholesterol, triglyceride (TG) , low-density lipoprotein cholesterol/high-density lipoprotein cholesterol ratios (LDL-C/HDL-C) , triglyceride to high-density lipoprotein cholesterol ratios (TG/HDL-C) and FPG. After adjustment of confounding factors, age ( OR= 1.046, 95% CI: 1.003-1.090), pre- pregnancy body mass index ( OR= 1.104, 95% CI: 1.049-1.161), gravidity>3 ( OR= 1.768, 95% CI: 1.071-2.920), FPG ( OR= 8.137, 95% CI: 5.412-12.236), TG ( OR= 1.460, 95% CI: 1.148-1.858) were independently associated with the risk of developing GDM. Equation, P GDM =1/{1+exp[-(-16.542+0.045×age+0.103×pre-pregnancy body mass index+0.551×gravidity>3+2.110×FPG+0.372×TG)]}, was constructed by the logistic regression analysis. Sensitivity (67.5%) and specificity (70.5%) were determined by the calculated risk score, with a cut-off value of 0.11 (area under the curve: 0.751, 95% CI: 0.718-0.783, P< 0.001). Conclusions: FPG and TG, together with clinical characteristics may have a better predictive value for the risk of GDM.

The Effect of Intelligent Physical Exercise Training on Sickness Presenteeism and Absenteeism Among Office Workers.

PubMed

Justesen, Just Bendix; Søgaard, Karen; Dalager, Tina; Christensen, Jeanette Reffstrup; Sjøgaard, Gisela

2017-10-01

The aim of this study was to investigate the effect of individually tailored intelligent physical exercise training (IPET) on presenteeism and absenteeism among office workers. In a 1-year randomized controlled trial (RCT), employees were allocated to a training group TG (N = 193) or control group CG (N = 194). TG received 1-hour high-intensity IPET once a week within working hours, and was recommended to perform 30 minutes of moderate-intensity physical activity (PA) 6 days a week during leisure-time. An intention-to-treat analysis showed no effect on absenteeism, but a significant 4% increase in workability and 9% increase in general health in TG compared with CG. A per-protocol analysis [adherence of ≥70% (N = 89)] in addition showed a significant 6% increase in productivity and a 29% reduction in absenteeism compared with CG. IPET combined with recommendations of leisure-time PA significantly improved presenteeism and decreased absenteeism if following the protocol.

Dust transport and deposition observed from the Terra-MODIS space observations

NASA Astrophysics Data System (ADS)

Kaufman, Y. J.; Koren, I.; Tanre, D.; Fan, S.; Remer, L.; Ginoux, P.

2003-12-01

Meteorological observations, in situ data and satellite images of dust episodes were used already in the 1970s to estimate that 100 tg of dust are transported from Africa over the Atlantic Ocean every year between June and August and deposited in the Atlantic Ocean and the Americas. Desert dust is a main source of nutrients to oceanic biota and the Amazon forest, but deteriorates air quality and caries pathogens as shown for Florida. Dust affects the Earth radiation budget, thus participating in climate change and feedback mechanisms. There is an urgent need for new tools for quantitative evaluation of the dust distribution, transport and deposition. The Terra spacecraft launched at the dawn of the last millennium provides first systematic well calibrated multispectral measurements from the MODIS instrument, for daily global analysis of aerosol. MODIS data are used here to distinguish dust from smoke and maritime aerosols and evaluate the African dust column concentration, transport and deposition. We found that 230 80 tg of dust are transported annually from Africa to the Atlantic Ocean, 30 tg return to Africa and Europe, 70 tg reach the Caribbean, 45 tg fertilize the Amazon Basin, 4 times as previous estimates thus explaining a paradox regarding the source of nutrition to the Amazon forest, and 120 40 tg are deposited in the Atlantic Ocean. The results are compared favorably with dust transport models for particle radius * 12 m. This study is a first example of quantitative use of MODIS aerosol for a geophysical study.

The triglyceride to high-density lipoprotein ratio identifies children who may be at risk of developing cardiometabolic disease.

PubMed

Bailey, Daniel P; Savory, Louise A; Denton, Sarah J; Davies, Ben R; Kerr, Catherine J

2014-08-01

It is important to develop simple, reliable methods to identify high-risk individuals who may benefit from intervention. This study investigated the association between the triglyceride to high-density lipoprotein cholesterol (TG/HDL) ratio and cardiometabolic risk, cardiorespiratory fitness and physical activity in children. Anthropometric, biochemical parameters, cardiorespiratory fitness and accelerometry determined physical activity were assessed in 155 children (80 girls) from 10 to 14 years of age from Bedfordshire, UK. Participants were grouped into high and low TG/HDL ratio groups, according to published thresholds. MANCOVA and logistic regression were used in the analysis. Cardiometabolic risk factor levels were significantly higher in participants with a high TG/HDL ratio (p < 0.05). The odds of having high waist circumference (OR = 13.99; 95% CI 2.93, 69.25), elevated systolic blood pressure (5.27; 1.39, 20.01), high non-HDL cholesterol (19.47; 4.42, 85.81) and ≥2 cardiometabolic risk factors (15.32; 3.10, 75.79) were higher in participants with a high TG/HDL ratio. The TG/HDL ratio values were significantly lower in those with high cardiorespiratory fitness (p = 0.01), but there was no association with physical activity. These findings support the use of the TG/HDL ratio to identify children with cardiometabolic risk factors who may be at risk of developing cardiometabolic disease. ©2014 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

Clinical laboratory verification of thyroglobulin concentrations in the presence of autoantibodies to thyroglobulin: comparison of EIA, radioimmunoassay and LC MS/MS measurements in an Urban Hospital.

PubMed

Wheeler, Sarah E; Liu, Li; Blair, Harry C; Sivak, Richard; Longo, Nancy; Tischler, Jeffery; Mulvey, Kathryn; Palmer, Octavia M Peck

2017-12-08

Thyroglobulin (Tg) measurements assess recurrence in post-thyroidectomy thyroid cancer patients. Tg measurements by enzyme immunoassays (EIA) can be falsely elevated by interference from Tg autoantibodies (TgAb). Radioimmunoassay (RIA) is less susceptible to TgAb interference and has been the standard-of-care test for TgAb positive patients. Recently developed liquid chromatography tandem mass spectrometry (LC-MS/MS) methods may eliminate TgAb interference. We assessed the performance of Tg measurements by EIA, RIA and LC-MS/MS to evaluate TgAb interference differences. We measured TgAb and Tg in 50 plasma samples from 40 patients in whom Tg measurement was part of their routine follow-up and 10 healthy volunteers. Discrepancy between EIA and both LC-MS/MS and RIA was observed at low Tg concentrations (≤ 7.55 ng/mL) in TgAb positive specimens (LC-MS/MS = 1.9 * EIA - 0.03, r = 0.68). RIA and LC-MS/MS Tg measurements in TgAb positive specimens with low Tg concentrations had improved correlation but demonstrated bias (LC MS/MS = 0.6 * RIA - 1.4, r = 0.90). Disagreement between methods may be attributed to LC-MS/MS reported Tg concentrations as undetectable compared to RIA. It seems likely that most discrepant cases are falsely elevated in RIA due to TgAb interference, however, some cases appear below the detection limit of LC-MS/MS; implementation of LC-MS/MS by clinicians will require lower detection limits.

SU-F-T-248: FMEA Risk Analysis Implementation (AAPM TG-100) in Total Skin Electron Irradiation Technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ibanez-Rosello, B; Bautista-Ballesteros, J; Bonaque, J

2016-06-15

Purpose: Total Skin Electron Irradiation (TSEI) is a radiotherapy treatment which involves irradiating the entire body surface as homogeneously as possible. It is composed of an extensive multi-step technique in which quality management requires high consumption of resources and a fluid communication between the involved staff, necessary to improve the safety of treatment. The TG-100 proposes a new perspective of quality management in radiotherapy, presenting a systematic method of risk analysis throughout the global flow of the stages through the patient. The purpose of this work has been to apply TG-100 approach to the TSEI procedure in our institution. Methods:more » A multidisciplinary team specifically targeting TSEI procedure was formed, that met regularly and jointly developed the process map (PM), following TG-100 guidelines of the AAPM. This PM is a visual representation of the temporal flow of steps through the patient since start until the end of his stay in the radiotherapy service. Results: This is the first stage of the full risk analysis, which is being carried out in the center. The PM provides an overview of the process and facilitates the understanding of the team members who will participate in the subsequent analysis. Currently, the team is implementing the analysis of failure modes and effects (FMEA). The failure modes of each of the steps have been identified and assessors are assigning a value of severity (S), frequency of occurrence (O) and lack of detection (D) individually. To our knowledge, this is the first PM made for the TSEI. The developed PM can be useful for those centers that intend to implement the TSEI technique. Conclusion: The PM of TSEI technique has been established, as the first stage of full risk analysis, performed in a reference center in this treatment.« less

Serial post-surgical stimulated and unstimulated highly sensitive thyroglobulin measurements in low- and intermediate-risk papillary thyroid carcinoma patients not receiving radioactive iodine.

PubMed

Kashat, Lawrence; Orlov, Steven; Orlov, David; Assi, Jasmeet; Salari, Farnaz; Walfish, Paul G

2016-11-01

The purpose of this study was to determine the natural temporal trends of serial thyroglobulin (Tg) among low/intermediate-risk PTC patients not receiving radioactive iodine (RAI) using TSH-stimulated Tg (Stim-Tg) and unstimulated highly sensitive Tg (u-hsTg). We prospectively analyzed serial Stim-Tg measurements after total thyroidectomy ± therapeutic central neck dissection among 121 consecutive low/intermediate-risk PTC patients who did not receive RAI, of whom 104 also had serial u-hsTg measurements available. Median follow-up was 6.5 years with Stim-Tg measurements commencing 3 months after surgery and u-hsTg commencing 1.8 years after surgery (when the assay became available). TSH stimulation was performed with 9-day T3 withdrawal, 22-day T4 withdrawal, or using recombinant human TSH (rhTSH). To account for within-patient correlations of repeated Tg measurements, temporal trends in Stim-Tg and u-hsTg were assessed using Generalized Estimating Equations. Stim-Tg models were adjusted for the method of TSH stimulation, whereas the u-hsTg models were adjusted for concurrent TSH level. Linear regression modeling was used to assess the trend in serial Stim-Tg and u-hsTg measurements as a function time from time of surgery throughout the duration of follow-up. The main outcome measured was the change in u-hsTg and Stim-Tg measurements over time. A total of 337 Stim-Tg (2.8/patient) and 602 u-hsTg (5.8/patient) measurements were analyzed. Among the 337 Stim-Tg measurements, Stim-Tg was assessed using rhTSH in 202 (60 %), T4 withdrawal in 41 (12 %), and T3 withdrawal in 94 (28 %) measurements. The overall mean ± 1SD for Stim-Tg and u-hsTg measured was 1.0 ± 1.2 and 0.2 ± 0.1 μg/L, respectively. When adjusted for method of TSH stimulation, serial Stim-Tg measurements did not significantly change over time (all p = NS). The estimated changes in Stim-Tg per year for rhTSH, T4 withdrawal, and T3 withdrawal were 0.01, -0.08, and 0.04 μg/L, respectively. Upon exclusion of 73 patients with an initial undetectable Stim-Tg (n = 48), serial Stim-Tg measurements did not change significantly over time (all p = NS). For these patients, the estimated changes in Stim-Tg per year for rhTSH, T4 withdrawal, and T3 withdrawal were -0.09, -0.10, and 0.01 μg/L, respectively. Serial u-hsTg measurements did not significantly change over time after adjusting for TSH level (p = NS). The estimated change in u-hsTg per year was -0.003 μg/L. No patients had any clinical or imaging evidence of a recurrence during the duration of their follow-up. Among low/intermediate-risk PTC patients not treated with RAI, serial post-surgical Stim-Tg and u-hsTg measurements do not change significantly over a median follow-up of 6.5 years.

Infrared Spectroscopy as a Chemical Fingerprinting Tool

NASA Technical Reports Server (NTRS)

Huff, Timothy L.

2003-01-01

Infrared (IR) spectroscopy is a powerful analytical tool in the chemical fingerprinting of materials. Any sample material that will interact with infrared light produces a spectrum and, although normally associated with organic materials, inorganic compounds may also be infrared active. The technique is rapid, reproducible and usually non-invasive to the sample. That it is non-invasive allows for additional characterization of the original material using other analytical techniques including thermal analysis and RAMAN spectroscopic techniques. With the appropriate accessories, the technique can be used to examine samples in liquid, solid or gas phase. Both aqueous and non-aqueous free-flowing solutions can be analyzed, as can viscous liquids such as heavy oils and greases. Solid samples of varying sizes and shapes may also be examined and with the addition of microscopic IR (microspectroscopy) capabilities, minute materials such as single fibers and threads may be analyzed. With the addition of appropriate software, microspectroscopy can be used for automated discrete point or compositional surface area mapping, with the latter providing a means to record changes in the chemical composition of a material surface over a defined area. Due to the ability to characterize gaseous samples, IR spectroscopy can also be coupled with thermal processes such as thermogravimetric (TG) analyses to provide both thermal and chemical data in a single run. In this configuration, solids (or liquids) heated in a TG analyzer undergo decomposition, with the evolving gases directed into the IR spectrometer. Thus, information is provided on the thermal properties of a material and the order in which its chemical constituents are broken down during incremental heating. Specific examples of these varied applications will be cited, with data interpretation and method limitations further discussed.

The tumor necrosis factor receptor superfamily member 1B polymorphisms predict response to anti-TNF therapy in patients with autoimmune disease: A meta-analysis.

PubMed

Chen, Wenjuan; Xu, Hui; Wang, Xiuxiu; Gu, Junying; Xiong, Huizi; Shi, Yuling

2015-09-01

Numerous published data on the tumor necrosis factor receptor superfamily member 1B (TNFRSF1B) gene polymorphisms are shown to be associated with response or non-response to anti-TNF therapy in autoimmune diseases such as rheumatoid arthritis (RA), psoriasis and Crohn's Disease (CD). The aim of this study is to investigate whether the TNFRSF1B rs1061622 T/G or TNFRSF1A A/G rs767455 polymorphisms can predict the response to anti-TNF-based therapy in patients with autoimmune diseases. We conducted a meta-analysis of studies on the association between TNFRSF1B rs1061622 T/G polymorphism or TNFRSF1A A/G rs767455 polymorphism and non-responsiveness to anti-TNF therapy in autoimmune diseases. A total of 8 studies involving 929 subjects for TNFRSF1B rs1061622 and 564 subjects for TNFRSF1A rs767455 were finally considered. These studies consisted of seven studies on the TNFRSF1B polymorphism and four studies on the TNFRSF1A polymorphism. Meta-analysis showed significant association between the TNFRSF1B rs1061622 allele and non-responders to anti-TNF therapy [T/G odds ratio (OR) 0.72, 95% confidence interval (CI) 0.57-0.93, p=0.01]. Stratification by disease type indicated an association between the TNFRSF1B rs1061622 allele and non-responders to TNF antagonist in RA (T/G OR 0.69, 95% CI 0.48-0.99, p<0.05) and psoriasis (T/G OR 0.39, 95% CI 0.23-0.67, p<0.001), but not in CD (T/G OR 1.14, 95% CI 0.57-0.93, p=0.57). And there was no association between TNFRSF1A rs767455 genotype and non-responders to the anti-TNF therapy (A/G OR 0.93, 95% CI 0.70-1.23, p=0.59). This meta-analysis demonstrates that TNFRSF1B T allele carriers show a better response to anti-TNF therapy, and individuals carrying TNFRSF1A A allele have no relationship with the response to anti-TNF therapy for autoimmune diseases. The genotyping of this polymorphism could help to optimize the treatment by identifying patients with a likely poor response to biological drugs. Copyright © 2015 Elsevier B.V. All rights reserved.

Exploration of a new method in determining the glass transition temperature of BMGs by electrical resistivity

NASA Astrophysics Data System (ADS)

Guo, Jing; Zu, Fangqiu; Chen, Zhihao; Zheng, Shubin; Yuan, Yuan

2005-07-01

Based on a brief retrospect of the method in establishing Tg of the bulk metallic glasses (BMGs), some perplexities concerning this are pointed out. With the experimental results of Zr-Al-Ni-Cu-X (Nb,Ti) BMGs, a electrical resistivity method is proposed to determine the glass transition temperature of BMGs. With the method, we define two kinds of characteristic temperature related to the glass transition, Tg-dep and Tg-int, respectively. By comparing Tg-dep and Tg-int with Tg determined by the DSC method, we have found that, for the same alloy at the same heating rate, Tg-dep is very close to Tg-onset while Tg-int is approximate to Tg-mid. As a method to determine the glass transition temperature, the electrical resistivity method has proved to be more convenient and practical in comparison with the DSC method, especially when the DSC curve cannot show the glass transition character of BMGs. In addition, we would emphasize that when we refer to Tg, it is necessary to expatiate on the way of denoting the glass transition temperature, such as Tg-dep or Tg-int ( Tg-onset or Tg-mid), and on the heating rate, in order to avoid ambiguity.

Construction of 6-thioguanine and 6-mercaptopurine carriers based on βcyclodextrins and gold nanoparticles.

PubMed

Sierpe, R; Noyong, Michael; Simon, Ulrich; Aguayo, D; Huerta, J; Kogan, Marcelo J; Yutronic, N

2017-12-01

As a novel strategy to overcome some of the therapeutic disadvantages of 6-thioguanine (TG) and 6-mercaptopurine (MP), we propose the inclusion of these drugs in βcyclodextrin (βCD) to form the complexes βCD-TG and βCD-MP, followed by subsequent interaction with gold nanoparticles (AuNPs), generating the ternary systems: βCD-TG-AuNPs and βCD-MP-AuNPs. This modification increased their solubility and improved their stability, betting by a site-specific transport due to their nanometric dimensions, among other advantages. The formation of the complexes was confirmed using powder X-ray diffraction, thermogravimetric analysis and one and two-dimensional NMR. A theoretical study using DFT and molecular modelling was conducted to obtain the more stable tautomeric species of TG and MP in solution and confirm the proposed inclusion geometries. The deposition of AuNPs onto βCD-TG and βCD-MP via sputtering was confirmed by UV-vis spectroscopy. Subsequently, the ternary systems were characterized by TEM, FE-SEM and EDX to directly observe the deposited AuNPs and evaluate their sizes, size dispersion, and composition. Finally, the in vitro permeability of the ternary systems was studied using parallel artificial membrane permeability assay (PAMPA). Copyright © 2017 Elsevier Ltd. All rights reserved.

A molecular dynamics approach for predicting the glass transition temperature and plasticization effect in amorphous pharmaceuticals.

PubMed

Gupta, Jasmine; Nunes, Cletus; Jonnalagadda, Sriramakamal

2013-11-04

The objectives of this study were as follows: (i) To develop an in silico technique, based on molecular dynamics (MD) simulations, to predict glass transition temperatures (Tg) of amorphous pharmaceuticals. (ii) To computationally study the effect of plasticizer on Tg. (iii) To investigate the intermolecular interactions using radial distribution function (RDF). Amorphous sucrose and water were selected as the model compound and plasticizer, respectively. MD simulations were performed using COMPASS force field and isothermal-isobaric ensembles. The specific volumes of amorphous cells were computed in the temperature range of 440-265 K. The characteristic "kink" observed in volume-temperature curves, in conjunction with regression analysis, defined the Tg. The MD computed Tg values were 367 K, 352 K and 343 K for amorphous sucrose containing 0%, 3% and 5% w/w water, respectively. The MD technique thus effectively simulated the plasticization effect of water; and the corresponding Tg values were in reasonable agreement with theoretical models and literature reports. The RDF measurements revealed strong hydrogen bond interactions between sucrose hydroxyl oxygens and water oxygen. Steric effects led to weak interactions between sucrose acetal oxygens and water oxygen. MD is thus a powerful predictive tool for probing temperature and water effects on the stability of amorphous systems during drug development.

UAP56 is a conserved crucial component of a divergent mRNA export pathway in Toxoplasma gondii.

PubMed

Serpeloni, Mariana; Jiménez-Ruiz, Elena; Vidal, Newton Medeiros; Kroeber, Constanze; Andenmatten, Nicole; Lemgruber, Leandro; Mörking, Patricia; Pall, Gurman S; Meissner, Markus; Ávila, Andréa R

2016-11-01

Nucleo-cytoplasmic RNA export is an essential post-transcriptional step to control gene expression in eukaryotic cells and is poorly understood in apicomplexan parasites. With the exception of UAP56, a component of TREX (Transcription Export) complex, other components of mRNA export machinery are not well conserved in divergent supergroups. Here, we use Toxoplasma gondii as a model system to functionally characterize TgUAP56 and its potential interaction factors. We demonstrate that TgUAP56 is crucial for mRNA export and that functional interference leads to significant accumulation of mRNA in the nucleus. It was necessary to employ bioinformatics and phylogenetic analysis to identify orthologs related to mRNA export, which show a remarkable low level of conservation in T. gondii. We adapted a conditional Cas9/CRISPR system to carry out a genetic screen to verify if these factors were involved in mRNA export in T. gondii. Only the disruption of TgRRM_1330 caused accumulation of mRNA in the nucleus as found with TgUAP56. This protein is potentially a divergent partner of TgUAP56, and provides insight into a divergent mRNA export pathway in apicomplexans. © 2016 The Authors. Molecular Microbiology Published by John Wiley & Sons Ltd.

UAP56 is a conserved crucial component of a divergent mRNA export pathway in Toxoplasma gondii

PubMed Central

Serpeloni, Mariana; Jiménez‐Ruiz, Elena; Vidal, Newton Medeiros; Kroeber, Constanze; Andenmatten, Nicole; Lemgruber, Leandro; Mörking, Patricia; Pall, Gurman S.

2016-01-01

Summary Nucleo‐cytoplasmic RNA export is an essential post‐transcriptional step to control gene expression in eukaryotic cells and is poorly understood in apicomplexan parasites. With the exception of UAP56, a component of TREX (Transcription Export) complex, other components of mRNA export machinery are not well conserved in divergent supergroups. Here, we use Toxoplasma gondii as a model system to functionally characterize TgUAP56 and its potential interaction factors. We demonstrate that TgUAP56 is crucial for mRNA export and that functional interference leads to significant accumulation of mRNA in the nucleus. It was necessary to employ bioinformatics and phylogenetic analysis to identify orthologs related to mRNA export, which show a remarkable low level of conservation in T. gondii. We adapted a conditional Cas9/CRISPR system to carry out a genetic screen to verify if these factors were involved in mRNA export in T. gondii. Only the disruption of TgRRM_1330 caused accumulation of mRNA in the nucleus as found with TgUAP56. This protein is potentially a divergent partner of TgUAP56, and provides insight into a divergent mRNA export pathway in apicomplexans. PMID:27542978

On the Occurrence of Hypomyelination in a Transgenic Mouse Model: A Consequence of the Myelin Basic Protein Promoter?

PubMed Central

Gaupp, Stefanie; Arezzo, Joseph; Dutta, Dipankar J.; John, Gareth R.; Raine, Cedric S.

2013-01-01

Central nervous system hypomyelination is a feature common to a number of transgenic (Tg) mouse lines that express a variety of unrelated exogenous (i.e. non-CNS) transgenes. In this report we document hypomyelination structurally by immunocytochemistry and functionally in the Tg line MBP-JE, which overexpresses the chemokine CCL2 (MCP-1) within oligodendrocytes targeted by a myelin basic protein (MBP) promoter. Analysis of hypomyelinated optic nerves of Tg mice revealed progressive decrease in oligodendrocyte numbers with age (p < 0.01). Although molecular mechanisms underlying hypomyelination in this and other Tg models remain largely unknown, we present preliminary findings on oligodendrocyte progenitor cell (OPC) cultures in which, although OPC expressed CCR2, the receptor for CCL2, treatment with CCL2 had no significant effect on OPC proliferation, differentiation or apoptosis. We suggest that hypomyelination in the MBP-JE model might not be due to CCL2 expression but rather the result of transcriptional dysfunction related to random insertion of the MBP promoter that disrupts myelinogenesis and leads to oligodendrocytes demise. Because an MBP promoter is a common denominator in most Tg lines displaying hypomyelination, we hypothesize that use of myelin gene sequences in the regulator region of transgenic constructs might underlie this perturbation of myelination in such models. PMID:22082665

Perlecan, a heparan sulfate proteoglycan, regulates systemic metabolism with dynamic changes in adipose tissue and skeletal muscle.

PubMed

Yamashita, Yuri; Nakada, Satoshi; Yoshihara, Toshinori; Nara, Takeshi; Furuya, Norihiko; Miida, Takashi; Hattori, Nobutaka; Arikawa-Hirasawa, Eri

2018-05-17

Perlecan (HSPG2), a heparan sulfate proteoglycan, is a component of basement membranes and participates in a variety of biological activities. Here, we show physiological roles of perlecan in both obesity and the onset of metabolic syndrome. The perinatal lethality-rescued perlecan knockout (Hspg2 -/- -Tg) mice showed a smaller mass and cell size of white adipose tissues than control (WT-Tg) mice. Abnormal lipid deposition, such as fatty liver, was not detected in the Hspg2 -/- -Tg mice, and those mice also consumed more fat as an energy source, likely due to their activated fatty acid oxidation. In addition, the Hspg2 -/- -Tg mice demonstrated increased insulin sensitivity. Molecular analysis revealed the significantly relatively increased amount of the muscle fiber type IIA (X) isoform and a larger quantity of mitochondria in the skeletal muscle of Hspg2 -/- -Tg mice. Furthermore, the perlecan-deficient skeletal muscle also had elevated levels of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1α) protein. PGC1α expression is activated by exercise, and induces mitochondrial biosynthesis. Thus, perlecan may act as a mechano-regulator of catabolism of both lipids and glucose by shifting the muscle fiber composition to oxidative fibers. Our data suggest that downregulation of perlecan is a promising strategy to control metabolic syndrome.

Molecular Regulation of Temperature-Dependent Floral Induction in Tulipa gesneriana.

PubMed

Leeggangers, Hendrika A C F; Nijveen, Harm; Bigas, Judit Nadal; Hilhorst, Henk W M; Immink, Richard G H

2017-03-01

The vegetative-to-reproductive phase change in tulip ( Tulipa gesneriana ) is promoted by increasing temperatures during spring. The warm winters of recent years interfere with this process and are calling for new adapted cultivars. A better understanding of the underlying molecular mechanisms would be of help, but unlike the model plant Arabidopsis ( Arabidopsis thaliana ), very little is known about floral induction in tulip. To shed light on the gene regulatory network controlling flowering in tulip, RNA sequencing was performed on meristem-enriched tissue collected under two contrasting temperature conditions, low and high. The start of reproductive development correlated with rounding of the shoot apical meristem and induction of TGSQA expression, a tulip gene with a high similarity to Arabidopsis APETALA1 Gene Ontology enrichment analysis of differentially expressed genes showed the overrepresentation of genes potentially involved in floral induction, bulb maturation, and dormancy establishment. Expression analysis revealed that TERMINAL FLOWER1 ( TgTFL1 ) and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1-like1 ( TgSOC1-like1 ) might be repressors, whereas TgSOC1-like2 likely is an activator, of flowering. Subsequently, the flowering time-associated expression of eight potential flowering time genes was confirmed in three tulip cultivars grown in the field. Additionally, heterologous functional analyses in Arabidopsis resulted in flowering time phenotypes in line with TgTFL1 being a floral repressor and TgSOC1-like2 being a floral activator in tulip. Taken together, we have shown that long before morphological changes occur in the shoot apical meristem, the expression of floral repressors in tulip is suppressed by increased ambient temperatures, leading either directly or indirectly to the activation of potential flowering activators shortly before the commencement of the phase change. © 2017 American Society of Plant Biologists. All Rights Reserved.

Atmospheric nitrogen deposition to China: a model analysis on nitrogen budget and critical load exceedance

NASA Astrophysics Data System (ADS)

Zhao, Y.; Zhang, L.; Chen, Y.; Liu, X.; Xu, W.; Pan, Y.; Duan, L.

2016-12-01

We present a national-scale model analysis of the sources and processes of inorganic nitrogen deposition over China using the GEOS-Chem model at 1/2°×1/3° horizontal resolution. Averaged model results for 2008-2012 are evaluated with an ensemble of surface measurements of nitrogen wet deposition flux and concentration, and satellite measurements of tropospheric NO2 columns. Annual inorganic nitrogen deposition fluxes are shown to be generally less than 10 kg N ha-1 a-1 in the western China, 15-50 kg N ha-1 a-1 in the eastern China, and 15.6 kg N ha-1 a-1 averaged over China. The model simulates an annual total deposition flux of 16.4 Tg N to China, with 10.3 Tg N (63%) from reduced nitrogen (NHx) and 6.2 Tg N from oxidized nitrogen (NOy). Domestic anthropogenic sources contribute 86% of the total deposition; foreign anthropogenic sources 7% and natural sources 7%. Annually 23% of domestically emitted NH3 and 36% for NOx are exported out of China. We also find while nitrogen deposition to China is comparable to the nitrogen input from fertilizer application (16.5 Tg N a-1) on the national scale, it is much more widely distributed spatially. The deposition flux is also much higher than natural biological fixation (7.3 Tg N a-1). A comparison with estimates of nitrogen critical load for eutrophication indicates that about 40% of the land over China faces nitrogen critical load exceedances. However, 45% of the exceeding areas, mainly in Beijing-Tianjin-Hebei, Central China, East China, and South China, will not occur in the absence of nitrogen deposition, demonstrating the necessity of nitrogen emission controls to avoid potential negative ecological effects over these areas.

Phage display selection of efficient glutamine-donor substrate peptides for transglutaminase 2

PubMed Central

Keresztessy, Zsolt; Csősz, Éva; Hársfalvi, Jolán; Csomós, Krisztián; Gray, Joe; Lightowlers, Robert N.; Lakey, Jeremy H.; Balajthy, Zoltán; Fésüs, László

2006-01-01

Understanding substrate specificity and identification of natural targets of transglutaminase 2 (TG2), the ubiquitous multifunctional cross-linking enzyme, which forms isopeptide bonds between protein-linked glutamine and lysine residues, is crucial in the elucidation of its physiological role. As a novel means of specificity analysis, we adapted the phage display technique to select glutamine-donor substrates from a random heptapeptide library via binding to recombinant TG2 and elution with a synthetic amine-donor substrate. Twenty-six Gln-containing sequences from the second and third biopanning rounds were susceptible for TG2-mediated incorporation of 5-(biotinamido)penthylamine, and the peptides GQQQTPY, GLQQASV, and WQTPMNS were modified most efficiently. A consensus around glutamines was established as pQX(P,T,S)l, which is consistent with identified substrates listed in the TRANSDAB database. Database searches showed that several proteins contain peptides similar to the phage-selected sequences, and the N-terminal glutamine-rich domain of SWI1/SNF1-related chromatin remodeling proteins was chosen for detailed analysis. MALDI/TOF and tandem mass spectrometry-based studies of a representative part of the domain, SGYGQQGQTPYYNQQSPHPQQQQPPYS (SnQ1), revealed that Q6, Q8, and Q22 are modified by TG2. Kinetic parameters of SnQ1 transamidation (KMapp = 250 μM, kcat = 18.3 sec−1, and kcat/KMapp = 73,200) classify it as an efficient TG2 substrate. Circular dichroism spectra indicated that SnQ1 has a random coil conformation, supporting its accessibility in the full-length parental protein. Added together, here we report a novel use of the phage display technology with great potential in transglutaminase research. PMID:17075129

Phage display selection of efficient glutamine-donor substrate peptides for transglutaminase 2.

PubMed

Keresztessy, Zsolt; Csosz, Eva; Hársfalvi, Jolán; Csomós, Krisztián; Gray, Joe; Lightowlers, Robert N; Lakey, Jeremy H; Balajthy, Zoltán; Fésüs, László

2006-11-01

Understanding substrate specificity and identification of natural targets of transglutaminase 2 (TG2), the ubiquitous multifunctional cross-linking enzyme, which forms isopeptide bonds between protein-linked glutamine and lysine residues, is crucial in the elucidation of its physiological role. As a novel means of specificity analysis, we adapted the phage display technique to select glutamine-donor substrates from a random heptapeptide library via binding to recombinant TG2 and elution with a synthetic amine-donor substrate. Twenty-six Gln-containing sequences from the second and third biopanning rounds were susceptible for TG2-mediated incorporation of 5-(biotinamido)penthylamine, and the peptides GQQQTPY, GLQQASV, and WQTPMNS were modified most efficiently. A consensus around glutamines was established as pQX(P,T,S)l, which is consistent with identified substrates listed in the TRANSDAB database. Database searches showed that several proteins contain peptides similar to the phage-selected sequences, and the N-terminal glutamine-rich domain of SWI1/SNF1-related chromatin remodeling proteins was chosen for detailed analysis. MALDI/TOF and tandem mass spectrometry-based studies of a representative part of the domain, SGYGQQGQTPYYNQQSPHPQQQQPPYS (SnQ1), revealed that Q(6), Q(8), and Q(22) are modified by TG2. Kinetic parameters of SnQ1 transamidation (K(M)(app) = 250 microM, k(cat) = 18.3 sec(-1), and k(cat)/K(M)(app) = 73,200) classify it as an efficient TG2 substrate. Circular dichroism spectra indicated that SnQ1 has a random coil conformation, supporting its accessibility in the full-length parental protein. Added together, here we report a novel use of the phage display technology with great potential in transglutaminase research.

Joint linkage and association analysis with exome sequence data implicates SLC25A40 in hypertriglyceridemia.

PubMed

Rosenthal, Elisabeth A; Ranchalis, Jane; Crosslin, David R; Burt, Amber; Brunzell, John D; Motulsky, Arno G; Nickerson, Deborah A; Wijsman, Ellen M; Jarvik, Gail P

2013-12-05

Hypertriglyceridemia (HTG) is a heritable risk factor for cardiovascular disease. Investigating the genetics of HTG may identify new drug targets. There are ~35 known single-nucleotide variants (SNVs) that explain only ~10% of variation in triglyceride (TG) level. Because of the genetic heterogeneity of HTG, a family study design is optimal for identification of rare genetic variants with large effect size because the same mutation can be observed in many relatives and cosegregation with TG can be tested. We considered HTG in a five-generation family of European American descent (n = 121), ascertained for familial combined hyperlipidemia. By using Bayesian Markov chain Monte Carlo joint oligogenic linkage and association analysis, we detected linkage to chromosomes 7 and 17. Whole-exome sequence data revealed shared, highly conserved, private missense SNVs in both SLC25A40 on chr7 and PLD2 on chr17. Jointly, these SNVs explained 49% of the genetic variance in TG; however, only the SLC25A40 SNV was significantly associated with TG (p = 0.0001). This SNV, c.374A>G, causes a highly disruptive p.Tyr125Cys substitution just outside the second helical transmembrane region of the SLC25A40 inner mitochondrial membrane transport protein. Whole-gene testing in subjects from the Exome Sequencing Project confirmed the association between TG and SLC25A40 rare, highly conserved, coding variants (p = 0.03). These results suggest a previously undescribed pathway for HTG and illustrate the power of large pedigrees in the search for rare, causal variants. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

A Homozygous Missense Mutation in TGM5 Abolishes Epidermal Transglutaminase 5 Activity and Causes Acral Peeling Skin Syndrome

PubMed Central

Cassidy, Andrew J.; van Steensel, Maurice A. M.; Steijlen, Peter M.; van Geel, Michel; Velden, Jaap van der; Morley, Susan M.; Terrinoni, Alessandro; Melino, Gerry; Candi, Eleonora; McLean, W. H. Irwin

2005-01-01

Peeling skin syndrome is an autosomal recessive genodermatosis characterized by the shedding of the outer epidermis. In the acral form, the dorsa of the hands and feet are predominantly affected. Ultrastructural analysis has revealed tissue separation at the junction between the granular cells and the stratum corneum in the outer epidermis. Genomewide linkage analysis in a consanguineous Dutch kindred mapped the gene to 15q15.2 in the interval between markers D15S1040 and D15S1016. Two homozygous missense mutations, T109M and G113C, were found in TGM5, which encodes transglutaminase 5 (TG5), in all affected persons in two unrelated families. The mutation was present on the same haplotype in both kindreds, indicating a probable ancestral mutation. TG5 is strongly expressed in the epidermal granular cells, where it cross-links a variety of structural proteins in the terminal differentiation of the epidermis to form the cornified cell envelope. An established, in vitro, biochemical cross-linking assay revealed that, although T109M is not pathogenic, G113C completely abolishes TG5 activity. Three-dimensional modeling of TG5 showed that G113C lies close to the catalytic domain, and, furthermore, that this glycine residue is conserved in all known transglutaminases, which is consistent with pathogenicity. Other families with more-widespread peeling skin phenotypes lacked TGM5 mutations. This study identifies the first causative gene in this heterogeneous group of skin disorders and demonstrates that the protein cross-linking function performed by TG5 is vital for maintaining cell-cell adhesion between the outermost layers of the epidermis. PMID:16380904

Molecular Regulation of Temperature-Dependent Floral Induction in Tulipa gesneriana1

PubMed Central

Leeggangers, Hendrika A.C.F.; Bigas, Judit Nadal

2017-01-01

The vegetative-to-reproductive phase change in tulip (Tulipa gesneriana) is promoted by increasing temperatures during spring. The warm winters of recent years interfere with this process and are calling for new adapted cultivars. A better understanding of the underlying molecular mechanisms would be of help, but unlike the model plant Arabidopsis (Arabidopsis thaliana), very little is known about floral induction in tulip. To shed light on the gene regulatory network controlling flowering in tulip, RNA sequencing was performed on meristem-enriched tissue collected under two contrasting temperature conditions, low and high. The start of reproductive development correlated with rounding of the shoot apical meristem and induction of TGSQA expression, a tulip gene with a high similarity to Arabidopsis APETALA1. Gene Ontology enrichment analysis of differentially expressed genes showed the overrepresentation of genes potentially involved in floral induction, bulb maturation, and dormancy establishment. Expression analysis revealed that TERMINAL FLOWER1 (TgTFL1) and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1-like1 (TgSOC1-like1) might be repressors, whereas TgSOC1-like2 likely is an activator, of flowering. Subsequently, the flowering time-associated expression of eight potential flowering time genes was confirmed in three tulip cultivars grown in the field. Additionally, heterologous functional analyses in Arabidopsis resulted in flowering time phenotypes in line with TgTFL1 being a floral repressor and TgSOC1-like2 being a floral activator in tulip. Taken together, we have shown that long before morphological changes occur in the shoot apical meristem, the expression of floral repressors in tulip is suppressed by increased ambient temperatures, leading either directly or indirectly to the activation of potential flowering activators shortly before the commencement of the phase change. PMID:28104719

Berberine improves cognitive impairment by promoting autophagic clearance and inhibiting production of β-amyloid in APP/tau/PS1 mouse model of Alzheimer's disease.

PubMed

Huang, Min; Jiang, Xin; Liang, Yubin; Liu, Qiong; Chen, Siyan; Guo, Yi

2017-05-01

This study investigates the neuroprotective properties of berberine (a natural isoquinoline alkaloid isolated from the Rhizoma coptidis) and finds that berberine could promote β-amyloid (Aβ) clearance and inhibit Aβ production in the triple-transgenic mouse model of Alzheimer's disease (3×Tg-AD). During the study, berberine was first administrated to treat 3×Tg-AD mice and primary neurons. Morris water maze assay, western blotting, enzyme-linked immunosorbent assay (ELISA), immunofluorescence staining and histological analysis, transmission electron microscopic analysis were then used to evaluate the effects of the berberine administration. The result showed that berberine significantly improved 3×Tg-AD mice's spatial learning capacity and memory retention, promoted autophagy activity identified by the enhancement of brain LC3-II, beclin-1, hVps34, and Cathepsin-D levels as well as the reduction of brain P62 and Bcl-2 levels in AD mice, facilitated reduction of Aβ and APP levels, reduced Aβ plaque deposition in the hippocampus of AD mice, and inhibited b-site APP cleavage enzyme 1 (BACE1) expression. Similar results were also found in 3×Tg-AD primary hippocampal neurons: berbernine treatment decreased the levels of extracellular and intracellular Aβ1-42, increased the protein levels of LC3-II, beclin-1, hVps34, and Cathepsin-D, and decreased the levels of P62, Bcl-2, APP and BACE1 levels. In summary, berberine shows neuroprotective effects on 3×Tg-AD mice and may be a promising multitarget drug in the preventionand protection against AD. Copyright © 2017. Published by Elsevier Inc.

Elucidation of reaction mechanism involved in the formation of LaNiO3 from XRD and TG analysis

NASA Astrophysics Data System (ADS)

Dharmadhikari, Dipti V.; Athawale, Anjali A.

2013-06-01

The present work is focused on the synthesis and elucidation of reaction mechanism involved in the formation of LaNiO3 with the help of X-ray diffraction (XRD) and thermogravimetric (TG) analysis. LaNiO3 was synthesized by hydrothermal method by heating at 160°C under autogenous pressure for 6h. Pure phase product was obtained after calcining the hydrothermally activated product for 6h at 700°C. The various phases of the product obtained after hydrothermal treatment and calcination followed by the formation of pure phase nanocrystalline lanthanum nickel oxide could be determined from XRD analysis of the samples. The reaction mechanism and phase formation temperature has been interpreted by thermogravimetric analysis of the hydrothermally synthesized product and XRD analysis.

Role of an estradiol regulatory factor-hydroxysteroid dehydrogenase (HSD) in Toxoplasma gondii infection and pathogenicity.

PubMed

Zhang, Xiao; Liu, Jing; Li, Muzi; Fu, Yong; Zhang, Taotao; Han, Qian; Liu, Qun

2017-11-01

Toxoplasma gondii is an apicomplexan parasite that infects most species of warm-blooded animals, including humans, and causes abortions and severe damage to the fetal central nervous system. During pregnancy, the prevalence of toxoplasmosis increases throughout the second and third quarter of gestation, while the hormones progesterone and estradiol simultaneously increase. Thus, it has been suggested that these hormones could affect parasite reproduction. This study was mainly focused on an estradiol regulatory factor-Hydroxysteroid dehydrogenase (HSD) gene in T. gondii. Our data showed that estradiol promoted Pru (Type II) and VEG (Type III) infection and thus significantly contributed to the pathogenicity of T. gondii in mice. Subsequently, we found that this phenomenon may relate to the interplay of T. gondii and estradiol. We reported that estradiol can enter T. gondii tachyzoites. Bioinformatics analysis showed that T. gondii may have a residual estradiol metabolism-related gene HSD. To verify the gene function, HEK293T cells were transiently transfected with Tg-HSD and gene expression was induced. Then, HPLC (high-performance liquid chromatography) analysis showed that Tg-HSD can efficiently transform estrone into estradiol. Moreover, Tg-HSD -overexpressing parasites showed significantly enhanced pathogenicity and upregulation of estradiol levels in mice. In conclusion, estradiol can promote T. gondii infection in vitro and in vivo, and this may be related to its Tg- HSD gene. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dielectric relaxation spectrum of undiluted poly(4-chlorostyrene), T≳Tg

NASA Astrophysics Data System (ADS)

Yoshihara, M.; Work, R. N.

1980-06-01

Dielectric relaxation characteristics of undiluted, atactic poly(4-chlorostyrene), P4CS, have been determined at temperatures 406 K⩽T⩽446 K from measurements made at frequencies 0.2 Hz⩽f⩽0.2 MHz. After effects of electrical conductivity are subtracted, it is found that the normalized complex dielectric constant K*=K'-i K″ can be represented quantitatively by the Havriliak-Negami (H-N) equation K*=[1+(iωτ0)1-α]-β, 0⩽α, β⩽1, except for a small, high frequency tail that appears in measurements made near the glass transition temperature, Tg. The parameter β is nearly constant, and α depends linearly on log τ0, where τ0 is a characteristic relaxation time. The parameters α and β extrapolate through values obtained from published data from P4CS solutions, and extrapolation to α=0 yields a value of τ0 which compares favorably with a published value for crankshaft motions of an equivalent isolated chain segment. These observations suggest that β may characterize effects of chain connectivity and α may describe effects of interactions of the surroundings with the chain. Experimental results are compared with alternative empirical and model-based representations of dielectric relaxation in polymers.

Sex Differences in Autism-Like Behavioral Phenotypes and Postsynaptic Receptors Expression in the Prefrontal Cortex of TERT Transgenic Mice.

PubMed

Kim, Ki Chan; Cho, Kyu Suk; Yang, Sung Min; Gonzales, Edson Luck; Valencia, Schley; Eun, Pyeong Hwa; Choi, Chang Soon; Mabunga, Darine Froy; Kim, Ji-Woon; Noh, Judy Kyoungju; Kim, Hee Jin; Jeon, Se Jin; Han, Seol-Heui; Bahn, Geon Ho; Shin, Chan Young

2017-07-01

Autism spectrum disorder (ASD) remains unexplained and untreated despite the high attention of research in recent years. Aside from its various characteristics is the baffling male preponderance over the female population. Using a validated animal model of ASD which is the telomerase reverse transcriptase overexpressing mice (TERT-tg), we conducted ASD-related behavioral assessments and protein expression experiments to mark the difference between male and females of this animal model. After statistically analyzing the results, we found significant effects of TERT overexpression in sociability, social novelty preference, anxiety, nest building, and electroseizure threshold in the males but not their female littermates. Along these differences are the male-specific increased expressions of postsynaptic proteins which are the NMDA and AMPA receptors in the prefrontal cortex. The vGluT1 presynaptic proteins, but not GAD, were upregulated in both sexes of TERT-tg mice, although it is more significantly pronounced in the male group. Here, we confirmed that the behavioral effect of TERT overexpression in mice was male-specific, suggesting that the aberration of this gene and its downstream pathways preferentially affect the functional development of the male brain, consistent with the male preponderance in ASD.

High-Resolution Mapping of Biomass Burning Emissions in Three Tropical Regions.

PubMed

Shi, Yusheng; Matsunaga, Tsuneo; Yamaguchi, Yasushi

2015-09-15

Biomass burning in tropical regions plays a significant role in atmospheric pollution and climate change. This study quantified a comprehensive monthly biomass burning emissions inventory with 1 km high spatial resolution, which included the burning of vegetation, human waste, and fuelwood for 2010 in three tropical regions. The estimations were based on the available burned area product MCD64A1 and statistical data. The total emissions of all gases and aerosols were 17382 Tg of CO2, 719 Tg of CO, 30 Tg of CH4, 29 Tg of NOx, 114 Tg of NMOC (nonmethane organic compounds), 7 Tg of SO2, 10 Tg of NH3, 79 Tg of PM2.5 (particulate matter), 45 Tg of OC (organic carbon), and 6 Tg of BC (black carbon). Taking CO as an example, vegetation burning accounted for 74% (530 Tg) of the total CO emissions, followed by fuelwood combustion and human waste burning. Africa was the biggest emitter (440 Tg), larger than Central and South America (113 Tg) and South and Southeast Asia (166 Tg). We also noticed that the dominant fire types in vegetation burning of these three regions were woody savanna/shrubland, savanna/grassland, and forest, respectively. Although there were some slight overestimations, our results are supported by comparisons with previously published data.

Reanalysis of the fragility of glycerol at very high pressures using new Tg data

NASA Astrophysics Data System (ADS)

Lyon, Kevin; Oliver, William

Direct measurements of the glass transition temperature of glycerol between 1 atm and 6.7 GPa from our lab allow reanalysis of high-pressure viscosity data, which were limited to approximately 107 poise. Previous attempts to determine Tg (P) and fragility by extrapolation of the viscosity data by many orders of magnitude led to inconclusive results. Tg (P) data constrain the value of viscosity at the glass transition providing for more accurate determinations of isobaric fragilities. Over most of the pressure range, a constant fragility is found in agreement with analysis of high-pressure dielectric data by Paluch et al.. Discrepancies in the pressure dependence of the fragility of glycerol at very low pressures exist in the literature and will also be discussed.

Error Analysis of non-TLD HDR Brachytherapy Dosimetric Techniques

NASA Astrophysics Data System (ADS)

Amoush, Ahmad

The American Association of Physicists in Medicine Task Group Report43 (AAPM-TG43) and its updated version TG-43U1 rely on the LiF TLD detector to determine the experimental absolute dose rate for brachytherapy. The recommended uncertainty estimates associated with TLD experimental dosimetry include 5% for statistical errors (Type A) and 7% for systematic errors (Type B). TG-43U1 protocol does not include recommendation for other experimental dosimetric techniques to calculate the absolute dose for brachytherapy. This research used two independent experimental methods and Monte Carlo simulations to investigate and analyze uncertainties and errors associated with absolute dosimetry of HDR brachytherapy for a Tandem applicator. An A16 MicroChamber* and one dose MOSFET detectors† were selected to meet the TG-43U1 recommendations for experimental dosimetry. Statistical and systematic uncertainty analyses associated with each experimental technique were analyzed quantitatively using MCNPX 2.6‡ to evaluate source positional error, Tandem positional error, the source spectrum, phantom size effect, reproducibility, temperature and pressure effects, volume averaging, stem and wall effects, and Tandem effect. Absolute dose calculations for clinical use are based on Treatment Planning System (TPS) with no corrections for the above uncertainties. Absolute dose and uncertainties along the transverse plane were predicted for the A16 microchamber. The generated overall uncertainties are 22%, 17%, 15%, 15%, 16%, 17%, and 19% at 1cm, 2cm, 3cm, 4cm, and 5cm, respectively. Predicting the dose beyond 5cm is complicated due to low signal-to-noise ratio, cable effect, and stem effect for the A16 microchamber. Since dose beyond 5cm adds no clinical information, it has been ignored in this study. The absolute dose was predicted for the MOSFET detector from 1cm to 7cm along the transverse plane. The generated overall uncertainties are 23%, 11%, 8%, 7%, 7%, 9%, and 8% at 1cm, 2cm, 3cm, and 4cm, 5cm, 6cm, and 7cm, respectively. The Nucletron Freiburg flap applicator is used with the Nucletron remote afterloader HDR machine to deliver dose to surface cancers. Dosimetric data for the Nucletron 192Ir source were generated using Monte Carlo simulation and compared with the published data. Two dimensional dosimetric data were calculated at two source positions; at the center of the sphere of the applicator and between two adjacent spheres. Unlike the TPS dose algorithm, The Monte Carlo code developed for this research accounts for the applicator material, secondary electrons and delta particles, and the air gap between the skin and the applicator. *Standard Imaging, Inc., Middleton, Wisconsin USA † OneDose MOSFET, Sicel Technologies, Morrisville NC ‡ Los Alamos National Laboratory, NM USA

Molecular diversity of tuliposide B-converting enzyme in tulip (Tulipa gesneriana): identification of the third isozyme with a distinct expression profile.

PubMed

Nomura, Taiji; Kuchida, Ryo; Kitaoka, Naoki; Kato, Yasuo

2018-02-23

6-Tuliposide B (PosB), a major secondary metabolite that accumulates in tulip (Tulipa gesneriana), is converted to the antibacterial lactone, tulipalin B (PaB), by PosB-converting enzyme (TCEB). TgTCEB1 and TgTCEB-R, which encode TCEB, are specifically expressed in tulip pollen and roots, respectively, but are hardly expressed in other tissues (e.g. leaves) despite the presence of substantial PosB-converting activity, suggesting the existence of another TCEB isozyme. Here, we describe the identification of TgTCEB-L ("L" for leaf), a paralog of TgTCEB1 and TgTCEB-R, from leaves via native enzyme purification. The enzymatic characters of TgTCEB-L, including catalytic activity and subcellular localization, were substantially the same as those of TgTCEB1 and TgTCEB-R. However, TgTCEB-L did not exhibit tissue-specific expression. Identification of TgTCEB-L explains the PosB-converting activity detected in tissues where TgTCEB1 and TgTCEB-R transcripts could not be detected, indicating that tulip subtilizes the three TgTCEB isozymes depending on the tissue.

Confidence limit variation for a single IMRT system following the TG119 protocol.

PubMed

Gordon, J D; Krafft, S P; Jang, S; Smith-Raymond, L; Stevie, M Y; Hamilton, R J

2011-03-01

To evaluate the robustness of TG119-based quality assurance metrics for an IMRT system. Four planners constructed treatment plans for the five IMRT test cases described in TG119. All plans were delivered to a 30 cm x 30 cm x 15 cm solid water phantom in one treatment session in order to minimize session-dependent variation from phantom setup, film quality, machine performance, etc. Composite measurements utilized film and an ionization chamber. Per-field measurements were collected using a diode array device at an effective depth of 5 cm. All data collected were analyzed using the TG119 specifications to determine the confidence limit values for each planner separately and then compared. The mean variance of ion chamber measurements for each planner was within 1.7% of the planned dose. The resulting confidence limits were 3.13%, 1.98%, 3.65%, and 4.39%. Confidence limit values determined by composite film analysis were 8.06%, 13.4%, 9.30%, and 16.5%. Confidence limits from per-field measurements were 1.55%, 0.00%, 0.00%, and 2.89%. For a single IMRT system, the accuracy assessment provided by TG119-based quality assurance metrics showed significant variations in the confidence limits between planners across all composite and per-field evaluations. This observed variation is likely due to the different levels of modulation between each planner's set of plans. Performing the TG119 evaluation using plans produced by a single planner may not provide an adequate estimation of IMRT system accuracy.

Analyzing Cold Tolerance Mechanism in Transgenic Zebrafish (Danio rerio)

PubMed Central

Wang, Qian; Tan, Xungang; Jiao, Shuang; You, Feng; Zhang, Pei-Jun

2014-01-01

Low temperatures may cause severe growth inhibition and mortality in fish. In order to understand the mechanism of cold tolerance, a transgenic zebrafish Tg (smyd1:m3ck) model was established to study the effect of energy homeostasis during cold stress. The muscle-specific promoter Smyd1 was used to express the carp muscle form III of creatine kinase (M3-CK), which maintained enzymatic activity at a relatively low temperature, in zebrafish skeletal muscle. In situ hybridization showed that M3-CK was expressed strongly in the skeletal muscle. When exposed to 13°C, Tg (smyd1:m3ck) fish maintained their swimming behavior, while the wild-type could not. Energy measurements showed that the concentration of ATP increased in Tg (smyd1:m3ck) versus wild-type fish at 28°C. After 2 h at 13°C, ATP concentrations were 2.16-fold higher in Tg (smyd1:m3ck) than in wild-type (P<0.05). At 13°C, the ATP concentration in Tg (smyd1:m3ck) fish and wild-type fish was 63.3% and 20.0%, respectively, of that in wild-type fish at 28°C. Microarray analysis revealed differential expression of 1249 transcripts in Tg (smyd1:m3ck) versus wild-type fish under cold stress. Biological processes that were significantly overrepresented in this group included circadian rhythm, energy metabolism, lipid transport, and metabolism. These results are clues to understanding the mechanisms underlying temperature acclimation in fish. PMID:25058652

The OECD expert meeting on ecotoxicology and environmental fate--towards the development of improved OECD guidelines for the testing of nanomaterials.

PubMed

Kühnel, Dana; Nickel, Carmen

2014-02-15

On behalf of the OECD Working Party on Manufactured Nanomaterials (WPMN) an expert meeting on ecotoxicology and environmental fate of nanomaterials (NMs) took place in January 2013 in Berlin. At this meeting experts from science, industry and regulatory bodies discussed the applicability of OECD test guidelines (TGs) for chemicals to nanomaterials. The objective was to discuss the current state of the relevant science and provide recommendations to the OECD WPMN on (1) the need for updating current OECD TGs and the need for developing new ones specific to nanomaterials; and (2) guidance needed for the appropriate and valid testing of environmental fate and ecotoxicity endpoints for NMs. Experts at the workshop agreed that the majority of the OECD TG for chemicals were generally applicable for the testing of NM, with the exception of TG 105 (water solubility) and 106 (adsorption-desorption). Additionally, the workshop also highlighted considerations when conducting OECD chemical TG on nanomaterials (e.g., sample preparation, dispersion, analysis, dosimetry and characterisation). These considerations will lead to the future development of proposals for new TG and guidance documents (GDs) to ensure that OECD TG give meaningful, repeatable, and accurate results when used for nanomaterials. This report provides a short overview of topics discussed during the meeting and the main outcomes. A more detailed report of the workshop will become available through the OECD, however, due to the urgency of having OECD TG relevant for nanomaterials, this brief report is being shared with the scientific community through this communication. Copyright © 2013. Published by Elsevier B.V.

Dust Transport and Deposition Observed from the Terra-Moderate Image Spectrometer (MODIS) Space Observations

NASA Technical Reports Server (NTRS)

Kaufman, Y.

2004-01-01

Meteorological observations, in situ data and satellite images of dust episodes were used already in the 1970s to estimate that 100 tg of dust are transported from Africa over the Atlantic Ocean every year between June and August and deposited in the Atlantic Ocean and the Americas. Desert dust is a main source of nutrients to oceanic biota and the Amazon forest, but deteriorates air quality and caries pathogens as shown for Florida. Dust affects the Earth radiation budget, thus participating in climate change and feedback mechanisms. There is an urgent need for new tools for quantitative evaluation of the dust distribution, transport and deposition. The Terra spacecraft launched at the dawn of the last millennium provides first systematic well calibrated multispectral measurements from the MODIS instrument, for daily global analysis of aerosol. MODIS data are used here to distinguish dust from smoke and maritime aerosols and evaluate the African dust column concentration, transport and deposition. We found that 230 plus or minus 80 tg of dust are transported annually from Africa to the Atlantic Ocean, 30 tg return to Africa and Europe, 70 tg reach the Caribbean, 45 tg fertilize the Amazon Basin, 4 times as previous estimates thus explaining a paradox regarding the source of nutrition to the Amazon forest, and 120 plus or minus 40 tg are deposited in the Atlantic Ocean. The results are compared favorably with dust transport models for particle radius less than or equal to 12 microns. This study is a first example of quantitative use of MODIS aerosol for a geophysical study.

Dust Transport and Deposition Observed from the Terra-MODIS Space Observations

NASA Technical Reports Server (NTRS)

Kaufman, Y. J.; Koren, I.; Remer, L. A.; Tanre, D.; Fan, Ginoux; Fan, S.

2004-01-01

Meteorological observations, in situ data and satellite images of dust episodes were used already in the 1970s to estimate that 100 tg of dust are transported from Africa over the Atlantic Ocean every year between June and August and deposited in the Atlantic Ocean and the Americas. Desert dust is a main source of nutrients to oceanic biota and the Amazon forest, but deteriorates air quality and caries pathogens as shown for Florida. Dust affects the Earth radiation budget, thus participating in climate change and feedback mechanisms. There is an urgent need for new tools for quantitative evaluation of the dust distribution, transport and deposition. The Terra spacecraft launched at the dawn of the last millennium provides first systematic well calibrated multispectral measurements from the MODIS instrument, for daily global analysis of aerosol. MODIS data are used here to distinguish dust from smoke and maritime aerosols and evaluate the African dust column concentration, transport and deposition. We found that 230+/-80 tg of dust are transported annually from Africa to the Atlantic Ocean, 30 tg return to Africa and Europe, 70 tg reach the Caribbean, 45 tg fertilize the Amazon Basin, 4 times as previous estimates thus explaining a paradox regarding the source of nutrition to the Amazon forest, and 120+/-40 tg are deposited in the Atlantic Ocean. The results are compared favorably with dust transport models for particle radius less than or equal to 12 microns. This study is a first example of quantitative use of MODIS aerosol for a geophysical study.

The parasite Toxoplasma sequesters diverse Rab host vesicles within an intravacuolar network

PubMed Central

2017-01-01

Many intracellular pathogens subvert host membrane trafficking pathways to promote their replication. Toxoplasma multiplies in a membrane-bound parasitophorous vacuole (PV) that interacts with mammalian host organelles and intercepts Golgi Rab vesicles to acquire sphingolipids. The mechanisms of host vesicle internalization and processing within the PV remain undefined. We demonstrate that Toxoplasma sequesters a broad range of Rab vesicles into the PV. Correlative light and electron microscopy analysis of infected cells illustrates that intravacuolar Rab1A vesicles are surrounded by the PV membrane, suggesting a phagocytic-like process for vesicle engulfment. Rab11A vesicles concentrate to an intravacuolar network (IVN), but this is reduced in Δgra2 and Δgra2Δgra6 parasites, suggesting that tubules stabilized by the TgGRA2 and TgGRA6 proteins secreted by the parasite within the PV contribute to host vesicle sequestration. Overexpression of a phospholipase TgLCAT, which is localized to the IVN, results in a decrease in the number of intravacuolar GFP-Rab11A vesicles, suggesting that TgLCAT controls lipolytic degradation of Rab vesicles for cargo release. PMID:29070609

Thermal Decomposition Behavior of Hydroxytyrosol (HT) in Nitrogen Atmosphere Based on TG-FTIR Methods.

PubMed

Tu, Jun-Ling; Yuan, Jiao-Jiao

2018-02-13

The thermal decomposition behavior of olive hydroxytyrosol (HT) was first studied using thermogravimetry (TG). Cracked chemical bond and evolved gas analysis during the thermal decomposition process of HT were also investigated using thermogravimetry coupled with infrared spectroscopy (TG-FTIR). Thermogravimetry-Differential thermogravimetry (TG-DTG) curves revealed that the thermal decomposition of HT began at 262.8 °C and ended at 409.7 °C with a main mass loss. It was demonstrated that a high heating rate (over 20 K·min -1 ) restrained the thermal decomposition of HT, resulting in an obvious thermal hysteresis. Furthermore, a thermal decomposition kinetics investigation of HT indicated that the non-isothermal decomposition mechanism was one-dimensional diffusion (D1), integral form g ( x ) = x ², and differential form f ( x ) = 1/(2 x ). The four combined approaches were employed to calculate the activation energy ( E = 128.50 kJ·mol -1 ) and Arrhenius preexponential factor (ln A = 24.39 min -1 ). In addition, a tentative mechanism of HT thermal decomposition was further developed. The results provide a theoretical reference for the potential thermal stability of HT.

Quantifying the origin of metallic glass formation

NASA Astrophysics Data System (ADS)

Johnson, W. L.; Na, J. H.; Demetriou, M. D.

2016-01-01

The waiting time to form a crystal in a unit volume of homogeneous undercooled liquid exhibits a pronounced minimum τX* at a `nose temperature' T* located between the glass transition temperature Tg, and the crystal melting temperature, TL. Turnbull argued that τX* should increase rapidly with the dimensionless ratio trg=Tg/TL. Angell introduced a dimensionless `fragility parameter', m, to characterize the fall of atomic mobility with temperature above Tg. Both trg and m are widely thought to play a significant role in determining τX*. Here we survey and assess reported data for TL, Tg, trg, m and τX* for a broad range of metallic glasses with widely varying τX*. By analysing this database, we derive a simple empirical expression for τX*(trg, m) that depends exponentially on trg and m, and two fitting parameters. A statistical analysis shows that knowledge of trg and m alone is therefore sufficient to predict τX* within estimated experimental errors. Surprisingly, the liquid/crystal interfacial free energy does not appear in this expression for τX*.

Transitions to sustainable management of phosphorus in Brazilian agriculture.

PubMed

Withers, Paul J A; Rodrigues, Marcos; Soltangheisi, Amin; de Carvalho, Teotonio S; Guilherme, Luiz R G; Benites, Vinicius de M; Gatiboni, Luciano C; de Sousa, Djalma M G; Nunes, Rafael de S; Rosolem, Ciro A; Andreote, Fernando D; Oliveira, Adilson de; Coutinho, Edson L M; Pavinato, Paulo S

2018-02-07

Brazil's large land base is important for global food security but its high dependency on inorganic phosphorus (P) fertilizer for crop production (2.2 Tg rising up to 4.6 Tg in 2050) is not a sustainable use of a critical and price-volatile resource. A new strategic analysis of current and future P demand/supply concluded that the nation's secondary P resources which are produced annually (e.g. livestock manures, sugarcane processing residues) could potentially provide up to 20% of crop P demand by 2050 with further investment in P recovery technologies. However, the much larger legacy stores of secondary P in the soil (30 Tg in 2016 worth over $40 billion and rising to 105 Tg by 2050) could provide a more important buffer against future P scarcity or sudden P price fluctuations, and enable a transition to more sustainable P input strategies that could reduce current annual P surpluses by 65%. In the longer-term, farming systems in Brazil should be redesigned to operate profitably but more sustainably under lower soil P fertility thresholds.

Evaluation of the diagnostic value of the first thyroglobulin determination in detecting metastases after differentiated thyroid carcinoma surgery.

PubMed

Makarewicz, J; Adamczewski, Z; Knapska-Kucharska, M; Lewiński, A

2006-10-01

Evaluation of the diagnostic value of the first thyroglobulin (Tg) level measurement, performed after thyroidectomy, before another treatment, as an early marker of either metastases or local recurrence of differentiated thyroid carcinoma (DTC). Data of 178 patients (160 women, 18 men, 14-79 years) with DTC and without known interference in Tg assay were evaluated retrospectively. In all patients, neck radioiodine uptake (Tup (24)), thyroid remnants volume (V), TSH and Tg were measured. The Tg/V and Tg/Tup (24) ratios were calculated to correct Tg concentration with regard to V and Tup (24). Six months after initial evaluation and routine therapy all patients underwent control examinations under endogenous TSH stimulation. During follow-up metastases or local recurrence were found in 32 patients. The groups of patients with no diagnosed metastases (M0) and with detected metastases (M1), did not differ with regard to V, serum TSH or Tup (24); difference between the two groups was found in Tg concentration (4.3 ng/ml VS 97.4 ng/ml; p=0.000001). The ratios of Tg/Tup (24) (p=0.000000) and Tg/V (p=0.004) were lower in the group M0 than M1. The areas under receiver operating characteristic curves (ROC) for Tg concentrations, Tg/Tup (24), and Tg/V ratios were 0.773 (95% CI - 0.655-0.892), 0.817 (0.709-0.925) and 0.712 (0.541-0.884), respectively. Both the absolute Tg concentration and Tg/V and Tg/Tup (24) ratios, determined after thyroidectomy but before another treatment in patients with metastases of DTC, diagnosed within 6 months after (131)I administration, are higher than those in patients without such metastases. This indicates that the mentioned parameters may be applied as early markers of either local recurrence or metastases of DTC. The highest discriminative value demonstrates Tg/Tup (24) ratio, Tg concentration has a lower value and Tg/V ratio has the lowest one.

SA79. Toxoplasma Gondii Affects Posterior Association Cortex and Related Functions in Healthy, but Not Schizophrenia, Individuals

PubMed Central

Cobia, Derin; Perry, Cynthia; Gale, Shawn; Hedges, Dawson; Smith, Matthew; Wang, Lei; Csernansky, John

2017-01-01

Abstract Background: The apicomplexan protozoa Toxoplasma gondii (TG) is a successful parasite infecting ~30% of the human population, with some evidence to suggest it is more frequent in individuals with schizophrenia. TG has an affinity for the central nervous system and has been linked to cognitive and behavioral changes in rodents as well as humans. It is believed this mechanism contributes to the presentation of some schizophrenia cases. Given the relative absence of neurobiological studies, the aim of this project was to examine the influence of TG status on cortical thickness and cognitive function in a sample of schizophrenia and healthy individuals both seropositive and negative for the parasite. Methods: Schizophrenia (SCZ) = 77 (5 TG positive) and healthy control volunteers (CON) = 36 (11 TG positive) with clinical, cognitive, imaging, and available blood samples were used for the study. At least a 1-cc aliquot of serum from each subject was used for micro-enzyme-linked immunosorbent assay (ELISA) using a commercially available research kit for quantitative immunoenzymatic determination of anti-TG immunoglogulin G (IgG)-class antibodies. Cognitive and clinical functioning was assessed using a standardized battery. Structural T1-weighted images were processed using the FreeSurfer toolkit. Analyses included analysis of variance models examining differences in cortical thickness and cognition between TG seropositive (+) and negative (−) groups per condition (SCZ and CON); and Pearson correlation models of anti-TG IgG antibody titer values with thickness and behavioral variables within each condition group. Results: No significant differences in cortical thickness or cognition were observed in SCZ(+) vs SCZ(−), as well as CON(+) vs CON(−) groups, with the exception of visuospatial reasoning in CON. When correlating against anti-TG IgG titer values and cognition, significant negative relationships were noted with visuospatial reasoning (r = −.39, P = .02) and verbal memory (r = −.36, P = .03) in CON but none in SCZ. Titer values were significantly correlated with cortical thickness of the superior parietal region in SCZ (RH: r = −.24, P = .03) and at a trend level in CON (LH: r = −.31, P = .06; RH: r = −.30, P = .07). Conclusion: To our knowledge, this is the first study to examine cortical thickness in relation to cognitive function in a sample of SCZ and CON subjects with both seropositive and negative TG status. Results revealed the presence of TG appeared to primarily disrupt posterior association cortex and related functions (e.g., visuospatial reasoning) most prominently in healthy individuals but to a minor extent in schizophrenia patients. Overall, our findings suggest TG appears to exert greater influence over the neurobiology of nonpsychiatric individuals relative to psychosis, although addition research is warranted. Small seropositive sample sizes likely underpowered our ability to detect other effects.

The triglyceride/high-density lipoprotein cholesterol ratio fails to predict insulin resistance in African-American women: an analysis of Jackson Heart Study.

PubMed

Sumner, Anne E; Harman, Jane L; Buxbaum, Sarah G; Miller, Bernard V; Tambay, Anita V; Wyatt, Sharon B; Taylor, Herman A; Rotimi, Charles N; Sarpong, Daniel F

2010-12-01

Compared to whites, insulin-resistant African Americans have worse outcomes. Screening programs that could identify insulin resistance early enough for intervention to affect outcome often rely on triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C) levels. Racial differences in TG and HDL-C may compromise the efficacy of these programs in African Americans. A recommendation currently exists to use the TG/HDL-C ratio ≥2.0 to predict insulin resistance in African Americans. The validity of this recommendation needs examination. Therefore, our aim was to determine the ability of TG/HDL-C ratio to predict insulin resistance in African Americans. In 1,903 African Americans [895 men, 1,008 women, age 55 ± 12 years, mean ± standard deviation (SD), range 35-80 years, body mass index (BMI) 31.0 ± 6.4 kg/m(2), range 18.5-55 kg/m(2)] participating in the Jackson Heart Study, a population-based study of African Americans, Jackson, Mississippi tricounty region, insulin resistance was defined by the upper quartile (≥4.43) of homeostasis model assessment of insulin resistance (HOMA-IR). An area under the receiver operating characteristic curve (AUC-ROC) of >0.70 was required for prediction of insulin resistance by TG/HDL-C. The optimal test cutoff was determined by the Youden index. HOMA-IR was similar in men and women (3.40 ± 2.03 vs. 3.80 ± 2.46, P = 0.60). Women had lower TG (94 ± 49 vs. 109 ± 65 mg/dL P < 0.001) and TG/HDL-C (1.9 ± 1.4 vs. 2.7 ± 2.1, P < 0.001). For men, AUC-ROC for prediction of insulin resistance by TG/HDL-C was: 0.77 ± 0.01, mean ± standard error (SE), with an optimal cutoff of ≥2.5. For women, the AUC-ROC was 0.66 ± 0.01, rendering an optimal cutoff indefinable. When women were divided in two groups according to age, 35-50 years and 51-80 years, the results did not change. In African-American men, the recommended TG/HDL-C threshold of 2.0 should be adjusted upward to 2.5. In African-American women, TG/HDL-C cannot identify insulin resistance. The Jackson Heart Study can help determine the efficacy of screening programs in African-Americans.

Serum transglutaminase 3 antibodies correlate with age at celiac disease diagnosis.

PubMed

Salmi, Teea T; Kurppa, Kalle; Hervonen, Kaisa; Laurila, Kaija; Collin, Pekka; Huhtala, Heini; Saavalainen, Päivi; Sievänen, Harri; Reunala, Timo; Kaukinen, Katri

2016-06-01

Transglutaminase (TG)2 is the autoantigen in celiac disease, but also TG3 antibodies have been detected in the serum of celiac disease patients. To investigate the correlations between serum TG3 antibodies and clinical and histological manifestations of celiac disease and to assess gluten-dependency of TG3 antibodies. Correlations between serum TG3 antibody levels measured from 119 adults and children with untreated coeliac disease and the demographic data, clinical symptoms, celiac antibodies, histological data and results of laboratory tests and bone mineral densities were tested. TG3 antibodies were reinvestigated in 97 celiac disease patients after 12 months on a gluten-free diet (GFD). TG3 antibody titers were shown to correlate with the age at celiac disease diagnosis. Further, negative correlation with TG3 antibodies and intestinal γδ+ cells at diagnosis and on GFD was detected. Correlations were not detected with the clinical manifestation of celiac disease, TG2 or endomysial autoantibodies, laboratory values, severity of mucosal villous atrophy, associated diseases or complications. TG3 antibody titers decreased on GFD in 56% of the TG3 antibody positive patients. Serum TG3 antibody positivity in celiac disease increases as the diagnostic age rises. TG3 antibodies did not show similar gluten-dependency as TG2 antibodies. Copyright © 2016 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

Synthesis, growth, structural, optical, spectral, thermal and mechanical studies of 4-methoxy 4-nitrostilbene (MONS): a new organic nonlinear optical single crystal.

PubMed

Dinakaran, Paul M; Bhagavannarayana, G; Kalainathan, S

2012-11-01

4-Methoxy 4-nitrostilbene (MONS), a new organic nonlinear optical material has been synthesized. Based on the solubility data good quality single crystal with dimensions up to 38×11×3 mm(3) has been grown by slow evaporation method using ethyl methyl ketone (MEK) as a solvent. Powder XRD confirms the crystalline property and also the diffraction planes have been indexed. The lattice parameters for the grown MONS crystals were determined by using single crystal X-ray diffraction analysis and it reveals that the crystal lattice system is triclinic. The crystalline perfection of the grown crystals has been analysed by high resolution X-ray diffraction (HRXRD) rocking curve measurements. Fourier transform infrared (FTIR) spectrum for powdered MONS sample confirms the functional groups present in the grown crystal. The UV-vis absorption spectrum has been recorded in the range of 190-1100 nm and the cut off wavelength 499 nm has been determined. The optical constants of MONS have been determined through UV-vis-NIR spectroscopy. The MONS crystals were further subjected to other characterizations. i.e., (1)H NMR, TG/DTA, photoluminescence and microhardness test. The Kurtz and Perry powder technique confirms the NLO property of the grown crystal and the SHG efficiency of MONS was found to be 1.55× greater than that of KDP crystal. Copyright © 2012 Elsevier B.V. All rights reserved.

Matrix metalloproteinase 9 and transglutaminase 2 expression at the ocular surface in patients with different forms of dry eye disease.

PubMed

Aragona, Pasquale; Aguennouz, M'Hammed; Rania, Laura; Postorino, Elisa; Sommario, Margherita Serena; Roszkowska, Anna Maria; De Pasquale, Maria Grazia; Pisani, Antonina; Puzzolo, Domenico

2015-01-01

To evaluate the expression of matrix metalloproteinase 9 (MMP9) and transglutaminase 2 (TG2) in different forms of dry eye. Case control study. Seventy-five female subjects divided into 3 groups: group 1, 15 healthy controls; group 2, 30 subjects with Sjögren syndrome (SS); and group 3, 30 subjects with Meibomian gland dysfunction (MGD). A clinical assessment was carried out and impression cytologic specimens were processed for immunoperoxidase staining for MMP9 and TG2 and real-time polymerase chain reaction analyses were carried out for MMP9, TG2, interleukin-6, interferon-γ, B-cell lymphoma 2, and caspase 3. To study MMP9 and TG2 expression after anti-inflammatory treatment, patients were divided into 2 subgroups, one treated with saline and the other treated with saline plus topical corticosteroid eye drops (0.5% loteprednol etabonate) 4 times daily for 15 days. For statistical analysis, Student t test, Mann-Whitney U test, and Spearman's correlation coefficient were used as appropriate. Conjunctival expression of MMP9 and TG2. MMP9 and TG2 expression were higher in both patient groups than in controls (P < 0.0001). Group 2 patients showed higher expression than group 3 (P < 0.0001). The Spearman's correlation coefficient showed in group 2 a positive correlation between MMP9 and TG2 expression (ρ = 0.437; P = 0.01), but no correlation in group 3 (ρ = 0.143; P = 0.45). Corticosteroid treatment significantly reduced MMP9 and TG2 expression in both groups, ameliorating symptoms and signs. A much higher percentage reduction was observed in SS. The pathogenic mechanisms of the 2 forms of dry eye give an account for the different MMP9 and TG2 expressions in the 2 groups of patients. The higher expression in SS is determined by the direct autoimmune insult to the ocular surface epithelia, whereas in MGD patients, with an epithelial damage due to an unbalanced tear secretion, the molecules expression is significantly lower, although higher than in controls. The corticosteroid treatment induced a reduction of both molecules, although higher in SS than in MGD, because of its direct inhibitory effect on inflammation. Copyright © 2015 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Constitutive expression of active microbial transglutaminase in Escherichia coli and comparative characterization to a known variant.

PubMed

Javitt, Gabe; Ben-Barak-Zelas, Zohar; Jerabek-Willemsen, Moran; Fishman, Ayelet

2017-02-28

Microbial transglutaminase (mTG) is a robust enzyme catalyzing the formation of an isopeptide bond between glutamine and lysine residues. It has found use in food applications, pharmaceuticals, textiles, and biomedicine. Overexpression of soluble and active mTG in E. coli has been limited due to improper protein folding and requirement for proteolytic cleavage of the pro-domain. Furthermore, to integrate mTG more fully industrially and academically, thermostable and solvent-stable variants may be imperative. A novel expression system constitutively producing active mTG was designed. Wild-type (WT) mTG and a S2P variant had similar expression levels, comparable to previous studies. Kinetic constants were determined by a glutamate dehydrogenase-coupled assay, and the S2P variant showed an increased affinity and a doubled enzyme efficiency towards Z-Gln-Gly. The melting temperature (T m ) of the WT was determined by intrinsic fluorescence measurements to be 55.8 ± 0.1 °C and of the S2P variant to be 56.3 ± 0.4 °C and 45.5 ± 0.1 °C, showing a moderately different thermostability profile. Stability in water miscible organic solvents was determined for both the WT and S2P variant. Of the solvents tested, incubation of mTG in isopropanol for 24 h at 4 °C showed the strongest stabilizing effect with mTG retaining 61 and 72% activity for WT and S2P respectively in 70% isopropanol. Both enzymes also showed an increased initial activity in the presence of organic solvents with the highest activity increase in 40% DMSO. Nevertheless, both enzymes were inactivated in 70% of all organic solvents tested. A constitutive expression system of active mTG in E. coli without downstream proteolytic cleavage processing was used for overexpression and characterization. High throughput techniques for testing thermostability and kinetics were useful in streamlining analysis and could be used in the future for quickly identifying beneficial mutants. Hitherto untested thermostability and stability of mTG in organic solvents was evaluated, which can pave the way for use of the enzyme in novel applications and processes.

Activation pattern of ACE2/Ang-(1-7) and ACE/Ang II pathway in course of heart failure assessed by multiparametric MRI in vivo in Tgαq*44 mice.

PubMed

Tyrankiewicz, Urszula; Olkowicz, Mariola; Skórka, Tomasz; Jablonska, Magdalena; Orzylowska, Anna; Bar, Anna; Gonet, Michal; Berkowicz, Piotr; Jasinski, Krzysztof; Zoladz, Jerzy A; Smolenski, Ryszard T; Chlopicki, Stefan

2018-01-01

Here, we analyzed systemic (plasma) and local (heart/aorta) changes in ACE/ACE-2 balance in Tgαq*44 mice in course of heart failure (HF). Tgαq*44 mice with cardiomyocyte-specific Gαq overexpression and late onset of HF were analyzed at different age for angiotensin pattern in plasma, heart, and aorta using liquid chromatography/mass spectrometry, for progression of HF by in vivo magnetic resonance imaging under isoflurane anesthesia, and for physical activity by voluntary wheel running. Six-month-old Tgαq*44 mice displayed decreased ventricle radial strains and impaired left atrial function. At 8-10 mo, Tgαq*44 mice showed impaired systolic performance and reduced voluntary wheel running but exhibited preserved inotropic reserve. At 12 mo, Tgαq*44 mice demonstrated a severe impairment of basal cardiac performance and modestly compromised inotropic reserve with reduced voluntary wheel running. Angiotensin analysis in plasma revealed an increase in concentration of angiotensin-(1-7) in 6- to 10-mo-old Tgαq*44 mice. However, in 12- to 14-mo-old Tgαq*44 mice, increased angiotensin II was noted with a concomitant increase in Ang III, Ang IV, angiotensin A, and angiotensin-(1-10). The pattern of changes in the heart and aorta was also compatible with activation of ACE2, followed by activation of the ACE pathway. In conclusion, mice with cardiomyocyte Gαq protein overexpression develop HF that is associated with activation of the systemic and the local ACE/Ang II pathway. However, it is counterbalanced by a prominent ACE2/Ang-(1-7) activation, possibly allowing to delay decompensation. NEW & NOTEWORTHY Changes in ACE/ACE-2 balance were analyzed based on measurements of a panel of nine angiotensins in plasma, heart, and aorta of Tgαq*44 mice in relation to progression of heart failure (HF) characterized by multiparametric MRI and exercise performance. The early stage of HF was associated with upregulation of the ACE2/angiotensin-(1-7) pathway, whereas the end-stage HF was associated with downregulation of ACE2/angiotensin-(1-7) and upregulation of the ACE/Ang II pathway. ACE/ACE-2 balance seems to determine the decompensation of HF in this model.

An Initial Look at Adjacent Band Interference Between Aeronautical Mobile Telemetry and Long-Term Evolution Wireless Service

DTIC Science & Technology

2016-07-04

required analysis, and further testing. 15. SUBJECT TERMS Adjacent Channel Interference, ACI, LTE -A, LTE , PCM/FM, SOQPSK-TG, ARTM CPM, AWS-3, User...Interference, ACI, LTE -A, LTE , PCM/FM, SOQPSK-TG, ARTM CPM, AWS-3, User Equipment, UE, Evolved Node B, eNodeB, Resource Blocks INTRODUCTION “On...these questions make necessary an improved understanding of the interferers that can be obtained only by hands-on measurements . This work will

Application of thermogravimetry-differential thermal analysis (TG-DTA) technique to study the ancient potteries from Vellore dist, Tamilnadu, India

NASA Astrophysics Data System (ADS)

Ravisankar, R.; Naseerutheen, A.; Rajalakshmi, A.; Raja Annamalai, G.; Chandrasekaran, A.

2014-08-01

The characterization of archeological ceramic and pottery can be studied for the determination of firing temperature and the presence of raw materials by thermal analysis. Clay minerals are the main material for the production of ceramic and pottery and show some characteristic reactions such as dehydration, dehydroxylation and transformation. This is key point of criteria for the elucidation of firing temperature and raw material analysis. In the present work, DTA-TG, XRD and EDXRF technique are applied on representative potsherds from Vellore dist., Tamilnadu, India to derive the information about the production technology, raw materials and firing temperature. From the analysis, all the samples were considered to be fired from 800 °C to 900 °C and organic material might be added intestinally as a binder in the preparation of pottery.

Striatal Transcriptome and Interactome Analysis of Shank3-overexpressing Mice Reveals the Connectivity between Shank3 and mTORC1 Signaling

PubMed Central

Lee, Yeunkum; Kim, Sun Gyun; Lee, Bokyoung; Zhang, Yinhua; Kim, Yoonhee; Kim, Shinhyun; Kim, Eunjoon; Kang, Hyojin; Han, Kihoon

2017-01-01

Mania causes symptoms of hyperactivity, impulsivity, elevated mood, reduced anxiety and decreased need for sleep, which suggests that the dysfunction of the striatum, a critical component of the brain motor and reward system, can be causally associated with mania. However, detailed molecular pathophysiology underlying the striatal dysfunction in mania remains largely unknown. In this study, we aimed to identify the molecular pathways showing alterations in the striatum of SH3 and multiple ankyrin repeat domains 3 (Shank3)-overexpressing transgenic (TG) mice that display manic-like behaviors. The results of transcriptome analysis suggested that mammalian target of rapamycin complex 1 (mTORC1) signaling may be the primary molecular signature altered in the Shank3 TG striatum. Indeed, we found that striatal mTORC1 activity, as measured by mTOR S2448 phosphorylation, was significantly decreased in the Shank3 TG mice compared to wild-type (WT) mice. To elucidate the potential underlying mechanism, we re-analyzed previously reported protein interactomes, and detected a high connectivity between Shank3 and several upstream regulators of mTORC1, such as tuberous sclerosis 1 (TSC1), TSC2 and Ras homolog enriched in striatum (Rhes), via 94 common interactors that we denominated “Shank3-mTORC1 interactome”. We noticed that, among the 94 common interactors, 11 proteins were related to actin filaments, the level of which was increased in the dorsal striatum of Shank3 TG mice. Furthermore, we could co-immunoprecipitate Shank3, Rhes and Wiskott-Aldrich syndrome protein family verprolin-homologous protein 1 (WAVE1) proteins from the striatal lysate of Shank3 TG mice. By comparing with the gene sets of psychiatric disorders, we also observed that the 94 proteins of Shank3-mTORC1 interactome were significantly associated with bipolar disorder (BD). Altogether, our results suggest a protein interaction-mediated connectivity between Shank3 and certain upstream regulators of mTORC1 that might contribute to the abnormal striatal mTORC1 activity and to the manic-like behaviors of Shank3 TG mice. PMID:28701918

Repeated Gestational Exposure of Mice to Chlorpyrifos Oxon Is Associated with Paraoxonase 1 (PON1) Modulated Effects in Maternal and Fetal Tissues

PubMed Central

Co, Aila L.; Hay, Ariel M.; MacDonald, James W.; Bammler, Theo K.; Farin, Federico M.; Costa, Lucio G.; Furlong, Clement E.

2014-01-01

Chlorpyrifos oxon (CPO), the toxic metabolite of the organophosphorus (OP) insecticide chlorpyrifos, causes developmental neurotoxicity in humans and rodents. CPO is hydrolyzed by paraoxonase-1 (PON1), with protection determined by PON1 levels and the human Q192R polymorphism. To examine how the Q192R polymorphism influences fetal toxicity associated with gestational CPO exposure, we measured enzyme inhibition and fetal-brain gene expression in wild-type (PON1+/+), PON1-knockout (PON1−/−), and tgHuPON1R192 and tgHuPON1Q192 transgenic mice. Pregnant mice exposed dermally to 0, 0.50, 0.75, or 0.85 mg/kg/d CPO from gestational day (GD) 6 through 17 were sacrificed on GD18. Biomarkers of CPO exposure inhibited in maternal tissues included brain acetylcholinesterase (AChE), red blood cell acylpeptide hydrolase (APH), and plasma butyrylcholinesterase (BChE) and carboxylesterase (CES). Fetal plasma BChE was inhibited in PON1−/− and tgHuPON1Q192, but not PON1+/+ or tgHuPON1R192 mice. Fetal brain AChE and plasma CES were inhibited in PON1−/− mice, but not in other genotypes. Weighted gene co-expression network analysis identified five gene modules based on clustering of the correlations among their fetal-brain expression values, allowing for correlation of module membership with the phenotypic data on enzyme inhibition. One module that correlated highly with maternal brain AChE activity had a large representation of homeobox genes. Gene set enrichment analysis revealed multiple gene sets affected by gestational CPO exposure in tgHuPON1Q192 but not tgHuPON1R192 mice, including gene sets involved in protein export, lipid metabolism, and neurotransmission. These data indicate that maternal PON1 status modulates the effects of repeated gestational CPO exposure on fetal-brain gene expression and on inhibition of both maternal and fetal biomarker enzymes. PMID:25070982

Use of thermal analysis coupled with differential scanning calorimetry, quadrupole mass spectrometry and infrared spectroscopy (TG-DSC-QMS-FTIR) to monitor chemical properties and thermal stability of fulvic and humic acids.

PubMed

Boguta, Patrycja; Sokołowska, Zofia; Skic, Kamil

2017-01-01

Thermogravimetry-coupled with differential scanning calorimetry, quadrupole mass spectrometry, and Fourier-transform infrared spectroscopy (TG-DSC-QMS-FTIR)-was applied to monitor the thermal stability (in an N2 pyrolytic atmosphere) and chemical properties of natural polymers, fulvic (FA) and humic acids (HA), isolated from chemically different soils. Three temperature ranges, R1, 40-220°C; R2, 220-430°C; and R3, 430-650°C, were distinguished from the DSC data, related to the main thermal processes of different structures (including transformations without weight loss). Weight loss (ΔM) estimated from TG curves at the above temperature intervals revealed distinct differences within the samples in the content of physically adsorbed water (at R1), volatile and labile functional groups (at R2) as well as recalcitrant and refractory structures (at R3). QMS and FTIR modules enabled the chemical identification (by masses and by functional groups, respectively) of gaseous species evolved during thermal decomposition at R1, R2 and R3. Variability in shape, area and temperature of TG, DSC, QMS and FTIR peaks revealed differences in thermal stability and chemical structure of the samples between the FAs and HAs fractions of different origin. The statistical analysis showed that the parameters calculated from QMS (areas of m/z = 16, 17, 18, 44), DSC (MaxDSC) and TG (ΔM) at R1, R2 and R3 correlated with selected chemical properties of the samples, such as N, O and COOH content as well as E2/E6 and E2/E4 indexes. This indicated a high potential for the coupled method to monitor the chemical changes of humic substances. A new humification parameter, HTD, based on simple calculations of weight loss at specific temperature intervals proved to be a good alternative to indexes obtained from other methods. The above findings showed that the TG-DSC-QMS-FTIR coupled technique can represent a useful tool for the comprehensive assessment of FAs and HAs properties related to their various origin.

Use of thermal analysis coupled with differential scanning calorimetry, quadrupole mass spectrometry and infrared spectroscopy (TG-DSC-QMS-FTIR) to monitor chemical properties and thermal stability of fulvic and humic acids

PubMed Central

Sokołowska, Zofia; Skic, Kamil

2017-01-01

Thermogravimetry–coupled with differential scanning calorimetry, quadrupole mass spectrometry, and Fourier-transform infrared spectroscopy (TG-DSC-QMS-FTIR)–was applied to monitor the thermal stability (in an N2 pyrolytic atmosphere) and chemical properties of natural polymers, fulvic (FA) and humic acids (HA), isolated from chemically different soils. Three temperature ranges, R1, 40–220°C; R2, 220–430°C; and R3, 430–650°C, were distinguished from the DSC data, related to the main thermal processes of different structures (including transformations without weight loss). Weight loss (ΔM) estimated from TG curves at the above temperature intervals revealed distinct differences within the samples in the content of physically adsorbed water (at R1), volatile and labile functional groups (at R2) as well as recalcitrant and refractory structures (at R3). QMS and FTIR modules enabled the chemical identification (by masses and by functional groups, respectively) of gaseous species evolved during thermal decomposition at R1, R2 and R3. Variability in shape, area and temperature of TG, DSC, QMS and FTIR peaks revealed differences in thermal stability and chemical structure of the samples between the FAs and HAs fractions of different origin. The statistical analysis showed that the parameters calculated from QMS (areas of m/z = 16, 17, 18, 44), DSC (MaxDSC) and TG (ΔM) at R1, R2 and R3 correlated with selected chemical properties of the samples, such as N, O and COOH content as well as E2/E6 and E2/E4 indexes. This indicated a high potential for the coupled method to monitor the chemical changes of humic substances. A new humification parameter, HTD, based on simple calculations of weight loss at specific temperature intervals proved to be a good alternative to indexes obtained from other methods. The above findings showed that the TG-DSC-QMS-FTIR coupled technique can represent a useful tool for the comprehensive assessment of FAs and HAs properties related to their various origin. PMID:29240819

Thyroglobulin autoantibodies switch to immunoglobulin (Ig)G1 and IgG3 subclasses and preserve their restricted epitope pattern after 131I treatment for Graves' hyperthyroidism: the activity of autoimmune disease influences subclass distribution but not epitope pattern of autoantibodies

PubMed Central

Latrofa, F; Ricci, D; Montanelli, L; Piaggi, P; Mazzi, B; Bianchi, F; Brozzi, F; Santini, P; Fiore, E; Marinò, M; Tonacchera, M; Vitti, P

2014-01-01

The subclass distribution of thyroglobulin autoantibodies (TgAb) is debated, whereas their epitope pattern is restricted. Radioidine (131I) treatment for Graves' disease (GD) induces a rise in TgAb levels, but it is unknown whether it modifies subclass distribution and epitope pattern of TgAb as well. We collected sera from GD patients before 131I treatment and 3 and 6 months thereafter. We measured total TgAb, TgAb light chains and TgAb subclasses by enzyme-linked immunosorbent assay (ELISA) in 25 patients. We characterized the TgAb epitope pattern in 30 patients by inhibiting their binding to 125-ITg by a pool of four TgAb-Fab (recognizing Tg epitope regions A, B, C and D) and to Tg in ELISA by each TgAb-Fab. Total TgAb immunoglobulin (Ig)G rose significantly (P = 0·024). TgAb κ chains did not change (P = 0·052), whereas TgAb λ chains increased significantly (P = 0·001) and persistently. We observed a significant rise in IgG1 and IgG3 levels after 131I (P = 0·008 and P = 0·006, respectively), while IgG2 and IgG4 levels did not change. The rise of IgG1 was persistent, that of IgG3 transient. The levels of inhibition of TgAb binding to Tg by the TgAb-Fab pool were comparable. A slight, non-significant reduction of the inhibition by the immune-dominant TgAb-Fab A was observed 3 and 6 months after 131I. We conclude that 131I treatment for GD increases the levels of the complement-activating IgG1 and IgG3 subclasses and does not influence significantly the epitope pattern of TgAb. In autoimmune thyroid disease subclass distribution of autoantibodies is dynamic in spite of a stable epitope pattern. PMID:25134846

Tryptic peptides of canine thyroglobulin reactive with sera of patients with canine hypothyroidism caused by autoimmune thyroiditis.

PubMed

Lee, J-Y; Uzuka, Y; Tanabe, S; Takasawa, T; Sarashina, T; Nachreiner, R F

2004-10-01

Canine thyroglobulin (cTg) was treated with trypsin at a ratio of trypsin to cTg of 1:100 (w/w). Tryptic peptides of cTg were analysed by Western immunoblotting for their reactivity to serum thyroglobulin autoantibodies (TgAA) from patients with TgAA-positive hypothyroidism and normal individuals. The sera of patients with TgAA-positive hypothyroidism reacted with several peptides: 43, 32.5 and 31 kDa; the sera of normal individuals did not bind these tryptic peptides. Some of the TgAA-positive sera of patients reacted with 25 kDa peptide in addition to three tryptic peptides above. This experiment was the first report about antigenic epitopes of cTg. These small tryptic peptides recognized by TgAA may be related with the induction of TgAA and may be useful as markers for autoimmune thyroid diseases in dog.

Production of Multiple Transgenic Yucatan Miniature Pigs Expressing Human Complement Regulatory Factors, Human CD55, CD59, and H-Transferase Genes

PubMed Central

Jang, Gun-Hyuk; Jeong, Yeun-Ik; Hwang, In-Sung; Jeong, Yeon-woo; Kim, Yu-Kyung; Shin, Taeyoung; Kim, Nam-Hyung; Hyun, Sang-Hwan; Jeung, Eui-Bae; Hwang, Woo-Suk

2013-01-01

The present study was conducted to generate transgenic pigs coexpressing human CD55, CD59, and H-transferase (HT) using an IRES-mediated polycistronic vector. The study focused on hyperacute rejection (HAR) when considering clinical xenotransplantation as an alternative source for human organ transplants. In total, 35 transgenic cloned piglets were produced by somatic cell nuclear transfer (SCNT) and were confirmed for genomic integration of the transgenes from umbilical cord samples by PCR analysis. Eighteen swine umbilical vein endothelial cells (SUVEC) were isolated from umbilical cord veins freshly obtained from the piglets. We observed a higher expression of transgenes in the transgenic SUVEC (Tg SUVEC) compared with the human umbilical vein endothelial cells (HUVEC). Among these genes, HT and hCD59 were expressed at a higher level in the tested Tg organs compared with non-Tg control organs, but there was no difference in hCD55 expression between them. The transgenes in various organs of the Tg clones revealed organ-specific and spatial expression patterns. Using from 0 to 50% human serum solutions, we performed human complement-mediated cytolysis assays. The results showed that, overall, the Tg SUVEC tested had greater survival rates than did the non-Tg SUVEC, and the Tg SUVEC with higher HT expression levels tended to have more down-regulated α-Gal epitope expression, resulting in greater protection against cytotoxicity. By contrast, several Tg SUVEC with low CD55 expression exhibited a decreased resistance response to cytolysis. These results indicated that the levels of HT expression were inversely correlated with the levels of α-Gal epitope expression and that the combined expression of hCD55, hCD59, and HT proteins in SUVECs markedly enhances a protective response to human serum-mediated cytolysis. Taken together, these results suggest that combining a polycistronic vector system with SCNT methods provides a fast and efficient alternative for the generation of transgenic large animals with multiple genetic modifications. PMID:23704897

Association between triglyceride to HDL-C ratio and insulin resistance in indigenous Argentinean children.

PubMed

Hirschler, V; Maccallini, G; Sanchez, M; Gonzalez, C; Molinari, C

2015-12-01

Insulin resistance is considered one of the major risk factors for the development of type 2 diabetes mellitus (T2DM). Thus, early identification, preferably by using simple and inexpensive diagnostic tools, is essential for preventing T2DM. Triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) has been proposed as an inexpensive tool to identify individuals at high risk of T2DM. The objective of this study was to determine the relationship between insulin resistance and TG/HDL-C in indigenous Argentinean children. A cross-sectional study of 501 (243 boys) indigenous school children aged 10.0 ± 2.4 yr were assessed for anthropometry, lipids, glucose, and insulin levels from November 2011 to November 2013. Insulin resistance was defined as the upper third quartile of homeostasis model assessment (HOMA-IR). The prevalence of overweight/obesity was 11.4% per Centers for Disease Control. Mean levels of various characteristics were: body mass index (BMI) 17.2 ± 2.6, HDL-C 39 ± 9 mg/dL, TGs 121 ± 58 mg/dL, TG/HDL-C 2.9 ± 1.8, glucose 77 ± 8 mg/dL, HOMA-IR 1.0 ± 0.8, and insulin 44 ± 9 mUI/L. Children in the higher quartiles of TG/HDL-C had significantly higher HOMA-IR values than children in the lower quartiles. Multiple linear regression analysis showed that TG/HDL-C was significantly associated with HOMA-IR (r² = 0.19) adjusted for age, gender, and BMI. Furthermore, for a 1-unit increase in log TG/HDL-C, the odds of being insulin resistant (HOMA-IR>III quartile) increased by 2.58 times [odds ratio (OR), 2.58 (1.63-4.05); p < 0.01], adjusted for age, gender, and BMI. This study suggests that TG/HDL-C may be a good marker to identify insulin resistant indigenous Argentinean children. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Transglutaminase 2 expression is enhanced synergistically by interferon-γ and tumour necrosis factor-α in human small intestine.

PubMed

Bayardo, M; Punzi, F; Bondar, C; Chopita, N; Chirdo, F

2012-04-01

Transglutaminase 2 (TG2) is expressed ubiquitously, has multiple physiological functions and has also been associated with inflammatory diseases, neurodegenerative disorders, autoimmunity and cancer. In particular, TG2 is expressed in small intestine mucosa where it is up-regulated in active coeliac disease (CD). The aim of this work was to investigate the induction of TG2 expression by proinflammatory cytokines [interleukin (IL)-1, IL-6, tumour necrosis factor (TNF)-α, interferon (IFN)-γ and IL-15] and the signalling pathways involved, in human epithelial and monocytic cells and in intestinal tissue from controls and untreated CD patients. Here we report that IFN-γ was the most potent inducer of TG2 expression in the small intestinal mucosa and in four [Caco-2, HT-29, Calu-6 and human acute monocytic leukaemia cell line (THP-1)] of five cell lines tested. The combination of TNF-α and IFN-γ produced a strong synergistic effect. The use of selective inhibitors of signalling pathways revealed that induction of TG2 by IFN-γ was mediated by phosphoinositide 3-kinase (PI3K), while c-Jun N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (MAPK) were required for TNF-α activation. Quantitative polymerase chain reaction (PCR), flow cytometry and Western blot analysis showed that TG2 expression was blocked completely when stimulation by either TNF-α or IFN-γ was performed in the presence of nuclear factor (NF)-κB inhibitors (sulphasalazine and BAY-117082). TG2 was up-regulated substantially by TNF-α and IFN-γ in intestinal mucosa in untreated CD compared with controls. This study shows that IFN-γ, a dominant cytokine in intestinal mucosa in active CD, is the most potent inducer of TG2, and synergism with TNF-α may contribute to exacerbate the pathogenic mechanism of CD. Selective inhibition of signalling pathways may be of therapeutic benefit. © 2011 The Authors. Clinical and Experimental Immunology © 2011 British Society for Immunology.

Lipid accumulation product and triglycerides/glucose index are useful predictors of insulin resistance.

PubMed

Mazidi, Mohsen; Kengne, Andre-Pascal; Katsiki, Niki; Mikhailidis, Dimitri P; Banach, Maciej

2018-03-01

To investigate the association of triglycerides/glucose index (TyG index), anthropometrically predicted visceral adipose tissue (apVAT), lipid accumulation product (LAP), visceral adiposity index (VAI) and triglycerides (TG):high density lipoprotein-cholesterol (HDL-C) ratio with insulin resistance (IR) in adult Americans. This study was based on data from three NHANES cycles (2005 to 2010). The TyG index was calculated as ln [TG×fasting glucose/2]. VAI was calculated using gender-specific formulas: men [waist circumference (WC)/39.68+(1.88×body mass index (BMI)]×(TG/1.03)×(1.31/HDL-C); women: [WC/36.58+(1.89×BMI)]×(TG/0.81)×(1.52/HDL-C). LAP index was calculated as [WC-65]×[TG] in men, and [WC-58]×[TG] in women. Correlation and regression analyses accounted for the complex sampling of database. A total of 18,318 subjects was included in this analysis [mean age 47.6Years]; 48.7% (n=8918) men]. The homeostatic model assessment of insulin resistance (HOMA-IR) had a significant positive correlation with the TyG index (r=0.502), LAP (r=0.551), apVAT (r=0.454), TG:HDL-C ratio (r=0.441) and VAI (r=451) (p<0.001 for all comparisons). Bland-Altman plots showed no systematic errors. The optimal cut-off to predict HOMA-diagnosed IR was 0.473 (sensitivity=74.5% and specificity=72.7%) for LAP, 0.478 (75.9%, 71.9%) for TyG, 0.391 (70.4%, 67.1%) for VAI, 0.392 (77.1% and 62.0%) for TG:HDL-C ratio and 0.381 (63.8%, 74.8%) for apVAT. The LAP index is a simple, cheap and accurate although not perfect, surrogate marker of HOMA-diagnosed IR among adult Americans. Moreover, it has higher predictability than other screening tools which traditionally applied. Among the markers, apVAT had the highest specificity and the TG:HDL-C ratio had the highest sensitivity. Copyright © 2017 Elsevier Inc. All rights reserved.

Directed Energy Beam Jitter Mitigation Using the Line-of-Sight Reference Frame

DTIC Science & Technology

2011-05-10

tg,’Connected’); C4 = ’Yes’ TF1 =strcmp(C1, C2);TF2=strcmp(C3, C4); if ~ TF1 ; unload(tg); load(tg,’FFD_9’); tg=xpctarget.xpc; end if...C1 = (get(tg,’Application’));C2=’FFD_9’C3 = get(tg,’Connected’); C4 = ’Yes’ TF1 =strcmp(C1, C2);TF2=strcmp(C3, C4); if ~ TF1 ; unload(tg

How sensitive (second-generation) thyroglobulin measurement is changing paradigms for monitoring patients with differentiated thyroid cancer, in the absence or presence of thyroglobulin autoantibodies

PubMed Central

Spencer, Carole; LoPresti, Jonathan; Fatemi, Shireen

2014-01-01

Purpose of review To discuss new insights regarding how sensitive (second-generation) thyroglobulin immunometric assays (Tg2GIMAs), (functional sensitivities ≤0.10 μg/L) necessitate different approaches for postoperative thyroglobulin monitoring of patients with differentiated thyroid cancer (DTC), depending on the presence of thyroglobulin autoantibodies (TgAbs). Recent findings Reliable low-range serum thyroglobulin measurement has both enhanced clinical utility and economic advantages, provided TgAb is absent (∼75% DTC patients). Basal [nonthyroid-stimulating hormone (TSH) stimulated] Tg2GIMA measurement obviates the need for recombinant human TSH stimulation because basal Tg2GIMA below 0.20 μg/L has comparable negative predictive value (>95%) to recombinant human TSH-stimulated thyroglobulin values below the cutoff of 2 μg/L. Now that radioiodine remnant ablation is no longer considered necessary to treat low-risk DTC, the trend and doubling time of low basal thyroglobulin values arising from postsurgical thyroid remnants have recognized prognostic significance. The major limitation of Tg2GIMA testing is interference by TgAb (∼25% DTC patients), causing Tg2GIMA underestimation that can mask disease. When TgAb is present, the trend in TgAb concentrations (measured by the same method) can serve as the primary (surrogate) tumor-marker and be augmented by thyroglobulin measured by a TgAb-resistant class of method (radioimmunoassay or liquid chromatography-tandem mass spectrometry). Summary The growing use of Tg2GIMA measurement is changing paradigms for postoperative DTC monitoring. When TgAb is absent, it is optimal to monitor the basal Tg2GIMA trend and doubling time (using the same method) in preference to recombinant human TSH-stimulated thyroglobulin testing. When TgAb is present, interference renders Tg2GIMA testing unreliable and the trend in serum TgAb concentrations per se (same method) can serve as a (surrogate) tumor-marker. PMID:25122493

Growth, structural, thermal, dielectric and nonlinear optical properties of potassium hexachloro cadmate (IV) a novel single crystal

NASA Astrophysics Data System (ADS)

Umarani, P.; Jagannathan, K.

2018-02-01

The Potassium hexachloro cadmate (IV) (PHC) single crystal was grown from the aqueous of the solution by a controlled evaporation method. Single crystal XRD solved the structure. FTIR is used to identify the functional groups of grown crystal. The UV-Vis-NIR spectrometer was used to find out the UV cut off region and to calculate the optical band gap of the Potassium hexachloro cadmate (IV) single crystal. The EDAX spectrum has been used to identify the compounds present in title compound. The TG-DTA profile shows the thermal stability of the grown crystal of Potassium hexachloro cadmate (IV). The Vicker's hardness measurement was used to calculate the material hardness of the title compound. The dielectric loss and constant varied with frequencies and activation energy is also calculated. The solid state parameters like plasma energy, Penn gap, Fermi energy, electronic polarizability using Penn analysis and Clausius-Mossotti equation were also calculated for the title compound. The Z-scan technique is used to calculate the third order nonlinear susceptibility of a real and imaginary part.

Synthesis, characterization and properties of copper(I) complexes with bis(diphenylphosphino)-ferrocene ancillary ligand

NASA Astrophysics Data System (ADS)

Liu, Xinfang; Zhang, Songlin; Ding, Yuqiang

2012-06-01

Three copper(I) complexes (2-4) containing dppf ancillary ligand (dppf = bis(diphenylphosphino)-ferrocene) were synthesized when chloride-bridged copper(I) complex 1 reacted with acetanilide and characterized by IR, element analysis and NMR spectrum. And the crystal structures of complexes 2 and 4 have been determined by X-ray diffraction method. Complex 2, an acetate-bridged copper(I) complex, was obtained under N2 atmosphere in un-dried solvent; the acetate ion came from the hydrolysis reaction of acetanilide due to residual water in solvent. Acetanilide was deprotonated and coordinated with the copper(I) centre to form a copper(I) amidate complex 3 when reacted in pre-dried solvent. In addition, a known complex 4, the oxidation product of dppf, was isolated from the same reaction system when reacted in air atmosphere. CV and TG experiments were carried out to check the electron transfer properties and thermal stabilities of complexes 2-3. Finally, the arylation reaction of complex 3 with iodobenzene was performed to study the reaction mechanism of copper(I) catalyzed Goldberg reaction.

Abnormal iron metabolism and oxidative stress in mice expressing a mutant form of the ferritin light polypeptide gene

PubMed Central

Barbeito, Ana G.; Garringer, Holly J.; Baraibar, Martin A.; Gao, Xiaoying; Arredondo, Miguel; Núñez, Marco T.; Smith, Mark A.; Ghetti, Bernardino; Vidal, Ruben

2009-01-01

Insertional mutations in exon 4 of the ferritin light chain (FTL) gene are associated with hereditary ferritinopathy (HF) or neuroferritinopathy, an autosomal dominant neurodegenerative disease characterized by progressive impairment of motor and cognitive functions. To determine the pathogenic mechanisms by which mutations in FTL lead to neurodegeneration, we investigated iron metabolism and markers of oxidative stress in the brain of transgenic (Tg) mice that express the mutant human FTL498-499InsTC cDNA. Compared with wild-type mice, brain extracts from Tg (FTL-Tg) mice showed an increase in the cytoplasmic levels of both FTL and ferritin heavy chain polypeptides, a decrease in the protein and mRNA levels of transferrin receptor-1, and a significant increase in iron levels. Transgenic mice also showed the presence of markers for lipid peroxidation, protein carbonyls, and nitrone–protein adducts in the brain. However, gene expression analysis of iron management proteins in the liver of Tg mice indicates that the FTL-Tg mouse liver is iron deficient. Our data suggest that disruption of iron metabolism in the brain has a primary role in the process of neurodegeneration in HF and that the pathogenesis of HF is likely to result from a combination of reduction in iron storage function and enhanced toxicity associated with iron-induced ferritin aggregates in the brain. PMID:19519778

Effectiveness and tolerability of oral administration of low-dose salmon oil to HIV patients with HAART-associated dyslipidemia.

PubMed

Baril, Jean-Guy; Kovacs, Colin M; Trottier, Sylvie; Roederer, Ghislaine; Martel, Alain Y; Ackad, Nabil; Koulis, Theodoro; Sampalis, John S

2007-01-01

To assess the effectiveness of low-dose salmon oil for the treatment of highly active antiretroviral therapy (HAART)-induced dyslipidemia in HIV-infected patients. Randomized, open-label, parallel and crossover, multicenter study. Patients received 1 g salmon oil tid for 24 weeks (SO-24) or no additional treatment for 12 weeks and salmon oil for weeks 12 to 24 (CT-SO). The primary outcome measure was the change in triglyceride (TG) levels. Fifty-eight patients completed the study (26 in SO-24; 32 in CT-SO). After 12 weeks, the SO-24 group experienced a mean TG reduction of 1.1 mmol/L, compared to an increase of 0.3 mmol/L for the CT-SO group (p = .040). When CT-SO patients were crossed over to salmon oil treatment, mean TG decreased by 0.7 mmol/L (p = .052). Concomitant use of fibrates, statins, or both were reported by 16 (27.6%), 10 (17.2%), and 8 (13.8%), respectively. Multivariate analysis showed that salmon oil produced a significant decrease in TG levels independent of other lipid-lowering medications (p = .022). There were 26 predominately mild treatment-emergent (antiretroviral or salmon oil) nonserious adverse events reported by 22 (33.3%) patients. Low-dose salmon oil (3 g/day) is effective and well-tolerated in reducing TG levels in HIV-infected patients receiving HAART.

PRMT1 methylates the single Argonaute of Toxoplasma gondii and is important for the recruitment of Tudor nuclease for target RNA cleavage by antisense guide RNA

PubMed Central

Musiyenko, Alla; Majumdar, Tanmay; Andrews, Joel; Adams, Brian; Barik, Sailen

2013-01-01

Summary Argonaute (Ago) plays a central role in RNA interference in metazoans, but its status in lower organisms remains ill-defined. We report on the Ago complex of the unicellular protozoan, Toxoplasma gondii (Tg), an obligatory pathogen of mammalian hosts. The PIWI-like domain of TgAgo lacked the canonical DDE/H catalytic triad, explaining its weak target RNA cleavage activity. However, TgAgo associated with a stronger RNA slicer, a Tudor staphylococcal nuclease (TSN), and with a protein Arg methyl transferase, PRMT1. Mutational analysis suggested that the N-terminal RGG-repeat domain of TgAgo was methylated by PRMT1, correlating with the recruitment of TSN. The slicer activity of TgAgo was Mg2+-dependent and required perfect complementarity between the guide RNA and the target. In contrast, the TSN activity was Ca2+-dependent and required an imperfectly paired guide RNA. Ago knockout parasites showed essentially normal growth, but in contrast, the PRMT1 knockouts grew abnormally. Chemical inhibition of Arg-methylation also had an anti-parasitic effect. These results suggest that the parasitic PRMT1 plays multiple roles, and its loss affects the recruitment of a more potent second slicer to the parasitic RNA silencing complex, the exact mechanism of which remains to be determined. PMID:22309152

Expression of HIV-Tat protein is associated with learning and memory deficits in the mouse

PubMed Central

Carey, Amanda N.; Sypek, Elizabeth I.; Singh, Harminder D.; Kaufman, Marc J.; McLaughlin, Jay P.

2012-01-01

HIV-Tat protein has been implicated in the pathogenesis of HIV-1 neurological complications (i.e., neuroAIDS), but direct demonstrations of the effects of Tat on behavior are limited. GT-tg mice with a doxycycline (Dox)-inducible and brain-selective tat gene coding for Tat protein were used to test the hypothesis that the activity of Tat in brain is sufficient to impair learning and memory processes. Western blot analysis of GT-tg mouse brains demonstrated an increase in Tat antibody labeling that seemed to be dependent on the dose and duration of Dox pretreatment. Dox-treated GT-tg mice tested in the Barnes maze demonstrated longer latencies to find an escape hole and displayed deficits in probe trial performance, versus uninduced GT-tg littermates, suggesting Tat-induced impairments of spatial learning and memory. Reversal learning was also impaired in Tat-induced mice. Tat-induced mice additionally demonstrated long-lasting (up to one month) deficiencies in novel object recognition learning and memory performance. Furthermore, novel object recognition impairment was dependent on the dose and duration of Dox exposure, suggesting that Tat exposure progressively mediated deficits. These experiments provide evidence that Tat protein expression is sufficient to mediate cognitive abnormalities seen in HIV-infected individuals. Moreover, the genetically engineered GT-tg mouse may be useful for improving our understanding of the neurological underpinnings of neuroAIDS-related behaviors. PMID:22197678

Sequence variations in the osteoprotegerin gene promoter in patients with postmenopausal osteoporosis.

PubMed

Arko, B; Prezelj, J; Komel, R; Kocijancic, A; Hudler, P; Marc, J

2002-09-01

Osteoprotegerin (OPG) is a recently discovered member of the TNF receptor superfamily that acts as an important paracrine regulator of bone remodeling. OPG knockout mice develop severe osteoporosis, whereas administration of OPG can prevent ovariectomy-induced bone loss. These findings implicate a role for OPG in the development of osteoporosis. In the present study, we screened the OPG gene promoter for sequence variations and examined their association with bone mineral density (BMD) in 103 osteoporotic postmenopausal women. Single-strand conformation polymorphism analysis followed by DNA sequencing revealed a presence of four nucleotide substitutions: 209 G-->A, 245 T-->G, 889 C-->T, and 950 T-->C. The frequencies of genotypes were as follows: GG (89.3%), GA (10.7%) for 209 G-->A polymorphism; TT (89.3%), TG (10.7%) for 245 T-->G polymorphism; and TT (25.2%), TC (53.4%), CC (21.4%) for 950 T-->C polymorphism. Substitution 889 C-->T was found in only two patients. Statistically significant association of genotypes with BMD at the lumbar spine (P = 0.005) was observed for 209 G-->A and 245 T-->G polymorphisms. Haplotype GATG was associated with lower BMD as compared with GGTT haplotype. Our results suggest that 209 G-->A and 245 T-->G polymorphisms in the OPG gene promoter may contribute to the genetic regulation of BMD.

Icosapent ethyl: Eicosapentaenoic acid concentration and triglyceride-lowering effects across clinical studies.

PubMed

Bays, Harold E; Ballantyne, Christie M; Doyle, Ralph T; Juliano, Rebecca A; Philip, Sephy

2016-09-01

Icosapent ethyl is a high-purity prescription form of eicosapentaenoic acid (EPA) ethyl ester approved at a dose of 4g/day as an adjunct to diet to reduce triglyceride (TG) levels in adult patients with severe (≥500mg/dL) hypertriglyceridemia. This post-hoc exploratory analysis examined the relationship of icosapent ethyl dose with EPA concentrations in plasma and red blood cells (RBCs) across 3 clinical studies-a phase 1 pharmacokinetic study in healthy adult volunteers and 2 pivotal phase 3 studies (MARINE and ANCHOR) in adult patients with hypertriglyceridemia-and examined the relationship between EPA levels and TG-lowering effects in MARINE and ANCHOR. In all 3 studies, icosapent ethyl produced dose-dependent increases in the concentrations of EPA in plasma and RBCs. In both MARINE and ANCHOR, these dose-dependent EPA increases correlated with the degree of TG level lowering (all P<0.01). In patients with high TG levels (≥200mg/dL) and treated with icosapent ethyl 4g/day, the end-of-treatment plasma and RBC EPA concentrations were >170μg/mL and>70μg/mL, respectively. These studies support icosapent ethyl as producing predictable dose-dependent pharmacokinetics/pharmacodynamics, with TG level lowering dependent upon icosapent ethyl dose and EPA concentrations in plasma and RBCs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Liquid chromatography-mass spectrometry for measuring deoxythioguanosine in DNA from thiopurine-treated patients.

PubMed

Coulthard, Sally A; Berry, Phil; McGarrity, Sarah; Ansari, Azhar; Redfern, Christopher P F

2016-08-15

Adverse reactions and non-response are common in patients treated with thiopurine drugs. Current monitoring of drug metabolite levels for guiding treatment are limited to analysis of thioguanine nucleotides (TGNs) in erythrocytes after chemical derivatisation. Erythrocytes are not the target tissue and TGN levels show poor correlations with clinical response. We have developed a sensitive assay to quantify deoxythioguanosine (dTG) without derivatisation in the DNA of nucleated blood cells. Using liquid chromatography and detection by tandem mass spectrometry, an intra- and inter-assay variability below 7.8% and 17.0% respectively were achieved. The assay had a detection limit of 0.0003125ng (1.1 femtomoles) dTG and was quantified in DNA samples relative to endogenous deoxyadenosine (dA) in a small group of 20 patients with inflammatory bowel disease, all of whom had been established on azathioprine (AZA) therapy for more than 25 weeks. These patients had dTG levels of 20-1360mol dTG/10(6)mol dA; three patients who had not started therapy had no detectable dTG. This method, comparable to previous methods in sensitivity, enables the direct detection of a cytotoxic thiopurine metabolite without derivatisation in an easily obtainable, stable sample and will facilitate a better understanding of the mechanisms of action of these inexpensive yet effective drugs. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Conformers, infrared spectrum and UV-induced photochemistry of matrix-isolated furfuryl alcohol.

PubMed

Araujo-Andrade, C; Gómez-Zavaglia, A; Reva, I D; Fausto, R

2012-03-08

The infrared spectra of furfuryl alcohol (2-furanmethanol, FFA) were investigated for FFA monomers isolated in low-temperature argon matrices. The structural interpretation of the obtained experimental spectra was assisted by analysis of the molecule's conformational landscape. According to the DFT(B3LYP)/6-311++G(d,p) calculations, five different minimum energy structures were found on the potential energy surface of the molecule. They can be defined by the orientation of the OCCO and CCOH dihedral angles: GG', GG, TG, TT, GT (G = +gauche, G' = -gauche, T = trans) and have a symmetry equivalent configuration: GG' = G'G, GG = G'G', TG = TG', GT = G'T. When zero-point energies are taken into account, only three (GG', GG, and TT) out of the five unique minima correspond to stable structures. The most stable conformer GG' (OCCO, 72.7°; CCOH, -59.3°), which in gas phase at room temperature accounts for ∼65% of the total population, was the only form isolated in the argon matrices at 14 K. The other two relevant forms convert into conformer GG' during matrix deposition. The low temperature glassy and crystalline states of FFA were also obtained and their infrared spectra assigned, suggesting the sole existence of the GG' conformer also in these phases. The photochemical behavior of FFA induced in situ, by tunable UV-laser, was also studied. The longest wavelength resulting in photochemical changes in the structure of the irradiated sample was found to be λ = 229 nm. Such UV irradiation of the matrix-isolated FFA led to production of formaldehyde and different isomeric C(4)H(4)O species. Cycloprop-2-ene-1-carbaldehyde and buta-2,3-dienal (two conformers) are the main initial C(4)H(4)O photoproducts formed upon short-time excitation at λ = 229 nm. But-3-ynal (two conformers) was the principal photoproduct resulting from prolonged excitation at λ= 229 nm, being consumed upon irradiation at shorter wavelengths (λ < 227.5 nm). Vinyl ketene is produced from FFA in the trans conformation and undergoes isomerization to the cis form upon irradiation at λ < 227.5 nm. Cyclopropene, propyne, allene, and CO were also identified in the irradiated matrices (in particular at the later stages of irradiation), suggesting that the photoproduced aldehydes partially decarbonylate during the performed photochemical experiments.

Disodium cromoglycate may act as a novel adjuvant for UV-attenuated Toxoplasma gondii vaccine in mouse model.

PubMed

Li, Xi; Wu, Yifan; Huang, Shiguang; Lu, Fangli

2018-06-01

We have proven the beneficial effects during acute Toxoplasma gondii infection when mast cells were inhibited by disodium cromoglycate (DSCG). Here we investigated the adjuvant effect of DSCG on the protective efficacy of UV-attenuated T. gondii (UV-Tg) vaccine. Mice were infected with 10 2 Tg alone or infected with 10 2 Tg plus DSCG (Tg + DSCG), immunized with 10 5 UV-Tg and challenged with 10 2 Tg (UV-Tg + Tg) or immunized with 10 5 UV-Tg plus DSCG and challenged with 10 2 Tg (UV-Tg + DSCG + Tg). Compared to Tg group, Tg + DSCG, UV-Tg + Tg, and UV-Tg + DSCG + Tg showed significantly prolonged survival times, decreased parasite burdens, reduced liver histopathologies, and increased levels of Th1 and Th2 cytokines and IL-17 in the livers and spleens by using quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR). Compared to UV-Tg + Tg, UV-Tg + DSCG + Tg had significantly longer survival time, lower tissue parasite burden and histopathological score, and higher levels of Th1 and Th2 cytokines and IL-17 in the livers or spleens. Our data suggest that DSCG may play an adjuvant role in the immunization induced by UV-attenuated T. gondii in mice, by promoting cellular immune response against T. gondii challenge. Copyright © 2018 Elsevier B.V. All rights reserved.

Development of carbon-11 labeled acryl amides for selective PET imaging of active tissue transglutaminase.

PubMed

van der Wildt, Berend; Wilhelmus, Micha M M; Bijkerk, Jonne; Haveman, Lizeth Y F; Kooijman, Esther J M; Schuit, Robert C; Bol, John G J M; Jongenelen, Cornelis A M; Lammertsma, Adriaan A; Drukarch, Benjamin; Windhorst, Albert D

2016-04-01

Tissue transglutaminase (TG2) is a ubiquitously expressed enzyme capable of forming metabolically and mechanically stable crosslinks between the γ-carboxamide of a glutamine acyl-acceptor substrate and the ε-amino functionality of a lysine acyl-donor substrate resulting in protein oligomers. High TG2 crosslinking activity has been implicated in the pathogenesis of various diseases including celiac disease, cancer and fibrotic and neurodegenerative diseases. Development of a PET tracer specific for active TG2 provides a novel tool to further investigate TG2 biology in vivo in disease states. Recently, potent irreversible active site TG2 inhibitors carrying an acrylamide warhead were synthesized and pharmacologically characterized. Three of these inhibitors, compound 1, 2 and 3, were successfully radiolabeled with carbon-11 on the acrylamide carbonyl position using a palladium mediated [(11)C]CO aminocarbonylation reaction. Ex vivo biodistribution and plasma stability were evaluated in healthy Wistar rats. Autoradiography was performed on MDA-MB-231 tumor sections. [(11)C]1, -2 and -3 were obtained in decay corrected radiochemical yields of 38-55%. Biodistribution showed low uptake in peripheral tissues, with the exception of liver and kidney. Low brain uptake of <0.05% ID/g was observed. Blood plasma analysis demonstrated that [(11)C]1 and [(11)C]2 were rapidly metabolized, whereas [(11)C]3 was metabolized at a more moderate rate (63.2 ± 6.8 and 28.7 ± 10.8% intact tracer after 15 and 45 min, respectively). Autoradiography with [(11)C]3 on MDA-MB-231 tumor sections showed selective and specific binding of the radiotracer to the active state of TG2. Taken together, these results identify [(11)C]3 as the most promising of the three compounds tested for development as PET radiotracer for the in vivo investigation of TG2 activity. Copyright © 2016 Elsevier Inc. All rights reserved.

Differential role of thiopurine methyltransferase in the cytotoxic effects of 6-mercaptopurine and 6-thioguanine on human leukemia cells.

PubMed

Karim, Hazhar; Ghalali, Aram; Lafolie, Pierre; Vitols, Sigurd; Fotoohi, Alan K

2013-07-26

The thiopurine antimetabolites, 6-mercaptopurine (6-MP) and 6-thioguanine (6-TG) are inactive pro-drugs that require intracellular metabolism for activation to cytotoxic metabolites. Thiopurine methyltransferase (TPMT) is one of the most important enzymes in this process metabolizing both 6-MP and 6-TG to different methylated metabolites including methylthioinosine monophosphate (meTIMP) and methylthioguanosine monophosphate (meTGMP), respectively, with different suggested pharmacological and cytotoxic properties. While meTIMP is a potent inhibitor of de novo purine synthesis (DNPS) and significantly contributes to the cytotoxic effects of 6-MP, meTGMP, does not add much to the effects of 6-TG, and the cytotoxicity of 6-TG seems to be more dependent on incorporation of thioguanine nucleotides (TGNs) into DNA rather than inhibition of DNPS. In order to investigate the role of TPMT in metabolism and thus, cytotoxic effects of 6-MP and 6-TG, we knocked down the expression of the gene encoding the TPMT enzyme using specifically designed small interference RNA (siRNA) in human MOLT4 leukemia cells. The knock-down was confirmed at RNA, protein, and enzyme function levels. Apoptosis was determined using annexin V and propidium iodide staining and FACS analysis. The results showed a 34% increase in sensitivity of MOLT4 cells to 1μM 6-TG after treatment with TPMT-targeting siRNA, as compared to cells transfected with non-targeting siRNA, while the sensitivity of the cells toward 6-MP was not affected significantly by down-regulation of the TPMT gene. This differential contribution of the enzyme TPMT to the cytotoxicity of the two thiopurines is probably due to its role in formation of the meTIMP, the cytotoxic methylated metabolite of 6-MP, while in case of 6-TG methylation by TPMT substantially deactivates the drug. Copyright © 2013 Elsevier Inc. All rights reserved.

Impact of a commercially available model-based dose calculation algorithm on treatment planning of high-dose-rate brachytherapy in patients with cervical cancer.

PubMed

Abe, Kota; Kadoya, Noriyuki; Sato, Shinya; Hashimoto, Shimpei; Nakajima, Yujiro; Miyasaka, Yuya; Ito, Kengo; Umezawa, Rei; Yamamoto, Takaya; Takahashi, Noriyoshi; Takeda, Ken; Jingu, Keiichi

2018-03-01

We evaluated the impact of model-based dose calculation algorithms (MBDCAs) on high-dose-rate brachytherapy (HDR-BT) treatment planning for patients with cervical cancer. Seven patients with cervical cancer treated using HDR-BT were studied. Tandem and ovoid applicators were used in four patients, a vaginal cylinder in one, and interstitial needles in the remaining two patients. MBDCAs were applied to the Advanced Collapsed cone Engine (ACE; Elekta, Stockholm, Sweden). All plans, which were originally calculated using TG-43, were re-calculated using both ACE and Monte Carlo (MC) simulations. Air was used as the rectal material. The mean difference in the rectum D2cm3 between ACErec-air and MCrec-air was 8.60 ± 4.64%, whereas that in the bladder D2cm3 was -2.80 ± 1.21%. Conversely, in the small group analysis (n = 4) using water instead of air as the rectal material, the mean difference in the rectum D2cm3 between TG-43 and ACErec-air was 11.87 ± 2.65%, whereas that between TG-43 and ACErec-water was 0.81 ± 2.04%, indicating that the use of water as the rectal material reduced the difference in D2cm3 between TG-43 and ACE. Our results suggested that the differences in the dose-volume histogram (DVH) parameters of TG-43 and ACE were large for the rectum when considerable air (gas) volume was present in it, and that this difference was reduced when the air (gas) volume was reduced. Also, ACE exhibited better dose calculation accuracy than that of TG-43 in this situation. Thus, ACE may be able to calculate the dose more accurately than TG-43 for HDR-BT in treating cervical cancers, particularly for patients with considerable air (gas) volume in the rectum.

Impact of a commercially available model-based dose calculation algorithm on treatment planning of high-dose-rate brachytherapy in patients with cervical cancer

PubMed Central

Abe, Kota; Kadoya, Noriyuki; Sato, Shinya; Hashimoto, Shimpei; Nakajima, Yujiro; Miyasaka, Yuya; Ito, Kengo; Umezawa, Rei; Yamamoto, Takaya; Takahashi, Noriyoshi; Takeda, Ken; Jingu, Keiichi

2018-01-01

Abstract We evaluated the impact of model-based dose calculation algorithms (MBDCAs) on high-dose-rate brachytherapy (HDR-BT) treatment planning for patients with cervical cancer. Seven patients with cervical cancer treated using HDR-BT were studied. Tandem and ovoid applicators were used in four patients, a vaginal cylinder in one, and interstitial needles in the remaining two patients. MBDCAs were applied to the Advanced Collapsed cone Engine (ACE; Elekta, Stockholm, Sweden). All plans, which were originally calculated using TG-43, were re-calculated using both ACE and Monte Carlo (MC) simulations. Air was used as the rectal material. The mean difference in the rectum D2cm3 between ACErec-air and MCrec-air was 8.60 ± 4.64%, whereas that in the bladder D2cm3 was −2.80 ± 1.21%. Conversely, in the small group analysis (n = 4) using water instead of air as the rectal material, the mean difference in the rectum D2cm3 between TG-43 and ACErec-air was 11.87 ± 2.65%, whereas that between TG-43 and ACErec-water was 0.81 ± 2.04%, indicating that the use of water as the rectal material reduced the difference in D2cm3 between TG-43 and ACE. Our results suggested that the differences in the dose–volume histogram (DVH) parameters of TG-43 and ACE were large for the rectum when considerable air (gas) volume was present in it, and that this difference was reduced when the air (gas) volume was reduced. Also, ACE exhibited better dose calculation accuracy than that of TG-43 in this situation. Thus, ACE may be able to calculate the dose more accurately than TG-43 for HDR-BT in treating cervical cancers, particularly for patients with considerable air (gas) volume in the rectum. PMID:29378024

Cognitive deficits associated with combined HIV gp120 expression and chronic methamphetamine exposure in mice.

PubMed

Kesby, James P; Markou, Athina; Semenova, Svetlana

2015-01-01

Methamphetamine abuse is common among individuals infected by human immunodeficiency virus (HIV). Neurocognitive outcomes tend to be worse in methamphetamine users with HIV. However, it is unclear whether discrete cognitive domains are susceptible to impairment after combined HIV infection and methamphetamine abuse. The expression of HIV/gp120 protein induces neuropathology in mice similar to HIV-induced pathology in humans. We investigated the separate and combined effects of methamphetamine exposure and gp120 expression on cognitive function in transgenic (gp120-tg) and control mice. The mice underwent an escalating methamphetamine binge regimen and were tested in novel object/location recognition, object-in-place recognition, and Barnes maze tests. gp120 expression disrupted performance in the object-in-place test (i.e. similar time spent with all objects, regardless of location), indicating deficits in associative recognition memory. gp120 expression also altered reversal learning in the Barnes maze, suggesting impairments in executive function. Methamphetamine exposure impaired spatial strategy in the Barnes maze, indicating deficits in spatial learning. Methamphetamine-exposed gp120-tg mice had the lowest spatial strategy scores in the final acquisition trials in the Barnes maze, suggesting greater deficits in spatial learning than all of the other groups. Although HIV infection involves interactions between multiple proteins and processes, in addition to gp120, our findings in gp120-tg mice suggest that humans with the dual insult of HIV infection and methamphetamine abuse may exhibit a broader spectrum of cognitive deficits than those with either factor alone. Depending on the cognitive domain, the combination of both insults may exacerbate deficits in cognitive performance compared with each individual insult. Copyright © 2014 Elsevier B.V. and ECNP. All rights reserved.

Cognitive deficits associated with combined HIV gp120 expression and chronic methamphetamine exposure in mice

PubMed Central

Kesby, James P.; Markou, Athina; Semenova, Svetlana

2014-01-01

Methamphetamine abuse is common among individuals infected by human immunodeficiency virus (HIV). Neurocognitive outcomes tend to be worse in methamphetamine users with HIV. However, it is unclear whether discrete cognitive domains are susceptible to impairment after combined HIV infection and methamphetamine abuse. The expression of HIV/gp120 protein induces neuropathology in mice similar to HIV-induced pathology in humans. We investigated the separate and combined effects of methamphetamine exposure and gp120 expression on cognitive function in transgenic (gp120-tg) and control mice. The mice underwent an escalating methamphetamine binge regimen and were tested in novel object/location recognition, object-in-place recognition, and Barnes maze tests. gp120 expression disrupted performance in the object-in-place test (i.e., similar time spent with all objects, regardless of location), indicating deficits in associative recognition memory. gp120 expression also altered reversal learning in the Barnes maze, suggesting impairments in executive function. Methamphetamine exposure impaired spatial strategy in the Barnes maze, indicating deficits in spatial learning. Methamphetamine-exposed gp120-tg mice had the lowest spatial strategy scores in the final acquisition trials in the Barnes maze, suggesting greater deficits in spatial learning than all of the other groups. Although HIV infection involves interactions between multiple proteins and processes, in addition to gp120, our findings in gp120-tg mice suggest that humans with the dual insult of HIV infection and methamphetamine abuse may exhibit a broader spectrum of cognitive deficits than those with either factor alone. Depending on the cognitive domain, the combination of both insults may exacerbate deficits in cognitive performance compared with each individual insult. PMID:25476577

Prevalence of celiac disease in adult Chinese patients with diarrhea-predominant irritable bowel syndrome: A prospective, controlled, cohort study.

PubMed

Kou, Guan Jun; Guo, Jing; Zuo, Xiu Li; Li, Chang Qing; Liu, Chao; Ji, Rui; Liu, Han; Wang, Xiao; Li, Yan Qing

2018-03-01

Celiac disease is a chronic inflammatory enteropathy with a symptom spectrum similar to that of irritable bowel syndrome (IBS). It is a common but largely undiagnosed condition in the Western countries. However, it is extremely rare among Chinese individuals, and few studies have investigated its prevalence in China. The aim was to determine the prevalence of celiac disease in patients with IBS who were diagnosed using the Rome III criteria in a single center of northern China. This was a single-center, prospective, controlled cohort study performed in Qilu Hospital involving 246 patients with IBS and 246 healthy controls. Blood samples were drawn to assess serum tissue transglutaminase immunoglobulin A (tTg-IgA). Patients with a positive or equivocal tTg-IgA (≥15 U/mL) were subjected to probe-based confocal laser endomicroscopy (pCLE) and duodenal biopsy to confirm celiac disease. Altogether 12 (4.9%) patients with IBS and two (0.8%) healthy controls were positive or equivocal for serum tTg-IgA. Of these, five patients with IBS underwent pCLE and a targeted biopsy; all were histopathologically found to have celiac disease, although one was eventually diagnosed with lymphoma. After implementation of a gluten-free diet, seven patients serologically positive for IBS showed clinical improvement, thus our study illustrated a minimum prevalence of 2.85% of celiac disease among patients with IBS in our center. Celiac disease is not rare in Chinese individuals, particularly among those with IBS. Therefore, it should receive higher attention in clinical practice in China. © 2018 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.

Inclusion complexes of cypermethrin and permethrin with monochlorotriazinyl-beta-cyclodextrin: A combined spectroscopy, TG/DSC and DFT study

NASA Astrophysics Data System (ADS)

Yao, Qi; You, Bin; Zhou, Shuli; Chen, Meng; Wang, Yujiao; Li, Wei

2014-01-01

The suitable size hydrophobic cavity and monochlorotriazinyl group as a reactive anchor make MCT-β-CD to be widely used in fabric finishing. In this paper, the inclusion complexes of monochlorotriazinyl-beta-cyclodextrin (MCT-β-CD) with cypermethrin (CYPERM) and permethrin (PERM) are synthesized and analyzed by TG/DSC, FT-IR and Raman spectroscopy. TG/DSC reveals that the decomposed temperatures of inclusion complexes are lower by 25-30 °C than that of physical mixtures. DFT calculations in conjunction with FT-IR and Raman spectral analyses are used to study the structures of MCT-β-CD and their inclusion complexes. Four isomers of trisubstituted MCT-β-CD are designed and DFT calculations reveal that 1,3,5-trisubstituted MCT-β-CD has the lowest energy and can be considered as main component of MCT-β-CD. The ground-state geometries, vibrational wavenumbers, IR and Raman intensities of MCT-β-CD and their inclusion complexes were calculated at B3LYP/6-31G (d) level of theory. Upon examining the optimized geometry of inclusion complex, we find that the CYPERM and PERM are inserted into the toroid of MCT-β-CD from the larger opening. The band at 1646 cm-1 in IR and at 1668 cm-1 in Raman spectrum reveals that monochloroazinyl group of MCT-β-CD exists in ketone form but not in anion form. The noticeable IR and Raman shift of phenyl reveals that these two benzene rings of CYPERM and PERM stays inside the cavity of MCT-β-CD and has weak interaction with MCT-β-CD. This spectroscopy conclusion is consistent with theoretical predicted structure.

Exploration on effects of 15 nm SiO2 filler on miscibility, thermal stability and ionic conductivity of PMMA/ENR 50 electrolytes

NASA Astrophysics Data System (ADS)

Zamri, S. F. M.; Latif, F. A.; Ali, A. M. M.; Ibrahim, R.; Azuan, S. I. H. M.; Kamaluddin, N.; Hadip, F.

2017-02-01

The effects of silicon dioxide (SiO2) (15 nm) filler on miscibility, thermal stability and ionic conductivity of polymethyl methacrylate/50% epoxidized narural rubber (PMMA/ENR 50) electrolytes were successfully explored. Samples were prepared by solvent casting method with tetrahydrofuran (THF) as solvent and doped with lithium tetrafluoroborate (LiBF4). Fourier transform infrared spectroscopy (FTIR) confirmed the present of hydrogen bond between PMMA and ENR 50. However, the hydrogen bond was reduced when SiO2 was added. Differential scanning calorimeter (DSC) analysis shows that PMMA/ENR 50 blends exhibit two glass transition temperatures (Tgs) recorded at -35 and 89 °C corresponding to the Tg of ENR 50 rich phase (Tg1) and PMMA rich phase (Tg2), respectively. However, the two Tgs almost merging and reduced when SiO2 was added. Tg1 was found increases as SiO2 weight percent increased. Thermogravimetric analysis (TGA) revealed that thermal degradation temperatures (Tds) of SiO2 filled PMMA/ENR 50 was similar as PMMA/ENR 50. Interestingly, thermal degradation temperatures of the loss of impurities (Td1) and thermal degradation temperatures of PMMA side chain (Td2) were increased when SiO2 was added. Meanwhile thermal degradation temperatures of main PMMA and ENR 50 main chain (Td3) was decreased as SiO2 was added. There was no significant change in Td1, Td2 and Td3 as SiO2 weight percent was varied. Electrochemical impedence spectroscopy (EIS) analysis shows that room temperature ionic conductivity of SiO2 filled PMMA/ENR 50 electrolytes were higher compaed PMMA/ENR 50 electrolyte with two conductivity maxima.

Trans-Gastric ERCP After Roux-en-Y Gastric Bypass: Systematic Review and Meta-Analysis.

PubMed

Aiolfi, Alberto; Asti, Emanuele; Rausa, Emanuele; Bernardi, Daniele; Bonitta, Gianluca; Bonavina, Luigi

2018-04-23

Trans-oral endoscopic access to the pancreaticobiliary system is challenging after Roux-en-Y gastric bypass (RYGB). Trans-gastric ERCP (TG-ERCP) has emerged as a viable option to manage patients with symptomatic post-RYBG choledocolithiasis. The aim of this systematic review and meta-analysis was to examine the outcomes of TG-ERCP to better define the risk-benefit ratio of this procedure and to guide clinical decision-making. A literature search was conducted to identify all reports on ERCP after RYGB. Pubmed, MEDLINE, Embase, and Cochrane databases were thoroughly consulted matching the terms "ERCP" AND "gastric bypass." Pooled prevalence of ERCP success rate, ERCP-related morbidity, post-procedural infectious complications, and overall morbidity were calculated using Freeman-Tukey double arcsine transformation and DerSimonian-Laird estimator in random effect meta-analysis. Heterogeneity among studies was evaluated using I 2 -index and Cochrane Q test. Meta-regression was used to address the effect of potential confounders. Thirteen papers published between 2009 and 2017 matched the inclusion criteria. Eight hundred fifty patients undergoing 931 procedures were included. The most common clinical indications for TG-ERCP were biliary (90%) and pancreatic (10%). The majority of patients underwent an initial laparoscopic approach (90%). Same-day ERCP was successfully achieved in 703 cases (75.5%). Pooled prevalence of ERCP success rate, ERCP-related morbidity, post-procedural infectious complications, and overall morbidity were 99% (95% CI = 98-100%), 3.1% (95% CI = 1.0-5.8%), 3.4% (95% CI = 1.7-5.5%), and 14.2% (95% CI = 8.5-20.8%), respectively. TG-ERCP is a safe and effective therapeutic option in patients with symptomatic post-RYGB choledocolithiasis.

Triglyceride Glucose-Body Mass Index Is a Simple and Clinically Useful Surrogate Marker for Insulin Resistance in Nondiabetic Individuals.

PubMed

Er, Leay-Kiaw; Wu, Semon; Chou, Hsin-Hua; Hsu, Lung-An; Teng, Ming-Sheng; Sun, Yu-Chen; Ko, Yu-Lin

2016-01-01

Insulin resistance (IR) and the consequences of compensatory hyperinsulinemia are pathogenic factors for a set of metabolic abnormalities, which contribute to the development of diabetes mellitus and cardiovascular diseases. We compared traditional lipid levels and ratios and combined them with fasting plasma glucose (FPG) levels or adiposity status for determining their efficiency as independent risk factors for IR. We enrolled 511 Taiwanese individuals for the analysis. The clinical usefulness of various parameters--such as traditional lipid levels and ratios; visceral adiposity indicators, visceral adiposity index (VAI), and lipid accumulation product (LAP); the product of triglyceride (TG) and FPG (the TyG index); TyG with adiposity status (TyG-body mass index [BMI]) and TyG-waist circumference index [WC]); and adipokine levels and ratios--was analyzed to identify IR. For all lipid ratios, the TG/high-density lipoprotein cholesterol (HDL-C) ratio had the highest additional percentage of variation in the homeostasis model assessment of insulin resistance (HOMA-IR; 7.0% in total); for all variables of interest, TyG-BMI and leptin-adiponectin ratio (LAR) were strongly associated with HOMA-IR, with 16.6% and 23.2% of variability, respectively. A logistic regression analysis revealed similar patterns. A receiver operating characteristic (ROC) curve analysis indicated that TG/HDL-C was a more efficient IR discriminator than other lipid variables or ratios. The area under the ROC curve (AUC) for VAI (0.734) and TyG (0.708) was larger than that for TG/HDL-C (0.707). TyG-BMI and LAR had the largest AUC (0.801 and 0.801, respectively). TyG-BMI is a simple, powerful, and clinically useful surrogate marker for early identification of IR.

Triglyceride Glucose-Body Mass Index Is a Simple and Clinically Useful Surrogate Marker for Insulin Resistance in Nondiabetic Individuals

PubMed Central

Er, Leay-Kiaw; Wu, Semon; Chou, Hsin-Hua; Hsu, Lung-An; Teng, Ming-Sheng; Sun, Yu-Chen; Ko, Yu-Lin

2016-01-01

Background Insulin resistance (IR) and the consequences of compensatory hyperinsulinemia are pathogenic factors for a set of metabolic abnormalities, which contribute to the development of diabetes mellitus and cardiovascular diseases. We compared traditional lipid levels and ratios and combined them with fasting plasma glucose (FPG) levels or adiposity status for determining their efficiency as independent risk factors for IR. Methods We enrolled 511 Taiwanese individuals for the analysis. The clinical usefulness of various parameters—such as traditional lipid levels and ratios; visceral adiposity indicators, visceral adiposity index (VAI), and lipid accumulation product (LAP); the product of triglyceride (TG) and FPG (the TyG index); TyG with adiposity status (TyG-body mass index [BMI]) and TyG-waist circumference index [WC]); and adipokine levels and ratios—was analyzed to identify IR. Results For all lipid ratios, the TG/high-density lipoprotein cholesterol (HDL-C) ratio had the highest additional percentage of variation in the homeostasis model assessment of insulin resistance (HOMA-IR; 7.0% in total); for all variables of interest, TyG-BMI and leptin-adiponectin ratio (LAR) were strongly associated with HOMA-IR, with 16.6% and 23.2% of variability, respectively. A logistic regression analysis revealed similar patterns. A receiver operating characteristic (ROC) curve analysis indicated that TG/HDL-C was a more efficient IR discriminator than other lipid variables or ratios. The area under the ROC curve (AUC) for VAI (0.734) and TyG (0.708) was larger than that for TG/HDL-C (0.707). TyG-BMI and LAR had the largest AUC (0.801 and 0.801, respectively). Conclusion TyG-BMI is a simple, powerful, and clinically useful surrogate marker for early identification of IR. PMID:26930652

Recognition pattern of thyroglobulin autoantibody from hypothyroid dogs to tryptic peptides of canine thyroglobulin.

PubMed

Tani, Hiroyuki; Shimizu, Reiko; Sasai, Kazumi; Baba, Eiichiroh

2003-10-01

Circulating thyroglobulin autoantibody (TgAA) was analyzed using the Western immunoblot for determination of the dominant epitopes recognized by TgAA on tryptic peptides of canine thyroglobulin (cTg) in hypothyroid dogs. TgAA was measured in hypothyroid dogs, non-hypothyroid dogs with skin diseases and clinically normal dogs. Five of the 7 hypothyroid dogs, 1 of the 8 dogs with skin diseases and 1 of the 4 normal dogs were positive for TgAA. Four of the 5 TgAA-positive hypothyroid dogs were Golden Retrievers, and 3 of them showed high antibody titers. The sera of TgAA positive-dogs reacted to several peptides, and their patterns varied from sample to sample. Sera from 3 dogs with high titers of TgAA reacted broadly to high molecular weight peptides ranging from 45 to 90 kDa. These Western immunoblot patterns of the sera were disappeared after pretreatment with sufficient amount of intact cTg. All serum samples of both TgAA positive dogs and negative controls reacted to low molecular weight peptides ranging from 15 to 20 kDa. These immunoblot patterns of the sera were not disappeared even after pretreatment with sufficient amount of intact cTg. These findings show the possibility that the epitopes recognized by TgAA depend upon individual dogs with hypothyroidism and these autoantibodies recognize conformational epitopes on the cTg molecule.

Genetic variants of apolipoprotein A5 T-1131C and apolipoprotein E common polymorphisms and their relationship to features of metabolic syndrome in adult dyslipidemic patients.

PubMed

Novotny, Dalibor; Vaverkova, Helena; Karasek, David; Malina, Pavel

2014-08-01

The aim was to evaluate the relationships of the T-1131C (rs662799) polymorphism variants of apolipoprotein A5 (Apo A5) gene and variants of apolipoprotein E (Apo E) gene common polymorphism (rs429358, rs7412) to signs of metabolic syndrome (MetS). We examined 590 asymptomatic dyslipidemic patients divided into MetS+ (n=146) and MetS- (n=444) groups according to criteria of NCEP ATPIII Panel. We evaluated genotype frequencies and differences in MetS features between individual groups. Logistic regression analysis was used for the evaluation of Apo A5/Apo E variants as possible risk factors for MetS. We found no statistical differences between genotype and allele frequencies for both Apo A5 and Apo E polymorphisms between MetS+ and MetS- groups. In all subjects and MetS- group, we confirmed well-known association of the -1131C Apo A5 minor allele with elevated triglycerides (TG, p<0.001). The Apo E gene E2 and E4 variants were associated with higher levels of TG (p<0.01) in comparison to E33 common variant. However, no statistical differences were observed in MetS+ subjects, regardless of significantly higher TG levels in this group. Apo A5/Apo E variant analysis in all dyslipidemic patients revealed significant increase of TG levels in all subgroups in comparison to common -1131T/E3 variant carriers, the most in -1131C/E4 variant subgroup. Logistic regression analysis models showed no association of Apo A5, Apo E and all Apo A5/Apo E variants with metabolic syndrome, even after adjustment for age and sex. Our study refined the role of Apo A5 and Apo E genetic variants in the group of adult dyslipidemic patients. We demonstrate that except of TG, Apo A5 T-1131C (rs662799) and Apo E (rs429358, rs7412) polymorphisms have no remarkable effect on MetS characteristics. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Production of the Main Celiac Disease Autoantigen by Transient Expression in Nicotiana benthamiana

PubMed Central

Marín Viegas, Vanesa S.; Acevedo, Gonzalo R.; Bayardo, Mariela P.; Chirdo, Fernando G.; Petruccelli, Silvana

2015-01-01

Celiac Disease (CD) is a gluten sensitive enteropathy that remains widely undiagnosed and implementation of massive screening tests is needed to reduce the long term complications associated to untreated CD. The main CD autoantigen, human tissue transglutaminase (TG2), is a challenge for the different expression systems available since its cross-linking activity affects cellular processes. Plant-based transient expression systems can be an alternative for the production of this protein. In this work, a transient expression system for the production of human TG2 in Nicotiana benthamiana leaves was optimized and reactivity of plant-produced TG2 in CD screening test was evaluated. First, a subcellular targeting strategy was tested. Cytosolic, secretory, endoplasmic reticulum (C-terminal SEKDEL fusion) and vacuolar (C-terminal KISIA fusion) TG2 versions were transiently expressed in leaves and recombinant protein yields were measured. ER-TG2 and vac-TG2 levels were 9- to 16-fold higher than their cytosolic and secretory counterparts. As second strategy, TG2 variants were co-expressed with a hydrophobic elastin-like polymer (ELP) construct encoding for 36 repeats of the pentapeptide VPGXG in which the guest residue X were V and F in ratio 8:1. Protein bodies (PB) were induced by the ELP, with a consequent two-fold-increase in accumulation of both ER-TG2 and vac-TG2. Subsequently, ER-TG2 and vac-TG2 were produced and purified using immobilized metal ion affinity chromatography. Plant purified ER-TG2 and vac-TG2 were recognized by three anti-TG2 monoclonal antibodies that bind different epitopes proving that plant-produced antigen has immunochemical characteristics similar to those of human TG2. Lastly, an ELISA was performed with sera of CD patients and healthy controls. Both vac-TG2 and ER-TG2 were positively recognized by IgA of CD patients while they were not recognized by serum from non-celiac controls. These results confirmed the usefulness of plant-produced TG2 to develop screening assays. In conclusion, the combination of subcellular sorting strategy with co-expression with a PB inducing construct was sufficient to increase TG2 protein yields. This type of approach could be extended to other problematic proteins, highlighting the advantages of plant based production platforms. PMID:26648956

Isozyme-specific comprehensive characterization of transglutaminase-crosslinked substrates in kidney fibrosis.

PubMed

Tatsukawa, Hideki; Otsu, Risa; Tani, Yuji; Wakita, Ryosuke; Hitomi, Kiyotaka

2018-05-09

Chronic kidney disease is characterized by prolonged decline in renal function, excessive accumulation of ECM, and progressive tissue fibrosis. Transglutaminase (TG) is a crosslinking enzyme that catalyzes the formation of covalent bonds between glutamine and lysine residues, and is involved in the induction of renal fibrosis via the stabilization of ECM and the activation of TGF-β1. Despite the accumulating evidences indicating that TG2 is a key enzyme in fibrosis, genetic knockout of TG2 reduced by only 50% the elevated protein crosslinking and fibrous protein in renal fibrosis model, whereas treatment with TG inhibitor almost completely reduced these levels. Here, we also clarified the distributions of TG isozymes and their in situ activities and identified the isozyme-specific crosslinked substrates for both TG1 and TG2 in fibrotic kidney. We found that TG1 activity was markedly enhanced in renal tubular epithelium and interstitial areas, whereas TG2 activity increased only in the extracellular space. In total, 47 and 67 possible candidates were identified as TG1 and TG2 substrates, respectively, only in fibrotic kidney. Among them, several possible substrates related to renal disease and fibrosis were identified. These findings provide novel insights into the mechanisms of renal fibrosis through the targeting of isozyme-specific TG substrates.

Centennial-scale analysis of the creation and fate of reactive nitrogen in China (1910–2010)

PubMed Central

Cui, Shenghui; Shi, Yalan; Groffman, Peter M.; Schlesinger, William H.; Zhu, Yong-Guan

2013-01-01

Human mobilization and use of reactive nitrogen (Nr) has been one of the major aspects of global change over the past century. Nowhere has that change been more dramatic than in China, where annual net Nr creation increased from 9.2 to 56 Tg from 1910 to 2010. Since 1956, anthropogenic Nr creation exceeded natural Nr creation, contributing over 80% of total Nr until 2010. There is great interest and uncertainty in the fate and effects of this Nr in China. Here, a comprehensive inventory of Nr in China shows that Nr (including recycled Nr) has continuously and increasingly accumulated on land (from 17 to 45 Tg), accompanied by increasing transfers to the atmosphere (before deposition; from 7.6 to 20 Tg), inland waters (from 2.7 to 9.6 Tg), and coastal waters (from 4.5 to 7.7 Tg) over the past 30 y. If current trends continue, Nr creation from human activities will increase to 63 Tg by 2050, raising concerns about deleterious environmental consequences for land, air, and water at regional and global scales. Tremendous amounts of Nr have accumulated in plants, soils, and waters in China over the past 30 y, but the retention capacity of the terrestrial landscape seems to be declining. There is a possibility that the negative environmental effects of excessive Nr may accelerate in coming decades, increasing the urgency to alter the trajectory of increasing Nr imbalance. Here, a conceptual framework of the relationships between human drivers and Nr cycling in China is oriented and well-targeted to Chinese abatement strategies for Nr environmental impact. PMID:23341613

APOE Modulates the Correlation Between Triglycerides, Cholesterol, and CHD Through Pleiotropy, and Gene-by-Gene Interactions

PubMed Central

Maxwell, Taylor J.; Ballantyne, Christie M.; Cheverud, James M.; Guild, Cameron S.; Ndumele, Chiadi E.; Boerwinkle, Eric

2013-01-01

Relationship loci (rQTL) exist when the correlation between multiple traits varies by genotype. rQTL often occur due to gene-by-gene (G × G) or gene-by-environmental interactions, making them a powerful tool for detecting G × G. Here we present an empirical analysis of apolipoprotein E (APOE) with respect to lipid traits and incident CHD leading to the discovery of loci that interact with APOE to affect these traits. We found that the relationship between total cholesterol (TC) and triglycerides (ln TG) varies by APOE isoform genotype in African-American (AA) and European-American (EA) populations. The e2 allele is associated with strong correlation between ln TG and TC while the e4 allele leads to little or no correlation. This led to a priori hypotheses that APOE genotypes affect the relationship of TC and/or ln TG with incident CHD. We found that APOE*TC was significant (P = 0.016) for AA but not EA while APOE*ln TG was significant for EA (P = 0.027) but not AA. In both cases, e2e2 and e2e3 had strong relationships between TC and ln TG with CHD while e2e4 and e4e4 results in little or no relationship between TC and ln TG with CHD. Using ARIC GWAS data, scans for loci that significantly interact with APOE produced four loci for African Americans (one CHD, one TC, and two HDL). These interactions contribute to the rQTL pattern. rQTL are a powerful tool to identify loci that modify the relationship between risk factors and disease and substantially increase statistical power for detecting G × G. PMID:24097412

Ultrastructural changes in the ovary cells of engorged Rhipicephalus sanguineus female ticks treated with esters of ricinoleic acid from castor oil (Ricinus communis).

PubMed

Sampieri, Bruno Rodrigues; Arnosti, André; Nunes, Pablo Henrique; Furquim, Karim Christina Scopinho; Chierice, Gilberto Orivaldo; Mathias, Maria Izabel Camargo

2012-05-01

Rhipicephalus sanguineus is a widely distributed tick species that has adapted to the urban environment, and the dog is its main host. This species is also known as a vector and reservoir of diseases caused by bacteria, protozoa, and viruses. Currently, acaricides of synthetic chemical origin have been widely and indiscriminately used, leading to the development of resistance to these products by ticks and causing damage to the environment. Thus, these issues have made it necessary to seek other forms of controlling these ectoparasites. R. sanguineus was artificially infested in host New Zealand White rabbits, which were divided into four treatment groups: control (CG1 and CG2) and treatment (TG1 and TG2) groups. TG1 and TG2 hosts were provided with feed supplemented with esters of ricinoleic acid from castor oil at a concentration of 5 g/kg of feed for 7 and 15 days. Afterward, the ovaries of the female ticks were removed for analysis by transmission electron microscopy. The results showed ultrastructural changes in the somatic and germ cells of ovaries from TG1 and TG2 females, particularly with respect to chorion deposition, a protective membrane of the oocyte, as well as in the transport process of vitellogenic materials via the hemolymph and pedicel cells. Moreover, the mitochondria were less electron-dense and had cristae that were more disorganized than the mitochondria from CG1 and CG2 individuals. Thus, this study demonstrated the action of esters on the ovaries of R. sanguineus, signaling the prospect of a way to control this ectoparasite without affecting nontarget organisms or the environment. Copyright © 2011 Wiley Periodicals, Inc.

Correlation of Serum Lipoprotein Ratios with Insulin Resistance in Infertile Women with Polycystic Ovarian Syndrome: A Case Control Study.

PubMed

Ghaffarzad, Aisa; Amani, Reza; Mehrzad Sadaghiani, Mahzad; Darabi, Masoud; Cheraghian, Bahman

2016-01-01

Dyslipidemia and insulin resistance (IR), occurring in most infertile women with polycystic ovarian syndrome (PCOS), increase the risk of cardiovascular disease (CVD) and type 2 diabetes. This study aimed to assess the relationships between lipoprotein ratios and IR in PCOS women. Thirty six infertile women with PCOS selected based on Androgen Excess Society (AES) criteria and 29 healthy women matched for age were recruited to this case-control study. After physical measurements, fasting serum glucose (Glu), insulin and lipid profile levels [triglycerides (TGs), total cholesterol (TC), low-density lipoproteincholesterol (LDL-C) and high-density lipoprotein-cholesterol (HDL-C)] were measured, while lipoprotein ratios (TC/HDL-C, LDL-C/HDL-C, TG/HDL-C) were calculated. IR was also calculated using homeostasis model assessment (HOMA)-IR. The optimal cutoffs of lipoprotein ratios in relation to HOMA-IR were calculated based on the Receiver Operating Characteristics (ROC) curve analysis using the area under curve (AUC). Waist circumference (WC), insulin levels, HOMA-IR, TG levels, and all lipoprotein ratios were significantly higher, while HDL-C was lower in PCOS group as compared to healthy controls. All lipoprotein ratios, TG levels, and WC are significantly correlated with insulin levels and HOMA-IR. Among lipoprotein ratios, the highest AUC of the ROC belonged to TG/HDL-C ratio with sensitivity of 63.6% and specificity of 84.4% (TG/HDL-C>3.19) as a marker of IR in infertile PCOS women. Lipoprotein ratios, particularly TG/HDL-C, are directly correlated with insulin levels and can be used as a marker of IR (HOMA-IR) in infertile PCOS patients.

Dynamic changes in plasma tissue plasminogen activator, plasminogen activator inhibitor-1 and beta-thromboglobulin content in ischemic stroke.

PubMed

Zhuang, Ping; Wo, Da; Xu, Zeng-Guang; Wei, Wei; Mao, Hui-ming

2015-07-01

The aim of this paper is to investigate the corresponding variations of plasma tissue plasminogen activator (t-PA) and plasminogen activator inhibitor-1 (PAI-1) activities, and beta-thromboglobulin (β-TG) content in patients during different stages of ischemic stroke. Ischemic stroke is a common disease among aging people and its occurrence is associated with abnormalities in the fibrinolytic system and platelet function. However, few reports focus on the dynamic changes in the plasma fibrinolytic system and β-TG content in patients with ischemic stroke. Patients were divided into three groups: acute, convalescent and chronic. Plasma t-PA and PAI-1 activities were determined by chromogenic substrate analysis and plasma β-TG content was detected by radioimmunoassay. Patients in the acute stage of ischemic stroke had significantly increased levels of t-PA activity and β-TG content, but PAI-1 activity was significantly decreased. Negative correlations were found between plasma t-PA and PAI-1 activities and between plasma t-PA activity and β-TG content in patients with acute ischemic stroke. There were significant differences in plasma t-PA and PAI-1 activities in the aged control group, as well as in the acute, convalescent and chronic groups. It can be speculated that the increased activity of t-PA in patients during the acute stage was the result of compensatory function, and that the increase in plasma β-TG level not only implies the presence of ischemic stroke but is likely a cause of ischemic stroke. During the later stages of ischemic stroke, greater attention is required in monitoring levels of PAI-1. Copyright © 2015 Elsevier Ltd. All rights reserved.

Impaired natriuretic response to high-NaCl diet plus aldosterone infusion in mice overexpressing human CD39, an ectonucleotidase (NTPDase1).

PubMed

Zhang, Yue; Robson, Simon C; Morris, Kaiya L; Heiney, Kristina M; Dwyer, Karen M; Kishore, Bellamkonda K; Ecelbarger, Carolyn M

2015-06-15

Extracellular nucleotides acting through P2 receptors facilitate natriuresis. To define how purinergic mechanisms are involved in sodium homeostasis, we used transgenic (TG) mice that globally overexpress human CD39 (hCD39, NTPDase1), an ectonucleotidase that hydrolyzes extracellular ATP/ADP to AMP, resulting in an altered extracellular purine profile. On a high-sodium diet (HSD, 3.5% Na(+)), urine volume and serum sodium were significantly higher in TG mice but sodium excretion was unaltered. Furthermore, TG mice showed an attenuated fall in urine aldosterone with HSD. Western blot analysis revealed significantly lower densities (∼40%) of the β-subunit of the epithelial sodium channel (ENaC) in medulla, and the major band (85-kDa) of γ-ENaC in TG mice cortex. To evaluate aldosterone-independent differences, in a second experiment, aldosterone was clamped by osmotic minipump at 20 μg/day, and mice were fed either an HSD or a low-sodium diet (LSD, 0.03% Na(+)). Here, no differences in urine volume or osmolality, or serum aldosterone were found, but TG mice showed a modest, yet significant impairment in late natriuresis (days 3 and 4). Several major sodium transporters or channel subunits were differentially expressed between the genotypes. HSD caused a downregulation of Na-Cl cotransporter (NCC) in both genotypes; and had higher cortical levels of NCC, Na-K-ATPase (α-1 subunit), and α- and γ-ENaC. The Na-K-2Cl cotransporter (NKCC2) was downregulated by HSD in wild-type mice, but it increased in TG mice. In summary, our data support the concept that extracellular nucleotides facilitate natriuresis; they also reveal an aldosterone-independent downregulation of major renal sodium transporters and channel subunits by purinergic signaling.

Loss of One or Two PATZ1 Alleles Has a Critical Role in the Progression of Thyroid Carcinomas Induced by the RET/PTC1 Oncogene

PubMed Central

Palma, Giuseppe; Vitiello, Michela; Capiluongo, Anna; D’Andrea, Barbara; Vuttariello, Emilia; Luciano, Antonio; Cerchia, Laura; Chiappetta, Gennaro; Arra, Claudio; Fusco, Alfredo

2018-01-01

POZ/BTB and AT-hook-containing zinc finger protein 1 (PATZ1) is an emerging cancer-related gene that is downregulated in different human malignancies, including thyroid cancer, where its levels gradually decrease going from papillary thyroid carcinomas (PTC) to poorly differentiated and undifferentiated highly aggressive anaplastic carcinomas (ATC). The restoration of PATZ1 expression in thyroid cancer cells reverted their malignant phenotype by inducing mesenchymal-to-epithelial transition, thus validating a tumor suppressor role for PATZ1 and suggesting its involvement in thyroid cancer progression. Here, we investigated the consequences of the homozygous and heterozygous loss of PATZ1 in the context of a mouse modeling of PTC, represented by mice carrying the RET/PTC1 oncogene under the thyroid specific control of the thyroglobulin promoter RET/PTC1 (RET/PTC1TG). The phenotypic analysis of RET/PTC1TG mice intercrossed with Patz1-knockout mice revealed that deficiency of both Patz1 alleles enhanced thyroid cancer incidence in RET/PTC1TG mice, but not the heterozygous knockout of the Patz1 gene. However, both RET/PTC1TG;Patz1+/− and RET/PTC1TG;Patz1−/− mice developed a more aggressive thyroid cancer phenotype—characterized by higher Ki-67 expression, presence of ATCs, and increased incidence of solid variants of PTC—than that shown by RET/PTC1TG; Patz1+/+ compound mice. These results confirm that PATZ1 downregulation has a critical role in thyroid carcinogenesis, showing that it cooperates with RET/PTC1 in thyroid cancer progression. PMID:29584698

Methane emissions in East Asia for 2000-2011 estimated using an atmospheric Bayesian inversion

NASA Astrophysics Data System (ADS)

Thompson, R. L.; Stohl, A.; Zhou, L. X.; Dlugokencky, E.; Fukuyama, Y.; Tohjima, Y.; Kim, S.-Y.; Lee, H.; Nisbet, E. G.; Fisher, R. E.; Lowry, D.; Weiss, R. F.; Prinn, R. G.; O'Doherty, S.; Young, D.; White, J. W. C.

2015-05-01

We present methane (CH4) emissions for East Asia from a Bayesian inversion of CH4 mole fraction and stable isotope (δ13C-CH4) measurements. Emissions were estimated at monthly resolution from 2000 to 2011. A posteriori, the total emission for East Asia increased from 43 ± 4 to 59 ± 4 Tg yr-1 between 2000 and 2011, owing largely to the increase in emissions from China, from 39 ± 4 to 54 ± 4 Tg yr-1, while emissions in other East Asian countries remained relatively stable. For China, South Korea, and Japan, the total emissions were smaller than the prior estimates (i.e., Emission Database for Global Atmospheric Research 4.2 FT2010 for anthropogenic emissions) by an average of 29%, 20%, and 23%, respectively. For Mongolia, Taiwan, and North Korea, the total emission was less than 2 Tg yr-1 and was not significantly different from the prior. The largest reductions in emissions, compared to the prior, occurred in summer in regions important for rice agriculture suggesting that this source is overestimated in the prior. Furthermore, an analysis of the isotope data suggests that the prior underestimates emissions from landfills and ruminant animals for winter 2010 to spring 2011 (no data available for other times). The inversion also found a lower average emission trend for China, 1.2 Tg yr-1 compared to 2.8 Tg yr-1 in the prior. This trend was not constant, however, and increased significantly after 2005, up to 2.0 Tg yr-1. Overall, the changes in emissions from China explain up to 40% of the increase in global emissions in the 2000s.

[Influence of diet and behavior related factors on the peripheral blood triglyceride levels in adults: a cross-sectional study].

PubMed

Liang, M B; Wang, H; Zhang, J; He, Q F; Fang, L; Wang, L X; Su, D T; Zhao, M; Zhang, X W; Hu, R Y; Cong, L M; Ding, G G; Ye, Z; Yu, M

2017-12-10

Objective: To study the influence of diet and behavior related factors on the peripheral blood triglyceride levels in adults, through a cross-sectional survey. Methods: The current study included 13 434 subjects without histories of major chronic diseases from a population-based cross-sectional survey: the 2010 Metabolic Syndrome Survey in Zhejiang Province. A generalized linear model was used to investigate the influence of diet/behavior-related factors on the peripheral blood triglyceride levels. Results: Mean TG of the sample population appeared as (1.36±1.18) mmol/L. The proportions of elevated TG and marginally elevated TG were 10.3% and 11.0% respectively, with statistically significant difference seen between males and females ( χ (2)=44.135, P <0.001). In this sampled population, the daily intake of cooking oil was exceeding the recommendation levels by over 50% while the intake of fruit, milk, nuts and physical exercise were much below the recommendation. There were statistically significant differences between smoking, alcohol-intake, meat, fruit and water intake in male population from this study. However, in females, the intake of aquatic product and physical exercise showed statistically significant differences. After controlling for other variables, factors as age, drinking, staple food and aquatic products showed positive influence on TG, while milk presented negative influence on TG. Through interaction analysis, fruit and meat intake in males and staple food in females showed positive influence on TG, when compared to the reference group. Conclusion: Hyperglyceridemia appeared as one of the major metabolic abnormities in Zhejiang province. Programs on monitoring the alcohol, staple food and meat intake should be priority on intervention, in the communities.

Gene-gene interaction between CETP and APOE polymorphisms confers higher risk for hypertriglyceridemia in oldest-old Chinese women.

PubMed

Sun, Liang; Hu, Caiyou; Zheng, Chenguang; Huang, Zezhi; Lv, Zeping; Huang, Jin; Liang, Siying; Shi, Xiaohong; Zhu, Xiaoquan; Yuan, Huiping; Yang, Ze

2014-07-01

The knowledge of dyslipidemia and its genetic contributors in oldest-old subjects is limited; in addition, the majority of oldest-old subjects are females. Evidence has accumulated that multiple genetic factors play important roles in determining susceptibility to dyslipidemia and extended life span. Cholesterol ester transfer protein (CETP) and apolipoprotein E (APOE) are two plausible candidate genes for human longevity owing to their functionally related modulation of circulating lipid homeostasis; however, few studies have considered their interplay. In this study, we analyzed the distribution of CETP*V (rs5882) and APOE*4 (rs429358 and rs7412) in 372 oldest-old Chinese women (aged 80-109) and 340 controls (aged 20-58). In addition to replicating the association of longevity, our main goal was to evaluate the contribution of CETP*V, APOE*4 and CETP*APOE interaction to the risk of dyslipidemia. Only APOE*4 conferred a risk against longevity and was associated with high-cholesterol (hTC) and mixed dyslipidemia for oldest-old females. Moreover, CETP*V was found to be associated with hypertriglyceridemia (hTG) independently from APOE*4, age, BMI, alcohol drinking, TC, TG, HDL-c, and LDL-c. The stratification test, multivariable-adjusted logistic regression, and nonparametric MDR analysis all suggested a significant CETP*APOE interaction associated with hTG. The unadjusted odds for hTG were more than 4-fold in subjects with CETP*V and APOE*4 than those without either (OR=4.36, P<0.001). These results provide evidence of strong independent associations between hTG and CETP*V in oldest-old Chinese females, and APOE*4, as an independently non-significant variant, might interact with CETP*V resulting in an increased risk for hTG. Copyright © 2014 Elsevier Inc. All rights reserved.

Dust transport and deposition observed from the Terra-Moderate Resolution Imaging Spectroradiometer (MODIS) spacecraft over the Atlantic Ocean

NASA Astrophysics Data System (ADS)

Kaufman, Y. J.; Koren, I.; Remer, L. A.; Tanré, D.; Ginoux, P.; Fan, S.

2005-05-01

Meteorological observations, in situ data, and satellite images of dust episodes were used already in the 1970s to estimate that 100 Tg of dust are transported from Africa over the Atlantic Ocean every year between June and August and are deposited in the Atlantic Ocean and the Americas. Desert dust is a main source of nutrients to oceanic biota and the Amazon forest, but it deteriorates air quality, as shown for Florida. Dust affects the Earth radiation budget, thus participating in climate change and feedback mechanisms. There is an urgent need for new tools for quantitative evaluation of the dust distribution, transport, and deposition. The Terra spacecraft, launched at the dawn of the last millennium, provides the first systematic well-calibrated multispectral measurements from the Moderate Resolution Imaging Spectroradiometer (MODIS) instrument for daily global analysis of aerosol. MODIS data are used here to distinguish dust from smoke and maritime aerosols and to evaluate the African dust column concentration, transport, and deposition. We found that 240 ± 80 Tg of dust are transported annually from Africa to the Atlantic Ocean, 140 ± 40 Tg are deposited in the Atlantic Ocean, 50 Tg fertilize the Amazon Basin (four times as previous estimates, thus explaining a paradox regarding the source of nutrition to the Amazon forest), 50 Tg reach the Caribbean, and 20 Tg return to Africa and Europe. The results are compared favorably with dust transport models for maximum particle diameter between 6 and 12 μm. This study is a first example of quantitative use of MODIS aerosol for a geophysical research.

Dosimetric evaluation of IMRT plan for homogenous and inhomogeneous medium using AAPM TG-119 protocol

NASA Astrophysics Data System (ADS)

Fatimah, L. A. N.; Wibowo, W. E.; Pawiro, S. A.

2017-05-01

The American Association of Physicists in Medicine (AAPM) TG-119 protocol has been applied for dose verification in IMRT technique. However, some criteria in the protocol need to be verified for inhomogeneous medium and small volume targets. Hence, the purpose of this study was to verify the assessment criteria of dose verification in AAPM TG-119 for inhomogeneous medium and small volume targets. The work has been conducted by dose verification for homogeneous (phantom A) and inhomogeneous phantoms (phantom B and C) on two geometrical targets: C-shape and circular targets. The targets were simulated using 7 static dMLC IMRT fields at two different depths of 5 g/cm2 and 10 g/cm2. The dose optimisation and calculation were done by using Pinnacle3 for 6 MV photons beam. The planning objectives were set according to AAPM TG-119 parameters. The plan analysis was conducted by Conformity Index and Homogeneity Index. The point dose measurements were conducted with Exradin A16, Semiflex 0.125cc, and Gafchromic EBT3. The plan results show that CI for C-shape target is in the range of 0.710-0.999 at 10 g/cm2 depth and 0.691-1.613 at 5 g/cm2. In addition, HI for C-shape and circular were in the range of 6.3%-58.7% and 5.4%-87.1% for 10 g/cm2 depth. The measurement results show that the dose measurement at inhomogeneous medium and small volume targets are much lower than the criteria in AAPM TG-119. In conclusion, the criteria in the AAPM TG-119 cannot be fully implemented for inhomogeneous medium and small volume targets.

Usefulness of triglycerides-to-high-density lipoprotein cholesterol ratio for predicting the first coronary event in men.

PubMed

Cordero, Alberto; Andrés, Eva; Ordoñez, Beatriz; León, Montserrat; Laclaustra, Martín; Grima, Alberto; Luengo, Emilio; Moreno, José; Bes, María; Pascual, Isaac; Civeira, Fernando; Pocoví, Miguel; Alegría, Eduardo; Casasnovas, José A

2009-11-15

Overweight and obesity potentiate the development of cardiovascular risk factors but many doubts have arisen recently regarding their role in coronary events. We evaluated the predictive value of a surrogate maker of insulin resistance, the ratio of triglyceride (TG) to high-density lipoprotein (HDL), for the incidence of a first coronary event in men workers according to body mass index (BMI). We designed a case-control study of active subjects collected from a single factory through their annual health examination and medical reports. Case subjects included those with myocardial infarction, unstable angina pectoris, or subclinical myocardial ischemia detected through electrocardiographic abnormalities. The sample was constituted by 208 case and 2,080 control subjects (mean age 49.9 years, 49.6 to 50.2). General characteristics of case and control subjects were well matched. The TG/HDL ratio was significantly higher in case subjects compared to controls. Stratification of the sample revealed an increasing prevalence of case subjects and mean TG/HDL in each category of BMI. Multivariable analysis, adjusted by smoking, demonstrated that TG/HDL increased 50% the risk of a first coronary event (odds ratio [OR] 1.47, 95% confidence interval [CI] 1.26 to 1.71), whereas low-density lipoprotein cholesterol values indicated a more moderate increased risk (OR 1.01, 95% CI 1.005 to 1.012); metabolic syndrome (OR 1.76, 95% CI 0.94 to 3.30) and hypertension (OR 1.50, 95% CI 0.81 to 2.79) did not reach statistical significance. The TG/HDL ratio was associated with a first coronary event in all categories of BMI. In conclusion, the TG/HDL ratio has a high predictive value of a first coronary event regardless of BMI.

[Endoplasmic reticulum stress in INS-1-3 cell associated with the expression changes of MODY gene pathway].

PubMed

Liu, Y T; Li, S R; Wang, Z; Xiao, J Z

2016-09-13

Objective: To profile the gene expression changes associated with endoplasmic reticulum stress in INS-1-3 cells induced by thapsigargin (TG) and tunicamycin (TM). Methods: Normal cultured INS-1-3 cells were used as a control. TG and TM were used to induce endoplasmic reticulum stress in INS-1-3 cells. Digital gene expression profiling technique was used to detect differentially expressed gene. The changes of gene expression were detected by expression pattern clustering analysis, gene ontology (GO) function and pathway enrichment analysis. Real time polymerase chain reaction (RT-PCR) was used to verify the key changes of gene expression. Results: Compared with the control group, there were 57 (45 up-regulated, 12 down-regulated) and 135 (99 up-regulated, 36 down-regulated) differentially expressed genes in TG and TM group, respectively. GO function enrichment analyses indicated that the main enrichment was in the endoplasmic reticulum. In signaling pathway analysis, the identified pathways were related with endoplasmic reticulum stress, antigen processing and presentation, protein export, and most of all, the maturity onset diabetes of the young (MODY) pathway. Conclusion: Under the condition of endoplasmic reticulum stress, the related expression changes of transcriptional factors in MODY signaling pathway may be related with the impaired function in islet beta cells.

Mast cell activator compound 48/40 is not an effective adjuvant for UV-attenuated Toxoplasma gondii vaccine.

PubMed

Li, Xi; Chen, Shengjie; Huang, Shiguang; Lu, Fangli

2017-08-01

Toxoplasma gondii (T. gondii, Tg) is a globally distributed parasitic protozoan causing different forms of toxoplasmosis in humans. Mast cells (MCs) play a role during T. gondii infection. Several studies suggest that MC activator compound 48/80 (C48/80) may be an effective vaccine adjuvant resulting in a potent and protective antigen-specific immune response against bacteria or virus infections. The present study was performed to determine whether C48/80 had adjuvant activity for ultraviolet (UV)-attenuated T. gondii vaccine to induce protective immune responses against T. gondii in mouse model. Kunming mice were divided into the following groups: naive mice, naive mice administrated with C48/80 intraperitoneal (i.p.) injection, mice infected by i.p. injection of 10 4 T. gondii RH strain alone (Tg group), mice infected with 10 4 RH tachyzoites plus C48/80 administration (Tg + C48/80), mice immunized with UV-Tg alone, and mice immunized with UV-Tg plus C48/80 administration (UV-Tg + C48/80). All the vaccinated mice were challenged with 10 4 tachyzoites of T. gondii RH strain at the same time as the primary infection. The survival rates, liver histopathologies, liver parasite burdens, and mRNA expression levels of Th1 and Th2 cytokines in the livers and spleens detected by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) were compared among the aforementioned groups after primary infection or challenge infection. The results showed that, compared to the Tg group or Tg + C48/80 group, the UV-Tg + Tg group and UV-Tg + C48/80 + Tg group had significantly prolonged survival time, lower liver histopathological scores, decreased liver parasite burdens, and increased levels of Th1 and Th2 cytokines in the livers and spleens. There was no significant difference of survival time between the UV-Tg + Tg group and the UV-Tg + C48/80 + Tg group; however, the UV-Tg + C48/80 + Tg group showed higher parasite burden, more severe liver histopathology, and decreased IL-4 level compared to the UV-Tg + Tg group. These results indicate that C48/80 had no adjuvant activity for the immunization induced by UV-attenuated T. gondii vaccine.

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

PubMed Central

Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

2017-01-01

Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G, we identified a novel c.1A>G mutation. Patients with CACTD with a genotype of c.199-10T>G mutation usually presents with a severe clinical phenotype. Early recognition and appropriate treatment is crucial in this highly lethal disorder. This case series highlights the importance of screening for metabolic diseases including CACTD in cases of sudden infant death and unexplained abrupt clinical deterioration in the early neonatal period. PMID:29137068

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

PubMed

Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

2017-11-01

Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G, we identified a novel c.1A>G mutation. Patients with CACTD with a genotype of c.199-10T>G mutation usually presents with a severe clinical phenotype. Early recognition and appropriate treatment is crucial in this highly lethal disorder. This case series highlights the importance of screening for metabolic diseases including CACTD in cases of sudden infant death and unexplained abrupt clinical deterioration in the early neonatal period.

Influence of thyroid gland status on the thyroglobulin cutoff level in washout fluid from cervical lymph nodes of patients with recurrent/metastatic papillary thyroid cancer.

PubMed

Lee, Jun Ho; Lee, Hyun Chul; Yi, Ha Woo; Kim, Bong Kyun; Bae, Soo Youn; Lee, Se Kyung; Choe, Jun-Ho; Kim, Jung-Han; Kim, Jee Soo

2016-04-01

The influence of serum thyroglobulin (Tg) and thyroidectomy status on Tg in fine-needle aspiration cytology (FNAC) washout fluid is unclear. A total of 282 lymph nodes were prospectively subjected to FNAC, fine-needle aspiration (FNA)-Tg measurement, and frozen and permanent biopsies. We evaluated the diagnostic performance of several predetermined FNA-Tg cutoff values for recurrence/metastasis in lymph nodes according to thyroidectomy status. The diagnostic performance of FNA-Tg varied according to thyroidectomy status. The optimized cutoff value of FNA-Tg was 2.2 ng/mL. However, among FNAC-negative lymph nodes, the FNA-Tg cutoff value of 0.9 ng/mL showed better diagnostic performance in patients with a thyroid gland. An FNA-Tg/serum-Tg cutoff ratio of 1 showed the best diagnostic performance in patients without a thyroid gland. Applying the optimal cutoff values of FNA-Tg according to thyroid gland status and serum Tg level facilitates the diagnostic evaluation of neck lymph node recurrences/metastases in patients with papillary thyroid carcinoma (PTC). © 2015 Wiley Periodicals, Inc. Head Neck 38: E1705-E1712, 2016. © 2015 Wiley Periodicals, Inc.

Impurity characterization of magnesium diuranate using simultaneous TG-DTA-FTIR measurements

NASA Astrophysics Data System (ADS)

Raje, Naina; Ghonge, Darshana K.; Hemantha Rao, G. V. S.; Reddy, A. V. R.

2013-05-01

Current studies describe the application of simultaneous thermogravimetry-differential thermal analysis - evolved gas analysis techniques for the compositional characterization of magnesium diuranate (MDU) with respect to the impurities present in the matrix. The stoichiometric composition of MDU was identified as MgU2O7ṡ3H2O. Presence of carbonate and sulphate as impurities in the matrix was confirmed through the evolved gas analysis using Fourier Transformation Infrared Spectrometry detection. Carbon and magnesium hydroxide content present as impurities in magnesium diuranate have been determined quantitatively using TG and FTIR techniques and the results are in good agreement. Powder X-ray diffraction analysis of magnesium diuranate suggests the presence of magnesium hydroxide as impurity in the matrix. Also these studies confirm the formation of magnesium uranate, uranium sesquioxide and uranium dioxide above 1000 °C, due to the decomposition of magnesium diuranate.

Novel EDA mutation in X-linked hypohidrotic ectodermal dysplasia and genotype-phenotype correlation.

PubMed

Zeng, B; Lu, H; Xiao, X; Zhou, L; Lu, J; Zhu, L; Yu, D; Zhao, W

2015-11-01

X-linked hypohidrotic ectodermal dysplasia (XLHED) is characterized by abnormalities of hair, teeth, and sweat glands, while non-syndromic hypodontia (NSH) affects only teeth. Mutations in Ectodysplasin A (EDA) underlie both XLHED and NSH. This study investigated the genetic causes of six hypohidrotic ectodermal dysplasia (HED) patients and genotype-phenotype correlation. The EDA gene of six patients with HED was sequenced. Bioinformatics analysis and structural modeling for the mutations were performed. The records of 134 patients with XLHED and EDA-related NSH regarding numbers of missing permanent teeth from this study and 20 articles were reviewed. Nonparametric tests were used to analyze genotype-phenotype correlations. In four of the six patients, we identified a novel mutation c.852T>G (p.Phe284Leu) and three reported mutations: c.467G>A (p.Arg156His), c.776C>A (p.Ala259Glu), and c.871G>A (p.Gly291Arg). They were predicted to be pathogenic by bioinformatics analysis and structural modeling. Genotype-phenotype correlation analysis revealed that truncating mutations were associated with more missing teeth. Missense mutations and the mutations affecting the TNF homology domain were correlated with fewer missing teeth. This study extended the mutation spectrum of XLHED and revealed the relationship between genotype and the number of missing permanent teeth. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Epilepsy and neurocysticercosis in Latin America: a systematic review and meta-analysis.

PubMed

Bruno, Elisa; Bartoloni, Alessandro; Zammarchi, Lorenzo; Strohmeyer, Marianne; Bartalesi, Filippo; Bustos, Javier A; Santivañez, Saul; García, Héctor H; Nicoletti, Alessandra

2013-01-01

The difference in epilepsy burden existing among populations in tropical regions has been attributed to many factors, including the distribution of infectious diseases with neurologic sequels. To define the burden of epilepsy in Latin American Countries (LAC) and to investigate the strength of association with neurocysticercosis (NCC), considered one of the leading causes of epilepsy, we performed a systematic review and meta-analysis of the literature. Studies published until 2012 were selected applying predefined inclusion criteria. Lifetime epilepsy (LTE) prevalence, active epilepsy (AE) prevalence, incidence, mortality, treatment gap (TG) and NCC proportion among people with epilepsy (PWE) were extracted. Median values were obtained for each estimate using random effects meta-analysis. The impact of NCC prevalence on epilepsy estimates was determined using meta-regression models. To assess the association between NCC and epilepsy, a further meta-analysis was performed on case-control studies. The median LTE prevalence was 15.8/1,000 (95% CI 13.5-18.3), the median AE prevalence was 10.7/1,000 (95% CI 8.4-13.2), the median incidence was 138.2/100,000 (95% CI 83.6-206.4), the overall standardized mortality ratio was 1.4 (95% CI 0.01-6.1) and the overall estimated TG was 60.6% (95% CI 45.3-74.9). The median NCC proportion among PWE was 32.3% (95% CI 26.0-39.0). Higher TG and NCC estimates were associated with higher epilepsy prevalence. The association between NCC and epilepsy was significant (p<0.001) with a common odds ratio of 2.8 (95% CI 1.9-4.0). A high burden of epilepsy and of NCC in LAC and a consistent association between these two diseases were pointed out. Furthermore, NCC prevalence and TG were identified as important factors influencing epilepsy prevalence to be considered in prevention and intervention strategies.

Epilepsy and Neurocysticercosis in Latin America: A Systematic Review and Meta-analysis

PubMed Central

Bruno, Elisa; Bartoloni, Alessandro; Zammarchi, Lorenzo; Strohmeyer, Marianne; Bartalesi, Filippo; Bustos, Javier A.; Santivañez, Saul; García, Héctor H.; Nicoletti, Alessandra

2013-01-01

Background The difference in epilepsy burden existing among populations in tropical regions has been attributed to many factors, including the distribution of infectious diseases with neurologic sequels. To define the burden of epilepsy in Latin American Countries (LAC) and to investigate the strength of association with neurocysticercosis (NCC), considered one of the leading causes of epilepsy, we performed a systematic review and meta-analysis of the literature. Methodology Studies published until 2012 were selected applying predefined inclusion criteria. Lifetime epilepsy (LTE) prevalence, active epilepsy (AE) prevalence, incidence, mortality, treatment gap (TG) and NCC proportion among people with epilepsy (PWE) were extracted. Median values were obtained for each estimate using random effects meta-analysis. The impact of NCC prevalence on epilepsy estimates was determined using meta-regression models. To assess the association between NCC and epilepsy, a further meta-analysis was performed on case-control studies. Principal findings The median LTE prevalence was 15.8/1,000 (95% CI 13.5–18.3), the median AE prevalence was 10.7/1,000 (95% CI 8.4–13.2), the median incidence was 138.2/100,000 (95% CI 83.6–206.4), the overall standardized mortality ratio was 1.4 (95% CI 0.01–6.1) and the overall estimated TG was 60.6% (95% CI 45.3–74.9). The median NCC proportion among PWE was 32.3% (95% CI 26.0–39.0). Higher TG and NCC estimates were associated with higher epilepsy prevalence. The association between NCC and epilepsy was significant (p<0.001) with a common odds ratio of 2.8 (95% CI 1.9–4.0). Significance A high burden of epilepsy and of NCC in LAC and a consistent association between these two diseases were pointed out. Furthermore, NCC prevalence and TG were identified as important factors influencing epilepsy prevalence to be considered in prevention and intervention strategies. PMID:24205415

SU-F-T-458: Tracking Trends of TG-142 Parameters Via Analysis of Data Recorded by 2D Chamber Array

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexandrian, A; Kabat, C; Defoor, D

Purpose: With increasing QA demands of medical physicists in clinical radiation oncology, the need for an effective method of tracking clinical data has become paramount. A tool was produced which scans through data automatically recorded by a 2D chamber array and extracts relevant information recommended by TG-142. Using this extracted information a timely and comprehensive analysis of QA parameters can be easily performed enabling efficient monthly checks on multiple linear accelerators simultaneously. Methods: A PTW STARCHECK chamber array was used to record several months of beam outputs from two Varian 2100 series linear accelerators and a Varian NovalisTx−. In conjunctionmore » with the chamber array, a beam quality phantom was used to simultaneously to determine beam quality. A minimalist GUI was created in MatLab that allows a user to set the file path of the data for each modality to be analyzed. These file paths are recorded to a MatLab structure and then subsequently accessed by a script written in Python (version 3.5.1) which then extracts values required to perform monthly checks as outlined by recommendations from TG-142. The script incorporates calculations to determine if the values recorded by the chamber array fall within an acceptable threshold. Results: Values obtained by the script are written to a spreadsheet where results can be easily viewed and annotated with a “pass” or “fail” and saved for further analysis. In addition to creating a new scheme for reviewing monthly checks, this application allows for able to succinctly store data for follow up analysis. Conclusion: By utilizing this tool, parameters recommended by TG-142 for multiple linear accelerators can be rapidly obtained and analyzed which can be used for evaluation of monthly checks.« less

Cell-mediated lysis of lipid vesicles containing eye muscle protein: Implications regarding pathogenesis of Graves ophthalmopathy*

PubMed Central

Kriss, Joseph P.; Mehdi, S. Qasim

1979-01-01

We prepared artificial vesicles that are lysed upon cell-mediated immunological attack by human lymphocytes. These vesicles are made from a mixture of dimyristoyl lecithin, dipalmitoyl lecithin, and cholesterol, have eye muscle membrane protein (EMP) inserted into the bilayer wall, and contain intravesicular 99mTc marker. Injury to the vesicular membrane was assessed by measurement of 99mTc release. Thyroglobulin (Tg) and Tg-anti-Tg complex (TgA) bind to EMP-vesicles to an extent equal to or greater than to native eye muscle membranes in vitro; this binding requires the presence of normal human IgG. The role of Tg, TgA, IgG, and peripheral blood lymphocytes in altering membrane permeability was analyzed. Incubation of vesicles for up to 3 hr alone, with added IgG alone, or with further addition of Tg or TgA did not result in 99mTc release. Addition of lymphocytes from normal donors to the above four preparations showed release in the presence of TgA. Lymphocytes from each of eight patients with Graves ophthalmopathy caused release not only in the presence of TgA, but also in the presence of Tg. Separation of a patient's lymphocytes into high- and low-affinity rosette-formers (T and K cells, respectively) showed that cell-mediated vesicle lysis in the presence of TgA was greater with K cells than with T cells, while vesicle lysis in the presence of Tg was greater with T cells than with K cells. Vesicles made with inserted Tg but lacking EMP were not lysed by such T cells. Lymphocytes failed to induce permeability changes in vesicles containing other inserted proteins obtained from human nonextraocular muscle, liver, spleen, or adrenal, even if Tg or TgA were present. The results support the concept that muscle cell damage in Graves ophthalmopathy is immunological, cell-mediated, and of two types: (i) K lymphocytes reacting to immune complex, TgA, on the eye muscle cell surface (i.e., antibody-dependent cytotoxicity) and (ii) sensitized T lymphocytes reacting to Tg on the eye muscle cell surface. An antigenic role for EMP is possible, but has not been unequivocally proven. PMID:88053

Beneficial effect of diosgenin as a stimulator of NGF on the brain with neuronal damage induced by Aβ-42 accumulation and neurotoxicant injection.

PubMed

Koh, Eun-Kyoung; Yun, Woo-Bin; Kim, Ji-Eun; Song, Sung-Hwa; Sung, Ji-Eun; Lee, Hyun-Ah; Seo, Eun-Ji; Jee, Seung-Wan; Bae, Chang-Joon; Hwang, Dae-Youn

2016-06-01

To investigate the beneficial effects of diosgenin (DG) on the multiple types of brain damage induced by Aβ-42 peptides and neurotoxicants, alterations in the specific aspects of brain functions were measured in trimethyltin (TMT)-injected transgenic 2576 (TG) mice that had been pretreated with DG for 21 days. Multiple types of damage were successfully induced by Aβ-42 accumulation and TMT injection into the brains of TG mice. However, DG treatment significantly reduced the number of Aβ-stained plaques and dead cells in the granule cells layer of the dentate gyrus. Significant suppression of acetylcholinesterase (AChE) activity and Bax/Bcl-2 expression was also observed in the DG treated TG mice (TG+DG group) when compared with those of the vehicle (VC) treated TG mice (TG+VC group). Additionally, the concentration of nerve growth factor (NGF) was dramatically enhanced in TG+DG group, although it was lower in the TG+VC group than the non-transgenic (nTG) group. Furthermore, the decreased phosphorylation of downstream members in the TrkA high affinity receptor signaling pathway in the TG+VC group was significantly recovered in the TG+DG group. A similar pattern was observed in p75(NTR) expression and JNK phosphorylation in the NGF low affinity receptor signaling pathway. Moreover, superoxide dismutase (SOD) activity was enhanced in the TG+DG group, while the level of malondialdehyde (MDA), a marker of lipid peroxidation, was lower in the TG+DG group than the TG+VC group. These results suggest that DG could exert a wide range of beneficial activities for multiple types of brain damage through stimulation of NGF biosynthesis.

Beneficial effect of diosgenin as a stimulator of NGF on the brain with neuronal damage induced by Aβ-42 accumulation and neurotoxicant injection

PubMed Central

Koh, Eun-Kyoung; Yun, Woo-Bin; Kim, Ji-Eun; Song, Sung-Hwa; Sung, Ji-Eun; Lee, Hyun-Ah; Seo, Eun-Ji; Jee, Seung-Wan

2016-01-01

To investigate the beneficial effects of diosgenin (DG) on the multiple types of brain damage induced by Aβ-42 peptides and neurotoxicants, alterations in the specific aspects of brain functions were measured in trimethyltin (TMT)-injected transgenic 2576 (TG) mice that had been pretreated with DG for 21 days. Multiple types of damage were successfully induced by Aβ-42 accumulation and TMT injection into the brains of TG mice. However, DG treatment significantly reduced the number of Aβ-stained plaques and dead cells in the granule cells layer of the dentate gyrus. Significant suppression of acetylcholinesterase (AChE) activity and Bax/Bcl-2 expression was also observed in the DG treated TG mice (TG+DG group) when compared with those of the vehicle (VC) treated TG mice (TG+VC group). Additionally, the concentration of nerve growth factor (NGF) was dramatically enhanced in TG+DG group, although it was lower in the TG+VC group than the non-transgenic (nTG) group. Furthermore, the decreased phosphorylation of downstream members in the TrkA high affinity receptor signaling pathway in the TG+VC group was significantly recovered in the TG+DG group. A similar pattern was observed in p75NTR expression and JNK phosphorylation in the NGF low affinity receptor signaling pathway. Moreover, superoxide dismutase (SOD) activity was enhanced in the TG+DG group, while the level of malondialdehyde (MDA), a marker of lipid peroxidation, was lower in the TG+DG group than the TG+VC group. These results suggest that DG could exert a wide range of beneficial activities for multiple types of brain damage through stimulation of NGF biosynthesis. PMID:27382379

Comparative effectiveness of fish oil versus fenofibrate, gemfibrozil, and atorvastatin on lowering triglyceride levels among HIV-infected patients in routine clinical care.

PubMed

Muñoz, Monica A; Liu, Wei; Delaney, Joseph A C; Brown, Elizabeth; Mugavero, Michael J; Mathews, W Chris; Napravnik, Sonia; Willig, James H; Eron, Joseph J; Hunt, Peter W; Kahn, James O; Saag, Michael S; Kitahata, Mari M; Crane, Heidi M

2013-11-01

The goal of this study was to compare the effectiveness of fish oil, fenofibrate, gemfibrozil, and atorvastatin on reducing triglyceride (TG) levels among a large cohort of HIV-infected patients in clinical care. Retrospective observational cohort study. The primary endpoint was absolute change in TG levels measured using the last TG value pretreatment and the first TG value posttreatment. A pre-post quasi-experimental design was used to estimate the change in TG because of initiating fish oil. Linear regression models examined the comparative effectiveness of treatment with fish oil versus gemfibrozil, fenofibrate, or atorvastatin for TG reduction. Models were adjusted for baseline differences in age, sex, race, CD4⁺ cell count, diabetes, body mass index, protease inhibitor use, and time between TG measures. A total of 493 patients (mean age, 46 years; 95% male) were included (46 patients receiving gemfibrozil; 80, fenofibrate; 291, atorvastatin; and 76, fish oil) with a mean baseline TG of 347 mg/dL. New use of fish oil decreased TG [ΔTG, -45 mg/dL; 95% confidence interval (CI): -80 to -11] in the pre-post study. Compared with fish oil (reference), fibrates were more effective (ΔTG, -66; 95% CI: -120 to -12) in reducing TG levels, whereas atorvastatin was not (ΔTG, -39; 95% CI: -86 to 9). In HIV-infected patients in routine clinical care, fish oil is less effective than fibrates (but not atorvastatin) at lowering TG values. Fish oil may still represent an attractive alternative for patients with moderately elevated TGs, particularly among patients who may not want or tolerate fibrates.

Coronary vasospasm induced in transgenic mouse with increased phospholipase C-δ1 activity.

PubMed

Shibutani, Shuji; Osanai, Tomohiro; Ashitate, Toshihiro; Sagara, Shigeki; Izumiyama, Kei; Yamamoto, Yuko; Hanada, Kenji; Echizen, Takashi; Tomita, Hirofumi; Fujita, Takeshi; Miwa, Takeshi; Matsubara, Hiroaki; Homma, Yoshimi; Okumura, Ken

2012-02-28

We reported that phospholipase C (PLC)-δ1 activity was enhanced 3-fold in patients with coronary spastic angina. We detected variant PLC-δ1 with replacement of arginine 257 by histidine (R257H) showing increased enzymatic activity. We tested the hypothesis that increased PLC-δ1 activity causes enhanced coronary vasomotility. We generated transgenic (TG) mice with human R257H variant PLC-δ1 in vascular smooth muscle cells. PLC enzymatic activity in the coronary artery was increased by 2.57 and 1.89 times, respectively, in homozygous and heterozygous TG compared with wild-type (WT) mice. ST elevation after ergometrine occurred in 17 of 18 homozygous TG, 6 of 20 heterozygous TG, and 3 of 22 WT mice (P<0.01, homozygous TG versus WT; P<0.05, homozygous TG versus heterozygous TG; P=NS, heterozygous TG versus WT). ST elevation was associated with bradyarrhythmias in homozygous TG mice. Focal coronary artery narrowing was documented with the microvascular filling technique in 3 of 5 homozygous TG mice after ergometrine but not in any of 7 WT mice (P<0.05). In the isolated Langendorff hearts, coronary perfusion pressure was increased after ergometrine in homozygous TG mice (P<0.01) but not in heterozygous TG or WT mice. Coronary perfusion pressure increase after prostaglandin F2α was similar among homozygous TG, heterozygous TG, and WT mice. Cultured rat aortic smooth muscle cells transfected with variant PLC-δ1 showed a higher PLC activity than those with WT PLC-δ1 (P<0.05) and furthermore showed greater intracellular Ca2+ response to acetylcholine in variant than in WT PLC-δ1 (P<0.05). Increased PLC-δ1 activity enhances coronary vasomotility such as that seen in patients with coronary spastic angina.

Abnormal excitability and episodic low-frequency oscillations in the cerebral cortex of the tottering mouse.

PubMed

Cramer, Samuel W; Popa, Laurentiu S; Carter, Russell E; Chen, Gang; Ebner, Timothy J

2015-04-08

The Ca(2+) channelopathies caused by mutations of the CACNA1A gene that encodes the pore-forming subunit of the human Cav2.1 (P/Q-type) voltage-gated Ca(2+) channel include episodic ataxia type 2 (EA2). Although, in EA2 the emphasis has been on cerebellar dysfunction, patients also exhibit episodic, nonmotoric abnormalities involving the cerebral cortex. This study demonstrates episodic, low-frequency oscillations (LFOs) throughout the cerebral cortex of tottering (tg/tg) mice, a widely used model of EA2. Ranging between 0.035 and 0.11 Hz, the LFOs in tg/tg mice can spontaneously develop very high power, referred to as a high-power state. The LFOs in tg/tg mice are mediated in part by neuronal activity as tetrodotoxin decreases the oscillations and cortical neuron discharge contain the same low frequencies. The high-power state involves compensatory mechanisms because acutely decreasing P/Q-type Ca(2+) channel function in either wild-type (WT) or tg/tg mice does not induce the high-power state. In contrast, blocking l-type Ca(2+) channels, known to be upregulated in tg/tg mice, reduces the high-power state. Intriguingly, basal excitatory glutamatergic neurotransmission constrains the high-power state because blocking ionotropic or metabotropic glutamate receptors results in high-power LFOs in tg/tg but not WT mice. The high-power LFOs are decreased markedly by acetazolamide and 4-aminopyridine, the primary treatments for EA2, suggesting disease relevance. Together, these results demonstrate that the high-power LFOs in the tg/tg cerebral cortex represent a highly abnormal excitability state that may underlie noncerebellar symptoms that characterize CACNA1A mutations. Copyright © 2015 the authors 0270-6474/15/355664-16$15.00/0.

The microbial transglutaminase immobilization on carboxylated poly(N-isopropylacrylamide) for thermo-responsivity.

PubMed

Zhou, Jian Qin; He, Ting; Wang, Jian Wen

2016-06-01

Microbial transglutaminase (mTG) is widely utilized in the PEGylation of pharmaceutical proteins. mTG immobilization can be achieved via covalent bonding on solid supports. However, the catalytic efficiency of mTG immobilized on solid supports was significantly reduced by mass transfer limitation. To overcome this limitation, mTG was covalently immobilized on the thermo-responsive carboxylated poly(N-isopropylacrylamide) (pNIPAM). The pNIPAM-mTG conjugate exhibited reversibly solubility in aqueous solution with a low critical solution temperature (LCST) at 39°C, i.e., it was insoluble above 39°C and soluble below 39°C. The pH dependence of the pNIPAM-mTG conjugate was similar with that of the native mTG. Upon conjugation to pNIPAM, the optimal temperature of mTG shifted down from 50-55°C to 40-45°C, and the thermal stability of the conjugate was elevated. The easy separation of the pNIPAM-mTG conjugate with its substrate and the catalytic efficiency of the pNIPAM-mTG conjugate were demonstrated by employing the pNIPAM-mTG conjugate to cross-link bovine serum albumin (BSA) and catalyze PEGylation of therapeutic protein, cytochrome c (Cyt C), respectively. The thermo-responsive mTG is suitable to modify proteins in food processing and biomedical engineering. Copyright © 2016 Elsevier Inc. All rights reserved.

Interactions of the apolipoprotein C-III 3238C>G polymorphism and alcohol consumption on serum triglyceride levels

PubMed Central

2010-01-01

Background Both apolipoprotein (Apo) C-III gene polymorphism and alcohol consumption have been associated with increased serum triglyceride (TG) levels, but their interactions on serum TG levels are not well known. The present study was undertaken to detect the interactions of the ApoC-III 3238C>G (rs5128) polymorphism and alcohol consumption on serum TG levels. Methods A total of 516 unrelated nondrinkers and 514 drinkers aged 15-89 were randomly selected from our previous stratified randomized cluster samples. Genotyping of the ApoC-III 3238C>G was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Interactions of the ApoC-III 3238C>G genotype and alcohol consumption was assessed by using a cross-product term between genotypes and the aforementioned factor. Results Serum total cholesterol (TC), TG, high-density lipoprotein cholesterol (HDL-C), ApoA-I and ApoB levels were higher in drinkers than in nondrinkers (P < 0.05-0.001). There was no significant difference in the genotypic and allelic frequencies between the two groups. Serum TG levels in nondrinkers were higher in CG genotype than in CC genotype (P < 0.01). Serum TC, TG, low-density lipoprotein cholesterol (LDL-C) and ApoB levels in drinkers were higher in GG genotype than in CC or CG genotype (P < 0.01 for all). Serum HDL-C levels in drinkers were higher in CG genotype than in CC genotype (P < 0.01). Serum TC, TG, HDL-C and ApoA-I levels in CC genotype, TC, HDL-C, ApoA-I levels and the ratio of ApoA-I to ApoB in CG genotype, and TC, TG, LDL-C, ApoA-I and ApoB levels in GG genotype were higher in drinkers than in nondrinkers (P < 0.05-0.01). But the ratio of ApoA-I to ApoB in GG genotype was lower in drinkers than in nondrinkers (P < 0.01). Multivariate logistic regression analysis showed that the levels of TC, TG and ApoB were correlated with genotype in nondrinkers (P < 0.05 for all). The levels of TC, LDL-C and ApoB were associated with genotype in drinkers (P < 0.01 for all). Serum lipid parameters were also correlated with age, sex, alcohol consumption, cigarette smoking, blood pressure, body weight, and body mass index in both groups. Conclusions This study suggests that the ApoC-III 3238CG heterozygotes benefited more from alcohol consumption than CC and GG homozygotes in increasing serum levels of HDL-C, ApoA-I, and the ratio of ApoA-I to ApoB, and lowering serum levels of TC and TG. PMID:20716347

Interactions of the apolipoprotein C-III 3238C>G polymorphism and alcohol consumption on serum triglyceride levels.

PubMed

Ruixing, Yin; Yiyang, Li; Meng, Li; Kela, Li; Xingjiang, Long; Lin, Zhang; Wanying, Liu; Jinzhen, Wu; Dezhai, Yang; Weixiong, Lin

2010-08-17

Both apolipoprotein (Apo) C-III gene polymorphism and alcohol consumption have been associated with increased serum triglyceride (TG) levels, but their interactions on serum TG levels are not well known. The present study was undertaken to detect the interactions of the ApoC-III 3238C>G (rs5128) polymorphism and alcohol consumption on serum TG levels. A total of 516 unrelated nondrinkers and 514 drinkers aged 15-89 were randomly selected from our previous stratified randomized cluster samples. Genotyping of the ApoC-III 3238C>G was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Interactions of the ApoC-III 3238C>G genotype and alcohol consumption was assessed by using a cross-product term between genotypes and the aforementioned factor. Serum total cholesterol (TC), TG, high-density lipoprotein cholesterol (HDL-C), ApoA-I and ApoB levels were higher in drinkers than in nondrinkers (P < 0.05-0.001). There was no significant difference in the genotypic and allelic frequencies between the two groups. Serum TG levels in nondrinkers were higher in CG genotype than in CC genotype (P < 0.01). Serum TC, TG, low-density lipoprotein cholesterol (LDL-C) and ApoB levels in drinkers were higher in GG genotype than in CC or CG genotype (P < 0.01 for all). Serum HDL-C levels in drinkers were higher in CG genotype than in CC genotype (P < 0.01). Serum TC, TG, HDL-C and ApoA-I levels in CC genotype, TC, HDL-C, ApoA-I levels and the ratio of ApoA-I to ApoB in CG genotype, and TC, TG, LDL-C, ApoA-I and ApoB levels in GG genotype were higher in drinkers than in nondrinkers (P < 0.05-0.01). But the ratio of ApoA-I to ApoB in GG genotype was lower in drinkers than in nondrinkers (P < 0.01). Multivariate logistic regression analysis showed that the levels of TC, TG and ApoB were correlated with genotype in nondrinkers (P < 0.05 for all). The levels of TC, LDL-C and ApoB were associated with genotype in drinkers (P < 0.01 for all). Serum lipid parameters were also correlated with age, sex, alcohol consumption, cigarette smoking, blood pressure, body weight, and body mass index in both groups. This study suggests that the ApoC-III 3238CG heterozygotes benefited more from alcohol consumption than CC and GG homozygotes in increasing serum levels of HDL-C, ApoA-I, and the ratio of ApoA-I to ApoB, and lowering serum levels of TC and TG.

TG-FTIR characterization of flame retardant polyurethane foams materials

NASA Astrophysics Data System (ADS)

Liu, W.; Tang, Y.; Li, F.; Ge, X. G.; Zhang, Z. J.

2016-07-01

Dimethyl methylphosphonate (DMMP) and trichloroethyl phosphtate (TCEP) have been used to enhance the flame retardancy of polyurethane foams materials (PUF). Flame retardancy and thermal degradation of PUF samples have been investigated by the LOI tests and thermal analysis. The results indicate that the excellent flame retardancy can be achieved due to the presence of the flame retardant system containing DMMP and TCEP. TG-FTIR reveals that the addition of DMMP/TCEP can not only improve the thermal stability of PUF samples but can also affect the gaseous phase at high temperature.

N-terminal region of myelin basic protein reduces fibrillar amyloid-β deposition in Tg-5xFAD mice.

PubMed

Ou-Yang, Ming-Hsuan; Xu, Feng; Liao, Mei-Chen; Davis, Judianne; Robinson, John K; Van Nostrand, William E

2015-02-01

Alzheimer's disease is a progressive neurodegenerative disorder that is characterized by extensive deposition of fibrillar amyloid-β (Aβ) in the brain. Previously, myelin basic protein (MBP) was identified to be a potent inhibitor to Aβ fibril formation, and this inhibitory activity was localized to the N-terminal residues 1-64, a fragment designated MBP1. Here, we show that the modest neuronal expression of a fusion protein of the biologically active MBP1 fragment and the enhanced green fluorescent protein (MBP1-EGFP) significantly improved the performance of spatial learning memory in Tg-5xFAD mice, a model of pathologic Aβ accumulation in brain. The levels of insoluble Aβ and fibrillar amyloid were significantly reduced in bigenic Tg-5xFAD/Tg-MBP1-EGFP mice. Quantitative stereological analysis revealed that the reduction in amyloid was because of a reduction in the size of fibrillar plaques rather than a decrease in plaque numbers. The current findings support previous studies showing that MBP1 inhibits Aβ fibril formation in vitro and demonstrate the ability of MBP1 to reduce Aβ pathology and improve behavioral performance. Copyright © 2015 Elsevier Inc. All rights reserved.

Exome-wide association study of plasma lipids in >300,000 individuals.

PubMed

Liu, Dajiang J; Peloso, Gina M; Yu, Haojie; Butterworth, Adam S; Wang, Xiao; Mahajan, Anubha; Saleheen, Danish; Emdin, Connor; Alam, Dewan; Alves, Alexessander Couto; Amouyel, Philippe; Di Angelantonio, Emanuele; Arveiler, Dominique; Assimes, Themistocles L; Auer, Paul L; Baber, Usman; Ballantyne, Christie M; Bang, Lia E; Benn, Marianne; Bis, Joshua C; Boehnke, Michael; Boerwinkle, Eric; Bork-Jensen, Jette; Bottinger, Erwin P; Brandslund, Ivan; Brown, Morris; Busonero, Fabio; Caulfield, Mark J; Chambers, John C; Chasman, Daniel I; Chen, Y Eugene; Chen, Yii-Der Ida; Chowdhury, Rajiv; Christensen, Cramer; Chu, Audrey Y; Connell, John M; Cucca, Francesco; Cupples, L Adrienne; Damrauer, Scott M; Davies, Gail; Deary, Ian J; Dedoussis, George; Denny, Joshua C; Dominiczak, Anna; Dubé, Marie-Pierre; Ebeling, Tapani; Eiriksdottir, Gudny; Esko, Tõnu; Farmaki, Aliki-Eleni; Feitosa, Mary F; Ferrario, Marco; Ferrieres, Jean; Ford, Ian; Fornage, Myriam; Franks, Paul W; Frayling, Timothy M; Frikke-Schmidt, Ruth; Fritsche, Lars G; Frossard, Philippe; Fuster, Valentin; Ganesh, Santhi K; Gao, Wei; Garcia, Melissa E; Gieger, Christian; Giulianini, Franco; Goodarzi, Mark O; Grallert, Harald; Grarup, Niels; Groop, Leif; Grove, Megan L; Gudnason, Vilmundur; Hansen, Torben; Harris, Tamara B; Hayward, Caroline; Hirschhorn, Joel N; Holmen, Oddgeir L; Huffman, Jennifer; Huo, Yong; Hveem, Kristian; Jabeen, Sehrish; Jackson, Anne U; Jakobsdottir, Johanna; Jarvelin, Marjo-Riitta; Jensen, Gorm B; Jørgensen, Marit E; Jukema, J Wouter; Justesen, Johanne M; Kamstrup, Pia R; Kanoni, Stavroula; Karpe, Fredrik; Kee, Frank; Khera, Amit V; Klarin, Derek; Koistinen, Heikki A; Kooner, Jaspal S; Kooperberg, Charles; Kuulasmaa, Kari; Kuusisto, Johanna; Laakso, Markku; Lakka, Timo; Langenberg, Claudia; Langsted, Anne; Launer, Lenore J; Lauritzen, Torsten; Liewald, David C M; Lin, Li An; Linneberg, Allan; Loos, Ruth J F; Lu, Yingchang; Lu, Xiangfeng; Mägi, Reedik; Malarstig, Anders; Manichaikul, Ani; Manning, Alisa K; Mäntyselkä, Pekka; Marouli, Eirini; Masca, Nicholas G D; Maschio, Andrea; Meigs, James B; Melander, Olle; Metspalu, Andres; Morris, Andrew P; Morrison, Alanna C; Mulas, Antonella; Müller-Nurasyid, Martina; Munroe, Patricia B; Neville, Matt J; Nielsen, Jonas B; Nielsen, Sune F; Nordestgaard, Børge G; Ordovas, Jose M; Mehran, Roxana; O'Donnell, Christoper J; Orho-Melander, Marju; Molony, Cliona M; Muntendam, Pieter; Padmanabhan, Sandosh; Palmer, Colin N A; Pasko, Dorota; Patel, Aniruddh P; Pedersen, Oluf; Perola, Markus; Peters, Annette; Pisinger, Charlotta; Pistis, Giorgio; Polasek, Ozren; Poulter, Neil; Psaty, Bruce M; Rader, Daniel J; Rasheed, Asif; Rauramaa, Rainer; Reilly, Dermot F; Reiner, Alex P; Renström, Frida; Rich, Stephen S; Ridker, Paul M; Rioux, John D; Robertson, Neil R; Roden, Dan M; Rotter, Jerome I; Rudan, Igor; Salomaa, Veikko; Samani, Nilesh J; Sanna, Serena; Sattar, Naveed; Schmidt, Ellen M; Scott, Robert A; Sever, Peter; Sevilla, Raquel S; Shaffer, Christian M; Sim, Xueling; Sivapalaratnam, Suthesh; Small, Kerrin S; Smith, Albert V; Smith, Blair H; Somayajula, Sangeetha; Southam, Lorraine; Spector, Timothy D; Speliotes, Elizabeth K; Starr, John M; Stirrups, Kathleen E; Stitziel, Nathan; Strauch, Konstantin; Stringham, Heather M; Surendran, Praveen; Tada, Hayato; Tall, Alan R; Tang, Hua; Tardif, Jean-Claude; Taylor, Kent D; Trompet, Stella; Tsao, Philip S; Tuomilehto, Jaakko; Tybjaerg-Hansen, Anne; van Zuydam, Natalie R; Varbo, Anette; Varga, Tibor V; Virtamo, Jarmo; Waldenberger, Melanie; Wang, Nan; Wareham, Nick J; Warren, Helen R; Weeke, Peter E; Weinstock, Joshua; Wessel, Jennifer; Wilson, James G; Wilson, Peter W F; Xu, Ming; Yaghootkar, Hanieh; Young, Robin; Zeggini, Eleftheria; Zhang, He; Zheng, Neil S; Zhang, Weihua; Zhang, Yan; Zhou, Wei; Zhou, Yanhua; Zoledziewska, Magdalena; Howson, Joanna M M; Danesh, John; McCarthy, Mark I; Cowan, Chad A; Abecasis, Goncalo; Deloukas, Panos; Musunuru, Kiran; Willer, Cristen J; Kathiresan, Sekar

2017-12-01

We screened variants on an exome-focused genotyping array in >300,000 participants (replication in >280,000 participants) and identified 444 independent variants in 250 loci significantly associated with total cholesterol (TC), high-density-lipoprotein cholesterol (HDL-C), low-density-lipoprotein cholesterol (LDL-C), and/or triglycerides (TG). At two loci (JAK2 and A1CF), experimental analysis in mice showed lipid changes consistent with the human data. We also found that: (i) beta-thalassemia trait carriers displayed lower TC and were protected from coronary artery disease (CAD); (ii) excluding the CETP locus, there was not a predictable relationship between plasma HDL-C and risk for age-related macular degeneration; (iii) only some mechanisms of lowering LDL-C appeared to increase risk for type 2 diabetes (T2D); and (iv) TG-lowering alleles involved in hepatic production of TG-rich lipoproteins (TM6SF2 and PNPLA3) tracked with higher liver fat, higher risk for T2D, and lower risk for CAD, whereas TG-lowering alleles involved in peripheral lipolysis (LPL and ANGPTL4) had no effect on liver fat but decreased risks for both T2D and CAD.

A track process for solvent annealing of high-χ BCPs

NASA Astrophysics Data System (ADS)

Guerrero, Douglas J.; Sakavuyi, Kaumba; Xu, Kui; Gharbi, Ahmed; Tiron, Raluca; Servin, Isabelle; Pain, Laurent; Claveau, Guillaume; Stokes, Harold; Harumoto, Masahiko; Nicolet, Célia; Chevalier, Xavier

2017-03-01

High chi organic lamellar-forming block copolymers were prepared with 18 nm intrinsic period Lo value. The BCPs were coated on a neutral layer on silicon substrates and were either thermally annealed or exposed to solvent vapors both in a 300mm track. The effect of lowering the glass transition temperature (Tg) on the high chi BCP was investigated. Process temperatures and times were varied. It was found that the BCP having lower Tg exhibits faster kinetics and is able to reach alignment in a shorter time than a similar BCP having higher Tg. Fingerprint defect analysis also shows that the BCP with lower Tg has lower defects. The results show that fingerprint formation can be achieved with either ether or ester type solvents depending on the BCP used. The results show that a track process for solvent annealing of high-χ BCPs is feasible and could provide the path forward for incorporation of BCP in future nodes. Finally, directed self-assembly was demonstrated by implemented high chi polymers on a graphoepitaxy test vehicles. CD and line width roughness was evaluated on patterns with a multiplication factor up to 7.

TG-MS analysis and kinetic study for thermal decomposition of six representative components of municipal solid waste under steam atmosphere.

PubMed

Zhang, Jinzhi; Chen, Tianju; Wu, Jingli; Wu, Jinhu

2015-09-01

Thermal decomposition of six representative components of municipal solid waste (MSW, including lignin, printing paper, cotton, rubber, polyvinyl chloride (PVC) and cabbage) was investigated by thermogravimetric-mass spectroscopy (TG-MS) under steam atmosphere. Compared with TG and derivative thermogravimetric (DTG) curves under N2 atmosphere, thermal decomposition of MSW components under steam atmosphere was divided into pyrolysis and gasification stages. In the pyrolysis stage, the shapes of TG and DTG curves under steam atmosphere were almost the same with those under N2 atmosphere. In the gasification stage, the presence of steam led to a greater mass loss because of the steam partial oxidation of char residue. The evolution profiles of H2, CH4, CO and CO2 were well consistent with DTG curves in terms of appearance of peaks and relevant stages in the whole temperature range, and the steam partial oxidation of char residue promoted the generation of more gas products in high temperature range. The multi-Gaussian distributed activation energy model (DAEM) was proved plausible to describe thermal decomposition behaviours of MSW components under steam atmosphere. Copyright © 2015 Elsevier Ltd. All rights reserved.

Not a Simple Tether: Binding of Toxoplasma gondii AMA1 to RON2 during Invasion Protects AMA1 from Rhomboid-Mediated Cleavage and Leads to Dephosphorylation of Its Cytosolic Tail

PubMed Central

Krishnamurthy, Shruthi; Deng, Bin; del Rio, Roxana; Buchholz, Kerry R.; Treeck, Moritz; Urban, Siniša; Boothroyd, John; Lam, Ying-Wai

2016-01-01

ABSTRACT Apical membrane antigen 1 (AMA1) is a receptor protein on the surface of Toxoplasma gondii that plays a critical role in host cell invasion. The ligand to which T. gondii AMA1 (TgAMA1) binds, TgRON2, is secreted into the host cell membrane by the parasite during the early stages of invasion. The TgAMA1-TgRON2 complex forms the core of the “moving junction,” a ring-shaped zone of tight contact between the parasite and host cell membranes, through which the parasite pushes itself during invasion. Paradoxically, the parasite also expresses rhomboid proteases that constitutively cleave the TgAMA1 transmembrane domain. How can TgAMA1 function effectively in host cell binding if its extracellular domain is constantly shed from the parasite surface? We show here that when TgAMA1 binds the domain 3 (D3) peptide of TgRON2, its susceptibility to cleavage by rhomboid protease(s) is greatly reduced. This likely serves to maintain parasite-host cell binding at the moving junction, a hypothesis supported by data showing that parasites expressing a hypercleavable version of TgAMA1 invade less efficiently than wild-type parasites do. Treatment of parasites with the D3 peptide was also found to reduce phosphorylation of S527 on the cytoplasmic tail of TgAMA1, and parasites expressing a phosphomimetic S527D allele of TgAMA1 showed an invasion defect. Taken together, these data suggest that TgAMA1-TgRON2 interaction at the moving junction protects TgAMA1 molecules that are actively engaged in host cell penetration from rhomboid-mediated cleavage and generates an outside-in signal that leads to dephosphorylation of the TgAMA1 cytosolic tail. Both of these effects are required for maximally efficient host cell invasion. PMID:27624124

Role of transglutaminase 2 in PAC1 receptor mediated protection against hypoxia-induced cell death and neurite outgrowth in differentiating N2a neuroblastoma cells.

PubMed

Algarni, Alanood S; Hargreaves, Alan J; Dickenson, John M

2017-03-15

The PAC 1 receptor and tissue transglutaminase (TG2) play important roles in neurite outgrowth and modulation of neuronal cell survival. In this study, we investigated the regulation of TG2 activity by the PAC 1 receptor in retinoic acid-induced differentiating N2a neuroblastoma cells. TG2 transamidase activity was determined using an amine incorporation and a peptide cross linking assay. In situ TG2 activity was assessed by visualising the incorporation of biotin-X-cadaverine using confocal microscopy. TG2 phosphorylation was monitored via immunoprecipitation and Western blotting. The role of TG2 in PAC 1 receptor-induced cytoprotection and neurite outgrowth was investigated by monitoring hypoxia-induced cell death and appearance of axonal-like processes, respectively. The amine incorporation and protein crosslinking activity of TG2 increased in a time and concentration-dependent manner following stimulation with pituitary adenylate cyclase-activating polypeptide-27 (PACAP-27). PACAP-27 mediated increases in TG2 activity were abolished by the TG2 inhibitors Z-DON and R283 and by pharmacological inhibition of protein kinase A (KT 5720 and Rp-cAMPs), protein kinase C (Ro 31-8220), MEK1/2 (PD 98059), and removal of extracellular Ca 2+ . Fluorescence microscopy demonstrated PACAP-27 induced in situ TG2 activity. TG2 inhibition blocked PACAP-27 induced attenuation of hypoxia-induced cell death and outgrowth of axon-like processes. TG2 activation and cytoprotection were also observed in human SH-SY5Y cells. Together, these results demonstrate that TG2 activity was stimulated downstream of the PAC 1 receptor via a multi protein kinase dependent pathway. Furthermore, PAC 1 receptor-induced cytoprotection and neurite outgrowth are dependent upon TG2. These results highlight the importance of TG2 in the cellular functions of the PAC 1 receptor. Copyright © 2017 Elsevier Inc. All rights reserved.

Development of ghrelin transgenic mice for elucidation of clinical implication of ghrelin.

PubMed

Aotani, Daisuke; Ariyasu, Hiroyuki; Shimazu-Kuwahara, Satoko; Shimizu, Yoshiyuki; Nomura, Hidenari; Murofushi, Yoshiteru; Kaneko, Kentaro; Izumi, Ryota; Matsubara, Masaki; Kanda, Hajime; Noguchi, Michio; Tanaka, Tomohiro; Kusakabe, Toru; Miyazawa, Takashi; Nakao, Kazuwa

2017-01-01

To elucidate the clinical implication of ghrelin, we have been trying to generate variable models of transgenic (Tg) mice overexpressing ghrelin. We generated Tg mice overexpressing des-acyl ghrelin in a wide variety of tissues under the control of β-actin promoter. While plasma des-acyl ghrelin level in the Tg mice was 44-fold greater than that of control mice, there was no differences in the plasma ghrelin level between des-acyl ghrelin Tg and the control mice. The des-acyl ghrelin Tg mice exhibited the lower body weight and the shorter body length due to modulation of GH-IGF-1 axis. We tried to generate Tg mice expressing a ghrelin analog, which possessed ghrelin-like activity (Trp 3 -ghrelin Tg mice). The plasma Trp 3 -ghrelin concentration in Trp 3 -ghrelin Tg mice was approximately 85-fold higher than plasma ghrelin (acylated ghrelin) concentration seen in the control mice. Because Trp 3 -ghrelin is approximately 24-fold less potent than ghrelin, the plasma Trp 3 -ghrelin concentration in Trp 3 -ghrelin Tg mice was calculated to have approximately 3.5-fold biological activity greater than that of ghrelin (acylated ghrelin) in the control mice. Trp 3 -ghrelin Tg mice did not show any phenotypes except for reduced insulin sensitivity in 1-year old. After the identification of ghrelin O-acyltransferase (GOAT), we generated doubly Tg mice overexpressing both mouse des-acyl ghrelin and mouse GOAT in the liver by cross-mating the two kinds of Tg mice. The plasma ghrelin concentration of doubly Tg mice was approximately 2-fold higher than that of the control mice. No apparent phenotypic changes in body weight and food intake were observed in doubly Tg mice. Further studies are ongoing in our laboratory to generate Tg mice with the increased plasma ghrelin level to a greater extent. The better understanding of physiological and pathophysiological significance of ghrelin from experiments using an excellent animal model may provide a new therapeutic approach for human diseases.

Determining Beta Sheet Crystallinity in Fibrous Proteins by Thermal Analysis and Infrared Spectroscopy

NASA Astrophysics Data System (ADS)

Hu, Xiao; Kaplan, David; Cebe, Peggy

2007-03-01

We report a study of self-assembled beta pleated sheets in Bombyx mori silk fibroin films using thermal analysis and infrared spectroscopy. Crystallization of beta pleated sheets was effected either by heating the films above the glass transition temperature (Tg) and holding isothermally, or by exposure to methanol. The fractions of secondary structural components including random coils, alpha helices, beta pleated sheets, turns, and side chains, were evaluated using Fourier self-deconvolution (FSD) of the infrared absorbance spectra. As crystalline beta sheets form, the heat capacity increment from the TMDSC trace at Tg is systematically decreased and is linearly well correlated with beta sheet content determined from FSD. This analysis of beta sheet content can serve as an alternative to X-ray methods and may have wide applicability to other crystalline beta sheet forming proteins.

Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.)

PubMed Central

2014-01-01

Background Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Results Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. Conclusion This study proposes a first broad collection of teak tissue and organ mRNA expression data for nine selected candidate qRT-PCR reference genes. NormFinder, Bestkeeper, geNorm and Delta Ct analyses suggested that TgUbq and TgEf-1α have the highest expression stability and provided similar results when evaluating TgCAD gene expression, while the commonly used Act should be avoided. PMID:25048176

Laser linewidth dependence to the transverse mode instability (TMI) nonlinear gain in kW-class fiber amplifiers

NASA Astrophysics Data System (ADS)

Mermelstein, Marc D.

2018-02-01

The thermal grating (TG) and inversion grating (IG) TMI gain dependence on the light beating intensity spectrum is investigated. TMI gain is restricted to intensity bandwidths comparable to the thermal gain bandwidth of 20 kHz. Seed laser phase noise generates intensity spectra determined by the laser linewidth and the relative group delay time of the gain fiber. These spectral bandwidths exceed the thermal gain bandwidth by orders of magnitude in both the coherent and incoherent regimes, making them unlikely sources of TMI. It is suggested that phase noise generated in the gain fiber due to external perturbations may be the source of the TMI.

Molecular cloning and characterization of an SRCAP chromatin remodeling homologue in Toxoplasma gondii.

PubMed

Sullivan, William J; Monroy, M Alexandra; Bohne, Wolfgang; Nallani, Karuna C; Chrivia, John; Yaciuk, Peter; Smith, Charles K; Queener, Sherry F

2003-05-01

We have identified and mapped a gene in Toxoplasma gondii that encodes a homologue of SRCAP (Snf2-related CBP activator protein), a member of the SNF/SWI family of chromatin remodeling factors. The genomic locus (TgSRCAP) is present as a single copy and contains 16 introns. The predicted cDNA contains an open reading frame of 8,775 bp and encodes a protein of 2,924 amino acids. We have identified additional SRCAP-like sequences in Apicomplexa for comparison by screening genomic databases. An analysis of SRCAP homologues between species reveals signature features that may be indicative of SRCAP members. Expression of mRNA encoding TgSRCAP is upregulated when tachyzoite (invasive form) parasites are induced to differentiate into bradyzoites (encysted form) in vitro. Recombinant TgSRCAP protein is functionally equivalent to the human homologue, being capable of increasing transcription mediated by CREB.

Should triglycerides and the triglycerides to high-density lipoprotein cholesterol ratio be used as surrogates for insulin resistance?

PubMed

Kim-Dorner, Su-Jong; Deuster, Patricia A; Zeno, Stacey A; Remaley, Alan T; Poth, Merrily

2010-02-01

The aims of the present study were to examine whether triglycerides (TG) and the triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) could predict insulin resistance in healthy African Americans and whites. This cross-sectional study included 99 African American and 50 white men and women between 18 and 45 years of age with body mass indexes between 18.5 and 38.0 kg/m(2). Anthropometric measures were obtained; and overnight fasting blood was collected for TG, HDL-C, glucose, and insulin. Insulin resistance was defined by fasting insulin concentration of at least 13.13 microU/mL and homeostasis model assessment of insulin resistance (HOMA-IR) of at least 2.5. Receiver operating characteristic curves were used to analyze the data. African Americans and whites had comparable demographic and anthropometric measures. Fasting insulin was higher in African Americans (12.4 +/- 7.8 microU/mL) than whites (10.2 +/- 7.5 microU/mL), but HOMA-IR did not differ significantly (African Americans, 2.9 +/- 2.0; whites, 2.4 +/- 1.9). Triglycerides and TG/HDL-C were significantly lower in African Americans (TG, 68.2 +/- 43.3 mg/dL; TG/HDL-C, 1.8 +/- 2.1) compared with whites (TG, 105.4 +/- 55.2 mg/dL; TG/HDL-C, 2.8 +/- 1.8). Area under the receiver operating characteristic curves revealed that both TG and TG/HDL-C were acceptable markers of insulin resistance, as defined by fasting insulin concentration, in whites, 0.770 and 0.765, respectively, but poor predictors in African Americans, 0.633 and 0.651, respectively. Similarly, TG and TG/HDL-C were acceptable in predicting insulin resistance, as measured by HOMA-IR, in whites, 0.763 and 0.770, respectively, but poor in predicting HOMA-IR in African Americans, with areas of 0.625 and 0.639, respectively. In conclusion, the relationship between TG and TG/HDL-C with insulin resistance differs by ethnicity; and using TG and TG/HDL-C to predict insulin resistance in African Americans would not be appropriate. Copyright 2010 Elsevier Inc. All rights reserved.

Augmentation of the expression of the eotaxin receptor on duodenal neutrophils by IL-21.

PubMed

Takeda, Yuji; Kato, Tomoyuki; Nemoto, Nobuhito; Araki, Akemi; Gazi, Mohammad Yeashin; Nara, Hidetoshi; Asao, Hironobu

2018-05-16

Inflammation can occur via different mechanisms, such as via acute and chronic responses, on numerous occasions and function accordingly through various roles. There are more than five subsets of neutrophils; neutrophilic heterogeneity is modulated by the inflammatory condition. To understand the characteristics of inflammation, identification of atypical neutrophils is important. In this study, we found that the expression of eotaxin receptor (CD193) on atypical neutrophils in the duodenum is augmented in IL-21 isoform transgenic (Tg) mice. In a series of studies, we have established a Tg mouse strain to further investigate the functions of IL-21 in vivo. Interestingly, Tg mice immunized with ovalbumin (OVA) were more sensitive to OVA-induced systemic anaphylaxis as compared with wild type mice with duodenal and splenic gross congestion. Further analysis conducted in the duodenum of Tg mice revealed that only the number of neutrophils migrating into the duodenum was significantly increased prior to immunization. Previous studies have shown that the gastrointestinal compartment and the spleen constantly produce eotaxin, which regulates basal levels of tissue eosinophils. Therefore, we analyzed CD193 expression on neutrophils and eosinophils. As expected, its expression by duodenal neutrophils was upregulated in Tg mice. Furthermore, the addition of IL-21 into bone marrow cell culture increased the number of CD193 + neutrophils, which easily migrated into the duodenum. These observations suggested that CD193 + neutrophils increase in number under inflammatory conditions due to chronic IL-21 production. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genotyping of Toxoplasma gondii: DNA extraction from formalin-fixed paraffin-embedded autopsy tissues from AIDS patients who died by severe disseminated toxoplasmosis.

PubMed

Bastos da Silva, Inara; Batista, Tatiana Pimental de Andrade; Martines, Roosecelis Brasil; Kanamura, Cristina Takami; Ferreira, Isabelle Martins Ribeiro; Vidal, Jose Ernesto; Pereira-Chioccola, Vera Lucia

2016-06-01

This study investigated the genetic features of Toxoplasma gondii isolated directly in autopsies of HIV-infected patients who died with severe disseminated toxoplasmosis. This retrospective analysis was conducted in a cohort of 15 HIV-infected patients with clinical and laboratory data. They had previous cerebral toxoplasmosis at least 6 months before the disseminated toxoplasmosis episode. The hypothesis was that they were infected with highly virulent parasites due to the condition in which they died. T. gondii genotyping was done directly in DNA extracted from 30 autopsy brain and lung samples (2 per patient) and mutilocus PCR-RFLP genotyping was done using 12 molecular markers. The 30 clinical samples were genotyped successfully in 8 or more loci and six suggestive genotypes were identified. One of them was Toxo DB #11, previously identified in different domestic animals and virulent in experimental animals. The other five suggestive genotypes identified in 14 patients were not described. TgHuDis1 was the most frequent and was determined in 8 patients. TgHuDis3 and TgHuDis5 were identified in two patients each. TgHuDis2 and TgHuDis4 have been identified in one patient each. These suggestive genotypes could be considered as virulent, since they caused severe tissue damage and had similar characteristics as Toxo # DB 11. Copyright © 2016 Elsevier Inc. All rights reserved.

Novel insights into the functional metabolic impact of an apparent de novo m.8993T>G variant in the MT-ATP6 gene associated with maternally inherited form of Leigh Syndrome.

PubMed

Uittenbogaard, Martine; Brantner, Christine A; Fang, ZiShui; Wong, Lee-Jun C; Gropman, Andrea; Chiaramello, Anne

2018-03-27

In this study, we report a novel perpective of metabolic consequences for the m.8993T>G variant using fibroblasts from a proband with clinical symptoms compatible with Maternally Inherited Leigh Syndrome (MILS). Definitive diagnosis was corroborated by mitochondrial DNA testing for the pathogenic variant m.8993T>G in MT-ATP6 subunit by Sanger sequencing. The long-range PCR followed by massively parallel sequencing method detected the near homoplasmic m.8993T>G variant at 83% in the proband's fibroblasts and at 0.4% in the mother's fibroblasts. Our results are compatible with very low levels of germline heteroplasmy or an apparent de novo mutation. Our mitochondrial morphometric analysis reveals severe defects in mitochondrial cristae structure in the proband's fibroblasts. Our live-cell mitochondrial respiratory analyses show impaired oxidative phosphorylation with decreased spare respiratory capacity in response to energy stress in the proband's fibroblasts. We detected a diminished glycolysis with a lessened glycolytic capacity and reserve, revealing a stunted ability to switch to glycolysis upon full inhibition of OXPHOS activities. This dysregulated energy reprogramming results in a defective interplay between OXPHOS and glycolysis during an energy crisis. Our study sheds light on the potential pathophysiologic mechanism leading to chronic energy crisis in this MILS patient harboring the m.8993T>G variant. Copyright © 2018 Elsevier Inc. All rights reserved.

Application of thermal analysis techniques in activated carbon production

USGS Publications Warehouse

Donnals, G.L.; DeBarr, J.A.; Rostam-Abadi, M.; Lizzio, A.A.; Brady, T.A.

1996-01-01

Thermal analysis techniques have been used at the ISGS as an aid in the development and characterization of carbon adsorbents. Promising adsorbents from fly ash, tires, and Illinois coals have been produced for various applications. Process conditions determined in the preparation of gram quantities of carbons were used as guides in the preparation of larger samples. TG techniques developed to characterize the carbon adsorbents included the measurement of the kinetics of SO2 adsorption, the performance of rapid proximate analyses, and the determination of equilibrium methane adsorption capacities. Thermal regeneration of carbons was assessed by TG to predict the life cycle of carbon adsorbents in different applications. TPD was used to determine the nature of surface functional groups and their effect on a carbon's adsorption properties.

Tissue transglutaminase crosslinks ataxin-1: Possible role in SCA1 pathogenesis

PubMed Central

D’Souza, D.R.; Wei, J.; Shao, Q.; Hebert, M.D.; Subramony, S.H.; Vig, P.J.S.

2007-01-01

Transglutaminase type 2 (TG2) has recently been implicated in crosslinking of mutant huntingtin protein into aggregates. Here we show that TG2 also crosslinks spinocerebellar ataxia-1 (SCA1) gene product ataxin-1. HeLa cell lysates expressing GFP tagged ataxin-1 with 2, 30 or 82 glutamines showed covalent crosslinking of ataxin-1 when incubated with exogenously added TG2. This crosslinking was inhibited by TG2 inhibitor cystamine. SCA1 transgenic mice which overexpress the mutant ataxin-1 in cerebellar Purkinje cells showed elevated nuclear TG2 in the absence of ataxin-1 nuclear aggregates. The addition of purified TG2 to the nuclear extracts or addition of SCA1 nuclear TG2 to GFP-Q82 HeLa cell lysates resulted in the formation of insoluble aggregates. These data indicate that ataxin-1 is a substrate of TG2. Further, in SCA1 TG2 may translocate to the nucleus in response to nuclear accumulation of mutant ataxin-1 at early stages of the disease. PMID:17045396

Carbon Sequestration Potential in Stands under the Grain for Green Program in Southwest China.

PubMed

Chen, Xiangang; Luo, Yunjian; Zhou, Yongfeng; Lu, Mei

2016-01-01

The Grain for Green Program (GGP) is the largest afforestation and reforestation project in China in the early part of this century. To assess carbon sequestration in stands under the GGP in Southwest China, the carbon stocks and their annual changes in the GGP stands in the region were estimated based on the following information: (1) collected data on the annually planted area of each tree species under the GGP in Southwest China from 1999 to 2010; (2) development of empirical growth curves and corresponding carbon estimation models for each species growing in the GPP stands; and (3) parameters associated with the stands such as wood density, biomass expansion factor, carbon fraction and the change rate of soil organic carbon content. Two forest management scenarios were examined: scenario A, with no harvesting, and scenario B, with logging at the customary rotation followed by replanting. The results showed that by the years 2020, 2030, 2040, 2050 and 2060, the expected carbon storage of the GGP stands in Southwest China is 139.58 TgC, 177.50-207.55 TgC, 196.86-259.65 TgC, 240.45-290.62 TgC and 203.22-310.03 TgC (T = 1012), respectively. For the same years, the expected annual change in carbon stocks is 7.96 TgCyr-1, -7.95-5.95 TgCyr-1, -0.10-4.67 TgCyr-1, 4.31-2.24 TgCyr-1 and -0.02-1.75 TgCyr-1, respectively. This indicates that the stands significantly contribute to forest carbon sinks in this region. In 2060, the estimated carbon stocks in the seven major species of GGP stands in Southwest China are 4.16-13.01 TgC for Pinus armandii, 6.30-15.01 TgC for Pinus massoniana, 11.51-13.44 TgC for Cryptomeria fortunei, 15.94-24.13 TgC for Cunninghamia lanceolata, 28.05 TgC for Cupressus spp., 5.32-15.63 TgC for Populus deltoides and 5.87-14.09 TgC for Eucalyptus spp. The carbon stocks in these seven species account for 36.8%-41.4% of the total carbon stocks in all GGP stands over the next 50 years.

Follicular thyroglobulin induces cathepsin H expression and activity in thyrocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oda, Kenzaburo; Laboratory of Molecular Diagnostics, Department of Mycobacteriology, Leprosy Research Center, National Institute of Infectious Diseases, 4-2-1 Aoba-cho, Higashimurayama, Tokyo 189-0002; Division of Diabetes, Metabolism and Endocrinology, Department of Internal Medicine, Toho University, 5-21-16 Omorinishi, Ota, Tokyo 143-8540

Thyroglobulin (Tg) stored in thyroid follicles exerts a potent negative-feedback effect on each step of pre-hormone biosynthesis, including Tg gene transcription and iodine uptake and organification, by suppressing the expression of specific transcription factors that regulate these steps. Pre-hormones are stored in the follicular colloid before being reabsorbed. Following lysosomal proteolysis of its precursor, thyroid hormone (TH) is released from thyroid follicles. Although the suppressive effects of follicular Tg on each step of pre-hormone biosynthesis have been extensively characterized, whether follicular Tg accumulation also affects hormone reabsorption, proteolysis, and secretion is unclear. In this study we explored whether follicular Tgmore » can regulate the expression and function of the lysosomal endopeptidases cathepsins. We found that in the rat thyroid cell line FRTL-5 follicular Tg induced cathepsin H mRNA and protein expression, as well as cathepsin H enzyme activity. Double immunofluorescence staining showed that Tg endocytosis promoted cathepsin H translocalization into lysosomes where it co-localized with internalized Tg. These results suggest that cathepsin H is an active participant in lysosome-mediated pre-hormone degradation, and that follicular Tg stimulates mobilization of pre-hormones by activating cathepsin H-associated proteolysis pathways. - Highlights: • Follicular Tg increases cathepsin H mRNA and protein levels in rat thyroid cells. • Follicular Tg increases cathepsin H enzyme activity in rat thyroid cells. • After Tg stimulation cathepsin H co-localizes to lysosomes with follicular Tg. • Cathepsin H promotes hormone secretion by lysosome-mediated mechanisms.« less

Cdk-related kinase 9 regulates RNA polymerase II mediated transcription in Toxoplasma gondii.

PubMed

Deshmukh, Abhijit S; Mitra, Pallabi; Kolagani, Ashok; Gurupwar, Rajkumar

2018-06-01

Cyclin-dependent kinases are an essential part of eukaryotic transcriptional machinery. In Apicomplexan parasites, the role and relevance of the kinases in the multistep process of transcription seeks more attention given the absence of full repertoire of canonical Cdks and cognate cyclin partners. In this study, we functionally characterize T. gondii Cdk-related kinase 9 (TgCrk9) showing maximal homology to eukaryotic Cdk9. An uncanonical cyclin, TgCyclin L, colocalizes with TgCrk9 in the parasite nucleus and co-immunoprecipitate, could activate the kinase in-vitro. We identify two threonines in conserved T-loop domain of TgCrk9 that are important for its activity. The activated TgCrk9 phosphorylates C-terminal domain (CTD) of TgRpb1, the largest subunit of RNA polymerase II highlighting its role in transcription. Selective chemical inhibition of TgCrk9 affected serine 2 phosphorylation in the heptapeptide repeats of TgRpb1-CTD towards 3' end of genes consistent with a possible role in transcription elongation. Interestingly, TgCrk9 kinase activity is regulated by the upstream TgCrk7 based CAK complex. TgCrk9 was found to functionally complement the role of its yeast counterpart Bur1 establishing its role as an important transcriptional kinase. In this study, we provide robust evidence that TgCrk9 is an important part of transcription machinery regulating gene expression in T. gondii. Copyright © 2018 Elsevier B.V. All rights reserved.

VCAM-1 blockade delays disease onset, reduces disease severity and inflammatory cells in an atopic dermatitis model.

PubMed

Chen, Lin; Lin, Shao-xia; Amin, Sanober; Overbergh, Lut; Maggiolino, Giacomo; Chan, Lawrence S

2010-01-01

We investigated the functions of critical adhesion molecules ICAM-1 and VCAM-1 in a keratin-14 IL-4-transgenic (Tg) mouse model of atopic dermatitis, the skin lesions of which are characterized by prominent inflammatory cell infiltration, significantly increased mRNAs and proteins of ICAM-1, VCAM-1, E-selectin, P-selectin, L-selectin, and PSGL-1, and significantly increased numbers of dermal vessels expressing these adhesion molecules. We tested the hypotheses that deletion or blockade of these molecules may impede the inflammation by examining the disease progresses in the Tg mice crossed with ICAM-1-knockout mice and Tg mice received anti-VCAM-1-neutralizing antibody. Although the findings of the ICAM-1-knockout Tg mice (Tg/ICAM-1(-/-)) developed skin lesions similar to wide-type ICAM-1 Tg mice (Tg/ICAM-1(+/+)) were surprising, a compensatory mechanism may account for it: the frequency of VCAM-1 ligand, CD49d, on CD3(+) T cells in the lesional skin significantly increased in the Tg/ICAM-1(-/-) mouse, compared with the Tg/ICAM-1(+/+) mice. In contrast, anti-VCAM-1-treated Tg/ICAM-1(-/-) or Tg/ICAM-1(+/+) mice had significantly delayed onset of skin inflammation compared with isotype antibody-treated groups. Moreover, anti-VCAM-1 significantly reduced the skin inflammation severity in Tg/ICAM-1(+/+) mice, accompanied with reduction of mast cell, eosinophil, and CD3(+) T cell infiltration. VCAM-1 is more critical in developing skin inflammation in this model.

Triacylglycerol kinetics in endotoxic rats with suppressed lipoprotein lipase activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bagby, G.J.; Corll, C.B.; Martinez, R.R.

1987-07-01

Hypertriglyceridemia observed in animals after bacterial endotoxin administration and some forms of sepsis can result from increased hepatic triacylglycerol (TG) output or decreased TG clearance by extrahepatic tissues. To differentiate between these two possibilities, TG and free fatty acid (FFA) kinetics were determined in control and endotoxin-injected rats 18 h after treatment. Plasma TG and FFA kinetics were assessed by a constant intravenous infusion with (9,10-/sup 3/H)palmitate-labeled very low-density lipoprotein and (1-/sup 14/C)palmitate bound to albumin, respectively. In addition, lipoprotein lipase (LPL) activity was determined in heart, skeletal muscle, and adipose tissue as well as in postheparin plasma of functionallymore » hepatectomized, adrenalectomized, and gonadectomized rats. Plasma FFA acid concentrations were slightly increased in endotoxin-treated rats but their turnover did not differ from control. Endotoxin-treated rats had a threefold increase in plasma TG concentrations and decreased heart, skeletal muscle, and post-heparin plasma LPL activity. Plasma TG turnover was decreased, indicating that hypertriglyceridemia was not due to an increased TG output by the liver. Instead, the endotoxin-induced increase in plasma TG concentration was consequence of the 80% reduction in TG metabolic clearance rate. Thus, suppression of LPL activity in endotoxic animals impairs TG clearance resulting in hypertriglyceridemia. Furthermore, endotoxin administration reduced the delivery of TG-FFA to extrahepatic tissues because hepatic synthesis and secretion of TG from plasma FFA was decreased and LPL activity was suppressed.« less

Mice over-expressing BDNF in forebrain neurons develop an altered behavioral phenotype with age.

PubMed

Weidner, Kate L; Buenaventura, Diego F; Chadman, Kathryn K

2014-07-15

Evidence from clinical studies suggests that abnormal activity of brain derived neurotrophic factor (BDNF) contributes to the pathogenesis of autism spectrum disorders (ASDs). A genetically modified line of mice over-expressing a BDNF transgene in forebrain neurons was used to investigate if this mutation leads to changes in behavior consistent with ASD. The mice used in these experiments were behaviorally tested past 5 months of age when spontaneous seizures were evident. These seizures were not observed in age-matched wildtype (WT) mice or younger mice from this transgenic line. The BDNF mice in these experiments weighed less than their WT littermates. The BDNF transgenic (BDNF-tg) mice demonstrated similar levels of sociability in the social approach test. Conversely, the BDNF-tg mice demonstrated less obsessive compulsive-like behavior in the marble burying test, less anxiety-like behavior in the elevated plus maze test, and less depressive-like behavior in the forced swim test. Changes in behavior were found in these older mice that have not been observed in younger mice from this transgenic line, which may be due to the development of seizures as the mice age. These mice do not have an ASD phenotype but may be useful to study adult onset epilepsy. Copyright © 2014 Elsevier B.V. All rights reserved.

Common functional variants of APOA5 and GCKR accumulate gradually in association with triglyceride increase in metabolic syndrome patients.

PubMed

Hadarits, Ferenc; Kisfali, Péter; Mohás, Márton; Maász, Anita; Duga, Balázs; Janicsek, Ingrid; Wittmann, István; Melegh, Béla

2012-02-01

The common functional variants of the apolipoprotein A5 (APOA5) and the glucokinase regulatory protein genes (GCKR) have been shown to associate with increased fasting triglyceride (TG) levels. Albeit the basic association has been extensively investigated in several populations of different origin, less is known about quantitative traits of them. In our study accumulation rates of four APOA5 (T-1131, IVS3 + G476A, T1259C and C56G) and two GCKR (C1337T and rs780094) functional SNPs were analyzed in patients stratified into four TG quartile groups. Randomly selected 325 metabolic syndrome patients were separated into four quartile (q) groups based on the TG levels as follows q1: TG <1.38 mmol/l; q2: 1.38-1.93 mmol/l; q3: 1.94-2.83 mmol/l; and q4: TG >2.83 mmol/l. We observed significant stepwise increase of prevalence rates of minor allele frequencies in the four plasma TG quartiles for three APOA5 SNPs: -1131C (q1: 4.94%; q2: 8.64%; q3: 11.6%; q4: 12.3%), IVS3 + 476A (q1: 4.32%; q2: 7.4%; q3: 10.36%; q4: 11.1%), and 1259C (q1: 4.94%; q2: 7.41%; q3: 10.4%; q4: 11.7%). The haplotype analysis revealed, that the frequency of APOA5*2 haplotype gradually increased in q2, q3 and q4 (q1: 9.87%; q2: 14.8%; q3: 18.3%; q4: 21%). The distribution of the homozygotes of the two analyzed GCKR variants resembled to the APOA5 pattern. Contrary to the hypothetically predictable linear association coming from the current knowledge about the APOA5 and GCKR functions, the findings presented here revealed a unique, TG raise dependent gradual accumulation of the functional variants of in MS patients. Thus, the findings of the current study serve indirect evidence for the existence of rare APOA5 and GCKR haplotypes in metabolic syndrome patients with higher TG levels, which contribute to the complex lipid metabolism alteration in this disease.

Waist-to-height ratio (WHtR) and triglyceride to HDL-C ratio (TG/HDL-c) as predictors of cardiometabolic risk.

PubMed

Weiler Miralles, Clara Silvana; Wollinger, Luana Maria; Marin, Débora; Genro, Julia Pasqualini; Contini, Veronica; Morelo Dal Bosco, Simone

2015-05-01

The excessive concentration of fat in the abdominal region is related to a higher risk of developing cardiovascular disease (CVD). Studies have been performed to identify simple and effective indicators of abdominal obesity and associated cardiometabolic risk through the use of simple parameters such as anthropometric and biochemical measures. The Triglyceride / High-density Lipoprotein Cholesterol (TG/HDL-c) has been proposed as a more practical and easy to use atherogenic marker, along with the Waist-to-Height Ratio (WHtR), which makes a superior tool for separating cardiometabolic risk related to overweight/obesity when comparing to Body Mass Index (BMI). To verify the applicability of the WHtR and the TG/HDL-c ratio as predictors of cardiometabolic risk. This cross-sectional study was performed at the Department of Nutrition of the UNIVATES University Center, where the participant's anthropometric and biochemical data were collected. Statistical analysis was performed by the Statistical Package for the Social Sciences software (SPSS) 20.0, with a significance level of 5% (p < 0.05). A total of 498 individuals took part on this research, 77.5% female and with a mean age of 25.5 ± 6.5. A high percentage of fat was found in both men and women (19.9 ± 5.80% and 29.24 ± 5.43%, respectively). The prevalence of overweight/obesity (BMI ≥ 25Kg/m(2)) was 35.05%. The WHtR marker was significantly correlated to Low-density Lipoprotein Cholesterol (LDL-c), Triglyceride (TG) and Anthropometric BMI values, waist circumference (WC) and body fat percentage (BF%). For the TG/HDL-c ratio, there was a positive and significant correlation to the same markers, beyond TC. There was also a correlation between WHtR and TG/HDL-c, and both presented a negative and significant correlation with HDL-c. WHtR and TG/HDL-c values were found to be good markers for the cardiometabolic risk ratio in the studied sample. Several studies, original articles and academic reviews confirm the use of the WHtR or TG/HDL-c markers for that purpose in adults. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Intrinsic Regulation of Thyroid Function by Thyroglobulin

PubMed Central

Sellitti, Donald F.

2014-01-01

Background: The established paradigm for thyroglobulin (Tg) function is that of a high molecular weight precursor of the much smaller thyroid hormones, triiodothyronine (T3) and thyroxine (T4). However, speculation regarding the cause of the functional and morphologic heterogeneity of the follicles that make up the thyroid gland has given rise to the proposition that Tg is not only a precursor of thyroid hormones, but that it also functions as an important signal molecule in regulating thyroid hormone biosynthesis. Summary: Evidence supporting this alternative paradigm of Tg function, including the up- or downregulation by colloidal Tg of the transcription of Tg, iodide transporters, and enzymes employed in Tg iodination, and also the effects of Tg on the proliferation of thyroid and nonthyroid cells, is examined in the present review. Also discussed in detail are potential mechanisms of Tg signaling in follicular cells. Conclusions: Finally, we propose a mechanism, based on experimental observations of Tg effects on thyroid cell behavior, that could account for the phenomenon of follicular heterogeneity as a highly regulated cycle of increasing and decreasing colloidal Tg concentration that functions to optimize thyroid hormone production through the transcriptional activation or suppression of specific genes. PMID:24251883

The solid state of rebamipide: preparation, characterization, and dissolution.

PubMed

Jeon, Seong Hyeon; Sohn, Young Taek

2016-04-01

Rebamipide is marketed as a peptic ulcer agent under the trade name Mucosta(R). The objective of this work was to investigate the existence of polymorphs and pseudopolymorphs of rebamipide. Two crystal forms of rebamipide were isolated by recrystallization and characterized by differential thermal analysis (DTA), thermogravimetric analysis (TG), powder X-ray diffractometry, infrared spectrometry, and nuclear magnetic resonance. The DTA curve of Form 1 showed one endothermic peak at 305.2 °C, and that of Form 2 showed one endothermic peak at 307.3 °C. The TG curve of Form 1 showed a single weight loss at 305.2 °C, which corresponded to melting. The TG curve of Form 2 also showed a single weight loss at 307.3 °C, which corresponded to melting. The melting point of Form 2 was higher than that of Form 1. In the dissolution studies in pH 6.8 buffer at 37 ± 0.5 °C, the two crystal forms showed no significant differences in dissolution. After 3 months of storage at 0, 52, and 95% RH, the two crystal forms were not transformed. After milling with a Specamill for 2 h, the two crystal forms were not transformed.

Dielectric relaxation of 2-ethyl-1-hexanol around the glass transition by thermally stimulated depolarization currents.

PubMed

Arrese-Igor, S; Alegría, A; Colmenero, J

2015-06-07

We explore new routes for characterizing the Debye-like and α relaxation in 2-ethyl-1-hexanol (2E1H) monoalcohol by using low frequency dielectric techniques including thermally stimulated depolarization current (TSDC) techniques and isothermal depolarization current methods. In this way, we have improved the resolution of the overlapped processes making it possible the analysis of the data in terms of a mode composition as expected for a chain-like response. Furthermore the explored ultralow frequencies enabled to study dynamics at relatively low temperatures close to the glass transition (Tg). Results show, on the one hand, that Debye-like and α relaxation timescales dramatically approach to each other upon decreasing temperature to Tg. On the other hand, the analysis of partial polarization TSDC data confirms the single exponential character of the Debye-like relaxation in 2E1H and rules out the presence of Rouse type modes in the scenario of a chain-like response. Finally, on crossing the glass transition, the Debye-like relaxation shows non-equilibrium effects which are further emphasized by aging treatment and would presumably emerge as a result of the arrest of the structural relaxation below Tg.

Reduced ratio of protective versus proinflammatory cytokine responses to commensal bacteria in HLA-B27 transgenic rats

PubMed Central

DIELEMAN, L A; HOENTJEN, F; QIAN, B-F; SPRENGERS, D; TJWA, E; TORRES, M F; TORRICE, C D; SARTOR, R B; TONKONOGY, S L

2004-01-01

Germ-free HLA-B27 transgenic (TG) rats do not develop colitis, but colonization with specific pathogen-free (SPF) bacteria induces colitis accompanied by immune activation. To study host-dependent immune responses to commensal caecal bacteria we investigated cytokine profiles in mesenteric lymph node (MLN) cells from HLA-B27 TG versus nontransgenic (non-TG) littermates after in vitro stimulation with caecal bacterial lysates (CBL). Supernatants from CBL-stimulated unseparated T- or B- cell-depleted MLN cells from HLA-B27 TG and non-TG littermates were analysed for IFN-γ, IL-12, TNF, IL-10 and TGF-β production. Our results show that unfractionated TG MLN cells stimulated with CBL produced more IFN-γ, IL-12 and TNF than did non-TG MLN cells. In contrast, CBL-stimulated non-TG MLN cells produced more IL-10 and TGF-β. T cell depletion abolished IFN-γ and decreased IL-12 production, but did not affect IL-10 and TGF-β production. Conversely, neither IL-10 nor TGF-β was produced in cultures of B cell-depleted MLN. In addition, CD4+ T cells enriched from MLN of HLA-B27 TG but not from non-TG rats produced IFN-γ when cocultured with CBL-pulsed antigen presenting cells from non-TG rats. Interestingly, IL-10 and TGF-β, but not IFN-γ, IL-12 and TNF were produced by MLN cells from germ-free TG rats. These results indicate that the colitis that develops in SPF HLA-B27 TG rats is accompanied by activation of IFN-γ-producing CD4+ T cells that respond to commensal bacteria. However, B cell cytokine production in response to components of commensal intestinal microorganisms occurs in the absence of intestinal inflammation. PMID:15030511

Mitochondrial antioxidative capacity regulates muscle glucose uptake in the conscious mouse: effect of exercise and diet.

PubMed

Kang, Li; Lustig, Mary E; Bonner, Jeffrey S; Lee-Young, Robert S; Mayes, Wesley H; James, Freyja D; Lin, Chien-Te; Perry, Christopher G R; Anderson, Ethan J; Neufer, P Darrell; Wasserman, David H

2012-10-15

The objective of this study was to test the hypothesis that exercise-stimulated muscle glucose uptake (MGU) is augmented by increasing mitochondrial reactive oxygen species (mtROS) scavenging capacity. This hypothesis was tested in genetically altered mice fed chow or a high-fat (HF) diet that accelerates mtROS formation. Mice overexpressing SOD2 (sod2(Tg)), mitochondria-targeted catalase (mcat(Tg)), and combined SOD2 and mCAT (mtAO) were used to increase mtROS scavenging. mtROS was assessed by the H(2)O(2) emitting potential (JH(2)O(2)) in muscle fibers. sod2(Tg) did not decrease JH(2)O(2) in chow-fed mice, but decreased JH(2)O(2) in HF-fed mice. mcat(Tg) and mtAO decreased JH(2)O(2) in both chow- and HF-fed mice. In parallel, the ratio of reduced to oxidized glutathione (GSH/GSSG) was unaltered in sod2(Tg) in chow-fed mice, but was increased in HF-fed sod2(Tg) and both chow- and HF-fed mcat(Tg) and mtAO. Nitrotyrosine, a marker of NO-dependent, reactive nitrogen species (RNS)-induced nitrative stress, was decreased in both chow- and HF-fed sod2(Tg), mcat(Tg), and mtAO mice. This effect was not changed with exercise. Kg, an index of MGU was assessed using 2-[(14)C]-deoxyglucose during exercise. In chow-fed mice, sod2(Tg), mcat(Tg), and mtAO increased exercise Kg compared with wild types. Exercise Kg was also augmented in HF-fed sod2(Tg) and mcat(Tg) mice but unchanged in HF-fed mtAO mice. In conclusion, mtROS scavenging is a key regulator of exercise-mediated MGU and this regulation depends on nutritional state.

Day 3 thyroglobulin ≤ 1 ng/ml after recombinant human TSH just prior to radioactive iodine is predictive of low risk for persistent/recurrent disease in patients with papillary thyroid carcinoma.

PubMed

Rosario, Pedro W; Siman, Thássio Leonardo; Calsolari, Maria R

2015-05-01

We evaluated the negative predictive value (NPV) of thyroglobulin obtained 24 h after the second recombinant human TSH (rhTSH) ampoule (Tg-D3), before ablation with (131)I, for persistent/recurrent disease (PRD) in low/intermediate risk patients with papillary thyroid carcinoma. One hundred and one patients with Tg-D3 ≤ 1 ng/ml without anti-Tg antibodies (TgAb) were selected. Post-therapy whole-body scanning was negative for metastases in 98 (97 %) patients, and three patients showed discrete ectopic cervical uptake, but no corresponding disease was detected by neck ultrasound or computed tomography. One year after ablation, 98 (97 %) patients were free of the disease. Three patients had stimulated Tg >1 ng/ml, but no metastases were detected by the imaging methods. During follow-up (median 50 months), tumor recurrence was observed in only one patient. Thus, the NPV of Tg-D3 ≤ 1 ng/ml for PRD was 99 %. Among the 101 patients with Tg-D3 ≤ 1 ng/ml, Tg obtained 48 h after ablation (Tg-D5) continued to be ≤ 1 ng/ml in 56, and 45 had Tg-D5 >1 ng/ml. None of these 45 patients had PRD. In conclusion, Tg-D3 ≤ 1 ng/ml had a high NPV for PRD in patients without TgAb or known persistent disease and who are not at high risk. In these patients, Tg-D5 >1 ng/ml is more likely to reflect actinic damage to the remnant thyroid tissue rather than persistence of significant normal or tumor tissue.

Evaluation of the highly sensitive Roche thyroglobulin II assay and establishment of a reference limit for thyroglobulin-negative patient samples.

PubMed

Rotteveel-de Groot, Dorien M; Ross, H Alec; Janssen, Marcel J R; Netea-Maier, Romana T; Oosting, Janine D; Sweep, Fred C G J; van Herwaarden, Antonius E

2016-08-01

Thyroglobulin (Tg) measurements are used to monitor for residual thyroid tissue in patients with differentiated thyroid cancer (DTC) after thyroidectomy and radioiodine ablative therapy. In recent years highly sensitive Tg assays have been developed. In this study the analytical performance of the new Roche Elecsys Tg II assay was evaluated and compared with the well documented Access2 Tg assay (Beckman-Coulter). Analytical performance was examined using various Clinical and Laboratory Standards Institute (CLSI) evaluation protocols. Tg negative patient sera were used to establish an upper reference limit (URL) for the Elecsys Tg II assay. Non-linearity, drift and carry-over according to CLSI EP10 and EP6 in a measuring range of 0.04-500 ng/mL were non-significant. Total precision according to CLSI EP5 was 10% at a Tg concentration of 0.08 ng/mL. A patient serum comparison performed according to a modified CLSI EP9 protocol showed a significant difference of a factor of approximately 1.4, despite using an identical CRM calibrator. The Elecsys Tg II assay measured Tg with a two-fold higher sensitivity than the Access2 assay. Finally, using human sera without Tg, an URL of 0.05 ng/mL was determined. In our hands the highly sensitive Elecsys Tg II assay shows a good analytical performance and a higher sensitivity compared to the Access2 Tg assay. An URL of 0.05 ng/mL for the Elecsys Tg II assay was determined which may improve the clinical utility of the assay for the detection of residual DTC or disease recurrence.

A novel mechanism by which tissue transglutaminase activates signaling events that promote cell survival.

PubMed

Boroughs, Lindsey K; Antonyak, Marc A; Cerione, Richard A

2014-04-04

Tissue transglutaminase (tTG) functions as a GTPase and an acyl transferase that catalyzes the formation of protein cross-links. tTG expression is frequently up-regulated in human cancer, where it has been implicated in various aspects of cancer progression, including cell survival and chemo-resistance. However, the extent to which tTG cooperates with other proteins within the context of a cancer cell, versus its intrinsic ability to confer transformed characteristics to cells, is poorly understood. To address this question, we asked what effect the ectopic expression of tTG in a non-transformed cellular background would have on the behavior of the cells. Using NIH3T3 fibroblasts stably expressing a Myc-tagged form of tTG, we found that tTG strongly protected these cells from serum starvation-induced apoptosis and triggered the activation of the PI3-kinase/mTOR Complex 1 (mTORC1)/p70 S6-kinase pathway. We determined that tTG forms a complex with the non-receptor tyrosine kinase c-Src and PI3-kinase, and that treating cells with inhibitors to block tTG function (monodansylcadaverine; MDC) or c-Src kinase activity (PP2) disrupted the formation of this complex, and prevented tTG from activating the PI3-kinase pathway. Moreover, treatment of fibroblasts over-expressing tTG with PP2, or with inhibitors that inactivate components of the PI3-kinase pathway, including PI3-kinase (LY294002) and mTORC1 (rapamycin), ablated the tTG-promoted survival of the cells. These findings demonstrate that tTG has an intrinsic capability to stimulate cell survival through a novel mechanism that activates PI3-kinase signaling events, thus highlighting tTG as a potential target for the treatment of human cancer.

Comparative effectiveness of fish oil versus fenofibrate, gemfibrozil, and atorvastatin on lowering triglyceride levels among HIV-infected patients in routine clinical care

PubMed Central

Muñoz, Monica A; Liu, Wei; Delaney, Joseph AC; Brown, Elizabeth; Mugavero, Michael J; Mathews, W Chris; Napravnik, Sonia; Willig, James H; Eron, Joseph J; Hunt, Peter W; Kahn, James O; Saag, Michael S; Kitahata, Mari M; Crane, Heidi M

2014-01-01

Objective The goal of this study was to compare the effectiveness of fish oil, fenofibrate, gemfibrozil, and atorvastatin on reducing triglyceride (TG) levels among a large cohort of HIV-infected patients in clinical care. Design Retrospective observational cohort study Methods The primary endpoint was absolute change in TG levels measured using the last TG value pre-treatment and the first TG value post-treatment. A pre-post quasi-experimental design was used to estimate the change in TG due to initiating fish oil. Linear regression models examined the comparative effectiveness of treatment with fish oil versus gemfibrozil, fenofibrate, or atorvastatin for TG reduction. Models were adjusted for baseline differences in age, sex, race, CD4+ cell count, diabetes, body mass index, protease inhibitor use, and time between TG measures. Results A total of 493 patients (mean age 46 years; 95% male) were included (46 receiving gemfibrozil, 80 fenofibrate, 291 atorvastatin, 76 fish oil) with a mean baseline TG of 347 mg/dL. New use of fish oil decreased TG (ΔTG -45 mg/dL 95% Confidence interval (CI):-80 to -11) in the pre-post study. Compared with fish oil (reference), fibrates were more effective (ΔTG -66; 95% CI:-120 to -12) in reducing TG levels, whereas atorvastatin was not (ΔTG -39; 95% CI:-86 to 9). Conclusion In HIV-infected patients in routine clinical care, fish oil is less effective than fibrates (but not atorvastatin) at lowering triglyceride values. Fish oil may still represent an attractive alternative for patients with moderately elevated triglycerides particularly among patients who may not want or tolerate fibrates. PMID:23892238

Longitudinal Associations between Triglycerides and Metabolic Syndrome Components in a Beijing Adult Population, 2007-2012.

PubMed

Tao, Li-Xin; Yang, Kun; Liu, Xiang-Tong; Cao, Kai; Zhu, Hui-Ping; Luo, Yan-Xia; Guo, Jin; Wu, Li-Juan; Li, Xia; Guo, Xiu-Hua

2016-01-01

Longitudinal associations between triglycerides (TG) and other metabolic syndrome (MetS) components have rarely been reported. The purpose was to investigate the longitudinal association between TG and other MetS components with time. The longitudinal study was established in 2007 on individuals who attended health check-ups at Beijing Tongren Hospital and Beijing Xiaotangshan Hospital. Data used in this study was based on 7489 participants who had at least three health check-ups over a period of 5-year follow up. Joint model was used to explore longitudinal associations between TG and other MetS components after adjusted for age. There were positive correlations between TG and other MetS components except for high density lipoprotein (HDL), and the correlations increased with time. A negative correlation was displayed between TG and HDL, and the correlation also increased with time. Among all five pairs of TG and other MetS components, the marginal correlation between TG and body mass index (BMI) was the largest for both men and women. The marginal correlation between TG and fasting plasma glucose was the smallest for men, while the marginal correlation between TG and diastolic blood pressure was the smallest for women. The longitudinal association between TG and other MetS components increased with time. Among five pairs of TG and other MetS components, the longitudinal correlation between TG and BMI was the largest. It is important to closely monitor subjects with high levels of TG and BMI in health check-up population especially for women, because these two components are closely associated with development of hypertension, diabetes, cardiovascular disease and other metabolic diseases.

A comparison of methods to estimate vertical land motion trends from GNSS and altimetry at tide gauge stations

NASA Astrophysics Data System (ADS)

Kleinherenbrink, Marcel; Riva, Riccardo; Frederikse, Thomas

2018-03-01

Tide gauge (TG) records are affected by vertical land motion (VLM), causing them to observe relative instead of geocentric sea level. VLM can be estimated from global navigation satellite system (GNSS) time series, but only a few TGs are equipped with a GNSS receiver. Hence, (multiple) neighboring GNSS stations can be used to estimate VLM at the TG. This study compares eight approaches to estimate VLM trends at 570 TG stations using GNSS by taking into account all GNSS trends with an uncertainty smaller than 1 mm yr-1 within 50 km. The range between the methods is comparable with the formal uncertainties of the GNSS trends. Taking the median of the surrounding GNSS trends shows the best agreement with differenced altimetry-tide gauge (ALT-TG) trends. An attempt is also made to improve VLM trends from ALT-TG time series. Only using highly correlated along-track altimetry and TG time series reduces the SD of ALT-TG time series by up to 10 %. As a result, there are spatially coherent changes in the trends, but the reduction in the root mean square (RMS) of differences between ALT-TG and GNSS trends is insignificant. However, setting correlation thresholds also acts like a filter to remove problematic TG time series. This results in sets of ALT-TG VLM trends at 344-663 TG locations, depending on the correlation threshold. Compared to other studies, we decrease the RMS of differences between GNSS and ALT-TG trends (from 1.47 to 1.22 mm yr-1), while we increase the number of locations (from 109 to 155), Depending on the methods the mean of differences between ALT-TG and GNSS trends vary between 0.1 and 0.2 mm yr-1. We reduce the mean of the differences by taking into account the effect of elastic deformation due to present-day mass redistribution. At varying ALT-TG correlation thresholds, we provide new sets of trends for 759 to 939 different TG stations. If both GNSS and ALT-TG trend estimates are available, we recommend using the GNSS trend estimates because residual ocean signals might correlate over long distances. However, if large discrepancies ( > 3 mm yr-1) between the two methods are present, local VLM differences between the TG and the GNSS station are likely the culprit and therefore it is better to take the ALT-TG trend estimate. GNSS estimates for which only a single GNSS station and no ALT-TG estimate are available might still require some inspection before they are used in sea level studies.

Thermal decomposition of ammonium perchlorate in the presence of Al(OH)(3)·Cr(OH)(3) nanoparticles.

PubMed

Zhang, WenJing; Li, Ping; Xu, HongBin; Sun, Randi; Qing, Penghui; Zhang, Yi

2014-03-15

An Al(OH)(3)·Cr(OH)(3) nanoparticle preparation procedure and its catalytic effect and mechanism on thermal decomposition of ammonium perchlorate (AP) were investigated using transmission electron microscopy (TEM), X-ray diffraction (XRD), thermogravimetric analysis and differential scanning calorimetry (TG-DSC), X-ray photoelectron spectroscopy (XPS), and thermogravimetric analysis and mass spectroscopy (TG-MS). In the preparation procedure, TEM, SAED, and FT-IR showed that the Al(OH)(3)·Cr(OH)(3) particles were amorphous particles with dimensions in the nanometer size regime containing a large amount of surface hydroxyl under the controllable preparation conditions. When the Al(OH)(3)·Cr(OH)(3) nanoparticles were used as additives for the thermal decomposition of AP, the TG-DSC results showed that the addition of Al(OH)(3)·Cr(OH)(3) nanoparticles to AP remarkably decreased the onset temperature of AP decomposition from approximately 450°C to 245°C. The FT-IR, RS and XPS results confirmed that the surface hydroxyl content of the Al(OH)(3)·Cr(OH)(3) nanoparticles decreased from 67.94% to 63.65%, and Al(OH)3·Cr(OH)3 nanoparticles were limitedly transformed from amorphous to crystalline after used as additives for the thermal decomposition of AP. Such behavior of Al(OH)(3)·Cr(OH)(3) nanoparticles promoted the oxidation of NH3 of AP to decompose to N2O first, as indicated by the TG-MS results, accelerating the AP thermal decomposition. Copyright © 2014 Elsevier B.V. All rights reserved.

On the sensitivity of TG-119 and IROC credentialing to TPS commissioning errors.

PubMed

McVicker, Drew; Yin, Fang-Fang; Adamson, Justus D

2016-01-08

We investigate the sensitivity of IMRT commissioning using the TG-119 C-shape phantom and credentialing with the IROC head and neck phantom to treatment planning system commissioning errors. We introduced errors into the various aspects of the commissioning process for a 6X photon energy modeled using the analytical anisotropic algorithm within a commercial treatment planning system. Errors were implemented into the various components of the dose calculation algorithm including primary photons, secondary photons, electron contamination, and MLC parameters. For each error we evaluated the probability that it could be committed unknowingly during the dose algorithm commissioning stage, and the probability of it being identified during the verification stage. The clinical impact of each commissioning error was evaluated using representative IMRT plans including low and intermediate risk prostate, head and neck, mesothelioma, and scalp; the sensitivity of the TG-119 and IROC phantoms was evaluated by comparing dosimetric changes to the dose planes where film measurements occur and change in point doses where dosimeter measurements occur. No commissioning errors were found to have both a low probability of detection and high clinical severity. When errors do occur, the IROC credentialing and TG 119 commissioning criteria are generally effective at detecting them; however, for the IROC phantom, OAR point-dose measurements are the most sensitive despite being currently excluded from IROC analysis. Point-dose measurements with an absolute dose constraint were the most effective at detecting errors, while film analysis using a gamma comparison and the IROC film distance to agreement criteria were less effective at detecting the specific commissioning errors implemented here.

Serotonin (5-HT) receptor 5A sequence variants affect human plasma triglyceride levels

PubMed Central

Zhang, Y.; Smith, E. M.; Baye, T. M.; Eckert, J. V.; Abraham, L. J.; Moses, E. K.; Kissebah, A. H.; Martin, L. J.

2010-01-01

Neurotransmitters such as serotonin (5-hydroxytryptamine, 5-HT) work closely with leptin and insulin to fine-tune the metabolic and neuroendocrine responses to dietary intake. Losing the sensitivity to excess food intake can lead to obesity, diabetes, and a multitude of behavioral disorders. It is largely unclear how different serotonin receptor subtypes respond to and integrate metabolic signals and which genetic variations in these receptor genes lead to individual differences in susceptibility to metabolic disorders. In an obese cohort of families of Northern European descent (n = 2,209), the serotonin type 5A receptor gene, HTR5A, was identified as a prominent factor affecting plasma levels of triglycerides (TG), supported by our data from both genome-wide linkage and targeted association analyses using 28 publicly available and 12 newly discovered single nucleotide polymorphisms (SNPs), of which 3 were strongly associated with plasma TG levels (P < 0.00125). Bayesian quantitative trait nucleotide (BQTN) analysis identified a putative causal promoter SNP (rs3734967) with substantial posterior probability (P = 0.59). Functional analysis of rs3734967 by electrophoretic mobility shift assay (EMSA) showed distinct binding patterns of the two alleles of this SNP with nuclear proteins from glioma cell lines. In conclusion, sequence variants in HTR5A are strongly associated with high plasma levels of TG in a Northern European population, suggesting a novel role of the serotonin receptor system in humans. This suggests a potential brain-specific regulation of plasma TG levels, possibly by alteration of the expression of HTR5A. PMID:20388841

Low serum thyroid-stimulating hormone levels are associated with lipid profile in depressive patients with long symptom duration.

PubMed

Peng, Rui; Li, Yan

2017-08-01

The current study was designed to investigate the association between serum thyroid hormones and thyroid-stimulating hormone (TSH) levels with lipid profile in depressive disorder. A total of 370 depressive individuals aged 18 years and above were recruited in this cross-section study. All participants underwent a Structured Clinical Interview for DSM-IV (SCID) and recorded the duration of their symptoms. The serum levels of total cholesterol (TCH), triglyceride (TG), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), lipoprotein A (Lp(a)), high-sensitivity C-reactive protein (hsCRP), free thyroxine (FT4), free triiodothyronine (FT3) and TSH levels were determined and the ratios of TCH/HDL-C were assessed. Depressed subjects with a symptom duration ≥3 years had higher TG levels, increased TCH/HDL-C ratios and lower levels of HDL-C, FT4 and TSH compared with depressive patients with a symptom duration <3 years. Correlation analysis displayed that TSH is positively and significantly associated with TCH and LDL-C (p<0.05); the above FT4 and FT3 are negatively, significantly and respectively associated with TCH/HDL-C (p<0.05) and TCH, HDL-C, LDL-C (p<0.05). Multiple linear regression analysis indicated that serum TG and TSH levels are associated with depressive symptom duration. According to our results,These findings indicate that low serum TSH levels are associated with lipid profile, TG and TSH levels have significant association with symptom duration in depressive patients. Copyright © 2017. Published by Elsevier B.V.

A Crystallographic Study of the Role of Sequence Context in Thymine Glycol Bypass by a Replicative DNA Polymerase Serendipitously Sheds Light on the Exonuclease Complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aller, Pierre; Duclos, Stéphanie; Wallace, Susan S.

2012-06-27

Thymine glycol (Tg) is the most common oxidation product of thymine and is known to be a strong block to replicative DNA polymerases. A previously solved structure of the bacteriophage RB69 DNA polymerase (RB69 gp43) in complex with Tg in the sequence context 5'-G-Tg-G shed light on how Tg blocks primer elongation: The protruding methyl group of the oxidized thymine displaces the adjacent 5'-G, which can no longer serve as a template for primer elongation [Aller, P., Rould, M. A., Hogg, M, Wallace, S. S. and Doublie S. (2007). A structural rationale for stalling of a replicative DNA polymerase atmore » the most common oxidative thymine lesion, thymine glycol. Proc. Natl. Acad. Sci. USA, 104, 814-818.]. Several studies showed that in the sequence context 5'-C-Tg-purine, Tg is more likely to be bypassed by Klenow fragment, an A-family DNA polymerase. We set out to investigate the role of sequence context in Tg bypass in a B-family polymerase and to solve the crystal structures of the bacteriophage RB69 DNA polymerase in complex with Tg-containing DNA in the three remaining sequence contexts: 5'-A-Tg-G, 5'-T-Tg-G, and 5'-C-Tg-G. A combination of several factors - including the associated exonuclease activity, the nature of the 3' and 5' bases surrounding Tg, and the cis-trans interconversion of Tg - influences Tg bypass. We also visualized for the first time the structure of a well-ordered exonuclease complex, allowing us to identify and confirm the role of key residues (Phe123, Met256, and Tyr257) in strand separation and in the stabilization of the primer strand in the exonuclease site.« less

Transglutaminases factor XIII-A and TG2 regulate resorption, adipogenesis and plasma fibronectin homeostasis in bone and bone marrow

PubMed Central

Mousa, Aisha; Cui, Cui; Song, Aimei; Myneni, Vamsee D; Sun, Huifang; Li, Jin Jin; Murshed, Monzur; Melino, Gerry; Kaartinen, Mari T

2017-01-01

Appropriate bone mass is maintained by bone-forming osteoblast and bone-resorbing osteoclasts. Mesenchymal stem cell (MSC) lineage cells control osteoclastogenesis via expression of RANKL and OPG (receptor activator of nuclear factor κB ligand and osteoprotegerin), which promote and inhibit bone resorption, respectively. Protein crosslinking enzymes transglutaminase 2 (TG2) and Factor XIII-A (FXIII-A) have been linked to activity of myeloid and MSC lineage cells; however, in vivo evidence has been lacking to support their function. In this study, we show in mice that TG2 and FXIII-A control monocyte-macrophage cell differentiation into osteoclasts as well as RANKL production in MSCs and in adipocytes. Long bones of mice lacking TG2 and FXIII-A transglutaminases, show compromised biomechanical properties and trabecular bone loss in axial and appendicular skeleton. This was caused by increased osteoclastogenesis, a cellular phenotype that persists in vitro. The increased potential of TG2 and FXIII-A deficient monocytes to form osteoclasts was reversed by chemical inhibition of TG activity, which revealed the presence of TG1 in osteoclasts and assigned different roles for the TGs as regulators of osteoclastogenesis. TG2- and FXIII-A-deficient mice had normal osteoblast activity, but increased bone marrow adipogenesis, MSCs lacking TG2 and FXIII-A showed high adipogenic potential and significantly increased RANKL expression as well as upregulated TG1 expression. Chemical inhibition of TG activity in the null cells further increased adipogenic potential and RANKL production. Altered differentiation of TG2 and FXIII-A null MSCs was associated with plasma fibronectin (FN) assembly defect in cultures and FN retention in serum and marrow in vivo instead of assembly into bone. Our findings provide new functions for TG2, FXIII-A and TG1 in bone cells and identify them as novel regulators of bone mass, plasma FN homeostasis, RANKL production and myeloid and MSC cell differentiation. PMID:28387755

Preparation, characterization and in vitro/vivo evaluation of tectorigenin solid dispersion with improved dissolution and bioavailability.

PubMed

Shuai, Shuping; Yue, Shanlan; Huang, Qingting; Wang, Wei; Yang, Junyi; Lan, Ke; Ye, Liming

2016-08-01

The purpose of this study was to develop and evaluate a novel amorphous solid dispersion system for tectorigenin (TG). TG is one of isoflavone aglycones extracted from Iris tectorum and flowers of Pueraria thunbergiana, but its poor water solubility and low membrane permeability have severely restricted the clinical application. To increase the aqueous solubility and oral bioavailability of TG, we prepared the solid dispersions of tectorigenin (TG-SD) using a simple solvent evaporation process with TG, polyvinylpyrrolidone (PVP) and PEG4000 at weight ratio of 7:54:9 after tested in several ratios. The prepared solid dispersions of tectorigenin are duly characterized for drug morphological conversion, in vitro dissolution and in vivo bioavailability. The X-ray diffraction (XRD), differential scanning calorimetry (DSC) and scanning electron microscopy (SEM) studies have indicated the morphological conversion of tectorigenin to amorphous form. In vitro release profiles revealed that the % release of TG-SD was achieved 4.35-fold higher than that of the pure drug after 150 min. The oral bioavailability of the solid dispersion in rats was also increased based on AUC0-t and C max of TG-SD, which were 4.8- and 13.1-fold higher than that of TG crystal, respectively. It is worth noting that physical mixture containing TG, PEG4000 and PVP produced a similar level of oral exposure as TG-SD, suggesting that PEG4000 and PVP were able to enhance bioavailability of TG in rats. However, with the reduction of particle size, TG-SD provided the fastest oral absorption compared to physical mixture and pure drug. These results demonstrated that the efficacy of solid dispersions for the enhancement of TG oral bioavailability was by increasing its aqueous solubility and the solid dispersion formulation could be a viable option for enhancing the oral bioavailability of TG.

Relationship between Plasma Triglyceride Level and Severity of Hypertriglyceridemic Pancreatitis.

PubMed

Wang, Sheng-Huei; Chou, Yu-Ching; Shangkuan, Wei-Chuan; Wei, Kuang-Yu; Pan, Yu-Han; Lin, Hung-Che

2016-01-01

Hypertriglyceridemia is the third most common cause of acute pancreatitis, but whether the level of triglyceride (TG) is related to severity of pancreatitis is unclear. To evaluate the effect of TG level on the severity of hypertriglyceridemic pancreatitis (HTGP). Retrospective cohort study. We reviewed the records of 144 patients with HTGP from 1999 to 2013 at Tri-Service General Hospital. Patients with possible etiology of pancreatitis, such as gallstones, those consuming alcohol or drugs, or those with infections were excluded. The classification of severity of pancreatitis was based on the revised Atlanta classification. We allocated the patients into high-TG and low-TG groups based on the optimal cut-off value (2648 mg/dL), which was derived from the receiver operating characteristic (ROC) curve between TG level and severity of HTGP. We then compared the clinical characteristics, pancreatitis severity, and mortality rates of the groups. There were 66 patients in the low-TG group and 78 patients in the high-TG group. There was no significant difference in the age, sex ratio, body mass index, and comorbidity between the 2 groups. The high-TG group had significantly higher levels of glucose (P = 0.022), total cholesterol (P = 0.002), and blood urea nitrogen (P = 0.037), and lower levels of sodium (P = 0.003) and bicarbonate (P = 0.002) than the low-TG group. The incidences of local complication (P = 0.002) and severe and moderate form of pancreatitis (P = 0.004) were significantly higher in the high-TG group than in the low-TG group. The mortality rate was higher in the high-TG group than in the low-TG group (P = 0.07). Higher TG level in patients with HTGP may be associated with adverse prognosis, but randomized and prospective studies are needed in the future verify this relationship.

A global high-resolution emission inventory for ammonia

NASA Astrophysics Data System (ADS)

Bouwman, A. F.; Lee, D. S.; Asman, W. A. H.; Dentener, F. J.; van der Hoek, K. W.; Olivier, J. G. J.

1997-12-01

A global emissions inventory for ammonia (NH3) has been compiled for the main known sources on a 1° × 1° grid, suitable for input to global atmospheric models. The estimated global emission for 1990 is about 54 Tg N yr-1. The major sources identified include excreta from domestic animals (21.6 Tg N yr-1) and wild animals (0.1 Tg N yr-1), use of synthetic N fertilizers (9.0 Tg N yr-1), oceans (8.2 Tg N yr-1), biomass burning (5.9 Tg N yr-1), crops (3.6 Tg N yr-1), human population and pets (2.6 Tg N yr-1), soils under natural vegetation (2.4 Tg N yr-1), industrial processes (0.2 Tg N yr-1 ), and fossil fuels (0.1 Tg N yr-1). About half of the global emission comes from Asia, and about 70% is related to food production. The regions with highest emission rates are located in Europe, the Indian subcontinent, and China, reflecting the patterns of animal densities and type and intensity of synthetic fertilizer use. The overall uncertainty in the global emission estimate is 25%, while the uncertainty in regional emissions is much greater. As the global human population will show considerable growth in the coming decades, food production and associated NH3 emissions are likely to increase as well.

Solid lipid particles for oral delivery of peptide and protein drugs II--the digestion of trilaurin protects desmopressin from proteolytic degradation.

PubMed

Christophersen, Philip Carsten; Zhang, Long; Müllertz, Anette; Nielsen, Hanne Mørck; Yang, Mingshi; Mu, Huiling

2014-09-01

To investigate the in vitro release and degradation of desmopressin from saturated triglyceride microparticles under both lipolytic and proteolytic conditions. The release of desmopressin from different solid lipid microparticles in the absence and presence of a microbial lipase and protease was determined. Trilaurin (TG12), trimyristin (TG14), tripalmitin (TG16), and tristearin (TG18) were used as lipid excipients to produce solid lipid microparticles. In the presence of lipase, the rate of drug release from different lipid particles was in the order of TG14 > TG16 > TG18, which is the same rank order as the lipid degradation rate. A reverse rank order was found for the protection of desmopressin from enzymatic degradation due to spatial separation of desmopressin from the protease. TG12 accelerated the release of desmopressin from all lipid particles when added as either drug-free microparticles to the lipolysis medium or incorporated in TG16 particles. Additionally, TG12 particles protected desmopressin from degradation when present in the lipolysis medium with the other lipid microparticles. TG12 is a very interesting lipid for oral lipid formulations containing peptides and proteins as it alters release and degradation of the incorporated desmopressin. The present study demonstrates the possibility of bio-relevant in vitro evaluation of lipid-based solid particles.

Bayesian inference for multivariate meta-analysis Box-Cox transformation models for individual patient data with applications to evaluation of cholesterol lowering drugs

PubMed Central

Kim, Sungduk; Chen, Ming-Hui; Ibrahim, Joseph G.; Shah, Arvind K.; Lin, Jianxin

2013-01-01

In this paper, we propose a class of Box-Cox transformation regression models with multidimensional random effects for analyzing multivariate responses for individual patient data (IPD) in meta-analysis. Our modeling formulation uses a multivariate normal response meta-analysis model with multivariate random effects, in which each response is allowed to have its own Box-Cox transformation. Prior distributions are specified for the Box-Cox transformation parameters as well as the regression coefficients in this complex model, and the Deviance Information Criterion (DIC) is used to select the best transformation model. Since the model is quite complex, a novel Monte Carlo Markov chain (MCMC) sampling scheme is developed to sample from the joint posterior of the parameters. This model is motivated by a very rich dataset comprising 26 clinical trials involving cholesterol lowering drugs where the goal is to jointly model the three dimensional response consisting of Low Density Lipoprotein Cholesterol (LDL-C), High Density Lipoprotein Cholesterol (HDL-C), and Triglycerides (TG) (LDL-C, HDL-C, TG). Since the joint distribution of (LDL-C, HDL-C, TG) is not multivariate normal and in fact quite skewed, a Box-Cox transformation is needed to achieve normality. In the clinical literature, these three variables are usually analyzed univariately: however, a multivariate approach would be more appropriate since these variables are correlated with each other. A detailed analysis of these data is carried out using the proposed methodology. PMID:23580436

Bayesian inference for multivariate meta-analysis Box-Cox transformation models for individual patient data with applications to evaluation of cholesterol-lowering drugs.

PubMed

Kim, Sungduk; Chen, Ming-Hui; Ibrahim, Joseph G; Shah, Arvind K; Lin, Jianxin

2013-10-15

In this paper, we propose a class of Box-Cox transformation regression models with multidimensional random effects for analyzing multivariate responses for individual patient data in meta-analysis. Our modeling formulation uses a multivariate normal response meta-analysis model with multivariate random effects, in which each response is allowed to have its own Box-Cox transformation. Prior distributions are specified for the Box-Cox transformation parameters as well as the regression coefficients in this complex model, and the deviance information criterion is used to select the best transformation model. Because the model is quite complex, we develop a novel Monte Carlo Markov chain sampling scheme to sample from the joint posterior of the parameters. This model is motivated by a very rich dataset comprising 26 clinical trials involving cholesterol-lowering drugs where the goal is to jointly model the three-dimensional response consisting of low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), and triglycerides (TG) (LDL-C, HDL-C, TG). Because the joint distribution of (LDL-C, HDL-C, TG) is not multivariate normal and in fact quite skewed, a Box-Cox transformation is needed to achieve normality. In the clinical literature, these three variables are usually analyzed univariately; however, a multivariate approach would be more appropriate because these variables are correlated with each other. We carry out a detailed analysis of these data by using the proposed methodology. Copyright © 2013 John Wiley & Sons, Ltd.

Effect of obstructive sleep apnea hypopnea syndrome on lipid profile: a meta-regression analysis.

PubMed

Nadeem, Rashid; Singh, Mukesh; Nida, Mahwish; Waheed, Irfan; Khan, Adnan; Ahmed, Saeed; Naseem, Jawed; Champeau, Daniel

2014-05-15

Obstructive sleep apnea (OSA) is associated with obesity, metabolic syndrome, and dyslipidemia, which may be related to decrease androgen levels found in OSA patients. Dyslipidemia may contribute to atherosclerosis leading to increasing risk of heart disease. Systematic review was conducted using PubMed and Cochrane library by utilizing different combinations of key words; sleep apnea, obstructive sleep apnea, serum lipids, dyslipidemia, cholesterol, total cholesterol, low density lipoprotein (LDL), high density lipoprotein (HDL), and triglyceride (TG). Inclusion criteria were: English articles, and studies with adult population in 2 groups of patients (patients with OSA and without OSA). A total 96 studies were reviewed for inclusion, with 25 studies pooled for analysis. Sixty-four studies were pooled for analysis; since some studies have more than one dataset, there were 107 datasets with 18,116 patients pooled for meta-analysis. All studies measured serum lipids. Total cholesterol pooled standardized difference in means was 0.267 (p = 0.001). LDL cholesterol pooled standardized difference in means was 0.296 (p = 0.001). HDL cholesterol pooled standardized difference in means was -0.433 (p = 0.001). Triglyceride pooled standardized difference in means was 0.603 (p = 0.001). Meta-regression for age, BMI, and AHI showed that age has significant effect for TC, LDL, and HDL. BMI had significant effect for LDL and HDL, while AHI had significant effect for LDL and TG. Patients with OSA appear to have increased dyslipidemia (high total cholesterol, LDL, TG, and low HDL).

Dietary triglycerides as signaling molecules that influence reward and motivation

PubMed Central

Berland, Chloé; Cansell, Céline; Hnasko, Thomas S.; Magnan, Christophe; Luquet, Serge

2017-01-01

The reinforcing and motivational aspects of food are tied to the release of the dopamine in the mesolimbic system (ML). Free fatty acids from triglyceride (TG)-rich particles are released upon action of TG-lipases found at high levels in peripheral oxidative tissue (muscle, heart), but also in the ML. This suggests that local TG-hydrolysis in the ML might regulate food seeking and reward. Indeed, evidence now suggests that dietary TG directly target the ML to regulate amphetamine-induced locomotion and reward seeking behavior. Though the cellular mechanisms of TG action are unresolved, TG act in part through ML lipoprotein lipase, upstream of dopamine 2 receptor (D2R), and show desensitization in conditions of chronically elevated plasma TG as occur in obesity. TG sensing in the ML therefore represents a new mechanism by which chronic consumption of dietary fat might lead to adaptations in the ML and dysregulated feeding behaviors. PMID:28191490

Utility of testing patients, on presentation, for serologic features of celiac disease.

PubMed

Srinivas, Melpakkam; Basumani, Pandurangan; Podmore, Geoff; Shrimpton, Anna; Bardhan, Karna Dev

2014-06-01

Celiac disease shares features of other disorders. It can be diagnosed conclusively only based on duodenal histology analysis, which is not practical for screening purposes. Serologic analysis might be used to identify candidates for biopsy analysis. We aimed to develop a simple diagnostic approach that all clinicians could follow to increase the percentage of patients accurately diagnosed with celiac disease at initial presentation. We performed a retrospective analysis of data from 752 patients (88 with celiac disease, none were IgA deficient) who attended a UK district general hospital from January 2007 through December 2008 and underwent biopsy analysis and serologic tests to measure endomyseal antibodies and IgA antibodies against tissue transglutaminase (tTG). Patients avoiding gluten in their diet were excluded. Patients were assigned to 1 of 4 groups: high-risk (based on presence of anemia, chronic diarrhea, unintentional weight loss, or dermatitis herpetiformis), low-risk (based on such factors as dyspepsia, abnormal liver function, ataxia, or chronic cough), nutrient deficiency (based on levels of iron, vitamins B12 and D, or folate), or screening (because they had type 1 diabetes or a family history of celiac disease). Patients with celiac disease were identified using the modified Marsh criteria (grades 1-3) for interpreting duodenal histology. We compared clinical category, serology profiles, and biopsy results between patients with and without celiac disease. Celiac disease was diagnosed in 64 of 565 patients in the high-risk group (11%), 14 of 156 patients in the low-risk group (9%; P = .47 compared with high-risk group), 7 of 28 patients in the nutrient-deficiency group, and 3 of 3 patients in the screening group. Among 71 patients who tested positive for both antibodies (tTG and endomyseal antibodies), the positive predictive value for celiac disease was 97%; a negative test result for tTG had a negative predictive value of 98%. Among 708 patients with normal-looking biopsy samples, only 62 had celiac disease (9%). Among 44 patients with abnormal biopsy samples, 26 had celiac disease (59%). Based on a retrospective analysis, patients with and without celiac disease cannot be distinguished based on clinical features. Patients who present with symptoms of celiac disease should be tested for tTG, to identify candidates for duodenal biopsy analysis. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.

Thyroglobulin levels and thyroglobulin doubling time independently predict a positive 18F-FDG PET/CT scan in patients with biochemical recurrence of differentiated thyroid carcinoma.

PubMed

Giovanella, Luca; Trimboli, Pierpaolo; Verburg, Frederik A; Treglia, Giorgio; Piccardo, Arnoldo; Foppiani, Luca; Ceriani, Luca

2013-06-01

To assess the relationship between serum thyroglobulin (Tg) levels, Tg doubling time (Tg-DT) and the diagnostic performance of (18)F-FDG PET/CT in detecting recurrences of (131)I-negative differentiated thyroid carcinoma (DTC). Included in the present study were 102 patients with DTC. All patients were treated by thyroid ablation (e.g. thyroidectomy and (131)I), and underwent (18)F-FDG PET/CT due to detectable Tg levels and negative conventional imaging. Consecutive serum Tg measurements performed before the (18)F-FDG PET/CT examination were used for Tg-DT calculation. The (18)F-FDG PET/CT results were assessed as true or false after histological and/or clinical follow-up. Serum Tg levels were higher in patients with a positive (18)F-FDG PET/CT scan (median 6.7 ng/mL, range 0.7-73.6 ng/mL) than in patients with a negative scan (median 1.8 ng/mL, range 0.5-4.9 ng/mL; P < 0.001). In 43 (88 %) of 49 patients with a true-positive (18)F-FDG PET/CT scan, the Tg levels were >5.5 ng/mL, and in 31 (74 %) of 42 patients with a true-negative (18)F-FDG PET/CT scan, the Tg levels were ≤5.5 ng/mL. A Tg-DT of <1 year was found in 46 of 49 patients (94 %) with a true-positive (18)F-FDG PET/CT scan, and 40 of 42 patients (95 %) with a true-negative scan had a stable or increased Tg-DT. Moreover, combining Tg levels and Tg-DT as selection criteria correctly distinguished between patients with a positive and a negative scan (P<0.0001). The accuracy of (18)F-FDG PET/CT significantly improves when the serum Tg level is above 5.5 ng/mL during levothyroxine treatment or when the Tg-DT is less than 1 year, independent of the absolute value.

Influence of triglycerides on other plasma lipids in middle-aged men intended for hypolipidaemic treatment.

PubMed

Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Salpea, Klelia D; Hoursalas, Ioannis S; Petropoulos, Ilias; Bilianou, Helen I; Damaskos, Dimitris S; Giannakopoulou, Vasiliki N; Cokkinos, Dennis V

2006-01-01

The present investigation aimed to evaluate the influence of serum triglycerides (TG) on other plasma lipids in male patients less than 65 years of age intended for hypolipidaemic treatment. Lipid profiles of a cohort of 412 dyslipidaemic male patients aged 53.4 +/- 7.7 years (mean +/- standard deviation) were evaluated. Patients were stratified in accordance with their fasting plasma lipid levels. They were divided into multiple groups on the basis of serum TG (> or = 150 or < 150 mg/dl) and high-density lipoprotein cholesterol (HDL-C > or = 40 or < 40 mg/dl). Patients with TG > or = 150 mg/dl had higher total cholesterol and lower HDL-C levels compared with those with TG < 150 mg/dl (p = 0.005 and p < 0.001, respectively). Patients with HDL-C < 40 mg/dl had similar total cholesterol levels and higher TG levels compared to those with HDL-C > or = 40 mg/dl (p < 0.001). In all patients, an inverse correlation between TG and HDL-C was found (r = -0.286, p < 0.001). Additionally, HDL-C levels were inversely correlated with the TG concentration in patients with TG < 150 mg/dl (r = -0.135, p = 0.042) and TG > or = 150 mg/dl (r = -0.188, p = 0.002). An inverse correlation between TG and HDL-C levels seems to exist in the sampled population, revealing a close link between the metabolic pathways for TG and HDL-C. This inverse correlation appears to persist even in patients with low fasting TG levels.

The Strathclyde Evaluation of Children's Active Travel (SE-CAT): study rationale and methods.

PubMed

McMinn, David; Rowe, David A; Murtagh, Shemane; Nelson, Norah M

2011-12-30

The school commute is a prime opportunity to increase children's physical activity levels. However, active commuting has decreased over the past 40 years. Strategies that increase walking to school are therefore needed. Travelling Green (TG) is a school-based active travel resource aimed at increasing children's walking to school. The resource consists of a curriculum-based program of lessons and goal setting activities. A previous study found that children who received the TG intervention increased self-reported distance travelled to school by active modes and reduced the distance travelled by inactive modes. This study was limited by self-reported outcome measures, a small sample, and no follow-up measures. A more robust evaluation of TG is required to address these limitations. This paper describes the rationale and methods for such an evaluation of Travelling Green, and describes the piloting of various active commuting measures in primary school children. Measures of active commuting were piloted in a sample of 26 children (aged 8-9 years) over one school week. These measures were subsequently used in an 18-month quasi-experimental design to evaluate the effect of TG on commuting behaviour. Participants were 166 children (60% male) aged 8-9 years from 5 primary schools. Two schools (n = 79 children) received TG in September/October 2009. Three schools (n = 87 children) acted as a comparison group, and subsequently received TG at a later date. Physical activity was measured using Actigraph GT1M accelerometers. Personal and environmental determinants of active commuting were measured via parent and child questionnaires, as were factors related to the Theory of Planned Behaviour and the construct of habit. Measures were taken pre- and post-intervention and at 5 and 12 months follow-up. The piloted protocol was practical and feasible and piloted measures were reliable and valid. All study data, including 5 and 12 month follow-up, have been collected and processed. Data analysis is ongoing. Results will indicate whether TG successfully increases active commuting in a sample of Scottish school children and will inform future efforts in school active travel promotion.

The Strathclyde Evaluation of Children's Active Travel (SE-CAT): study rationale and methods

PubMed Central

2011-01-01

Background The school commute is a prime opportunity to increase children's physical activity levels. However, active commuting has decreased over the past 40 years. Strategies that increase walking to school are therefore needed. Travelling Green (TG) is a school-based active travel resource aimed at increasing children's walking to school. The resource consists of a curriculum-based program of lessons and goal setting activities. A previous study found that children who received the TG intervention increased self-reported distance travelled to school by active modes and reduced the distance travelled by inactive modes. This study was limited by self-reported outcome measures, a small sample, and no follow-up measures. A more robust evaluation of TG is required to address these limitations. This paper describes the rationale and methods for such an evaluation of Travelling Green, and describes the piloting of various active commuting measures in primary school children. Methods/Design Measures of active commuting were piloted in a sample of 26 children (aged 8-9 years) over one school week. These measures were subsequently used in an 18-month quasi-experimental design to evaluate the effect of TG on commuting behaviour. Participants were 166 children (60% male) aged 8-9 years from 5 primary schools. Two schools (n = 79 children) received TG in September/October 2009. Three schools (n = 87 children) acted as a comparison group, and subsequently received TG at a later date. Physical activity was measured using Actigraph GT1M accelerometers. Personal and environmental determinants of active commuting were measured via parent and child questionnaires, as were factors related to the Theory of Planned Behaviour and the construct of habit. Measures were taken pre- and post-intervention and at 5 and 12 months follow-up. Discussion The piloted protocol was practical and feasible and piloted measures were reliable and valid. All study data, including 5 and 12 month follow-up, have been collected and processed. Data analysis is ongoing. Results will indicate whether TG successfully increases active commuting in a sample of Scottish school children and will inform future efforts in school active travel promotion. PMID:22208498

SU-E-I-20: Comprehensive Quality Assurance Test of Second Generation Toshiba Aquilion Large Bore CT Simulator Based On AAPM TG-66 Recommendations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, D

2015-06-15

Purpose: AAPM radiation therapy committee task group No. 66 (TG-66) published a report which described a general approach to CT simulator QA. The report outlines the testing procedures and specifications for the evaluation of patient dose, radiation safety, electromechanical components, and image quality for a CT simulator. The purpose of this study is to thoroughly evaluate the performance of a second generation Toshiba Aquilion Large Bore CT simulator with 90 cm bore size (Toshiba, Nasu, JP) based on the TG-66 criteria. The testing procedures and results from this study provide baselines for a routine QA program. Methods: Different measurements andmore » analysis were performed including CTDIvol measurements, alignment and orientation of gantry lasers, orientation of the tabletop with respect to the imaging plane, table movement and indexing accuracy, Scanogram location accuracy, high contrast spatial resolution, low contrast resolution, field uniformity, CT number accuracy, mA linearity and mA reproducibility using a number of different phantoms and measuring devices, such as CTDI phantom, ACR image quality phantom, TG-66 laser QA phantom, pencil ion chamber (Fluke Victoreen) and electrometer (RTI Solidose 400). Results: The CTDI measurements were within 20% of the console displayed values. The alignment and orientation for both gantry laser and tabletop, as well as the table movement and indexing and scanogram location accuracy were within 2mm as specified in TG66. The spatial resolution, low contrast resolution, field uniformity and CT number accuracy were all within ACR’s recommended limits. The mA linearity and reproducibility were both well below the TG66 threshold. Conclusion: The 90 cm bore size second generation Toshiba Aquilion Large Bore CT simulator that comes with 70 cm true FOV can consistently meet various clinical needs. The results demonstrated that this simulator complies with the TG-66 protocol in all aspects including electromechanical component, radiation safety component, and image quality component. Employee of Toshiba America Medical Systems.« less

Role of transglutaminase 2 in A1 adenosine receptor- and β2-adrenoceptor-mediated pharmacological pre- and post-conditioning against hypoxia-reoxygenation-induced cell death in H9c2 cells.

PubMed

Vyas, Falguni S; Nelson, Carl P; Dickenson, John M

2018-01-15

Pharmacologically-induced pre- and post-conditioning represent attractive therapeutic strategies to reduce ischaemia/reperfusion injury during cardiac surgery and following myocardial infarction. We have previously reported that transglutaminase 2 (TG2) activity is modulated by the A 1 adenosine receptor and β 2 -adrenoceptor in H9c2 cardiomyoblasts. The primary aim of this study was to determine the role of TG2 in A 1 adenosine receptor and β 2 -adrenoceptor-induced pharmacological pre- and post-conditioning in the H9c2 cells. H9c2 cells were exposed to 8h hypoxia (1% O 2 ) followed by 18h reoxygenation, after which cell viability was assessed by monitoring mitochondrial reduction of MTT, lactate dehydrogenase release and caspase-3 activation. N 6 -cyclopentyladenosine (CPA; A 1 adenosine receptor agonist), formoterol (β 2 -adrenoceptor agonist) or isoprenaline (non-selective β-adrenoceptor agonist) were added before hypoxia/reoxygenation (pre-conditioning) or at the start of reoxygenation following hypoxia (post-conditioning). Pharmacological pre- and post-conditioning with CPA and isoprenaline significantly reduced hypoxia/reoxygenation-induced cell death. In contrast, formoterol did not elicit protection. Pre-treatment with pertussis toxin (G i/o -protein inhibitor), DPCPX (A 1 adenosine receptor antagonist) or TG2 inhibitors (Z-DON and R283) attenuated the A 1 adenosine receptor-induced pharmacological pre- and post-conditioning. Similarly, pertussis toxin, ICI 118,551 (β 2 -adrenoceptor antagonist) or TG2 inhibition attenuated the isoprenaline-induced cell survival. Knockdown of TG2 using small interfering RNA (siRNA) attenuated CPA and isoprenaline-induced pharmacological pre- and post-conditioning. Finally, proteomic analysis following isoprenaline treatment identified known (e.g. protein S100-A6) and novel (e.g. adenine phosphoribosyltransferase) protein substrates for TG2. These results have shown that A 1 adenosine receptor and β 2 -adrenoceptor-induced protection against simulated hypoxia/reoxygenation occurs in a TG2 and G i/o -protein dependent manner in H9c2 cardiomyoblasts. Copyright © 2017 Elsevier B.V. All rights reserved.

SU-F-T-485: Independent Remote Audits for TG51 NonCompliant Photon Beams Performed by the IROC Houston QA Center

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alvarez, P; Molineu, A; Lowenstein, J

Purpose: IROC-H conducts external audits for output check verification of photon and electron beams. Many of these beams can meet the geometric requirements of the TG 51 calibration protocol. For those photon beams that are non TG 51 compliant like Elekta GammaKnife, Accuray CyberKnife and TomoTherapy, IROC-H has specific audit tools to monitor the reference calibration. Methods: IROC-H used its TLD and OSLD remote monitoring systems to verify the output of machines with TG 51 non compliant beams. Acrylic OSLD miniphantoms are used for the CyberKnife. Special TLD phantoms are used for TomoTherapy and GammaKnife machines to accommodate the specificmore » geometry of each machine. These remote audit tools are sent to institutions to be irradiated and returned to IROC-H for analysis. Results: The average IROC-H/institution ratios for 480 GammaKnife, 660 CyberKnife and 907 rotational TomoTherapy beams are 1.000±0.021, 1.008±0.019, 0.974±0.023, respectively. In the particular case of TomoTherapy, the overall ratio is 0.977±0.022 for HD units. The standard deviations of all results are consistent with values determined for TG 51 compliant photon beams. These ratios have shown some changes compared to values presented in 2008. The GammaKnife results were corrected by an experimentally determined scatter factor of 1.025 in 2013. The TomoTherapy helical beam results are now from a rotational beam whereas in 2008 the results were from a static beam. The decision to change modality was based on recommendations from the users. Conclusion: External audits of beam outputs is a valuable tool to confirm the calibrations of photon beams regardless of whether the machine is TG 51 or TG 51 non compliant. The difference found for TomoTherapy units is under investigation. This investigation was supported by IROC grant CA180803 awarded by the NCI.« less

Effects of postmenopausal hormone therapy every day and every other day on lipid levels according to difference in body mass index.

PubMed

Yasui, Toshiyuki; Umino, Yuka; Takikawa, Masaya; Uemura, Hirokazu; Kuwahara, Akira; Matsuzaki, Toshiya; Maegawa, Masahiko; Furumoto, Hiroyuki; Miura, Masakazu; Irahara, Minoru

2005-03-01

The objective of this study was to determine the effects of postmenopausal estrogen and progestogen therapy (EPT) every day and every other day on lipid levels, particularly triglyceride (TG) levels, according to difference in body mass index (BMI). Ninety-nine postmenopausal women (mean age, 53.9 +/- 5.6 years; mean BMI, 22.8 +/- 2.8 kg/m) were randomly treated with EPT every other day or every day for 1 year. Fifty women received oral administration of 0.625 mg of conjugated equine estrogen (CEE) and 2.5 mg of medroxyprogesterone acetate (MPA) every other day, and 49 women received oral administration of 0.625 mg of CEE and 2.5 mg of MPA every day. Blood samples were collected at baseline and after 1 year of therapy for measurement of fasting TG, total cholesterol, high-density lipoprotein-cholesterol (HDL-C), and apolipoproteins. Data from 88 of the 99 postmenopausal women were used for analysis. In women whose BMI was 25 kg/m or higher, TG levels during EPT every day increased by 26.8%, while TG levels during EPT every other day decreased by 12.3%. There was a significant (P < 0.05) difference between percentage changes in TG during EPT every day and every other day. In women whose BMI was less than 25 kg/m, TG levels during EPT every day increased by 21.7%, while during EPT every other day TG levels did not change. The mean levels of estradiol during EPT every day in women whose BMI was less than 25 kg/m and in women whose BMI was 25 kg/m or higher were 28.5 and 38.7 pg/mL, respectively, the difference between these levels was significant (P < 0.01). On the other hand, there was no significant difference between levels of estradiol during EPT every other day in these two BMI groups. Triglyceride levels during EPT every day with conventional doses of CEE and MPA increased more in overweight and obese postmenopausal women in association with increased estrogen levels.

Transglutaminase from newly isolated Streptomyces sp. CBMAI 1617: Production optimization, characterization and evaluation in wheat protein and dough systems.

PubMed

Ceresino, Elaine B; de Melo, Ricardo R; Kuktaite, Ramune; Hedenqvist, Mikael S; Zucchi, Tiago D; Johansson, Eva; Sato, Helia H

2018-02-15

The popularity of transglutaminase (TG) by the food industry and the variation in functionality of this enzyme from different origins, prompted us to isolate and evaluate a high-yielding TG strain. Through the statistical approaches, Plackett-Burman and response surface methodology, a low cost fermentation media was obtained to produce 6.074±0.019UmL -1 of TG from a novel source; Streptomyces sp. CBMAI 1617 (SB6). Its potential exploitation was compared to commonly used TG, from Streptomyces mobaraensis. Biochemical and FT-IR studies indicated differences between SB6 and commercial TG (Biobond™ TG-M). Additions of TG to wheat protein and flour based doughs revealed that the dough stretching depended on the wheat protein fraction, TG amount and its origin. A higher degree of cross-linking of glutenins and of inclusion of gliadin in the polymers was seen for SB6 as compared to commercial TG. Thus, our results support the potential of SB6 to tailor wheat protein properties within various food applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effect of Thyroglobulin Autoantibodies on the Metabolic Clearance of Serum Thyroglobulin.

PubMed

Latrofa, Francesco; Ricci, Debora; Bottai, Sara; Brozzi, Federica; Chiovato, Luca; Piaggi, Paolo; Marinò, Michele; Vitti, Paolo

2018-03-01

In order to establish whether thyroglobulin autoantibodies (TgAb) influence the metabolic clearance of thyroglobulin (Tg) in humans, serum Tg and TgAb were correlated shortly after radioiodine ( 131 I) treatment. Samples were collected from 30 consecutive patients undergoing 131 I activity for Graves' hyperthyroidism at the time of treatment and every 15 days thereafter, up to 90 days. Tg and TgAb were measured by immunometric assays (functional sensitivities: 0.1 ng/mL and 8 IU/mL). Tg was detectable in all patients at day 0. Tg concentrations rose from a mean of 33.2 ng/mL [confidence interval (CI) 17.8-61.0 ng/mL] at day 0 to a mean of 214.6 ng/mL [CI 116.9-393.4 ng/mL] at day 30 and then steadily decreased, reaching the lowest concentration at day 90 (M = 10.9 ng/mL [CI 5.5-20.9 ng/mL]). Compared to their levels at day 0 (M = 23.6 IU/mL [CI 10.5-52.9 IU/mL]), TgAb remained stable through day 15 and then gradually increased up to a mean of 116.6 IU/mL [CI 51.9-262.2 IU/mL] at day 90. Patients were then split into two groups according to their TgAb status at day 0: undetectable (<8 IU/mL; 9 patients) or detectable (≥8 IU/mL; 21 patients) TgAb. Compared to the other cohort, patients with detectable TgAb showed significantly lower Tg concentrations at day 0 (M = 20.3 ng/mL [CI 10.1-40.2 ng/mL] vs. M = 101.8 ng/mL [CI 36.6-279.8 ng/mL]), similar at day 15, lower levels at day 30 (M = 146.5 ng/mL [CI 74.3-287.8 ng/mL] vs. M = 514.8 ng/mL [CI 187.8-1407.9 ng/mL]), at day 45 (M = 87.5 ng/mL [CI 43.1-176.6 ng/mL] vs. M = 337.9 ng/mL [CI 120.1-947.0 ng/mL]), at day 60 (M = 61.6 ng/mL [CI 31.0-121.4 ng/mL] vs. M = 255.8 ng/mL [CI 79.0-823.8 ng/mL]), and at day 75 (M = 24.5 ng/mL [CI 11.9-49.2 ng/mL] vs. M = 249.5 ng/mL [CI 63.5-971.1 ng/mL]), and similar levels at day 90. Patients with detectable TgAb showed a lower (M = 182.5 ng/mL [CI 92.0-361.0 ng/mL] vs. M = 514.8 ng/mL [CI 187.8-1407.9 ng/mL]) and an earlier (day 15 vs. day 30) peak of Tg. The mean Tg concentration was lower in patients with detectable TgAb than in those with undetectable TgAb (area under the curve: 17,340 ± 16,481 ng/mL vs. 36,883 ± 44,625 ng/mL; p = 0.02). TgAb influence the changes in Tg concentrations observed immediately after 131 I treatment, inducing lower levels and an earlier peak of Tg. These observations indicate that TgAb significantly influence the metabolic clearance of Tg, supporting the concept that their interference in the measurement of Tg is mainly due to an in vivo effect.

Epigallocatechin gallate (EGCG) reduces the intensity of pancreatic amyloid fibrils in human islet amyloid polypeptide (hIAPP) transgenic mice.

PubMed

Franko, Andras; Rodriguez Camargo, Diana C; Böddrich, Annett; Garg, Divita; Rodriguez Camargo, Andres; Rathkolb, Birgit; Janik, Dirk; Aichler, Michaela; Feuchtinger, Annette; Neff, Frauke; Fuchs, Helmut; Wanker, Erich E; Reif, Bernd; Häring, Hans-Ulrich; Peter, Andreas; Hrabě de Angelis, Martin

2018-01-18

The formation of amyloid fibrils by human islet amyloid polypeptide protein (hIAPP) has been implicated in pancreas dysfunction and diabetes. However, efficient treatment options to reduce amyloid fibrils in vivo are still lacking. Therefore, we tested the effect of epigallocatechin gallate (EGCG) on fibril formation in vitro and in vivo. To determine the binding of hIAPP and EGCG, in vitro interaction studies were performed. To inhibit amyloid plaque formation in vivo, homozygous (tg/tg), hemizygous (wt/tg), and control mice (wt/wt) were treated with EGCG. EGCG bound to hIAPP in vitro and induced formation of amorphous aggregates instead of amyloid fibrils. Amyloid fibrils were detected in the pancreatic islets of tg/tg mice, which was associated with disrupted islet structure and diabetes. Although pancreatic amyloid fibrils could be detected in wt/tg mice, these animals were non-diabetic. EGCG application decreased amyloid fibril intensity in wt/tg mice, however it was ineffective in tg/tg animals. Our data indicate that EGCG inhibits amyloid fibril formation in vitro and reduces fibril intensity in non-diabetic wt/tg mice. These results demonstrate a possible in vivo effectiveness of EGCG on amyloid formation and suggest an early therapeutical application.

Arterial function parameters in patients with metabolic syndrome and severe hypertriglyceridemia.

PubMed

Rinkūnienė, Egidija; Butkutė, Eglė; Puronaitė, Roma; Petrulionienė, Žaneta; Dženkevičiūtė, Vilma; Kasiulevičius, Vytautas; Laucevičius, Aleksandras

Hypertriglyceridemia (hTG) is 1 of the dyslipidemia manifestations in patients with metabolic syndrome (MetS). However, for several decades, the role of hTG in cardiovascular risk was not well established. The aim of this study was to assess the parameters of the vascular structure and function in patients with MetS and different degree of hTG. Patients (aged 40-65 years) with MetS were divided into 3 groups by triglyceride (TG) levels according to National Cholesterol Education Program Adult Treatment Panel III Guidelines: severe hTG (TG ≥ 500 mg/dL), moderate hTG (TG 200-499 mg/dL), and a control (TG < 150 mg/dL) groups. Noninvasive assessment of vascular parameters (aortic augmentation index adjusted for heart rate 75 bpm [AixHR75], pulse wave velocity [PWV], flow-mediated dilatation, and common carotid artery intima-media thickness (IMT)) were performed. Among the 1938 patients analyzed, 1041 had hTG. Moderate hTG was observed in 90.40% (n = 941), whereas severe TG was observed in 9.6% (n = 100) of patients. Overall TG concentration was 231.17 ± 184.23 mg/dL; in severe hTG group, TG concentration was 795.36 ± 368.45 mg/dL, in moderate hTG group 285.20 ± 70.86 mg/dL, and 112.48 ± 24.80 mg/dL in control group. AIxHR75 and IMT were the lowest in the severe hTG group (P < .001 for both). Mean arterial pressure, carotid-radial PWV (9.25 ± 1.13 vs 9.24 ± 1.28 vs 8.91 ± 1.28; P < .001) as well as carotid-femoral PWV (8.63 ± 1.65 vs 8.75 ± 1.58 vs 8.51 ± 1.6; P = .006) were the higher in hTG groups compared with control. There were no significant differences between groups in flow-mediated dilatation (3.39 ± 2.01 vs 3.26 ± 2.43 vs 3.45 ± 2.61, P = .283). Patients with MetS and severe hTG have lower IMT and AIxHR75 and higher PWV and mean arterial pressure. Many factors could affect arterial parameters, and more research are needed to investigate arterial parameters and hTG connection. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Effects of altering the dose and timing of triptorelin when given as an intravaginal gel for advancing and synchronizing ovulation in weaned sows.

PubMed

Knox, R V; Taibl, J N; Breen, S M; Swanson, M E; Webel, S K

2014-08-01

Previous studies have shown that triptorelin gel (TG) given intravaginally in gel form is effective for advancing the time of ovulation in weaned sows. Three experiments were performed to determine the effects of altering the dose and timing of administration of intravaginal TG for advancing and synchronizing ovulation in weaned sows. In all experiments, estrus was detected twice or three times daily and ultrasound was performed to determine ovulation at 8-hour intervals. In experiment 1, sows (n = 131) received intravaginal gel containing 0 (Placebo), 25, 100, or 200 μg of TG at 96 hours after weaning and sows were inseminated on each day of standing estrus. Wean-to-estrus interval and duration of estrus were correlated (P < 0.0001) with estrus duration longer in TG (P < 0.05) compared with Placebo. More sows ovulated (P < 0.001) by 48 hours after treatment with 200 (81%), 100 (64%), and 25 μg (63%) of TG compared with Placebo (42%). The farrowing rate and total pigs born did not differ (P > 0.10). In experiment 2, sows (n = 126) received 200 μg of TG at 72, 84, or 96 hours after weaning or were untreated (Control-96). Sows receiving TG were inseminated once 24 to 28 hours after treatment. Control-96 sows were inseminated on each day of standing estrus. Wean-to-estrus interval was not affected by treatment, but wean-to-ovulation interval was reduced (P < 0.05) by TG-72 and TG-84 compared with TG-96 and Control-96. More sows ovulated 40 hours after treatment (P < 0.001) with TG-72 (56.5%) and TG-84 (32.2%) compared with TG-96 and Control-96 (13%) and for all TG treatments 48 hours after treatment (64%) compared with Control-96 (34%, P < 0.05). The farrowing rate was lower (P < 0.05) for sows assigned to TG-72 and TG-84 compared with TG-96 and Control-96, whereas the number of liveborn pigs did not differ (P > 0.10). In experiment 3, sows (n = 113) were assigned to receive no treatment (Control), intravaginal gel alone (Placebo), or 200 μg of TG given intravaginally (OvuGel) at 96 hours after weaning. Wean-to-estrus interval did not differ, but the duration of estrus tended (P < 0.10) to be reduced with OvuGel compared with the other treatments. More sows ovulated (P < 0.001) by 48 hours after OvuGel treatment (79.1%) compared with Control (46.4%) and Placebo (37.9%) and by 56 hours (P < 0.05). The farrowing rate and the number of liveborn pigs did not differ among treatments. The results of these studies indicate that 200 μg of TG given intravaginally at 96 hours after weaning (OvuGel) synchronizes ovulation and results in fertility similar to Controls. Copyright © 2014 Elsevier Inc. All rights reserved.

Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

PubMed

Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2015-03-15

Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein molecule that alter the biosynthesis of thyroid hormones. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.