A role for exon sequences in alternative splicing of the human fibronectin gene.

PubMed Central

Mardon, H J; Sebastio, G; Baralle, F E

1987-01-01

Exon EDIIIA of the fibronectin (Fn) gene is alternatively spliced via pathways which either skip or include the whole exon in the messenger RNA (mRNA). We have investigated the role of EDIIIA exon sequences in the human Fn gene in determining alternative splicing of this exon during transient expression of alpha globin/Fn minigene hybrids in HeLa cells. We demonstrate that a DNA sequence of 81bp within the central region of exon EDIIIA is required for alternative splicing during processing of the primary transcript to generate both EDIIIA+ and EDIIIA- mRNA's. Furthermore, alternative splicing of EDIIIA only occurs when this sequence is present in the correct orientation since when it is in antisense orientation splicing always occurs via exon-skipping generating EDIIIA- mRNA. Images PMID:3671064

Interplay between DMD Point Mutations and Splicing Signals in Dystrophinopathy Phenotypes

PubMed Central

Juan-Mateu, Jonàs; González-Quereda, Lidia; Rodríguez, Maria José; Verdura, Edgard; Lázaro, Kira; Jou, Cristina; Nascimento, Andrés; Jiménez-Mallebrera, Cecilia; Colomer, Jaume; Monges, Soledad; Lubieniecki, Fabiana; Foncuberta, Maria Eugenia; Pascual-Pascual, Samuel Ignacio; Molano, Jesús; Baiget, Montserrat; Gallano, Pia

2013-01-01

DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements. PMID:23536893

A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.

PubMed

Liu, H X; Cartegni, L; Zhang, M Q; Krainer, A R

2001-01-01

Point mutations can generate defective and sometimes harmful proteins. The nonsense-mediated mRNA decay (NMD) pathway minimizes the potential damage caused by nonsense mutations. In-frame nonsense codons located at a minimum distance upstream of the last exon-exon junction are recognized as premature termination codons (PTCs), targeting the mRNA for degradation. Some nonsense mutations cause skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon is termed nonsense-mediated altered splicing (NAS), and its underlying mechanism is unclear. By analyzing NAS in BRCA1, we show here that inappropriate exon skipping can be reproduced in vitro, and results from disruption of a splicing enhancer in the coding sequence. Enhancers can be disrupted by single nonsense, missense and translationally silent point mutations, without recognition of an open reading frame as such. These results argue against a nuclear reading-frame scanning mechanism for NAS. Coding-region single-nucleotide polymorphisms (cSNPs) within exonic splicing enhancers or silencers may affect the patterns or efficiency of mRNA splicing, which may in turn cause phenotypic variability and variable penetrance of mutations elsewhere in a gene.

Transcriptome instability as a molecular pan-cancer characteristic of carcinomas.

PubMed

Sveen, Anita; Johannessen, Bjarne; Teixeira, Manuel R; Lothe, Ragnhild A; Skotheim, Rolf I

2014-08-10

We have previously proposed transcriptome instability as a genome-wide, pre-mRNA splicing-related characteristic of colorectal cancer. Here, we explore the hypothesis of transcriptome instability being a general characteristic of cancer. Exon-level microarray expression data from ten cancer datasets were analyzed, including breast cancer, cervical cancer, colorectal cancer, gastric cancer, lung cancer, neuroblastoma, and prostate cancer (555 samples), as well as paired normal tissue samples from the colon, lung, prostate, and stomach (93 samples). Based on alternative splicing scores across the genomes, we calculated sample-wise relative amounts of aberrant exon skipping and inclusion. Strong and non-random (P < 0.001) correlations between these estimates and the expression levels of splicing factor genes (n = 280) were found in most cancer types analyzed (breast-, cervical-, colorectal-, lung- and prostate cancer). This suggests a biological explanation for the splicing variation. Surprisingly, these associations prevailed in pan-cancer analyses. This is in contrast to the tissue and cancer specific patterns observed in comparisons across healthy tissue samples from the colon, lung, prostate, and stomach, and between paired cancer-normal samples from the same four tissue types. Based on exon-level expression profiling and computational analyses of alternative splicing, we propose transcriptome instability as a molecular pan-cancer characteristic. The affected cancers show strong and non-random associations between low expression levels of splicing factor genes, and high amounts of aberrant exon skipping and inclusion, and vice versa, on a genome-wide scale.

The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing.

PubMed

Makeyev, Eugene V; Zhang, Jiangwen; Carrasco, Monica A; Maniatis, Tom

2007-08-03

Both microRNAs and alternative pre-mRNA splicing have been implicated in the development of the nervous system (NS), but functional interactions between these two pathways are poorly understood. We demonstrate that the neuron-specific microRNA miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in nonneuronal cells. Among the targets of PTBP1 is a critical cassette exon in the pre-mRNA of PTBP2 (nPTB/brPTB/PTBLP), an NS-enriched PTBP1 homolog. When this exon is skipped, PTBP2 mRNA is subject to nonsense-mediated decay (NMD). During neuronal differentiation, miR-124 reduces PTBP1 levels, leading to the accumulation of correctly spliced PTBP2 mRNA and a dramatic increase in PTBP2 protein. These events culminate in the transition from non-NS to NS-specific alternative splicing patterns. We also present evidence that miR-124 plays a key role in the differentiation of progenitor cells to mature neurons. Thus, miR-124 promotes NS development, at least in part by regulating an intricate network of NS-specific alternative splicing.

Lariat sequencing in a unicellular yeast identifies regulated alternative splicing of exons that are evolutionarily conserved with humans.

PubMed

Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A

2013-07-30

Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.

Intron-mediated alternative splicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation

PubMed Central

Kesari, Ravi; Lasky, Jesse R.; Villamor, Joji Grace; Des Marais, David L.; Chen, Ying-Jiun C.; Liu, Tzu-Wen; Juenger, Thomas E.; Verslues, Paul E.

2012-01-01

Drought-induced proline accumulation is widely observed in plants but its regulation and adaptive value are not as well understood. Proline accumulation of the Arabidopsis accession Shakdara (Sha) was threefold less than that of Landsberg erecta (Ler) and quantitative trait loci mapping identified a reduced function allele of the proline synthesis enzyme Δ1-pyrroline-5-carboxylate synthetase1 (P5CS1) as a basis for the lower proline of Sha. Sha P5CS1 had additional TA repeats in intron 2 and a G-to-T transversion in intron 3 that were sufficient to promote alternative splicing and production of a nonfunctional transcript lacking exon 3 (exon 3-skip P5CS1). In Sha, and additional accessions with the same intron polymorphisms, the nonfunctional exon 3-skip P5CS1 splice variant constituted as much as half of the total P5CS1 transcript. In a larger panel of Arabidopsis accessions, low water potential-induced proline accumulation varied by 10-fold and variable production of exon 3-skip P5CS1 among accessions was an important, but not the sole, factor underlying variation in proline accumulation. Population genetic analyses suggest that P5CS1 may have evolved under positive selection, and more extensive correlation of exon 3-skip P5CS1 production than proline abundance with climate conditions of natural accessions also suggest a role of P5CS1 in local adaptation to the environment. These data identify a unique source of alternative splicing in plants, demonstrate a role of exon 3-skip P5CS1 in natural variation of proline metabolism, and suggest an association of P5CS1 and its alternative splicing with environmental adaptation. PMID:22615385

Antisense oligonucleotide–mediated MDM4 exon 6 skipping impairs tumor growth

PubMed Central

Dewaele, Michael; Tabaglio, Tommaso; Willekens, Karen; Bezzi, Marco; Teo, Shun Xie; Low, Diana H.P.; Koh, Cheryl M.; Rambow, Florian; Fiers, Mark; Rogiers, Aljosja; Radaelli, Enrico; Al-Haddawi, Muthafar; Tan, Soo Yong; Hermans, Els; Amant, Frederic; Yan, Hualong; Lakshmanan, Manikandan; Koumar, Ratnacaram Chandrahas; Lim, Soon Thye; Derheimer, Frederick A.; Campbell, Robert M.; Bonday, Zahid; Tergaonkar, Vinay; Shackleton, Mark; Blattner, Christine; Marine, Jean-Christophe; Guccione, Ernesto

2015-01-01

MDM4 is a promising target for cancer therapy, as it is undetectable in most normal adult tissues but often upregulated in cancer cells to dampen p53 tumor-suppressor function. The mechanisms that underlie MDM4 upregulation in cancer cells are largely unknown. Here, we have shown that this key oncogenic event mainly depends on a specific alternative splicing switch. We determined that while a nonsense-mediated, decay-targeted isoform of MDM4 (MDM4-S) is produced in normal adult tissues as a result of exon 6 skipping, enhanced exon 6 inclusion leads to expression of full-length MDM4 in a large number of human cancers. Although this alternative splicing event is likely regulated by multiple splicing factors, we identified the SRSF3 oncoprotein as a key enhancer of exon 6 inclusion. In multiple human melanoma cell lines and in melanoma patient–derived xenograft (PDX) mouse models, antisense oligonucleotide–mediated (ASO-mediated) skipping of exon 6 decreased MDM4 abundance, inhibited melanoma growth, and enhanced sensitivity to MAPK-targeting therapeutics. Additionally, ASO-based MDM4 targeting reduced diffuse large B cell lymphoma PDX growth. As full-length MDM4 is enhanced in multiple human tumors, our data indicate that this strategy is applicable to a wide range of tumor types. We conclude that enhanced MDM4 exon 6 inclusion is a common oncogenic event and has potential as a clinically compatible therapeutic target. PMID:26595814

The MicroRNA miR-124 Promotes Neuronal Differentiation by Triggering Brain-Specific Alternative Pre-mRNA Splicing

PubMed Central

Makeyev, Eugene V.; Zhang, Jiangwen; Carrasco, Monica A.; Maniatis, Tom

2011-01-01

SUMMARY Both microRNAs and alternative pre-mRNA splicing have been implicated in the development of the nervous system (NS), but functional interactions between these two pathways are poorly understood. We demonstrate that the neuron-specific microRNA miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in nonneuronal cells. Among the targets of PTBP1 is a critical cassette exon in the pre-mRNA of PTBP2 (nPTB/brPTB/PTBLP), an NS-enriched PTBP1 homolog. When this exon is skipped, PTBP2 mRNA is subject to nonsense-mediated decay (NMD). During neuronal differentiation, miR-124 reduces PTBP1 levels, leading to the accumulation of correctly spliced PTBP2 mRNA and a dramatic increase in PTBP2 protein. These events culminate in the transition from non-NS to NS-specific alternative splicing patterns. We also present evidence that miR-124 plays a key role in the differentiation of progenitor cells to mature neurons. Thus, miR-124 promotes NS development, at least in part by regulating an intricate network of NS-specific alternative splicing. PMID:17679093

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.

Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regionsmore » (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Finally, taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically.« less

Fluorescent Protein-Based Quantification of Alternative Splicing of a Target Cassette Exon in Mammalian Cells.

PubMed

Gurskaya, N G; Staroverov, D B; Lukyanov, K A

2016-01-01

Alternative splicing is an important mechanism of regulation of gene expression and expansion of proteome complexity. Recently we developed a new fluorescence reporter for quantitative analysis of alternative splicing of a target cassette exon in live cells (Gurskaya et al., 2012). It consists of a specially designed minigene encoding red and green fluorescent proteins (Katushka and TagGFP2) and a fragment of the target gene between them. Skipping or inclusion of the alternative exon induces a frameshift; ie, alternative exon length must not be a multiple of 3. Finally, red and green fluorescence intensities of cells expressing this reporter are used to estimate the percentage of alternative (exon-skipped) and normal (exon-retained) transcripts. Here, we provide a detailed description of design and application of the fluorescence reporter of a target alternative exon splicing in mammalian cell lines. © 2016 Elsevier Inc. All rights reserved.

Schizophyllum commune has an extensive and functional alternative splicing repertoire

PubMed Central

Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.; Wösten, Han A. B.; Abeel, Thomas; Reinders, Marcel J. T.

2016-01-01

Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regions (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically. PMID:27659065

Schizophyllum commune has an extensive and functional alternative splicing repertoire

DOE PAGES

Gehrmann, Thies; Pelkmans, Jordi F.; Lugones, Luis G.; ...

2016-09-23

Recent genome-wide studies have demonstrated that fungi possess the machinery to alternatively splice pre-mRNA. However, there has not been a systematic categorization of the functional impact of alternative splicing in a fungus. We investigate alternative splicing and its functional consequences in the model mushroom forming fungus Schizophyllum commune. Alternative splicing was demonstrated for 2,285 out of 12,988 expressed genes, resulting in 20% additional transcripts. Intron retentions were the most common alternative splicing events, accounting for 33% of all splicing events, and 43% of the events in coding regions. On the other hand, exon skipping events were rare in coding regionsmore » (1%) but enriched in UTRs where they accounted for 57% of the events. Specific functional groups, including transcription factors, contained alternatively spliced genes. Alternatively spliced transcripts were regulated differently throughout development in 19% of the 2,285 alternatively spliced genes. Notably, 69% of alternatively spliced genes have predicted alternative functionality by loss or gain of functional domains, or by acquiring alternative subcellular locations. S. commune exhibits more alternative splicing than any other studied fungus. Finally, taken together, alternative splicing increases the complexity of the S. commune proteome considerably and provides it with a rich repertoire of alternative functionality that is exploited dynamically.« less

Differential HFE Gene Expression Is Regulated by Alternative Splicing in Human Tissues

PubMed Central

Proença, Daniela; Faustino, Paula

2011-01-01

Background The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. Methodology/Principal Findings Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE) that is mostly secreted by cells to the medium in association with β2M. Conclusions/Significance HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum. PMID:21407826

Differential HFE gene expression is regulated by alternative splicing in human tissues.

PubMed

Martins, Rute; Silva, Bruno; Proença, Daniela; Faustino, Paula

2011-03-03

The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants. Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE) that is mostly secreted by cells to the medium in association with β2M. HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum.

MutPred Splice: machine learning-based prediction of exonic variants that disrupt splicing

PubMed Central

2014-01-01

We have developed a novel machine-learning approach, MutPred Splice, for the identification of coding region substitutions that disrupt pre-mRNA splicing. Applying MutPred Splice to human disease-causing exonic mutations suggests that 16% of mutations causing inherited disease and 10 to 14% of somatic mutations in cancer may disrupt pre-mRNA splicing. For inherited disease, the main mechanism responsible for the splicing defect is splice site loss, whereas for cancer the predominant mechanism of splicing disruption is predicted to be exon skipping via loss of exonic splicing enhancers or gain of exonic splicing silencer elements. MutPred Splice is available at http://mutdb.org/mutpredsplice. PMID:24451234

Exon Specific U1 snRNAs improve ELP1 exon 20 definition and rescue ELP1 protein expression in a Familial Dysautonomia mouse model.

PubMed

Donadon, Irving; Pinotti, Mirko; Rajkowska, Katarzyna; Pianigiani, Giulia; Barbon, Elena; Morini, Elisabetta; Motaln, Helena; Rogelj, Boris; Mingozzi, Federico; Slaugenhaupt, Susan A; Pagani, Franco

2018-04-25

Familial dysautonomia (FD) is a rare genetic disease with no treatment, caused by an intronic point mutation (c.2204 + 6T>C) that negatively affects the definition of exon 20 in the Elongator complex protein 1 gene (ELP1 also known as IKBKAP). This substitution modifies the 5' splice site and, in combination with regulatory splicing factors, induces different levels of exon 20 skipping, in various tissues. Here, we evaluated the therapeutic potential of a novel class of U1 snRNA molecules, Exon-Specific U1s (ExSpeU1s), in correcting ELP1 exon 20 recognition. Lentivirus-mediated expression of ELP1-ExSpeU1 in FD fibroblasts improved ELP1 splicing and protein levels. We next focused on a transgenic mouse model that recapitulates the same tissue-specific mis-splicing seen in FD patients. Intraperitoneal delivery of ELP1-ExSpeU1s-adeno-associated virus particles successfully increased the production of full-length human ELP1 transcript and protein. This splice-switching class of molecules is the first to specifically correct the ELP1 exon 20 splicing defect. Our data provide proof of principle of ExSpeU1s-adeno-associated virus particles as a novel therapeutic strategy for FD.

Transcriptome Bioinformatical Analysis of Vertebrate Stages of Schistosoma japonicum Reveals Alternative Splicing Events

PubMed Central

Wang, Xinye; Xu, Xindong; Lu, Xingyu; Zhang, Yuanbin; Pan, Weiqing

2015-01-01

Alternative splicing is a molecular process that contributes greatly to the diversification of proteome and to gene functions. Understanding the mechanisms of stage-specific alternative splicing can provide a better understanding of the development of eukaryotes and the functions of different genes. Schistosoma japonicum is an infectious blood-dwelling trematode with a complex lifecycle that causes the tropical disease schistosomiasis. In this study, we analyzed the transcriptome of Schistosoma japonicum to discover alternative splicing events in this parasite, by applying RNA-seq to cDNA library of adults and schistosomula. Results were validated by RT-PCR and sequencing. We found 11,623 alternative splicing events among 7,099 protein encoding genes and average proportion of alternative splicing events per gene was 42.14%. We showed that exon skip is the most common type of alternative splicing events as found in high eukaryotes, whereas intron retention is the least common alternative splicing type. According to intron boundary analysis, the parasite possesses same intron boundaries as other organisms, namely the classic “GT-AG” rule. And in alternative spliced introns or exons, this rule is less strict. And we have attempted to detect alternative splicing events in genes encoding proteins with signal peptides and transmembrane helices, suggesting that alternative splicing could change subcellular locations of specific gene products. Our results indicate that alternative splicing is prevalent in this parasitic worm, and that the worm is close to its hosts. The revealed secretome involved in alternative splicing implies new perspective into understanding interaction between the parasite and its host. PMID:26407301

Unusual splice site mutations disrupt FANCA exon 8 definition.

PubMed

Mattioli, Chiara; Pianigiani, Giulia; De Rocco, Daniela; Bianco, Anna Monica Rosaria; Cappelli, Enrico; Savoia, Anna; Pagani, Franco

2014-07-01

The pathological role of mutations that affect not conserved splicing regulatory sequences can be difficult to determine. In a patient with Fanconi anemia, we identified two unpredictable splicing mutations that act on either sides of FANCA exon 8. In patients-derived cells and in minigene splicing assay, we showed that both an apparently benign intronic c.710-5T>C transition and the nonsense c.790C>T substitution induce almost complete exon 8 skipping. Site-directed mutagenesis experiments indicated that the c.710-5T>C transition affects a polypyrimidine tract where most of the thymidines cannot be compensated by cytidines. The c.790C>T mutation located in position -3 relative to the donor site induce exon 8 skipping in an NMD-independent manner and complementation experiments with modified U1 snRNAs showed that U1 snRNP is only partially involved in the splicing defect. Our results highlight the importance of performing splicing functional assay for correct identification of disease-causing mechanism of genomic variants and provide mechanistic insights on how these two FANCA mutations affect exon 8 definition. Copyright © 2014 Elsevier B.V. All rights reserved.

A novel point mutation (G[sup [minus]1] to T) in a 5[prime] splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker Muscular Dystrophy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagiwara, Yoko; Nishio, Hisahide; Kitoh, Yoshihiko

1994-01-01

The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. The authors now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5[prime] splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophinmore » lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5[prime] splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G[sup [minus]1]-to-T mutation at the 5[prime] splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. 48 refs., 5 figs.« less

Functional analysis of a large set of BRCA2 exon 7 variants highlights the predictive value of hexamer scores in detecting alterations of exonic splicing regulatory elements.

PubMed

Di Giacomo, Daniela; Gaildrat, Pascaline; Abuli, Anna; Abdat, Julie; Frébourg, Thierry; Tosi, Mario; Martins, Alexandra

2013-11-01

Exonic variants can alter pre-mRNA splicing either by changing splice sites or by modifying splicing regulatory elements. Often these effects are difficult to predict and are only detected by performing RNA analyses. Here, we analyzed, in a minigene assay, 26 variants identified in the exon 7 of BRCA2, a cancer predisposition gene. Our results revealed eight new exon skipping mutations in this exon: one directly altering the 5' splice site and seven affecting potential regulatory elements. This brings the number of splicing regulatory mutations detected in BRCA2 exon 7 to a total of 11, a remarkably high number considering the total number of variants reported in this exon (n = 36), all tested in our minigene assay. We then exploited this large set of splicing data to test the predictive value of splicing regulator hexamers' scores recently established by Ke et al. (). Comparisons of hexamer-based predictions with our experimental data revealed high sensitivity in detecting variants that increased exon skipping, an important feature for prescreening variants before RNA analysis. In conclusion, hexamer scores represent a promising tool for predicting the biological consequences of exonic variants and may have important applications for the interpretation of variants detected by high-throughput sequencing. © 2013 WILEY PERIODICALS, INC.

Alternatively spliced Spalax heparanase inhibits extracellular matrix degradation, tumor growth, and metastasis

PubMed Central

Nasser, Nicola J.; Avivi, Aaron; Shafat, Itay; Edovitsky, Evgeny; Zcharia, Eyal; Ilan, Neta; Vlodavsky, Israel; Nevo, Eviatar

2009-01-01

Heparanase is an endoglycosidase that degrades heparan sulfate (HS) at the cell surface and in the extracellular matrix. Heparanase is expressed mainly by cancer cells, and its expression is correlated with increased tumor aggressiveness, metastasis, and angiogenesis. Here, we report the cloning of a unique splice variant (splice 36) of heparanase from the subterranean blind mole rat (Spalax). This splice variant results from skipping part of exon 3, exons 4 and 5, and part of exon 6 and functions as a dominant negative to the wild-type enzyme. It inhibits HS degradation, suppresses glioma tumor growth, and decreases experimental B16–BL6 lung colonization in a mouse model. Intriguingly, Spalax splice variant 7 of heparanase (which results from skipping of exon 7) is devoid of enzymatic activity, but unlike splice 36 it enhances tumor growth. Our results demonstrate that alternative splicing of heparanase regulates its enzymatic activity and might adapt the heparanase function to the fluctuating normoxic–hypoxic subterranean environment that Spalax experiences. Development of anticancer drugs designed to suppress tumor growth, angiogenesis, and metastasis is a major challenge, of which heparanase inhibition is a promising approach. We anticipate that the heparanase splicing model, evolved during 40 million years of Spalacid adaptation to underground life, would pave the way for the development of heparanase-based therapeutic modalities directed against angiogenesis, tumor growth, and metastasis. PMID:19164514

A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

PubMed Central

Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

2009-01-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

PubMed

Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

2009-05-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

A mechanism underlying position-specific regulation of alternative splicing

PubMed Central

Hamid, Fursham M.

2017-01-01

Abstract Many RNA-binding proteins including a master regulator of splicing in developing brain and muscle, polypyrimidine tract-binding protein 1 (PTBP1), can either activate or repress alternative exons depending on the pre-mRNA recruitment position. When bound upstream or within regulated exons PTBP1 tends to promote their skipping, whereas binding to downstream sites often stimulates inclusion. How this switch is orchestrated at the molecular level is poorly understood. Using bioinformatics and biochemical approaches we show that interaction of PTBP1 with downstream intronic sequences can activate natural cassette exons by promoting productive docking of the spliceosomal U1 snRNP to a suboptimal 5′ splice site. Strikingly, introducing upstream PTBP1 sites to this circuitry leads to a potent splicing repression accompanied by the assembly of an exonic ribonucleoprotein complex with a tightly bound U1 but not U2 snRNP. Our data suggest a molecular mechanism underlying the transition between a better-known repressive function of PTBP1 and its role as a bona fide splicing activator. More generally, we argue that the functional outcome of individual RNA contacts made by an RNA-binding protein is subject to extensive context-specific modulation.

Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

PubMed Central

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

2004-01-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

PubMed

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

2004-05-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

Identification of a splicing enhancer in MLH1 using COMPARE a new assay for determination of relative RNA splicing efficiencies

PubMed Central

Xu, Dong-Qing; Mattox, William

2006-01-01

Exonic splicing enhancers (ESEs) are sequences that facilitate recognition of splice sites and prevent exon-skipping. Because ESEs are often embedded within proteincoding sequences, alterations in them can also often be interpreted as nonsense, missense or silent mutations. To correctly interpret exonic mutations and their roles in disease, it is important to develop strategies that identify ESE mutations. Potential ESEs can be found computationally in many exons but it has proven difficult to predict if a given mutation will have effects on splicing based on sequence alone. Here we describe a flexible in vitro method that can be used to functionally compare the effects of multiple sequence variants on ESE activity in a single in vitro splicing reaction. We have applied this method in parallel with conventional splicing assays to test for a splicing enhancer in exon 17 of the human MLH1 gene. Point mutations associated with hereditary nonpolyposis colorectal cancer (HNPCC) have previously been found to correlate with exon-skipping in both lymphocytes and tumors from patients. We show that sequences from this exon can replace an ESE from the mouse IgM gene to support RNA splicing in HeLa nuclear extracts. ESE activity was reduced by HNPCC point mutations in codon 659 indicating that their primary effect is on splicing. Surprisingly the strongest enhancer function mapped to a different region of the exon upstream of this codon. Together our results indicate that HNPCC point mutations in codon 659 affect an auxillary element that augments the enhancer function to ensure exon inclusion. PMID:16357104

Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

PubMed Central

Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta

2012-01-01

Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

SASD: the Synthetic Alternative Splicing Database for identifying novel isoform from proteomics

PubMed Central

2013-01-01

Background Alternative splicing is an important and widespread mechanism for generating protein diversity and regulating protein expression. High-throughput identification and analysis of alternative splicing in the protein level has more advantages than in the mRNA level. The combination of alternative splicing database and tandem mass spectrometry provides a powerful technique for identification, analysis and characterization of potential novel alternative splicing protein isoforms from proteomics. Therefore, based on the peptidomic database of human protein isoforms for proteomics experiments, our objective is to design a new alternative splicing database to 1) provide more coverage of genes, transcripts and alternative splicing, 2) exclusively focus on the alternative splicing, and 3) perform context-specific alternative splicing analysis. Results We used a three-step pipeline to create a synthetic alternative splicing database (SASD) to identify novel alternative splicing isoforms and interpret them at the context of pathway, disease, drug and organ specificity or custom gene set with maximum coverage and exclusive focus on alternative splicing. First, we extracted information on gene structures of all genes in the Ensembl Genes 71 database and incorporated the Integrated Pathway Analysis Database. Then, we compiled artificial splicing transcripts. Lastly, we translated the artificial transcripts into alternative splicing peptides. The SASD is a comprehensive database containing 56,630 genes (Ensembl gene IDs), 95,260 transcripts (Ensembl transcript IDs), and 11,919,779 Alternative Splicing peptides, and also covering about 1,956 pathways, 6,704 diseases, 5,615 drugs, and 52 organs. The database has a web-based user interface that allows users to search, display and download a single gene/transcript/protein, custom gene set, pathway, disease, drug, organ related alternative splicing. Moreover, the quality of the database was validated with comparison to other known databases and two case studies: 1) in liver cancer and 2) in breast cancer. Conclusions The SASD provides the scientific community with an efficient means to identify, analyze, and characterize novel Exon Skipping and Intron Retention protein isoforms from mass spectrometry and interpret them at the context of pathway, disease, drug and organ specificity or custom gene set with maximum coverage and exclusive focus on alternative splicing. PMID:24267658

Genome-wide Analysis Reveals SR Protein Cooperation and Competition in Regulated Splicing

PubMed Central

Pandit, Shatakshi; Zhou, Yu; Shiue, Lily; Coutinho-Mansfield, Gabriela; Li, Hairi; Qiu, Jinsong; Huang, Jie; Yeo, Gene W.; Ares, Manuel; Fu, Xiang-Dong

2013-01-01

Summary SR proteins are well-characterized RNA binding proteins that promote exon inclusion by binding to exonic splicing enhancers (ESEs). However, it has been unclear whether regulatory rules deduced on model genes apply generally to activities of SR proteins in the cell. Here, we report global analyses of two prototypical SR proteins SRSF1 (SF2/ASF) and SRSF2 (SC35) using splicing-sensitive arrays and CLIP-seq on mouse embryo fibroblasts (MEFs). Unexpectedly, we find that these SR proteins promote both inclusion and skipping of exons in vivo, but their binding patterns do not explain such opposite responses. Further analyses reveal that loss of one SR protein is accompanied by coordinated loss or compensatory gain in the interaction of other SR proteins at the affected exons. Therefore, specific effects on regulated splicing by one SR protein actually depend on a complex set of relationships with multiple other SR proteins in mammalian genomes. PMID:23562324

Circular RNAs: An emerging type of RNA in cancer.

PubMed

Hou, Li-Dan; Zhang, Jing

2017-03-01

Circular RNAs (circRNAs), a novel type of widespread and diverse endogenous non-coding RNAs (ncRNAs), which are different from the linear RNAs, form a covalently closed continuous loop without 5' or 3' polarities. The majority of circRNAs are abundant, conserved and stable across different species, and exhibit tissue/developmental-stage-specific characteristics. They are generated primarily through a type of alternative RNA splicing called "back-splicing," in which a downstream splice donor is joined to an upstream splice acceptor through splice skipping or direct splice. Recent studies have discovered circRNAs function as microRNA sponges, binding with RNA-associated proteins to form RNA-protein complexes and then regulating gene transcription and translation into polypeptides. Emerging evidence indicates that circRNAs play important roles in the regulation of the development and progression of multiple cancers by serving as potential diagnostic and predictive biomarkers involved in tumor growth and invasion and providing new strategies for cancer diagnosis and targeted therapy. In this review, we briefly delineate the diversity and characteristics of circRNAs and discuss the highlights of the biogenesis of circRNAs and their potential functions in tumor.

Alternative Splice in Alternative Lice

PubMed Central

Tovar-Corona, Jaime M.; Castillo-Morales, Atahualpa; Chen, Lu; Olds, Brett P.; Clark, John M.; Reynolds, Stuart E.; Pittendrigh, Barry R.; Feil, Edward J.; Urrutia, Araxi O.

2015-01-01

Genomic and transcriptomics analyses have revealed human head and body lice to be almost genetically identical; although con-specific, they nevertheless occupy distinct ecological niches and have differing feeding patterns. Most importantly, while head lice are not known to be vector competent, body lice can transmit three serious bacterial diseases; epidemictyphus, trench fever, and relapsing fever. In order to gain insights into the molecular bases for these differences, we analyzed alternative splicing (AS) using next-generation sequencing data for one strain of head lice and one strain of body lice. We identified a total of 3,598 AS events which were head or body lice specific. Exon skipping AS events were overrepresented among both head and body lice, whereas intron retention events were underrepresented in both. However, both the enrichment of exon skipping and the underrepresentation of intron retention are significantly stronger in body lice compared with head lice. Genes containing body louse-specific AS events were found to be significantly enriched for functions associated with development of the nervous system, salivary gland, trachea, and ovarian follicle cells, as well as regulation of transcription. In contrast, no functional categories were overrepresented among genes with head louse-specific AS events. Together, our results constitute the first evidence for transcript pool differences in head and body lice, providing insights into molecular adaptations that enabled human lice to adapt to clothing, and representing a powerful illustration of the pivotal role AS can play in functional adaptation. PMID:26169943

Kinetin improves IKBKAP mRNA splicing in patients with familial dysautonomia

PubMed Central

Axelrod, Felicia B.; Liebes, Leonard; Gold-von Simson, Gabrielle; Mendoza, Sandra; Mull, James; Leyne, Maire; Norcliffe-Kaufmann, Lucy; Kaufmann, Horacio; Slaugenhaupt, Susan A.

2011-01-01

Familial dysautonomia (FD) is caused by an intronic splice mutation in the IKBKAP gene that leads to partial skipping of exon 20 and tissue-specific reduction in I-κ-B kinase complex associated protein/ elongation protein 1 (IKAP/ELP-1) expression. Kinetin (6-furfurylaminopurine) has been shown to improve splicing and increase wild-type IKBKAP mRNA and IKAP protein expression in FD cell lines and carriers. To determine if oral kinetin treatment could alter mRNA splicing in FD subjects and was tolerable, we administered kinetin to eight FD individuals homozygous for the splice mutation. Subjects received 23.5 mg/Kg/day for 28 days. An increase in wild-type IKBKAP mRNA expression in leukocytes was noted after eight days in six of eight individuals; after 28 days the mean increase as compared to baseline was significant (p=0.002). We have demonstrated that kinetin is tolerable in this medically fragile population. Not only did kinetin produce the desired effect on splicing in FD patients, but also that effect appears to improve with time despite lack of dose change. This is the first report of a drug that produces in vivo mRNA splicing changes in individuals with FD and supports future long-term trials to determine if kinetin will prove therapeutic in FD patients. PMID:21775922

Alternative Splicing of a Novel Inducible Exon Diversifies the CASK Guanylate Kinase Domain

PubMed Central

Dembowski, Jill A.; An, Ping; Scoulos-Hanson, Maritsa; Yeo, Gene; Han, Joonhee; Fu, Xiang-Dong; Grabowski, Paula J.

2012-01-01

Alternative pre-mRNA splicing has a major impact on cellular functions and development with the potential to fine-tune cellular localization, posttranslational modification, interaction properties, and expression levels of cognate proteins. The plasticity of regulation sets the stage for cells to adjust the relative levels of spliced mRNA isoforms in response to stress or stimulation. As part of an exon profiling analysis of mouse cortical neurons stimulated with high KCl to induce membrane depolarization, we detected a previously unrecognized exon (E24a) of the CASK gene, which encodes for a conserved peptide insertion in the guanylate kinase interaction domain. Comparative sequence analysis shows that E24a appeared selectively in mammalian CASK genes as part of a >3,000 base pair intron insertion. We demonstrate that a combination of a naturally defective 5′ splice site and negative regulation by several splicing factors, including SC35 (SRSF2) and ASF/SF2 (SRSF1), drives E24a skipping in most cell types. However, this negative regulation is countered with an observed increase in E24a inclusion after neuronal stimulation and NMDA receptor signaling. Taken together, E24a is typically a skipped exon, which awakens during neuronal stimulation with the potential to diversify the protein interaction properties of the CASK polypeptide. PMID:23008758

Anti-tumor efficacy of a novel CLK inhibitor via targeting RNA splicing and MYC-dependent vulnerability.

PubMed

Iwai, Kenichi; Yaguchi, Masahiro; Nishimura, Kazuho; Yamamoto, Yukiko; Tamura, Toshiya; Nakata, Daisuke; Dairiki, Ryo; Kawakita, Yoichi; Mizojiri, Ryo; Ito, Yoshiteru; Asano, Moriteru; Maezaki, Hironobu; Nakayama, Yusuke; Kaishima, Misato; Hayashi, Kozo; Teratani, Mika; Miyakawa, Shuichi; Iwatani, Misa; Miyamoto, Maki; Klein, Michael G; Lane, Wes; Snell, Gyorgy; Tjhen, Richard; He, Xingyue; Pulukuri, Sai; Nomura, Toshiyuki

2018-06-01

The modulation of pre-mRNA splicing is proposed as an attractive anti-neoplastic strategy, especially for the cancers that exhibit aberrant pre-mRNA splicing. Here, we discovered that T-025 functions as an orally available and potent inhibitor of Cdc2-like kinases (CLKs), evolutionally conserved kinases that facilitate exon recognition in the splicing machinery. Treatment with T-025 reduced CLK-dependent phosphorylation, resulting in the induction of skipped exons, cell death, and growth suppression in vitro and in vivo Further, through growth inhibitory characterization, we identified high CLK2 expression or MYC amplification as a sensitive-associated biomarker of T-025. Mechanistically, the level of CLK2 expression correlated with the magnitude of global skipped exons in response to T-025 treatment. MYC activation, which altered pre-mRNA splicing without the transcriptional regulation of CLKs, rendered cancer cells vulnerable to CLK inhibitors with synergistic cell death. Finally, we demonstrated in vivo anti-tumor efficacy of T-025 in an allograft model of spontaneous, MYC-driven breast cancer, at well-tolerated dosage. Collectively, our results suggest that the novel CLK inhibitor could have therapeutic benefits, especially for MYC-driven cancer patients. © 2018 Takeda Pharmaceutical Company Published under the terms of the CC BY 4.0 license.

Comprehensive splicing functional analysis of DNA variants of the BRCA2 gene by hybrid minigenes

PubMed Central

2012-01-01

Introduction The underlying pathogenic mechanism of a large fraction of DNA variants of disease-causing genes is the disruption of the splicing process. We aimed to investigate the effect on splicing of the BRCA2 variants c.8488-1G > A (exon 20) and c.9026_9030del (exon 23), as well as 41 BRCA2 variants reported in the Breast Cancer Information Core (BIC) mutation database. Methods DNA variants were analyzed with the splicing prediction programs NNSPLICE and Human Splicing Finder. Functional analyses of candidate variants were performed by lymphocyte RT-PCR and/or hybrid minigene assays. Forty-one BIC variants of exons 19, 20, 23 and 24 were bioinformatically selected and generated by PCR-mutagenesis of the wild type minigenes. Results Lymphocyte RT-PCR of c.8488-1G > A showed intron 19 retention and a 12-nucleotide deletion in exon 20, whereas c.9026_9030del did not show any splicing anomaly. Minigene analysis of c.8488-1G > A displayed the aforementioned aberrant isoforms but also exon 20 skipping. We further evaluated the splicing outcomes of 41 variants of four BRCA2 exons by minigene analysis. Eighteen variants presented splicing aberrations. Most variants (78.9%) disrupted the natural splice sites, whereas four altered putative enhancers/silencers and had a weak effect. Fluorescent RT-PCR of minigenes accurately detected 14 RNA isoforms generated by cryptic site usage, exon skipping and intron retention events. Fourteen variants showed total splicing disruptions and were predicted to truncate or eliminate essential domains of BRCA2. Conclusions A relevant proportion of BRCA2 variants are correlated with splicing disruptions, indicating that RNA analysis is a valuable tool to assess the pathogenicity of a particular DNA change. The minigene system is a straightforward and robust approach to detect variants with an impact on splicing and contributes to a better knowledge of this gene expression step. PMID:22632462

Translational and regulatory challenges for exon skipping therapies.

PubMed

Aartsma-Rus, Annemieke; Ferlini, Alessandra; Goemans, Nathalie; Pasmooij, Anna M G; Wells, Dominic J; Bushby, Katerine; Vroom, Elizabeth; Balabanov, Pavel

2014-10-01

Several translational challenges are currently impeding the therapeutic development of antisense-mediated exon skipping approaches for rare diseases. Some of these are inherent to developing therapies for rare diseases, such as small patient numbers and limited information on natural history and interpretation of appropriate clinical outcome measures. Others are inherent to the antisense oligonucleotide (AON)-mediated exon skipping approach, which employs small modified DNA or RNA molecules to manipulate the splicing process. This is a new approach and only limited information is available on long-term safety and toxicity for most AON chemistries. Furthermore, AONs often act in a mutation-specific manner, in which case multiple AONs have to be developed for a single disease. A workshop focusing on preclinical development, trial design, outcome measures, and different forms of marketing authorization was organized by the regulatory models and biochemical outcome measures working groups of Cooperation of Science and Technology Action: "Networking towards clinical application of antisense-mediated exon skipping for rare diseases." The workshop included participants from patient organizations, academia, and members of staff from the European Medicine Agency and Medicine Evaluation Board (the Netherlands). This statement article contains the key outcomes of this meeting.

Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing.

PubMed

Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok

2016-04-01

Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.

RNA-Seq profiling reveals aberrant RNA splicing in patient with adult acute myeloid leukemia during treatment.

PubMed

Li, X-y; Yao, X; Li, S-n; Suo, A-l; Ruan, Z-p; Liang, X; Kong, Y; Zhang, W-g; Yao, Y

2014-01-01

Multiple genetic alterations that affect the process of acute myeloid leukemia (AML) have been discovered, and more evidence also indicates that aberrant splicing plays an important role in cancer. We present a RNA-Seq profiling of an AML patient with complete remission after treatment, to analyze the aberrant splicing of genes during treatment. We sequenced 3.97 and 3.32 Gbp clean data of the AML and remission sample, respectively. Firstly, by analyzing biomarkers associated with AML, to assist normal clinical tests, we confirmed that the patient was anormal karyo type, with NPM1 and IDH2 mutations and deregulation patterns of related genes, such as BAALC, ERG, MN1 and HOX family. Then, we performed alternative splicing detection of the AML and remission sample. We detected 91 differentially splicing events in 68 differentially splicing genes (DSGs) by mixture of isoforms (MISO). Considering Psi values (Ψ) and confidence intervals, 25 differentially expressed isoforms were identified as more confident isoforms, which were associated with RNA processing, cellular macromolecule catabolic process and DNA binding according to GO enrichment analysis. An exon2-skipping event in oncogene FOS (FBJ murine osteosarcoma viral oncogene homolog) were detected and validated in this study. FOS has a critical function in regulating cell proliferation, differentiation and transformation. The exon2-skipping isoform of FOS was increased significantly after treatment. All the data and information of RNA-Seq provides highly accurate and comprehensive supplements to conventional clinical tests of AML. Moreover, the splicing aberrations would be another source for biomarker and even therapeutic target discovery. More information of splicing may also assist the better understanding of leukemogenesis.

RNA-Seq analysis identifies aberrant RNA splicing of TRIP12 in acute myeloid leukemia patients at remission.

PubMed

Gao, Panke; Jin, Zhen; Cheng, Yingying; Cao, Xiangshan

2014-10-01

Aberrant splicing events play important roles in the pathogenesis of acute myeloid leukemia (AML). To investigate the aberrant splicing events in AML during treatment, we carried out RNA sequencing in peripheral mononuclear cell samples from a patient with complete remission. In addition to the sequencing samples, selected splicing events were confirmed and validated with real-time quantitative RT-PCR in another seven pairs of samples. A total of 4.05 and 3.39 GB clean data of the AML and remission sample were generated, respectively, and 2,223 differentially expressed genes (DEGs) were identified. Integrated with gene expression profiling on T cells from AML patients compared with healthy donors, 82 DEGs were also differentially expressed in AML CD4 T cells and CD8 T cells. Twenty-three alternative splicing events were considered to be confidential, and they were involved in many biological processes, such as RNA processing, cellular macromolecule catabolic process, and DNA binding process. An exon3-skipping event in TRIP12 was detected in patients at remission and further validated in another three independent samples. TRIP12 is an ubiquitin ligase of ARF, which suppresses aberrant cell growth by activating p53 responses. The exon3-skipping isoform of TRIP12 increased significantly after treatment. Our results may provide new understanding of AML, and the confirmed alternative splicing event of TRIP12 may be used as potential target for future investigations.

Nemaline myopathy and distal arthrogryposis associated with an autosomal recessive TNNT3 splice variant.

PubMed

Sandaradura, Sarah A; Bournazos, Adam; Mallawaarachchi, Amali; Cummings, Beryl B; Waddell, Leigh B; Jones, Kristi J; Troedson, Christopher; Sudarsanam, Annapurna; Nash, Benjamin M; Peters, Gregory B; Algar, Elizabeth M; MacArthur, Daniel G; North, Kathryn N; Brammah, Susan; Charlton, Amanda; Laing, Nigel G; Wilson, Meredith J; Davis, Mark R; Cooper, Sandra T

2018-03-01

A male neonate presented with severe weakness, hypotonia, contractures and congenital scoliosis. Skeletal muscle specimens showed marked atrophy and degeneration of fast fibers with striking nemaline rods and hypertrophy of slow fibers that were ultrastructurally normal. A neuromuscular gene panel identified a homozygous essential splice variant in TNNT3 (chr11:1956150G > A, NM_006757.3:c.681+1G > A). TNNT3 encodes skeletal troponin-T fast and is associated with autosomal dominant distal arthrogryposis. TNNT3 has not previously been associated with nemaline myopathy (NM), a rare congenital myopathy linked to defects in proteins associated with thin filament structure and regulation. cDNA studies confirmed pathogenic consequences of the splice variant, eliciting exon-skipping and intron retention events leading to a frameshift. Western blot showed deficiency of troponin-T fast protein with secondary loss of troponin-I fast . We establish a homozygous splice variant in TNNT3 as the likely cause of severe congenital NM with distal arthrogryposis, characterized by specific involvement of Type-2 fibers and deficiency of troponin-T fast . © 2017 Wiley Periodicals, Inc.

Functional understanding of the diverse exon-intron structures of human GPCR genes.

PubMed

Hammond, Dorothy A; Olman, Victor; Xu, Ying

2014-02-01

The GPCR genes have a variety of exon-intron structures even though their proteins are all structurally homologous. We have examined all human GPCR genes with at least two functional protein isoforms, totaling 199, aiming to gain an understanding of what may have contributed to the large diversity of the exon-intron structures of the GPCR genes. The 199 genes have a total of 808 known protein splicing isoforms with experimentally verified functions. Our analysis reveals that 1301 (80.6%) adjacent exon-exon pairs out of the total of 1,613 in the 199 genes have either exactly one exon skipped or the intron in-between retained in at least one of the 808 protein splicing isoforms. This observation has a statistical significance p-value of 2.051762 * e(-09), assuming that the observed splicing isoforms are independent of the exon-intron structures. Our interpretation of this observation is that the exon boundaries of the GPCR genes are not randomly determined; instead they may be selected to facilitate specific alternative splicing for functional purposes.

Systemic Delivery of Morpholinos to Skip Multiple Exons in a Dog Model of Duchenne Muscular Dystrophy.

PubMed

Maruyama, Rika; Echigoya, Yusuke; Caluseriu, Oana; Aoki, Yoshitsugu; Takeda, Shin'ichi; Yokota, Toshifumi

2017-01-01

Exon-skipping therapy is an emerging approach that uses synthetic DNA-like molecules called antisense oligonucleotides (AONs) to splice out frame-disrupting parts of mRNA, restore the reading frame, and produce truncated yet functional proteins. Multiple exon skipping utilizing a cocktail of AONs can theoretically treat 80-90% of patients with Duchenne muscular dystrophy (DMD). The success of multiple exon skipping by the systemic delivery of a cocktail of AONs called phosphorodiamidate morpholino oligomers (PMOs) in a DMD dog model has made a significant impact on the development of therapeutics for DMD, leading to clinical trials of PMO-based drugs. Here, we describe the systemic delivery of a cocktail of PMOs to skip multiple exons in dystrophic dogs and the evaluation of the efficacies and toxicity in vivo.

Alternative Splice in Alternative Lice.

PubMed

Tovar-Corona, Jaime M; Castillo-Morales, Atahualpa; Chen, Lu; Olds, Brett P; Clark, John M; Reynolds, Stuart E; Pittendrigh, Barry R; Feil, Edward J; Urrutia, Araxi O

2015-10-01

Genomic and transcriptomics analyses have revealed human head and body lice to be almost genetically identical; although con-specific, they nevertheless occupy distinct ecological niches and have differing feeding patterns. Most importantly, while head lice are not known to be vector competent, body lice can transmit three serious bacterial diseases; epidemictyphus, trench fever, and relapsing fever. In order to gain insights into the molecular bases for these differences, we analyzed alternative splicing (AS) using next-generation sequencing data for one strain of head lice and one strain of body lice. We identified a total of 3,598 AS events which were head or body lice specific. Exon skipping AS events were overrepresented among both head and body lice, whereas intron retention events were underrepresented in both. However, both the enrichment of exon skipping and the underrepresentation of intron retention are significantly stronger in body lice compared with head lice. Genes containing body louse-specific AS events were found to be significantly enriched for functions associated with development of the nervous system, salivary gland, trachea, and ovarian follicle cells, as well as regulation of transcription. In contrast, no functional categories were overrepresented among genes with head louse-specific AS events. Together, our results constitute the first evidence for transcript pool differences in head and body lice, providing insights into molecular adaptations that enabled human lice to adapt to clothing, and representing a powerful illustration of the pivotal role AS can play in functional adaptation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

TSUNAMI: an antisense method to phenocopy splicing-associated diseases in animals

PubMed Central

Sahashi, Kentaro; Hua, Yimin; Ling, Karen K.Y.; Hung, Gene; Rigo, Frank; Horev, Guy; Katsuno, Masahisa; Sobue, Gen; Ko, Chien-Ping; Bennett, C. Frank; Krainer, Adrian R.

2012-01-01

Antisense oligonucleotides (ASOs) are versatile molecules that can be designed to specifically alter splicing patterns of target pre-mRNAs. Here we exploit this feature to phenocopy a genetic disease. Spinal muscular atrophy (SMA) is a motor neuron disease caused by loss-of-function mutations in the SMN1 gene. The related SMN2 gene expresses suboptimal levels of functional SMN protein due to alternative splicing that skips exon 7; correcting this defect—e.g., with ASOs—is a promising therapeutic approach. We describe the use of ASOs that exacerbate SMN2 missplicing and phenocopy SMA in a dose-dependent manner when administered to transgenic Smn−/− mice. Intracerebroventricular ASO injection in neonatal mice recapitulates SMA-like progressive motor dysfunction, growth impairment, and shortened life span, with α-motor neuron loss and abnormal neuromuscular junctions. These SMA-like phenotypes are prevented by a therapeutic ASO that restores correct SMN2 splicing. We uncovered starvation-induced splicing changes, particularly in SMN2, which likely accelerate disease progression. These results constitute proof of principle that ASOs designed to cause sustained splicing defects can be used to induce pathogenesis and rapidly and accurately model splicing-associated diseases in animals. This approach allows the dissection of pathogenesis mechanisms, including spatial and temporal features of disease onset and progression, as well as testing of candidate therapeutics. PMID:22895255

Functions for fission yeast splicing factors SpSlu7 and SpPrp18 in alternative splice-site choice and stress-specific regulated splicing.

PubMed

Melangath, Geetha; Sen, Titash; Kumar, Rakesh; Bawa, Pushpinder; Srinivasan, Subha; Vijayraghavan, Usha

2017-01-01

Budding yeast spliceosomal factors ScSlu7 and ScPrp18 interact and mediate intron 3'ss choice during second step pre-mRNA splicing. The fission yeast genome with abundant multi-intronic transcripts, degenerate splice signals and SR proteins is an apt unicellular fungal model to deduce roles for core spliceosomal factors in alternative splice-site choice, intron retention and to study the cellular implications of regulated splicing. From our custom microarray data we deduce a stringent reproducible subset of S. pombe alternative events. We examined the role of factors SpSlu7 or SpPrp18 for these splice events and investigated the relationship to growth phase and stress. Wild-type log and stationary phase cells showed ats1+ exon 3 skipped and intron 3 retained transcripts. Interestingly the non-consensus 5'ss in ats1+ intron 3 caused SpSlu7 and SpPrp18 dependent intron retention. We validated the use of an alternative 5'ss in dtd1+ intron 1 and of an upstream alternative 3'ss in DUF3074 intron 1. The dtd1+ intron 1 non-canonical 5'ss yielded an alternative mRNA whose levels increased in stationary phase. Utilization of dtd1+ intron 1 sub-optimal 5' ss required functional SpPrp18 and SpSlu7 while compromise in SpSlu7 function alone hampered the selection of the DUF3074 intron 1 non canonical 3'ss. We analysed the relative abundance of these splice isoforms during mild thermal, oxidative and heavy metal stress and found stress-specific splice patterns for ats1+ and DUF3074 intron 1 some of which were SpSlu7 and SpPrp18 dependent. By studying ats1+ splice isoforms during compromised transcription elongation rates in wild-type, spslu7-2 and spprp18-5 mutant cells we found dynamic and intron context-specific effects in splice-site choice. Our work thus shows the combinatorial effects of splice site strength, core splicing factor functions and transcription elongation kinetics to dictate alternative splice patterns which in turn serve as an additional recourse of gene regulation in fission yeast.

Functions for fission yeast splicing factors SpSlu7 and SpPrp18 in alternative splice-site choice and stress-specific regulated splicing

PubMed Central

Kumar, Rakesh; Bawa, Pushpinder; Srinivasan, Subha

2017-01-01

Budding yeast spliceosomal factors ScSlu7 and ScPrp18 interact and mediate intron 3’ss choice during second step pre-mRNA splicing. The fission yeast genome with abundant multi-intronic transcripts, degenerate splice signals and SR proteins is an apt unicellular fungal model to deduce roles for core spliceosomal factors in alternative splice-site choice, intron retention and to study the cellular implications of regulated splicing. From our custom microarray data we deduce a stringent reproducible subset of S. pombe alternative events. We examined the role of factors SpSlu7 or SpPrp18 for these splice events and investigated the relationship to growth phase and stress. Wild-type log and stationary phase cells showed ats1+ exon 3 skipped and intron 3 retained transcripts. Interestingly the non-consensus 5’ss in ats1+ intron 3 caused SpSlu7 and SpPrp18 dependent intron retention. We validated the use of an alternative 5’ss in dtd1+ intron 1 and of an upstream alternative 3’ss in DUF3074 intron 1. The dtd1+ intron 1 non-canonical 5’ss yielded an alternative mRNA whose levels increased in stationary phase. Utilization of dtd1+ intron 1 sub-optimal 5’ ss required functional SpPrp18 and SpSlu7 while compromise in SpSlu7 function alone hampered the selection of the DUF3074 intron 1 non canonical 3’ss. We analysed the relative abundance of these splice isoforms during mild thermal, oxidative and heavy metal stress and found stress-specific splice patterns for ats1+ and DUF3074 intron 1 some of which were SpSlu7 and SpPrp18 dependent. By studying ats1+ splice isoforms during compromised transcription elongation rates in wild-type, spslu7-2 and spprp18-5 mutant cells we found dynamic and intron context-specific effects in splice-site choice. Our work thus shows the combinatorial effects of splice site strength, core splicing factor functions and transcription elongation kinetics to dictate alternative splice patterns which in turn serve as an additional recourse of gene regulation in fission yeast. PMID:29236736

Alternative splicing of mutually exclusive exons--a review.

PubMed

Pohl, Martin; Bortfeldt, Ralf H; Grützmann, Konrad; Schuster, Stefan

2013-10-01

Alternative splicing (AS) of pre-mRNAs in higher eukaryotes and several viruses is one major source of protein diversity. Usually, the following major subtypes of AS are distinguished: exon skipping, intron retention, and alternative 3' and 5' splice sites. Moreover, mutually exclusive exons (MXEs) represent a rare subtype. In the splicing of MXEs, two (or more) splicing events are not independent anymore, but are executed or disabled in a coordinated manner. In this review, several bioinformatics approaches for analyzing MXEs are presented and discussed. In particular, we revisit suitable definitions and nomenclatures, and bioinformatics tools for finding MXEs, adjacent and non-adjacent MXEs, clustered and grouped MXEs. Moreover, the molecular mechanisms for splicing MXEs proposed in the literature are reviewed and discussed. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Deciphering Transcriptome and Complex Alternative Splicing Transcripts in Mammary Gland Tissues from Cows Naturally Infected with Staphylococcus aureus Mastitis

PubMed Central

Jiang, Qiang; Yang, Chun Hong; Zhang, Yan; Sun, Yan; Li, Rong Ling; Wang, Chang Fa; Zhong, Ji Feng; Huang, Jin Ming

2016-01-01

Alternative splicing (AS) contributes to the complexity of the mammalian proteome and plays an important role in diseases, including infectious diseases. The differential AS patterns of these transcript sequences between the healthy (HS3A) and mastitic (HS8A) cows naturally infected by Staphylococcus aureus were compared to understand the molecular mechanisms underlying mastitis resistance and susceptibility. In this study, using the Illumina paired-end RNA sequencing method, 1352 differentially expressed genes (DEGs) with higher than twofold changes were found in the HS3A and HS8A mammary gland tissues. Gene ontology and KEGG pathway analyses revealed that the cytokine–cytokine receptor interaction pathway is the most significantly enriched pathway. Approximately 16k annotated unigenes were respectively identified in two libraries, based on the bovine Bos taurus UMD3.1 sequence assembly and search. A total of 52.62% and 51.24% annotated unigenes were alternatively spliced in term of exon skipping, intron retention, alternative 5′ splicing and alternative 3ʹ splicing. Additionally, 1,317 AS unigenes were HS3A-specific, whereas 1,093 AS unigenes were HS8A-specific. Some immune-related genes, such as ITGB6, MYD88, ADA, ACKR1, and TNFRSF1B, and their potential relationships with mastitis were highlighted. From Chromosome 2, 4, 6, 7, 10, 13, 14, 17, and 20, 3.66% (HS3A) and 5.4% (HS8A) novel transcripts, which harbor known quantitative trait locus associated with clinical mastitis, were identified. Many DEGs in the healthy and mastitic mammary glands are involved in immune, defense, and inflammation responses. These DEGs, which exhibit diverse and specific splicing patterns and events, can endow dairy cattle with the potential complex genetic resistance against mastitis. PMID:27459697

Diverse functions of myosin VI elucidated by an isoform-specific α-helix domain

PubMed Central

Magistrati, Elisa; Molteni, Erika; Lupia, Michela; Soffientini, Paolo; Rottner, Klemens; Cavallaro, Ugo; Pozzoli, Uberto; Mapelli, Marina; Walters, Kylie J.; Polo, Simona

2016-01-01

Myosin VI functions in endocytosis and cell motility. Alternative splicing of myosin VI mRNA generates two distinct isoform types, myosin VIshort and myosin VIlong, which differ in the C-terminal region. Their physiological and pathological role remains unknown. Here we identified an isoform-specific regulatory helix, named α2-linker that defines specific conformations and hence determines the target selectivity of human myosin VI. The presence of the α2-linker structurally defines a novel clathrin-binding domain that is unique to myosin VIlong and masks the known RRL interaction motif. This finding is relevant to ovarian cancer, where alternative myosin VI splicing is aberrantly regulated, and exon skipping dictates cell addiction to myosin VIshort for tumor cell migration. The RRL interactor optineurin contributes to this process by selectively binding myosin VIshort. Thus the α2-linker acts like a molecular switch that assigns myosin VI to distinct endocytic (myosin VIlong) or migratory (myosin VIshort) functional roles. PMID:26950368

Diverse functions of myosin VI elucidated by an isoform-specific α-helix domain.

PubMed

Wollscheid, Hans-Peter; Biancospino, Matteo; He, Fahu; Magistrati, Elisa; Molteni, Erika; Lupia, Michela; Soffientini, Paolo; Rottner, Klemens; Cavallaro, Ugo; Pozzoli, Uberto; Mapelli, Marina; Walters, Kylie J; Polo, Simona

2016-04-01

Myosin VI functions in endocytosis and cell motility. Alternative splicing of myosin VI mRNA generates two distinct isoform types, myosin VI(short) and myosin VI(long), which differ in the C-terminal region. Their physiological and pathological roles remain unknown. Here we identified an isoform-specific regulatory helix, named the α2-linker, that defines specific conformations and hence determines the target selectivity of human myosin VI. The presence of the α2-linker structurally defines a new clathrin-binding domain that is unique to myosin VI(long) and masks the known RRL interaction motif. This finding is relevant to ovarian cancer, in which alternative myosin VI splicing is aberrantly regulated, and exon skipping dictates cell addiction to myosin VI(short) in tumor-cell migration. The RRL interactor optineurin contributes to this process by selectively binding myosin VI(short). Thus, the α2-linker acts like a molecular switch that assigns myosin VI to distinct endocytic (myosin VI(long)) or migratory (myosin VI(short)) functional roles.

Human DBR1 modulates the recycling of snRNPs to affect alternative RNA splicing and contributes to the suppression of cancer development.

PubMed

Han, B; Park, H K; Ching, T; Panneerselvam, J; Wang, H; Shen, Y; Zhang, J; Li, L; Che, R; Garmire, L; Fei, P

2017-09-21

The contribution of RNA processing to tumorigenesis is understudied. Here, we report that the human RNA debranching enzyme (hDBR1), when inappropriately regulated, induces oncogenesis by causing RNA processing defects, for example, splicing defects. We found that wild-type p53 and hypoxia-inducible factor 1 co-regulate hDBR1 expression, and insufficient hDBR1 leads to a higher rate of exon skipping. Transcriptomic sequencing confirmed the effect of hDBR1 on RNA splicing, and metabolite profiling supported the observation that neoplasm is triggered by a decrease in hDBR1 expression both in vitro and in vivo. Most importantly, when modulating the expression of hDBR1, which was found to be generally low in malignant human tissues, higher expression of hDBR1 only affected exon-skipping activity in malignant cells. Together, our findings demonstrate previously unrecognized regulation and functions of hDBR1, with immediate clinical implications regarding the regulation of hDBR1 as an effective strategy for combating human cancer.

In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

PubMed Central

Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

2015-01-01

The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.; Deschenes, S.

We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exonmore » 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.« less

Splice junction mutations at the Menkes locus that maintain some proper splicing are associated with milder clinical phenotypes, including typical occipital horn syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaler, S.G.; Gahl, W.A.

1994-09-01

Menkes disease is an X linked recessive disorder of copper metabolism produced by abnormalities in a gene that encodes a copper transporting ATPase. The clinical spectrum of Menkes disease includes a range of neurological severity from the classical type to the occipital horn syndrome (OHS) in which slightly subnormal intelligence or signs of autonomic dysfunction are the only neurologic abnormalities. We previously documented a distinctive, less severe Menkes phenotype associated with a +3 intronic splice donor mutation at the 3{prime} end of the gene in which exon skipping occurred but some normally spliced message was also detectable. We now reportmore » a similar splicing mutation in a patient with a typical OHS phenotype an A to G transition at the 2 exonic position of a splice donor site in the middle of the Menkes coding sequence. Some normally sized transcripts are evident by RT-PCR of lymphoblast mRNA from this individual, as well as 2 truncated fragments generated by exon skipping and activation of a cryptic splice acceptor site, respectively. The predicted effect of the mutation on the gene product involves a serine to glycine substitution in a noncritical region of the Menkes ATPase from the patient`s normally sized message, and premature termination due to translational frameshift in both truncated transcripts. The mutation eliminates a Dde 1 restriction site in the gene which provided a method to rapidly screen other family members, and revealed that the patient`s mother is a non-carrier. The mutational base change was not present in 25 normal X chromosomes studied. Preliminary analysis of the Menkes locus in 5 other Menkes disease families indicates aberrant mRNA splicing in 2. Our findings confirm allelism at the Menkes locus, indicate that splice mutations are relatively common mutational event in Menkes disease, and suggest that splice mutations in which some normal splicing is preserved may underlie milder Menkes disease variants, including OHS.« less

Assessing the residual CFTR gene expression in human nasal epithelium cells bearing CFTR splicing mutations causing cystic fibrosis

PubMed Central

Masvidal, Laia; Igreja, Susana; Ramos, Maria D; Alvarez, Antoni; de Gracia, Javier; Ramalho, Anabela; Amaral, Margarida D; Larriba, Sara; Casals, Teresa

2014-01-01

The major purpose of the present study was to quantify correctly spliced CFTR transcripts in human nasal epithelial cells from cystic fibrosis (CF) patients carrying the splicing mutations c.580-1G>T (712-1G>T) and c.2657+5G>A (2789+5G>A) and to assess the applicability of this model in CFTR therapeutic approaches. We performed the relative quantification of CFTR mRNA by reverse transcription quantitative PCR (RT-qPCR) of these splicing mutations in four groups (wild type, CF-F508del controls, CF patients and CF carriers) of individuals. In addition, in vitro assays using minigene constructs were performed to evaluate the effect of a new CF complex allele c.[2657+5G>A; 2562T>G]. Ex vivo qPCR data show that the primary consequence of both mutations at the RNA level is the skipping of their neighboring exon (6 and 16, respectively). The CFTR minigenes results mimicked the ex vivo data, as exon 16 skipping is the main aberrant transcript, and the correctly spliced transcript level was observed in a similar proportion when the c.2657+5G>A mutation is present. In summary, we provide evidence that ex vivo quantitative transcripts analysis using RT/qPCR is a robust technology that could be useful for measuring the efficacy of therapeutic approaches that attempt to achieve an increase in CFTR gene expression. PMID:24129438

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alvarez, Enrique, E-mail: ealvarez@cbm.uam.es; Castello, Alfredo; Carrasco, Luis

Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of proteasemore » fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.« less

X-linked Alport syndrome caused by splicing mutations in COL4A5.

PubMed

Nozu, Kandai; Vorechovsky, Igor; Kaito, Hiroshi; Fu, Xue Jun; Nakanishi, Koichi; Hashimura, Yuya; Hashimoto, Fusako; Kamei, Koichi; Ito, Shuichi; Kaku, Yoshitsugu; Imasawa, Toshiyuki; Ushijima, Katsumi; Shimizu, Junya; Makita, Yoshio; Konomoto, Takao; Yoshikawa, Norishige; Iijima, Kazumoto

2014-11-07

X-linked Alport syndrome is caused by mutations in the COL4A5 gene. Although many COL4A5 mutations have been detected, the mutation detection rate has been unsatisfactory. Some men with X-linked Alport syndrome show a relatively mild phenotype, but molecular basis investigations have rarely been conducted to clarify the underlying mechanism. In total, 152 patients with X-linked Alport syndrome who were suspected of having Alport syndrome through clinical and pathologic investigations and referred to the hospital for mutational analysis between January of 2006 and January of 2013 were genetically diagnosed. Among those patients, 22 patients had suspected splice site mutations. Transcripts are routinely examined when suspected splice site mutations for abnormal transcripts are detected; 11 of them showed expected exon skipping, but others showed aberrant splicing patterns. The mutation detection strategy had two steps: (1) genomic DNA analysis using PCR and direct sequencing and (2) mRNA analysis using RT-PCR to detect RNA processing abnormalities. Six splicing consensus site mutations resulting in aberrant splicing patterns, one exonic mutation leading to exon skipping, and four deep intronic mutations producing cryptic splice site activation were identified. Interestingly, one case produced a cryptic splice site with a single nucleotide substitution in the deep intron that led to intronic exonization containing a stop codon; however, the patient showed a clearly milder phenotype for X-linked Alport syndrome in men with a truncating mutation. mRNA extracted from the kidney showed both normal and abnormal transcripts, with the normal transcript resulting in the milder phenotype. This novel mechanism leads to mild clinical characteristics. This report highlights the importance of analyzing transcripts to enhance the mutation detection rate and provides insight into genotype-phenotype correlations. This approach can clarify the cause of atypically mild phenotypes in X-linked Alport syndrome. Copyright © 2014 by the American Society of Nephrology.

Altered Splicing of the BIN1 Muscle-Specific Exon in Humans and Dogs with Highly Progressive Centronuclear Myopathy

PubMed Central

Böhm, Johann; Vasli, Nasim; Maurer, Marie; Cowling, Belinda; Shelton, G. Diane; Kress, Wolfram; Toussaint, Anne; Prokic, Ivana; Schara, Ulrike; Anderson, Thomas James; Weis, Joachim; Tiret, Laurent; Laporte, Jocelyn

2013-01-01

Amphiphysin 2, encoded by BIN1, is a key factor for membrane sensing and remodelling in different cell types. Homozygous BIN1 mutations in ubiquitously expressed exons are associated with autosomal recessive centronuclear myopathy (CNM), a mildly progressive muscle disorder typically showing abnormal nuclear centralization on biopsies. In addition, misregulation of BIN1 splicing partially accounts for the muscle defects in myotonic dystrophy (DM). However, the muscle-specific function of amphiphysin 2 and its pathogenicity in both muscle disorders are not well understood. In this study we identified and characterized the first mutation affecting the splicing of the muscle-specific BIN1 exon 11 in a consanguineous family with rapidly progressive and ultimately fatal centronuclear myopathy. In parallel, we discovered a mutation in the same BIN1 exon 11 acceptor splice site as the genetic cause of the canine Inherited Myopathy of Great Danes (IMGD). Analysis of RNA from patient muscle demonstrated complete skipping of exon 11 and BIN1 constructs without exon 11 were unable to promote membrane tubulation in differentiated myotubes. Comparative immunofluorescence and ultrastructural analyses of patient and canine biopsies revealed common structural defects, emphasizing the importance of amphiphysin 2 in membrane remodelling and maintenance of the skeletal muscle triad. Our data demonstrate that the alteration of the muscle-specific function of amphiphysin 2 is a common pathomechanism for centronuclear myopathy, myotonic dystrophy, and IMGD. The IMGD dog is the first faithful model for human BIN1-related CNM and represents a mammalian model available for preclinical trials of potential therapies. PMID:23754947

Basal exon skipping and nonsense-associated altered splicing allows bypassing complete CEP290 loss-of-function in individuals with unusually mild retinal disease.

PubMed

Barny, Iris; Perrault, Isabelle; Michel, Christel; Soussan, Mickael; Goudin, Nicolas; Rio, Marlène; Thomas, Sophie; Attié-Bitach, Tania; Hamel, Christian; Dollfus, Hélène; Kaplan, Josseline; Rozet, Jean-Michel; Gerard, Xavier

2018-05-16

CEP290 mutations cause a spectrum of ciliopathies from Leber congenital amaurosis type 10 (LCA10) to embryo-lethal Meckel syndrome (MKS). Using panel-based molecular diagnosis testing for inherited retinal diseases, we identified two individuals with some preserved vision despite biallelism for presumably truncating CEP290 mutations. The first one carried a homozygous 1 base-pair deletion in exon 17, introducing a premature termination codon (PTC) in exon 18 (c.1666del; p.Ile556Phefs*17). mRNA analysis revealed a basal exon skipping (BES) of exon 18, providing mutant cells with the ability to escape protein truncation, while disrupting the reading frame in controls. The second individual harbored compound heterozygous nonsense mutations in exon 8 (c.508A>T, p.Lys170*) and exon 32 (c.4090G>T, p.Glu1364*), respectively. Some CEP290 lacking exon 8 were detected in mutant fibroblasts but not in controls whereas some skipping of exon 32 occurred in both lines, but with higher amplitude in the mutant. Considering that the deletion of either exon maintains the reading frame in either line, skipping in mutant cells likely involves nonsense-associated altered splicing (NAS) alone (exon 8), or with BES (exon 32). Skipping of PTC-containing exons in mutant cells allowed production of CEP290 isoforms with preserved ability to assemble into a high molecular weight complex and to interact efficiently with proteins important for cilia formation and intraflagellar trafficking. In contrast, studying LCA10 and MKS fibroblasts we show moderate to severe cilia alterations, providing support for a correlation between disease severity and the ability of cells to express shortened, yet functional, CEP290 isoforms.

Efficient exon skipping of SGCG mutations mediated by phosphorodiamidate morpholino oligomers.

PubMed

Wyatt, Eugene J; Demonbreun, Alexis R; Kim, Ellis Y; Puckelwartz, Megan J; Vo, Andy H; Dellefave-Castillo, Lisa M; Gao, Quan Q; Vainzof, Mariz; Pavanello, Rita C M; Zatz, Mayana; McNally, Elizabeth M

2018-05-03

Exon skipping uses chemically modified antisense oligonucleotides to modulate RNA splicing. Therapeutically, exon skipping can bypass mutations and restore reading frame disruption by generating internally truncated, functional proteins to rescue the loss of native gene expression. Limb-girdle muscular dystrophy type 2C is caused by autosomal recessive mutations in the SGCG gene, which encodes the dystrophin-associated protein γ-sarcoglycan. The most common SGCG mutations disrupt the transcript reading frame abrogating γ-sarcoglycan protein expression. In order to treat most SGCG gene mutations, it is necessary to skip 4 exons in order to restore the SGCG transcript reading frame, creating an internally truncated protein referred to as Mini-Gamma. Using direct reprogramming of human cells with MyoD, myogenic cells were tested with 2 antisense oligonucleotide chemistries, 2'-O-methyl phosphorothioate oligonucleotides and vivo-phosphorodiamidate morpholino oligomers, to induce exon skipping. Treatment with vivo-phosphorodiamidate morpholino oligomers demonstrated efficient skipping of the targeted exons and corrected the mutant reading frame, resulting in the expression of a functional Mini-Gamma protein. Antisense-induced exon skipping of SGCG occurred in normal cells and those with multiple distinct SGCG mutations, including the most common 521ΔT mutation. These findings demonstrate a multiexon-skipping strategy applicable to the majority of limb-girdle muscular dystrophy 2C patients.

A splicing mutation in Aryl Hydrocarbon Receptor associated with retinitis pigmentosa.

PubMed

Zhou, Yu; Li, Shijin; Huang, Lulin; Yang, Yeming; Zhang, Lin; Yang, Mu; Liu, Wenjing; Ramasamy, Kim; Jiang, Zhilin; Sundaresan, Periasamy; Zhu, Xianjun; Yang, Zhenglin

2018-05-02

Retinitis pigmentosa (RP) refers to a group of retinal degenerative diseases, which often lead to vision loss. Although 70 genes have been identified in RP patients, the genetic cause of approximately 30% of RP cases remains unknown. We aimed to identify the cause of the disease in a cohort of RP families by whole exome sequencing. A rare homozygous splicing variant, c.1160 + 1G>A, which introduced skipping of exon 9 of the aryl hydrocarbon receptor (AHR), was identified in family RD-134. This variant is very rare in several exome databases and leads to skipping of exon 9 in the transcript. AHR is expressed in the human retina and is a ligand-activated transcription factor with multiple functions. Mutant AHR failed to promote 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced Xenobiotic Responsive Element (XRE) luciferase activity. In parallel, mutation in AHR abolished activation of its downstream target gene, such as CYP1A1 and CYP1A2. To investigate the in vivo roles of Ahr in the retina, we generated a retina-specific conditional knockout mouse model of Ahr. Comparing with wildtype mouse, Ahr knockout mice exhibited reduced electroretinogram responses at 9 months of age. Retinal histology revealed Retinal histology showed the degeneration of photoreceptors with a thinner outer nuclear layer. Thus, our data demonstrate that AHR is associated with RP.

Genetic diagnosis of familial hypercholesterolaemia: the importance of functional analysis of potential splice-site mutations.

PubMed

Bourbon, M; Duarte, M A; Alves, A C; Medeiros, A M; Marques, L; Soutar, A K

2009-05-01

Familial hypercholesterolemia (FH) results from defective low-density lipoprotein receptor (LDLR) activity, mainly due to LDLR gene defects. Of the many different LDLR mutations found in patients with FH, about 6% of single base substitutions are located near or within introns, and are predicted to result in exon skipping, retention of an intron, or activation of cryptic sites during mRNA splicing. This paper reports on the Portuguese FH Study, which found 10 such mutations, 6 of them novel. For the mutations that have not been described before or those whose effect on function have not been analysed, their effect on splicing was investigated, using reverse transcriptase PCR analysis of LDLR mRNA from freshly isolated blood mononuclear cells. Two of these variants (c.313+6 T-->C, c.2389G-->T (p.V776L)) caused exon skipping, and one caused retention of an intron (c.1359-5C-->G), whereas two others (c.2140+5 G-->A and c.1061-8T-->C) had no apparent effect. Any effect of c.1185G-->C (p.V374V) on splicing could not be determined because it was on an allele with a promoter mutation (-42C-->G) that was probably not transcribed. Variants in four patients lost to follow-up could not be tested experimentally, but they almost certainly affect splicing because they disrupt the invariant AG or GT in acceptor (c.818-2A-->G) or donor (c.1060+1G-->A, c.1845+1delG and c.2547+1G-->A) spice sites. These findings emphasise that care must be taken before reporting the presence or absence of a splice-site mutation in the LDLR gene for diagnostic purposes. The study also shows that relatively simple, quick and inexpensive RNA assays can evaluate putative splicing mutations that are not always predictable by available software, thereby reducing genetic misdiagnosis of patients with FH.

Functioning of the Drosophila Wilms'-Tumor-1-Associated Protein Homolog, Fl(2)d, in Sex-Lethal-Dependent Alternative Splicing

PubMed Central

Penn, Jill K. M.; Graham, Patricia; Deshpande, Girish; Calhoun, Gretchen; Chaouki, Ahmad Sami; Salz, Helen K.; Schedl, Paul

2008-01-01

fl(2)d, the Drosophila homolog of Wilms'-tumor-1-associated protein (WTAP), regulates the alternative splicing of Sex-lethal (Sxl), transformer (tra), and Ultrabithorax (Ubx). Although WTAP has been found in functional human spliceosomes, exactly how it contributes to the splicing process remains unknown. Here we attempt to identify factors that interact genetically and physically with fl(2)d. We begin by analyzing the Sxl-Fl(2)d protein–protein interaction in detail and present evidence suggesting that the female-specific fl(2)d1 allele is antimorphic with respect to the process of sex determination. Next we show that fl(2)d interacts genetically with early acting general splicing regulators and that Fl(2)d is present in immunoprecipitable complexes with Snf, U2AF50, U2AF38, and U1-70K. By contrast, we could not detect Fl(2)d complexes containing the U5 snRNP protein U5-40K or with a protein that associates with the activated B spliceosomal complex SKIP. Significantly, the genetic and molecular interactions observed for Sxl are quite similar to those detected for fl(2)d. Taken together, our findings suggest that Sxl and fl(2)d function to alter splice-site selection at an early step in spliceosome assembly. PMID:18245840

Systematic profiling of alternative splicing signature reveals prognostic predictor for ovarian cancer.

PubMed

Zhu, Junyong; Chen, Zuhua; Yong, Lei

2018-02-01

The majority of genes are alternatively spliced and growing evidence suggests that alternative splicing is modified in cancer and is associated with cancer progression. Systematic analysis of alternative splicing signature in ovarian cancer is lacking and greatly needed. We profiled genome-wide alternative splicing events in 408 ovarian serous cystadenocarcinoma (OV) patients in TCGA. Seven types of alternative splicing events were curated and prognostic analyses were performed with predictive models and splicing network built for OV patients. Among 48,049 mRNA splicing events in 10,582 genes, we detected 2,611 alternative splicing events in 2,036 genes which were significant associated with overall survival of OV patients. Exon skip events were the most powerful prognostic factors among the seven types. The area under the curve of the receiver-operator characteristic curve for prognostic predictor, which was built with top significant alternative splicing events, was 0.937 at 2,000 days of overall survival, indicating powerful efficiency in distinguishing patient outcome. Interestingly, splicing correlation network suggested obvious trends in the role of splicing factors in OV. In summary, we built powerful prognostic predictors for OV patients and uncovered interesting splicing networks which could be underlying mechanisms. Copyright © 2017 Elsevier Inc. All rights reserved.

SAM68 is a physiological regulator of SMN2 splicing in spinal muscular atrophy

PubMed Central

Pagliarini, Vittoria; Pelosi, Laura; Bustamante, Maria Blaire; Nobili, Annalisa; Berardinelli, Maria Grazia; D’Amelio, Marcello; Musarò, Antonio

2015-01-01

Spinal muscular atrophy (SMA) is a neurodegenerative disease caused by loss of motor neurons in patients with null mutations in the SMN1 gene. The almost identical SMN2 gene is unable to compensate for this deficiency because of the skipping of exon 7 during pre–messenger RNA (mRNA) processing. Although several splicing factors can modulate SMN2 splicing in vitro, the physiological regulators of this disease-causing event are unknown. We found that knockout of the splicing factor SAM68 partially rescued body weight and viability of SMAΔ7 mice. Ablation of SAM68 function promoted SMN2 splicing and expression in SMAΔ7 mice, correlating with amelioration of SMA-related defects in motor neurons and skeletal muscles. Mechanistically, SAM68 binds to SMN2 pre-mRNA, favoring recruitment of the splicing repressor hnRNP A1 and interfering with that of U2AF65 at the 3′ splice site of exon 7. These findings identify SAM68 as the first physiological regulator of SMN2 splicing in an SMA mouse model. PMID:26438828

Widespread alternative and aberrant splicing revealed by lariat sequencing

PubMed Central

Stepankiw, Nicholas; Raghavan, Madhura; Fogarty, Elizabeth A.; Grimson, Andrew; Pleiss, Jeffrey A.

2015-01-01

Alternative splicing is an important and ancient feature of eukaryotic gene structure, the existence of which has likely facilitated eukaryotic proteome expansions. Here, we have used intron lariat sequencing to generate a comprehensive profile of splicing events in Schizosaccharomyces pombe, amongst the simplest organisms that possess mammalian-like splice site degeneracy. We reveal an unprecedented level of alternative splicing, including alternative splice site selection for over half of all annotated introns, hundreds of novel exon-skipping events, and thousands of novel introns. Moreover, the frequency of these events is far higher than previous estimates, with alternative splice sites on average activated at ∼3% the rate of canonical sites. Although a subset of alternative sites are conserved in related species, implying functional potential, the majority are not detectably conserved. Interestingly, the rate of aberrant splicing is inversely related to expression level, with lowly expressed genes more prone to erroneous splicing. Although we validate many events with RNAseq, the proportion of alternative splicing discovered with lariat sequencing is far greater, a difference we attribute to preferential decay of aberrantly spliced transcripts. Together, these data suggest the spliceosome possesses far lower fidelity than previously appreciated, highlighting the potential contributions of alternative splicing in generating novel gene structures. PMID:26261211

Rare splicing defects of FAS underly severe recessive autoimmune lymphoproliferative syndrome.

PubMed

Agrebi, N; Ben-Mustapha, I; Matoussi, N; Dhouib, N; Ben-Ali, M; Mekki, N; Ben-Ahmed, M; Larguèche, B; Ben Becher, S; Béjaoui, M; Barbouche, M R

2017-10-01

Autoimmune lymphoproliferative syndrome (ALPS) is a prototypic disorder of impaired apoptosis characterized by autoimmune features and lymphoproliferation. Heterozygous germline or somatic FAS mutations associated with preserved protein expression have been described. Very rare cases of homozygous germline FAS mutations causing severe autosomal recessive form of ALPS with a complete defect of Fas expression have been reported. We report two unrelated patients from highly inbred North African population showing a severe ALPS phenotype and an undetectable Fas surface expression. Two novel homozygous mutations have been identified underlying rare splicing defects mechanisms. The first mutation breaks a branch point sequence and the second alters a regulatory exonic splicing site. These splicing defects induce the skipping of exon 6 encoding the transmembrane domain of CD95. Our findings highlight the requirement of tight regulation of FAS exon 6 splicing for balanced alternative splicing and illustrate the importance of such studies in highly consanguineous populations. Copyright © 2017 Elsevier Inc. All rights reserved.

Human Splicing Finder: an online bioinformatics tool to predict splicing signals.

PubMed

Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

2009-05-01

Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-beta Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5' and 3' splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project.

Human Splicing Finder: an online bioinformatics tool to predict splicing signals

PubMed Central

Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

2009-01-01

Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-β Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5′ and 3′ splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project. PMID:19339519

New lessons from an old gene: complex splicing and a novel cryptic exon in VHL gene cause erythrocytosis and VHL disease.

PubMed

Lenglet, Marion; Robriquet, Florence; Schwarz, Klaus; Camps, Carme; Couturier, Anne; Hoogewijs, David; Buffet, Alexandre; Knight, Samantha Jl; Gad, Sophie; Couvé, Sophie; Chesnel, Franck; Pacault, Mathilde; Lindenbaum, Pierre; Job, Sylvie; Dumont, Solenne; Besnard, Thomas; Cornec, Marine; Dreau, Helene; Pentony, Melissa; Kvikstad, Erika; Deveaux, Sophie; Burnichon, Nelly; Ferlicot, Sophie; Vilaine, Mathias; Mazzella, Jean-Michaël; Airaud, Fabrice; Garrec, Céline; Heidet, Laurence; Irtan, Sabine; Mantadakis, Elpis; Bouchireb, Karim; Debatin, Klaus-Michael; Redon, Richard; Bezieau, Stéphane; Bressac-de Paillerets, Brigitte; Teh, Bin Tean; Girodon, François; Randi, Maria-Luigia; Putti, Maria Caterina; Bours, Vincent; Van Wijk, Richard; Göthert, Joachim R; Kattamis, Antonis; Janin, Nicolas; Bento, Celeste; Taylor, Jenny C; Arlot-Bonnemains, Yannick; Richard, Stéphane; Gimenez-Roqueplo, Anne-Paule; Cario, Holger; Gardie, Betty

2018-06-11

Chuvash polycythemia is an autosomal recessive form of erythrocytosis associated with a homozygous p.Arg200Trp mutation in the von Hippel-Lindau (VHL) gene. Since this discovery, additional VHL mutations have been identified in patients with congenital erythrocytosis, in a homozygous or compound-heterozygous state. VHL is a major tumor suppressor gene, mutations in which were first described in patients presenting with von Hippel-Lindau disease, which is characterized by the development of highly vascularized tumors. Here, we identified a new VHL cryptic-exon (termed E1') deep in intron 1 that is naturally expressed in many tissues. More importantly, we identified mutations in E1' in seven families with erythrocytosis (one homozygous case and six compound-heterozygous cases with a mutation in E1' in addition to a mutation in VHL coding sequences) and in one large family with typical VHL disease but without any alteration in the other VHL exons. In this study we have shown that the mutations induced a dysregulation of the VHL splicing with excessive retention of E1' and are associated with a downregulation of VHL protein expression. In addition, we have demonstrated a pathogenic role for synonymous mutations in VHL-Exon 2 that alter splicing through E2-skipping in five families with erythrocytosis or VHL disease. In all the studied cases, the mutations differentially impact splicing, correlating with phenotype severity. This study demonstrates that cryptic-exon-retention or exon-skipping are new VHL alterations and reveals a novel complex splicing regulation of the VHL gene. These findings open new avenues for diagnosis and research into the VHL-related-hypoxia-signaling pathway. Copyright © 2018 American Society of Hematology.

Hereditary vitamin D resistant rickets: identification of a novel splice site mutation in the vitamin D receptor gene and successful treatment with oral calcium therapy.

PubMed

Ma, Nina S; Malloy, Peter J; Pitukcheewanont, Pisit; Dreimane, Daina; Geffner, Mitchell E; Feldman, David

2009-10-01

To study the vitamin D receptor (VDR) gene in a young girl with severe rickets and clinical features of hereditary vitamin D resistant rickets, including hypocalcemia, hypophosphatemia, partial alopecia, and elevated serum levels of 1,25-dihydroxyvitamin D. We amplified and sequenced DNA samples from blood from the patient, her mother, and the patient's two siblings. We also amplified and sequenced the VDR cDNA from RNA isolated from the patient's blood. DNA sequence analyses of the VDR gene showed that the patient was homozygous for a novel guanine to thymine substitution in the 5'-splice site in the exon 8-intron J junction. Analysis of the VDR cDNA using reverse transcriptase-polymerase chain reaction showed that exons 7 and 9 were fused, and that exon 8 was skipped. The mother was heterozygous for the mutation and the two siblings were unaffected. A novel splice site mutation was identified in the VDR gene that caused exon 8 to be skipped. The mutation deleted amino acids 303-341 in the VDR ligand-binding domain, which is expected to render the VDR non-functional. Nevertheless, successful outpatient treatment was achieved with frequent high doses of oral calcium.

ATP-binding cassette subfamily A, member 4 intronic variants c.4773+3A>G and c.5461-10T>C cause Stargardt disease due to defective splicing.

PubMed

Jonsson, Frida; Westin, Ida Maria; Österman, Lennart; Sandgren, Ola; Burstedt, Marie; Holmberg, Monica; Golovleva, Irina

2018-02-20

Inherited retinal dystrophies (IRDs) represent a group of progressive conditions affecting the retina. There is a great genetic heterogeneity causing IRDs, and to date, more than 260 genes are associated with IRDs. Stargardt disease, type 1 (STGD1) or macular degeneration with flecks, STGD1 represents a disease with early onset, central visual impairment, frequent appearance of yellowish flecks and mutations in the ATP-binding cassette subfamily A, member 4 (ABCA4) gene. A large number of intronic sequence variants in ABCA4 have been considered pathogenic although their functional effect was seldom demonstrated. In this study, we aimed to reveal how intronic variants present in patients with Stargardt from the same Swedish family affect splicing. The splicing of the ABCA4 gene was studied in human embryonic kidney cells, HEK293T, and in human retinal pigment epithelium cells, ARPE-19, using a minigene system containing variants c.4773+3A>G and c.5461-10T>C. We showed that both ABCA4 variants, c.4773+3A>G and c.5461-10T>C, cause aberrant splicing of the ABCA4 minigene resulting in exon skipping. We also demonstrated that splicing of ABCA4 has different outcomes depending on transfected cell type. Two intronic variants c.4773+3A>G and c.5461-10T>C, both predicted to affect splicing, are indeed disease-causing mutations due to skipping of exons 33, 34, 39 and 40 of ABCA4 gene. The experimental proof that ABCA4 mutations in STGD patients affect protein function is crucial for their inclusion to future clinical trials; therefore, functional testing of all ABCA4 intronic variants associated with Stargardt disease by minigene technology is desirable. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

Early Clinical Diagnosis of PC1/3 Deficiency in a Patient With a Novel Homozygous PCSK1 Splice-Site Mutation.

PubMed

Härter, Bettina; Fuchs, Irene; Müller, Thomas; Akbulut, Ulas Emre; Cakir, Murat; Janecke, Andreas R

2016-04-01

Autosomal recessive proprotein convertase 1/3 (PC1/3) deficiency, caused by mutations in the PCSK1 gene, is characterized by severe congenital malabsorptive diarrhea, early-onset obesity, and certain endocrine abnormalities. We suspected PC1/3 deficiency in a 4-month-old girl based on the presence of congenital diarrhea and polyuria. Sequencing the whole coding region and splice sites detected a novel homozygous PCSK1 splice-site mutation, c.544-2A>G, in the patient. The mutation resulted in the skipping of exon 5, the generation of a premature termination codon, and nonsense-mediated PCSK1 messenger ribonucleic acid decay, which was demonstrated in complementary DNA derived from fibroblasts.

Two-Exon Skipping within MLPH Is Associated with Coat Color Dilution in Rabbits

PubMed Central

Lehner, Stefanie; Gähle, Marion; Dierks, Claudia; Stelter, Ricarda; Gerber, Jonathan; Brehm, Ralph; Distl, Ottmar

2013-01-01

Coat color dilution turns black coat color to blue and red color to cream and is a characteristic in many mammalian species. Matings among Netherland Dwarf, Loh, and Lionhead Dwarf rabbits over two generations gave evidence for a monogenic autosomal recessive inheritance of coat colour dilution. Histological analyses showed non-uniformly distributed, large, agglomerating melanin granules in the hair bulbs of coat color diluted rabbits. We sequenced the cDNA of MLPH in two dilute and one black rabbit for polymorphism detection. In both color diluted rabbits, skipping of exons 3 and 4 was present resulting in altered amino acids at p.QGL[37-39]QWA and a premature stop codon at p.K40*. Sequencing of genomic DNA revealed a c.111-5C>A splice acceptor mutation within the polypyrimidine tract of intron 2 within MLPH. This mutation presumably causes skipping of exons 3 and 4. In 14/15 dilute rabbits, the c.111-5C>A mutation was homozygous and in a further dilute rabbit, heterozygous and in combination with a homozygous frame shift mutation within exon 6 (c.585delG). In conclusion, our results demonstrated a colour dilution associated MLPH splice variant causing a strongly truncated protein (p.Q37QfsX4). An involvement of further MLPH-associated mutations needs further investigations. PMID:24376820

STAR splicing mutations cause the severe phenotype of lipoid congenital adrenal hyperplasia: insights from a novel splice mutation and review of reported cases.

PubMed

Camats, Núria; Pandey, Amit V; Fernández-Cancio, Mónica; Fernández, Juan M; Ortega, Ana M; Udhane, Sameer; Andaluz, Pilar; Audí, Laura; Flück, Christa E

2014-02-01

The steroidogenic acute regulatory protein (StAR) transports cholesterol to the mitochondria for steroidogenesis. Loss of StAR function causes lipoid congenital adrenal hyperplasia (LCAH) which is characterized by impaired synthesis of adrenal and gonadal steroids causing adrenal insufficiency, 46,XY disorder of sex development (DSD) and failure of pubertal development. Partial loss of StAR activity may cause adrenal insufficiency only. A newborn girl was admitted for mild dehydration, hyponatremia, hyperkalemia and hypoglycaemia and had normal external female genitalia without hyperpigmentation. Plasma cortisol, 17OH-progesterone, DHEA-S, androstendione and aldosterone were low, while ACTH and plasma renin activity were elevated, consistent with the diagnosis of primary adrenal insufficiency. Imaging showed normal adrenals, and cytogenetics revealed a 46,XX karyotype. She was treated with fluids, hydrocortisone and fludrocortisone. Genetic studies revealed a novel homozygous STAR mutation in the 3' acceptor splice site of intron 4, c.466-1G>A (IVS4-1G>A). To test whether this mutation would affect splicing, we performed a minigene experiment with a plasmid construct containing wild-type or mutant StAR gDNA of exons-introns 4-6 in COS-1 cells. The splicing was assessed on total RNA using RT-PCR for STAR cDNAs. The mutant STAR minigene skipped exon 5 completely and changed the reading frame. Thus, it is predicted to produce an aberrant and shorter protein (p.V156GfsX19). Computational analysis revealed that this mutant protein lacks wild-type exons 5-7 which are essential for StAR-cholesterol interaction. STAR c.466-1A skips exon 5 and causes a dramatic change in the C-terminal sequence of the protein, which is essential for StAR-cholesterol interaction. This splicing mutation is a loss-of-function mutation explaining the severe phenotype of our patient. Thus far, all reported splicing mutations of STAR cause a severe impairment of protein function and phenotype. © 2013 John Wiley & Sons Ltd.

Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.

PubMed

Echigoya, Yusuke; Lim, Kenji Rowel Q; Trieu, Nhu; Bao, Bo; Miskew Nichols, Bailey; Vila, Maria Candida; Novak, James S; Hara, Yuko; Lee, Joshua; Touznik, Aleksander; Mamchaoui, Kamel; Aoki, Yoshitsugu; Takeda, Shin'ichi; Nagaraju, Kanneboyina; Mouly, Vincent; Maruyama, Rika; Duddy, William; Yokota, Toshifumi

2017-11-01

Duchenne muscular dystrophy (DMD), the most common lethal genetic disorder, is caused by mutations in the dystrophin (DMD) gene. Exon skipping is a therapeutic approach that uses antisense oligonucleotides (AOs) to modulate splicing and restore the reading frame, leading to truncated, yet functional protein expression. In 2016, the US Food and Drug Administration (FDA) conditionally approved the first phosphorodiamidate morpholino oligomer (morpholino)-based AO drug, eteplirsen, developed for DMD exon 51 skipping. Eteplirsen remains controversial with insufficient evidence of its therapeutic effect in patients. We recently developed an in silico tool to design antisense morpholino sequences for exon skipping. Here, we designed morpholino AOs targeting DMD exon 51 using the in silico tool and quantitatively evaluated the effects in immortalized DMD muscle cells in vitro. To our surprise, most of the newly designed morpholinos induced exon 51 skipping more efficiently compared with the eteplirsen sequence. The efficacy of exon 51 skipping and rescue of dystrophin protein expression were increased by up to more than 12-fold and 7-fold, respectively, compared with the eteplirsen sequence. Significant in vivo efficacy of the most effective morpholino, determined in vitro, was confirmed in mice carrying the human DMD gene. These findings underscore the importance of AO sequence optimization for exon skipping. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Stabilization of the μ-opioid receptor by truncated single transmembrane splice variants through a chaperone-like action.

PubMed

Xu, Jin; Xu, Ming; Brown, Taylor; Rossi, Grace C; Hurd, Yasmin L; Inturrisi, Charles E; Pasternak, Gavril W; Pan, Ying-Xian

2013-07-19

The μ-opioid receptor gene, OPRM1, undergoes extensive alternative pre-mRNA splicing, as illustrated by the identification of an array of splice variants generated by both 5' and 3' alternative splicing. The current study reports the identification of another set of splice variants conserved across species that are generated through exon skipping or insertion that encodes proteins containing only a single transmembrane (TM) domain. Using a Tet-Off system, we demonstrated that the truncated single TM variants can dimerize with the full-length 7-TM μ-opioid receptor (MOR-1) in the endoplasmic reticulum, leading to increased expression of MOR-1 at the protein level by a chaperone-like function that minimizes endoplasmic reticulum-associated degradation. In vivo antisense studies suggested that the single TM variants play an important role in morphine analgesia, presumably through modulation of receptor expression levels. Our studies suggest the functional roles of truncated receptors in other G protein-coupled receptor families.

Abnormal splicing switch of DMD's penultimate exon compromises muscle fibre maintenance in myotonic dystrophy.

PubMed

Rau, Frédérique; Lainé, Jeanne; Ramanoudjame, Laetitita; Ferry, Arnaud; Arandel, Ludovic; Delalande, Olivier; Jollet, Arnaud; Dingli, Florent; Lee, Kuang-Yung; Peccate, Cécile; Lorain, Stéphanie; Kabashi, Edor; Athanasopoulos, Takis; Koo, Taeyoung; Loew, Damarys; Swanson, Maurice S; Le Rumeur, Elisabeth; Dickson, George; Allamand, Valérie; Marie, Joëlle; Furling, Denis

2015-05-28

Myotonic Dystrophy type 1 (DM1) is a dominant neuromuscular disease caused by nuclear-retained RNAs containing expanded CUG repeats. These toxic RNAs alter the activities of RNA splicing factors resulting in alternative splicing misregulation and muscular dysfunction. Here we show that the abnormal splicing of DMD exon 78 found in dystrophic muscles of DM1 patients is due to the functional loss of MBNL1 and leads to the re-expression of an embryonic dystrophin in place of the adult isoform. Forced expression of embryonic dystrophin in zebrafish using an exon-skipping approach severely impairs the mobility and muscle architecture. Moreover, reproducing Dmd exon 78 missplicing switch in mice induces muscle fibre remodelling and ultrastructural abnormalities including ringed fibres, sarcoplasmic masses or Z-band disorganization, which are characteristic features of dystrophic DM1 skeletal muscles. Thus, we propose that splicing misregulation of DMD exon 78 compromises muscle fibre maintenance and contributes to the progressive dystrophic process in DM1.

Abnormal splicing switch of DMD's penultimate exon compromises muscle fibre maintenance in myotonic dystrophy

PubMed Central

Rau, Frédérique; Lainé, Jeanne; Ramanoudjame, Laetitita; Ferry, Arnaud; Arandel, Ludovic; Delalande, Olivier; Jollet, Arnaud; Dingli, Florent; Lee, Kuang-Yung; Peccate, Cécile; Lorain, Stéphanie; Kabashi, Edor; Athanasopoulos, Takis; Koo, Taeyoung; Loew, Damarys; Swanson, Maurice S.; Le Rumeur, Elisabeth; Dickson, George; Allamand, Valérie; Marie, Joëlle; Furling, Denis

2015-01-01

Myotonic Dystrophy type 1 (DM1) is a dominant neuromuscular disease caused by nuclear-retained RNAs containing expanded CUG repeats. These toxic RNAs alter the activities of RNA splicing factors resulting in alternative splicing misregulation and muscular dysfunction. Here we show that the abnormal splicing of DMD exon 78 found in dystrophic muscles of DM1 patients is due to the functional loss of MBNL1 and leads to the re-expression of an embryonic dystrophin in place of the adult isoform. Forced expression of embryonic dystrophin in zebrafish using an exon-skipping approach severely impairs the mobility and muscle architecture. Moreover, reproducing Dmd exon 78 missplicing switch in mice induces muscle fibre remodelling and ultrastructural abnormalities including ringed fibres, sarcoplasmic masses or Z-band disorganization, which are characteristic features of dystrophic DM1 skeletal muscles. Thus, we propose that splicing misregulation of DMD exon 78 compromises muscle fibre maintenance and contributes to the progressive dystrophic process in DM1. PMID:26018658

SplicingTypesAnno: annotating and quantifying alternative splicing events for RNA-Seq data.

PubMed

Sun, Xiaoyong; Zuo, Fenghua; Ru, Yuanbin; Guo, Jiqiang; Yan, Xiaoyan; Sablok, Gaurav

2015-04-01

Alternative splicing plays a key role in the regulation of the central dogma. Four major types of alternative splicing have been classified as intron retention, exon skipping, alternative 5 splice sites or alternative donor sites, and alternative 3 splice sites or alternative acceptor sites. A few algorithms have been developed to detect splice junctions from RNA-Seq reads. However, there are few tools targeting at the major alternative splicing types at the exon/intron level. This type of analysis may reveal subtle, yet important events of alternative splicing, and thus help gain deeper understanding of the mechanism of alternative splicing. This paper describes a user-friendly R package, extracting, annotating and analyzing alternative splicing types for sequence alignment files from RNA-Seq. SplicingTypesAnno can: (1) provide annotation for major alternative splicing at exon/intron level. By comparing the annotation from GTF/GFF file, it identifies the novel alternative splicing sites; (2) offer a convenient two-level analysis: genome-scale annotation for users with high performance computing environment, and gene-scale annotation for users with personal computers; (3) generate a user-friendly web report and additional BED files for IGV visualization. SplicingTypesAnno is a user-friendly R package for extracting, annotating and analyzing alternative splicing types at exon/intron level for sequence alignment files from RNA-Seq. It is publically available at https://sourceforge.net/projects/splicingtypes/files/ or http://genome.sdau.edu.cn/research/software/SplicingTypesAnno.html. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Genome-wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator

PubMed Central

Bonasio, Roberto; Li, Qiye; Lian, Jinmin; Mutti, Navdeep S.; Jin, Lijun; Zhao, Hongmei; Zhang, Pei; Wen, Ping; Xiang, Hui; Ding, Yun; Jin, Zonghui; Shen, Steven S.; Wang, Zongji; Wang, Wen; Wang, Jun; Berger, Shelley L.; Liebig, Jürgen; Zhang, Guojie; Reinberg, Danny

2012-01-01

SUMMARY Background Ant societies comprise individuals belonging to different castes characterized by specialized morphologies and behaviors. Because ant embryos can follow different developmental trajectories, epigenetic mechanisms must play a role in caste determination. Ants have a full set of DNA methyltransferase and their genomes contain methylcytosine. To determine the relationship between DNA methylation and phenotypic plasticity in ants, we obtained and compared the genome-wide methylomes of different castes and developmental stages of Camponotus floridanus and Harpegnathos saltator. Results In the ant genomes, methylcytosines are found both in CpG and non-CpG contexts and are strongly enriched at exons of active genes. Changes in exonic DNA methylation correlate with alternative splicing events such as exon skipping and alternative splice site selection. Several genes exhibit caste-specific and developmental changes in DNA methylation that are conserved between the two species, including genes involved in reproduction, telomere maintenance, and noncoding RNA metabolism. Several loci are methylated and expressed monoallelically, and in some cases the choice of methylated allele depends on the caste. Conclusions These first ant methylomes and their intra- and inter-species comparison reveal an exonic methylation pattern that points to a connection between DNA methylation and splicing. The presence of monoallelic DNA methylation and the methylation of non-CpG sites in all samples suggest roles in genome regulation in these social insects, including the intriguing possibility of parental or caste-specific genomic imprinting. PMID:22885060

FOX-2 Dependent Splicing of Ataxin-2 Transcript Is Affected by Ataxin-1 Overexpression

PubMed Central

Welzel, Franziska; Kaehler, Christian; Isau, Melanie; Hallen, Linda; Lehrach, Hans; Krobitsch, Sylvia

2012-01-01

Alternative splicing is a fundamental posttranscriptional mechanism for controlling gene expression, and splicing defects have been linked to various human disorders. The splicing factor FOX-2 is part of a main protein interaction hub in a network related to human inherited ataxias, however, its impact remains to be elucidated. Here, we focused on the reported interaction between FOX-2 and ataxin-1, the disease-causing protein in spinocerebellar ataxia type 1. In this line, we further evaluated this interaction by yeast-2-hybrid analyses and co-immunoprecipitation experiments in mammalian cells. Interestingly, we discovered that FOX-2 localization and splicing activity is affected in the presence of nuclear ataxin-1 inclusions. Moreover, we observed that FOX-2 directly interacts with ataxin-2, a protein modulating spinocerebellar ataxia type 1 pathogenesis. Finally, we provide evidence that splicing of pre-mRNA of ataxin-2 depends on FOX-2 activity, since reduction of FOX-2 levels led to increased skipping of exon 18 in ataxin-2 transcripts. Most striking, we observed that ataxin-1 overexpression has an effect on this splicing event as well. Thus, our results demonstrate that FOX-2 is involved in splicing of ataxin-2 transcripts and that this splicing event is altered by overexpression of ataxin-1. PMID:22666429

Identification of Small Molecule and Genetic Modulators of AON-Induced Dystrophin Exon Skipping by High-Throughput Screening

PubMed Central

O'Leary, Debra A.; Sharif, Orzala; Anderson, Paul; Tu, Buu; Welch, Genevieve; Zhou, Yingyao; Caldwell, Jeremy S.; Engels, Ingo H.; Brinker, Achim

2009-01-01

One therapeutic approach to Duchenne Muscular Dystrophy (DMD) recently entering clinical trials aims to convert DMD phenotypes to that of a milder disease variant, Becker Muscular Dystrophy (BMD), by employing antisense oligonucleotides (AONs) targeting splice sites, to induce exon skipping and restore partial dystrophin function. In order to search for small molecule and genetic modulators of AON-dependent and independent exon skipping, we screened ∼10,000 known small molecule drugs, >17,000 cDNA clones, and >2,000 kinase- targeted siRNAs against a 5.6 kb luciferase minigene construct, encompassing exon 71 to exon 73 of human dystrophin. As a result, we identified several enhancers of exon skipping, acting on both the reporter construct as well as endogenous dystrophin in mdx cells. Multiple mechanisms of action were identified, including histone deacetylase inhibition, tubulin modulation and pre-mRNA processing. Among others, the nucleolar protein NOL8 and staufen RNA binding protein homolog 2 (Stau2) were found to induce endogenous exon skipping in mdx cells in an AON-dependent fashion. An unexpected but recurrent theme observed in our screening efforts was the apparent link between the inhibition of cell cycle progression and the induction of exon skipping. PMID:20020055

Identification of small molecule and genetic modulators of AON-induced dystrophin exon skipping by high-throughput screening.

PubMed

O'Leary, Debra A; Sharif, Orzala; Anderson, Paul; Tu, Buu; Welch, Genevieve; Zhou, Yingyao; Caldwell, Jeremy S; Engels, Ingo H; Brinker, Achim

2009-12-17

One therapeutic approach to Duchenne Muscular Dystrophy (DMD) recently entering clinical trials aims to convert DMD phenotypes to that of a milder disease variant, Becker Muscular Dystrophy (BMD), by employing antisense oligonucleotides (AONs) targeting splice sites, to induce exon skipping and restore partial dystrophin function. In order to search for small molecule and genetic modulators of AON-dependent and independent exon skipping, we screened approximately 10,000 known small molecule drugs, >17,000 cDNA clones, and >2,000 kinase- targeted siRNAs against a 5.6 kb luciferase minigene construct, encompassing exon 71 to exon 73 of human dystrophin. As a result, we identified several enhancers of exon skipping, acting on both the reporter construct as well as endogenous dystrophin in mdx cells. Multiple mechanisms of action were identified, including histone deacetylase inhibition, tubulin modulation and pre-mRNA processing. Among others, the nucleolar protein NOL8 and staufen RNA binding protein homolog 2 (Stau2) were found to induce endogenous exon skipping in mdx cells in an AON-dependent fashion. An unexpected but recurrent theme observed in our screening efforts was the apparent link between the inhibition of cell cycle progression and the induction of exon skipping.

Bi-specific splice-switching PMO oligonucleotides conjugated via a single peptide active in a mouse model of Duchenne muscular dystrophy

PubMed Central

Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F.; Järver, Peter; Wood, Matthew J.A.; Gait, Michael J.

2015-01-01

The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage (‘click chemistry’) in the other. The most active bi-specific CPP–PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP–PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897

MET exon 14 skipping defines a unique molecular class of non-small cell lung cancer.

PubMed

Zheng, Difan; Wang, Rui; Ye, Ting; Yu, Su; Hu, Haichuan; Shen, Xuxia; Li, Yuan; Ji, Hongbin; Sun, Yihua; Chen, Haiquan

2016-07-05

Recurrent MET exon 14 splicing has been revealed in lung cancers and is a promising therapeutic target. Because we have limited knowledge about the natural history of MET mutant tumors, the current study was aiming to determine the clinical and pathological characteristics in non-small cell lung cancers (NSCLC). Twenty-three patients (1.3%) were positive for MET exon 14 skipping. Patients with MET exon 14 skipping displayed unique characteristics: female, non-smokers, earlier pathology stage and older age. MET exon 14 skipping indicated an early event as other drivers in lung cancer, while MET copy number gain was more likely a late event in lung cancer. Overall survival (OS) of patients harboring MET exon 14 skipping was longer than patients with KRAS mutation. Almost four-fifths of the lung tumors with MET exon 14 skipping had EGFR and/or HER2 gene copy number gains. EGFR inhibitor showed moderate antitumor activity in treatment of a patient harboring MET exon 14 skipping. From October 2007 to June 2013, we screened 1770 patients with NSCLC and correlated MET status with clinical pathologic characteristics and mutations in EGFR, KRAS, BRAF, HER2, and ALK. Quantitative Real-Time PCR was used to detect MET gene copy number gain. Immunohistochemistry (IHC) was also performed to screen MET exon 14 skipping. Clinicopathological characteristics and survival information were analyzed. MET exon 14 skipping was detected in 1.3% (23/1770) of the Chinese patients with NSCLC. MET exon 14 skipping defined a new molecular subset of NSCLC with identifiable clinical characteristics. The therapeutic EGFR inhibitors might be an alternative treatment for patients with MET mutant NSCLC.

Rice cyclophilin OsCYP18-2 is translocated to the nucleus by an interaction with SKIP and enhances drought tolerance in rice and Arabidopsis.

PubMed

Lee, Sang Sook; Park, Hyun Ji; Yoon, Dae Hwa; Kim, Beom-Gi; Ahn, Jun Cheul; Luan, Sheng; Cho, Hye Sun

2015-10-01

Cyclophilin 18-2 (CYP18-2) genes, homologues of human peptidyl-prolyl isomerase-like 1 (PPiL1), are conserved across multicellular organisms and Schizosaccharomyces pombe. Although PPiL1 is known to interact with ski-interacting protein (SKIP), a transcriptional co-regulator and spliceosomal component, there have been no functional analyses of PPiL1 homologues in plants. Rice cyclophilin 18-2 (OsCYP18-2) bound directly to amino acids 56-95 of OsSKIP and its binding was independent of cyclosporin A, a cyclophilin-binding drug. Moreover, OsCYP18-2 exhibited PPIase activity regardless of its interaction with OsSKIP. Therefore, the binding site for OsCYP18-2's interaction with SKIP was distinct from the PPIase active site. OsCYP18-2's interaction with SKIP full-length protein enabled OsCYP18-2's translocation from the cytoplasm into the nucleus and AtSKIP interacted in planta with both AtCYP18-2 and OsCYP18-2. Drought and salt stress induced similar expression of OsCYP18-2 and OsSKIP. Overexpression of OsCYP18-2 in transgenic rice and Arabidopsis thaliana plants enhanced drought tolerance and altered expression and pre-mRNA splicing patterns of stress-related genes in Arabidopsis under drought conditions. Furthermore, OsCYP18-2 caused transcriptional activation with/without OsSKIP in the GAL4 system of yeast; thus the OsSKIP-OsCYP18-2 interaction has an important role in the transcriptional and post-transcriptional regulation of stress-related genes and increases tolerance to drought stress. © 2015 John Wiley & Sons Ltd.

Two splice variants of the bovine lactoferrin gene identified in Staphylococcus aureus isolated from mastitis in dairy cattle.

PubMed

Huang, J M; Wang, Z Y; Ju, Z H; Wang, C F; Li, Q L; Sun, T; Hou, Q L; Hang, S Q; Hou, M H; Zhong, J F

2011-12-21

Bovine lactoferrin (bLF) is a member of the transferrin family; it plays an important role in the innate immune response. We identified novel splice variants of the bLF gene in mastitis-infected and healthy cows. Reverse transcription-polymerase chain reaction (RT-PCR) and clone sequencing analysis were used to screen the splice variants of the bLF gene in the mammary gland, spleen and liver tissues. One main transcript corresponding to the bLF reference sequence was found in three tissues in both healthy and mastitis-infected cows. Quantitative real-time PCR analysis showed that the expression levels of the LF gene's main transcript were not significantly different in tissues from healthy versus mastitis-infected cows. However, the new splice variant, LF-AS2, which has the exon-skipping alternative splicing pattern, was only identified in mammary glands infected with Staphylococcus aureus. Sequencing analysis showed that the new splice variant was 251 bp in length, including exon 1, part of exon 2, part of exon 16, and exon 17. We conclude that bLF may play a role in resistance to mastitis through alternative splicing mechanisms.

Decoding of exon splicing patterns in the human RUNX1-RUNX1T1 fusion gene.

PubMed

Grinev, Vasily V; Migas, Alexandr A; Kirsanava, Aksana D; Mishkova, Olga A; Siomava, Natalia; Ramanouskaya, Tatiana V; Vaitsiankova, Alina V; Ilyushonak, Ilia M; Nazarov, Petr V; Vallar, Laurent; Aleinikova, Olga V

2015-11-01

The t(8;21) translocation is the most widespread genetic defect found in human acute myeloid leukemia. This translocation results in the RUNX1-RUNX1T1 fusion gene that produces a wide variety of alternative transcripts and influences the course of the disease. The rules of combinatorics and splicing of exons in the RUNX1-RUNX1T1 transcripts are not known. To address this issue, we developed an exon graph model of the fusion gene organization and evaluated its local exon combinatorics by the exon combinatorial index (ECI). Here we show that the local exon combinatorics of the RUNX1-RUNX1T1 gene follows a power-law behavior and (i) the vast majority of exons has a low ECI, (ii) only a small part is represented by "exons-hubs" of splicing with very high ECI values, and (iii) it is scale-free and very sensitive to targeted skipping of "exons-hubs". Stochasticity of the splicing machinery and preferred usage of exons in alternative splicing can explain such behavior of the system. Stochasticity may explain up to 12% of the ECI variance and results in a number of non-coding and unproductive transcripts that can be considered as a noise. Half-life of these transcripts is increased due to the deregulation of some key genes of the nonsense-mediated decay system in leukemia cells. On the other hand, preferred usage of exons may explain up to 75% of the ECI variability. Our analysis revealed a set of splicing-related cis-regulatory motifs that can explain "attractiveness" of exons in alternative splicing but only when they are considered together. Cis-regulatory motifs are guides for splicing trans-factors and we observed a leukemia-specific profile of expression of the splicing genes in t(8;21)-positive blasts. Altogether, our results show that alternative splicing of the RUNX1-RUNX1T1 transcripts follows strict rules and that the power-law component of the fusion gene organization confers a high flexibility to this process. Copyright © 2015 Elsevier Ltd. All rights reserved.

ABCA4 midigenes reveal the full splice spectrum of all reported noncanonical splice site variants in Stargardt disease.

PubMed

Sangermano, Riccardo; Khan, Mubeen; Cornelis, Stéphanie S; Richelle, Valerie; Albert, Silvia; Garanto, Alejandro; Elmelik, Duaa; Qamar, Raheel; Lugtenberg, Dorien; van den Born, L Ingeborgh; Collin, Rob W J; Cremers, Frans P M

2018-01-01

Stargardt disease is caused by variants in the ABCA4 gene, a significant part of which are noncanonical splice site (NCSS) variants. In case a gene of interest is not expressed in available somatic cells, small genomic fragments carrying potential disease-associated variants are tested for splice abnormalities using in vitro splice assays. We recently discovered that when using small minigenes lacking the proper genomic context, in vitro results do not correlate with splice defects observed in patient cells. We therefore devised a novel strategy in which a bacterial artificial chromosome was employed to generate midigenes, splice vectors of varying lengths (up to 11.7 kb) covering almost the entire ABCA4 gene. These midigenes were used to analyze the effect of all 44 reported and three novel NCSS variants on ABCA4 pre-mRNA splicing. Intriguingly, multi-exon skipping events were observed, as well as exon elongation and intron retention. The analysis of all reported NCSS variants in ABCA4 allowed us to reveal the nature of aberrant splicing events and to classify the severity of these mutations based on the residual fraction of wild-type mRNA. Our strategy to generate large overlapping splice vectors carrying multiple exons, creating a toolbox for robust and high-throughput analysis of splice variants, can be applied to all human genes. © 2018 Sangermano et al.; Published by Cold Spring Harbor Laboratory Press.

Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays

PubMed Central

Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel

2006-01-01

Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921

ANXA11 mutations prevail in Chinese ALS patients with and without cognitive dementia.

PubMed

Zhang, Kang; Liu, Qing; Liu, Keqiang; Shen, Dongchao; Tai, Hongfei; Shu, Shi; Ding, Qingyun; Fu, Hanhui; Liu, Shuangwu; Wang, Zhili; Li, Xiaoguang; Liu, Mingsheng; Zhang, Xue; Cui, Liying

2018-06-01

To investigate the genetic contribution of ANXA11 , a gene associated with amyotrophic lateral sclerosis (ALS), in Chinese ALS patients with and without cognitive dementia. Sequencing all the coding exons of ANXA11 and intron-exon boundaries in 18 familial amyotrophic lateral sclerosis (FALS), 353 unrelated sporadic amyotrophic lateral sclerosis (SALS), and 12 Chinese patients with ALS-frontotemporal lobar dementia (ALS-FTD). The transcripts in peripheral blood generated from a splicing mutation were examined by reverse transcriptase PCR. We identified 6 nonsynonymous heterozygous mutations (5 novel and 1 recurrent), 1 splice site mutation, and 1 deletion of 10 amino acids (not accounted in the mutant frequency) in 11 unrelated patients, accounting for a mutant frequency of 5.6% (1/18) in FALS, 2.3% (8/353) in SALS, and 8.3% (1/12) in ALS-FTD. The deletion of 10 amino acids was detected in 1 clinically undetermined male with an ALS family history who had atrophy in hand muscles and myotonic discharges revealed by EMG. The novel p. P36R mutation was identified in 1 FALS index, 1 patient with SALS, and 1 ALS-FTD. The splicing mutation (c.174-2A>G) caused in-frame skipping of the entire exon 6. The rest missense mutations including p.D40G, p.V128M, p.S229R, p.R302C and p.G491R were found in 6 unrelated patients with SALS. The ANXA11 gene is one of the most frequently mutated genes in Chinese patients with SALS. A canonical splice site mutation leading to skipping of the entire exon 6 further supports the loss-of-function mechanism. In addition, the study findings further expand the ANXA11 phenotype, first highlighting its pathogenic role in ALS-FTD.

Analysis and Prediction of Exon Skipping Events from RNA-Seq with Sequence Information Using Rotation Forest.

PubMed

Du, Xiuquan; Hu, Changlin; Yao, Yu; Sun, Shiwei; Zhang, Yanping

2017-12-12

In bioinformatics, exon skipping (ES) event prediction is an essential part of alternative splicing (AS) event analysis. Although many methods have been developed to predict ES events, a solution has yet to be found. In this study, given the limitations of machine learning algorithms with RNA-Seq data or genome sequences, a new feature, called RS (RNA-seq and sequence) features, was constructed. These features include RNA-Seq features derived from the RNA-Seq data and sequence features derived from genome sequences. We propose a novel Rotation Forest classifier to predict ES events with the RS features (RotaF-RSES). To validate the efficacy of RotaF-RSES, a dataset from two human tissues was used, and RotaF-RSES achieved an accuracy of 98.4%, a specificity of 99.2%, a sensitivity of 94.1%, and an area under the curve (AUC) of 98.6%. When compared to the other available methods, the results indicate that RotaF-RSES is efficient and can predict ES events with RS features.

Genome-wide association between DNA methylation and alternative splicing in an invertebrate

PubMed Central

2012-01-01

Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee) and Nasonia vitripennis (jewel wasp) analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq) to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice variants by positively influencing exon inclusion during transcription. The results from our cross-species homology analysis suggest that DNA methylation and alternative splicing are genetic mechanisms whose utilization could contribute to a longer gene length and a slower rate of gene evolution. PMID:22978521

Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

PubMed

Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2015-03-15

Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein molecule that alter the biosynthesis of thyroid hormones. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

A Dentin Sialophosphoprotein Mutation That Partially Disrupts a Splice Acceptor Site Causes Type II Dentin Dysplasia

PubMed Central

Lee, Sook-Kyung; Hu, Jan C.-C.; Lee, Kyung-Eun; Simmer, James P.; Kim, Jung-Wook

2009-01-01

The dentin sialophosphoprotein (DSPP) gene on chromosome 4q21.3 encodes the major noncollagenous protein in tooth dentin. DSPP mutations are the principal cause of dentin dysplasia type II, dentinogenesis imperfecta type II, and dentinogenesis imperfecta type III. We have identified a DSPP splice junction mutation (IVS2-6T>G) in a family with dentin dysplasia type II. The primary dentition is discolored brown with severe attrition. The mildly discolored permanent dentition has thistle-shaped pulp chambers, pulp stones, and eventual pulp obliteration. The mutation is in the sixth nucleotide from the end of intron 2, perfectly segregates with the disease phenotype, and is absent in 200 normal control chromosomes. An in vitro splicing assay shows that pre-mRNA splicing of the mutant allele generates wild-type mRNA and mRNA lacking exon 3 in approximately equal amounts. Skipping exon 3 might interfere with signal peptide cleavage, causing endoplasmic reticulum stress, and also reduce DSPP secretion, leading to haploinsufficiency. PMID:19026876

Repair of pre-mRNA splicing

PubMed Central

Nlend, Rachel Nlend; Meyer, Kathrin

2010-01-01

Recent analyses of complete genomes have revealed that alternative splicing became more prevalent and important during eukaryotic evolution. Alternative splicing augments the protein repertoire—particularly that of the human genome—and plays an important role in the development and function of differentiated cell types. However, splicing is also extremely vulnerable, and defects in the proper recognition of splicing signals can give rise to a variety of diseases. In this review, we discuss splicing correction therapies, by using the inherited disease Spinal Muscular Atrophy (SMA) as an example. This lethal early childhood disorder is caused by deletions or other severe mutations of SMN1, a gene coding for the essential survival of motoneurons protein. A second gene copy present in humans and few non-human primates, SMN2, can only partly compensate for the defect because of a single nucleotide change in exon 7 that causes this exon to be skipped in the majority of mRNAs. Thus SMN2 is a prime therapeutic target for SMA. In recent years, several strategies based on small molecule drugs, antisense oligonucleotides or in vivo expressed RNAs have been developed that allow a correction of SMN2 splicing. For some of these, a therapeutic benefit has been demonstrated in mouse models for SMA. This means that clinical trials of such splicing therapies for SMA may become possible in the near future. PMID:20523126

Identification of novel point mutations in splicing sites integrating whole-exome and RNA-seq data in myeloproliferative diseases.

PubMed

Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo

2013-11-01

Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC 3 (NM_003786.3:c.1783-1G>A), KLHDC 1 (NM_172193.1:c.568-2A>G), HOOK 1 (NM_015888.4:c.1662-1G>A), SMAD 9 (NM_001127217.2:c.1004-1C>T), and DNAH 9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC 3, HOOK 1. In ABCC 3 and HOOK 1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK 1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4-6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis.

Identification of a chemical inhibitor for nuclear speckle formation: Implications for the function of nuclear speckles in regulation of alternative pre-mRNA splicing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurogi, Yutaro; Matsuo, Yota; Mihara, Yuki

2014-03-28

Highlights: • We identified tubercidin as a compound inducing aberrant formation of the speckles. • Tubercidin causes delocalization of poly (A){sup +}RNAs from nuclear speckles. • Tubercidin induces dispersion of splicing factors from nuclear speckles. • Tubercidin affects alternative pre-mRNA splicing. • Nuclear speckles play a role in regulation of alternative pre-mRNA splicing. - Abstract: Nuclear speckles are subnuclear structures enriched with RNA processing factors and poly (A){sup +} RNAs comprising mRNAs and poly (A){sup +} non-coding RNAs (ncRNAs). Nuclear speckles are thought to be involved in post-transcriptional regulation of gene expression, such as pre-mRNA splicing. By screening 3585 culturemore » extracts of actinomycetes with in situ hybridization using an oligo dT probe, we identified tubercidin, an analogue of adenosine, as an inhibitor of speckle formation, which induces the delocalization of poly (A){sup +} RNA and dispersion of splicing factor SRSF1/SF2 from nuclear speckles in HeLa cells. Treatment with tubercidin also decreased steady-state MALAT1 long ncRNA, thought to be involved in the retention of SRSF1/SF2 in nuclear speckles. In addition, we found that tubercidin treatment promoted exon skipping in the alternative splicing of Clk1 pre-mRNA. These results suggest that nuclear speckles play a role in modulating the concentration of splicing factors in the nucleoplasm to regulate alternative pre-mRNA splicing.« less

Splicing analysis for exonic and intronic mismatch repair gene variants associated with Lynch syndrome confirms high concordance between minigene assays and patient RNA analyses

PubMed Central

van der Klift, Heleen M; Jansen, Anne M L; van der Steenstraten, Niki; Bik, Elsa C; Tops, Carli M J; Devilee, Peter; Wijnen, Juul T

2015-01-01

A subset of DNA variants causes genetic disease through aberrant splicing. Experimental splicing assays, either RT-PCR analyses of patient RNA or functional splicing reporter minigene assays, are required to evaluate the molecular nature of the splice defect. Here, we present minigene assays performed for 17 variants in the consensus splice site regions, 14 exonic variants outside these regions, and two deep intronic variants, all in the DNA mismatch-repair (MMR) genes MLH1, MSH2, MSH6, and PMS2, associated with Lynch syndrome. We also included two deep intronic variants in APC and PKD2. For one variant (MLH1 c.122A>G), our minigene assay and patient RNA analysis could not confirm the previously reported aberrant splicing. The aim of our study was to further investigate the concordance between minigene splicing assays and patient RNA analyses. For 30 variants results from patient RNA analyses were available, either performed by our laboratory or presented in literature. Some variants were deliberately included in this study because they resulted in multiple aberrant transcripts in patient RNA analysis, or caused a splice effect other than the prevalent exon skip. While both methods were completely concordant in the assessment of splice effects, four variants exhibited major differences in aberrant splice patterns. Based on the present and earlier studies, together showing an almost 100% concordance of minigene assays with patient RNA analyses, we discuss the weight given to minigene splicing assays in the current criteria proposed by InSiGHT for clinical classification of MMR variants. PMID:26247049

A splice variant in the ACSL5 gene relates migraine with fatty acid activation in mitochondria

PubMed Central

Matesanz, Fuencisla; Fedetz, María; Barrionuevo, Cristina; Karaky, Mohamad; Catalá-Rabasa, Antonio; Potenciano, Victor; Bello-Morales, Raquel; López-Guerrero, Jose-Antonio; Alcina, Antonio

2016-01-01

Genome-wide association studies (GWAS) in migraine are providing the molecular basis of this heterogeneous disease, but the understanding of its aetiology is still incomplete. Although some biomarkers have currently been accepted for migraine, large amount of studies for identifying new ones is needed. The migraine-associated variant rs12355831:A>G (P=2 × 10−6), described in a GWAS of the International Headache Genetic Consortium, is localized in a non-coding sequence with unknown function. We sought to identify the causal variant and the genetic mechanism involved in the migraine risk. To this end, we integrated data of RNA sequences from the Genetic European Variation in Health and Disease (GEUVADIS) and genotypes from 1000 GENOMES of 344 lymphoblastoid cell lines (LCLs), to determine the expression quantitative trait loci (eQTLs) in the region. We found that the migraine-associated variant belongs to a linkage disequilibrium block associated with the expression of an acyl-coenzyme A synthetase 5 (ACSL5) transcript lacking exon 20 (ACSL5-Δ20). We showed by exon-skipping assay a direct causality of rs2256368-G in the exon 20 skipping of approximately 20 to 40% of ACSL5 RNA molecules. In conclusion, we identified the functional variant (rs2256368:A>G) affecting ACSL5 exon 20 skipping, as a causal factor linked to the migraine-associated rs12355831:A>G, suggesting that the activation of long-chain fatty acids by the spliced ACSL5-Δ20 molecules, a mitochondrial located enzyme, is involved in migraine pathology. PMID:27189022

Isolation and characterization of alternatively spliced variants of the mouse sigma1 receptor gene, Sigmar1.

PubMed

Pan, Ling; Pasternak, David A; Xu, Jin; Xu, Mingming; Lu, Zhigang; Pasternak, Gavril W; Pan, Ying-Xian

2017-01-01

The sigma1 receptor acts as a chaperone at the endoplasmic reticulum, associates with multiple proteins in various cellular systems, and involves in a number of diseases, such as addiction, pain, cancer and psychiatric disorders. The sigma1 receptor is encoded by the single copy SIGMAR1 gene. The current study identifies five alternatively spliced variants of the mouse sigma1 receptor gene using a polymerase chain reaction cloning approach. All the splice variants are generated by exon skipping or alternative 3' or 5' splicing, producing the truncated sigma1 receptor. Similar alternative splicing has been observed in the human SIGMAR1 gene based on the molecular cloning or genome sequence prediction, suggesting conservation of alternative splicing of SIGMAR1 gene. Using quantitative polymerase chain reactions, we demonstrate differential expression of several splice variants in mouse tissues and brain regions. When expressed in HEK293 cells, all the splice variants fail to bind sigma ligands, implicating that each truncated region in these splice variants is important for ligand binding. However, co-immunoprecipitation (Co-IP) study in HEK293 cells co-transfected with tagged constructs reveals that all the splice variants maintain their ability to physically associate with a mu opioid receptor (mMOR-1), providing useful information to correlate the motifs/sequences necessary for their physical association. Furthermore, a competition Co-IP study showed that all the variants can disrupt in a dose-dependent manner the dimerization of the original sigma1 receptor with mMOR-1, suggesting a potential dominant negative function and providing significant insights into their function.

Alternative splicing and nonsense-mediated decay of circadian clock genes under environmental stress conditions in Arabidopsis

PubMed Central

2014-01-01

Background The circadian clock enables living organisms to anticipate recurring daily and seasonal fluctuations in their growth habitats and synchronize their biology to the environmental cycle. The plant circadian clock consists of multiple transcription-translation feedback loops that are entrained by environmental signals, such as light and temperature. In recent years, alternative splicing emerges as an important molecular mechanism that modulates the clock function in plants. Several clock genes are known to undergo alternative splicing in response to changes in environmental conditions, suggesting that the clock function is intimately associated with environmental responses via the alternative splicing of the clock genes. However, the alternative splicing events of the clock genes have not been studied at the molecular level. Results We systematically examined whether major clock genes undergo alternative splicing under various environmental conditions in Arabidopsis. We also investigated the fates of the RNA splice variants of the clock genes. It was found that the clock genes, including EARLY FLOWERING 3 (ELF3) and ZEITLUPE (ZTL) that have not been studied in terms of alternative splicing, undergo extensive alternative splicing through diverse modes of splicing events, such as intron retention, exon skipping, and selection of alternative 5′ splice site. Their alternative splicing patterns were differentially influenced by changes in photoperiod, temperature extremes, and salt stress. Notably, the RNA splice variants of TIMING OF CAB EXPRESSION 1 (TOC1) and ELF3 were degraded through the nonsense-mediated decay (NMD) pathway, whereas those of other clock genes were insensitive to NMD. Conclusion Taken together, our observations demonstrate that the major clock genes examined undergo extensive alternative splicing under various environmental conditions, suggesting that alternative splicing is a molecular scheme that underlies the linkage between the clock and environmental stress adaptation in plants. It is also envisioned that alternative splicing of the clock genes plays more complex roles than previously expected. PMID:24885185

Novel MSH2 splice-site mutation in a young patient with Lynch syndrome

PubMed Central

Liccardo, Raffaella; De Rosa, Marina; Izzo, Paola; Duraturo, Francesca

2018-01-01

Lynch Syndrome (LS) is associated with germline mutations in one of the mismatch repair (MMR) genes, including MutL homolog 1 (MLH1), MutS homolog 2 (MSH2), MSH6, PMS1 homolog 2, mismatch repair system component (PMS2), MLH3 and MSH3. The mutations identified in MMR genes are point mutations or large rearrangements. The point mutations are certainly pathogenetic whether they determine formation of truncated protein. The mutations that arise in splice sites are classified as ‘likely pathogenic’ variants. In the present study, a novel splicing mutation was identified, (named c.212-1g>a), in the MSH2 gene. This novel mutation in the consensus splice site of MSH2 exon 2 leads to the loss of the canonical splice site, without skipping in-frame of exon 2; also with the formation of 2 aberrant transcripts, due to the activation of novel splice sites in exon 2. This mutation was identified in a young patient who developed colon cancer at the age of 26 years and their belongs to family that met the ‘Revised Amsterdam Criteria’. The present study provided insight into the molecular mechanism determining the pathogenicity of this novel MSH2 mutation and it reaffirms the importance of genetic testing in LS. PMID:29568967

Novel mRNA isoforms and mutations of uridine monophosphate synthetase and 5-fluorouracil resistance in colorectal cancer.

PubMed

Griffith, M; Mwenifumbo, J C; Cheung, P Y; Paul, J E; Pugh, T J; Tang, M J; Chittaranjan, S; Morin, R D; Asano, J K; Ally, A A; Miao, L; Lee, A; Chan, S Y; Taylor, G; Severson, T; Hou, Y-C; Griffith, O L; Cheng, G S W; Novik, K; Moore, R; Luk, M; Owen, D; Brown, C J; Morin, G B; Gill, S; Tai, I T; Marra, M A

2013-04-01

The drug fluorouracil (5-FU) is a widely used antimetabolite chemotherapy in the treatment of colorectal cancer. The gene uridine monophosphate synthetase (UMPS) is thought to be primarily responsible for conversion of 5-FU to active anticancer metabolites in tumor cells. Mutation or aberrant expression of UMPS may contribute to 5-FU resistance during treatment. We undertook a characterization of UMPS mRNA isoform expression and sequence variation in 5-FU-resistant cell lines and drug-naive or -exposed primary and metastatic tumors. We observed reciprocal differential expression of two UMPS isoforms in a colorectal cancer cell line with acquired 5-FU resistance relative to the 5-FU-sensitive cell line from which it was derived. A novel isoform arising as a consequence of exon skipping was increased in abundance in resistant cells. The underlying mechanism responsible for this shift in isoform expression was determined to be a heterozygous splice site mutation acquired in the resistant cell line. We developed sequencing and expression assays to specifically detect alternative UMPS isoforms and used these to determine that UMPS was recurrently disrupted by mutations and aberrant splicing in additional 5-FU-resistant colorectal cancer cell lines and colorectal tumors. The observed mutations, aberrant splicing and downregulation of UMPS represent novel mechanisms for acquired 5-FU resistance in colorectal cancer.

A G-to-A mutation in IVS-3 of the human gamma fibrinogen gene causing afibrinogenemia due to abnormal RNA splicing.

PubMed

Margaglione, M; Santacroce, R; Colaizzo, D; Seripa, D; Vecchione, G; Lupone, M R; De Lucia, D; Fortina, P; Grandone, E; Perricone, C; Di Minno, G

2000-10-01

Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by a hemorrhagic diathesis of variable severity. Although more than 100 families with this disorder have been described, genetic defects have been characterized in few cases. An investigation of a young propositus, offspring of a consanguineous marriage, with undetectable levels of functional and quantitative fibrinogen, was conducted. Sequence analysis of the fibrinogen genes showed a homozygous G-to-A mutation at the fifth nucleotide (nt 2395) of the third intervening sequence (IVS) of the gamma-chain gene. Her first-degree relatives, who had approximately half the normal fibrinogen values and showed concordance between functional and immunologic levels, were heterozygtes. The G-to-A change predicts the disappearance of a donor splice site. After transfection with a construct, containing either the wild-type or the mutated sequence, cells with the mutant construct showed an aberrant messenger RNA (mRNA), consistent with skipping of exon 3, but not the expected mRNA. Sequencing of the abnormal mRNA showed the complete absence of exon 3. Skipping of exon 3 predicts the deletion of amino acid sequence from residue 16 to residue 75 and shifting of reading frame at amino acid 76 with a premature stop codon within exon 4 at position 77. Thus, the truncated gamma-chain gene product would not interact with other chains to form the mature fibrinogen molecule. The current findings show that mutations within highly conserved IVS regions of fibrinogen genes could affect the efficiency of normal splicing, giving rise to congenital afibrinogenemia.

Nuclear sequestration of COL1A1 mRNA transcript associated with type I osteogenesis imperfecta (OI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Primorac, D.; Stover, M.L.; McKinstry, M.B.

Previously we identified an OI type I patient with a splice donor mutation that resulted in intron 26 retention instead of exon skipping and sequestration of normal levels of the mutant transcript in the nuclear compartment. Intron retention was consistent with the exon definition hypothesis for splice site selection since the size of the exon-intron-exon unit was less than 300 bp. Furthermore, the retained intron contained in-frame stop codons which is thought to cause the mutant RNA to remain within the nucleus rather than appearing in the cytoplasm. To test these hypotheses, genomic fragments containing the normal sequence or themore » donor mutation were cloned into a collagen minigene and expressed in stably tansfected NIH 3T3 cells. None of the modifications to the normal intron altered the level of RNA that accumulated in the cytoplasm, as expected. However none of the modifications to the mutant intron allowed accumulation of normal levels of mRNA in the cytoplasm. Moreover, in contrast to our findings in the patient`s cells only low levels of mutant transcript were found in the nucleus; a fraction of the transcript did appear in the cytoplasm which had spliced the mutant donor site correctly. Nuclear run-on experiments demonstrated equal levels of transcription from each transgene. Expression of another donor mutation known to cause in-frame exon skipping in OI type IV was accurately reproduced in the minigene in transfected 3T3 cells. Our experience suggests that either mechanism can lead to formation of a null allele possibly related to the type of splicing events surrounding the potential stop codons. Understanding the rules governing inactivation of a collagen RNA transcript may be important in designing a strategy to inactivate a dominate negative mutation associated with the more severe forms of OI.« less

Isolation and characterization of alternatively spliced variants of the mouse sigma1 receptor gene, Sigmar1

PubMed Central

Pan, Ling; Pasternak, David A.; Xu, Jin; Xu, Mingming; Lu, Zhigang; Pasternak, Gavril W.

2017-01-01

The sigma1 receptor acts as a chaperone at the endoplasmic reticulum, associates with multiple proteins in various cellular systems, and involves in a number of diseases, such as addiction, pain, cancer and psychiatric disorders. The sigma1 receptor is encoded by the single copy SIGMAR1 gene. The current study identifies five alternatively spliced variants of the mouse sigma1 receptor gene using a polymerase chain reaction cloning approach. All the splice variants are generated by exon skipping or alternative 3’ or 5’ splicing, producing the truncated sigma1 receptor. Similar alternative splicing has been observed in the human SIGMAR1 gene based on the molecular cloning or genome sequence prediction, suggesting conservation of alternative splicing of SIGMAR1 gene. Using quantitative polymerase chain reactions, we demonstrate differential expression of several splice variants in mouse tissues and brain regions. When expressed in HEK293 cells, all the splice variants fail to bind sigma ligands, implicating that each truncated region in these splice variants is important for ligand binding. However, co-immunoprecipitation (Co-IP) study in HEK293 cells co-transfected with tagged constructs reveals that all the splice variants maintain their ability to physically associate with a mu opioid receptor (mMOR-1), providing useful information to correlate the motifs/sequences necessary for their physical association. Furthermore, a competition Co-IP study showed that all the variants can disrupt in a dose-dependent manner the dimerization of the original sigma1 receptor with mMOR-1, suggesting a potential dominant negative function and providing significant insights into their function. PMID:28350844

Identification of novel point mutations in splicing sites integrating whole-exome and RNA-seq data in myeloproliferative diseases

PubMed Central

Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo

2013-01-01

Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC3 (NM_003786.3:c.1783-1G>A), KLHDC1 (NM_172193.1:c.568-2A>G), HOOK1 (NM_015888.4:c.1662-1G>A), SMAD9 (NM_001127217.2:c.1004-1C>T), and DNAH9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC3, HOOK1. In ABCC3 and HOOK1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4–6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis. PMID:24498620

Expression of exon-8-skipped kindlin-1 does not compensate for defects of Kindler syndrome.

PubMed

Natsuga, Ken; Nishie, Wataru; Shinkuma, Satoru; Nakamura, Hideki; Matsushima, Yoichiro; Tatsuta, Aya; Komine, Mayumi; Shimizu, Hiroshi

2011-01-01

Kindler syndrome (KS) is a rare, inherited skin disease characterized by blister formation and generalized poikiloderma. Mutations in KIND1, which encodes kindlin-1, are responsible for KS. c.1089del/1089+1del is a recurrent splice-site deletion mutation in KS patients. To elucidate the effects of c.1089del/1089+1del at the mRNA and protein level. Two KS patients with c.1089del/1089+1del were included in this study. Immunofluorescence analysis of KS skin samples using antibodies against the dermo-epidermal junction proteins was performed. Exon-trapping experiments were performed to isolate the mRNA sequences transcribed from genomic DNA harbouring c.1089del/1089+1del. β1 integrin activation in HeLa cells transfected with truncated KIND1 cDNA was analyzed. Immunofluorescence study showed positive expression of kindlin-1 in KS skin with c.1089del/1089+1del mutation. We identified the exon-8-skipped in-frame transcript as the main product among multiple splicing variants derived from that mutation. HeLa cells transfected with KIND1 cDNA without exon 8 showed impaired β1 integrin activation. Exon-8-coding amino acids are located in the FERM F2 domain, which is conserved among species, and the unstructured region between F2 and the pleckstrin homology domain. This study suggests that exon-8-skipped truncated kindlin-1 is functionally defective and does not compensate for the defects of KS, even though kindlin-1 expression in skin is positive. Copyright © 2010 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Small-scale high-throughput sequencing-based identification of new therapeutic tools in cystic fibrosis.

PubMed

Bonini, Jennifer; Varilh, Jessica; Raynal, Caroline; Thèze, Corinne; Beyne, Emmanuelle; Audrezet, Marie-Pierre; Ferec, Claude; Bienvenu, Thierry; Girodon, Emmanuelle; Tuffery-Giraud, Sylvie; Des Georges, Marie; Claustres, Mireille; Taulan-Cadars, Magali

2015-10-01

Although 97-99% of CFTR mutations have been identified, great efforts must be made to detect yet-unidentified mutations. We developed a small-scale next-generation sequencing approach for reliably and quickly scanning the entire gene, including noncoding regions, to identify new mutations. We applied this approach to 18 samples from patients suffering from cystic fibrosis (CF) in whom only one mutation had hitherto been identified. Using an in-house bioinformatics pipeline, we could rapidly identify a second disease-causing CFTR mutation for 16 of 18 samples. Of them, c.1680-883A>G was found in three unrelated CF patients. Analysis of minigenes and patients' transcripts showed that this mutation results in aberrantly spliced transcripts because of the inclusion of a pseudoexon. It is located only three base pairs from the c.1680-886A>G mutation (1811+1.6kbA>G), the fourth most frequent mutation in southwestern Europe. We next tested the effect of antisense oligonucleotides targeting splice sites on these two mutations on pseudoexon skipping. Oligonucleotide transfection resulted in the restoration of the full-length, in-frame CFTR transcript, demonstrating the effect of antisense oligonucleotide-induced pseudoexon skipping in CF. Our data confirm the importance of analyzing noncoding regions to find unidentified mutations, which is essential to designing targeted therapeutic approaches.

Correction of Dystrophin Expression in Cells From Duchenne Muscular Dystrophy Patients Through Genomic Excision of Exon 51 by Zinc Finger Nucleases

PubMed Central

Ousterout, David G; Kabadi, Ami M; Thakore, Pratiksha I; Perez-Pinera, Pablo; Brown, Matthew T; Majoros, William H; Reddy, Timothy E; Gersbach, Charles A

2015-01-01

Duchenne muscular dystrophy (DMD) is caused by genetic mutations that result in the absence of dystrophin protein expression. Oligonucleotide-induced exon skipping can restore the dystrophin reading frame and protein production. However, this requires continuous drug administration and may not generate complete skipping of the targeted exon. In this study, we apply genome editing with zinc finger nucleases (ZFNs) to permanently remove essential splicing sequences in exon 51 of the dystrophin gene and thereby exclude exon 51 from the resulting dystrophin transcript. This approach can restore the dystrophin reading frame in ~13% of DMD patient mutations. Transfection of two ZFNs targeted to sites flanking the exon 51 splice acceptor into DMD patient myoblasts led to deletion of this genomic sequence. A clonal population was isolated with this deletion and following differentiation we confirmed loss of exon 51 from the dystrophin mRNA transcript and restoration of dystrophin protein expression. Furthermore, transplantation of corrected cells into immunodeficient mice resulted in human dystrophin expression localized to the sarcolemmal membrane. Finally, we quantified ZFN toxicity in human cells and mutagenesis at predicted off-target sites. This study demonstrates a powerful method to restore the dystrophin reading frame and protein expression by permanently deleting exons. PMID:25492562

Exon 11 skipping of SCN10A coding for voltage-gated sodium channels in dorsal root ganglia

PubMed Central

Schirmeyer, Jana; Szafranski, Karol; Leipold, Enrico; Mawrin, Christian; Platzer, Matthias; Heinemann, Stefan H

2014-01-01

The voltage-gated sodium channel NaV1.8 (encoded by SCN10A) is predominantly expressed in dorsal root ganglia (DRG) and plays a critical role in pain perception. We analyzed SCN10A transcripts isolated from human DRGs using deep sequencing and found a novel splice variant lacking exon 11, which codes for 98 amino acids of the domain I/II linker. Quantitative PCR analysis revealed an abundance of this variant of up to 5–10% in human, while no such variants were detected in mouse or rat. Since no obvious functional differences between channels with and without the exon-11 sequence were detected, it is suggested that SCN10A exon 11 skipping in humans is a tolerated event. PMID:24763188

A novel TFF2 splice variant (ΔEX2TFF2) correlates with longer overall survival time in cholangiocarcinoma

PubMed Central

KAMLUA, SURASEE; PATRAKITKOMJORN, SIRIPORN; JEARANAIKOON, PATCHAREE; MENHENIOTT, TREVELYAN R.; GIRAUD, ANDREW S.; LIMPAIBOON, TEMDUANG

2012-01-01

Trefoil factor 2 (TFF2) is a member of trefoil factor family found to be overexpressed in many cancers including cholangiocarcinoma (CCA). The majority of studies have focused on wild-type TFF2 (wtTFF2) expression, but information regarding alternative splicing variants of TFF2 mRNA has not been reported. In this study, we aimed to identify and quantify a novel TFF2 splice variant in cholangiocarcinoma (CCA). Seventy-eight tumors and 15 normal adjacent tissues were quantified for the expression of the TFF2 splice variant relative to wild-type (wt) TFF2 mRNA using quantitative reverse transcriptase polymerase chain reaction (QRT-PCR). The ratio of TFF2 splice variant against wtTFF2 was analyzed for associations with clinical parameters. We found a novel TFF2 splice variant, exon 2 skipping (ΔEX2TFF2), resulting in a stop codon (TAG) at exon 1. The ΔEX2TFF2/wtTFF2 ratio in tumors was significantly higher than in normal tissue (P<0.01). Interestingly, high ΔEX2TFF2/wtTFF2 ratio was significantly associated with good prognosis compared with low ratio (P=0.017). In contrast, the presence of wtTFF2 protein was associated with poor survival of CCA patients (P=0.034). This is the first report of a trefoil factor splice variant and its potential application as a prognostic biomarker in CCA. PMID:22159958

A contracted DNA repeat in LHX3 intron 5 is associated with aberrant splicing and pituitary dwarfism in German shepherd dogs.

PubMed

Voorbij, Annemarie M W Y; van Steenbeek, Frank G; Vos-Loohuis, Manon; Martens, Ellen E C P; Hanson-Nilsson, Jeanette M; van Oost, Bernard A; Kooistra, Hans S; Leegwater, Peter A

2011-01-01

Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism.

A Contracted DNA Repeat in LHX3 Intron 5 Is Associated with Aberrant Splicing and Pituitary Dwarfism in German Shepherd Dogs

PubMed Central

Voorbij, Annemarie M. W. Y.; van Steenbeek, Frank G.; Vos-Loohuis, Manon; Martens, Ellen E. C. P.; Hanson-Nilsson, Jeanette M.; van Oost, Bernard A.; Kooistra, Hans S.; Leegwater, Peter A.

2011-01-01

Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism. PMID:22132174

Genome-wide profiling of chemoradiation‑induced changes in alternative splicing in colon cancer cells.

PubMed

Xiong, Wei; Gao, Depei; Li, Yunfeng; Liu, Xin; Dai, Peiling; Qin, Jiyong; Wang, Guanshun; Li, Kangming; Bai, Han; Li, Wenhui

2016-10-01

Alternative splicing is a key mechanism that regulates protein diversity and has been found to be associated with colon cancer progression and metastasis. However, the function of alternative splicing in chemoradiation‑resistant colon cancer remains elusive. In this study, we constructed a chemoradiation‑resistant colon cancer cell line. Through RNA-sequencing of normal and chemoradiation‑resistant colon cancer cells (HCT116), we found 818 genes that were highly expressed in the normal HCT116 cells, whereas 285 genes were highly expressed in the chemoradiation-resistant HCT116 (RCR-HCT116) cells. Gene ontology (GO) analysis showed that genes that were highly expressed in the HCT116 cells were enriched in GO categories related to cell cycle and cell division, whereas genes that were highly expressed in the RCR-HCT116 cells were associated with regulation of system processes and response to wounding. Analysis of alternative splicing events revealed that exon skipping was significantly increased in the chemoradiation‑resistant colon cancer cells. Moreover, we identified 323 alternative splicing events in 293 genes that were significantly different between the two different HCT116 cell types. These alternative splicing‑related genes were clustered functionally into several groups related with DNA replication, such as deoxyribonucleotide metabolic/catabolic processes, response to DNA damage stimulus and helicase activity. These findings enriched our knowledge by elucidating the function of alternative splicing in chemoradiation-resistant colon cancer.

Splicing of designer exons informs a biophysical model for exon definition

PubMed Central

Arias, Mauricio A.; Chasin, Lawrence A.

2015-01-01

Pre-mRNA molecules in humans contain mostly short internal exons flanked by longer introns. To explain the removal of such introns, exon recognition instead of intron recognition has been proposed. We studied this exon definition using designer exons (DEs) made up of three prototype modules of our own design: an exonic splicing enhancer (ESE), an exonic splicing silencer (ESS), and a Reference Sequence (R) predicted to be neither. Each DE was examined as the central exon in a three-exon minigene. DEs made of R modules showed a sharp size dependence, with exons shorter than 14 nt and longer than 174 nt splicing poorly. Changing the strengths of the splice sites improved longer exon splicing but worsened shorter exon splicing, effectively displacing the curve to the right. For the ESE we found, unexpectedly, that its enhancement efficiency was independent of its position within the exon. For the ESS we found a step-wise positional increase in its effects; it was most effective at the 3′ end of the exon. To apply these results quantitatively, we developed a biophysical model for exon definition of internal exons undergoing cotranscriptional splicing. This model features commitment to inclusion before the downstream exon is synthesized and competition between skipping and inclusion fates afterward. Collision of both exon ends to form an exon definition complex was incorporated to account for the effect of size; ESE/ESS effects were modeled on the basis of stabilization/destabilization. This model accurately predicted the outcome of independent experiments on more complex DEs that combined ESEs and ESSs. PMID:25492963

Functional assessment of a novel COL4A5 splice region variant and immunostaining of plucked hair follicles as an alternative method of diagnosis in X-linked Alport syndrome.

PubMed

Malone, Andrew F; Funk, Steven D; Alhamad, Tarek; Miner, Jeffrey H

2017-06-01

Many COL4A5 splice region variants have been described in patients with X-linked Alport syndrome, but few have been confirmed by functional analysis to actually cause defective splicing. We sought to demonstrate that a novel COL4A5 splice region variant in a family with Alport syndrome is pathogenic using functional studies. We also describe an alternative method of diagnosis. Targeted next-generation sequencing results of an individual with Alport syndrome were analyzed and the results confirmed by Sanger sequencing in family members. A splicing reporter minigene assay was used to examine the variant's effect on splicing in transfected cells. Plucked hair follicles from patients and controls were examined for collagen IV proteins using immunofluorescence microscopy. A novel splice region mutation in COL4A5, c.1780-6T>G, was identified and segregated with disease in this family. This variant caused frequent skipping of exon 25, resulting in a frameshift and truncation of collagen α5(IV) protein. We also developed and validated a new approach to characterize the expression of collagen α5(IV) protein in the basement membranes of plucked hair follicles. Using this approach we demonstrated reduced collagen α5(IV) protein in affected male and female individuals in this family, supporting frequent failure of normal splicing. Differing normal to abnormal transcript ratios in affected individuals carrying splice region variants may contribute to variable disease severity observed in Alport families. Examination of plucked hair follicles in suspected X-linked Alport syndrome patients may offer a less invasive alternative method of diagnosis and serve as a pathogenicity test for COL4A5 variants of uncertain significance.

Functional assessment of a novel COL4A5 splice region variant and immunostaining of plucked hair follicles as an alternative method of diagnosis in X-linked Alport syndrome

PubMed Central

Malone, Andrew F.; Funk, Steven D.; Alhamad, Tarek; Miner, Jeffrey H.

2016-01-01

Introduction Many COL4A5 splice region variants have been described in patients with X-linked Alport syndrome, but few have been confirmed by functional analysis to actually cause defective splicing. We sought to demonstrate that a novel COL4A5 splice region variant in a family with Alport syndrome is pathogenic using functional studies. We also describe an alternative method of diagnosis. Methods We analyzed targeted next-generation sequencing results of an individual with Alport syndrome and confirmed results by Sanger sequencing in family members. A splicing reporter minigene assay was used to examine the variant’s effect on splicing in transfected cells. Plucked hair follicles from patients and controls were examined for collagen IV proteins using immunofluorescence microscopy. Results A novel splice region mutation in COL4A5, c.1780-6T>G, was identified and segregated with disease in this family. This variant caused frequent skipping of exon 25, resulting in a frameshift and truncation of collagen α5(IV) protein. We also developed and validated a new approach to characterize the expression of collagen α5(IV) protein in the basement membranes of plucked hair follicles. We demonstrated reduced collagen α5(IV) protein in affected male and female individuals in this family, supporting frequent failure of normal splicing. Conclusions Differing normal to abnormal transcript ratios in affected individuals carrying splice region variants may contribute to variable disease severity observed in Alport families. Examination of plucked hair follicles in suspected X-linked Alport syndrome patients may offer a less invasive alternative method of diagnosis and serve as a pathogenicity test for COL4A5 variants of uncertain significance. PMID:28013382

Intragenic motifs regulate the transcriptional complexity of Pkhd1/PKHD1

PubMed Central

Boddu, Ravindra; Yang, Chaozhe; O’Connor, Amber K.; Hendrickson, Robert Curtis; Boone, Braden; Cui, Xiangqin; Garcia-Gonzalez, Miguel; Igarashi, Peter; Onuchic, Luiz F.; Germino, Gregory G.

2014-01-01

Autosomal recessive polycystic kidney disease (ARPKD) results from mutations in the human PKHD1 gene. Both this gene, and its mouse ortholog, Pkhd1, are primarily expressed in renal and biliary ductal structures. The mouse protein product, fibrocystin/polyductin complex (FPC), is a 445-kDa protein encoded by a 67-exon transcript that spans >500 kb of genomic DNA. In the current study, we observed multiple alternatively spliced Pkhd1 transcripts that varied in size and exon composition in embryonic mouse kidney, liver, and placenta samples, as well as among adult mouse pancreas, brain, heart, lung, testes, liver, and kidney. Using reverse transcription PCR and RNASeq, we identified 22 novel Pkhd1 kidney transcripts with unique exon junctions. Various mechanisms of alternative splicing were observed, including exon skipping, use of alternate acceptor/donor splice sites, and inclusion of novel exons. Bioinformatic analyses identified, and exon-trapping minigene experiments validated, consensus binding sites for serine/arginine-rich proteins that modulate alternative splicing. Using site-directed mutagenesis, we examined the functional importance of selected splice enhancers. In addition, we demonstrated that many of the novel transcripts were polysome bound, thus likely translated. Finally, we determined that the human PKHD1 R760H missense variant alters a splice enhancer motif that disrupts exon splicing in vitro and is predicted to truncate the protein. Taken together, these data provide evidence of the complex transcriptional regulation of Pkhd1/PKHD1 and identified motifs that regulate its splicing. Our studies indicate that Pkhd1/PKHD1 transcription is modulated, in part by intragenic factors, suggesting that aberrant PKHD1 splicing represents an unappreciated pathogenic mechanism in ARPKD. PMID:24984783

Whole blood transcriptional profiling comparison between different milk yield of Chinese Holstein cows using RNA-seq data.

PubMed

Bai, Xue; Zheng, Zhuqing; Liu, Bin; Ji, Xiaoyang; Bai, Yongsheng; Zhang, Wenguang

2016-08-22

The objective of this research was to investigate the variation of gene expression in the blood transcriptome profile of Chinese Holstein cows associated to the milk yield traits. We used RNA-seq to generate the bovine transcriptome from the blood of 23 lactating Chinese Holstein cows with extremely high and low milk yield. A total of 100 differentially expressed genes (DEGs) (p < 0.05, FDR < 0.05) were revealed between the high and low groups. Gene ontology (GO) analysis demonstrated that the 100 DEGs were enriched in specific biological processes with regard to defense response, immune response, inflammatory response, icosanoid metabolic process, and fatty acid metabolic process (p < 0.05). The KEGG pathway analysis with 100 DEGs revealed that the most statistically-significant metabolic pathway was related with Toll-like receptor signaling pathway (p < 0.05). The expression level of four selected DEGs was analyzed by qRT-PCR, and the results indicated that the expression patterns were consistent with the deep sequencing results by RNA-Seq. Furthermore, alternative splicing analysis of 100 DEGs demonstrated that there were different splicing pattern between high and low yielders. The alternative 3' splicing site was the major splicing pattern detected in high yielders. However, in low yielders the major type was exon skipping. This study provides a non-invasive method to identify the DEGs in cattle blood using RNA-seq for milk yield. The revealed 100 DEGs between Holstein cows with extremely high and low milk yield, and immunological pathway are likely involved in milk yield trait. Finally, this study allowed us to explore associations between immune traits and production traits related to milk production.

A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish.

PubMed

Radev, Zlatko; Hermel, Jean-Michel; Elipot, Yannick; Bretaud, Sandrine; Arnould, Sylvain; Duchateau, Philippe; Ruggiero, Florence; Joly, Jean-Stéphane; Sohm, Frédéric

2015-01-01

Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders.

A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish

PubMed Central

Elipot, Yannick; Bretaud, Sandrine; Arnould, Sylvain; Duchateau, Philippe; Ruggiero, Florence; Joly, Jean-Stéphane; Sohm, Frédéric

2015-01-01

Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders. PMID:26221953

The Status of Exon Skipping as a Therapeutic Approach to Duchenne Muscular Dystrophy

PubMed Central

Lu, Qi-Long; Yokota, Toshifumi; Takeda, Shin'ichi; Garcia, Luis; Muntoni, Francesco; Partridge, Terence

2011-01-01

Duchenne muscular dystrophy (DMD) is associated with mutations in the dystrophin gene that disrupt the open reading frame whereas the milder Becker's form is associated with mutations which leave an in-frame mRNA transcript that can be translated into a protein that includes the N- and C- terminal functional domains. It has been shown that by excluding specific exons at, or adjacent to, frame-shifting mutations, open reading frame can be restored to an out-of-frame mRNA, leading to the production of a partially functional Becker-like dystrophin protein. Such targeted exclusion can be achieved by administration of oligonucleotides that are complementary to sequences that are crucial to normal splicing of the exon into the transcript. This principle has been validated in mouse and canine models of DMD with a number of variants of oligonucleotide analogue chemistries and by transduction with adeno-associated virus (AAV)-small nuclear RNA (snRNA) reagents encoding the antisense sequence. Two different oligonucleotide agents are now being investigated in human trials for splicing out of exon 51 with some early indications of success at the biochemical level. PMID:20978473

Circular RNAs: Unexpected outputs of many protein-coding genes

PubMed Central

Wilusz, Jeremy E.

2017-01-01

ABSTRACT Pre-mRNAs from thousands of eukaryotic genes can be non-canonically spliced to generate circular RNAs, some of which accumulate to higher levels than their associated linear mRNA. Recent work has revealed widespread mechanisms that dictate whether the spliceosome generates a linear or circular RNA. For most genes, circular RNA biogenesis via backsplicing is far less efficient than canonical splicing, but circular RNAs can accumulate due to their long half-lives. Backsplicing is often initiated when complementary sequences from different introns base pair and bring the intervening splice sites close together. This process is further regulated by the combinatorial action of RNA binding proteins, which allow circular RNAs to be expressed in unique patterns. Some genes do not require complementary sequences to generate RNA circles and instead take advantage of exon skipping events. It is still unclear what most mature circular RNAs do, but future investigations into their functions will be facilitated by recently described methods to modulate circular RNA levels. PMID:27571848

A syndrome of microcephaly, short stature, polysyndactyly, and dental anomalies caused by a homozygous KATNB1 mutation.

PubMed

Yigit, Gökhan; Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Möller-Hartmann, Claudia; Altmüller, Janine; Thiele, Holger; Nürnberg, Peter; Wollnik, Bernd

2016-03-01

Using whole-exome sequencing, we identified a homozygous acceptor splice-site mutation in intron 6 of the KATNB1 gene in a patient from a consanguineous Turkish family who presented with congenital microcephaly, lissencephaly, short stature, polysyndactyly, and dental abnormalities. cDNA analysis revealed complete loss of the natural acceptor splice-site resulting either in the usage of an alternative, exonic acceptor splice-site inducing a frame-shift and premature protein truncation or, to a minor extent, in complete skipping of exon 7. Both effects most likely lead to complete loss of KATNB1 function. Homozygous and compound heterozygous mutations in KATNB1 have very recently been described as a cause of microcephaly with brain malformations and seizures. We extend the KATNB1 associated phenotype by describing a syndrome characterized by primordial dwarfism, lissencephaly, polysyndactyly, and dental anomalies, which is caused by a homozygous truncating KATNB1 mutation. © 2015 Wiley Periodicals, Inc.

Alternative RNA splicing and gastric cancer.

PubMed

Li, Ying; Yuan, Yuan

2017-07-01

Alternative splicing (AS) linked to diseases, especially to tumors. Recently, more and more studies focused on the relationship between AS and gastric cancer (GC). This review surveyed the hot topic from four aspects: First, the common types of AS in cancer, including exon skipping, intron retention, mutually exclusive exon, alternative 5 ' or 3' splice site, alternative first or last exon and alternative 3' untranslated regions. Second, basic mechanisms of AS and its relationship with cancer. RNA splicing in eukaryotes follows the GT-AG rule by both cis-elements and trans-acting factors regulatory. Through RNA splicing, different proteins with different forms and functions can be produced and may be associated with carcinogenesis. Third, AS types of GC-related genes and their splicing variants. In this paper, we listed 10 common genes with AS and illustrated its possible molecular mechanisms owing to genetic variation (mutation and /or polymorphism). Fourth, the splicing variants of GC-associated genes and gastric carcinogenesis, invasion and metastasis. Many studies have found that the different splicing variants of the same gene are differentially expressed in GC and its precancerous diseases, suggesting AS has important implications in GC development. Taking together, this review highlighted the role of AS and splicing variants in the process of GC. We hope that this is not only beneficial to advances in the study field of GC, but also can provide valuable information to other similar tumor research.Although we already know some gene splicing and splicing variants play an important role in the development of GC, but many phenomena and mechanisms are still unknown. For example, how the tumor microenvironment and signal transduction pathway effect the forming and function of AS? Unfortunately, this review did not cover the contents because the current study is limited. It is no doubt that clarifying the phenomena and mechanisms of these unknown may help to reveal the relationship of AS with complex tumor genetic variation and the occurrence and development of tumors. Copyright © 2016 Elsevier B.V. All rights reserved.

A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals.

PubMed

Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M

2017-01-01

Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.

Characterization of variegate porphyria mutations using a minigene approach.

PubMed

Granata, Barbara Xoana; Baralle, Marco; De Conti, Laura; Parera, Victoria; Rossetti, Maria Victoria

2015-01-01

Porphyrias are a group of metabolic diseases that affect the skin and/or nervous system. In 2008, three unrelated patients were diagnosed with variegate porphyria at the CIPYP (Centro de Investigaciones sobre Porfirinas y Porfirias). Sequencing of the protoporphyrinogen oxidase gene, the gene altered in this type of porphyria, revealed three previously undescribed mutations: c.338+3insT, c.807G>A, and c.808-1G>C. As these mutations do not affect the protein sequence, we hypothesized that they might be splicing mutations. RT-PCRs performed on the patient's mRNAs showed normal mRNA or no amplification at all. This result indicated that the aberrant spliced transcript is possibly being degraded. In order to establish whether they were responsible or not for the patient's disease by causing aberrant splicing, we utilized a minigene approach. We found that the three mutations lead to exon skipping; therefore, the abnormal mRNAs are most likely degraded by a mechanism such as nonsense-mediated decay. In conclusion, these mutations are responsible for the disease because they alter the normal splicing pathway, thus providing a functional explanation for the appearance of disease and highlighting the use of minigene assays to complement transcript analysis.

Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

PubMed

Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

2003-04-01

Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

Antisense Masking of an hnRNP A1/A2 Intronic Splicing Silencer Corrects SMN2 Splicing in Transgenic Mice

PubMed Central

Hua, Yimin; Vickers, Timothy A.; Okunola, Hazeem L.; Bennett, C. Frank; Krainer, Adrian R.

2008-01-01

survival of motor neuron 2, centromeric (SMN2) is a gene that modifies the severity of spinal muscular atrophy (SMA), a motor-neuron disease that is the leading genetic cause of infant mortality. Increasing inclusion of SMN2 exon 7, which is predominantly skipped, holds promise to treat or possibly cure SMA; one practical strategy is the disruption of splicing silencers that impair exon 7 recognition. By using an antisense oligonucleotide (ASO)-tiling method, we systematically screened the proximal intronic regions flanking exon 7 and identified two intronic splicing silencers (ISSs): one in intron 6 and a recently described one in intron 7. We analyzed the intron 7 ISS by mutagenesis, coupled with splicing assays, RNA-affinity chromatography, and protein overexpression, and found two tandem hnRNP A1/A2 motifs within the ISS that are responsible for its inhibitory character. Mutations in these two motifs, or ASOs that block them, promote very efficient exon 7 inclusion. We screened 31 ASOs in this region and selected two optimal ones to test in human SMN2 transgenic mice. Both ASOs strongly increased hSMN2 exon 7 inclusion in the liver and kidney of the transgenic animals. Our results show that the high-resolution ASO-tiling approach can identify cis-elements that modulate splicing positively or negatively. Most importantly, our results highlight the therapeutic potential of some of these ASOs in the context of SMA. PMID:18371932

Transcriptomic insights into the alternative splicing-mediated adaptation of the entomopathogenic fungus Beauveria bassiana to host niches: autophagy-related gene 8 as an example.

PubMed

Dong, Wei-Xia; Ding, Jin-Li; Gao, Yang; Peng, Yue-Jin; Feng, Ming-Guang; Ying, Sheng-Hua

2017-10-01

Alternative splicing (AS) regulates various biological processes in fungi by extending the cellular proteome. However, comprehensive studies investigating AS in entomopathogenic fungi are lacking. Based on transcriptome data obtained via dual RNA-seq, the first overview of AS events was developed for Beauveria bassiana growing in an insect haemocoel. The AS was demonstrated for 556 of 8840 expressed genes, accounting for 5.4% of the total genes in B. bassiana. Intron retention was the most abundant type of AS, accounting for 87.1% of all splicing events and exon skipping events were rare, only accounting for 2.0% of all events. Functional distribution analysis indicated an association between alternatively spliced genes and several physiological processes. Notably, B. bassiana autophagy-related gene 8 (BbATG8), an indispensable gene for autophagy, was spliced at an alternative 5' splice site to generate two transcripts (BbATG8-α and BbATG8-β). The BbATG8-α transcript was necessary for fungal autophagy and oxidation tolerance, while the BbATG8-β transcript was not. These two transcripts differentially contributed to the formation of conidia or blastospores as well as fungal virulence. Thus, AS acts as a powerful post-transcriptional regulatory strategy in insect mycopathogens and significantly mediates fungal transcriptional adaption to host niches. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

MRI roadmap-guided transendocardial delivery of exon-skipping recombinant adeno-associated virus restores dystrophin expression in a canine model of Duchenne muscular dystrophy.

PubMed

Barbash, I M; Cecchini, S; Faranesh, A Z; Virag, T; Li, L; Yang, Y; Hoyt, R F; Kornegay, J N; Bogan, J R; Garcia, L; Lederman, R J; Kotin, R M

2013-03-01

Duchenne muscular dystrophy (DMD) cardiomyopathy patients currently have no therapeutic options. We evaluated catheter-based transendocardial delivery of a recombinant adeno-associated virus (rAAV) expressing a small nuclear U7 RNA (U7smOPT) complementary to specific cis-acting splicing signals. Eliminating specific exons restores the open reading frame resulting in translation of truncated dystrophin protein. To test this approach in a clinically relevant DMD model, golden retriever muscular dystrophy (GRMD) dogs received serotype 6 rAAV-U7smOPT via the intracoronary or transendocardial route. Transendocardial injections were administered with an injection-tipped catheter and fluoroscopic guidance using X-ray fused with magnetic resonance imaging (XFM) roadmaps. Three months after treatment, tissues were analyzed for DNA, RNA, dystrophin protein, and histology. Whereas intracoronary delivery did not result in effective transduction, transendocardial injections, XFM guidance, enabled 30±10 non-overlapping injections per animal. Vector DNA was detectable in all samples tested and ranged from <1 to >3000 vector genome copies per cell. RNA analysis, western blot analysis, and immunohistology demonstrated extensive expression of skipped RNA and dystrophin protein in the treated myocardium. Left ventricular function remained unchanged over a 3-month follow-up. These results demonstrated that effective transendocardial delivery of rAAV-U7smOPT was achieved using XFM. This approach restores an open reading frame for dystrophin in affected dogs and has potential clinical utility.

Combined genetic and splicing analysis of BRCA1 c.[594-2A>C; 641A>G] highlights the relevance of naturally occurring in-frame transcripts for developing disease gene variant classification algorithms

PubMed Central

de la Hoya, Miguel; Soukarieh, Omar; López-Perolio, Irene; Vega, Ana; Walker, Logan C.; van Ierland, Yvette; Baralle, Diana; Santamariña, Marta; Lattimore, Vanessa; Wijnen, Juul; Whiley, Philip; Blanco, Ana; Raponi, Michela; Hauke, Jan; Wappenschmidt, Barbara; Becker, Alexandra; Hansen, Thomas V. O.; Behar, Raquel; Investigators, KConFaB; Niederacher, Diether; Arnold, Norbert; Dworniczak, Bernd; Steinemann, Doris; Faust, Ulrike; Rubinstein, Wendy; Hulick, Peter J.; Houdayer, Claude; Caputo, Sandrine M.; Castera, Laurent; Pesaran, Tina; Chao, Elizabeth; Brewer, Carole; Southey, Melissa C.; van Asperen, Christi J.; Singer, Christian F.; Sullivan, Jan; Poplawski, Nicola; Mai, Phuong; Peto, Julian; Johnson, Nichola; Burwinkel, Barbara; Surowy, Harald; Bojesen, Stig E.; Flyger, Henrik; Lindblom, Annika; Margolin, Sara; Chang-Claude, Jenny; Rudolph, Anja; Radice, Paolo; Galastri, Laura; Olson, Janet E.; Hallberg, Emily; Giles, Graham G.; Milne, Roger L.; Andrulis, Irene L.; Glendon, Gord; Hall, Per; Czene, Kamila; Blows, Fiona; Shah, Mitul; Wang, Qin; Dennis, Joe; Michailidou, Kyriaki; McGuffog, Lesley; Bolla, Manjeet K.; Antoniou, Antonis C.; Easton, Douglas F.; Couch, Fergus J.; Tavtigian, Sean; Vreeswijk, Maaike P.; Parsons, Michael; Meeks, Huong D.; Martins, Alexandra; Goldgar, David E.; Spurdle, Amanda B.

2016-01-01

A recent analysis using family history weighting and co-observation classification modeling indicated that BRCA1 c.594-2A > C (IVS9-2A > C), previously described to cause exon 10 skipping (a truncating alteration), displays characteristics inconsistent with those of a high risk pathogenic BRCA1 variant. We used large-scale genetic and clinical resources from the ENIGMA, CIMBA and BCAC consortia to assess pathogenicity of c.594-2A > C. The combined odds for causality considering case-control, segregation and breast tumor pathology information was 3.23 × 10−8. Our data indicate that c.594-2A > C is always in cis with c.641A > G. The spliceogenic effect of c.[594-2A > C;641A > G] was characterized using RNA analysis of human samples and splicing minigenes. As expected, c.[594-2A > C; 641A > G] caused exon 10 skipping, albeit not due to c.594-2A > C impairing the acceptor site but rather by c.641A > G modifying exon 10 splicing regulatory element(s). Multiple blood-based RNA assays indicated that the variant allele did not produce detectable levels of full-length transcripts, with a per allele BRCA1 expression profile composed of ≈70–80% truncating transcripts, and ≈20–30% of in-frame Δ9,10 transcripts predicted to encode a BRCA1 protein with tumor suppression function. We confirm that BRCA1c.[594-2A > C;641A > G] should not be considered a high-risk pathogenic variant. Importantly, results from our detailed mRNA analysis suggest that BRCA-associated cancer risk is likely not markedly increased for individuals who carry a truncating variant in BRCA1 exons 9 or 10, or any other BRCA1 allele that permits 20–30% of tumor suppressor function. More generally, our findings highlight the importance of assessing naturally occurring alternative splicing for clinical evaluation of variants in disease-causing genes. PMID:27008870

Gene expression and splicing alterations analyzed by high throughput RNA sequencing of chronic lymphocytic leukemia specimens.

PubMed

Liao, Wei; Jordaan, Gwen; Nham, Phillipp; Phan, Ryan T; Pelegrini, Matteo; Sharma, Sanjai

2015-10-16

To determine differentially expressed and spliced RNA transcripts in chronic lymphocytic leukemia specimens a high throughput RNA-sequencing (HTS RNA-seq) analysis was performed. Ten CLL specimens and five normal peripheral blood CD19+ B cells were analyzed by HTS RNA-seq. The library preparation was performed with Illumina TrueSeq RNA kit and analyzed by Illumina HiSeq 2000 sequencing system. An average of 48.5 million reads for B cells, and 50.6 million reads for CLL specimens were obtained with 10396 and 10448 assembled transcripts for normal B cells and primary CLL specimens respectively. With the Cuffdiff analysis, 2091 differentially expressed genes (DEG) between B cells and CLL specimens based on FPKM (fragments per kilobase of transcript per million reads and false discovery rate, FDR q < 0.05, fold change >2) were identified. Expression of selected DEGs (n = 32) with up regulated and down regulated expression in CLL from RNA-seq data were also analyzed by qRT-PCR in a test cohort of CLL specimens. Even though there was a variation in fold expression of DEG genes between RNA-seq and qRT-PCR; more than 90 % of analyzed genes were validated by qRT-PCR analysis. Analysis of RNA-seq data for splicing alterations in CLL and B cells was performed by Multivariate Analysis of Transcript Splicing (MATS analysis). Skipped exon was the most frequent splicing alteration in CLL specimens with 128 significant events (P-value <0.05, minimum inclusion level difference >0.1). The RNA-seq analysis of CLL specimens identifies novel DEG and alternatively spliced genes that are potential prognostic markers and therapeutic targets. High level of validation by qRT-PCR for a number of DEG genes supports the accuracy of this analysis. Global comparison of transcriptomes of B cells, IGVH non-mutated CLL (U-CLL) and mutated CLL specimens (M-CLL) with multidimensional scaling analysis was able to segregate CLL and B cell transcriptomes but the M-CLL and U-CLL transcriptomes were indistinguishable. The analysis of HTS RNA-seq data to identify alternative splicing events and other genetic abnormalities specific to CLL is an added advantage of RNA-seq that is not feasible with other genome wide analysis.

An Ethyl-Nitrosourea-Induced Point Mutation in Phex Causes Exon Skipping, X-Linked Hypophosphatemia, and Rickets

PubMed Central

Carpinelli, Marina R.; Wicks, Ian P.; Sims, Natalie A.; O’Donnell, Kristy; Hanzinikolas, Katherine; Burt, Rachel; Foote, Simon J.; Bahlo, Melanie; Alexander, Warren S.; Hilton, Douglas J.

2002-01-01

We describe the clinical, genetic, biochemical, and molecular characterization of a mouse that arose in the first generation (G1) of a random mutagenesis screen with the chemical mutagen ethyl-nitrosourea. The mouse was observed to have skeletal abnormalities inherited with an X-linked dominant pattern of inheritance. The causative mutation, named Skeletal abnormality 1 (Ska1), was shown to be a single base pair mutation in a splice donor site immediately following exon 8 of the Phex (phosphate-regulating gene with homologies to endopeptidases located on the X-chromosome) gene. This point mutation caused skipping of exon 8 from Phex mRNA, hypophosphatemia, and features of rickets. This experimentally induced phenotype mirrors the human condition X-linked hypophosphatemia; directly confirms the role of Phex in phosphate homeostasis, normal skeletal development, and rickets; and illustrates the power of mutagenesis in exploring animal models of human disease. PMID:12414538

An ethyl-nitrosourea-induced point mutation in phex causes exon skipping, x-linked hypophosphatemia, and rickets.

PubMed

Carpinelli, Marina R; Wicks, Ian P; Sims, Natalie A; O'Donnell, Kristy; Hanzinikolas, Katherine; Burt, Rachel; Foote, Simon J; Bahlo, Melanie; Alexander, Warren S; Hilton, Douglas J

2002-11-01

We describe the clinical, genetic, biochemical, and molecular characterization of a mouse that arose in the first generation (G(1)) of a random mutagenesis screen with the chemical mutagen ethyl-nitrosourea. The mouse was observed to have skeletal abnormalities inherited with an X-linked dominant pattern of inheritance. The causative mutation, named Skeletal abnormality 1 (Ska1), was shown to be a single base pair mutation in a splice donor site immediately following exon 8 of the Phex (phosphate-regulating gene with homologies to endopeptidases located on the X-chromosome) gene. This point mutation caused skipping of exon 8 from Phex mRNA, hypophosphatemia, and features of rickets. This experimentally induced phenotype mirrors the human condition X-linked hypophosphatemia; directly confirms the role of Phex in phosphate homeostasis, normal skeletal development, and rickets; and illustrates the power of mutagenesis in exploring animal models of human disease.

Identification and characterization of ALK kinase splicing isoforms in non-small-cell lung cancer

PubMed Central

de Figueiredo-Pontes, Lorena Lobo; Wong, Daisy Wing-Sze; Tin, Vick Pui-Chi; Chung, Lap-Ping; Yasuda, Hiroyuki; Yamaguchi, Norihiro; Nakayama, Sohei; Jänne, Pasi Antero; Wong, Maria Pik; Kobayashi, Susumu Soeda; Costa, Daniel Botelho

2014-01-01

Purpose: Anaplastic lymphoma kinase (ALK) rearrangements are present in an important subset of non-small-cell lung cancer (NSCLC) and predict for response to the tyrosine kinase inhibitor crizotinib. In this study, we evaluated the yet unknown frequency and functional role of ALK splicing isoforms in NSCLC. Experimental Design: We analyzed 270 cases of NSCLC for ALK kinase domain splicing aberrations, and in addition generated constructs with full length EML4-ALK (E13;A20) and a splicing isoform. Results: Splicing isoforms of the kinase domain of ALK - including complete skipping of exon 23 (ALKdel23, ALK p.I1171fs*42) and exon 27 (ALKdel27, ALK p.T1312fs*0) - were identified in 11.1% (30/270 cases) of NSCLC, and these changes co-existed with ALK rearrangements, KRAS mutations and EGFR mutations. ALK splicing isoforms were observed with full length EML4-ALK in crizotinib-naïve and treated NSCLCs. ALK T1312fs*0 was unable to render cells solely dependent on ALK signaling. Unlike EML4-ALK and EML4-ALK p.L1196M, EML4-ALK T1312fs*0 did not autophosphorylate ALK or other phospho-tyrosine sites. Co-expression of equal amounts of EML4-ALK T1312fs*0 and EML4-ALK did not result in resistance to crizotinib, while co-expression of EML4-ALK L1196M with EML4-ALK resulted in resistance to inhibition of ALK by crizotinib. Conclusions: ALK kinase splicing isoforms were present in NSCLC and even if translated seemed to be non-functional variants of ALK. PMID:24419423

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

PubMed Central

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

2016-01-01

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

PubMed

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

2016-01-12

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy

PubMed Central

Ottesen, Eric W.

2017-01-01

Abstract Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 (SMN1) gene. SMN2, a nearly identical copy of SMN1, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza™ (synonyms: Nusinersen, IONIS-SMNRX, ISIS-SMNRX), an antisense drug based on ISS-N1 target. Spinraza™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols. PMID:28400976

Lnx2 ubiquitin ligase is essential for exocrine cell differentiation in the early zebrafish pancreas

PubMed Central

Won, Minho; Ro, Hyunju; Dawid, Igor B.

2015-01-01

The gene encoding the E3 ubiquitin ligase Ligand of Numb protein-X (Lnx)2a is expressed in the ventral-anterior pancreatic bud of zebrafish embryos in addition to its expression in the brain. Knockdown of Lnx2a by using an exon 2/intron 2 splice morpholino resulted in specific inhibition of the differentiation of ventral bud derived exocrine cell types, with little effect on endocrine cell types. A frame shifting null mutation in lnx2a did not mimic this phenotype, but a mutation that removed the exon 2 splice donor site did. We found that Lnx2b functions in a redundant manner with its paralog Lnx2a. Inhibition of lnx2a exon 2/3 splicing causes exon 2 skipping and leads to the production of an N-truncated protein that acts as an interfering molecule. Thus, the phenotype characterized by inhibition of exocrine cell differentiation requires inactivation of both Lnx2a and Lnx2b. Human LNX1 is known to destabilize Numb, and we show that inhibition of Numb expression rescues the Lnx2a/b-deficient phenotype. Further, Lnx2a/b inhibition leads to a reduction in the number of Notch active cells in the pancreas. We suggest that Lnx2a/b function to fine tune the regulation of Notch through Numb in the differentiation of cell types in the early zebrafish pancreas. Further, the complex relationships among genotype, phenotype, and morpholino effect in this case may be instructive in the ongoing consideration of morpholino use. PMID:26392552

Lnx2 ubiquitin ligase is essential for exocrine cell differentiation in the early zebrafish pancreas.

PubMed

Won, Minho; Ro, Hyunju; Dawid, Igor B

2015-10-06

The gene encoding the E3 ubiquitin ligase Ligand of Numb protein-X (Lnx)2a is expressed in the ventral-anterior pancreatic bud of zebrafish embryos in addition to its expression in the brain. Knockdown of Lnx2a by using an exon 2/intron 2 splice morpholino resulted in specific inhibition of the differentiation of ventral bud derived exocrine cell types, with little effect on endocrine cell types. A frame shifting null mutation in lnx2a did not mimic this phenotype, but a mutation that removed the exon 2 splice donor site did. We found that Lnx2b functions in a redundant manner with its paralog Lnx2a. Inhibition of lnx2a exon 2/3 splicing causes exon 2 skipping and leads to the production of an N-truncated protein that acts as an interfering molecule. Thus, the phenotype characterized by inhibition of exocrine cell differentiation requires inactivation of both Lnx2a and Lnx2b. Human LNX1 is known to destabilize Numb, and we show that inhibition of Numb expression rescues the Lnx2a/b-deficient phenotype. Further, Lnx2a/b inhibition leads to a reduction in the number of Notch active cells in the pancreas. We suggest that Lnx2a/b function to fine tune the regulation of Notch through Numb in the differentiation of cell types in the early zebrafish pancreas. Further, the complex relationships among genotype, phenotype, and morpholino effect in this case may be instructive in the ongoing consideration of morpholino use.

Vectorization of morpholino oligomers by the (R-Ahx-R)4 peptide allows efficient splicing correction in the absence of endosomolytic agents.

PubMed

Abes, Saïd; Moulton, Hong M; Clair, Philippe; Prevot, Paul; Youngblood, Derek S; Wu, Rebecca P; Iversen, Patrick L; Lebleu, Bernard

2006-12-01

The efficient and non-toxic nuclear delivery of steric-block oligonucleotides (ON) is a prerequisite for therapeutic strategies involving splice correction or exon skipping. Cationic cell penetrating peptides (CPPs) have given rise to much interest for the intracellular delivery of biomolecules, but their efficiency in promoting cytoplasmic or nuclear delivery of oligonucleotides has been hampered by endocytic sequestration and subsequent degradation of most internalized material in endocytic compartments. In the present study, we compared the splice correction activity of three different CPPs conjugated to PMO(705), a steric-block ON targeted against the mutated splicing site of human beta-globin pre-mRNA in the HeLa pLuc705 splice correction model. In contrast to Tat48-60 (Tat) and oligoarginine (R(9)F(2)) PMO(705) conjugates, the 6-aminohexanoic-spaced oligoarginine (R-Ahx-R)(4)-PMO(705) conjugate was able to promote an efficient splice correction in the absence of endosomolytic agents. Our mechanistic investigations about its uptake mechanisms lead to the conclusion that these three vectors are internalized using the same endocytic route involving proteoglycans, but that the (R-Ahx-R)(4)-PMO(705) conjugate has the unique ability to escape from lysosomial fate and to access to the nuclear compartment. This vector, which has displays an extremely low cytotoxicity, the ability to function without chloroquine adjunction and in the presence of serum proteins. It thus offers a promising lead for the development of vectors able to enhance the delivery of therapeutic steric-block ON in clinically relevant models.

Splicing-related single nucleotide polymorphism of RAB, member of RAS oncogene family like 2B (RABL2B) jeopardises semen quality in Chinese Holstein bulls.

PubMed

Wang, Xiuge; Cui, Xiaohui; Zhang, Yan; Hao, Haisheng; Ju, Zhihua; Liu, Deyu; Jiang, Qiang; Yang, Chunhong; Sun, Yan; Wang, Changfa; Huang, Jinming; Zhu, Huabin

2017-11-01

RAB, member of RAS oncogene family like 2B (RABL2B) is a member of a poorly characterised clade of the RAS GTPase superfamily, which plays an essential role in male fertility, sperm intraflagellar transport and tail assembly. In the present study, we identified a novel RABL2B splice variant in bovine testis and spermatozoa. This splice variant, designated RABL2B-TV, is characterised by exon 2 skipping. Moreover, a single nucleotide polymorphism (SNP), namely c.125G>A, was found within the exonic splicing enhancer (ESE) motif, indicating that the SNP caused the production of the RABL2B-TV aberrant splice variant. This was demonstrated by constructing a pSPL3 exon capturing vector with different genotypes and transfecting these vectors into murine Leydig tumour cell line (MLTC-1) cells. Expression of the RABL2B-TV transcript was lower in semen from high- versus low-performance bulls. Association analysis showed that sperm deformity rate was significantly lower in Chinese Holstein bulls with the GG or GA genotype than in bulls with the AA genotype (P<0.05). In addition, initial sperm motility was significantly higher in individuals with the GG or GA genotype than in individuals with the AA genotype (P<0.05). The findings of the present study suggest that the difference in semen quality in bulls with different RABL2B genotypes is generated via an alternative splicing mechanism caused by a functional SNP within the ESE motif.

RNA interference knockdown of DNA methyl-transferase 3 affects gene alternative splicing in the honey bee

PubMed Central

Li-Byarlay, Hongmei; Li, Yang; Stroud, Hume; Feng, Suhua; Newman, Thomas C.; Kaneda, Megan; Hou, Kirk K.; Worley, Kim C.; Elsik, Christine G.; Wickline, Samuel A.; Jacobsen, Steven E.; Ma, Jian; Robinson, Gene E.

2013-01-01

Studies of DNA methylation from fungi, plants, and animals indicate that gene body methylation is ancient and highly conserved in eukaryotic genomes, but its role has not been clearly defined. It has been postulated that regulation of alternative splicing of transcripts was an original function of DNA methylation, but a direct experimental test of the effect of methylation on alternative slicing at the whole genome level has never been performed. To do this, we developed a unique method to administer RNA interference (RNAi) in a high-throughput and noninvasive manner and then used it to knock down the expression of DNA methyl-transferase 3 (dnmt3), which is required for de novo DNA methylation. We chose the honey bee (Apis mellifera) for this test because it has recently emerged as an important model organism for studying the effects of DNA methylation on development and social behavior, and DNA methylation in honey bees is predominantly on gene bodies. Here we show that dnmt3 RNAi decreased global genomic methylation level as expected and in addition caused widespread and diverse changes in alternative splicing in fat tissue. Four different types of splicing events were affected by dnmt3 gene knockdown, and change in two types, exon skipping and intron retention, was directly related to decreased methylation. These results demonstrate that one function of gene body DNA methylation is to regulate alternative splicing. PMID:23852726

Alternative splicing regulated by butyrate in bovine epithelial cells.

PubMed

Wu, Sitao; Li, Congjun; Huang, Wen; Li, Weizhong; Li, Robert W

2012-01-01

As a signaling molecule and an inhibitor of histone deacetylases (HDACs), butyrate exerts its impact on a broad range of biological processes, such as apoptosis and cell proliferation, in addition to its critical role in energy metabolism in ruminants. This study examined the effect of butyrate on alternative splicing in bovine epithelial cells using RNA-seq technology. Junction reads account for 11.28 and 12.32% of total mapped reads between the butyrate-treated (BT) and control (CT) groups. 201,326 potential splicing junctions detected were supported by ≥ 3 junction reads. Approximately 94% of these junctions conformed to the consensus sequence (GT/AG) while ~3% were GC/AG junctions. No AT/AC junctions were observed. A total of 2,834 exon skipping events, supported by a minimum of 3 junction reads, were detected. At least 7 genes, their mRNA expression significantly affected by butyrate, also had exon skipping events differentially regulated by butyrate. Furthermore, COL5A3, which was induced 310-fold by butyrate (FDR <0.001) at the gene level, had a significantly higher number of junction reads mapped to Exon#8 (Donor) and Exon#11 (Acceptor) in BT. This event had the potential to result in the formation of a COL5A3 mRNA isoform with 2 of the 69 exons missing. In addition, 216 differentially expressed transcript isoforms regulated by butyrate were detected. For example, Isoform 1 of ORC1 was strongly repressed by butyrate while Isoform 2 remained unchanged. Butyrate physically binds to and inhibits all zinc-dependent HDACs except HDAC6 and HDAC10. Our results provided evidence that butyrate also regulated deacetylase activities of classical HDACs via its transcriptional control. Moreover, thirteen gene fusion events differentially affected by butyrate were identified. Our results provided a snapshot into complex transcriptome dynamics regulated by butyrate, which will facilitate our understanding of the biological effects of butyrate and other HDAC inhibitors.

New approaches to the treatment of orphan genetic disorders: Mitigating molecular pathologies using chemicals.

PubMed

Velho, Renata V; Sperb-Ludwig, Fernanda; Schwartz, Ida V D

2015-08-01

With the advance and popularization of molecular techniques, the identification of genetic mutations that cause diseases has increased dramatically. Thus, the number of laboratories available to investigate a given disorder and the number of subsequent diagnosis have increased over time. Although it is necessary to identify mutations and provide diagnosis, it is also critical to develop specific therapeutic approaches based on this information. This review aims to highlight recent advances in mutation-targeted therapies with chemicals that mitigate mutational pathology at the molecular level, for disorders that, for the most part, have no effective treatment. Currently, there are several strategies being used to correct different types of mutations, including the following: the identification and characterization of translational readthrough compounds; antisense oligonucleotide-mediated splicing redirection; mismatch repair; and exon skipping. These therapies and other approaches are reviewed in this paper.

Prolyl hydroxylation regulates protein degradation, synthesis, and splicing in human induced pluripotent stem cell-derived cardiomyocytes

PubMed Central

Stoehr, Andrea; Yang, Yanqin; Patel, Sajni; Evangelista, Alicia M.; Aponte, Angel; Wang, Guanghui; Liu, Poching; Boylston, Jennifer; Kloner, Philip H.; Lin, Yongshun; Gucek, Marjan; Zhu, Jun; Murphy, Elizabeth

2016-01-01

Aims Protein hydroxylases are oxygen- and α-ketoglutarate-dependent enzymes that catalyse hydroxylation of amino acids such as proline, thus linking oxygen and metabolism to enzymatic activity. Prolyl hydroxylation is a dynamic post-translational modification that regulates protein stability and protein–protein interactions; however, the extent of this modification is largely uncharacterized. The goals of this study are to investigate the biological consequences of prolyl hydroxylation and to identify new targets that undergo prolyl hydroxylation in human cardiomyocytes. Methods and results We used human induced pluripotent stem cell-derived cardiomyocytes in combination with pulse-chase amino acid labelling and proteomics to analyse the effects of prolyl hydroxylation on protein degradation and synthesis. We identified 167 proteins that exhibit differences in degradation with inhibition of prolyl hydroxylation by dimethyloxalylglycine (DMOG); 164 were stabilized. Proteins involved in RNA splicing such as serine/arginine-rich splicing factor 2 (SRSF2) and splicing factor and proline- and glutamine-rich (SFPQ) were stabilized with DMOG. DMOG also decreased protein translation of cytoskeletal and sarcomeric proteins such as α-cardiac actin. We searched the mass spectrometry data for proline hydroxylation and identified 134 high confidence peptides mapping to 78 unique proteins. We identified SRSF2, SFPQ, α-cardiac actin, and cardiac titin as prolyl hydroxylated. We identified 29 prolyl hydroxylated proteins that showed a significant difference in either protein degradation or synthesis. Additionally, we performed next-generation RNA sequencing and showed that the observed decrease in protein synthesis was not due to changes in mRNA levels. Because RNA splicing factors were prolyl hydroxylated, we investigated splicing ± inhibition of prolyl hydroxylation and detected 369 alternative splicing events, with a preponderance of exon skipping. Conclusions This study provides the first extensive characterization of the cardiac prolyl hydroxylome and demonstrates that inhibition of α-ketoglutarate hydroxylases alters protein stability, translation, and splicing. PMID:27095734

A Heroin Addiction Severity-Associated Intronic Single Nucleotide Polymorphism Modulates Alternative Pre-mRNA Splicing of the μ Opioid Receptor Gene OPRM1 via hnRNPH Interactions

PubMed Central

Xu, Jin; Lu, Zhigang; Xu, Mingming; Pan, Ling; Deng, Yi; Xie, Xiaohu; Liu, Huifen; Ding, Shixiong; Hurd, Yasmin L.; Pasternak, Gavril W.; Klein, Robert J.; Cartegni, Luca

2014-01-01

Single nucleotide polymorphisms (SNPs) in the OPRM1 gene have been associated with vulnerability to opioid dependence. The current study identifies an association of an intronic SNP (rs9479757) with the severity of heroin addiction among Han-Chinese male heroin addicts. Individual SNP analysis and haplotype-based analysis with additional SNPs in the OPRM1 locus showed that mild heroin addiction was associated with the AG genotype, whereas severe heroin addiction was associated with the GG genotype. In vitro studies such as electrophoretic mobility shift assay, minigene, siRNA, and antisense morpholino oligonucleotide studies have identified heterogeneous nuclear ribonucleoprotein H (hnRNPH) as the major binding partner for the G-containing SNP site. The G-to-A transition weakens hnRNPH binding and facilitates exon 2 skipping, leading to altered expressions of OPRM1 splice-variant mRNAs and hMOR-1 proteins. Similar changes in splicing and hMOR-1 proteins were observed in human postmortem prefrontal cortex with the AG genotype of this SNP when compared with the GG genotype. Interestingly, the altered splicing led to an increase in hMOR-1 protein levels despite decreased hMOR-1 mRNA levels, which is likely contributed by a concurrent increase in single transmembrane domain variants that have a chaperone-like function on MOR-1 protein stability. Our studies delineate the role of this SNP as a modifier of OPRM1 alternative splicing via hnRNPH interactions, and suggest a functional link between an SNP-containing splicing modifier and the severity of heroin addiction. PMID:25122903

Molecular Cloning and Characterization of the Human ErbB4 Gene: Identification of Novel Splice Isoforms in the Developing and Adult Brain

PubMed Central

Tan, Wei; Dean, Michael; Law, Amanda J.

2010-01-01

ErbB4 is a growth factor receptor tyrosine kinase essential for neurodevelopment. Genetic variation in ErbB4 is associated with schizophrenia and risk-associated polymorphisms predict overexpression of ErbB4 CYT-1 isoforms in the brain in the disorder. The molecular mechanism of association is unclear because the polymorphisms flank exon 3 of the gene and reside 700 kb distal to the CYT-1 defining exon. We hypothesized that the polymorphisms are indirectly associated with ErbB4 CYT-1 via splicing of exon 3 on the CYT-1 background. We report via cloning and sequencing of adult and fetal human brain cDNA libraries the identification of novel splice isoforms of ErbB4, whereby exon 3 is skipped (del.3). ErbB4 del.3 transcripts exist as CYT-2 isoforms and are predicted to produce truncated proteins. Furthermore, our data refine the structure of the human ErbB4 gene, clarify that juxtamembrane (JM) splice variants of ErbB4, JM-a and JM-b respectively, are characterized by the replacement of a 75 nucleotide (nt) sequence with a 45-nt insertion, and demonstrate that there are four alternative exons in the gene. Our analyses reveal that novel splice variants of ErbB4 exist in the developing and adult human brain and, given the failure to identify ErbB4 del.3 CYT-1 transcripts, suggest that the association of risk polymorphisms in the ErbB4 gene with CYT-1 transcript levels is not mediated via an exon 3 splicing event. PMID:20886074

Combination Antisense Treatment for Destructive Exon Skipping of Myostatin and Open Reading Frame Rescue of Dystrophin in Neonatal mdx Mice.

PubMed

Lu-Nguyen, Ngoc B; Jarmin, Susan A; Saleh, Amer F; Popplewell, Linda; Gait, Michael J; Dickson, George

2015-08-01

The fatal X-linked Duchenne muscular dystrophy (DMD), characterized by progressive muscle wasting and muscle weakness, is caused by mutations within the DMD gene. The use of antisense oligonucleotides (AOs) modulating pre-mRNA splicing to restore the disrupted dystrophin reading frame, subsequently generating a shortened but functional protein has emerged as a potential strategy in DMD treatment. AO therapy has recently been applied to induce out-of-frame exon skipping of myostatin pre-mRNA, knocking-down expression of myostatin protein, and such an approach is suggested to enhance muscle hypertrophy/hyperplasia and to reduce muscle necrosis. Within this study, we investigated dual exon skipping of dystrophin and myostatin pre-mRNAs using phosphorodiamidate morpholino oligomers conjugated with an arginine-rich peptide (B-PMOs). Intraperitoneal administration of B-PMOs was performed in neonatal mdx males on the day of birth, and at weeks 3 and 6. At week 9, we observed in treated mice (as compared to age-matched, saline-injected controls) normalization of muscle mass, a recovery in dystrophin expression, and a decrease in muscle necrosis, particularly in the diaphragm. Our data provide a proof of concept for antisense therapy combining dystrophin restoration and myostatin inhibition for the treatment of DMD.

Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align With Collagen Binding Sites for Integrins and Proteoglycans

PubMed Central

Marini, Joan C.; Forlino, Antonella; Cabral, Wayne A.; Barnes, Aileen M.; San Antonio, James D.; Milgrom, Sarah; Hyland, James C.; Körkkö, Jarmo; Prockop, Darwin J.; De Paepe, Anne; Coucke, Paul; Symoens, Sofie; Glorieux, Francis H.; Roughley, Peter J.; Lund, Alan M.; Kuurila-Svahn, Kaija; Hartikka, Heini; Cohn, Daniel H.; Krakow, Deborah; Mottes, Monica; Schwarze, Ulrike; Chen, Diana; Yang, Kathleen; Kuslich, Christine; Troendle, James; Dalgleish, Raymond; Byers, Peter H.

2014-01-01

Osteogenesis imperfecta (OI) is a generalized disorder of connective tissue characterized by fragile bones and easy susceptibility to fracture. Most cases of OI are caused by mutations in type I collagen. We have identified and assembled structural mutations in type I collagen genes (COL1A1 and COL1A2, encoding the proα1(I) and proα2(I) chains, respectively) that result in OI. Quantitative defects causing type I OI were not included. Of these 832 independent mutations, 682 result in substitution for glycine residues in the triple helical domain of the encoded protein and 150 alter splice sites. Distinct genotype–phenotype relationships emerge for each chain. One-third of the mutations that result in glycine substitutions in α1(I) are lethal, especially when the substituting residues are charged or have a branched side chain. Substitutions in the first 200 residues are nonlethal and have variable outcome thereafter, unrelated to folding or helix stability domains. Two exclusively lethal regions (helix positions 691–823 and 910–964) align with major ligand binding regions (MLBRs), suggesting crucial interactions of collagen monomers or fibrils with integrins, matrix metalloproteinases (MMPs), fibronectin, and cartilage oligomeric matrix protein (COMP). Mutations in COL1A2 are predominantly nonlethal (80%). Lethal substitutions are located in eight regularly spaced clusters along the chain, supporting a regional model. The lethal regions align with proteoglycan binding sites along the fibril, suggesting a role in fibril–matrix interactions. Recurrences at the same site in α2(I) are generally concordant for outcome, unlike α1(I). Splice site mutations comprise 20% of helical mutations identified in OI patients, and may lead to exon skipping, intron inclusion, or the activation of cryptic splice sites. Splice site mutations in COL1A1 are rarely lethal; they often lead to frameshifts and the mild type I phenotype. In α2(I), lethal exon skipping events are located in the carboxyl half of the chain. Our data on genotype–phenotype relationships indicate that the two collagen chains play very different roles in matrix integrity and that phenotype depends on intracellular and extracellular events. PMID:17078022

ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy.

PubMed

Ottesen, Eric W

2017-01-01

Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 ( SMN1 ) gene. SMN2 , a nearly identical copy of SMN1 , cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza ™ (synonyms: Nusinersen, IONIS-SMN RX , ISIS-SMN RX ), an antisense drug based on ISS-N1 target. Spinraza ™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza ™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza ™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols.

IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.

PubMed

Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

2016-11-07

The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

PubMed Central

Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

2016-01-01

The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein. PMID:27827994

A novel deletion in the splice donor site of MLH1 exon 6 in a Japanese colon cancer patient with Lynch syndrome.

PubMed

Yamaguchi, Junya; Sato, Yuri; Kita, Mizuho; Nomura, Sachio; Yamamoto, Noriko; Kato, Yo; Ishikawa, Yuichi; Arai, Masami

2015-10-01

Lynch syndrome is an autosomal dominantly inherited disease that is characterized by a predisposition to cancers, mainly colorectal cancer. Germline mutations of DNA mismatch repair genes such as MLH1, MSH2, MSH6 and PMS2 have been described in patients with Lynch syndrome. Here, we report deletion of 2 bp in the splice donor site of the MLH1 exon 6 (c.545+4_545+5delCA) in a 48-year-old Japanese woman with Lynch syndrome. RT-PCR direct sequencing analysis revealed that this mutation led to an increase in the level of an MLH1 transcript in which exon 6 was skipped, and may cause a frameshift (p.E153FfsX8). Therefore, this mutation appears to be pathogenic and is responsible for Lynch syndrome. Additionally, analysis of the patient's tumor cells indicated microsatellite instability high phenotype and loss of the MLH1 and PMS2 proteins. To our knowledge, this is a germline splice site mutation of MLH1 that has not been reported previously. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Becker muscular dystrophy due to an intronic splicing mutation inducing a dual dystrophin transcript.

PubMed

Todeschini, Alice; Gualandi, Francesca; Trabanelli, Cecilia; Armaroli, Annarita; Ravani, Anna; Fanin, Marina; Rota, Silvia; Bello, Luca; Ferlini, Alessandra; Pegoraro, Elena; Padovani, Alessandro; Filosto, Massimiliano

2016-10-01

We describe a 29-year-old patient who complained of left thigh muscle weakness since he was 23 and of moderate proximal weakness of both lower limbs with difficulty in climbing stairs and running since he was 27. Mild weakness of iliopsoas and quadriceps muscles and muscle atrophy of both the distal forearm and thigh were observed upon clinical examination. He harboured a novel c.1150-3C>G substitution in the DMD gene, affecting the intron 10 acceptor splice site and causing exon 11 skipping and an out-of-frame transcript. However, protein of normal molecular weight but in reduced amounts was observed on Western Blot analysis. Reverse transcription analysis on muscle RNA showed production, via alternative splicing, of a transcript missing exon 11 as well as a low abundant full-length transcript which is enough to avoid the severe Duchenne phenotype. Our study showed that a reduced amount of full length dystrophin leads to a mild form of Becker muscular dystrophy. These results confirm earlier findings that low amounts of dystrophin can be associated with a milder phenotype, which is promising for therapies aiming at dystrophin restoration. Copyright © 2016 Elsevier B.V. All rights reserved.

Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides.

PubMed

Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, C I Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L

2014-11-25

Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, "ZEN™") to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2'-O-methyl (2'OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2'OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2'OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2'OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized.

Exon definition as a potential negative force against intron losses in evolution.

PubMed

Niu, Deng-Ke

2008-11-13

Previous studies have indicated that the wide variation in intron density (the number of introns per gene) among different eukaryotes largely reflects varying degrees of intron loss during evolution. The most popular model, which suggests that organisms lose introns through a mechanism in which reverse-transcribed cDNA recombines with the genomic DNA, concerns only one mutational force. Using exons as the units of splicing-site recognition, exon definition constrains the length of exons. An intron-loss event results in fusion of flanking exons and thus a larger exon. The large size of the newborn exon may cause splicing errors, i.e., exon skipping, if the splicing of pre-mRNAs is initiated by exon definition. By contrast, if the splicing of pre-mRNAs is initiated by intron definition, intron loss does not matter. Exon definition may thus be a selective force against intron loss. An organism with a high frequency of exon definition is expected to experience a low rate of intron loss throughout evolution and have a high density of spliceosomal introns. The majority of spliceosomal introns in vertebrates may be maintained during evolution not because of potential functions, but because of their splicing mechanism (i.e., exon definition). Further research is required to determine whether exon definition is a negative force in maintaining the high intron density of vertebrates. This article was reviewed by Dr. Scott W. Roy (nominated by Dr. John Logsdon), Dr.Eugene V. Koonin, and Dr. Igor B. Rogozin (nominated by Dr. Mikhail Gelfand). For the full reviews,please go to the Reviewers' comments section.

Concerted effects of heterogeneous nuclear ribonucleoprotein C1/C2 to control vitamin D-directed gene transcription and RNA splicing in human bone cells.

PubMed

Zhou, Rui; Park, Juw Won; Chun, Rene F; Lisse, Thomas S; Garcia, Alejandro J; Zavala, Kathryn; Sea, Jessica L; Lu, Zhi-Xiang; Xu, Jianzhong; Adams, John S; Xing, Yi; Hewison, Martin

2017-01-25

Traditionally recognized as an RNA splicing regulator, heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNPC1/C2) can also bind to double-stranded DNA and function in trans as a vitamin D response element (VDRE)-binding protein. As such, hnRNPC1/C2 may couple transcription induced by the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25(OH) 2 D) with subsequent RNA splicing. In MG63 osteoblastic cells, increased expression of the 1,25(OH) 2 D target gene CYP24A1 involved immunoprecipitation of hnRNPC1/C2 with CYP24A1 chromatin and RNA. Knockdown of hnRNPC1/C2 suppressed expression of CYP24A1, but also increased expression of an exon 10-skipped CYP24A1 splice variant; in a minigene model the latter was attenuated by a functional VDRE in the CYP24A1 promoter. In genome-wide analyses, knockdown of hnRNPC1/C2 resulted in 3500 differentially expressed genes and 2232 differentially spliced genes, with significant commonality between groups. 1,25(OH) 2 D induced 324 differentially expressed genes, with 187 also observed following hnRNPC1/C2 knockdown, and a further 168 unique to hnRNPC1/C2 knockdown. However, 1,25(OH) 2 D induced only 10 differentially spliced genes, with no overlap with differentially expressed genes. These data indicate that hnRNPC1/C2 binds to both DNA and RNA and influences both gene expression and RNA splicing, but these actions do not appear to be linked through 1,25(OH) 2 D-mediated induction of transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Global Profiling and Molecular Characterization of Alternative Splicing Events Misregulated in Lung Cancer ▿ †

PubMed Central

Misquitta-Ali, Christine M.; Cheng, Edith; O'Hanlon, Dave; Liu, Ni; McGlade, C. Jane; Tsao, Ming Sound; Blencowe, Benjamin J.

2011-01-01

Alternative splicing (AS) is a widespread mechanism underlying the generation of proteomic and regulatory complexity. However, which of the myriad of human AS events play important roles in disease is largely unknown. To identify frequently occurring AS events in lung cancer, we used AS microarray profiling and reverse transcription-PCR (RT-PCR) assays to survey patient-matched normal and adenocarcinoma tumor tissues from the lungs of 29 individuals diagnosed with non-small cell lung cancer (NSCLC). Of 5,183 profiled alternative exons, four displayed tumor-associated changes in the majority of the patients. These events affected transcripts from the VEGFA, MACF1, APP, and NUMB genes. Similar AS changes were detected in NUMB and APP transcripts in primary breast and colon tumors. Tumor-associated increases in NUMB exon 9 inclusion correlated with reduced levels of NUMB protein expression and activation of the Notch signaling pathway, an event that has been linked to tumorigenesis. Moreover, short hairpin RNA (shRNA) knockdown of NUMB followed by isoform-specific rescue revealed that expression of the exon 9-skipped (nontumor) isoform represses Notch target gene activation whereas expression of the exon 9-included (tumor) isoform lacks this activity and is capable of promoting cell proliferation. The results thus reveal widespread AS changes in NSCLC that impact cell signaling in a manner that likely contributes to tumorigenesis. PMID:21041478

Drosophila Polypyrimidine Tract-Binding Protein (DmPTB) Regulates Dorso-Ventral Patterning Genes in Embryos

PubMed Central

Huntley, Jim; Wesley, Cedric S.; Singh, Ravinder

2014-01-01

The Drosophila polypyrimidine tract-binding protein (dmPTB or hephaestus) plays an important role during embryogenesis. A loss of function mutation, heph03429, results in varied defects in embryonic developmental processes, leading to embryonic lethality. However, the suite of molecular functions that are disrupted in the mutant remains unknown. We have used an unbiased high throughput sequencing approach to identify transcripts that are misregulated in this mutant. Misregulated transcripts show evidence of significantly altered patterns of splicing (exon skipping, 5′ and 3′ splice site switching), alternative 5′ ends, and mRNA level changes (up and down regulation). These findings are independently supported by reverse-transcription-polymerase chain reaction (RT-PCR) analysis and in situ hybridization. We show that a group of genes, such as Zerknüllt, z600 and screw are among the most upregulated in the mutant and have been functionally linked to dorso-ventral patterning and/or dorsal closure processes. Thus, loss of dmPTB function results in specific misregulated transcripts, including those that provide the missing link between the loss of dmPTB function and observed developmental defects in embryogenesis. This study provides the first comprehensive repertoire of genes affected in vivo in the heph mutant in Drosophila and offers insight into the role of dmPTB during embryonic development. PMID:25014769

Common pathological mutations in PQBP1 induce nonsense-mediated mRNA decay and enhance exclusion of the mutant exon.

PubMed

Musante, Luciana; Kunde, Stella-Amrei; Sulistio, Tina O; Fischer, Ute; Grimme, Astrid; Frints, Suzanna G M; Schwartz, Charles E; Martínez, Francisco; Romano, Corrado; Ropers, Hans-Hilger; Kalscheuer, Vera M

2010-01-01

The polyglutamine binding protein 1 (PQBP1) gene plays an important role in X-linked mental retardation (XLMR). Nine of the thirteen PQBP1 mutations known to date affect the AG hexamer in exon 4 and cause frameshifts introducing premature termination codons (PTCs). However, the phenotype in this group of patients is variable. To investigate the pathology of these PQBP1 mutations, we evaluated their consequences on mRNA and protein expression. RT-PCRs revealed mutation-specific reduction of PQBP1 mRNAs carrying the PTCs that can be partially restored by blocking translation, thus indicating a role for the nonsense-mediated mRNA decay pathway. In addition, these mutations resulted in altered levels of PQBP1 transcripts that skipped exon 4, probably as a result of altering important splicing motifs via nonsense-associated altered splicing (NAS). This hypothesis is supported by transfection experiments using wild-type and mutant PQBP1 minigenes. Moreover, we show that a truncated PQBP1 protein is indeed present in the patients. Remarkably, patients with insertion/deletion mutations in the AG hexamer express significantly increased levels of a PQBP1 isoform, which is very likely encoded by the transcripts without exon 4, confirming the findings at the mRNA level. Our study provides significant insight into the early events contributing to the pathogenesis of the PQBP1 related XLMR disease.

Global profiling and molecular characterization of alternative splicing events misregulated in lung cancer.

PubMed

Misquitta-Ali, Christine M; Cheng, Edith; O'Hanlon, Dave; Liu, Ni; McGlade, C Jane; Tsao, Ming Sound; Blencowe, Benjamin J

2011-01-01

Alternative splicing (AS) is a widespread mechanism underlying the generation of proteomic and regulatory complexity. However, which of the myriad of human AS events play important roles in disease is largely unknown. To identify frequently occurring AS events in lung cancer, we used AS microarray profiling and reverse transcription-PCR (RT-PCR) assays to survey patient-matched normal and adenocarcinoma tumor tissues from the lungs of 29 individuals diagnosed with non-small cell lung cancer (NSCLC). Of 5,183 profiled alternative exons, four displayed tumor-associated changes in the majority of the patients. These events affected transcripts from the VEGFA, MACF1, APP, and NUMB genes. Similar AS changes were detected in NUMB and APP transcripts in primary breast and colon tumors. Tumor-associated increases in NUMB exon 9 inclusion correlated with reduced levels of NUMB protein expression and activation of the Notch signaling pathway, an event that has been linked to tumorigenesis. Moreover, short hairpin RNA (shRNA) knockdown of NUMB followed by isoform-specific rescue revealed that expression of the exon 9-skipped (nontumor) isoform represses Notch target gene activation whereas expression of the exon 9-included (tumor) isoform lacks this activity and is capable of promoting cell proliferation. The results thus reveal widespread AS changes in NSCLC that impact cell signaling in a manner that likely contributes to tumorigenesis.

Mutation in Pyrroline-5-Carboxylate Reductase 1 Gene in Families with Cutis Laxa Type 2

PubMed Central

Guernsey, Duane L.; Jiang, Haiyan; Evans, Susan C.; Ferguson, Meghan; Matsuoka, Makoto; Nightingale, Mathew; Rideout, Andrea L.; Provost, Sylvie; Bedard, Karen; Orr, Andrew; Dubé, Marie-Pierre; Ludman, Mark; Samuels, Mark E.

2009-01-01

Autosomal-recessive cutis laxa type 2 (ARCL2) is a multisystem disorder characterized by the appearance of premature aging, wrinkled and lax skin, joint laxity, and a general developmental delay. Cutis laxa includes a family of clinically overlapping conditions with confusing nomenclature, generally requiring molecular analyses for definitive diagnosis. Six genes are currently known to mutate to yield one of these related conditions. We ascertained a cohort of typical ARCL2 patients from a subpopulation isolate within eastern Canada. Homozygosity mapping with high-density SNP genotyping excluded all six known genes, and instead identified a single homozygous region near the telomere of chromosome 17, shared identically by state by all genotyped affected individuals from the families. A putative pathogenic variant was identified by direct DNA sequencing of genes within the region. The single nucleotide change leads to a missense mutation adjacent to a splice junction in the gene encoding pyrroline-5-carboxylate reductase 1 (PYCR1). Bioinformatic analysis predicted a pathogenic effect of the variant on splice donor site function. Skipping of the associated exon was confirmed in RNA from blood lymphocytes of affected homozygotes and heterozygous mutation carriers. Exon skipping leads to deletion of the reductase functional domain-coding region and an obligatory downstream frameshift. PYCR1 plays a critical role in proline biosynthesis. Pathogenicity of the genetic variant in PYCR1 is likely, given that a similar clinical phenotype has been documented for mutation carriers of another proline biosynthetic enzyme, pyrroline-5-carboxylate synthase. Our results support a significant role for proline in normal development. PMID:19576563

Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials.

PubMed

Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S; Verschuuren, Jan J; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E; Muntoni, Francesco

2011-12-01

Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy.

Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials

PubMed Central

Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S.; Verschuuren, Jan J.; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E.

2011-01-01

Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy. PMID:22102647

A Duchenne Muscular Dystrophy Gene Hot Spot Mutation in Dystrophin-Deficient Cavalier King Charles Spaniels Is Amenable to Exon 51 Skipping

PubMed Central

Walmsley, Gemma L.; Arechavala-Gomeza, Virginia; Fernandez-Fuente, Marta; Burke, Margaret M.; Nagel, Nicole; Holder, Angela; Stanley, Rachael; Chandler, Kate; Marks, Stanley L.; Muntoni, Francesco; Shelton, G. Diane; Piercy, Richard J.

2010-01-01

Background Duchenne muscular dystrophy (DMD), which afflicts 1 in 3500 boys, is one of the most common genetic disorders of children. This fatal degenerative condition is caused by an absence or deficiency of dystrophin in striated muscle. Most affected patients have inherited or spontaneous deletions in the dystrophin gene that disrupt the reading frame resulting in unstable truncated products. For these patients, restoration of the reading frame via antisense oligonucleotide-mediated exon skipping is a promising therapeutic approach. The major DMD deletion “hot spot” is found between exons 45 and 53, and skipping exon 51 in particular is predicted to ameliorate the dystrophic phenotype in the greatest number of patients. Currently the mdx mouse is the most widely used animal model of DMD, although its mild phenotype limits its suitability in clinical trials. The Golden Retriever muscular dystrophy (GRMD) model has a severe phenotype, but due to its large size, is expensive to use. Both these models have mutations in regions of the dystrophin gene distant from the commonly mutated DMD “hot spot”. Methodology/Principal Findings Here we describe the severe phenotype, histopathological findings, and molecular analysis of Cavalier King Charles Spaniels with dystrophin-deficient muscular dystrophy (CKCS-MD). The dogs harbour a missense mutation in the 5′ donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Antisense oligonucleotide-mediated skipping of exon 51 in cultured myoblasts from an affected dog restored the reading frame and protein expression. Conclusions/Significance Given the small size of the breed, the amiable temperament and the nature of the mutation, we propose that CKCS-MD is a valuable new model for clinical trials of antisense oligonucleotide-induced exon skipping and other therapeutic approaches for DMD. PMID:20072625

Prolyl hydroxylation regulates protein degradation, synthesis, and splicing in human induced pluripotent stem cell-derived cardiomyocytes.

PubMed

Stoehr, Andrea; Yang, Yanqin; Patel, Sajni; Evangelista, Alicia M; Aponte, Angel; Wang, Guanghui; Liu, Poching; Boylston, Jennifer; Kloner, Philip H; Lin, Yongshun; Gucek, Marjan; Zhu, Jun; Murphy, Elizabeth

2016-06-01

Protein hydroxylases are oxygen- and α-ketoglutarate-dependent enzymes that catalyse hydroxylation of amino acids such as proline, thus linking oxygen and metabolism to enzymatic activity. Prolyl hydroxylation is a dynamic post-translational modification that regulates protein stability and protein-protein interactions; however, the extent of this modification is largely uncharacterized. The goals of this study are to investigate the biological consequences of prolyl hydroxylation and to identify new targets that undergo prolyl hydroxylation in human cardiomyocytes. We used human induced pluripotent stem cell-derived cardiomyocytes in combination with pulse-chase amino acid labelling and proteomics to analyse the effects of prolyl hydroxylation on protein degradation and synthesis. We identified 167 proteins that exhibit differences in degradation with inhibition of prolyl hydroxylation by dimethyloxalylglycine (DMOG); 164 were stabilized. Proteins involved in RNA splicing such as serine/arginine-rich splicing factor 2 (SRSF2) and splicing factor and proline- and glutamine-rich (SFPQ) were stabilized with DMOG. DMOG also decreased protein translation of cytoskeletal and sarcomeric proteins such as α-cardiac actin. We searched the mass spectrometry data for proline hydroxylation and identified 134 high confidence peptides mapping to 78 unique proteins. We identified SRSF2, SFPQ, α-cardiac actin, and cardiac titin as prolyl hydroxylated. We identified 29 prolyl hydroxylated proteins that showed a significant difference in either protein degradation or synthesis. Additionally, we performed next-generation RNA sequencing and showed that the observed decrease in protein synthesis was not due to changes in mRNA levels. Because RNA splicing factors were prolyl hydroxylated, we investigated splicing ± inhibition of prolyl hydroxylation and detected 369 alternative splicing events, with a preponderance of exon skipping. This study provides the first extensive characterization of the cardiac prolyl hydroxylome and demonstrates that inhibition of α-ketoglutarate hydroxylases alters protein stability, translation, and splicing. Published by Oxford University Press on behalf of the European Society of Cardiology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene.

PubMed

Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2014-01-01

Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband's leukocytes. DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5' splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia.

Tannic acid facilitates expression of the polypyrimidine tract binding protein and alleviates deleterious inclusion of CHRNA1 exon P3A due to an hnRNP H-disrupting mutation in congenital myasthenic syndrome

PubMed Central

Bian, Yang; Masuda, Akio; Matsuura, Tohru; Ito, Mikako; Okushin, Kazuya; Engel, Andrew G.; Ohno, Kinji

2009-01-01

We recently reported that the intronic splice-site mutation IVS3-8G>A of CHRNA1 that encodes the muscle nicotinic acetylcholine receptor α subunit disrupts binding of a splicing repressor, hnRNP H. This, in turn, results in exclusive inclusion of the downstream exon P3A. The P3A(+) transcript encodes a non-functional α subunit that comprises 50% of the transcripts in normal human skeletal muscle, but its functional significance remains undetermined. In an effort to search for a potential therapy, we screened off-label effects of 960 bioactive chemical compounds and found that tannic acid ameliorates the aberrant splicing due to IVS3-8G>A but without altering the expression of hnRNP H. Therefore, we searched for another splicing trans-factor. We found that the polypyrimidine tract binding protein (PTB) binds close to the 3′ end of CHRNA1 intron 3, that PTB induces skipping of exon P3A and that tannic acid increases the expression of PTB in a dose-dependent manner. Deletion assays of the PTB promoter region revealed that the tannic acid-responsive element is between positions −232 and −74 from the translation initiation site. These observations open the door to the discovery of novel therapies based on PTB overexpression and to detecting possible untoward effects of the overexpression. PMID:19147685

Modeling the ferrochelatase c.315-48C modifier mutation for erythropoietic protoporphyria (EPP) in mice

PubMed Central

Bansode, Vijay B.; Koentgen, Frank; Trüb, Judith; Pelczar, Pawel; Schneider-Yin, Xiaoye; Minder, Elisabeth I.

2017-01-01

ABSTRACT Erythropoietic protoporphyria (EPP) is caused by deficiency of ferrochelatase (FECH), which incorporates iron into protoporphyrin IX (PPIX) to form heme. Excitation of accumulated PPIX by light generates oxygen radicals that evoke excessive pain and, after longer light exposure, cause ulcerations in exposed skin areas of individuals with EPP. Moreover, ∼5% of the patients develop a liver dysfunction as a result of PPIX accumulation. Most patients (∼97%) have a severe FECH mutation (Mut) in trans to an intronic polymorphism (c.315-48C), which reduces ferrochelatase synthesis by stimulating the use of an aberrant 3′ splice site 63 nt upstream of the normal site for exon 4. In contrast, with the predominant c.315-48T allele, the correct splice site is mostly used, and individuals with a T/Mut genotype do not develop EPP symptoms. Thus, the C allele is a potential target for therapeutic approaches that modify this splicing decision. To provide a model for pre-clinical studies of such approaches, we engineered a mouse containing a partly humanized Fech gene with the c.315-48C polymorphism. F1 hybrids obtained by crossing these mice with another inbred line carrying a severe Fech mutation (named m1Pas) show a very strong EPP phenotype that includes elevated PPIX in the blood, enlargement of liver and spleen, anemia, as well as strong pain reactions and skin lesions after a short period of light exposure. In addition to the expected use of the aberrant splice site, the mice also show a strong skipping of the partly humanized exon 3. This will limit the use of this model for certain applications and illustrates that engineering of a hybrid gene may have unforeseeable consequences on its splicing. PMID:28093505

Exome Sequencing Identified a Splice Site Mutation in FHL1 that Causes Uruguay Syndrome, an X-Linked Disorder With Skeletal Muscle Hypertrophy and Premature Cardiac Death.

PubMed

Xue, Yuan; Schoser, Benedikt; Rao, Aliz R; Quadrelli, Roberto; Vaglio, Alicia; Rupp, Verena; Beichler, Christine; Nelson, Stanley F; Schapacher-Tilp, Gudrun; Windpassinger, Christian; Wilcox, William R

2016-04-01

Previously, we reported a rare X-linked disorder, Uruguay syndrome in a single family. The main features are pugilistic facies, skeletal deformities, and muscular hypertrophy despite a lack of exercise and cardiac ventricular hypertrophy leading to premature death. An ≈19 Mb critical region on X chromosome was identified through identity-by-descent analysis of 3 affected males. Exome sequencing was conducted on one affected male to identify the disease-causing gene and variant. A splice site variant (c.502-2A>G) in the FHL1 gene was highly suspicious among other candidate genes and variants. FHL1A is the predominant isoform of FHL1 in cardiac and skeletal muscle. Sequencing cDNA showed the splice site variant led to skipping of exons 6 of the FHL1A isoform, equivalent to the FHL1C isoform. Targeted analysis showed that this splice site variant cosegregated with disease in the family. Western blot and immunohistochemical analysis of muscle from the proband showed a significant decrease in protein expression of FHL1A. Real-time polymerase chain reaction analysis of different isoforms of FHL1 demonstrated that the FHL1C is markedly increased. Mutations in the FHL1 gene have been reported in disorders with skeletal and cardiac myopathy but none has the skeletal or facial phenotype seen in patients with Uruguay syndrome. Our data suggest that a novel FHL1 splice site variant results in the absence of FHL1A and the abundance of FHL1C, which may contribute to the complex and severe phenotype. Mutation screening of the FHL1 gene should be considered for patients with uncharacterized myopathies and cardiomyopathies. © 2016 American Heart Association, Inc.

Potentially pathogenic germline CHEK2 c.319+2T>A among multiple early-onset cancer families.

PubMed

Dominguez-Valentin, Mev; Nakken, Sigve; Tubeuf, Hélène; Vodak, Daniel; Ekstrøm, Per Olaf; Nissen, Anke M; Morak, Monika; Holinski-Feder, Elke; Martins, Alexandra; Møller, Pål; Hovig, Eivind

2018-01-01

To study the potential contribution of genes other than BRCA1/2, PTEN, and TP53 to the biological and clinical characteristics of multiple early-onset cancers in Norwegian families, including early-onset breast cancer, Cowden-like and Li-Fraumeni-like syndromes (BC, CSL and LFL, respectively). The Hereditary Cancer Biobank from the Norwegian Radium Hospital was used to identify early-onset BC, CSL or LFL for whom no pathogenic variants in BRCA1/2, PTEN, or TP53 had been found in routine diagnostic DNA sequencing. Forty-four cancer susceptibility genes were selected and analyzed by our in-house designed TruSeq amplicon-based assay for targeted sequencing. Protein- and RNA splicing-dedicated in silico analyses were performed for all variants of unknown significance (VUS). Variants predicted as the more likely to affect splicing were experimentally analyzed by minigene assay. We identified a CSL individual carrying a variant in CHEK2 (c.319+2T>A, IVS2), here considered as likely pathogenic. Out of the five VUS (BRCA2, CDH1, CHEK2, MAP3K1, NOTCH3) tested in the minigene splicing assay, only NOTCH3 c.14090C>T (p.Ser497Leu) showed a significant effect on RNA splicing, notably by inducing partial skipping of exon 9. Among 13 early-onset BC, CSL and LFL patients, gene panel sequencing identified a potentially pathogenic variant in CHEK2 that affects a canonical RNA splicing signal. Our study provides new information on genetic loci that may affect the risk of developing cancer in these patients and their families, demonstrating that genes presently not routinely tested in molecular diagnostic settings may be important for capturing cancer predisposition in these families.

A Comprehensive Analysis of Alternative Splicing in Paleopolyploid Maize.

PubMed

Mei, Wenbin; Liu, Sanzhen; Schnable, James C; Yeh, Cheng-Ting; Springer, Nathan M; Schnable, Patrick S; Barbazuk, William B

2017-01-01

Identifying and characterizing alternative splicing (AS) enables our understanding of the biological role of transcript isoform diversity. This study describes the use of publicly available RNA-Seq data to identify and characterize the global diversity of AS isoforms in maize using the inbred lines B73 and Mo17, and a related species, sorghum. Identification and characterization of AS within maize tissues revealed that genes expressed in seed exhibit the largest differential AS relative to other tissues examined. Additionally, differences in AS between the two genotypes B73 and Mo17 are greatest within genes expressed in seed. We demonstrate that changes in the level of alternatively spliced transcripts (intron retention and exon skipping) do not solely reflect differences in total transcript abundance, and we present evidence that intron retention may act to fine-tune gene expression across seed development stages. Furthermore, we have identified temperature sensitive AS in maize and demonstrate that drought-induced changes in AS involve distinct sets of genes in reproductive and vegetative tissues. Examining our identified AS isoforms within B73 × Mo17 recombinant inbred lines (RILs) identified splicing QTL (sQTL). The 43.3% of cis- sQTL regulated junctions are actually identified as alternatively spliced junctions in our analysis, while 10 Mb windows on each side of 48.2% of trans -sQTLs overlap with splicing related genes. Using sorghum as an out-group enabled direct examination of loss or conservation of AS between homeologous genes representing the two subgenomes of maize. We identify several instances where AS isoforms that are conserved between one maize homeolog and its sorghum ortholog are absent from the second maize homeolog, suggesting that these AS isoforms may have been lost after the maize whole genome duplication event. This comprehensive analysis provides new insights into the complexity of AS in maize.

Identification of Alternative Splice Variants Using Unique Tryptic Peptide Sequences for Database Searches.

PubMed

Tran, Trung T; Bollineni, Ravi C; Strozynski, Margarita; Koehler, Christian J; Thiede, Bernd

2017-07-07

Alternative splicing is a mechanism in eukaryotes by which different forms of mRNAs are generated from the same gene. Identification of alternative splice variants requires the identification of peptides specific for alternative splice forms. For this purpose, we generated a human database that contains only unique tryptic peptides specific for alternative splice forms from Swiss-Prot entries. Using this database allows an easy access to splice variant-specific peptide sequences that match to MS data. Furthermore, we combined this database without alternative splice variant-1-specific peptides with human Swiss-Prot. This combined database can be used as a general database for searching of LC-MS data. LC-MS data derived from in-solution digests of two different cell lines (LNCaP, HeLa) and phosphoproteomics studies were analyzed using these two databases. Several nonalternative splice variant-1-specific peptides were found in both cell lines, and some of them seemed to be cell-line-specific. Control and apoptotic phosphoproteomes from Jurkat T cells revealed several nonalternative splice variant-1-specific peptides, and some of them showed clear quantitative differences between the two states.

Tissue-Specific Reduction in Splicing Efficiency of IKBKAP Due to the Major Mutation Associated with Familial Dysautonomia

PubMed Central

Cuajungco, Math P.; Leyne, Maire; Mull, James; Gill, Sandra P.; Lu, Weining; Zagzag, David; Axelrod, Felicia B.; Maayan, Channa; Gusella, James F.; Slaugenhaupt, Susan A.

2003-01-01

We recently identified a mutation in the I-κB kinase associated protein (IKBKAP) gene as the major cause of familial dysautonomia (FD), a recessive sensory and autonomic neuropathy. This alteration, located at base pair 6 of the intron 20 donor splice site, is present on >99.5% of FD chromosomes and results in tissue-specific skipping of exon 20. A second FD mutation, a missense change in exon 19 (R696P), was seen in only four patients heterozygous for the major mutation. Here, we have further characterized the consequences of the major mutation by examining the ratio of wild-type to mutant (WT:MU) IKBKAP transcript in EBV-transformed lymphoblast lines, primary fibroblasts, freshly collected blood samples, and postmortem tissues from patients with FD. We consistently found that WT IKBKAP transcripts were present, albeit to varying extents, in all cell lines, blood, and postmortem FD tissues. Further, a corresponding decrease in the level of WT protein is seen in FD cell lines and tissues. The WT:MU ratio in cultured lymphoblasts varied with growth phase but not with serum concentration or inclusion of antibiotics. Using both densitometry and real-time quantitative polymerase chain reaction, we found that relative WT:MU IKBKAP RNA levels were highest in cultured patient lymphoblasts and lowest in postmortem central and peripheral nervous tissues. These observations suggest that the relative inefficiency of WT IKBKAP mRNA production from the mutant alleles in the nervous system underlies the selective degeneration of sensory and autonomic neurons in FD.Therefore, exploration of methods to increase the WT:MU IKBKAP transcript ratio in the nervous system offers a promising approach for developing an effective therapy for patients with FD. PMID:12577200

Transcriptomic characterization of cold acclimation in larval zebrafish

PubMed Central

2013-01-01

Background Temperature is one of key environmental parameters that affect the whole life of fishes and an increasing number of studies have been directed towards understanding the mechanisms of cold acclimation in fish. However, the adaptation of larvae to cold stress and the cold-specific transcriptional alterations in fish larvae remain largely unknown. In this study, we characterized the development of cold-tolerance in zebrafish larvae and investigated the transcriptional profiles under cold stress using RNA-seq. Results Pre-exposure of 96 hpf zebrafish larvae to cold stress (16°C) for 24 h significantly increased their survival rates under severe cold stress (12°C). RNA-seq generated 272 million raw reads from six sequencing libraries and about 92% of the processed reads were mapped to the reference genome of zebrafish. Differential expression analysis identified 1,431 up- and 399 down-regulated genes. Gene ontology enrichment analysis of cold-induced genes revealed that RNA splicing, ribosome biogenesis and protein catabolic process were the most highly overrepresented biological processes. Spliceosome, proteasome, eukaryotic ribosome biogenesis and RNA transport were the most highly enriched pathways for genes up-regulated by cold stress. Moreover, alternative splicing of 197 genes and promoter switching of 64 genes were found to be regulated by cold stress. A shorter isoform of stk16 that lacks 67 amino acids at the N-terminus was specifically generated by skipping the second exon in cold-treated larvae. Alternative promoter usage was detected for per3 gene under cold stress, which leading to a highly up-regulated transcript encoding a truncated protein lacking the C-terminal domains. Conclusions These findings indicate that zebrafish larvae possess the ability to build cold-tolerance under mild low temperature and transcriptional and post-transcriptional regulations are extensively involved in this acclimation process. PMID:24024969

Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

PubMed

Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

2014-05-01

Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

Case report of a novel homozygous splice site mutation in PLA2G6 gene causing infantile neuroaxonal dystrophy in a Sudanese family.

PubMed

Elsayed, Liena E O; Mohammed, Inaam N; Hamed, Ahlam A A; Elseed, Maha A; Salih, Mustafa A M; Yahia, Ashraf; Siddig, Rayan A; Amin, Mutaz; Koko, Mahmoud; Elbashir, Mustafa I; Ibrahim, Muntaser E; Brice, Alexis; Ahmed, Ammar E; Stevanin, Giovanni

2018-05-08

Infantile neuroaxonal dystrophy (INAD) is a rare hereditary neurological disorder caused by mutations in PLA2G6. The disease commonly affects children below 3 years of age and presents with delay in motor skills, optic atrophy and progressive spastic tetraparesis. Studies of INAD in Africa are extremely rare, and genetic studies from Sub Saharan Africa are almost non-existent. Two Sudanese siblings presented, at ages 18 and 24 months, with regression in both motor milestones and speech development and hyper-reflexia. Brain MRI showed bilateral and symmetrical T2/FLAIR hyperintense signal changes in periventricular areas and basal ganglia and mild cerebellar atrophy. Whole exome sequencing with confirmatory Sanger sequencing were performed for the two patients and healthy family members. A novel variant (NM_003560.2 c.1427 + 2 T > C) acting on a splice donor site and predicted to lead to skipping of exon 10 was found in PLA2G6. It was found in a homozygous state in the two patients and homozygous reference or heterozygous in five healthy family members. This variant has one very strong (loss of function mutation) and three supporting evidences for its pathogenicity (segregation with the disease, multiple computational evidence and specific patients' phenotype). Therefore this variant can be currently annotated as "pathogenic". This is the first study to report mutations in PLA2G6 gene in patients from Sudan.

Evolution of Nova-Dependent Splicing Regulation in the Brain

PubMed Central

Živin, Marko; Darnell, Robert B

2007-01-01

A large number of alternative exons are spliced with tissue-specific patterns, but little is known about how such patterns have evolved. Here, we study the conservation of the neuron-specific splicing factors Nova1 and Nova2 and of the alternatively spliced exons they regulate in mouse brain. Whereas Nova RNA binding domains are 94% identical across vertebrate species, Nova-dependent splicing silencer and enhancer elements (YCAY clusters) show much greater divergence, as less than 50% of mouse YCAY clusters are conserved at orthologous positions in the zebrafish genome. To study the relation between the evolution of tissue-specific splicing and YCAY clusters, we compared the brain-specific splicing of Nova-regulated exons in zebrafish, chicken, and mouse. The presence of YCAY clusters in lower vertebrates invariably predicted conservation of brain-specific splicing across species, whereas their absence in lower vertebrates correlated with a loss of alternative splicing. We hypothesize that evolution of Nova-regulated splicing in higher vertebrates proceeds mainly through changes in cis-acting elements, that tissue-specific splicing might in some cases evolve in a single step corresponding to evolution of a YCAY cluster, and that the conservation level of YCAY clusters relates to the functions encoded by the regulated RNAs. PMID:17937501

DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

PubMed

Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

2006-02-01

Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene

PubMed Central

Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

2014-01-01

Introduction: Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. Materials and methods: The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband’s leukocytes. Results: DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5′ splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Conclusions: Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia. PMID:24627724

Diversification of the muscle proteome through alternative splicing.

PubMed

Nakka, Kiran; Ghigna, Claudia; Gabellini, Davide; Dilworth, F Jeffrey

2018-03-06

Skeletal muscles express a highly specialized proteome that allows the metabolism of energy sources to mediate myofiber contraction. This muscle-specific proteome is partially derived through the muscle-specific transcription of a subset of genes. Surprisingly, RNA sequencing technologies have also revealed a significant role for muscle-specific alternative splicing in generating protein isoforms that give specialized function to the muscle proteome. In this review, we discuss the current knowledge with respect to the mechanisms that allow pre-mRNA transcripts to undergo muscle-specific alternative splicing while identifying some of the key trans-acting splicing factors essential to the process. The importance of specific splicing events to specialized muscle function is presented along with examples in which dysregulated splicing contributes to myopathies. Though there is now an appreciation that alternative splicing is a major contributor to proteome diversification, the emergence of improved "targeted" proteomic methodologies for detection of specific protein isoforms will soon allow us to better appreciate the extent to which alternative splicing modifies the activity of proteins (and their ability to interact with other proteins) in the skeletal muscle. In addition, we highlight a continued need to better explore the signaling pathways that contribute to the temporal control of trans-acting splicing factor activity to ensure specific protein isoforms are expressed in the proper cellular context. An understanding of the signal-dependent and signal-independent events driving muscle-specific alternative splicing has the potential to provide us with novel therapeutic strategies to treat different myopathies.

Muscle-Specific Mis-Splicing and Heart Disease Exemplified by RBM20.

PubMed

Rexiati, Maimaiti; Sun, Mingming; Guo, Wei

2018-01-05

Alternative splicing is an essential post-transcriptional process to generate multiple functional RNAs or proteins from a single transcript. Progress in RNA biology has led to a better understanding of muscle-specific RNA splicing in heart disease. The recent discovery of the muscle-specific splicing factor RNA-binding motif 20 (RBM20) not only provided great insights into the general alternative splicing mechanism but also demonstrated molecular mechanism of how this splicing factor is associated with dilated cardiomyopathy. Here, we review our current knowledge of muscle-specific splicing factors and heart disease, with an emphasis on RBM20 and its targets, RBM20-dependent alternative splicing mechanism, RBM20 disease origin in induced Pluripotent Stem Cells (iPSCs), and RBM20 mutations in dilated cardiomyopathy. In the end, we will discuss the multifunctional role of RBM20 and manipulation of RBM20 as a potential therapeutic target for heart disease.

Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, proof-of-concept study

PubMed Central

Kinali, Maria; Arechavala-Gomeza, Virginia; Feng, Lucy; Cirak, Sebahattin; Hunt, David; Adkin, Carl; Guglieri, Michela; Ashton, Emma; Abbs, Stephen; Nihoyannopoulos, Petros; Garralda, Maria Elena; Rutherford, Mary; Mcculley, Caroline; Popplewell, Linda; Graham, Ian R; Dickson, George; Wood, Matthew JA; Wells, Dominic J; Wilton, Steve D; Kole, Ryszard; Straub, Volker; Bushby, Kate; Sewry, Caroline; Morgan, Jennifer E; Muntoni, Francesco

2009-01-01

Summary Background Mutations that disrupt the open reading frame and prevent full translation of DMD, the gene that encodes dystrophin, underlie the fatal X-linked disease Duchenne muscular dystrophy. Oligonucleotides targeted to splicing elements (splice switching oligonucleotides) in DMD pre-mRNA can lead to exon skipping, restoration of the open reading frame, and the production of functional dystrophin in vitro and in vivo, which could benefit patients with this disorder. Methods We did a single-blind, placebo-controlled, dose-escalation study in patients with DMD recruited nationally, to assess the safety and biochemical efficacy of an intramuscular morpholino splice-switching oligonucleotide (AVI-4658) that skips exon 51 in dystrophin mRNA. Seven patients with Duchenne muscular dystrophy with deletions in the open reading frame of DMD that are responsive to exon 51 skipping were selected on the basis of the preservation of their extensor digitorum brevis (EDB) muscle seen on MRI and the response of cultured fibroblasts from a skin biopsy to AVI-4658. AVI-4658 was injected into the EDB muscle; the contralateral muscle received saline. Muscles were biopsied between 3 and 4 weeks after injection. The primary endpoint was the safety of AVI-4658 and the secondary endpoint was its biochemical efficacy. This trial is registered, number NCT00159250. Findings Two patients received 0·09 mg AVI-4658 in 900 μL (0·9%) saline and five patients received 0·9 mg AVI-4658 in 900 μL saline. No adverse events related to AVI-4658 administration were reported. Intramuscular injection of the higher-dose of AVI-4658 resulted in increased dystrophin expression in all treated EDB muscles, although the results of the immunostaining of EDB-treated muscle for dystrophin were not uniform. In the areas of the immunostained sections that were adjacent to the needle track through which AVI-4658 was given, 44–79% of myofibres had increased expression of dystrophin. In randomly chosen sections of treated EDB muscles, the mean intensity of dystrophin staining ranged from 22% to 32% of the mean intensity of dystrophin in healthy control muscles (mean 26·4%), and the mean intensity was 17% (range 11–21%) greater than the intensity in the contralateral saline-treated muscle (one-sample paired t test p=0·002). In the dystrophin-positive fibres, the intensity of dystrophin staining was up to 42% of that in healthy muscle. We showed expression of dystrophin at the expected molecular weight in the AVI-4658-treated muscle by immunoblot. Interpretation Intramuscular AVI-4658 was safe and induced the expression of dystrophin locally within treated muscles. This proof-of-concept study has led to an ongoing systemic clinical trial of AVI-4658 in patients with DMD. Funding UK Department of Health. PMID:19713152

Coordinated tissue-specific regulation of adjacent alternative 3′ splice sites in C. elegans

PubMed Central

Ragle, James Matthew; Katzman, Sol; Akers, Taylor F.; Barberan-Soler, Sergio; Zahler, Alan M.

2015-01-01

Adjacent alternative 3′ splice sites, those separated by ≤18 nucleotides, provide a unique problem in the study of alternative splicing regulation; there is overlap of the cis-elements that define the adjacent sites. Identification of the intron's 3′ end depends upon sequence elements that define the branchpoint, polypyrimidine tract, and terminal AG dinucleotide. Starting with RNA-seq data from germline-enriched and somatic cell-enriched Caenorhabditis elegans samples, we identify hundreds of introns with adjacent alternative 3′ splice sites. We identify 203 events that undergo tissue-specific alternative splicing. For these, the regulation is monodirectional, with somatic cells preferring to splice at the distal 3′ splice site (furthest from the 5′ end of the intron) and germline cells showing a distinct shift toward usage of the adjacent proximal 3′ splice site (closer to the 5′ end of the intron). Splicing patterns in somatic cells follow C. elegans consensus rules of 3′ splice site definition; a short stretch of pyrimidines preceding an AG dinucleotide. Splicing in germline cells occurs at proximal 3′ splice sites that lack a preceding polypyrimidine tract, and in three instances the germline-specific site lacks the AG dinucleotide. We provide evidence that use of germline-specific proximal 3′ splice sites is conserved across Caenorhabditis species. We propose that there are differences between germline and somatic cells in the way that the basal splicing machinery functions to determine the intron terminus. PMID:25922281

Mutations in KIAA0753 cause Joubert syndrome associated with growth hormone deficiency

PubMed Central

Stephen, Joshi; Vilboux, Thierry; Mian, Luhe; Kuptanon, Chulaluck; Sinclair, Courtney M.; Yildirimli, Deniz; Maynard, Dawn M.; Bryant, Joy; Fischer, Roxanne; Vemulapalli, Meghana; Mullikin, James C.; Huizing, Marjan; Gahl, William A.

2017-01-01

Joubert syndrome and related disorders (JSRD) are a heterogeneous group of ciliopathies defined based on the mid-hindbrain abnormalities that result in the characteristic “molar tooth sign” on brain imaging. The core clinical findings of JSRD are hypotonia, developmental delay, abnormal eye movements and breathing abnormalities. To date, more than 30 JSRD genes that encode proteins important for structure and/or function of cilia have been identified. Here, we present 2 siblings with Joubert syndrome associated with growth hormone deficiency. Whole exome sequencing of the family identified compound heterozygous mutations in KIAA0753, i.e., a missense mutation (p.Arg257Gly) and an intronic mutation (c.2359-1G>C). The intronic mutation alters normal splicing by activating a cryptic acceptor splice site in exon 16. The novel acceptor site skips nine nucleotides, deleting three amino acids from the protein coding frame. KIAA0753 (OFIP) is a centrosome and pericentriolar satellite protein, previously not known to cause Joubert syndrome. We present comprehensive clinical descriptions of the Joubert syndrome patients as well as the cellular phenotype of defective ciliogenesis in the patients’ fibroblasts. PMID:28220259

Mutations in KIAA0753 cause Joubert syndrome associated with growth hormone deficiency.

PubMed

Stephen, Joshi; Vilboux, Thierry; Mian, Luhe; Kuptanon, Chulaluck; Sinclair, Courtney M; Yildirimli, Deniz; Maynard, Dawn M; Bryant, Joy; Fischer, Roxanne; Vemulapalli, Meghana; Mullikin, James C; Huizing, Marjan; Gahl, William A; Malicdan, May Christine V; Gunay-Aygun, Meral

2017-04-01

Joubert syndrome and related disorders (JSRD) are a heterogeneous group of ciliopathies defined based on the mid-hindbrain abnormalities that result in the characteristic "molar tooth sign" on brain imaging. The core clinical findings of JSRD are hypotonia, developmental delay, abnormal eye movements and breathing abnormalities. To date, more than 30 JSRD genes that encode proteins important for structure and/or function of cilia have been identified. Here, we present 2 siblings with Joubert syndrome associated with growth hormone deficiency. Whole exome sequencing of the family identified compound heterozygous mutations in KIAA0753, i.e., a missense mutation (p.Arg257Gly) and an intronic mutation (c.2359-1G>C). The intronic mutation alters normal splicing by activating a cryptic acceptor splice site in exon 16. The novel acceptor site skips nine nucleotides, deleting three amino acids from the protein coding frame. KIAA0753 (OFIP) is a centrosome and pericentriolar satellite protein, previously not known to cause Joubert syndrome. We present comprehensive clinical descriptions of the Joubert syndrome patients as well as the cellular phenotype of defective ciliogenesis in the patients' fibroblasts.

Control of calcitonin/calcitonin gene-related peptide pre-mRNA processing by constitutive intron and exon elements.

PubMed Central

Yeakley, J M; Hedjran, F; Morfin, J P; Merillat, N; Rosenfeld, M G; Emeson, R B

1993-01-01

The calcitonin/calcitonin gene-related peptide (CGRP) primary transcript is alternatively spliced in thyroid C cells and neurons, resulting in the tissue-specific production of calcitonin and CGRP mRNAs. Analyses of mutated calcitonin/CGRP transcription units in permanently transfected cell lines have indicated that alternative splicing is regulated by a differential capacity to utilize the calcitonin-specific splice acceptor. The analysis of an extensive series of mutations suggests that tissue-specific regulation of calcitonin mRNA production does not depend on the presence of a single, unique cis-active element but instead appears to be a consequence of suboptimal constitutive splicing signals. While only those mutations that altered constitutive splicing signals affected splice choices, the action of multiple regulatory sequences cannot be formally excluded. Further, we have identified a 13-nucleotide purine-rich element from a constitutive exon that, when placed in exon 4, entirely switches splice site usage in CGRP-producing cells. These data suggest that specific exon recruitment sequences, in combination with other constitutive elements, serve an important function in exon recognition. These results are consistent with the hypothesis that tissue-specific alternative splicing of the calcitonin/CGRP primary transcript is mediated by cell-specific differences in components of the constitutive splicing machinery. Images PMID:8413203

A study of alternative splicing in the pig

PubMed Central

2010-01-01

Background Since at least half of the genes in mammalian genomes are subjected to alternative splicing, alternative pre-mRNA splicing plays an important contribution to the complexity of the mammalian proteome. Expressed sequence tags (ESTs) provide evidence of a great number of possible alternative isoforms. With the EST resource for the domestic pig now containing more than one million porcine ESTs, it is possible to identify alternative splice forms of the individual transcripts in this species from the EST data with some confidence. Results The pig EST data generated by the Sino-Danish Pig Genome project has been assembled with publicly available ESTs and made available in the PigEST database. Using the Distiller package 2,515 EST clusters with candidate alternative isoforms were identified in the EST data with high confidence. In agreement with general observations in human and mouse, we find putative splice variants in about 30% of the contigs with more than 50 ESTs. Based on the criteria that a minimum of two EST sequences confirmed each splice event, a list of 100 genes with the most distinct tissue-specific alternative splice events was generated from the list of candidates. To confirm the tissue specificity of the splice events, 10 genes with functional annotation were randomly selected from which 16 individual splice events were chosen for experimental verification by quantitative PCR (qPCR). Six genes were shown to have tissue specific alternatively spliced transcripts with expression patterns matching those of the EST data. The remaining four genes had tissue-restricted expression of alternative spliced transcripts. Five out of the 16 splice events that were experimentally verified were found to be putative pig specific. Conclusions In accordance with human and rodent studies we estimate that approximately 30% of the porcine genes undergo alternative splicing. We found a good correlation between EST predicted tissue-specificity and experimentally validated splice events in different porcine tissue. This study indicates that a cluster size of around 50 ESTs is optimal for in silico detection of alternative splicing. Although based on a limited number of splice events, the study supports the notion that alternative splicing could have an important impact on species differentiation since 31% of the splice events studied appears to be species specific. PMID:20444244

Subgroup Specific Alternative Splicing in Medulloblastoma

PubMed Central

Kloosterhof, Nanne K; Northcott, Paul A; Yu, Emily PY; Shih, David; Peacock, John; Grajkowska, Wieslawa; van Meter, Timothy; Eberhart, Charles G; Pfister, Stefan; Marra, Marco A; Weiss, William A; Scherer, Stephen W; Rutka, James T; French, Pim J; Taylor, Michael D

2014-01-01

Medulloblastoma is comprised of four distinct molecular variants: WNT, SHH, Group 3, and Group 4. We analyzed alternative splicing usage in 14 normal cerebellar samples and 103 medulloblastomas of known subgroup. Medulloblastoma samples have a statistically significant increase in alternative splicing as compared to normal fetal cerebella (2.3-times; P<6.47E-8). Splicing patterns are distinct and specific between molecular subgroups. Unsupervised hierarchical clustering of alternative splicing events accurately assigns medulloblastomas to their correct subgroup. Subgroup-specific splicing and alternative promoter usage was most prevalent in Group 3 (19.4%) and SHH (16.2%) medulloblastomas, while observed less frequently in WNT (3.2%), and Group 4 (9.3%) tumors. Functional annotation of alternatively spliced genes reveals over-representation of genes important for neuronal development. Alternative splicing events in medulloblastoma may be regulated in part by the correlative expression of antisense transcripts, suggesting a possible mechanism affecting subgroup specific alternative splicing. Our results identify additional candidate markers for medulloblastoma subgroup affiliation, further support the existence of distinct subgroups of the disease, and demonstrate an additional level of transcriptional heterogeneity between medulloblastoma subgroups. PMID:22358458

Using a minigene approach to characterize a novel splice site mutation in human F7 gene causing inherited factor VII deficiency in a Chinese pedigree.

PubMed

Yu, T; Wang, X; Ding, Q; Fu, Q; Dai, J; Lu, Y; Xi, X; Wang, H

2009-11-01

Factor VII deficiency which transmitted as an autosomal recessive disorder is a rare haemorrhagic condition. The aim of this study was to identify the molecular genetic defect and determine its functional consequences in a Chinese pedigree with FVII deficiency. The proband was diagnosed as inherited coagulation FVII deficiency by reduced plasma levels of FVII activity (4.4%) and antigen (38.5%). All nine exons and their flanking sequence of F7 gene were amplified by polymerase chain reaction (PCR) for the proband and the PCR products were directly sequenced. The compound heterozygous mutations of F7 (NM_000131.3) c.572-1G>A and F7 (NM_000131.3) c.1165T>G; p.Cys389Gly were identified in the proband's F7 gene. To investigate the splicing patterns associated with F7 c.572-1G>A, ectopic transcripts in leucocytes of the proband were analyzed. F7 minigenes, spanning from intron 4 to intron 7 and carrying either an A or a G at position -1 of intron 5, were constructed and transiently transfected into human embryonic kidney (HEK) 293T cells, followed by RT-PCR analysis. The aberrant transcripts from the F7 c.572-1G>A mutant allele were not detected by ectopic transcription study. Sequencing of the RT-PCR products from the mutant transfectant demonstrated the production of an erroneously spliced mRNA with exon 6 skipping, whereas a normal splicing occurred in the wide type transfectant. The aberrant mRNA produced from the F7 c.572-1G>A mutant allele is responsible for the factor VII deficiency in this pedigree.

Risk of mental health problems in adolescents skipping meals: The Korean National Health and Nutrition Examination Survey 2010 to 2012.

PubMed

Lee, Gyungjoo; Han, Kyungdo; Kim, Hyunju

Adolescents frequently skip meals, doing so even more than once per day. This is associated with more mental health problems. This study identified mental health problems' associations with skipping meals and the frequency thereof among adolescents. This cross-sectional population-based study used a data set of 1,413 adolescents from the 2010 to 2012 Korean National Health and Nutrition Examination Survey. Hierarchical multivariable logistic regression was conducted to determine the risk of mental health problems, including stress, depressive mood, and suicidal ideation in relation to skipping meals and the frequency thereof per day. Breakfast skipping significantly increased the risks of stress and depressive mood. Stress, depressive mood, and suicidal ideation were significantly prevalent as the daily frequency of skipping meals increased. Specific strategies should be developed at government or school level to decrease the frequency of skipping meals per day, associated with serious mental health problems in adolescents. Copyright © 2017 Elsevier Inc. All rights reserved.

Modulating Calcium Signals to Boost AON Exon Skipping for DMD

DTIC Science & Technology

2016-10-01

RNA Seq analysis to identify mechanisms of activity and specificity in order to guide discovery of second-generation skipping drugs or combinations...with greater activity. 15. SUBJECT TERMS Exon skipping, Dantrolene, Calcium, Duchenne, Dytrophy, Dystrophin, anti-sense-oligonucleatide, DMD, RNA ...for a subset of very rare mutations. Finally, we hypothesize that by combining chemical genomics with RNA Seq analysis we can begin to identify

RBFOX2 Is an Important Regulator of Mesenchymal Tissue-Specific Splicing in both Normal and Cancer Tissues

PubMed Central

Venables, Julian P.; Brosseau, Jean-Philippe; Gadea, Gilles; Klinck, Roscoe; Prinos, Panagiotis; Beaulieu, Jean-François; Lapointe, Elvy; Durand, Mathieu; Thibault, Philippe; Tremblay, Karine; Rousset, François; Tazi, Jamal; Abou Elela, Sherif

2013-01-01

Alternative splicing provides a critical and flexible layer of regulation intervening in many biological processes to regulate the diversity of proteins and impact cell phenotype. To identify alternative splicing differences that distinguish epithelial from mesenchymal tissues, we have investigated hundreds of cassette exons using a high-throughput reverse transcription-PCR (RT-PCR) platform. Extensive changes in splicing were noted between epithelial and mesenchymal tissues in both human colon and ovarian tissues, with many changes from mostly one splice variant to predominantly the other. Remarkably, many of the splicing differences that distinguish normal mesenchymal from normal epithelial tissues matched those that differentiate normal ovarian tissues from ovarian cancer. Furthermore, because splicing profiling could classify cancer cell lines according to their epithelial/mesenchymal characteristics, we used these cancer cell lines to identify regulators for these specific splicing signatures. By knocking down 78 potential splicing factors in five cell lines, we provide an extensive view of the complex regulatory landscape associated with the epithelial and mesenchymal states, thus revealing that RBFOX2 is an important driver of mesenchymal tissue-specific splicing. PMID:23149937

Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.

PubMed

da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes

2016-05-01

Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.

IRAS: High-Throughput Identification of Novel Alternative Splicing Regulators.

PubMed

Zheng, S

2016-01-01

Alternative splicing is a fundamental regulatory process of gene expression. Defects in alternative splicing can lead to various diseases, and modification of disease-causing splicing events presents great therapeutic promise. Splicing outcome is commonly affected by extracellular stimuli and signaling cascades that converge on RNA-binding splicing regulators. These trans-acting factors recognize cis-elements in pre-mRNA transcripts to affect spliceosome assembly and splice site choices. Identification of these splicing regulators and/or upstream modulators has been difficult and traditionally done by piecemeal. High-throughput screening strategies to find multiple regulators of exon splicing have great potential to accelerate the discovery process, but typically confront low sensitivity and low specificity of screening assays. Here we describe a unique screening strategy, IRAS (identifying regulators of alternative splicing), using a pair of dual-output minigene reporters to allow for sensitive detection of exon splicing changes. Each dual-output reporter produces green fluorescent protein (GFP) and red fluorescent protein (RFP) fluorescent signals to assay the two spliced isoforms exclusively. The two complementary minigene reporters alter GFP/RFP output ratios in the opposite direction in response to splicing change. Applying IRAS in cell-based high-throughput screens allows sensitive and specific identification of splicing regulators and modulators for any alternative exons of interest. In comparison to previous high-throughput screening methods, IRAS substantially enhances the specificity of the screening assay. This strategy significantly eliminates false positives without sacrificing sensitive identification of true regulators of splicing. © 2016 Elsevier Inc. All rights reserved.

Intragenic DNA methylation and BORIS-mediated cancer-specific splicing contribute to the Warburg effect

PubMed Central

Singh, Smriti; Narayanan, Sathiya Pandi; Biswas, Kajal; Gupta, Amit; Ahuja, Neha; Yadav, Sandhya; Panday, Rajendra Kumar; Samaiya, Atul; Sharan, Shyam K.

2017-01-01

Aberrant alternative splicing and epigenetic changes are both associated with various cancers, but epigenetic regulation of alternative splicing in cancer is largely unknown. Here we report that the intragenic DNA methylation-mediated binding of Brother of Regulator of Imprinted Sites (BORIS) at the alternative exon of Pyruvate Kinase (PKM) is associated with cancer-specific splicing that promotes the Warburg effect and breast cancer progression. Interestingly, the inhibition of DNA methylation, BORIS depletion, or CRISPR/Cas9-mediated deletion of the BORIS binding site leads to a splicing switch from cancer-specific PKM2 to normal PKM1 isoform. This results in the reversal of the Warburg effect and the inhibition of breast cancer cell growth, which may serve as a useful approach to inhibit the growth of breast cancer cells. Importantly, our results show that in addition to PKM splicing, BORIS also regulates the alternative splicing of several genes in a DNA methylation-dependent manner. Our findings highlight the role of intragenic DNA methylation and DNA binding protein BORIS in cancer-specific splicing and its role in tumorigenesis. PMID:29073069

Correlates of meal skipping in young adults: a systematic review.

PubMed

Pendergast, Felicity J; Livingstone, Katherine M; Worsley, Anthony; McNaughton, Sarah A

2016-12-01

Meal skipping rates may be highest during young adulthood, a period of transition and development. Although these dietary behaviours may increase future risk of chronic disease, limited research has investigated correlates of meal skipping in young adults. A systematic literature search was conducted to identify studies that investigated correlates of meal skipping behaviours in young adults (aged 18-30 years). EBSCO host, MEDLINE Complete, Global Health, Scopus, EMBASE, Web of Science and Informit platforms were searched for eligible articles. Correlates were defined as any factor that was either associated with meal skipping or was self-reported by the participant to have an influence on meal skipping. Randomised controlled trials, prospective cohort studies, case-control studies, nested case-control studies, cross-sectional studies, and longitudinal studies were eligible for inclusion. Three-hundred and thirty-one articles were identified, 141 full-text articles assessed for eligibility, resulting in 35 included studies. Multiple methodological and reporting weaknesses were apparent in the reviewed studies with 28 of the 35 studies scoring a negative rating in the risk of bias assessment. Meal skipping (any meal), defined as the skipping of any meal throughout the day, was reported in 12 studies with prevalence ranging between 5 and 83%. The remaining 25 studies identified specific meals and their skipping rates, with breakfast the most frequently skipped meal 14-88% compared to lunch 8-57% and dinner 4-57%. Lack of time was consistently reported as an important correlate of meal skipping, compared with correlates such as cost and weight control, while sex was the most commonly reported associated correlate. Breakfast skipping was more common among men while lunch or dinner skipping being more common among women. This review is the first to examine potential correlates of meal skipping in young adults. Future research would benefit from stronger design and reporting strategies, using a standardised approach for measuring and defining meal skipping.

Targeting RNA Splicing for Disease Therapy

PubMed Central

Havens, Mallory A.; Duelli, Dominik M.

2013-01-01

Splicing of pre-messenger RNA into mature messenger RNA is an essential step for expression of most genes in higher eukaryotes. Defects in this process typically affect cellular function and can have pathological consequences. Many human genetic diseases are caused by mutations that cause splicing defects. Furthermore, a number of diseases are associated with splicing defects that are not attributed to overt mutations. Targeting splicing directly to correct disease-associated aberrant splicing is a logical approach to therapy. Splicing is a favorable intervention point for disease therapeutics, because it is an early step in gene expression and does not alter the genome. Significant advances have been made in the development of approaches to manipulate splicing for therapy. Splicing can be manipulated with a number of tools including antisense oligonucleotides, modified small nuclear RNAs (snRNAs), trans-splicing, and small molecule compounds, all of which have been used to increase specific alternatively spliced isoforms or to correct aberrant gene expression resulting from gene mutations that alter splicing. Here we describe clinically relevant splicing defects in disease states, the current tools used to target and alter splicing, specific mutations and diseases that are being targeted using splice-modulating approaches, and emerging therapeutics. PMID:23512601

Targeting RNA splicing for disease therapy.

PubMed

Havens, Mallory A; Duelli, Dominik M; Hastings, Michelle L

2013-01-01

Splicing of pre-messenger RNA into mature messenger RNA is an essential step for the expression of most genes in higher eukaryotes. Defects in this process typically affect cellular function and can have pathological consequences. Many human genetic diseases are caused by mutations that cause splicing defects. Furthermore, a number of diseases are associated with splicing defects that are not attributed to overt mutations. Targeting splicing directly to correct disease-associated aberrant splicing is a logical approach to therapy. Splicing is a favorable intervention point for disease therapeutics, because it is an early step in gene expression and does not alter the genome. Significant advances have been made in the development of approaches to manipulate splicing for therapy. Splicing can be manipulated with a number of tools including antisense oligonucleotides, modified small nuclear RNAs (snRNAs), trans-splicing, and small molecule compounds, all of which have been used to increase specific alternatively spliced isoforms or to correct aberrant gene expression resulting from gene mutations that alter splicing. Here we describe clinically relevant splicing defects in disease states, the current tools used to target and alter splicing, specific mutations and diseases that are being targeted using splice-modulating approaches, and emerging therapeutics. Copyright © 2013 John Wiley & Sons, Ltd.

Position-dependent and neuron-specific splicing regulation by the CELF family RNA-binding protein UNC-75 in Caenorhabditis elegans

PubMed Central

Kuroyanagi, Hidehito; Watanabe, Yohei; Suzuki, Yutaka; Hagiwara, Masatoshi

2013-01-01

A large fraction of protein-coding genes in metazoans undergo alternative pre-mRNA splicing in tissue- or cell-type-specific manners. Recent genome-wide approaches have identified many putative-binding sites for some of tissue-specific trans-acting splicing regulators. However, the mechanisms of splicing regulation in vivo remain largely unknown. To elucidate the modes of splicing regulation by the neuron-specific CELF family RNA-binding protein UNC-75 in Caenorhabditis elegans, we performed deep sequencing of poly(A)+ RNAs from the unc-75(+)- and unc-75-mutant worms and identified more than 20 cassette and mutually exclusive exons repressed or activated by UNC-75. Motif searches revealed that (G/U)UGUUGUG stretches are enriched in the upstream and downstream introns of the UNC-75-repressed and -activated exons, respectively. Recombinant UNC-75 protein specifically binds to RNA fragments carrying the (G/U)UGUUGUG stretches in vitro. Bi-chromatic fluorescence alternative splicing reporters revealed that the UNC-75-target exons are regulated in tissue-specific and (G/U)UGUUGUG element-dependent manners in vivo. The unc-75 mutation affected the splicing reporter expression specifically in the nervous system. These results indicate that UNC-75 regulates alternative splicing of its target exons in neuron-specific and position-dependent manners through the (G/U)UGUUGUG elements in C. elegans. This study thus reveals the repertoire of target events for the CELF family in the living organism. PMID:23416545

Splice-site mutations identified in PDE6A responsible for retinitis pigmentosa in consanguineous Pakistani families

PubMed Central

Khan, Shahid Y.; Ali, Shahbaz; Naeem, Muhammad Asif; Khan, Shaheen N.; Husnain, Tayyab; Butt, Nadeem H.; Qazi, Zaheeruddin A.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

2015-01-01

Purpose This study was conducted to localize and identify causal mutations associated with autosomal recessive retinitis pigmentosa (RP) in consanguineous familial cases of Pakistani origin. Methods Ophthalmic examinations that included funduscopy and electroretinography (ERG) were performed to confirm the affectation status. Blood samples were collected from all participating individuals, and genomic DNA was extracted. A genome-wide scan was performed, and two-point logarithm of odds (LOD) scores were calculated. Sanger sequencing was performed to identify the causative variants. Subsequently, we performed whole exome sequencing to rule out the possibility of a second causal variant within the linkage interval. Sequence conservation was performed with alignment analyses of PDE6A orthologs, and in silico splicing analysis was completed with Human Splicing Finder version 2.4.1. Results A large multigenerational consanguineous family diagnosed with early-onset RP was ascertained. An ophthalmic clinical examination consisting of fundus photography and electroretinography confirmed the diagnosis of RP. A genome-wide scan was performed, and suggestive two-point LOD scores were observed with markers on chromosome 5q. Haplotype analyses identified the region; however, the region did not segregate with the disease phenotype in the family. Subsequently, we performed a second genome-wide scan that excluded the entire genome except the chromosome 5q region harboring PDE6A. Next-generation whole exome sequencing identified a splice acceptor site mutation in intron 16: c.2028–1G>A, which was completely conserved in PDE6A orthologs and was absent in ethnically matched 350 control chromosomes, the 1000 Genomes database, and the NHLBI Exome Sequencing Project. Subsequently, we investigated our entire cohort of RP familial cases and identified a second family who harbored a splice acceptor site mutation in intron 10: c.1408–2A>G. In silico analysis suggested that these mutations will result in the elimination of wild-type splice acceptor sites that would result in either skipping of the respective exon or the creation of a new cryptic splice acceptor site; both possibilities would result in retinal photoreceptor cells that lack PDE6A wild-type protein. Conclusions we report two splice acceptor site variations in PDE6A in consanguineous Pakistani families who manifested cardinal symptoms of RP. Taken together with our previously published work, our data suggest that mutations in PDE6A account for about 2% of the total genetic load of RP in our cohort and possibly in the Pakistani population as well. PMID:26321862

How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy

PubMed Central

Singh, Natalia N.; Howell, Matthew D.; Androphy, Elliot J.; Singh, Ravindra N.

2017-01-01

Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7 during pre-mRNA splicing. With the recent FDA approval of nusinersen (Spinraza™), the potential for correction of SMN2 exon 7 splicing as a SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions. PMID:28485722

How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy.

PubMed

Singh, N N; Howell, M D; Androphy, E J; Singh, R N

2017-09-01

Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 because of predominant skipping of exon 7 during pre-mRNA splicing. With the recent US Food and Drug Administration approval of nusinersen (Spinraza), the potential for correction of SMN2 exon 7 splicing as an SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here, we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions.

A de novo mosaic mutation of PHEX in a boy with hypophosphatemic rickets.

PubMed

Weng, Chen; Chen, Jiao; Sun, Li; Zhou, Zhong-Wei; Feng, Xue; Sun, Jun-Hui; Lu, Ling-Ping; Yu, Ping; Qi, Ming

2016-03-01

X-linked dominant hypophosphatemic rickets (XLHR), is characterized mainly by renal phosphate wasting with hypophosphatemia, short stature and abnormal bone mineralization. PHEX, located at Xp22.1-p22.2, is the gene causing XLHR. We aim to characterize the pathogenesis of a Chinese boy who is apparently 'heterozygous' in PHEX gene. Direct sequencing showed two peaks: one was a wild-type 'G' and the other was one base substitution to 'A', though the patient was a male. TA clone assay clearly showed each sequences and the ratios. The mutation effect was predicted via bioinformatics and validated by exon-trapping assay. Real-time PCR was applied to determine the copy number of PHEX. TA clone assay showed the frequency of normal (G) to mutant allele (A) as 19:13. Normal karyotype and real-time PCR results indicate the normal copy number of PHEX. This splice site mutation leads to 4 bp of exon 18 skipping out causing frame shift p.Gly590Glufs*28 that ends up with a loss of active site and Zn(2+)-binding site of PHEX, which probably interfere with renal phosphate reabsorption and bone mineralization. In conclusion, mutation at conserved splice acceptor site resulted in aberrant splicing, ending up with a damaged protein product. This novel mutation is de novo in mosaic pattern that may be induced during early postzygotic period. Taking mosaic somatic mutation of PHEX into consideration is strongly suggested in genetic counseling and etiology research for XLHR.

A Splice Defect in the EDA Gene in Dogs with an X-Linked Hypohidrotic Ectodermal Dysplasia (XLHED) Phenotype.

PubMed

Waluk, Dominik P; Zur, Gila; Kaufmann, Ronnie; Welle, Monika M; Jagannathan, Vidhya; Drögemüller, Cord; Müller, Eliane J; Leeb, Tosso; Galichet, Arnaud

2016-09-08

X-linked hypohidrotic ectodermal dysplasia (XLHED) caused by variants in the EDA gene represents the most common ectodermal dysplasia in humans. We investigated three male mixed-breed dogs with an ectodermal dysplasia phenotype characterized by marked hypotrichosis and multifocal complete alopecia, almost complete absence of sweat and sebaceous glands, and altered dentition with missing and abnormally shaped teeth. Analysis of SNP chip genotypes and whole genome sequence data from the three affected dogs revealed that the affected dogs shared the same haplotype on a large segment of the X-chromosome, including the EDA gene. Unexpectedly, the whole genome sequence data did not reveal any nonsynonymous EDA variant in the affected dogs. We therefore performed an RNA-seq experiment on skin biopsies to search for changes in the transcriptome. This analysis revealed that the EDA transcript in the affected dogs lacked 103 nucleotides encoded by exon 2. We speculate that this exon skipping is caused by a genetic variant located in one of the large introns flanking this exon, which was missed by whole genome sequencing with the illumina short read technology. The altered EDA transcript splicing most likely causes the observed ectodermal dysplasia in the affected dogs. These dogs thus offer an excellent opportunity to gain insights into the complex splicing processes required for expression of the EDA gene, and other genes with large introns. Copyright © 2016 Waluk et al.

Isolated autosomal dominant growth hormone deficiency: an evolving pituitary deficit? A multicenter follow-up study.

PubMed

Mullis, Primus E; Robinson, Iain C A F; Salemi, Souzan; Eblé, Andrée; Besson, Amélie; Vuissoz, Jean-Marc; Deladoey, Johnny; Simon, Dominique; Czernichow, Paul; Binder, Gerhard

2005-04-01

Four distinct familial types of isolated GH deficiency have been described so far, of which type II is the autosomal dominant inherited form. It is mainly caused by mutations within the first 6 bp of intervening sequence 3. However, other splice site and missense mutations have been reported. Based on in vitro experiments and transgenic animal data, there is strong evidence that there is a wide variability in phenotype in terms of the severity of GH deficiency. Therefore, we studied a total of 57 subjects belonging to 19 families suffering from different splice site as well as missense mutations within the GH-1 gene. The subjects presenting with a splice site mutation within the first 2 bp of intervening sequence 3 (5'IVS +1/+2 bp) leading to a skipping of exon 3 were found to be more likely to present in the follow-up with other pituitary hormone deficiencies. In addition, although the patients with missense mutations have previously been reported to be less affected, a number of patients presenting with the P89L missense GH form, showed some pituitary hormone impairment. The development of multiple hormonal deficiencies is not age dependent, and there is a clear variability in onset, severity, and progression, even within the same families. The message of clinical importance from these studies is that the pituitary endocrine status of all such patients should continue to be monitored closely over the years because further hormonal deficiencies may evolve with time.

Novel variants in PAX6 gene caused congenital aniridia in two Chinese families.

PubMed

Zhang, R; Linpeng, S; Wei, X; Li, H; Huang, Y; Guo, J; Wu, Q; Liang, D; Wu, L

2017-06-01

PurposeTo reveal the underlying genetic defect in two four-generation Chinese families with aniridia and explore the pathologic mechanism.MethodsFull ophthalmic examinations were performed in two families with aniridia. The PAX6 gene was directly sequenced in patients of two families, and the detected variants were screened in unaffected family members and two hundred unrelated healthy controls. Real-time quantitative PCR was used to explore pathologic mechanisms of the two variants.ResultsAniridia, cataract, and oscillatory nystagmus were observed in patients of the two families. In addition, we observed corneal opacity and microphthalmus in family 1, and strabismus, left ectopia lentis, microphthalmus, and microcornea in family 2. Sanger sequencing detected a novel 1-bp duplication (c.50dupA) in family 1 and a novel 2-bp splice site deletion (c.765+1_765+2delGT) in family 2. Sequencing of cDNA indicated skipping of exon 9 caused by the splice site deletion, being predicted to cause a premature stop codon, as well as the duplication. The PAX6 mRNA significantly lower in patients with aniridia than in unaffected family members in both families, suggesting that the duplication and splice site deletion caused nonsense-mediated mRNA decay.ConclusionsOur study identified two novel PAX6 variants in two families with aniridia and revealed the pathogenicity of the variants; this would expand the variant spectrum of PAX6 and help us better understand the molecular basis of aniridia, thus facilitating genetic counseling.

Manananggal - a novel viewer for alternative splicing events.

PubMed

Barann, Matthias; Zimmer, Ralf; Birzele, Fabian

2017-02-21

Alternative splicing is an important cellular mechanism that can be analyzed by RNA sequencing. However, identification of splicing events in an automated fashion is error-prone. Thus, further validation is required to select reliable instances of alternative splicing events (ASEs). There are only few tools specifically designed for interactive inspection of ASEs and available visualization approaches can be significantly improved. Here, we present Manananggal, an application specifically designed for the identification of splicing events in next generation sequencing data. Manananggal includes a web application for visual inspection and a command line tool that allows for ASE detection. We compare the sashimi plots available in the IGV Viewer, the DEXSeq splicing plots and SpliceSeq to the Manananggal interface and discuss the advantages and drawbacks of these tools. We show that sashimi plots (such as those used by the IGV Viewer and SpliceSeq) offer a practical solution for simple ASEs, but also indicate short-comings for highly complex genes. Manananggal is an interactive web application that offers functions specifically tailored to the identification of alternative splicing events that other tools are lacking. The ability to select a subset of isoforms allows an easier interpretation of complex alternative splicing events. In contrast to SpliceSeq and the DEXSeq splicing plot, Manananggal does not obscure the gene structure by showing full transcript models that makes it easier to determine which isoforms are expressed and which are not.

The TREAT-NMD DMD Global Database: Analysis of More than 7,000 Duchenne Muscular Dystrophy Mutations

PubMed Central

Bladen, Catherine L; Salgado, David; Monges, Soledad; Foncuberta, Maria E; Kekou, Kyriaki; Kosma, Konstantina; Dawkins, Hugh; Lamont, Leanne; Roy, Anna J; Chamova, Teodora; Guergueltcheva, Velina; Chan, Sophelia; Korngut, Lawrence; Campbell, Craig; Dai, Yi; Wang, Jen; Barišić, Nina; Brabec, Petr; Lahdetie, Jaana; Walter, Maggie C; Schreiber-Katz, Olivia; Karcagi, Veronika; Garami, Marta; Viswanathan, Venkatarman; Bayat, Farhad; Buccella, Filippo; Kimura, En; Koeks, Zaïda; van den Bergen, Janneke C; Rodrigues, Miriam; Roxburgh, Richard; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Zimowski, Janusz; Santos, Rosário; Neagu, Elena; Artemieva, Svetlana; Rasic, Vedrana Milic; Vojinovic, Dina; Posada, Manuel; Bloetzer, Clemens; Jeannet, Pierre-Yves; Joncourt, Franziska; Díaz-Manera, Jordi; Gallardo, Eduard; Karaduman, A Ayşe; Topaloğlu, Haluk; El Sherif, Rasha; Stringer, Angela; Shatillo, Andriy V; Martin, Ann S; Peay, Holly L; Bellgard, Matthew I; Kirschner, Jan; Flanigan, Kevin M; Straub, Volker; Bushby, Kate; Verschuuren, Jan; Aartsma-Rus, Annemieke; Béroud, Christophe; Lochmüller, Hanns

2015-01-01

Analyzing the type and frequency of patient-specific mutations that give rise to Duchenne muscular dystrophy (DMD) is an invaluable tool for diagnostics, basic scientific research, trial planning, and improved clinical care. Locus-specific databases allow for the collection, organization, storage, and analysis of genetic variants of disease. Here, we describe the development and analysis of the TREAT-NMD DMD Global database (http://umd.be/TREAT_DMD/). We analyzed genetic data for 7,149 DMD mutations held within the database. A total of 5,682 large mutations were observed (80% of total mutations), of which 4,894 (86%) were deletions (1 exon or larger) and 784 (14%) were duplications (1 exon or larger). There were 1,445 small mutations (smaller than 1 exon, 20% of all mutations), of which 358 (25%) were small deletions and 132 (9%) small insertions and 199 (14%) affected the splice sites. Point mutations totalled 756 (52% of small mutations) with 726 (50%) nonsense mutations and 30 (2%) missense mutations. Finally, 22 (0.3%) mid-intronic mutations were observed. In addition, mutations were identified within the database that would potentially benefit from novel genetic therapies for DMD including stop codon read-through therapies (10% of total mutations) and exon skipping therapy (80% of deletions and 55% of total mutations). PMID:25604253

The Human Splicing Factor ASF/SF2 can Specifically Recognize Pre-mRNA 5' Splice Sites

NASA Astrophysics Data System (ADS)

Zuo, Ping; Manley, James L.

1994-04-01

ASF/SF2 is a human protein previously shown to function in in vitro pre-mRNA splicing as an essential factor necessary for all splices and also as an alternative splicing factor, capable of switching selection of 5' splice sites. To begin to study the protein's mechanism of action, we have investigated the RNA binding properties of purified recombinant ASF/SF2. Using UV crosslinking and gel shift assays, we demonstrate that the RNA binding region of ASF/SF2 can interact with RNA in a sequence-specific manner, recognizing the 5' splice site in each of two different pre-mRNAs. Point mutations in the 5' splice site consensus can reduce binding by as much as a factor of 100, with the largest effects observed in competition assays. These findings support a model in which ASF/SF2 aids in the recognition of pre-mRNA 5' splice sites.

Splicing-factor alterations in cancers

PubMed Central

Anczuków, Olga; Krainer, Adrian R.

2016-01-01

Tumor-associated alterations in RNA splicing result either from mutations in splicing-regulatory elements or changes in components of the splicing machinery. This review summarizes our current understanding of the role of splicing-factor alterations in human cancers. We describe splicing-factor alterations detected in human tumors and the resulting changes in splicing, highlighting cell-type-specific similarities and differences. We review the mechanisms of splicing-factor regulation in normal and cancer cells. Finally, we summarize recent efforts to develop novel cancer therapies, based on targeting either the oncogenic splicing events or their upstream splicing regulators. PMID:27530828

Exploiting differential RNA splicing patterns: a potential new group of therapeutic targets in cancer.

PubMed

Jyotsana, Nidhi; Heuser, Michael

2018-02-01

Mutations in genes associated with splicing have been found in hematologic malignancies, but also in solid cancers. Aberrant cancer specific RNA splicing either results from mutations or misexpression of the spliceosome genes directly, or from mutations in splice sites of oncogenes or tumor suppressors. Areas covered: In this review, we present molecular targets of aberrant splicing in various malignancies, information on existing and emerging therapeutics against such targets, and strategies for future drug development. Expert opinion: Alternative splicing is an important mechanism that controls gene expression, and hence pharmacologic and genetic control of aberrant alternative RNA splicing has been proposed as a potential therapy in cancer. To identify and validate aberrant RNA splicing patterns as therapeutic targets we need to (1) characterize the most common genetic aberrations of the spliceosome and of splice sites, (2) understand the dysregulated downstream pathways and (3) exploit in-vivo disease models of aberrant splicing. Antisense oligonucleotides show promising activity, but will benefit from improved delivery tools. Inhibitors of mutated splicing factors require improved specificity, as alternative and aberrant splicing are often intertwined like two sides of the same coin. In summary, targeting aberrant splicing is an early but emerging field in cancer treatment.

Cancer-Associated Perturbations in Alternative Pre-messenger RNA Splicing.

PubMed

Shkreta, Lulzim; Bell, Brendan; Revil, Timothée; Venables, Julian P; Prinos, Panagiotis; Elela, Sherif Abou; Chabot, Benoit

2013-01-01

For most of our 25,000 genes, the removal of introns by pre-messenger RNA (pre-mRNA) splicing represents an essential step toward the production of functional messenger RNAs (mRNAs). Alternative splicing of a single pre-mRNA results in the production of different mRNAs. Although complex organisms use alternative splicing to expand protein function and phenotypic diversity, patterns of alternative splicing are often altered in cancer cells. Alternative splicing contributes to tumorigenesis by producing splice isoforms that can stimulate cell proliferation and cell migration or induce resistance to apoptosis and anticancer agents. Cancer-specific changes in splicing profiles can occur through mutations that are affecting splice sites and splicing control elements, and also by alterations in the expression of proteins that control splicing decisions. Recent progress in global approaches that interrogate splicing diversity should help to obtain specific splicing signatures for cancer types. The development of innovative approaches for annotating and reprogramming splicing events will more fully establish the essential contribution of alternative splicing to the biology of cancer and will hopefully provide novel targets and anticancer strategies. Metazoan genes are usually made up of several exons interrupted by introns. The introns are removed from the pre-mRNA by RNA splicing. In conjunction with other maturation steps, such as capping and polyadenylation, the spliced mRNA is then transported to the cytoplasm to be translated into a functional protein. The basic mechanism of splicing requires accurate recognition of each extremity of each intron by the spliceosome. Introns are identified by the binding of U1 snRNP to the 5' splice site and the U2AF65/U2AF35 complex to the 3' splice site. Following these interactions, other proteins and snRNPs are recruited to generate the complete spliceosomal complex needed to excise the intron. While many introns are constitutively removed by the spliceosome, other splice junctions are not used systematically, generating the phenomenon of alternative splicing. Alternative splicing is therefore the process by which a single species of pre-mRNA can be matured to produce different mRNA molecules (Fig. 1). Depending on the number and types of alternative splicing events, a pre-mRNA can generate from two to several thousands different mRNAs leading to the production of a corresponding number of proteins. It is now believed that the expression of at least 70 % of human genes is subjected to alternative splicing, implying an enormous contribution to proteomic diversity, and by extension, to the development and the evolution of complex animals. Defects in splicing have been associated with human diseases (Caceres and Kornblihtt, Trends Genet 18(4):186-93, 2002, Cartegni et al., Nat Rev Genet 3(4):285-98, 2002, Pagani and Baralle, Nat Rev Genet 5(5):389-96, 2004), including cancer (Brinkman, Clin Biochem 37(7):584-94, 2004, Venables, Bioessays 28(4):378-86, 2006, Srebrow and Kornblihtt, J Cell Sci 119(Pt 13):2635-2641, 2006, Revil et al., Bull Cancer 93(9):909-919, 2006, Venables, Transworld Res Network, 2006, Pajares et al., Lancet Oncol 8(4):349-57, 2007, Skotheim and Nees, Int J Biochem Cell Biol 39:1432-1449, 2007). Numerous studies have now confirmed the existence of specific differences in the alternative splicing profiles between normal and cancer tissues. Although there are a few cases where specific mutations are the primary cause for these changes, global alterations in alternative splicing in cancer cells may be primarily derived from changes in the expression of RNA-binding proteins that control splice site selection. Overall, these cancer-specific differences in alternative splicing offer an immense potential to improve the diagnosis and the prognosis of cancer. This review will focus on the functional impact of cancer-associated alternative splicing variants, the molecular determinants that alter the splicing decisions in cancer cells, and future therapeutic strategies.

Neonatal Marfan Syndrome: Report of a Case with an Inherited Splicing Mutation outside the Neonatal Domain

PubMed Central

Le Gloan, Laurianne; Hauet, Quentin; David, Albert; Hanna, Nadine; Arfeuille, Chloé; Arnaud, Pauline; Boileau, Catherine; Romefort, Bénédicte; Benbrik, Nadir; Gournay, Véronique; Joram, Nicolas; Baron, Olivier; Isidor, Bertrand

2016-01-01

We report a child and her mother affected by Marfan syndrome. The child presented with a phenotype of neonatal Marfan syndrome, revealed by acute and refractory heart failure, finally leading to death within the first 4 months of life. Her mother had a common clinical presentation. Genetic analysis revealed an inherited FBN1 mutation. This intronic mutation (c.6163+3_6163+6del), undescribed to date, leads to exon 49 skipping, corresponding to in-frame deletion of 42 amino acids (p.Ile2014_Asp2055del). FBN1 next-generation sequencing did not show any argument for mosaicism. Association in the same family of severe neonatal and classical Marfan syndrome illustrates the intrafamilial phenotype variability. PMID:27022329

Neonatal Marfan Syndrome: Report of a Case with an Inherited Splicing Mutation outside the Neonatal Domain.

PubMed

Le Gloan, Laurianne; Hauet, Quentin; David, Albert; Hanna, Nadine; Arfeuille, Chloé; Arnaud, Pauline; Boileau, Catherine; Romefort, Bénédicte; Benbrik, Nadir; Gournay, Véronique; Joram, Nicolas; Baron, Olivier; Isidor, Bertrand

2016-02-01

We report a child and her mother affected by Marfan syndrome. The child presented with a phenotype of neonatal Marfan syndrome, revealed by acute and refractory heart failure, finally leading to death within the first 4 months of life. Her mother had a common clinical presentation. Genetic analysis revealed an inherited FBN1 mutation. This intronic mutation (c.6163+3_6163+6del), undescribed to date, leads to exon 49 skipping, corresponding to in-frame deletion of 42 amino acids (p.Ile2014_Asp2055del). FBN1 next-generation sequencing did not show any argument for mosaicism. Association in the same family of severe neonatal and classical Marfan syndrome illustrates the intrafamilial phenotype variability.

RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification.

PubMed

Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang; Li, Jinghong

2017-08-01

RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5'-ASO could block RNA splicing by inhibiting the first step, while 3'-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs.

Evolution of a tissue-specific splicing network

PubMed Central

Taliaferro, J. Matthew; Alvarez, Nehemiah; Green, Richard E.; Blanchette, Marco; Rio, Donald C.

2011-01-01

Alternative splicing of precursor mRNA (pre-mRNA) is a strategy employed by most eukaryotes to increase transcript and proteomic diversity. Many metazoan splicing factors are members of multigene families, with each member having different functions. How these highly related proteins evolve unique properties has been unclear. Here we characterize the evolution and function of a new Drosophila splicing factor, termed LS2 (Large Subunit 2), that arose from a gene duplication event of dU2AF50, the large subunit of the highly conserved heterodimeric general splicing factor U2AF (U2-associated factor). The quickly evolving LS2 gene has diverged from the splicing-promoting, ubiquitously expressed dU2AF50 such that it binds a markedly different RNA sequence, acts as a splicing repressor, and is preferentially expressed in testes. Target transcripts of LS2 are also enriched for performing testes-related functions. We therefore propose a path for the evolution of a new splicing factor in Drosophila that regulates specific pre-mRNAs and contributes to transcript diversity in a tissue-specific manner. PMID:21406555

An RNA-splicing mutation (G{sup +51VS20}) in the Type II collagen gene (COL2A1) in a family with spondyloepiphyseal dysplasia congenita

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tiller, G.E.; Polumbo, P.A.; Weis, M.A.

1995-02-01

Defects in type II collagen have been demonstrated in a phenotypic continuum of chondrodysplasias that includes achondrogenesis II, hypochondrogenesis, spondyloepiphyseal dysplasia congenita (SEDC), Kniest dysplasia, and Stickler syndrome. We have determined that cartilage from a terminated fetus with an inherited form of SEDC contained both normal {alpha}1(II) collagen chains and chains that lacked amino acids 256-273 of the triple-helical domain. PCR amplification of this region of COL2A1, from genomic DNA, yielded products of normal size, while amplification of cDNA yielded a normal sized species and a shorter fragment missing exon 20. Sequence analysis of genomic DNA from the fetus revealedmore » a G{yields}T transversion at position +5 of intron 20; the affected father was also heterozygous for the mutation. Allele-specific PCR and heteroduplex analysis of a VNTR in COL2A1 independently confirmed the unaffected status of a fetus in a subsequent pregnancy. Thermodynamic calculations suggest that the mutation prevents normal splicing of exon 20 by interfering with binding of U{sub 1} small-nuclear RNA to pre-mRNA, thus leading to skipping of exon 20 in transcripts from the mutant allele. Electron micrographs of diseased cartilage showed intracellular inclusion bodies, which were stained by an antibody to {alpha}1(II) procollagen. Our findings support the hypothesis that {alpha}-chain length alterations that preserve the Gly-X-Y repeat motif of the triple helix result in partial intracellular retention of {alpha}1(II) procollagen and produce mild to moderate chondrodysplasia phenotypes. 50 refs., 6 figs., 1 tab.« less

Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

PubMed

Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

2012-07-01

Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Alternative Splicing of Four Trafficking Genes Regulates Myofiber Structure and Skeletal Muscle Physiology.

PubMed

Giudice, Jimena; Loehr, James A; Rodney, George G; Cooper, Thomas A

2016-11-15

During development, transcriptional and post-transcriptional networks are coordinately regulated to drive organ maturation. Alternative splicing contributes by producing temporal-specific protein isoforms. We previously found that genes undergoing splicing transitions during mouse postnatal heart development are enriched for vesicular trafficking and membrane dynamics functions. Here, we show that adult trafficking isoforms are also expressed in adult skeletal muscle and hypothesize that striated muscle utilizes alternative splicing to generate specific isoforms required for function of adult tissue. We deliver morpholinos into flexor digitorum brevis muscles in adult mice to redirect splicing of four trafficking genes to the fetal isoforms. The splicing switch results in multiple structural and functional defects, including transverse tubule (T-tubule) disruption and dihydropyridine receptor alpha (DHPR) and Ryr1 mislocalization, impairing excitation-contraction coupling, calcium handling, and force generation. The results demonstrate a previously unrecognized role for trafficking functions in adult muscle tissue homeostasis and a specific requirement for the adult splice variants. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data.

PubMed

Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S

2016-01-01

Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers.

Association of polymorphisms in genes of factors involved in regulation of splicing of cystic fibrosis transmembrane conductance regulator mRNA with acute respiratory distress syndrome in children with pneumonia.

PubMed

Perez-Marques, Francesca; Simpson, Pippa; Yan, Ke; Quasney, Michael W; Halligan, Nadine; Merchant, Daniel; Dahmer, Mary K

2016-09-05

Previous work has demonstrated a strong association between lung injury in African American children with pneumonia and a polymorphic (TG)mTn region in cystic fibrosis transmembrane conductance (CFTR) involved in the generation of a nonfunctional CFTR protein lacking exon 9. A number of splicing factors that regulate the inclusion/exclusion of exon 9 have been identified. The objective of this study was to determine whether genetic variants in these splicing factors were associated with acute respiratory distress syndrome (ARDS) in children with pneumonia. This is a prospective cohort genetic association study of lung injury in African American and non-Hispanic Caucasian children with community-acquired pneumonia evaluated in the emergency department or admitted to the hospital. Linkage-disequilibrium-tag single nucleotide polymorphisms (LD-tag SNPs) in genes of the following splicing factors (followed by gene name) involved in exon 9 skipping PTB1 (PTBP1), SRp40 (SFRS1), SR2/ASF (SFRS5), TDP-43 (TARDBP), TIA-1 (TIA1), and U2AF(65) (U2AF2) were genotyped. SNPs in the gene of the splicing factor CELF2 (CELF2) were selected by conservation score. Multivariable analysis was used to examine association between genotypes and ARDS. The African American cohort (n = 474) had 29 children with ARDS and the non-Hispanic Caucasian cohort (n = 304) had 32 children with ARDS. In the African American group multivariable analysis indicated that three variants in CELF2, rs7068124 (p = 0.004), rs3814634 (p = 0.032) and rs10905928 (p = 0.044), and two in TIA1, rs2592178 (p = 0.005) and rs13402990 (p = 0.018) were independently associated with ARDS. In the non-Hispanic Caucasian group, a single variant in CELF2, rs2277212 (p = 0.014), was associated with increased risk of developing ARDS. The data indicate that SNPs in CELF2 may be associated with the risk of developing ARDS in both African American and non-Hispanic Caucasian children with pneumonia and suggest that the potential role of the splicing factor CELF2 in ARDS should be explored further.

Multiple cis-acting sequence elements are required for efficient splicing of simian virus 40 small-t antigen pre-mRNA.

PubMed Central

Fu, X Y; Colgan, J D; Manley, J L

1988-01-01

We have determined the effects of a number of mutations in the small-t antigen mRNA intron on the alternative splicing pattern of the simian virus 40 early transcript. Expansion of the distance separating the small-t pre-mRNA lariat branch point and the shared large T-small t 3' splice site from 18 to 29 nucleotides (nt) resulted in a relative enhancement of small-t splicing in vivo. This finding, coupled with the observation that large-T pre-RNA splicing in vitro was not affected by this expansion, suggests that small-t splicing is specifically constrained by a short branch point-3' splice site distance. Similarly, the distance separating the 5' splice site and branch point (48 nt) was found to be at or near a minimum for small-t splicing, because deletions in this region as small as 2 nt dramatically reduced the ratio of small-t to large-T mRNA that accumulated in transfected cells. Finally, a specific sequence within the small-t intron, encompassing the upstream branch sites used in large-T splicing, was found to be an important element in the cell-specific pattern of early alternative splicing. Substitutions within this region reduced the ratio of small-t to large-T mRNA produced in HeLa cells but had only minor effects in human 293 cells. Images PMID:2851720

Lineage-specific splicing of a brain-enriched alternative exon promotes glioblastoma progression

PubMed Central

Ferrarese, Roberto; Harsh, Griffith R.; Yadav, Ajay K.; Bug, Eva; Maticzka, Daniel; Reichardt, Wilfried; Dombrowski, Stephen M.; Miller, Tyler E.; Masilamani, Anie P.; Dai, Fangping; Kim, Hyunsoo; Hadler, Michael; Scholtens, Denise M.; Yu, Irene L.Y.; Beck, Jürgen; Srinivasasainagendra, Vinodh; Costa, Fabrizio; Baxan, Nicoleta; Pfeifer, Dietmar; von Elverfeldt, Dominik; Backofen, Rolf; Weyerbrock, Astrid; Duarte, Christine W.; He, Xiaolin; Prinz, Marco; Chandler, James P.; Vogel, Hannes; Chakravarti, Arnab; Rich, Jeremy N.; Carro, Maria S.; Bredel, Markus

2014-01-01

Tissue-specific alternative splicing is critical for the emergence of tissue identity during development, yet the role of this process in malignant transformation is undefined. Tissue-specific splicing involves evolutionarily conserved, alternative exons that represent only a minority of the total alternative exons identified. Many of these conserved exons have functional features that influence signaling pathways to profound biological effect. Here, we determined that lineage-specific splicing of a brain-enriched cassette exon in the membrane-binding tumor suppressor annexin A7 (ANXA7) diminishes endosomal targeting of the EGFR oncoprotein, consequently enhancing EGFR signaling during brain tumor progression. ANXA7 exon splicing was mediated by the ribonucleoprotein PTBP1, which is normally repressed during neuronal development. PTBP1 was highly expressed in glioblastomas due to loss of a brain-enriched microRNA (miR-124) and to PTBP1 amplification. The alternative ANXA7 splicing trait was present in precursor cells, suggesting that glioblastoma cells inherit the trait from a potential tumor-initiating ancestor and that these cells exploit this trait through accumulation of mutations that enhance EGFR signaling. Our data illustrate that lineage-specific splicing of a tissue-regulated alternative exon in a constituent of an oncogenic pathway eliminates tumor suppressor functions and promotes glioblastoma progression. This paradigm may offer a general model as to how tissue-specific regulatory mechanisms can reprogram normal developmental processes into oncogenic ones. PMID:24865424

Alternative Splicing in Neurogenesis and Brain Development.

PubMed

Su, Chun-Hao; D, Dhananjaya; Tarn, Woan-Yuh

2018-01-01

Alternative splicing of precursor mRNA is an important mechanism that increases transcriptomic and proteomic diversity and also post-transcriptionally regulates mRNA levels. Alternative splicing occurs at high frequency in brain tissues and contributes to every step of nervous system development, including cell-fate decisions, neuronal migration, axon guidance, and synaptogenesis. Genetic manipulation and RNA sequencing have provided insights into the molecular mechanisms underlying the effects of alternative splicing in stem cell self-renewal and neuronal fate specification. Timely expression and perhaps post-translational modification of neuron-specific splicing regulators play important roles in neuronal development. Alternative splicing of many key transcription regulators or epigenetic factors reprograms the transcriptome and hence contributes to stem cell fate determination. During neuronal differentiation, alternative splicing also modulates signaling activity, centriolar dynamics, and metabolic pathways. Moreover, alternative splicing impacts cortical lamination and neuronal development and function. In this review, we focus on recent progress toward understanding the contributions of alternative splicing to neurogenesis and brain development, which has shed light on how splicing defects may cause brain disorders and diseases.

Methods for Characterization of Alternative RNA Splicing.

PubMed

Harvey, Samuel E; Cheng, Chonghui

2016-01-01

Quantification of alternative splicing to detect the abundance of differentially spliced isoforms of a gene in total RNA can be accomplished via RT-PCR using both quantitative real-time and semi-quantitative PCR methods. These methods require careful PCR primer design to ensure specific detection of particular splice isoforms. We also describe analysis of alternative splicing using a splicing "minigene" in mammalian cell tissue culture to facilitate investigation of the regulation of alternative splicing of a particular exon of interest.

RNA Structure Design Improves Activity and Specificity of trans-Splicing-Triggered Cell Death in a Suicide Gene Therapy Approach.

PubMed

Poddar, Sushmita; Loh, Pei She; Ooi, Zi Hao; Osman, Farhana; Eul, Joachim; Patzel, Volker

2018-06-01

Spliceosome-mediated RNA trans-splicing enables correction or labeling of pre-mRNA, but therapeutic applications are hampered by issues related to the activity and target specificity of trans-splicing RNA (tsRNA). We employed computational RNA structure design to improve both on-target activity and specificity of tsRNA in a herpes simplex virus thymidine kinase/ganciclovir suicide gene therapy approach targeting alpha fetoprotein (AFP), a marker of hepatocellular carcinoma (HCC) or human papillomavirus type 16 (HPV-16) pre-mRNA. While unstructured, mismatched target binding domains significantly improved 3' exon replacement (3'ER), 5' exon replacement (5'ER) correlated with the thermodynamic stability of the tsRNA 3' end. Alternative on-target trans-splicing was found to be a prevalent event. The specificity of trans-splicing with the intended target splice site was improved 10-fold by designing tsRNA that harbors secondary target binding domains shielding alternative on-target and blinding off-target splicing events. Such rationally designed suicide RNAs efficiently triggered death of HPV-16-transduced or hepatoblastoma-derived human tissue culture cells without evidence for off-target cell killing. Highest cell death activities were observed with novel dual-targeting tsRNAs programmed for trans-splicing toward AFP and a second HCC pre-mRNA biomarker. Our observations suggest trans-splicing represents a promising approach to suicide gene therapy. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Conserved Domains in the Transformer Protein Act Complementary to Regulate Sex-Specific Splicing of Its Own Pre-mRNA.

PubMed

Tanaka, Arisa; Aoki, Fugaku; Suzuki, Masataka G

2018-05-26

The transformer (tra) gene, which is a female-determining master gene in the housefly Musca domestica, acts as a memory device for sex determination via its auto-regulatory function, i.e., through the contribution of the TRA protein to female-specific splicing of its own pre-mRNA. The TRA protein contains 4 small domains that are specifically conserved among TRA proteins (domains 1-4). Domain 2, also named TRA-CAM domain, is the most conserved, but its function remains unknown. To examine whether these domains are involved in the auto-regulatory function, we performed in vitro splicing assays using a tra minigene containing a partial genomic sequence of the M. domestica tra (Mdtra) gene. Co-transfection of the Mdtra minigene and an MdTRA protein expression vector into cultured insect cells strongly induced female-specific splicing of the minigene. A series of deletion mutation analyses demonstrated that these domains act complementarily to induce female-specific splicing. Domain 1 and the TRA-CAM domain were necessary for the female-specific splicing when the MdTRA protein lacked both domains 3 and 4. In this situation, mutation of the well-conserved 3 amino acids (GEG) in the TRA-CAM domain significantly reduced the female-specific splicing activity of MdTRA. GST-pull down analyses demonstrated that the MdTRA protein specifically enriched on the male-specific exonic region (exon 2b), which contains the putative TRA/TRA-2 binding sites, and that the GEG mutation disrupts this enrichment. Since the MdTRA protein interacts with its own pre-mRNA through TRA-2, our findings suggest that the conserved amino acid residues in the TRA-CAM domain may be crucial for the interaction between MdTRA and TRA-2, enhancing MdTRA recruitment on its pre-mRNA to induce female-specific splicing of tra in the housefly. © 2018 S. Karger AG, Basel.

RNA splicing during terminal erythropoiesis.

PubMed

Conboy, John G

2017-05-01

Erythroid progenitors must accurately and efficiently splice thousands of pre-mRNAs as the cells undergo extensive changes in gene expression and cellular remodeling during terminal erythropoiesis. Alternative splicing choices are governed by interactions between RNA binding proteins and cis-regulatory binding motifs in the RNA. This review will focus on recent studies that define the genome-wide scope of splicing in erythroblasts and discuss what is known about its regulation. RNA-seq analysis of highly purified erythroblast populations has revealed an extensive program of alternative splicing of both exons and introns. During normal erythropoiesis, stage-specific splicing transitions alter the structure and abundance of protein isoforms required for optimized red cell production. Mutation or deficiency of splicing regulators underlies hematopoietic disease in myelopdysplasia syndrome patients via disrupting the splicing program. Erythroid progenitors execute an elaborate alternative splicing program that modulates gene expression posttranscriptionally, ultimately regulating the structure and function of the proteome in a differentiation stage-specific manner during terminal erythropoiesis. This program helps drive differentiation and ensure synthesis of the proper protein isoforms required to produce mechanically stable red cells. Mutation or deficiency of key splicing regulatory proteins disrupts the splicing program to cause disease.

Context-dependent control of alternative splicing by RNA-binding proteins

PubMed Central

Fu, Xiang-Dong; Ares, Manuel

2015-01-01

Sequence-specific RNA-binding proteins (RBPs) bind to pre-mRNA to control alternative splicing, but it is not yet possible to read the ‘splicing code’ that dictates splicing regulation on the basis of genome sequence. Each alternative splicing event is controlled by multiple RBPs, the combined action of which creates a distribution of alternatively spliced products in a given cell type. As each cell type expresses a distinct array of RBPs, the interpretation of regulatory information on a given RNA target is exceedingly dependent on the cell type. RBPs also control each other’s functions at many levels, including by mutual modulation of their binding activities on specific regulatory RNA elements. In this Review, we describe some of the emerging rules that govern the highly context-dependent and combinatorial nature of alternative splicing regulation. PMID:25112293

Alternative splicing and trans-splicing events revealed by analysis of the Bombyx mori transcriptome

PubMed Central

Shao, Wei; Zhao, Qiong-Yi; Wang, Xiu-Ye; Xu, Xin-Yan; Tang, Qing; Li, Muwang; Li, Xuan; Xu, Yong-Zhen

2012-01-01

Alternative splicing and trans-splicing events have not been systematically studied in the silkworm Bombyx mori. Here, the silkworm transcriptome was analyzed by RNA-seq. We identified 320 novel genes, modified 1140 gene models, and found thousands of alternative splicing and 58 trans-splicing events. Studies of three SR proteins show that both their alternative splicing patterns and mRNA products are conserved from insect to human, and one isoform of Srsf6 with a retained intron is expressed sex-specifically in silkworm gonads. Trans-splicing of mod(mdg4) in silkworm was experimentally confirmed. We identified integrations from a common 5′-gene with 46 newly identified alternative 3′-exons that are located on both DNA strands over a 500-kb region. Other trans-splicing events in B. mori were predicted by bioinformatic analysis, in which 12 events were confirmed by RT-PCR, six events were further validated by chimeric SNPs, and two events were confirmed by allele-specific RT-PCR in F1 hybrids from distinct silkworm lines of JS and L10, indicating that trans-splicing is more widespread in insects than previously thought. Analysis of the B. mori transcriptome by RNA-seq provides valuable information of regulatory alternative splicing events. The conservation of splicing events across species and newly identified trans-splicing events suggest that B. mori is a good model for future studies. PMID:22627775

PubMed Central

DE LOS ANGELES BEYTÍA, MARIA; VRY, JULIA; KIRSCHNER, JANBERND

2012-01-01

Duchenne muscular dystrophy (DMD) is a disease linked to the X-chromosome which affects 1 in 3,600-6,000 newborn males. It is manifested by the absence of the dystrophin protein in muscle fibres, which causes progressive damage leading to death in the third decade of life. The only medication so far shown to be effective in delaying the progression of this illness are corticosteroids, which have been shown to increase muscle strength in randomised controlled studies; long-term studies have demonstrated that they prolong walking time and retard the progression of respiratory dysfunction, dilated cardiomyopathy and scoliosis. Several potential drugs are now being investigated. Genetic therapy, involving the insertion of a dystrophin gene through a vector, has proven effective in animals but not humans. Currently under clinical study is Ataluren, a molecule that binds with ribosomes and may allow the insertion of an aminoacid in the premature termination codon, and exon-skipping, which binds with RNA and excludes specific sites of RNA splicing, producing a dystrophin that is smaller but functional. There are also studies attempting to modulate other muscular proteins, such as myostatin and utrophin, to reduce symptoms. This paper does not address cardiomyopathy treatment in DMD patients. PMID:22655510

Morpholino oligomer-mediated exon skipping averts the onset of dystrophic pathology in the mdx mouse.

PubMed

Fletcher, Sue; Honeyman, Kaite; Fall, Abbie M; Harding, Penny L; Johnsen, Russell D; Steinhaus, Joshua P; Moulton, Hong M; Iversen, Patrick L; Wilton, Stephen D

2007-09-01

Duchenne and Becker muscular dystrophies are allelic disorders arising from mutations in the dystrophin gene. Duchenne muscular dystrophy is characterized by an absence of functional protein, whereas Becker muscular dystrophy, commonly caused by in-frame deletions, shows synthesis of partially functional protein. Anti-sense oligonucleotides can induce specific exon removal during processing of the dystrophin primary transcript, while maintaining or restoring the reading frame, and thereby overcome protein-truncating mutations. The mdx mouse has a non-sense mutation in exon 23 of the dystrophin gene that precludes functional dystrophin production, and this model has been used in the development of treatment strategies for dystrophinopathies. A phosphorodiamidate morpholino oligomer (PMO) has previously been shown to exclude exon 23 from the dystrophin gene transcript and induce dystrophin expression in the mdxmouse, in vivo and in vitro. In this report, a cell-penetrating peptide (CPP)-conjugated oligomer targeted to the mouse dystrophin exon 23 donor splice site was administered to mdxmice by intraperitoneal injection. We demonstrate dystrophin expression and near-normal muscle architecture in all muscles examined, except for cardiac muscle. The CPP greatly enhanced uptake of the PMO, resulting in widespread dystrophin expression.

MET Exon 14 Skipping Mutations in Lung Adenocarcinoma: Clinicopathologic Implications and Prognostic Values.

PubMed

Lee, Geun Dong; Lee, Seung Eun; Oh, Doo-Yi; Yu, Dan-Bi; Jeong, Hae Min; Kim, Jooseok; Hong, Sungyoul; Jung, Hun Soon; Oh, Ensel; Song, Ji-Young; Lee, Mi-Sook; Kim, Mingi; Jung, Kyungsoo; Kim, Jhingook; Shin, Young Kee; Choi, Yoon-La; Kim, Hyeong Ryul

2017-08-01

Response to mesenchymal-epithelial transition (MET) inhibitors in NSCLC with mesenchymal-epithelial transition gene (MET) exon 14 skipping (METex14) has fueled molecular screening efforts and the search for optimal therapies. However, further work is needed to refine the clinicopathologic and prognostic implications of METex14 skipping. Among 795 East Asian patients who underwent a surgical procedure for NSCLC, we screened 45 patients with quintuple-negative (EGFR-negative/KRAS-negative/anaplastic lymphoma kinase gene [ALK]-negative/ROS1-negative/ret proto-oncogene [RET]-negative) lung adenocarcinomas by using reverse-transcriptase polymerase chain reaction and found 17 patients (37.8%) with METex14 skipping. We also investigated the effect of small interfering RNA (siRNA) targeting skipping junction in cells with METex14 skipping. The median age of the 17 patients was 73 years. The acinar subtype was predominant (52.9%), followed by the solid subtype (35.3%). MET immunohistochemistry demonstrated 100% sensitivity and 70.4% specificity. Multivariate analyses showed that patients with METex14 skipping had a higher recurrence rate than those with ALK fusion (versus METex14 skipping) (hazard ratio = 0.283, 95% confidence interval: 0.119-0.670) in stage I to IIIA disease; however, the differences in overall survival were not significant after adjustment for pathologic stage (p = 0.669). Meanwhile, siRNA decreased MET-driven signaling pathways in Hs746T cells, and combined treatment with siRNA and crizotinib inhibited cell proliferation in crizotinib-resistant H596 cells. The prevalence of METex14 skipping was quite high in East Asian patients without other driver mutations in lung adenocarcinomas. METex14 skipping was associated with old age, the acinar or solid histologic subtype, and high MET immunohistochemical expression. The prognosis of patients with METex14 skipping was similar to that of patients with major driver mutations. siRNA targeting the junction of METex14 skipping could inhibit MET-driven signaling pathways in cells with METex14 skipping. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

A human-specific mutation leads to the origin of a novel splice form of neuropsin (KLK8), a gene involved in learning and memory.

PubMed

Lu, Zhi-xiang; Peng, Jia; Su, Bing

2007-10-01

Neuropsin (kallikrein 8, KLK8) is a secreted-type serine protease preferentially expressed in the central nervous system and involved in learning and memory. Its splicing pattern is different in human and mouse, with the longer form (type II) only expressed in human. Sequence analysis suggested a recent origin of type II during primate evolution. Here we demonstrate that the type II form is absent in nonhuman primates, and is thus a human-specific splice form. With the use of an in vitro splicing assay, we show that a human-specific T to A mutation (c.71-127T>A) triggers the change of splicing pattern, leading to the origin of a novel splice form in the human brain. Using mutation assay, we prove that this mutation is not only necessary but also sufficient for type II expression. Our results demonstrate a molecular mechanism for the creation of novel proteins through alternative splicing in the central nervous system during human evolution. Copyright 2007 Wiley-Liss, Inc.

Transcriptomic profile analysis of mouse neural tube development by RNA-Seq.

PubMed

Yu, Juan; Mu, Jianbing; Guo, Qian; Yang, Lihong; Zhang, Juan; Liu, Zhizhen; Yu, Baofeng; Zhang, Ting; Xie, Jun

2017-09-01

The neural tube is the primordium of the central nervous system (CNS) in which its development is not entirely clear. Understanding the cellular and molecular basis of neural tube development could, therefore, provide vital clues to the mechanism of neural tube defects (NTDs). Here, we investigated the gene expression profiles of three different time points (embryonic day (E) 8.5, 9.5 and 10.5) of mouse neural tube by using RNA-seq approach. About 391 differentially expressed genes (DEGs) were screened during mouse neural tube development, including 45 DEGs involved in CNS development, among which Bmp2, Ascl1, Olig2, Lhx1, Wnt7b and Eomes might play the important roles. Of 45 DEGs, Foxp2, Eomes, Hoxb3, Gpr56, Hap1, Nkx2-1, Sez6l2, Wnt7b, Tbx20, Nfib, Cntn1 and Dcx had different isoforms, and the opposite expression pattern of different isoforms was observed for Gpr56, Nkx2-1 and Sez6l2. In addition, alternative splicing, such as mutually exclusive exon, retained intron, skipped exon and alternative 3' splice site was identified in 10 neural related differentially splicing genes, including Ngrn, Ddr1, Dctn1, Dnmt3b, Ect2, Map2, Mbnl1, Meis2, Vcan and App. Moreover, seven neural splicing factors, such as Nova1/2, nSR100/Srrm4, Elavl3/4, Celf3 and Rbfox1 were differentially expressed during mouse neural tube development. Interestingly, nine DEGs identified above were dysregulated in retinoic acid-induced NTDs model, indicating the possible important role of these genes in NTDs. Taken together, our study provides more comprehensive information on mouse neural tube development, which might provide new insights on NTDs occurrence. © 2017 IUBMB Life, 69(9):706-719, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants.

PubMed

Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Fariss, Robert N; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

2002-06-15

The retinal pigment epithelium (RPE) and choroid comprise a functional unit of the eye that is essential to normal retinal health and function. Here we describe expressed sequence tag (EST) analysis of human RPE/choroid as part of a project for ocular bioinformatics. A cDNA library (cs) was made from human RPE/choroid and sequenced. Data were analyzed and assembled using the program GRIST (GRouping and Identification of Sequence Tags). Complete sequencing, Northern and Western blots, RH mapping, peptide antibody synthesis and immunofluorescence (IF) have been used to examine expression patterns and genome location for selected transcripts and proteins. Ten thousand individual sequence reads yield over 6300 unique gene clusters of which almost half have no matches with named genes. One of the most abundant transcripts is from a gene (named "alpha") that maps to the BBS1 region of chromosome 11. A number of tissue preferred transcripts are common to both RPE/choroid and iris. These include oculoglycan/opticin, for which an alternative splice form is detected in RPE/choroid, and "oculospanin" (Ocsp), a novel tetraspanin that maps to chromosome 17q. Antiserum to Ocsp detects expression in RPE, iris, ciliary body, and retinal ganglion cells by IF. A newly identified gene for a zinc-finger protein (TIRC) maps to 19q13.4. Variant transcripts of several genes were also detected. Most notably, the predominant form of Bestrophin represented in cs contains a longer open reading frame as a result of splice junction skipping. The unamplified cs library gives a view of the transcriptional repertoire of the adult RPE/choroid. A large number of potentially novel genes and splice forms and candidates for genetic diseases are revealed. Clones from this collection are being included in a large, nonredundant set for cDNA microarray construction.

Functional Studies and In Silico Analyses to Evaluate Non-Coding Variants in Inherited Cardiomyopathies.

PubMed

Frisso, Giulia; Detta, Nicola; Coppola, Pamela; Mazzaccara, Cristina; Pricolo, Maria Rosaria; D'Onofrio, Antonio; Limongelli, Giuseppe; Calabrò, Raffaele; Salvatore, Francesco

2016-11-10

Point mutations are the most common cause of inherited diseases. Bioinformatics tools can help to predict the pathogenicity of mutations found during genetic screening, but they may work less well in determining the effect of point mutations in non-coding regions. In silico analysis of intronic variants can reveal their impact on the splicing process, but the consequence of a given substitution is generally not predictable. The aim of this study was to functionally test five intronic variants ( MYBPC3 -c.506-2A>C, MYBPC3 -c.906-7G>T, MYBPC3 -c.2308+3G>C, SCN5A -c.393-5C>A, and ACTC1 -c.617-7T>C) found in five patients affected by inherited cardiomyopathies in the attempt to verify their pathogenic role. Analysis of the MYBPC3 -c.506-2A>C mutation in mRNA from the peripheral blood of one of the patients affected by hypertrophic cardiac myopathy revealed the loss of the canonical splice site and the use of an alternative splicing site, which caused the loss of the first seven nucleotides of exon 5 ( MYBPC3 -G169AfsX14). In the other four patients, we generated minigene constructs and transfected them in HEK-293 cells. This minigene approach showed that MYBPC3 -c.2308+3G>C and SCN5A -c.393-5C>A altered pre-mRNA processing, thus resulting in the skipping of one exon. No alterations were found in either MYBPC3 -c.906-7G>T or ACTC1 -c.617-7T>C. In conclusion, functional in vitro analysis of the effects of potential splicing mutations can confirm or otherwise the putative pathogenicity of non-coding mutations, and thus help to guide the patient's clinical management and improve genetic counseling in affected families.

Can the HIV-1 splicing machinery be targeted for drug discovery?

PubMed Central

Dlamini, Zodwa; Hull, Rodney

2017-01-01

HIV-1 is able to express multiple protein types and isoforms from a single 9 kb mRNA transcript. These proteins are also expressed at particular stages of viral development, and this is achieved through the control of alternative splicing and the export of these transcripts from the nucleus. The nuclear export is controlled by the HIV protein Rev being required to transport incompletely spliced and partially spliced mRNA from the nucleus where they are normally retained. This implies a close relationship between the control of alternate splicing and the nuclear export of mRNA in the control of HIV-1 viral proliferation. This review discusses both the processes. The specificity and regulation of splicing in HIV-1 is controlled by the use of specific splice sites as well as exonic splicing enhancer and exonic splicing silencer sequences. The use of these silencer and enhancer sequences is dependent on the serine arginine family of proteins as well as the heterogeneous nuclear ribonucleoprotein family of proteins that bind to these sequences and increase or decrease splicing. Since alternative splicing is such a critical factor in viral development, it presents itself as a promising drug target. This review aims to discuss the inhibition of splicing, which would stall viral development, as an anti-HIV therapeutic strategy. In this review, the most recent knowledge of splicing in human immunodeficiency viral development and the latest therapeutic strategies targeting human immunodeficiency viral splicing are discussed. PMID:28331370

Quiz Today: Should I Skip Class?

ERIC Educational Resources Information Center

Zizler, Peter

2013-01-01

How does selective assessment, wherein one counts only the best "k" out of "n" quizzes set, impact grade inflation? Based on our analysis, a specific quantitative answer can be given to a student who plans to skip a quiz, depending, of course, on the student's quiz writing consistency or inconsistency.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

PubMed

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

PubMed Central

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

Analysis of RNA-Seq datasets reveals enrichment of tissue-specific splice variants for nuclear envelope proteins.

PubMed

Capitanchik, Charlotte; Dixon, Charles; Swanson, Selene K; Florens, Laurence; Kerr, Alastair R W; Schirmer, Eric C

2018-06-18

Nuclear envelopathies/laminopathies yield tissue-specific pathologies, yet arise from mutation of ubiquitously-expressed genes. One possible explanation of this tissue specificity is that tissue-specific partners become disrupted from larger complexes, but a little investigated alternate hypothesis is that the mutated proteins themselves have tissue-specific splice variants. Here, we analyze RNA-Seq datasets to identify muscle-specific splice variants of nuclear envelope genes that could be relevant to the study of laminopathies, particularly muscular dystrophies, that are not currently annotated in sequence databases. Notably, we found novel isoforms or tissue-specificity of isoforms for: Lap2, linked to cardiomyopathy; Nesprin 2, linked to Emery-Dreifuss muscular dystrophy and Lmo7, a regulator of the emerin gene that is linked to Emery-Dreifuss muscular dystrophy. Interestingly, the muscle-specific exon in Lmo7 is rich in serine phosphorylation motifs, suggesting an important regulatory function. Evidence for muscle-specific splice variants in non-nuclear envelope proteins linked to other muscular dystrophies was also found. Tissue-specific variants were also indicated for several nucleoporins including Nup54, Nup133, Nup153 and Nup358/RanBP2. We confirmed expression of novel Lmo7 and RanBP2 variants with RT-PCR and found that specific knockdown of the Lmo7 variant caused a reduction in myogenic index during mouse C2C12 myogenesis. Global analysis revealed an enrichment of tissue-specific splice variants for nuclear envelope proteins in general compared to the rest of the genome, suggesting that splice variants contribute to regulating its tissue-specific functions.

Alternative splicing of inner-ear-expressed genes.

PubMed

Wang, Yanfei; Liu, Yueyue; Nie, Hongyun; Ma, Xin; Xu, Zhigang

2016-09-01

Alternative splicing plays a fundamental role in the development and physiological function of the inner ear. Inner-ear-specific gene splicing is necessary to establish the identity and maintain the function of the inner ear. For example, exon 68 of Cadherin 23 (Cdh23) gene is subject to inner-ear-specific alternative splicing, and as a result, Cdh23(+ 68) is only expressed in inner ear hair cells. Alternative splicing along the tonotopic axis of the cochlea contributes to frequency tuning, particularly in lower vertebrates, such as chickens and turtles. Differential splicing of Kcnma1, which encodes for the α subunit of the Ca(2+)-activated K(+) channel (BK channel), has been suggested to affect the channel gating properties and is important for frequency tuning. Consequently, deficits in alternative splicing have been shown to cause hearing loss, as we can observe in Bronx Waltzer (bv) mice and Sfswap mutant mice. Despite the advances in this field, the regulation of alternative splicing in the inner ear remains elusive. Further investigation is also needed to clarify the mechanism of hearing loss caused by alternative splicing deficits.

An alternative splicing program promotes adipose tissue thermogenesis

PubMed Central

Vernia, Santiago; Edwards, Yvonne JK; Han, Myoung Sook; Cavanagh-Kyros, Julie; Barrett, Tamera; Kim, Jason K; Davis, Roger J

2016-01-01

Alternative pre-mRNA splicing expands the complexity of the transcriptome and controls isoform-specific gene expression. Whether alternative splicing contributes to metabolic regulation is largely unknown. Here we investigated the contribution of alternative splicing to the development of diet-induced obesity. We found that obesity-induced changes in adipocyte gene expression include alternative pre-mRNA splicing. Bioinformatics analysis associated part of this alternative splicing program with sequence specific NOVA splicing factors. This conclusion was confirmed by studies of mice with NOVA deficiency in adipocytes. Phenotypic analysis of the NOVA-deficient mice demonstrated increased adipose tissue thermogenesis and improved glycemia. We show that NOVA proteins mediate a splicing program that suppresses adipose tissue thermogenesis. Together, these data provide quantitative analysis of gene expression at exon-level resolution in obesity and identify a novel mechanism that contributes to the regulation of adipose tissue function and the maintenance of normal glycemia. DOI: http://dx.doi.org/10.7554/eLife.17672.001 PMID:27635635

Analysis of Alternative Pre-RNA Splicing in the Mouse Retina Using a Fluorescent Reporter.

PubMed

Murphy, Daniel; Kolandaivelu, Saravanan; Ramamurthy, Visvanathan; Stoilov, Peter

2016-01-01

In vivo alternative splicing is controlled in a tissue and cell type specific manner. Often individual cellular components of complex tissues will express different splicing programs. Thus, when studying splicing in multicellular organisms it is critical to determine the exon inclusion levels in individual cells positioned in the context of their native tissue or organ. Here we describe how a fluorescent splicing reporter in combination with in vivo electroporation can be used to visualize alternative splicing in individual cells within mature tissues. In a test case we show how the splicing of a photoreceptor specific exon can be visualized within the mouse retina. The retina was chosen as an example of a complex tissue that is fragile and whose cells cannot be studied in culture. With minor modifications to the injection and electroporation procedure, the protocol we outline can be applied to other tissues and organs.

Splicing fidelity: DEAD/H-box ATPases as molecular clocks.

PubMed

Koodathingal, Prakash; Staley, Jonathan P

2013-07-01

The spliceosome discriminates against suboptimal substrates, both during assembly and catalysis, thereby enhancing specificity during pre-mRNA splicing. Central to such fidelity mechanisms are a conserved subset of the DEAD- and DEAH-box ATPases, which belong to a superfamily of proteins that mediate RNP rearrangements in almost all RNA-dependent processes in the cell. Through an investigation of the mechanisms contributing to the specificity of 5' splice site cleavage, two related reports, one from our lab and the other from the Cheng lab, have provided insights into fidelity mechanisms utilized by the spliceosome. In our work, we found evidence for a kinetic proofreading mechanism in splicing in which the DEAH-box ATPase Prp16 discriminates against substrates undergoing slow 5' splice site cleavage. Additionally, our study revealed that discriminated substrates are discarded through a general spliceosome disassembly pathway, mediated by another DEAH-box ATPase Prp43. In their work, Tseng et al. described the underlying molecular events through which Prp16 discriminates against a splicing substrate during 5' splice site cleavage. Here, we present a synthesis of these two studies and, additionally, provide the first biochemical evidence for discrimination of a suboptimal splicing substrate just prior to 5' splice site cleavage. Together, these findings support a general mechanism for a ubiquitous superfamily of ATPases in enhancing specificity during RNA-dependent processes in the cell.

RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification† †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc01336a Click here for additional data file.

PubMed Central

Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang

2017-01-01

RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5′-ASO could block RNA splicing by inhibiting the first step, while 3′-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs. PMID:28989608

Evolutionary conservation and regulation of particular alternative splicing events in plant SR proteins

PubMed Central

Kalyna, Maria; Lopato, Sergiy; Voronin, Viktor; Barta, Andrea

2006-01-01

Alternative splicing is an important mechanism for fine tuning of gene expression at the post-transcriptional level. SR proteins govern splice site selection and spliceosome assembly. The Arabidopsis genome encodes 19 SR proteins, several of which have no orthologues in metazoan. Three of the plant specific subfamilies are characterized by the presence of a relatively long alternatively spliced intron located in their first RNA recognition motif, which potentially results in an extremely truncated protein. In atRSZ33, a member of the RS2Z subfamily, this alternative splicing event was shown to be autoregulated. Here we show that atRSp31, a member of the RS subfamily, does not autoregulate alternative splicing of its similarily positioned intron. Interestingly, this alternative splicing event is regulated by atRSZ33. We demonstrate that the positions of these long introns and their capability for alternative splicing are conserved from green algae to flowering plants. Moreover, in particular alternative splicing events the splicing signals are embedded into highly conserved sequences. In different taxa, these conserved sequences occur in at least one gene within a subfamily. The evolutionary preservation of alternative splice forms together with highly conserved intron features argues for additional functions hidden in the genes of these plant-specific SR proteins. PMID:16936312

Histone and RNA-binding protein interaction creates crosstalk network for regulation of alternative splicing.

PubMed

Kim, Yong-Eun; Park, Chungoo; Kim, Kyoon Eon; Kim, Kee K

2018-04-30

Alternative splicing is an essential process in eukaryotes, as it increases the complexity of gene expression by generating multiple proteins from a single pre-mRNA. However, information on the regulatory mechanisms for alternative splicing is lacking, because splicing occurs over a short period via the transient interactions of proteins within functional complexes of the spliceosome. Here, we investigated in detail the molecular mechanisms connecting alternative splicing with epigenetic mechanisms. We identified interactions between histone proteins and splicing factors such as Rbfox2, Rbfox3, and splicing factor proline and glutamine rich protein (SFPQ) by in vivo crosslinking and immunoprecipitation. Furthermore, we confirmed that splicing factors were bound to specific modified residues of histone proteins. Additionally, changes in histone methylation due to histone methyltransferase inhibitor treatment notably affected alternative splicing in selected genes. Therefore, we suggested that there may be crosstalk mechanisms connecting histone modifications and RNA-binding proteins that increase the local concentration of RNA-binding proteins in alternative exon loci of nucleosomes by binding specific modified histone proteins, leading to alternative splicing. This crosstalk mechanism may play a major role in epigenetic processes such as histone modification and the regulation of alternative splicing. Copyright © 2018 Elsevier Inc. All rights reserved.

Evidence that "brain-specific" FOX-1, FOX-2, and nPTB alternatively spliced isoforms are produced in the lens.

PubMed

Bitel, Claudine L; Nathan, Rachel; Wong, Patrick; Kuppasani, Sunil; Matsushita, Masafumi; Kanazawa, Hrioshi; Frederikse, Peter H

2011-04-01

Alternative RNA splicing is essential in development and more rapid physiological processes that include disease mechanisms. Studies over the last 20 years demonstrated that RNA binding protein families, which mediate the alternative splicing of a large percentage of genes in mammals, contain isoforms with mutually exclusive expression in non-neural and neural progenitor cells vs. post-mitotic neurons, and regulate the comprehensive reprogramming of alternative splicing during neurogenesis. Polypyrimidine tract binding (PTB) proteins and Fox-1 proteins also undergo mutually exclusive alternative splicing in neural and non-neural cells that regulates their tissue-specific expression and splicing activities. Over the past 50 years, striking morphological similarities noted between lens fiber cells and neurons suggested that cell biology processes and gene expression profiles may be shared as well. Here, we examined mouse and rat lenses to determine if alternative splicing of neuronal nPTB and Fox-1/Fox-2 isoforms also occurs in lenses. Immunoblot, immunofluorescence, and RT-PCR were used to examine expression and alternative splicing of transcripts in lens and brain. We demonstrated that exon 10 is predominantly included in nPTB transcripts consistent with nPTB protein in lenses, and that alternatively spliced Fox-1/-2 lens transcripts contain exons that have been considered neuron-specific. We identified a 3' alternative Fox-1 exon in lenses that encodes a nuclear localization signal consistent with its protein distribution detected in fiber cells. Neuronal alternative splicing of kinesin KIF1Bβ2 has been associated with PTB/nPTB and Fox-2, and we found that two 'neuron-specific' exons are also included in lenses. The present study provides evidence that alternative neuronal nPTB and Fox-1/Fox-2 isoforms are also produced in lenses. These findings raise questions regarding the extent these factors contribute to a similar reprogramming of alternative splicing during lens differentiation, and the degree that alternative gene transcripts produced during neurogenesis are also expressed in the lens.

Identification of an elaborate NK-specific system regulating HLA-C expression

PubMed Central

Ivarsson, Martin A.; Walker-Sperling, Victoria E.; Subleski, Jeff; Johnson, Jenna K.; Wright, Paul W.; Carrington, Mary; McVicar, Daniel W.

2018-01-01

The HLA-C gene appears to have evolved in higher primates to serve as a dominant source of ligands for the KIR2D family of inhibitory MHC class I receptors. The expression of NK cell-intrinsic MHC class I has been shown to regulate the murine Ly49 family of MHC class I receptors due to the interaction of these receptors with NK cell MHC in cis. However, cis interactions have not been demonstrated for the human KIR and HLA proteins. We report the discovery of an elaborate NK cell-specific system regulating HLA-C expression, indicating an important role for HLA-C in the development and function of NK cells. A large array of alternative transcripts with differences in intron/exon content are generated from an upstream NK-specific HLA-C promoter, and exon content varies between HLA-C alleles due to SNPs in splice donor/acceptor sites. Skipping of the first coding exon of HLA-C generates a subset of untranslatable mRNAs, and the proportion of untranslatable HLA-C mRNA decreases as NK cells mature, correlating with increased protein expression by mature NK cells. Polymorphism in a key Ets-binding site of the NK promoter has generated HLA-C alleles that lack significant promoter activity, resulting in reduced HLA-C expression and increased functional activity. The NK-intrinsic regulation of HLA-C thus represents a novel mechanism controlling the lytic activity of NK cells during development. PMID:29329284

Alterations in expression pattern of splicing factors in epithelial ovarian cancer and its clinical impact.

PubMed

Iborra, Severine; Hirschfeld, Marc; Jaeger, Markus; Zur Hausen, Axel; Braicu, Iona; Sehouli, Jalid; Gitsch, Gerald; Stickeler, Elmar

2013-07-01

Alternative splicing represents an important nuclear mechanism in the posttranscriptional regulation of gene expression, which is frequently altered during tumorigenesis. Previously, we described marked changes in alternative splicing of the CD44 gene in ovarian and breast cancer as well as specific induction of distinct splicing factors during tumor development. The present study was focused on the expression profiles of different splicing factors, including classical serine-arginine (SR) proteins including ASF/SF2, hTra2β1, hTra2α, and Y-box-binding protein (YB-1) in physiological and malignant epithelial ovarian tissue to evaluate their expression pattern with regard to tumor development and disease progression. Expression levels of the different splicing factors were analyzed in physiological epithelial ovarian tissue samples, primary tumors, and metastatic samples of patients with a diagnosis of epithelial ovarian cancer using quantified reverse transcription polymerase chain reaction analysis. We examined more closely the splicing factor hTra2β1 using Western blot analysis and immunohistochemistry. The analysis revealed a marked and specific induction of ASF/SF2, SRp20, hTra2β1, and YB-1 in primary tumors as well as in their metastatic sites. However, in our patient cohort, no induction was seen for the other investigated splicing factors SRp55, SRp40, and hTra2α. Our results suggest a specific induction of distinct splicing factors in ovarian cancer tumorigenesis. The involvement of hTra2β1, YB-1, SRp20, and ASF/SF2 in exon recognition and alternative splicing may be important for gene regulation of alternatively spliced genes like CD44 with potential functional consequences in this tumor type leading to progression and metastasis.

Molecular Characterization of Tomato 3-Dehydroquinate Dehydratase-Shikimate:NADP Oxidoreductase1

PubMed Central

Bischoff, Markus; Schaller, Andreas; Bieri, Fabian; Kessler, Felix; Amrhein, Nikolaus; Schmid, Jürg

2001-01-01

Analysis of cDNAs encoding the bifunctional 3-dehydroquinate dehydratase-shikimate:NADP oxidoreductase (DHQase-SORase) from tomato (Lycopersicon esculentum) revealed two classes of cDNAs that differed by 57 bp within the coding regions, but were otherwise identical. Comparison of these cDNA sequences with the sequence of the corresponding single gene unequivocally proved that the primary transcript is differentially spliced, potentially giving rise to two polypeptides that differ by 19 amino acids. Quantitative real-time polymerase chain reaction revealed that the longer transcript constitutes at most 1% to 2% of DHQase-SORase transcripts. Expression of the respective polypeptides in Escherichia coli mutants lacking the DHQase or the SORase activity gave functional complementation only in case of the shorter polypeptide, indicating that skipping of a potential exon is a prerequisite for the production of an enzymatically active protein. The deduced amino acid sequence revealed that the DHQase-SORase is most likely synthesized as a precursor with a very short (13-amino acid) plastid-specific transit peptide. Like other genes encoding enzymes of the prechorismate pathway in tomato, this gene is elicitor-inducible. Tissue-specific expression resembles the patterns obtained for 3-deoxy-d-arabino-heptulosonate 7-phosphate synthase 2 and dehydroquinate synthase genes. This work completes our studies of the prechorismate pathway in that cDNAs for all seven enzymes (including isozymes) of the prechorismate pathway from tomato have now been characterized. PMID:11299368

PASTA: splice junction identification from RNA-Sequencing data

PubMed Central

2013-01-01

Background Next generation transcriptome sequencing (RNA-Seq) is emerging as a powerful experimental tool for the study of alternative splicing and its regulation, but requires ad-hoc analysis methods and tools. PASTA (Patterned Alignments for Splicing and Transcriptome Analysis) is a splice junction detection algorithm specifically designed for RNA-Seq data, relying on a highly accurate alignment strategy and on a combination of heuristic and statistical methods to identify exon-intron junctions with high accuracy. Results Comparisons against TopHat and other splice junction prediction software on real and simulated datasets show that PASTA exhibits high specificity and sensitivity, especially at lower coverage levels. Moreover, PASTA is highly configurable and flexible, and can therefore be applied in a wide range of analysis scenarios: it is able to handle both single-end and paired-end reads, it does not rely on the presence of canonical splicing signals, and it uses organism-specific regression models to accurately identify junctions. Conclusions PASTA is a highly efficient and sensitive tool to identify splicing junctions from RNA-Seq data. Compared to similar programs, it has the ability to identify a higher number of real splicing junctions, and provides highly annotated output files containing detailed information about their location and characteristics. Accurate junction data in turn facilitates the reconstruction of the splicing isoforms and the analysis of their expression levels, which will be performed by the remaining modules of the PASTA pipeline, still under development. Use of PASTA can therefore enable the large-scale investigation of transcription and alternative splicing. PMID:23557086

A novel ALMS1 splice mutation in a non-obese juvenile-onset insulin-dependent syndromic diabetic patient

PubMed Central

Sanyoura, May; Woudstra, Cédric; Halaby, George; Baz, Patrick; Senée, Valérie; Guillausseau, Pierre-Jean; Zalloua, Pierre; Julier, Cécile

2014-01-01

Insulin-dependent juvenile-onset diabetes may occur in the context of rare syndromic presentations suggesting monogenic inheritance rather than common multifactorial autoimmune type 1 diabetes. Here, we report the case of a Lebanese patient diagnosed with juvenile-onset insulin-dependent diabetes presenting ketoacidosis, early-onset retinopathy with optic atrophy, hearing loss, diabetes insipidus, epilepsy, and normal weight and stature, who later developed insulin resistance. Despite similarities with Wolfram syndrome, we excluded the WFS1 gene as responsible for this disease. Using combined linkage and candidate gene study, we selected ALMS1, responsible for Alström syndrome, as a candidate gene. We identified a novel splice mutation in intron 18 located 3 bp before the intron–exon junction (IVS18-3T>G), resulting in exon 19 skipping and consequent frameshift generating a truncated protein (V3958fs3964X). The clinical presentation of the patient significantly differed from typical Alström syndrome by the absence of truncal obesity and short stature, and by the presence of ketoacidotic insulin-dependent diabetes, optic atrophy and diabetes insipidus. Our observation broadens the clinical spectrum of Alström syndrome and suggests that ALMS1 mutations may be considered in patients who initially present with an acute onset of insulin-dependent diabetes. PMID:23652376

Tribolium castaneum Transformer-2 regulates sex determination and development in both males and females

PubMed Central

Shukla, Jayendra Nath; Palli, Subba Reddy

2014-01-01

Tribolium castaneum Transformer (TcTra) is essential for female sex determination and maintenance through the regulation of sex-specific splicing of doublesex (dsx) pre-mRNA. In females, TcTra also regulates the sex-specific splicing of its own pre-mRNA to ensure continuous production of functional Tra protein. Transformer protein is absent in males and hence dsx pre-mRNA is spliced in a default mode. The mechanisms by which males inhibit the production of functional Tra protein are not known. Here, we report on functional characterization of transformer-2 (tra-2) gene (an ortholog of Drosophila transformer-2) in T. castaneum. RNA interference-mediated knockdown in the expression of gene coding for tra-2 in female pupae or adults resulted in the production of male-specific isoform of dsx and both female and male isoforms of tra suggesting that Tra-2 is essential for the female-specific splicing of tra and dsx pre-mRNAs. Interestingly, knockdown of tra-2 in males did not affect the splicing of dsx but resulted in the production of both female and male isoforms of tra suggesting that Tra-2 suppresses female-specific splicing of tra pre-mRNA in males. This dual regulation of sex-specific splicing of tra pre-mRNA ensures a tight regulation of sex determination and maintenance. These data suggest a critical role for Tra-2 in suppression of female sex determination cascade in males. In addition, RNAi studies showed that Tra-2 is also required for successful embryonic and larval development in both sexes. PMID:24056158

Human-specific protein isoforms produced by novel splice sites in the human genome after the human-chimpanzee divergence.

PubMed

Kim, Dong Seon; Hahn, Yoonsoo

2012-11-13

Evolution of splice sites is a well-known phenomenon that results in transcript diversity during human evolution. Many novel splice sites are derived from repetitive elements and may not contribute to protein products. Here, we analyzed annotated human protein-coding exons and identified human-specific splice sites that arose after the human-chimpanzee divergence. We analyzed multiple alignments of the annotated human protein-coding exons and their respective orthologous mammalian genome sequences to identify 85 novel splice sites (50 splice acceptors and 35 donors) in the human genome. The novel protein-coding exons, which are expressed either constitutively or alternatively, produce novel protein isoforms by insertion, deletion, or frameshift. We found three cases in which the human-specific isoform conferred novel molecular function in the human cells: the human-specific IMUP protein isoform induces apoptosis of the trophoblast and is implicated in pre-eclampsia; the intronization of a part of SMOX gene exon produces inactive spermine oxidase; the human-specific NUB1 isoform shows reduced interaction with ubiquitin-like proteins, possibly affecting ubiquitin pathways. Although the generation of novel protein isoforms does not equate to adaptive evolution, we propose that these cases are useful candidates for a molecular functional study to identify proteomic changes that might bring about novel phenotypes during human evolution.

RBFOX2 protein domains and cellular activities.

PubMed

Arya, Anurada D; Wilson, David I; Baralle, Diana; Raponi, Michaela

2014-08-01

RBFOX2 (RNA-binding protein, Fox-1 homologue 2)/RBM9 (RNA-binding-motif protein 9)/RTA (repressor of tamoxifen action)/HNRBP2 (hexaribonucleotide-binding protein 2) encodes an RNA-binding protein involved in tissue specific alternative splicing regulation and steroid receptors transcriptional activity. Its ability to regulate specific splicing profiles depending on context has been related to different expression levels of the RBFOX2 protein itself and that of other splicing regulatory proteins involved in the shared modulation of specific genes splicing. However, this cannot be the sole explanation as to why RBFOX2 plays a widespread role in numerous cellular mechanisms from development to cell survival dependent on cell/tissue type. RBFOX2 isoforms with altered protein domains exist. In the present article, we describe the main RBFOX2 protein domains, their importance in the context of splicing and transcriptional regulation and we propose that RBFOX2 isoform distribution may play a fundamental role in RBFOX2-specific cellular effects.

ELAV, a Drosophila neuron-specific protein, mediates the generation of an alternatively spliced neural protein isoform.

PubMed

Koushika, S P; Lisbin, M J; White, K

1996-12-01

Tissue-specific alternative pre-mRNA splicing is a widely used mechanism for gene regulation and the generation of different protein isoforms, but relatively little is known about the factors and mechanisms that mediate this process. Tissue-specific RNA-binding proteins could mediate alternative pre-mRNA splicing. In Drosophila melanogaster, the RNA-binding protein encoded by the elav (embryonic lethal abnormal visual system) gene is a candidate for such a role. The ELAV protein is expressed exclusively in neurons, and is important for the formation and maintenance of the nervous system. In this study, photoreceptor neurons genetically depleted of ELAV, and elav-null central nervous system neurons, were analyzed immunocytochemically for the expression of neural proteins. In both situations, the lack of ELAV corresponded with a decrease in the immunohistochemical signal of the neural-specific isoform of Neuroglian, which is generated by alternative splicing. Furthermore, when ELAV was expressed ectopically in cells that normally express only the non-neural isoform of Neuroglian, we observed the generation of the neural isoform of Neuroglian. Drosophila ELAV promotes the generation of the neuron-specific isoform of Neuroglian by the regulation of pre-mRNA splicing. The findings reported in this paper demonstrate that ELAV is necessary, and the ectopic expression of ELAV in imaginal disc cells is sufficient, to mediate neuron-specific alternative splicing.

Atmospheric guidance law for planar skip trajectories

NASA Technical Reports Server (NTRS)

Mease, K. D.; Mccreary, F. A.

1985-01-01

The applicability of an approximate, closed-form, analytical solution to the equations of motion, as a basis for a deterministic guidance law for controlling the in-plane motion during a skip trajectory, is investigated. The derivation of the solution by the method of matched asymptotic expansions is discussed. Specific issues that arise in the application of the solution to skip trajectories are addressed. Based on the solution, an explicit formula for the approximate energy loss due to an atmospheric pass is derived. A guidance strategy is proposed that illustrates the use of the approximate solution. A numerical example shows encouraging performance.

Antisense oligonucleotides effectively inhibit the co-transcriptional splicing of a Candida group I intron in vitro and in vivo: Implications for antifungal therapeutics.

PubMed

Zhang, Libin; Leibowitz, Michael J; Zhang, Yi

2009-02-18

Self-splicing of group I intron from the 26S rRNA of Candida albicans is essential for maturation of the host RNA. Here, we demonstrated that the co-transcriptional splicing of the intron in vitro was blocked by antisense oligonucleotides (AONs) targeting the P3-P7 core of the intron. The core-targeted AON effectively and specifically inhibited the intron splicing from its host RNA in living C. albicans. Furthermore, flow cytometry experiments showed that the growth inhibition was caused by a fungicidal effect. For the first time, we showed that an AON targeting the ribozyme core folding specifically inhibits the endogenous ribozyme splicing in living cells and specifically kills the intron-containing fungal strains, which sheds light on the development of antifungal drugs in the future.

A comprehensive analysis of clinical outcomes in lung cancer patients harboring a MET exon 14 skipping mutation compared to other driver mutations in an East Asian population.

PubMed

Gow, Chien-Hung; Hsieh, Min-Shu; Wu, Shang-Gin; Shih, Jin-Yuan

2017-01-01

Recurrent somatic splice-site alterations at MET exon 14 (MET Δ14 ), which result in exon skipping and MET proto-oncogene, receptor tyrosine kinase (MET) activation, have been characterised. However, their demographic features and clinical outcomes in East Asian lung cancer patients have yet to be determined. A one-step reverse transcription-polymerase chain reaction (RT-PCR), using RNA samples from 850 East Asian lung cancer patients, was performed in order to detect MET Δ14 and five other major driver mutations, including those in the EGFR, KRAS, ALK, HER2, and ROS1 genes. Immunohistochemistry (IHC) was used to confirm the overexpression of MET in patients harbouring the MET Δ14 mutation. We analysed the demographic data and clinical outcomes of MET Δ14 mutation positive lung cancer patients and compared them to those of MET Δ14 mutation negative lung cancer patients. In total, 27 lung adenocarcinoma (ADC) patients and 1 squamous cell carcinoma patient with the MET Δ14 mutation were identified. The overall incidence was 3.3% for lung cancer and 4.0% for lung ADC. IHC demonstrated that the majority of lung cancer patients harboring a MET Δ14 mutation exhibited a strong cytoplasmic expression of MET. MET Δ14 mutation positive patients were generally quite elderly individuals. Stage IV MET Δ14 mutation positive lung cancer patients receiving no specific anti-MET therapy were observed to have a similar overall survival (OS) compared to patients in the all negative group (P>0.05). In the multivariate analysis, mutation status was found not to be a major risk factor for OS in lung cancer patients without appropriate tyrosine kinase inhibitors treatment. The OS of MET Δ14 mutation positive lung cancer patients is comparable to that of the major driver gene mutation negative lung cancer patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

[Deregulation of pre-messenger RNA splicing and rare diseases].

PubMed

de la Grange, Pierre

2016-12-01

Most of protein-coding human genes are subjected to alternative pre-mRNA splicing. This mechanism is highly regulated to precisely modulate detection of specific splice sites. This regulation is under control of the spliceosome and several splicing factors are also required to modulate the alternative usage of splice sites. Splicing factors and spliceosome components recognize splicing signals and regulatory sequences of the pre-mRNAs. These splicing sequences make splicing susceptible to polymorphisms and mutations. Examples of associations between human rare diseases and defects in pre-messenger RNA splicing are accumulating. Although many alterations are caused by mutations in splicing sequence (i.e., cis acting mutations), recent studies described the disruptive impact of mutations within spliceosome components or splicing factors (i.e., trans acting mutations). Following growing of knowledge regarding splicing regulation, several approaches have been developed to compensate for the effect of deleterious mutations and to restore sufficient amounts of functional protein. © 2016 médecine/sciences – Inserm.

Premature chain termination is a unifying mechanism for COL1A1 null alleles in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.C.; Deschenes, S.P.; Roberts, E.J.

Nonsense and frameshift mutations, which predict premature termination of translation, often cause a dramatic reduction in the amount of transcript from the mutant allele (nonsense-mediated mRNA decay). In some genes, these mutations also influence RNA splicing and induce skipping of the exon that contains the nonsense codon. To begin to dissect how premature termination alters the metabolism of RNA from the COL1A1 gene, we studied nonsense and frameshift mutations distributed over exons 11-49 of the gene. These mutations were originally identified in 10 unrelated families with osteogenesis imperfecta (OI) type I. We observed marked reduction in steady-state amounts of mRNAmore » from the mutant allele in both total cellular and nuclear RNA extracts of cells from affected individuals, suggesting that nonsense-mediated decay of COL1A1 RNA is a nuclear phenomenon. Position of the mutation within the gene did not influence this observation. None of the mutations induced skipping of either the exon containing the mutation or, for the frameshifts, the downstream exons with the new termination sites. Our data suggest that nonsense and frameshift mutations throughout most of the COL1A1 gene result in a null allele, which is associated with the predictable mild clinical phenotype, OI type I. 42 refs., 6 figs., 1 tab.« less

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Haploinsufficiency of the NF-κB1 Subunit p50 in Common Variable Immunodeficiency.

PubMed

Fliegauf, Manfred; Bryant, Vanessa L; Frede, Natalie; Slade, Charlotte; Woon, See-Tarn; Lehnert, Klaus; Winzer, Sandra; Bulashevska, Alla; Scerri, Thomas; Leung, Euphemia; Jordan, Anthony; Keller, Baerbel; de Vries, Esther; Cao, Hongzhi; Yang, Fang; Schäffer, Alejandro A; Warnatz, Klaus; Browett, Peter; Douglass, Jo; Ameratunga, Rohan V; van der Meer, Jos W M; Grimbacher, Bodo

2015-09-03

Common variable immunodeficiency (CVID), characterized by recurrent infections, is the most prevalent symptomatic antibody deficiency. In ∼90% of CVID-affected individuals, no genetic cause of the disease has been identified. In a Dutch-Australian CVID-affected family, we identified a NFKB1 heterozygous splice-donor-site mutation (c.730+4A>G), causing in-frame skipping of exon 8. NFKB1 encodes the transcription-factor precursor p105, which is processed to p50 (canonical NF-κB pathway). The altered protein bearing an internal deletion (p.Asp191_Lys244delinsGlu; p105ΔEx8) is degraded, but is not processed to p50ΔEx8. Altered NF-κB1 proteins were also undetectable in a German CVID-affected family with a heterozygous in-frame exon 9 skipping mutation (c.835+2T>G) and in a CVID-affected family from New Zealand with a heterozygous frameshift mutation (c.465dupA) in exon 7. Given that residual p105 and p50—translated from the non-mutated alleles—were normal, and altered p50 proteins were absent, we conclude that the CVID phenotype in these families is caused by NF-κB1 p50 haploinsufficiency. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Rescue of cardiomyopathy through U7snRNA-mediated exon skipping in Mybpc3-targeted knock-in mice.

PubMed

Gedicke-Hornung, Christina; Behrens-Gawlik, Verena; Reischmann, Silke; Geertz, Birgit; Stimpel, Doreen; Weinberger, Florian; Schlossarek, Saskia; Précigout, Guillaume; Braren, Ingke; Eschenhagen, Thomas; Mearini, Giulia; Lorain, Stéphanie; Voit, Thomas; Dreyfus, Patrick A; Garcia, Luis; Carrier, Lucie

2013-07-01

Exon skipping mediated by antisense oligoribonucleotides (AON) is a promising therapeutic approach for genetic disorders, but has not yet been evaluated for cardiac diseases. We investigated the feasibility and efficacy of viral-mediated AON transfer in a Mybpc3-targeted knock-in (KI) mouse model of hypertrophic cardiomyopathy (HCM). KI mice carry a homozygous G>A transition in exon 6, which results in three different aberrant mRNAs. We identified an alternative variant (Var-4) deleted of exons 5-6 in wild-type and KI mice. To enhance its expression and suppress aberrant mRNAs we designed AON-5 and AON-6 that mask splicing enhancer motifs in exons 5 and 6. AONs were inserted into modified U7 small nuclear RNA and packaged in adeno-associated virus (AAV-U7-AON-5+6). Transduction of cardiac myocytes or systemic administration of AAV-U7-AON-5+6 increased Var-4 mRNA/protein levels and reduced aberrant mRNAs. Injection of newborn KI mice abolished cardiac dysfunction and prevented left ventricular hypertrophy. Although the therapeutic effect was transient and therefore requires optimization to be maintained over an extended period, this proof-of-concept study paves the way towards a causal therapy of HCM. © 2013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.

ABERRANT SPLICING OF A BRAIN-ENRICHED ALTERNATIVE EXON ELIMINATES TUMOR SUPPRESSOR FUNCTION AND PROMOTES ONCOGENE FUNCTION DURING BRAIN TUMORIGENESIS

PubMed Central

Bredel, Markus; Ferrarese, Roberto; Harsh, Griffith R.; Yadav, Ajay K.; Bug, Eva; Maticzka, Daniel; Reichardt, Wilfried; Masilamani, Anie P.; Dai, Fangping; Kim, Hyunsoo; Hadler, Michael; Scholtens, Denise M.; Yu, Irene L.Y.; Beck, Jürgen; Srinivasasainagendra, Vinodh; Costa, Fabrizio; Baxan, Nicoleta; Pfeifer, Dietmar; Elverfeldt, Dominik v.; Backofen, Rolf; Weyerbrock, Astrid; Duarte, Christine W.; He, Xiaolin; Prinz, Marco; Chandler, James P.; Vogel, Hannes; Chakravarti, Arnab; Rich, Jeremy N.; Carro, Maria S.

2014-01-01

BACKGROUND: Tissue-specific alternative splicing is known to be critical to emergence of tissue identity during development, yet its role in malignant transformation is undefined. Tissue-specific splicing involves evolutionary-conserved, alternative exons, which represent only a minority of total alternative exons. Many, however, have functional features that influence activity in signaling pathways to profound biological effect. Given that tissue-specific splicing has a determinative role in brain development and the enrichment of genes containing tissue-specific exons for proteins with roles in signaling and development, it is thus plausible that changes in such exons could rewire normal neurogenesis towards malignant transformation. METHODS: We used integrated molecular genetic and cell biology analyses, computational biology, animal modeling, and clinical patient profiles to characterize the effect of aberrant splicing of a brain-enriched alternative exon in the membrane-binding tumor suppressor Annexin A7 (ANXA7) on oncogene regulation and brain tumorigenesis. RESULTS: We show that aberrant splicing of a tissue-specific cassette exon in ANXA7 diminishes endosomal targeting and consequent termination of the signal of the EGFR oncoprotein during brain tumorigenesis. Splicing of this exon is mediated by the ribonucleoprotein Polypyrimidine Tract-Binding Protein 1 (PTBP1), which is normally repressed during brain development but, we find, is excessively expressed in glioblastomas through either gene amplification or loss of a neuron-specific microRNA, miR-124. Silencing of PTBP1 attenuates both malignancy and angiogenesis in a stem cell-derived glioblastoma animal model characterized by a high native propensity to generate tumor endothelium or vascular pericytes to support tumor growth. We show that EGFR amplification and PTBP1 overexpression portend a similarly poor clinical outcome, further highlighting the importance of PTBP1-mediated activation of EGFR. CONCLUSIONS: Our data illustrate how anomalous splicing of a tissue-regulated exon in a constituent of an oncogenic signaling pathway eliminates its tumor suppressor function and promotes tumorigenesis. This paradigm of malignant glial transformation as a consequence of tissue-specific alternative exon splicing in a tumor suppressor, may have widespread applicability in explaining how changes in critical tissue-specific regulatory mechanisms reprogram normal development to oncogenesis. SECONDARY CATEGORY: n/a.

Brahma regulates a specific trans-splicing event at the mod(mdg4) locus of Drosophila melanogaster

PubMed Central

Yu, Simei; Waldholm, Johan; Böhm, Stefanie; Visa, Neus

2014-01-01

The mod(mdg4) locus of Drosophila melanogaster contains several transcription units encoded on both DNA strands. The mod(mdg4) pre-mRNAs are alternatively spliced, and a very significant fraction of the mature mod(mdg4) mRNAs are formed by trans-splicing. We have studied the transcripts derived from one of the anti-sense regions within the mod(mdg4) locus in order to shed light on the expression of this complex locus. We have characterized the expression of anti-sense mod(mdg4) transcripts in S2 cells, mapped their transcription start sites and cleavage sites, identified and quantified alternatively spliced transcripts, and obtained insight into the regulation of the mod(mdg4) trans-splicing. In a previous study, we had shown that the alternative splicing of some mod(mdg4) transcripts was regulated by Brahma (BRM), the ATPase subunit of the SWI/SNF chromatin-remodeling complex. Here we show, using RNA interference and overexpression of recombinant BRM proteins, that the levels of BRM affect specifically the abundance of a trans-spliced mod(mdg4) mRNA isoform in both S2 cells and larvae. This specific effect on trans-splicing is accompanied by a local increase in the density of RNA polymerase II and by a change in the phosphorylation state of the C-terminal domain of the large subunit of RNA polymerase II. Interestingly, the regulation of the mod(mdg4) splicing by BRM is independent of the ATPase activity of BRM, which suggests that the mechanism by which BRM modulates trans-splicing is independent of its chromatin-remodeling activity. PMID:24526065

Transcriptome analysis of adiposity in domestic ducks by transcriptomic comparison with their wild counterparts.

PubMed

Chen, L; Luo, J; Li, J X; Li, J J; Wang, D Q; Tian, Y; Lu, L Z

2015-06-01

Excessive adiposity is a major problem in the duck industry, but its molecular mechanisms remain unknown. Genetic comparisons between domestic and wild animals have contributed to the exploration of genetic mechanisms responsible for many phenotypic traits. Significant differences in body fat mass have been detected between domestic and wild ducks. In this study, we used the Peking duck and Anas platyrhynchos as the domestic breed and wild counterpart respectively and performed a transcriptomic comparison of abdominal fat between the two breeds to comprehensively analyze the transcriptome basis of adiposity in ducks. We obtained approximately 350 million clean reads; assembled 61 250 transcripts, including 23 699 novel ones; and identified alternative 5' splice sites, alternative 3' splice sites, skipped exons and retained intron as the main alternative splicing events. A differential expression analysis between the two breeds showed that 753 genes exhibited differential expression. In Peking ducks, some lipid metabolism-related genes (IGF2, FABP5, BMP7, etc.) and oncogenes (RRM2, AURKA, CYR61, etc.) were upregulated, whereas genes related to tumor suppression and immunity (TNFRSF19, TNFAIP6, IGSF21, NCF1, etc.) were downregulated, suggesting adiposity might closely associate with tumorigenesis in ducks. Furthermore, 280 576 single-nucleotide variations were found differentiated between the two breeds, including 8641 non-synonymous ones, and some of the non-synonymous ones were found enriched in genes involved in lipid-associated and immune-associated pathways, suggesting abdominal fat of the duck undertakes both a metabolic function and immune-related function. These datasets enlarge our genetic information of ducks and provide valuable resources for analyzing mechanisms underlying adiposity in ducks. © 2015 Stichting International Foundation for Animal Genetics.

Integrating Omics and Alternative Splicing Reveals Insights into Grape Response to High Temperature1[OPEN

PubMed Central

Jiang, Jianfu; Liu, Xinna; Liu, Guotian; Li, Shaohua

2017-01-01

Heat stress is one of the primary abiotic stresses that limit crop production. Grape (Vitis vinifera) is a cultivated fruit with high economic value throughout the world, with its growth and development often influenced by high temperature. Alternative splicing (AS) is a widespread phenomenon increasing transcriptome and proteome diversity. We conducted high-temperature treatments (35°C, 40°C, and 45°C) on grapevines and assessed transcriptomic (especially AS) and proteomic changes in leaves. We found that nearly 70% of the genes were alternatively spliced under high temperature. Intron retention (IR), exon skipping, and alternative donor/acceptor sites were markedly induced under different high temperatures. Among all differential AS events, IR was the most abundant up- and down-regulated event. Moreover, the occurrence frequency of IR events at 40°C and 45°C was far higher than at 35°C. These results indicated that AS, especially IR, is an important posttranscriptional regulatory event during grape leaf responses to high temperature. Proteomic analysis showed that protein levels of the RNA-binding proteins SR45, SR30, and SR34 and the nuclear ribonucleic protein U1A gradually rose as ambient temperature increased, which revealed a reason why AS events occurred more frequently under high temperature. After integrating transcriptomic and proteomic data, we found that heat shock proteins and some important transcription factors such as MULTIPROTEIN BRIDGING FACTOR1c and HEAT SHOCK TRANSCRIPTION FACTOR A2 were involved mainly in heat tolerance in grape through up-regulating transcriptional (especially modulated by AS) and translational levels. To our knowledge, these results provide the first evidence for grape leaf responses to high temperature at simultaneous transcriptional, posttranscriptional, and translational levels. PMID:28049741

Integrating Omics and Alternative Splicing Reveals Insights into Grape Response to High Temperature.

PubMed

Jiang, Jianfu; Liu, Xinna; Liu, Chonghuai; Liu, Guotian; Li, Shaohua; Wang, Lijun

2017-02-01

Heat stress is one of the primary abiotic stresses that limit crop production. Grape (Vitis vinifera) is a cultivated fruit with high economic value throughout the world, with its growth and development often influenced by high temperature. Alternative splicing (AS) is a widespread phenomenon increasing transcriptome and proteome diversity. We conducted high-temperature treatments (35°C, 40°C, and 45°C) on grapevines and assessed transcriptomic (especially AS) and proteomic changes in leaves. We found that nearly 70% of the genes were alternatively spliced under high temperature. Intron retention (IR), exon skipping, and alternative donor/acceptor sites were markedly induced under different high temperatures. Among all differential AS events, IR was the most abundant up- and down-regulated event. Moreover, the occurrence frequency of IR events at 40°C and 45°C was far higher than at 35°C. These results indicated that AS, especially IR, is an important posttranscriptional regulatory event during grape leaf responses to high temperature. Proteomic analysis showed that protein levels of the RNA-binding proteins SR45, SR30, and SR34 and the nuclear ribonucleic protein U1A gradually rose as ambient temperature increased, which revealed a reason why AS events occurred more frequently under high temperature. After integrating transcriptomic and proteomic data, we found that heat shock proteins and some important transcription factors such as MULTIPROTEIN BRIDGING FACTOR1c and HEAT SHOCK TRANSCRIPTION FACTOR A2 were involved mainly in heat tolerance in grape through up-regulating transcriptional (especially modulated by AS) and translational levels. To our knowledge, these results provide the first evidence for grape leaf responses to high temperature at simultaneous transcriptional, posttranscriptional, and translational levels. © 2017 American Society of Plant Biologists. All Rights Reserved.

Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

PubMed

Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

2015-05-15

The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

Splicing mutation in Sbf1 causes nonsyndromic male infertility in the rat.

PubMed

Liška, František; Chylíková, Blanka; Janků, Michaela; Šeda, Ondřej; Vernerová, Zdeňka; Pravenec, Michal; Křen, Vladimír

2016-09-01

In the inbred SHR/OlaIpcv rat colony, we identified males with small testicles and inability to reproduce. By selectively breeding their parents, we revealed the infertility to segregate as an autosomal recessive Mendelian character. No other phenotype was observed in males, and females were completely normal. By linkage using a backcross with Brown Norway strain, we mapped the locus to a 1.2Mbp segment on chromosome 7, harboring 35 genes. Sequencing of candidate genes revealed a G to A substitution in a canonical 'AG' splice site of intron 37 in Sbf1 (SET binding factor 1, alias myotubularin-related protein 5). This leads to either skipping exon 38 or shifting splicing one base downstream, invariantly resulting in frameshift, premature stop codon and truncation of the protein. Western blotting using two anti-Sbf1 antibodies revealed absence of the full-length protein in the mutant testis. Testicles of the mutant males were significantly smaller compared with SHR from 4weeks, peaked at 84% wild-type weight at 6weeks and declined afterward to 28%, reflecting massive germ cell loss. Histological examination revealed lower germ cell number; latest observed germ cell stage were round spermatids, resulting in the absence of sperm in the epididymis (azoospermia). SBF1 is a member of a phosphatase family lacking the catalytical activity. It probably modulates the activity of a phosphoinositol phosphatase MTMR2. Human homozygotes or compound heterozygotes for missense SBF1 mutations exhibit Charcot-Marie-Tooth disease (manifested mainly as progressive neuropathy), while a single mouse knockout reported in the literature identified male infertility as the only phenotype manifestation. © 2016 Society for Reproduction and Fertility.

Tribolium castaneum Transformer-2 regulates sex determination and development in both males and females.

PubMed

Shukla, Jayendra Nath; Palli, Subba Reddy

2013-12-01

Tribolium castaneum Transformer (TcTra) is essential for female sex determination and maintenance through the regulation of sex-specific splicing of doublesex (dsx) pre-mRNA. In females, TcTra also regulates the sex-specific splicing of its own pre-mRNA to ensure continuous production of functional Tra protein. Transformer protein is absent in males and hence dsx pre-mRNA is spliced in a default mode. The mechanisms by which males inhibit the production of functional Tra protein are not known. Here, we report on functional characterization of transformer-2 (tra-2) gene (an ortholog of Drosophila transformer-2) in T. castaneum. RNA interference-mediated knockdown in the expression of gene coding for tra-2 in female pupae or adults resulted in the production of male-specific isoform of dsx and both female and male isoforms of tra suggesting that Tra-2 is essential for the female-specific splicing of tra and dsx pre-mRNAs. Interestingly, knockdown of tra-2 in males did not affect the splicing of dsx but resulted in the production of both female and male isoforms of tra suggesting that Tra-2 suppresses female-specific splicing of tra pre-mRNA in males. This dual regulation of sex-specific splicing of tra pre-mRNA ensures a tight regulation of sex determination and maintenance. These data suggest a critical role for Tra-2 in suppression of female sex determination cascade in males. In addition, RNAi studies showed that Tra-2 is also required for successful embryonic and larval development in both sexes. Copyright © 2013 Elsevier Ltd. All rights reserved.

Human-specific protein isoforms produced by novel splice sites in the human genome after the human-chimpanzee divergence

PubMed Central

2012-01-01

Background Evolution of splice sites is a well-known phenomenon that results in transcript diversity during human evolution. Many novel splice sites are derived from repetitive elements and may not contribute to protein products. Here, we analyzed annotated human protein-coding exons and identified human-specific splice sites that arose after the human-chimpanzee divergence. Results We analyzed multiple alignments of the annotated human protein-coding exons and their respective orthologous mammalian genome sequences to identify 85 novel splice sites (50 splice acceptors and 35 donors) in the human genome. The novel protein-coding exons, which are expressed either constitutively or alternatively, produce novel protein isoforms by insertion, deletion, or frameshift. We found three cases in which the human-specific isoform conferred novel molecular function in the human cells: the human-specific IMUP protein isoform induces apoptosis of the trophoblast and is implicated in pre-eclampsia; the intronization of a part of SMOX gene exon produces inactive spermine oxidase; the human-specific NUB1 isoform shows reduced interaction with ubiquitin-like proteins, possibly affecting ubiquitin pathways. Conclusions Although the generation of novel protein isoforms does not equate to adaptive evolution, we propose that these cases are useful candidates for a molecular functional study to identify proteomic changes that might bring about novel phenotypes during human evolution. PMID:23148531

Design of RNA splicing analysis null models for post hoc filtering of Drosophila head RNA-Seq data with the splicing analysis kit (Spanki)

PubMed Central

2013-01-01

Background The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. Results We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Conclusions Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools. PMID:24209455

Design of RNA splicing analysis null models for post hoc filtering of Drosophila head RNA-Seq data with the splicing analysis kit (Spanki).

PubMed

Sturgill, David; Malone, John H; Sun, Xia; Smith, Harold E; Rabinow, Leonard; Samson, Marie-Laure; Oliver, Brian

2013-11-09

The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools.

Alternative Splicing of hTERT Pre-mRNA: A Potential Strategy for the Regulation of Telomerase Activity.

PubMed

Liu, Xuewen; Wang, Yuchuan; Chang, Guangming; Wang, Feng; Wang, Fei; Geng, Xin

2017-03-07

The activation of telomerase is one of the key events in the malignant transition of cells, and the expression of human telomerase reverse transcriptase (hTERT) is indispensable in the process of activating telomerase. The pre-mRNA alternative splicing of hTERT at the post-transcriptional level is one of the mechanisms for the regulation of telomerase activity. Shifts in splicing patterns occur in the development, tumorigenesis, and response to diverse stimuli in a tissue-specific and cell type-specific manner. Despite the regulation of telomerase activity, the alternative splicing of hTERT pre-mRNA may play a role in other cellular functions. Modulating the mode of hTERT pre-mRNA splicing is providing a new precept of therapy for cancer and aging-related diseases. This review focuses on the patterns of hTERT pre-mRNA alternative splicing and their biological functions, describes the potential association between the alternative splicing of hTERT pre-mRNA and telomerase activity, and discusses the possible significance of the alternative splicing of the hTERT pre-mRNA in the diagnosis, therapy, and prognosis of cancer and aging-related diseases.

Nonparametric Multiple Imputation for Questionnaires with Individual Skip Patterns and Constraints: The Case of Income Imputation in The National Educational Panel Study

ERIC Educational Resources Information Center

Aßmann, Christian; Würbach, Ariane; Goßmann, Solange; Geissler, Ferdinand; Bela, Anika

2017-01-01

Large-scale surveys typically exhibit data structures characterized by rich mutual dependencies between surveyed variables and individual-specific skip patterns. Despite high efforts in fieldwork and questionnaire design, missing values inevitably occur. One approach for handling missing values is to provide multiply imputed data sets, thus…

Aberrant RNA splicing in cancer; expression changes and driver mutations of splicing factor genes.

PubMed

Sveen, A; Kilpinen, S; Ruusulehto, A; Lothe, R A; Skotheim, R I

2016-05-12

Alternative splicing is a widespread process contributing to structural transcript variation and proteome diversity. In cancer, the splicing process is commonly disrupted, resulting in both functional and non-functional end-products. Cancer-specific splicing events are known to contribute to disease progression; however, the dysregulated splicing patterns found on a genome-wide scale have until recently been less well-studied. In this review, we provide an overview of aberrant RNA splicing and its regulation in cancer. We then focus on the executors of the splicing process. Based on a comprehensive catalog of splicing factor encoding genes and analyses of available gene expression and somatic mutation data, we identify cancer-associated patterns of dysregulation. Splicing factor genes are shown to be significantly differentially expressed between cancer and corresponding normal samples, and to have reduced inter-individual expression variation in cancer. Furthermore, we identify enrichment of predicted cancer-critical genes among the splicing factors. In addition to previously described oncogenic splicing factor genes, we propose 24 novel cancer-critical splicing factors predicted from somatic mutations.

Small Molecule Modulators of Pre-mRNA Splicing in Cancer Therapy.

PubMed

Salton, Maayan; Misteli, Tom

2016-01-01

Pre-mRNA splicing is a fundamental process in mammalian gene expression and alternative RNA splicing plays a considerable role in generating protein diversity. RNA splicing events are also key to the pathology of numerous diseases, particularly cancers. Some tumors are molecularly addicted to specific RNA splicing isoforms making interference with pre-mRNA processing a viable therapeutic strategy. Several RNA splicing modulators have recently been characterized, some showing promise in preclinical studies. While the targets of most splicing modulators are constitutive RNA processing components, possibly leading to undesirable side effects, selectivity for individual splicing events has been observed. Given the high prevalence of splicing defects in cancer, small molecule modulators of RNA processing represent a potentially promising novel therapeutic strategy in cancer treatment. Here, we review their reported effects, mechanisms, and limitations. Published by Elsevier Ltd.

Boric acid reversibly inhibits the second step of pre-mRNA splicing.

PubMed

Shomron, Noam; Ast, Gil

2003-09-25

Several approaches have been used to identify the factors involved in mRNA splicing. None of them, however, comprises a straightforward reversible method for inhibiting the second step of splicing using an external reagent other than a chelator. This investigation demonstrates that the addition of boric acid to an in vitro pre-mRNA splicing reaction causes a dose-dependent reversible inhibition effect on the second step of splicing. The mechanism of action does not involve chelation of several metal ions; hindrance of 3' splice-site; or binding to hSlu7. This study presents a novel method for specific reversible inhibition of the second step of pre-mRNA splicing.

A mammalian germ cell-specific RNA-binding protein interacts with ubiquitously expressed proteins involved in splice site selection

NASA Astrophysics Data System (ADS)

Elliott, David J.; Bourgeois, Cyril F.; Klink, Albrecht; Stévenin, James; Cooke, Howard J.

2000-05-01

RNA-binding motif (RBM) genes are found on all mammalian Y chromosomes and are implicated in spermatogenesis. Within human germ cells, RBM protein shows a similar nuclear distribution to components of the pre-mRNA splicing machinery. To address the function of RBM, we have used protein-protein interaction assays to test for possible physical interactions between these proteins. We find that RBM protein directly interacts with members of the SR family of splicing factors and, in addition, strongly interacts with itself. We have mapped the protein domains responsible for mediating these interactions and expressed the mouse RBM interaction region as a bacterial fusion protein. This fusion protein can pull-down several functionally active SR protein species from cell extracts. Depletion and add-back experiments indicate that these SR proteins are the only splicing factors bound by RBM which are required for the splicing of a panel of pre-mRNAs. Our results suggest that RBM protein is an evolutionarily conserved mammalian splicing regulator which operates as a germ cell-specific cofactor for more ubiquitously expressed pre-mRNA splicing activators.

Proceedings of the Workshop on the Assessment of Crew Workload Measurement Methods, Techniques and Procedures. Volume 2. Library References.

DTIC Science & Technology

1987-06-01

OHIO 45433-6553 0. % NOTICE When Government drawings, specifications, or other data are used for any purpose other than in connection with a definitely...have formulated or in any way supplied the said drawings, specifications, or other data , is not to be regarded by implication, or otherwise in any...Formal Review 2= Informal Review 3= No Reviewer C. Quality of Data (If not 1-3 QUIT) 1= Experiment(s) 2= Case Study(s) 3= Theory/Review (Skip to F.) (Skip

Evolution of RNA-Protein Interactions: Non-Specific Binding Led to RNA Splicing Activity of Fungal Mitochondrial Tyrosyl-tRNA Synthetases

PubMed Central

Lamech, Lilian T.; Mallam, Anna L.; Lambowitz, Alan M.

2014-01-01

The Neurospora crassa mitochondrial tyrosyl-tRNA synthetase (mtTyrRS; CYT-18 protein) evolved a new function as a group I intron splicing factor by acquiring the ability to bind group I intron RNAs and stabilize their catalytically active RNA structure. Previous studies showed: (i) CYT-18 binds group I introns by using both its N-terminal catalytic domain and flexibly attached C-terminal anticodon-binding domain (CTD); and (ii) the catalytic domain binds group I introns specifically via multiple structural adaptations that occurred during or after the divergence of Peziomycotina and Saccharomycotina. However, the function of the CTD and how it contributed to the evolution of splicing activity have been unclear. Here, small angle X-ray scattering analysis of CYT-18 shows that both CTDs of the homodimeric protein extend outward from the catalytic domain, but move inward to bind opposite ends of a group I intron RNA. Biochemical assays show that the isolated CTD of CYT-18 binds RNAs non-specifically, possibly contributing to its interaction with the structurally different ends of the intron RNA. Finally, we find that the yeast mtTyrRS, which diverged from Pezizomycotina fungal mtTyrRSs prior to the evolution of splicing activity, binds group I intron and other RNAs non-specifically via its CTD, but lacks further adaptations needed for group I intron splicing. Our results suggest a scenario of constructive neutral (i.e., pre-adaptive) evolution in which an initial non-specific interaction between the CTD of an ancestral fungal mtTyrRS and a self-splicing group I intron was “fixed” by an intron RNA mutation that resulted in protein-dependent splicing. Once fixed, this interaction could be elaborated by further adaptive mutations in both the catalytic domain and CTD that enabled specific binding of group I introns. Our results highlight a role for non-specific RNA binding in the evolution of RNA-binding proteins. PMID:25536042

Evolution of RNA-protein interactions: non-specific binding led to RNA splicing activity of fungal mitochondrial tyrosyl-tRNA synthetases.

PubMed

Lamech, Lilian T; Mallam, Anna L; Lambowitz, Alan M

2014-12-01

The Neurospora crassa mitochondrial tyrosyl-tRNA synthetase (mtTyrRS; CYT-18 protein) evolved a new function as a group I intron splicing factor by acquiring the ability to bind group I intron RNAs and stabilize their catalytically active RNA structure. Previous studies showed: (i) CYT-18 binds group I introns by using both its N-terminal catalytic domain and flexibly attached C-terminal anticodon-binding domain (CTD); and (ii) the catalytic domain binds group I introns specifically via multiple structural adaptations that occurred during or after the divergence of Peziomycotina and Saccharomycotina. However, the function of the CTD and how it contributed to the evolution of splicing activity have been unclear. Here, small angle X-ray scattering analysis of CYT-18 shows that both CTDs of the homodimeric protein extend outward from the catalytic domain, but move inward to bind opposite ends of a group I intron RNA. Biochemical assays show that the isolated CTD of CYT-18 binds RNAs non-specifically, possibly contributing to its interaction with the structurally different ends of the intron RNA. Finally, we find that the yeast mtTyrRS, which diverged from Pezizomycotina fungal mtTyrRSs prior to the evolution of splicing activity, binds group I intron and other RNAs non-specifically via its CTD, but lacks further adaptations needed for group I intron splicing. Our results suggest a scenario of constructive neutral (i.e., pre-adaptive) evolution in which an initial non-specific interaction between the CTD of an ancestral fungal mtTyrRS and a self-splicing group I intron was "fixed" by an intron RNA mutation that resulted in protein-dependent splicing. Once fixed, this interaction could be elaborated by further adaptive mutations in both the catalytic domain and CTD that enabled specific binding of group I introns. Our results highlight a role for non-specific RNA binding in the evolution of RNA-binding proteins.

Splicing Factor 1 Modulates Dietary Restriction and TORC1 Pathway Longevity in C. elegans

PubMed Central

Heintz, Caroline; Escoubas, Caroline; Zhang, Yue; Weir, Heather J.; Dutta, Sneha; Silva-García, Carlos Giovanni; Bruun, Gitte Hoffmann; Morantte, Ianessa; Hoxhaj, Gerta; Manning, Brendan D.; Andresen, Brage S.; Mair, William B.

2016-01-01

Ageing is driven by a loss of transcriptional and protein homeostasis1–3 and is the key risk factor for multiple chronic diseases. Interventions that attenuate or reverse systemic dysfunction seen with age therefore have potential to reduce overall disease risk in the elderly. Pre-mRNA splicing is a fundamental link between gene expression and the proteome, and deregulation of the splicing machinery is linked to multiple age-related chronic diseases4,5. However, the role of splicing homeostasis in healthy ageing remains unclear. Here we demonstrate that pre-mRNA splicing homeostasis is a biomarker and predictor of life expectancy in Caenorhabditis elegans. Using transcriptomics and in-depth splicing analysis in young and old animals fed ad libitum or on dietary restriction (DR), we find defects in global pre-mRNA splicing with age that are reduced by DR via the branch point binding protein (BBP)/splicing factor 1 (SFA-1). We show that SFA-1 is specifically required for lifespan extension both by DR, and modulation of TORC1 pathway components AMPK, RAGA-1 and RSKS-1/S6 Kinase. Lastly, we demonstrate that overexpression of SFA-1 is sufficient to extend lifespan. Together, these data demonstrate a role for RNA splicing homeostasis in DR longevity and suggest modulation of specific spliceosome components can prolong healthy ageing. PMID:27919065

hnRNP U protein is required for normal pre-mRNA splicing and postnatal heart development and function.

PubMed

Ye, Junqiang; Beetz, Nadine; O'Keeffe, Sean; Tapia, Juan Carlos; Macpherson, Lindsey; Chen, Weisheng V; Bassel-Duby, Rhonda; Olson, Eric N; Maniatis, Tom

2015-06-09

We report that mice lacking the heterogeneous nuclear ribonucleoprotein U (hnRNP U) in the heart develop lethal dilated cardiomyopathy and display numerous defects in cardiac pre-mRNA splicing. Mutant hearts have disorganized cardiomyocytes, impaired contractility, and abnormal excitation-contraction coupling activities. RNA-seq analyses of Hnrnpu mutant hearts revealed extensive defects in alternative splicing of pre-mRNAs encoding proteins known to be critical for normal heart development and function, including Titin and calcium/calmodulin-dependent protein kinase II delta (Camk2d). Loss of hnRNP U expression in cardiomyocytes also leads to aberrant splicing of the pre-mRNA encoding the excitation-contraction coupling component Junctin. We found that the protein product of an alternatively spliced Junctin isoform is N-glycosylated at a specific asparagine site that is required for interactions with specific protein partners. Our findings provide conclusive evidence for the essential role of hnRNP U in heart development and function and in the regulation of alternative splicing.

RNA splicing factors as oncoproteins and tumor suppressors

PubMed Central

Dvinge, Heidi; Kim, Eunhee; Abdel-Wahab, Omar; Bradley, Robert K.

2016-01-01

Preface The recent genomic characterization of cancers has revealed recurrent somatic point mutations and copy number changes affecting genes encoding RNA splicing factors. Initial studies of these ‘spliceosomal mutations’ suggest that the proteins bearing these mutations exhibit altered splice site and/or exon recognition preferences relative to their wild-type counterparts, resulting in cancer-specific mis-splicing. Such changes in the splicing machinery may create novel vulnerabilities in cancer cells that can be therapeutically exploited using compounds that can influence the splicing process. Further studies to dissect the biochemical, genomic, and biological effects of spliceosomal mutations are critical for the development of cancer therapies targeted to these mutations. PMID:27282250

The neuron-specific RNA-binding protein ELAV regulates neuroglian alternative splicing in neurons and binds directly to its pre-mRNA

PubMed Central

Lisbin, Michael J.; Qiu, Jan; White, Kalpana

2001-01-01

Drosophila melanogaster neural-specific protein, ELAV, has been shown to regulate the neural-specific splicing of three genes: neuroglian (nrg), erect wing, and armadillo. Alternative splicing of the nrg transcript involves alternative inclusion of a 3′-terminal exon. Here, using a minigene reporter, we show that the nrg alternatively spliced intron (nASI) has all the determinants required to recreate proper neural-specific RNA processing seen with the endogenous nrg transcript, including regulation by ELAV. An in vitro UV cross-linking assay revealed that ELAV from nuclear extracts cross-links to four distinct sites along the 3200 nucleotide long nASI; one EXS is positioned at the polypyrimidine tract of the default 3′ splice site. ELAV cross-linking sites (EXSs) have in common long tracts of (U)-rich sequence rather than a precise consensus; moreover, each tract has at least two 8/10U elements; their importance is validated by mutant transgene reporter analysis. Further, we propose criteria for ELAV target sequence recognition based on the four EXSs, sites within the nASI that are (U) rich but do not cross-link with ELAV, and predicted EXSs from a phylogenetic comparison with Drosophila virilis nASI. These results suggest that ELAV regulates nrg alternative splicing by direct interaction with the nASI. PMID:11581160

The neuron-specific RNA-binding protein ELAV regulates neuroglian alternative splicing in neurons and binds directly to its pre-mRNA.

PubMed

Lisbin, M J; Qiu, J; White, K

2001-10-01

Drosophila melanogaster neural-specific protein, ELAV, has been shown to regulate the neural-specific splicing of three genes: neuroglian (nrg), erect wing, and armadillo. Alternative splicing of the nrg transcript involves alternative inclusion of a 3'-terminal exon. Here, using a minigene reporter, we show that the nrg alternatively spliced intron (nASI) has all the determinants required to recreate proper neural-specific RNA processing seen with the endogenous nrg transcript, including regulation by ELAV. An in vitro UV cross-linking assay revealed that ELAV from nuclear extracts cross-links to four distinct sites along the 3200 nucleotide long nASI; one EXS is positioned at the polypyrimidine tract of the default 3' splice site. ELAV cross-linking sites (EXSs) have in common long tracts of (U)-rich sequence rather than a precise consensus; moreover, each tract has at least two 8/10U elements; their importance is validated by mutant transgene reporter analysis. Further, we propose criteria for ELAV target sequence recognition based on the four EXSs, sites within the nASI that are (U) rich but do not cross-link with ELAV, and predicted EXSs from a phylogenetic comparison with Drosophila virilis nASI. These results suggest that ELAV regulates nrg alternative splicing by direct interaction with the nASI.

Mechanisms of splicing-dependent trans-synaptic adhesion by PTPδ-IL1RAPL1/IL-1RAcP for synaptic differentiation

NASA Astrophysics Data System (ADS)

Yamagata, Atsushi; Yoshida, Tomoyuki; Sato, Yusuke; Goto-Ito, Sakurako; Uemura, Takeshi; Maeda, Asami; Shiroshima, Tomoko; Iwasawa-Okamoto, Shiho; Mori, Hisashi; Mishina, Masayoshi; Fukai, Shuya

2015-04-01

Synapse formation is triggered through trans-synaptic interaction between pairs of pre- and postsynaptic adhesion molecules, the specificity of which depends on splice inserts known as `splice-insert signaling codes'. Receptor protein tyrosine phosphatase δ (PTPδ) can bidirectionally induce pre- and postsynaptic differentiation of neurons by trans-synaptically binding to interleukin-1 receptor accessory protein (IL-1RAcP) and IL-1RAcP-like-1 (IL1RAPL1) in a splicing-dependent manner. Here, we report crystal structures of PTPδ in complex with IL1RAPL1 and IL-1RAcP. The first immunoglobulin-like (Ig) domain of IL1RAPL1 directly recognizes the first splice insert, which is critical for binding to IL1RAPL1. The second splice insert functions as an adjustable linker that positions the Ig2 and Ig3 domains of PTPδ for simultaneously interacting with the Ig1 domain of IL1RAPL1 or IL-1RAcP. We further identified the IL1RAPL1-specific interaction, which appears coupled to the first-splice-insert-mediated interaction. Our results thus reveal the decoding mechanism of splice-insert signaling codes for synaptic differentiation induced by trans-synaptic adhesion between PTPδ and IL1RAPL1/IL-1RAcP.

Gaucher disease: A G[sup +1][yields]A[sup +1] IVS2 splice donor site mutation causing exon 2 skipping in the acid [beta]-glucosidase mRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Guo-Shun; Grabowski, G.A.

1992-10-01

Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less

Splicing defect in FKBP10 gene causes autosomal recessive osteogenesis imperfecta disease: a case report.

PubMed

Maghami, Fatemeh; Tabei, Seyed Mohammad Bagher; Moravej, Hossein; Dastsooz, Hassan; Modarresi, Farzaneh; Silawi, Mohammad; Faghihi, Mohammad Ali

2018-05-25

Osteogenesis imperfecta (OI) is a group of connective tissue disorder caused by mutations of genes involved in the production of collagen and its supporting proteins. Although the majority of reported OI variants are in COL1A1 and COL1A2 genes, recent reports have shown problems in other non-collagenous genes involved in the post translational modifications, folding and transport, transcription and proliferation of osteoblasts, bone mineralization, and cell signaling. Up to now, 17 types of OI have been reported in which types I to IV are the most frequent cases with autosomal dominant pattern of inheritance. Here we report an 8- year- old boy with OI who has had multiple fractures since birth and now he is wheelchair-dependent. To identify genetic cause of OI in our patient, whole exome sequencing (WES) was carried out and it revealed a novel deleterious homozygote splice acceptor site mutation (c.1257-2A > G, IVS7-2A > G) in FKBP10 gene in the patient. Then, the identified mutation was confirmed using Sanger sequencing in the proband as homozygous and in his parents as heterozygous, indicating its autosomal recessive pattern of inheritance. In addition, we performed RT-PCR on RNA transcripts originated from skin fibroblast of the proband to analyze the functional effect of the mutation on splicing pattern of FKBP10 gene and it showed skipping of the exon 8 of this gene. Moreover, Real-Time PCR was carried out to quantify the expression level of FKBP10 in the proband and his family members in which it revealed nearly the full decrease in the level of FKBP10 expression in the proband and around 75% decrease in its level in the carriers of the mutation, strongly suggesting the pathogenicity of the mutation. Our study identified, for the first time, a private pathogenic splice site mutation in FKBP10 gene and further prove the involvement of this gene in the rare cases of autosomal recessive OI type XI with distinguished clinical manifestations.

ACTG: novel peptide mapping onto gene models.

PubMed

Choi, Seunghyuk; Kim, Hyunwoo; Paek, Eunok

2017-04-15

In many proteogenomic applications, mapping peptide sequences onto genome sequences can be very useful, because it allows us to understand origins of the gene products. Existing software tools either take the genomic position of a peptide start site as an input or assume that the peptide sequence exactly matches the coding sequence of a given gene model. In case of novel peptides resulting from genomic variations, especially structural variations such as alternative splicing, these existing tools cannot be directly applied unless users supply information about the variant, either its genomic position or its transcription model. Mapping potentially novel peptides to genome sequences, while allowing certain genomic variations, requires introducing novel gene models when aligning peptide sequences to gene structures. We have developed a new tool called ACTG (Amino aCids To Genome), which maps peptides to genome, assuming all possible single exon skipping, junction variation allowing three edit distances from the original splice sites, exon extension and frame shift. In addition, it can also consider SNVs (single nucleotide variations) during mapping phase if a user provides the VCF (variant call format) file as an input. Available at http://prix.hanyang.ac.kr/ACTG/search.jsp . eunokpaek@hanyang.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Polyoma virus small tumor antigen pre-mRNA splicing requires cooperation between two 3' splice sites.

PubMed Central

Ge, H; Noble, J; Colgan, J; Manley, J L

1990-01-01

We have studied splicing of the polyoma virus early region pre-mRNA in vitro. This RNA is alternatively spliced in vivo to produce mRNA encoding the large, middle-sized (MTAg), and small (StAg) tumor antigens. Our primary interest was to learn how the 48-nucleotide StAg intron is excised, because the length of this intron is significantly less than the apparent minimum established for mammalian introns. Although the products of all three splices are detected in vitro, characterization of the pathway and sequence requirements of StAg splicing suggests that splicing factors interact with the precursor RNA in an unexpected way to catalyze removal of this intron. Specifically, StAg splicing uses either of two lariat branch points, one of which is located only 4 nucleotides from the 3' splice site. Furthermore, the StAg splice absolutely requires that the alternative MTAg 3' splice site, located 14 nucleotides downstream of the StAg 3' splice site, be intact. Insertion mutations that increase or decrease the quality of the MTAg pyrimidine stretch enhance or repress StAg as well as MTAg splicing, and a single-base change in the MTAg AG splice acceptor totally blocks both splices. These results demonstrate the ability of two 3' splice sites to cooperate with each other to bring about removal of a single intron. Images PMID:2159146

Alternatively Spliced Homologous Exons Have Ancient Origins and Are Highly Expressed at the Protein Level

PubMed Central

Abascal, Federico; Ezkurdia, Iakes; Rodriguez-Rivas, Juan; Rodriguez, Jose Manuel; del Pozo, Angela; Vázquez, Jesús; Valencia, Alfonso; Tress, Michael L.

2015-01-01

Alternative splicing of messenger RNA can generate a wide variety of mature RNA transcripts, and these transcripts may produce protein isoforms with diverse cellular functions. While there is much supporting evidence for the expression of alternative transcripts, the same is not true for the alternatively spliced protein products. Large-scale mass spectroscopy experiments have identified evidence of alternative splicing at the protein level, but with conflicting results. Here we carried out a rigorous analysis of the peptide evidence from eight large-scale proteomics experiments to assess the scale of alternative splicing that is detectable by high-resolution mass spectroscopy. We find fewer splice events than would be expected: we identified peptides for almost 64% of human protein coding genes, but detected just 282 splice events. This data suggests that most genes have a single dominant isoform at the protein level. Many of the alternative isoforms that we could identify were only subtly different from the main splice isoform. Very few of the splice events identified at the protein level disrupted functional domains, in stark contrast to the two thirds of splice events annotated in the human genome that would lead to the loss or damage of functional domains. The most striking result was that more than 20% of the splice isoforms we identified were generated by substituting one homologous exon for another. This is significantly more than would be expected from the frequency of these events in the genome. These homologous exon substitution events were remarkably conserved—all the homologous exons we identified evolved over 460 million years ago—and eight of the fourteen tissue-specific splice isoforms we identified were generated from homologous exons. The combination of proteomics evidence, ancient origin and tissue-specific splicing indicates that isoforms generated from homologous exons may have important cellular roles. PMID:26061177

Feeling 'too fat' rather than being 'too fat' increases unhealthy eating habits among adolescents - even in boys.

PubMed

van Vliet, Jolanda S; Gustafsson, Per A; Nelson, Nina

2016-01-01

Adolescence is a period of gender-specific physical changes, during which eating habits develop. To better understand what factors determine unhealthy eating habits such as dieting to lose weight, skipping meals, and consumption of unhealthy foods, we studied how physical measurements and body perception relate to eating habits in boys and girls, before and during adolescence. For this cross-sectional study, we obtained data from both written questionnaires and physical measurements of height, weight, and waist circumference (WC). Dieting to lose weight and skipping breakfast were more common among adolescents than among younger boys and girls (p<0.05). The strongest risk factor for dieting in both boys and girls was perception of overweight, which persisted after adjusting for age and for being overweight (p<0.01). Another independent risk factor for dieting behaviour was overweight, as defined by body mass index (BMI) among boys (p<0.01) and WC among girls (p<0.05). In both boys and girls, skipping breakfast was associated with both a more negative body perception and higher BMI (p<0.05). Skipping breakfast was also associated with age- and gender-specific unhealthy eating habits such as skipping other meals, lower consumption of fruits and vegetables, and higher consumption of sweets and sugary drinks (p<0.05). Body perception among adolescents is an important factor relating to unhealthy eating habits, not only in girls, but even in boys. Focus on body perception and eating breakfast daily is crucial for the development of healthy food consumption behaviours during adolescence and tracking into adulthood.

Clinical characterisation of Becker muscular dystrophy patients predicts favourable outcome in exon-skipping therapy.

PubMed

van den Bergen, J C; Schade van Westrum, S M; Dekker, L; van der Kooi, A J; de Visser, M; Wokke, B H A; Straathof, C S; Hulsker, M A; Aartsma-Rus, A; Verschuuren, J J; Ginjaar, H B

2014-01-01

Duchenne and Becker muscular dystrophy (DMD/BMD) are both caused by mutations in the DMD gene. Out-of-frame mutations in DMD lead to absence of the dystrophin protein, while in-frame BMD mutations cause production of internally deleted dystrophin. Clinically, patients with DMD loose ambulance around the age of 12, need ventilatory support at their late teens and die in their third or fourth decade due to pulmonary or cardiac failure. BMD has a more variable disease course. The disease course of patients with BMD with specific mutations could be very informative to predict the outcome of the exon-skipping therapy, aiming to restore the reading-frame in patients with DMD. Patients with BMD with a mutation equalling a DMD mutation after successful exon skipping were selected from the Dutch Dystrophinopathy Database. Information about disease course was gathered through a standardised questionnaire. Cardiac data were collected from medical correspondence and a previous study on cardiac function in BMD. Forty-eight patients were included, representing 11 different mutations. Median age of patients was 43 years (range 6-67). Nine patients were wheelchair users (26-56 years). Dilated cardiomyopathy was present in 7/36 patients. Only one patient used ventilatory support. Three patients had died at the age of 45, 50 and 76 years, respectively. This study provides mutation specific data on the course of disease in patients with BMD. It shows that the disease course of patients with BMD, with a mutation equalling a 'skipped' DMD mutation is relatively mild. This finding strongly supports the potential benefit of exon skipping in patients with DMD.

FAS-antisense 1 lncRNA and production of soluble versus membrane Fas in B-cell lymphoma

PubMed Central

Sehgal, Lalit; Mathur, Rohit; Braun, Frank K.; Wise, Jillian F.; Berkova, Zuzana; Neelapu, Sattva; Kwak, Larry W.; Samaniego, Felipe

2018-01-01

Impaired Fas-mediated apoptosis is associated with poor clinical outcomes and cancer chemoresistance. Soluble Fas receptor (sFas), produced by skipping of exon 6, inhibits apoptosis by sequestering Fas ligand. Serum sFas is associated with poor prognosis of non-Hodgkin's lymphomas. We found that the alternative splicing of Fas in lymphomas is tightly regulated by a lncRNA corresponding to an antisense transcript of Fas (FAS-AS1). Levels of FAS-AS1 correlate inversely with production of sFas and FAS-AS1 binding to the RBM5 inhibits RBM5-mediated exon 6 skipping. EZH2, often mutated or overexpressed in lymphomas, hyper-methylates the FAS-AS1 promoter and represses the FAS-AS1 expression. EZH2-mediated repression of FAS-AS1 promoter can be released by DZNeP or overcome by ectopic expression of FAS-AS1, both of which increase levels of FAS-AS1 and correspondingly decrease expression of sFas. Treatment with Bruton’s tyrosine kinase (BTK) inhibitor or EZH2 knockdown decreases the levels of EZH2, RBM5 and sFas thereby enhances Fas-mediated apoptosis. This is the first report showing functional regulation of Fas repression by its antisense RNA. Our results reveal new therapeutic targets in lymphomas and provide a rationale for the use of EZH2 inhibitors or ibrutinib in combination with chemotherapeutic agents that recruit Fas for effective cell killing. PMID:24811343

Widespread Use of Non-productive Alternative Splice Sites in Saccharomyces cerevisiae

PubMed Central

Kawashima, Tadashi; Douglass, Stephen; Gabunilas, Jason; Pellegrini, Matteo; Chanfreau, Guillaume F.

2014-01-01

Saccharomyces cerevisiae has been used as a model system to investigate the mechanisms of pre-mRNA splicing but only a few examples of alternative splice site usage have been described in this organism. Using RNA-Seq analysis of nonsense-mediated mRNA decay (NMD) mutant strains, we show that many S. cerevisiae intron-containing genes exhibit usage of alternative splice sites, but many transcripts generated by splicing at these sites are non-functional because they introduce premature termination codons, leading to degradation by NMD. Analysis of splicing mutants combined with NMD inactivation revealed the role of specific splicing factors in governing the use of these alternative splice sites and identified novel functions for Prp17p in enhancing the use of branchpoint-proximal upstream 3′ splice sites and for Prp18p in suppressing the usage of a non-canonical AUG 3′-splice site in GCR1. The use of non-productive alternative splice sites can be increased in stress conditions in a promoter-dependent manner, contributing to the down-regulation of genes during stress. These results show that alternative splicing is frequent in S. cerevisiae but masked by RNA degradation and that the use of alternative splice sites in this organism is mostly aimed at controlling transcript levels rather than increasing proteome diversity. PMID:24722551

Mutations in PRPF31 Inhibit Pre-mRNA Splicing of Rhodopsin Gene and Cause Apoptosis of Retinal Cells

PubMed Central

Yuan, Liya; Kawada, Mariko; Havlioglu, Necat; Tang, Hao; Wu, Jane Y.

2007-01-01

Mutations in human PRPF31 gene have been identified in patients with autosomal dominant retinitis pigmentosa (adRP). To begin to understand mechanisms by which defects in this general splicing factor cause retinal degeneration, we examined the relationship between PRPF31 and pre-mRNA splicing of photoreceptor-specific genes. We used a specific anti-PRPF31 antibody to immunoprecipitate splicing complexes from retinal cells and identified the transcript of rhodopsin gene (RHO) among RNA species associated with PRPF31-containing complexes. Mutant PRPF31 proteins significantly inhibited pre-mRNA splicing of intron 3 in RHO gene. In primary retinal cell cultures, expression of the mutant PRPF31 proteins reduced rhodopsin expression and caused apoptosis of rhodopsin-positive retinal cells. This primary retinal culture assay provides an in vitro model to study photoreceptor cell death caused by PRPF31 mutations. Our results demonstrate that mutations in PRPF31 gene affect RHO pre-mRNA splicing and reveal a link between PRPF31 and RHO, two major adRP genes. PMID:15659613

Arrest is a regulator of fiber-specific alternative splicing in the indirect flight muscles of Drosophila

PubMed Central

Oas, Sandy T.

2014-01-01

Drosophila melanogaster flight muscles are distinct from other skeletal muscles, such as jump muscles, and express several uniquely spliced muscle-associated transcripts. We sought to identify factors mediating splicing differences between the flight and jump muscle fiber types. We found that the ribonucleic acid–binding protein Arrest (Aret) is expressed in flight muscles: in founder cells, Aret accumulates in a novel intranuclear compartment that we termed the Bruno body, and after the onset of muscle differentiation, Aret disperses in the nucleus. Down-regulation of the aret gene led to ultrastructural changes and functional impairment of flight muscles, and transcripts of structural genes expressed in the flight muscles became spliced in a manner characteristic of jump muscles. Aret also potently promoted flight muscle splicing patterns when ectopically expressed in jump muscles or tissue culture cells. Genetically, aret is located downstream of exd (extradenticle), hth (homothorax), and salm (spalt major), transcription factors that control fiber identity. Our observations provide insight into a transcriptional and splicing regulatory network for muscle fiber specification. PMID:25246617

NOVA2-mediated RNA regulation is required for axonal pathfinding during development.

PubMed

Saito, Yuhki; Miranda-Rottmann, Soledad; Ruggiu, Matteo; Park, Christopher Y; Fak, John J; Zhong, Ru; Duncan, Jeremy S; Fabella, Brian A; Junge, Harald J; Chen, Zhe; Araya, Roberto; Fritzsch, Bernd; Hudspeth, A J; Darnell, Robert B

2016-05-25

The neuron specific RNA-binding proteins NOVA1 and NOVA2 are highly homologous alternative splicing regulators. NOVA proteins regulate at least 700 alternative splicing events in vivo, yet relatively little is known about the biologic consequences of NOVA action and in particular about functional differences between NOVA1 and NOVA2. Transcriptome-wide searches for isoform-specific functions, using NOVA1 and NOVA2 specific HITS-CLIP and RNA-seq data from mouse cortex lacking either NOVA isoform, reveals that NOVA2 uniquely regulates alternative splicing events of a series of axon guidance related genes during cortical development. Corresponding axonal pathfinding defects were specific to NOVA2 deficiency: Nova2-/- but not Nova1-/- mice had agenesis of the corpus callosum, and axonal outgrowth defects specific to ventral motoneuron axons and efferent innervation of the cochlea. Thus we have discovered that NOVA2 uniquely regulates alternative splicing of a coordinate set of transcripts encoding key components in cortical, brainstem and spinal axon guidance/outgrowth pathways during neural differentiation, with severe functional consequences in vivo.

Human osteopontin splicing isoforms: known roles, potential clinical applications and activated signaling pathways.

PubMed

Gimba, E R; Tilli, T M

2013-04-30

Human osteopontin is subject to alternative splicing, which generates three isoforms, termed OPNa, OPNb and OPNc. These variants show specific expression and roles in different cell contexts. We present an overview of current knowledge of the expression profile of human OPN splicing isoforms (OPN-SIs), their tissue-specific roles, and the pathways mediating their functional properties in different pathophysiological conditions. We also describe their putative application as biomarkers, and their potential use as therapeutic targets by using antibodies, oligonucleotides or siRNA molecules. This synthesis provides new clues for a better understanding of human OPN splice variants, their roles in normal and pathological conditions, and their possible clinical applications. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Tissue-specific alternative splicing of TCF7L2

PubMed Central

Prokunina-Olsson, Ludmila; Welch, Cullan; Hansson, Ola; Adhikari, Neeta; Scott, Laura J.; Usher, Nicolle; Tong, Maurine; Sprau, Andrew; Swift, Amy; Bonnycastle, Lori L.; Erdos, Michael R.; He, Zhi; Saxena, Richa; Harmon, Brennan; Kotova, Olga; Hoffman, Eric P.; Altshuler, David; Groop, Leif; Boehnke, Michael; Collins, Francis S.; Hall, Jennifer L.

2009-01-01

Common variants in the transcription factor 7-like 2 (TCF7L2) gene have been identified as the strongest genetic risk factors for type 2 diabetes (T2D). However, the mechanisms by which these non-coding variants increase risk for T2D are not well-established. We used 13 expression assays to survey mRNA expression of multiple TCF7L2 splicing forms in up to 380 samples from eight types of human tissue (pancreas, pancreatic islets, colon, liver, monocytes, skeletal muscle, subcutaneous adipose tissue and lymphoblastoid cell lines) and observed a tissue-specific pattern of alternative splicing. We tested whether the expression of TCF7L2 splicing forms was associated with single nucleotide polymorphisms (SNPs), rs7903146 and rs12255372, located within introns 3 and 4 of the gene and most strongly associated with T2D. Expression of two splicing forms was lower in pancreatic islets with increasing counts of T2D-associated alleles of the SNPs: a ubiquitous splicing form (P = 0.018 for rs7903146 and P = 0.020 for rs12255372) and a splicing form found in pancreatic islets, pancreas and colon but not in other tissues tested here (P = 0.009 for rs12255372 and P = 0.053 for rs7903146). Expression of this form in glucose-stimulated pancreatic islets correlated with expression of proinsulin (r2 = 0.84–0.90, P < 0.00063). In summary, we identified a tissue-specific pattern of alternative splicing of TCF7L2. After adjustment for multiple tests, no association between expression of TCF7L2 in eight types of human tissue samples and T2D-associated genetic variants remained significant. Alternative splicing of TCF7L2 in pancreatic islets warrants future studies. GenBank Accession Numbers: FJ010164–FJ010174. PMID:19602480

A saga of cancer epigenetics: linking epigenetics to alternative splicing.

PubMed

Narayanan, Sathiya Pandi; Singh, Smriti; Shukla, Sanjeev

2017-03-07

The discovery of an increasing number of alternative splicing events in the human genome highlighted that ∼94% of genes generate alternatively spliced transcripts that may produce different protein isoforms with diverse functions. It is now well known that several diseases are a direct and indirect consequence of aberrant splicing events in humans. In addition to the conventional mode of alternative splicing regulation by ' cis ' RNA-binding sites and ' trans' RNA-binding proteins, recent literature provides enormous evidence for epigenetic regulation of alternative splicing. The epigenetic modifications may regulate alternative splicing by either influencing the transcription elongation rate of RNA polymerase II or by recruiting a specific splicing regulator via different chromatin adaptors. The epigenetic alterations and aberrant alternative splicing are known to be associated with various diseases individually, but this review discusses/highlights the latest literature on the role of epigenetic alterations in the regulation of alternative splicing and thereby cancer progression. This review also points out the need for further studies to understand the interplay between epigenetic modifications and aberrant alternative splicing in cancer progression. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

Functional analysis of U1-70K interacting SR proteins in pre-mRNA splicing in Arabidopsis

DOE Office of Scientific and Technical Information (OSTI.GOV)

A.S.N. Reddy

Proteins of a serine/arginine-rich (SR) family are part of the spliceosome and are implicated in both constitutive and alternative splicing of pre-mRNAs. With the funding from DOE we have been studying alternative of splicing of genes encoding serine/arginine-rich (SR) proteins and the roles of SR proteins that interact with U1-70K in regulating basic and alternative splicing. Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins and its regulation by hormones and stresses: We analyzed the splicing of all 19 Arabidopsis genes in different tissues, during different seedling stages and in response to various hormonal and stress treatments. Remarkably, about 90 differentmore » transcripts are produced from 15 SR genes, thereby increasing the transcriptome complexity of SR genes by about five fold. Using the RNA isolated from polysomes we have shown that most of the splice variants are recruited for translation. Alternative splicing of some SR genes is controlled in a developmental and tissue-specific manner (Palusa et al., 2007). Interestingly, among the various hormones and abiotic stresses tested, temperature stress (cold and heat) and ultraviolet light dramatically altered alternative splicing of pre-mRNAs of several SR genes whereas hormones altered the splicing of only two SR genes (Palusa et al., 2007). Localization and dynamics of a novel serine/arginine-rich protein that interacts with U1-70K: We analyzed the intranuclear movement of SR45 fused to GFP by fluorescence recovery after photobleaching (FRAP) and fluorescence loss in photobleaching (FLIP). We demonstrate that the movement of GFP-SR45 is ATP-dependent. Interestingly, inhibition of transcription or phosphorylation slowed the mobility of GFP-SR45 (Ali et al., 2006). Our studies have revealed that the nuclear localization signals are located in arg/ser-rich domains (RS) 1 and 2, whereas the speckle targeting signals are exclusively present in RS2 (Ali et al., 2006). The regulation of SR45 mobility by ATP and a transcriptional inhibitor is in contrast to the mobility of SR family splicing factors in animals and suggests fundamental differences in the movement of plant and animals splicing factors. In vivo interaction of U170K with SR45: To analyze the interaction of U170K with SR45, we expressed these proteins fused to RFP and GFP respectively, in protoplasts. Both the reporters co-localized to the same subnuclear domains. To determine direct interaction of these proteins, we fused full-length U170K to one part of split YFP and full-length or truncated version of SR45 to the second half of split YFP. Coexpession of these split YFP constructs resulted in reconstitution of YFP in speckles, suggesting direction interaction of these proteins in vivo (Ali et al., 2008). SR45 is a Novel Plant-Specific Splicing Factor and is Involved in Regulating Multiple Developmental Processes: Using an in vitro splicing complementation assay, we showed that SR45 is an essential splicing factor. The sr45-1 mutant exhibited a number of developmental abnormalities. Further analysis of flowering time has shown that the autonomous pathway of flowering is affected in the mutant. Expression analysis of several flowering genes has revealed that FLC, a key flowering repressor, is up-regulated in the SR45 mutant. Further, alternative splicing pattern of several other SR genes was altered in the sr45-1 mutant in a tissue-specific manner. Hence, the observed pleiotropic effects on various aspects of development are likely due to altered level of SR protein isoforms, which in turn regulate the splicing of other pre-mRNAs. Expression of wild-type SR45 in the mutant complemented the phenotypic defects and changes in alternative splicing of SR genes. SR45 thus is a novel plant-specific splicing factor and plays a crucial role in multiple developmental processes.« less

Live-cell imaging visualizes frequent mitotic skipping during senescence-like growth arrest in mammary carcinoma cells exposed to ionizing radiation.

PubMed

Suzuki, Masatoshi; Yamauchi, Motohiro; Oka, Yasuyoshi; Suzuki, Keiji; Yamashita, Shunichi

2012-06-01

Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% and 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO(2)-hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ß-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation. Copyright © 2012 Elsevier Inc. All rights reserved.

Genome-wide mapping of alternative splicing in Arabidopsis thaliana

PubMed Central

Filichkin, Sergei A.; Priest, Henry D.; Givan, Scott A.; Shen, Rongkun; Bryant, Douglas W.; Fox, Samuel E.; Wong, Weng-Keen; Mockler, Todd C.

2010-01-01

Alternative splicing can enhance transcriptome plasticity and proteome diversity. In plants, alternative splicing can be manifested at different developmental stages, and is frequently associated with specific tissue types or environmental conditions such as abiotic stress. We mapped the Arabidopsis transcriptome at single-base resolution using the Illumina platform for ultrahigh-throughput RNA sequencing (RNA-seq). Deep transcriptome sequencing confirmed a majority of annotated introns and identified thousands of novel alternatively spliced mRNA isoforms. Our analysis suggests that at least ∼42% of intron-containing genes in Arabidopsis are alternatively spliced; this is significantly higher than previous estimates based on cDNA/expressed sequence tag sequencing. Random validation confirmed that novel splice isoforms empirically predicted by RNA-seq can be detected in vivo. Novel introns detected by RNA-seq were substantially enriched in nonconsensus terminal dinucleotide splice signals. Alternative isoforms with premature termination codons (PTCs) comprised the majority of alternatively spliced transcripts. Using an example of an essential circadian clock gene, we show that intron retention can generate relatively abundant PTC+ isoforms and that this specific event is highly conserved among diverse plant species. Alternatively spliced PTC+ isoforms can be potentially targeted for degradation by the nonsense mediated mRNA decay (NMD) surveillance machinery or regulate the level of functional transcripts by the mechanism of regulated unproductive splicing and translation (RUST). We demonstrate that the relative ratios of the PTC+ and reference isoforms for several key regulatory genes can be considerably shifted under abiotic stress treatments. Taken together, our results suggest that like in animals, NMD and RUST may be widespread in plants and may play important roles in regulating gene expression. PMID:19858364

RNA-Seq of Arabidopsis Pollen Uncovers Novel Transcription and Alternative Splicing1[C][W][OA

PubMed Central

Loraine, Ann E.; McCormick, Sheila; Estrada, April; Patel, Ketan; Qin, Peng

2013-01-01

Pollen grains of Arabidopsis (Arabidopsis thaliana) contain two haploid sperm cells enclosed in a haploid vegetative cell. Upon germination, the vegetative cell extrudes a pollen tube that carries the sperm to an ovule for fertilization. Knowing the identity, relative abundance, and splicing patterns of pollen transcripts will improve our understanding of pollen and allow investigation of tissue-specific splicing in plants. Most Arabidopsis pollen transcriptome studies have used the ATH1 microarray, which does not assay splice variants and lacks specific probe sets for many genes. To investigate the pollen transcriptome, we performed high-throughput sequencing (RNA-Seq) of Arabidopsis pollen and seedlings for comparison. Gene expression was more diverse in seedling, and genes involved in cell wall biogenesis were highly expressed in pollen. RNA-Seq detected at least 4,172 protein-coding genes expressed in pollen, including 289 assayed only by nonspecific probe sets. Additional exons and previously unannotated 5′ and 3′ untranslated regions for pollen-expressed genes were revealed. We detected regions in the genome not previously annotated as expressed; 14 were tested and 12 were confirmed by polymerase chain reaction. Gapped read alignments revealed 1,908 high-confidence new splicing events supported by 10 or more spliced read alignments. Alternative splicing patterns in pollen and seedling were highly correlated. For most alternatively spliced genes, the ratio of variants in pollen and seedling was similar, except for some encoding proteins involved in RNA splicing. This study highlights the robustness of splicing patterns in plants and the importance of ongoing annotation and visualization of RNA-Seq data using interactive tools such as Integrated Genome Browser. PMID:23590974

Skipping meals and alcohol consumption. The regulation of energy intake and expenditure among weight loss participants.

PubMed

Carels, Robert A; Young, Kathleen M; Coit, Carissa; Clayton, Anna Marie; Spencer, Alexis; Wagner, Marissa

2008-11-01

Research suggests that specific eating patterns (e.g., eating breakfast) may be related to favorable weight status. This investigation examined the relationship between eating patterns (i.e., skipping meals; consuming alcohol) and weight loss treatment outcomes (weight loss, energy intake, energy expenditure, and duration of exercise). Fifty-four overweight or obese adults (BMI> or =27 kg/m(2)) participated in a self-help or therapist-assisted weight loss program. Daily energy intake from breakfast, lunch, dinner, and alcoholic beverages, total daily energy intake, total daily energy expenditure, physical activity, and weekly weight loss were assessed. On days that breakfast or dinner was skipped, or alcoholic beverages were not consumed, less total daily energy was consumed compared to days that breakfast, dinner, or alcoholic beverages were consumed. On days that breakfast or alcohol was consumed, daily energy expenditure (breakfast only) and duration of exercise were higher compared to days that breakfast or alcohol was not consumed. Individuals who skipped dinner or lunch more often had lower energy expenditure and exercise duration than individuals who skipped dinner or lunch less often. Individuals who consumed alcohol more often had high daily energy expenditure than individuals who consumed alcohol less often. Skipping meals or consuming alcoholic beverages was not associated with weekly weight loss. In this investigation, weight loss program participants may have compensated for excess energy intake from alcoholic beverages and meals with greater daily energy expenditure and longer exercise duration.

Cold-dependent alternative splicing of a Jumonji C domain-containing gene MtJMJC5 in Medicago truncatula.

PubMed

Shen, Yingfang; Wu, Xiaopei; Liu, Demei; Song, Shengjing; Liu, Dengcai; Wang, Haiqing

2016-05-27

Histone methylation is an epigenetic modification mechanism that regulates gene expression in eukaryotic cells. Jumonji C domain-containing demethylases are involved in removal of methyl groups at lysine or arginine residues. The JmjC domain-only member, JMJ30/JMJD5 of Arabidopsis, is a component of the plant circadian clock. Although some plant circadian clock genes undergo alternative splicing in response to external cues, there is no evidence that JMJ30/JMJD5 is regulated by alternative splicing. In this study, the expression of an Arabidopsis JMJ30/JMJD5 ortholog in Medicago truncatula, MtJMJC5, in response to circadian clock and abiotic stresses were characterized. The results showed that MtJMJC5 oscillates with a circadian rhythm, and undergoes cold specifically induced alternative splicing. The cold-induced alternative splicing could be reversed after ambient temperature returning to the normal. Sequencing results revealed four alternative splicing RNA isoforms including a full-length authentic protein encoding variant, and three premature termination condon-containing variants due to alternative 3' splice sites at the first and second intron. Under cold treatment, the variants that share a common 3' alternative splicing site at the second intron were intensively up-regulated while the authentic protein encoding variant and the premature termination condon-containing variant only undergoing a 3' alternative splicing at the first intron were down regulated. Although all the premature termination condon-harboring alternative splicing variants were sensitive to nonsense-mediated decay, the premature termination codon-harboring alternative splicing variants sharing the 3' alternative splicing site at the second intron showed less sensitivity than the one only containing the 3' alternative slicing site at the first intron under cold treatment. These results suggest that the cold-dependent alternative splicing of MtJMJC5 is likely a species or genus-specific mechanism of gene expression regulation on RNA levels, and might play a role in epigenetic regulation of the link between the circadian clock and ambient temperature fluctuation in Medicago. Copyright © 2016 Elsevier Inc. All rights reserved.

The splicing activator DAZAP1 integrates splicing control into MEK/Erk-regulated cell proliferation and migration

NASA Astrophysics Data System (ADS)

Choudhury, Rajarshi; Roy, Sreerupa Ghose; Tsai, Yihsuan S.; Tripathy, Ashutosh; Graves, Lee M.; Wang, Zefeng

2014-01-01

Alternative splicing of pre-messenger RNA (mRNA) is a critical stage of gene regulation in response to environmental stimuli. Here we show that DAZAP1, an RNA-binding protein involved in mammalian development and spermatogenesis, promotes inclusion of weak exons through specific recognition of diverse cis-elements. The carboxy-terminal proline-rich domain of DAZAP1 interacts with and neutralizes general splicing inhibitors, and is sufficient to activate splicing when recruited to pre-mRNA. This domain is phosphorylated by the MEK/Erk (extracellular signal-regulated protein kinase) pathway and this modification is essential for the splicing regulatory activity and the nuclear/cytoplasmic translocation of DAZAP1. Using mRNA-seq, we identify endogenous splicing events regulated by DAZAP1, many of which are involved in maintaining cell growth. Knockdown or over-expression of DAZAP1 causes a cell proliferation defect. Taken together, these studies reveal a molecular mechanism that integrates splicing control into MEK/Erk-regulated cell proliferation.

The splicing activator DAZAP1 integrates splicing control into MEK/Erk regulated cell proliferation and migration

PubMed Central

Choudhury, Rajarshi; Roy, Sreerupa Ghose; Tsai, Yihsuan S.; Tripathy, Ashutosh; Graves, Lee M.; Wang, Zefeng

2014-01-01

Alternative splicing of pre-mRNA is a critical stage of gene regulation in response to environmental stimuli. Here we show that DAZAP1, an RNA binding protein involved in mammalian development and spermatogenesis, promotes inclusion of weak exons through specific recognition of diverse cis-elements. The C-terminal proline-rich domain of DAZAP1 interacts with and neutralizes general splicing inhibitors, and is sufficient to activate splicing when recruited to pre-mRNA. This domain is phosphorylated by the MEK/Erk pathway and this modification is essential for the splicing regulatory activity and the nuclear/cytoplasmic translocation of DAZAP1. Using mRNA-seq we identify endogenous splicing events regulated by DAZAP1, many of which are involved in maintaining cell growth. Knockdown or over-expression of DAZAP1 causes a cell proliferation defect. Taken together, these studies reveal a molecular mechanism that integrates splicing control into MEK/Erk regulated cell proliferation. PMID:24452013

Genomic overview of mRNA 5′-leader trans-splicing in the ascidian Ciona intestinalis

PubMed Central

Satou, Yutaka; Hamaguchi, Makoto; Takeuchi, Keisuke; Hastings, Kenneth E. M.; Satoh, Nori

2006-01-01

Although spliced leader (SL) trans-splicing in the chordates was discovered in the tunicate Ciona intestinalis there has been no genomic overview analysis of the extent of trans-splicing or the make-up of the trans-spliced and non-trans-spliced gene populations of this model organism. Here we report such an analysis for Ciona based on the oligo-capping full-length cDNA approach. We randomly sampled 2078 5′-full-length ESTs representing 668 genes, or 4.2% of the entire genome. Our results indicate that Ciona contains a single major SL, which is efficiently trans-spliced to mRNAs transcribed from a specific set of genes representing ∼50% of the total number of expressed genes, and that individual trans-spliced mRNA species are, on average, 2–3-fold less abundant than non-trans-spliced mRNA species. Our results also identify a relationship between trans-splicing status and gene functional classification; ribosomal protein genes fall predominantly into the non-trans-spliced category. In addition, our data provide the first evidence for the occurrence of polycistronic transcription in Ciona. An interesting feature of the Ciona polycistronic transcription units is that the great majority entirely lack intercistronic sequences. PMID:16822859

Structure and function of splice variants of the cardiac voltage-gated sodium channel Na(v)1.5.

PubMed

Schroeter, Annett; Walzik, Stefan; Blechschmidt, Steve; Haufe, Volker; Benndorf, Klaus; Zimmer, Thomas

2010-07-01

Voltage-gated sodium channels mediate the rapid upstroke of the action potential in excitable tissues. The tetrodotoxin (TTX) resistant isoform Na(v)1.5, encoded by the SCN5A gene, is the predominant isoform in the heart. This channel plays a key role for excitability of atrial and ventricular cardiomyocytes and for rapid impulse propagation through the specific conduction system. During recent years, strong evidence has been accumulated in support of the expression of several Na(v)1.5 splice variants in the heart, and in various other tissues and cell lines including brain, dorsal root ganglia, breast cancer cells and neuronal stem cell lines. This review summarizes our knowledge on the structure and putative function of nine Na(v)1.5 splice variants detected so far. Attention will be paid to the distinct biophysical properties of the four functional splice variants, to the pronounced tissue- and species-specific expression, and to the developmental regulation of Na(v)1.5 splicing. The implications of alternative splicing for SCN5A channelopathies, and for a better understanding of genotype-phenotype correlations, are discussed. Copyright 2010 Elsevier Ltd. All rights reserved.

Identification of alternatively spliced isoforms of interleukin-2/15 receptor β chain in ducks.

PubMed

Jeong, Jipseol; Kim, Woo H; Yeo, Jaeseung; Fernandez, Cherry P; Kim, Suk; Lee, Youn-Jeong; Lillehoj, Hyun S; Min, Wongi

2014-12-15

Interleukin (IL)-2 and IL-15 receptor β (IL-2/15Rβ, CD122) play important roles in signal transduction for biological functions of IL-2 and IL-15. We found that ducks possess three different IL-2/15Rβ transcripts, a conventional form (duIL-2/15Rβ) and two variants. Comparisons between the cDNA and genomic sequences revealed that the two variants, duIL-2/15Rβ-d7 and duIL-2/15Rβ-d9, were novel spliced transcripts resulting from skipping exons 7 and 9, respectively. Expression profiles of duIL-2/15Rβ and its isoforms were examined in healthy tissues, concanavalin A (ConA)-stimulated splenic lymphocytes and in livers and spleens of Riemerella anatipestifer-infected ducks using quantitative real-time PCR (qRT-PCR). Generally, duIL-2/15Rβ-d9 expression was undetectable in healthy tissues, ConA-activated samples, and R. anatipestifer-infected ducks. Expression levels of duIL-2/15Rβ transcript were relatively high to moderate in all healthy tissues tested, while duIL-2/15Rβ-d7 expression was low. Compared to untreated controls, expression levels of duIL-2/15Rβ were elevated in ConA-activated splenic lymphocytes and in livers on day 7 in R. anatipestifer-infected ducks, while duIL-2/15Rβ-d7 expression was unchanged. Additionally, COS-7 cells transfected with duIL-2/15Rβ, duIL-2/15Rβ-d7, or duIL-2/15Rβ-d9 constructs generated 73 kilodalton (kDa), 31kDa, and 40kDa proteins, respectively. This study identified three different IL-2/15Rβ transcripts, including two isoforms generated by alternative splicing and their gene expression patterns in stimulated conditions. Copyright © 2014 Elsevier B.V. All rights reserved.

Autosomal-recessive congenital cerebellar ataxia is caused by mutations in metabotropic glutamate receptor 1.

PubMed

Guergueltcheva, Velina; Azmanov, Dimitar N; Angelicheva, Dora; Smith, Katherine R; Chamova, Teodora; Florez, Laura; Bynevelt, Michael; Nguyen, Thai; Cherninkova, Sylvia; Bojinova, Veneta; Kaprelyan, Ara; Angelova, Lyudmila; Morar, Bharti; Chandler, David; Kaneva, Radka; Bahlo, Melanie; Tournev, Ivailo; Kalaydjieva, Luba

2012-09-07

Autosomal-recessive congenital cerebellar ataxia was identified in Roma patients originating from a small subisolate with a known strong founder effect. Patients presented with global developmental delay, moderate to severe stance and gait ataxia, dysarthria, mild dysdiadochokinesia, dysmetria and tremors, intellectual deficit, and mild pyramidal signs. Brain imaging revealed progressive generalized cerebellar atrophy, and inferior vermian hypoplasia and/or a constitutionally small brain were observed in some patients. Exome sequencing, used for linkage analysis on extracted SNP genotypes and for mutation detection, identified two novel (i.e., not found in any database) variants located 7 bp apart within a unique 6q24 linkage region. Both mutations cosegregated with the disease in five affected families, in which all ten patients were homozygous. The mutated gene, GRM1, encodes metabotropic glutamate receptor mGluR1, which is highly expressed in cerebellar Purkinje cells and plays an important role in cerebellar development and synaptic plasticity. The two mutations affect a gene region critical for alternative splicing and the generation of receptor isoforms; they are a 3 bp exon 8 deletion and an intron 8 splicing mutation (c.2652_2654del and c.2660+2T>G, respectively [RefSeq accession number NM_000838.3]). The functional impact of the deletion is unclear and is overshadowed by the splicing defect. Although ataxia lymphoblastoid cell lines expressed GRM1 at levels comparable to those of control cells, the aberrant transcripts skipped exon 8 or ended in intron 8 and encoded various species of nonfunctional receptors either lacking the transmembrane domain and containing abnormal intracellular tails or completely missing the tail. The study implicates mGluR1 in human hereditary ataxia. It also illustrates the potential of the Roma founder populations for mutation identification by exome sequencing. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Multidrug resistance in epilepsy and polymorphisms in the voltage-gated sodium channel genes SCN1A, SCN2A, and SCN3A: correlation among phenotype, genotype, and mRNA expression.

PubMed

Kwan, Patrick; Poon, Wai Sang; Ng, Ho-Keung; Kang, David E; Wong, Virginia; Ng, Ping Wing; Lui, Colin H T; Sin, Ngai Chuen; Wong, Ka S; Baum, Larry

2008-11-01

Many antiepileptic drugs (AEDs) prevent seizures by blocking voltage-gated brain sodium channels. However, treatment is ineffective in 30% of epilepsy patients, which might, at least in part, result from polymorphisms of the sodium channel genes. We investigated the association of AED responsiveness with genetic polymorphisms and correlated any association with mRNA expression of the neuronal sodium channels. We performed genotyping of tagging and candidate single nucleotide polymorphisms (SNPs) of SCN1A, 2A, and 3A in 471 Chinese epilepsy patients (272 drug responsive and 199 drug resistant). A total of 27 SNPs were selected based on the HapMap database. Genotype distributions in drug-responsive and drug-resistant patients were compared. SCN2A mRNA was quantified by real-time PCR in 24 brain and 57 blood samples. Its level was compared between patients with different genotypes of an SCN2A SNP found to be associated with drug responsiveness. SCN2A IVS7-32A>G (rs2304016) A alleles were associated with drug resistance (odds ratio = 2.1, 95% confidence interval: 1.2-3.7, P=0.007). Haplotypes containing the IVS7-32A>G allele A were also associated with drug resistance. IVS7-32A>G is located within the putative splicing branch site for splicing exons 7 and 9. PCR of reverse-transcribed RNA from blood or brain of patients with different IVS7-32A>G genotypes using primers in exons 7 and 9 showed no skipping of exon 8, and real-time PCR showed no difference in SCN2A mRNA levels among genotypes. Results of this study suggest an association between SCN2A IVS7-32A>G and AED responsiveness, without evidence of an effect on splicing or mRNA expression.

NOVA2-mediated RNA regulation is required for axonal pathfinding during development

PubMed Central

Saito, Yuhki; Miranda-Rottmann, Soledad; Ruggiu, Matteo; Park, Christopher Y; Fak, John J; Zhong, Ru; Duncan, Jeremy S; Fabella, Brian A; Junge, Harald J; Chen, Zhe; Araya, Roberto; Fritzsch, Bernd; Hudspeth, A J; Darnell, Robert B

2016-01-01

The neuron specific RNA-binding proteins NOVA1 and NOVA2 are highly homologous alternative splicing regulators. NOVA proteins regulate at least 700 alternative splicing events in vivo, yet relatively little is known about the biologic consequences of NOVA action and in particular about functional differences between NOVA1 and NOVA2. Transcriptome-wide searches for isoform-specific functions, using NOVA1 and NOVA2 specific HITS-CLIP and RNA-seq data from mouse cortex lacking either NOVA isoform, reveals that NOVA2 uniquely regulates alternative splicing events of a series of axon guidance related genes during cortical development. Corresponding axonal pathfinding defects were specific to NOVA2 deficiency: Nova2-/- but not Nova1-/- mice had agenesis of the corpus callosum, and axonal outgrowth defects specific to ventral motoneuron axons and efferent innervation of the cochlea. Thus we have discovered that NOVA2 uniquely regulates alternative splicing of a coordinate set of transcripts encoding key components in cortical, brainstem and spinal axon guidance/outgrowth pathways during neural differentiation, with severe functional consequences in vivo. DOI: http://dx.doi.org/10.7554/eLife.14371.001 PMID:27223325

An in vivo genetic screen for genes involved in spliced leader trans-splicing indicates a crucial role for continuous de novo spliced leader RNP assembly.

PubMed

Philippe, Lucas; Pandarakalam, George C; Fasimoye, Rotimi; Harrison, Neale; Connolly, Bernadette; Pettitt, Jonathan; Müller, Berndt

2017-08-21

Spliced leader (SL) trans-splicing is a critical element of gene expression in a number of eukaryotic groups. This process is arguably best understood in nematodes, where biochemical and molecular studies in Caenorhabditis elegans and Ascaris suum have identified key steps and factors involved. Despite this, the precise details of SL trans-splicing have yet to be elucidated. In part, this is because the systematic identification of the molecules involved has not previously been possible due to the lack of a specific phenotype associated with defects in this process. We present here a novel GFP-based reporter assay that can monitor SL1 trans-splicing in living C. elegans. Using this assay, we have identified mutants in sna-1 that are defective in SL trans-splicing, and demonstrate that reducing function of SNA-1, SNA-2 and SUT-1, proteins that associate with SL1 RNA and related SmY RNAs, impairs SL trans-splicing. We further demonstrate that the Sm proteins and pICln, SMN and Gemin5, which are involved in small nuclear ribonucleoprotein assembly, have an important role in SL trans-splicing. Taken together these results provide the first in vivo evidence for proteins involved in SL trans-splicing, and indicate that continuous replacement of SL ribonucleoproteins consumed during trans-splicing reactions is essential for effective trans-splicing. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Conservation and Sex-Specific Splicing of the transformer Gene in the Calliphorids Cochliomyia hominivorax, Cochliomyia macellaria and Lucilia sericata

PubMed Central

Li, Fang; Vensko, Steven P.; Belikoff, Esther J.; Scott, Maxwell J.

2013-01-01

Transformer (TRA) promotes female development in several dipteran species including the Australian sheep blowfly Lucilia cuprina, the Mediterranean fruit fly, housefly and Drosophila melanogaster. tra transcripts are sex-specifically spliced such that only the female form encodes full length functional protein. The presence of six predicted TRA/TRA2 binding sites in the sex-specific female intron of the L. cuprina gene suggested that tra splicing is auto-regulated as in medfly and housefly. With the aim of identifying conserved motifs that may play a role in tra sex-specific splicing, here we have isolated and characterized the tra gene from three additional blowfly species, L. sericata, Cochliomyia hominivorax and C. macellaria. The blowfly adult male and female transcripts differ in the choice of splice donor site in the first intron, with males using a site downstream of the site used in females. The tra genes all contain a single TRA/TRA2 site in the male exon and a cluster of four to five sites in the male intron. However, overall the sex-specific intron sequences are poorly conserved in closely related blowflies. The most conserved regions are around the exon/intron junctions, the 3′ end of the intron and near the cluster of TRA/TRA2 sites. We propose a model for sex specific regulation of tra splicing that incorporates the conserved features identified in this study. In L. sericata embryos, the male tra transcript was first detected at around the time of cellular blastoderm formation. RNAi experiments showed that tra is required for female development in L. sericata and C. macellaria. The isolation of the tra gene from the New World screwworm fly C. hominivorax, a major livestock pest, will facilitate the development of a “male-only” strain for genetic control programs. PMID:23409170

Interplay between Alternative Splicing and Alternative Polyadenylation Defines the Expression Outcome of the Plant Unique OXIDATIVE TOLERANT-6 Gene.

PubMed

Li, Qingshun Q; Liu, Zhaoyang; Lu, Wenjia; Liu, Man

2017-05-17

Pre-mRNA alternative splicing and alternative polyadenylation have been implicated to play important roles during eukaryotic gene expression. However, much remains unknown regarding the regulatory mechanisms and the interactions of these two processes in plants. Here we focus on an Arabidopsis gene OXT6 (Oxidative Tolerant-6) that has been demonstrated to encode two proteins through alternative splicing and alternative polyadenylation. Specifically, alternative polyadenylation at Intron-2 of OXT6 produces a transcript coding for AtCPSF30, an Arabidopsis ortholog of 30 kDa subunit of the Cleavage and Polyadenylation Specificity Factor. On the other hand, alternative splicing of Intron-2 generates a longer transcript encoding a protein named AtC30Y, a polypeptide including most part of AtCPSF30 and a YT521B domain. To investigate the expression outcome of OXT6 in plants, a set of mutations were constructed to alter the splicing and polyadenylation patterns of OXT6. Analysis of transgenic plants bearing these mutations by quantitative RT-PCR revealed a competition relationship between these two processes. Moreover, when both splice sites and poly(A) signals were mutated, polyadenylation became the preferred mode of OXT6 processing. These results demonstrate the interplay between alternative splicing and alternative polyadenylation, and it is their concerted actions that define a gene's expression outcome.

MKLN1 splicing defect in dogs with lethal acrodermatitis

PubMed Central

Bauer, Anina; McEwan, Neil A.; Cadieu, Edouard; André, Catherine; Roosje, Petra; Mellersh, Cathryn; Casal, Margret L.

2018-01-01

Lethal acrodermatitis (LAD) is a genodermatosis with monogenic autosomal recessive inheritance in Bull Terriers and Miniature Bull Terriers. The LAD phenotype is characterized by poor growth, immune deficiency, and skin lesions, especially at the paws. Utilizing a combination of genome wide association study and haplotype analysis, we mapped the LAD locus to a critical interval of ~1.11 Mb on chromosome 14. Whole genome sequencing of an LAD affected dog revealed a splice region variant in the MKLN1 gene that was not present in 191 control genomes (chr14:5,731,405T>G or MKLN1:c.400+3A>C). This variant showed perfect association in a larger combined Bull Terrier/Miniature Bull Terrier cohort of 46 cases and 294 controls. The variant was absent from 462 genetically diverse control dogs of 62 other dog breeds. RT-PCR analysis of skin RNA from an affected and a control dog demonstrated skipping of exon 4 in the MKLN1 transcripts of the LAD affected dog, which leads to a shift in the MKLN1 reading frame. MKLN1 encodes the widely expressed intracellular protein muskelin 1, for which diverse functions in cell adhesion, morphology, spreading, and intracellular transport processes are discussed. While the pathogenesis of LAD remains unclear, our data facilitate genetic testing of Bull Terriers and Miniature Bull Terriers to prevent the unintentional production of LAD affected dogs. This study may provide a starting point to further clarify the elusive physiological role of muskelin 1 in vivo. PMID:29565995

Mutations Preventing Regulated Exon Skipping in MET Cause Osteofibrous Dysplasia

PubMed Central

Gray, Mary J.; Kannu, Peter; Sharma, Swarkar; Neyt, Christine; Zhang, Dongping; Paria, Nandina; Daniel, Philip B.; Whetstone, Heather; Sprenger, Hans-Georg; Hammerschmidt, Philipp; Weng, Angela; Dupuis, Lucie; Jobling, Rebekah; Mendoza-Londono, Roberto; Dray, Michael; Su, Peiqiang; Wilson, Megan J.; Kapur, Raj P.; McCarthy, Edward F.; Alman, Benjamin A.; Howard, Andrew; Somers, Gino R.; Marshall, Christian R.; Manners, Simon; Flanagan, Adrienne M.; Rathjen, Karl E.; Karol, Lori A.; Crawford, Haemish; Markie, David M.; Rios, Jonathan J.; Wise, Carol A.; Robertson, Stephen P.

2015-01-01

The periosteum contributes to bone repair and maintenance of cortical bone mass. In contrast to the understanding of bone development within the epiphyseal growth plate, factors that regulate periosteal osteogenesis have not been studied as intensively. Osteofibrous dysplasia (OFD) is a congenital disorder of osteogenesis and is typically sporadic and characterized by radiolucent lesions affecting the cortical bone immediately under the periosteum of the tibia and fibula. We identified germline mutations in MET, encoding a receptor tyrosine kinase, that segregate with an autosomal-dominant form of OFD in three families and a mutation in a fourth affected subject from a simplex family and with bilateral disease. Mutations identified in all families with dominant inheritance and in the one simplex subject with bilateral disease abolished the splice inclusion of exon 14 in MET transcripts, which resulted in a MET receptor (METΔ14) lacking a cytoplasmic juxtamembrane domain. Splice exclusion of this domain occurs during normal embryonic development, and forced induction of this exon-exclusion event retarded osteoblastic differentiation in vitro and inhibited bone-matrix mineralization. In an additional subject with unilateral OFD, we identified a somatic MET mutation, also affecting exon 14, that substituted a tyrosine residue critical for MET receptor turnover and, as in the case of the METΔ14 mutations, had a stabilizing effect on the mature protein. Taken together, these data show that aberrant MET regulation via the juxtamembrane domain subverts core MET receptor functions that regulate osteogenesis within cortical diaphyseal bone. PMID:26637977

Novel LAMP2 mutations in Chinese patients with Danon disease cause varying degrees of clinical severity.

PubMed

Luo, Su-shan; Xi, Jian-ying; Cai, Shuang; Zhao, Chong-bo; Lu, Jia-hong; Zhu, Wen-hua; Lin, Jie; Qiao, Kai; Wang, Yin; Ye, Zhu-rong

2014-01-01

Danon disease is an Xlinked dominant lysosomal glycogen storage disorder characterized by cardiomyopathy, skeletal myopathy, and mental retardation. This study described two Chinese cases of Danon disease in order to broaden the phenotypic and genetic spectrum. Clinical data were collected and LAMP2 mutations were analyzed. Patient A had fluctuating limb weakness during 6 months follow-up and was diagnosed with drug-induced myopathy due to anti-hepatitis B therapy with lamivudine. However, the first muscle biopsy with large cytoplasmic vacuoles confused the diagnosis and led to the second biopsy that allowed for the final diagnosis. Patient B had severe cardiac disturbances leading to sudden death. Molecularly, patient A harbored a synonymous mutation adjacent to the exon 6-intron 6 junction; mRNA analysis provided evidence that totally abolished the donor site and caused skipping of exon 6. Patient B harbored a frame-shift deletion mutation in exon 3 (c.396delA) leading to a truncated protein. To our knowledge, this is the first report of Danon disease caused by a synonymous exon mutation that affected mRNA splicing, which indicates that a synonymous substitution may not be silent when it is in the exon sequences close to the splice sites. It is also the first description of Danon disease clinically presenting as druginduced myopathy at onset; the pathological changes might be the key point for making a differential diagnosis. *These two authors contributed equally to this work.

The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

1994-12-31

Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

A novel heterozygous intronic mutation in POU1F1 is associated with combined pituitary hormone deficiency.

PubMed

Takagi, Masaki; Kamasaki, Hotaka; Yagi, Hiroko; Fukuzawa, Ryuji; Narumi, Satoshi; Hasegawa, Tomonobu

2017-02-27

POU class 1 homeobox 1 (POU1F1) regulates pituitary cell-specific gene expression of somatotropes, lactotropes, and thyrotropes. In humans, two POU1F1 isoforms (long and short isoform), which are generated by the alternative use of the splice acceptor site for exon 2, have been identified. To date, more than 30 POU1F1 mutations in patients with combined pituitary hormone deficiency (CPHD) have been described. All POU1F1 variants reported to date affect both the short and long isoforms of the POU1F1 protein; therefore, it is unclear at present whether a decrease in the function of only one of these two isoforms is sufficient for disease onset in humans. Here, we described a sibling case of CPHD carrying a heterozygous mutation in intron 1 of POU1F1. In vitro experiments showed that this mutation resulted in exon 2-skipping of only in the short isoform of POU1F1, while the long isoform remained intact. This result strongly suggests the possibility, for the first time, that isolated mutations in the short isoform of POU1F1 could be sufficient for induction of POU1F1-related CPHD. This finding improves our understanding of the molecular mechanisms, and developmental course associated with mutations in POU1F1.

High Throughput Sequencing Identifies Misregulated Genes in the Drosophila Polypyrimidine Tract-Binding Protein (hephaestus) Mutant Defective in Spermatogenesis.

PubMed

Sridharan, Vinod; Heimiller, Joseph; Robida, Mark D; Singh, Ravinder

2016-01-01

The Drosophila polypyrimidine tract-binding protein (dmPTB or hephaestus) plays an important role during spermatogenesis. The heph2 mutation in this gene results in a specific defect in spermatogenesis, causing aberrant spermatid individualization and male sterility. However, the array of molecular defects in the mutant remains uncharacterized. Using an unbiased high throughput sequencing approach, we have identified transcripts that are misregulated in this mutant. Aberrant transcripts show altered expression levels, exon skipping, and alternative 5' ends. We independently verified these findings by reverse-transcription and polymerase chain reaction (RT-PCR) analysis. Our analysis shows misregulation of transcripts that have been connected to spermatogenesis, including components of the actomyosin cytoskeletal apparatus. We show, for example, that the Myosin light chain 1 (Mlc1) transcript is aberrantly spliced. Furthermore, bioinformatics analysis reveals that Mlc1 contains a high affinity binding site(s) for dmPTB and that the site is conserved in many Drosophila species. We discuss that Mlc1 and other components of the actomyosin cytoskeletal apparatus offer important molecular links between the loss of dmPTB function and the observed developmental defect in spermatogenesis. This study provides the first comprehensive list of genes misregulated in vivo in the heph2 mutant in Drosophila and offers insight into the role of dmPTB during spermatogenesis.

X-exome sequencing identifies a HDAC8 variant in a large pedigree with X-linked intellectual disability, truncal obesity, gynaecomastia, hypogonadism and unusual face.

PubMed

Harakalova, Magdalena; van den Boogaard, Marie-Jose; Sinke, Richard; van Lieshout, Stef; van Tuil, Marc C; Duran, Karen; Renkens, Ivo; Terhal, Paulien A; de Kovel, Carolien; Nijman, Ies J; van Haelst, Mieke; Knoers, Nine V A M; van Haaften, Gijs; Kloosterman, Wigard; Hennekam, Raoul C M; Cuppen, Edwin; Ploos van Amstel, Hans Kristian

2012-08-01

We present a large Dutch family with seven males affected by a novel syndrome of X-linked intellectual disability, hypogonadism, gynaecomastia, truncal obesity, short stature and recognisable craniofacial manifestations resembling but not identical to Wilson-Turner syndrome. Seven female relatives show a much milder expression of the phenotype. We performed X chromosome exome (X-exome) sequencing in five individuals from this family and identified a novel intronic variant in the histone deacetylase 8 gene (HDAC8), c.164+5G>A, which disturbs the normal splicing of exon 2 resulting in exon skipping, and introduces a premature stop at the beginning of the histone deacetylase catalytic domain. The identified variant completely segregates in this family and was absent in 96 Dutch controls and available databases. Affected female carriers showed a notably skewed X-inactivation pattern in lymphocytes in which the mutated X-chromosome was completely inactivated. HDAC8 is a member of the protein family of histone deacetylases that play a major role in epigenetic gene silencing during development. HDAC8 specifically controls the patterning of the skull with the mouse HDAC8 knock-out showing craniofacial deformities of the skull. The present family provides the first evidence for involvement of HDAC8 in a syndromic form of intellectual disability.

Co-expression networks reveal the tissue-specific regulation of transcription and splicing

PubMed Central

Saha, Ashis; Kim, Yungil; Gewirtz, Ariel D.H.; Jo, Brian; Gao, Chuan; McDowell, Ian C.; Engelhardt, Barbara E.

2017-01-01

Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the regulation of splicing and transcription. We built TWNs for 16 tissues and found that hubs in these networks were strongly enriched for splicing and RNA binding genes, demonstrating their utility in unraveling regulation of splicing in the human transcriptome. Next, we used a Bayesian biclustering model that identifies network edges unique to a single tissue to reconstruct Tissue-Specific Networks (TSNs) for 26 distinct tissues and 10 groups of related tissues. Finally, we found genetic variants associated with pairs of adjacent nodes in our networks, supporting the estimated network structures and identifying 20 genetic variants with distant regulatory impact on transcription and splicing. Our networks provide an improved understanding of the complex relationships of the human transcriptome across tissues. PMID:29021288

Functional impact of splice isoform diversity in individual cells

PubMed Central

Yap, Karen; Makeyev, Eugene V.

2016-01-01

Alternative pre-mRNA splicing provides an effective means for expanding coding capacity of eukaryotic genomes. Recent studies suggest that co-expression of different splice isoforms may increase diversity of RNAs and proteins at a single-cell level. A pertinent question in the field is whether such co-expression is biologically meaningful or, rather, represents insufficiently stringent splicing regulation. Here we argue that isoform co-expression may produce functional outcomes that are difficult and sometimes impossible to achieve using other regulation strategies. Far from being a ‘splicing noise’, co-expression is often established through co-ordinated activity of specific cis-elements and trans-acting factors. Further work in this area may uncover new biological functions of alternative splicing (AS) and generate important insights into mechanisms allowing different cell types to attain their unique molecular identities. PMID:27528755

Functional impact of splice isoform diversity in individual cells.

PubMed

Yap, Karen; Makeyev, Eugene V

2016-08-15

Alternative pre-mRNA splicing provides an effective means for expanding coding capacity of eukaryotic genomes. Recent studies suggest that co-expression of different splice isoforms may increase diversity of RNAs and proteins at a single-cell level. A pertinent question in the field is whether such co-expression is biologically meaningful or, rather, represents insufficiently stringent splicing regulation. Here we argue that isoform co-expression may produce functional outcomes that are difficult and sometimes impossible to achieve using other regulation strategies. Far from being a 'splicing noise', co-expression is often established through co-ordinated activity of specific cis-elements and trans-acting factors. Further work in this area may uncover new biological functions of alternative splicing (AS) and generate important insights into mechanisms allowing different cell types to attain their unique molecular identities. © 2016 The Author(s).

Platinum coat color in red fox (Vulpes vulpes) is caused by a mutation in an autosomal copy of KIT.

PubMed

Johnson, J L; Kozysa, A; Kharlamova, A V; Gulevich, R G; Perelman, P L; Fong, H W F; Vladimirova, A V; Oskina, I N; Trut, L N; Kukekova, A V

2015-04-01

The red fox (Vulpes vulpes) demonstrates a variety of coat colors including platinum, a common phenotype maintained in farm-bred fox populations. Foxes heterozygous for the platinum allele have a light silver coat and extensive white spotting, whereas homozygosity is embryonic lethal. Two KIT transcripts were identified in skin cDNA from platinum foxes. The long transcript was identical to the KIT transcript of silver foxes, whereas the short transcript, which lacks exon 17, was specific to platinum. The KIT gene has several copies in the fox genome: an autosomal copy on chromosome 2 and additional copies on the B chromosomes. To identify the platinum-specific KIT sequence, the genomes of one platinum and one silver fox were sequenced. A single nucleotide polymorphism (SNP) was identified at the first nucleotide of KIT intron 17 in the platinum fox. In platinum foxes, the A allele of the SNP disrupts the donor splice site and causes exon 17, which is part of a segment that encodes a conserved tyrosine kinase domain, to be skipped. Complete cosegregation of the A allele with the platinum phenotype was confirmed by linkage mapping (LOD 25.59). All genotyped farm-bred platinum foxes from Russia and the US were heterozygous for the SNP (A/G), whereas foxes with different coat colors were homozygous for the G allele. Identification of the platinum mutation suggests that other fox white-spotting phenotypes, which are allelic to platinum, would also be caused by mutations in the KIT gene. © 2015 Stichting International Foundation for Animal Genetics.

Genome-Wide Associations of CD46 and IFI44L Genetic Variants with Neutralizing Antibody Response to Measles Vaccine

PubMed Central

Haralambieva, Iana H.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Larrabee, Beth R.; Zimmermann, Michael T.; Grill, Diane E.; Schaid, Daniel J.; Poland, Gregory A.

2017-01-01

Background Population-based studies have revealed 2 to 10% measles vaccine failure rate even after two vaccine doses. While the mechanisms behind this remain unknown, we hypothesized that host genetic factors are likely to be involved. Methods We performed a genome-wide association study of measles specific neutralizing antibody and IFNγ ELISPOT response in a combined sample of 2,872 subjects. Results We identified two distinct chromosome 1 regions (previously associated with MMR-related febrile seizures), associated with vaccine-induced measles neutralizing antibody titers. The 1q32 region contained 20 significant SNPs in/around the measles virus receptor-encoding CD46 gene, including the intronic rs2724384 (p-value = 2.64x10−09) and rs2724374 (p-value = 3.16x10−09) SNPs. The 1q31.1 region contained nine significant SNPs in/around IFI44L, including the intronic rs1333973 (p-value = 1.41x10−10) and the missense rs273259 (His73Arg, p-value = 2.87x10−10) SNPs. Analysis of differential exon usage with mRNA-Seq data and RT-PCR suggests the involvement of rs2724374 minor G allele in the CD46 STP region exon B skipping, resulting in shorter CD46 isoforms. Conclusions Our study reveals common CD46 and IFI44L SNPs associated with measles-specific humoral immunity, and highlights the importance of alternative splicing/virus cellular receptor isoform usage as a mechanism explaining inter-individual variation in immune response after live measles vaccine. PMID:28289848

scaRNAs regulate splicing and vertebrate heart development.

PubMed

Patil, Prakash; Kibiryeva, Nataliya; Uechi, Tamayo; Marshall, Jennifer; O'Brien, James E; Artman, Michael; Kenmochi, Naoya; Bittel, Douglas C

2015-08-01

Alternative splicing (AS) plays an important role in regulating mammalian heart development, but a link between misregulated splicing and congenital heart defects (CHDs) has not been shown. We reported that more than 50% of genes associated with heart development were alternatively spliced in the right ventricle (RV) of infants with tetralogy of Fallot (TOF). Moreover, there was a significant decrease in the level of 12 small cajal body-specific RNAs (scaRNAs) that direct the biochemical modification of specific nucleotides in spliceosomal RNAs. We sought to determine if scaRNA levels influence patterns of AS and heart development. We used primary cells derived from the RV of infants with TOF to show a direct link between scaRNA levels and splice isoforms of several genes that regulate heart development (e.g., GATA4, NOTCH2, DAAM1, DICER1, MBNL1 and MBNL2). In addition, we used antisense morpholinos to knock down the expression of two scaRNAs (scarna1 and snord94) in zebrafish and saw a corresponding disruption of heart development with an accompanying alteration in splice isoforms of cardiac regulatory genes. Based on these combined results, we hypothesize that scaRNA modification of spliceosomal RNAs assists in fine tuning the spliceosome for dynamic selection of mRNA splice isoforms. Our results are consistent with disruption of splicing patterns during early embryonic development leading to insufficient communication between the first and second heart fields, resulting in conotruncal misalignment and TOF. Our findings represent a new paradigm for determining the mechanisms underlying congenital cardiac malformations. Copyright © 2015. Published by Elsevier B.V.

Tissue-specific expression and regulation of the alternatively-spliced forms of lysyl hydroxylase 2 (LH2) in human kidney cells and skin fibroblasts.

PubMed

Walker, Linda C; Overstreet, Mayra A; Yeowell, Heather N

2005-01-01

Lysyl hydroxylases 1, 2, and 3 catalyse the hydroxylation of specific lysines in collagen. A small percentage of these hydroxylysine residues are precursors for the cross-link formation essential for the tensile strength of collagen. Lysyl hydroxylase 2 (LH2) exists as two alternatively-spliced forms; the long transcript (the major ubiquitously-expressed form) includes a 63 bp exon (13A) that is spliced out in the short form (expressed, together with the long form, in human kidney, spleen, liver, and placenta). This study shows that this alternative splicing event can be regulated by both cell density and cycloheximide (CHX). Although only the long form of LH2 is detected in untreated confluent human skin fibroblasts, after 24 h treatment with CHX the short LH2 transcript is also expressed. In kidney cells, in which both LH2 transcripts are equally expressed, the long LH2 transcript is significantly decreased after 24 h CHX treatment, whereas expression of the short transcript is slightly increased. This suggests that, in kidney cells, the splicing mechanism for the inclusion of exon 13A in LH2 requires a newly-synthesized protein factor that is suppressed by CHX, whereas, in skin fibroblasts in which levels of LH2 (long) are unaffected, CHX appears to suppress a factor that inhibits exclusion of exon 13A, thereby promoting expression of LH2 (short). As these alternate transcripts of LH2 may have specificity for hydroxylation of lysines in either telopeptide or helical collagen domains, their relative expression determines the type of cross-links formed, thereby affecting collagen strength. Therefore, any perturbation of the regulation of LH2 splicing could influence the stability of the extracellular matrix and contribute to specific connective tissue disorders.

Proteasomes generate spliced epitopes by two different mechanisms and as efficiently as non-spliced epitopes

PubMed Central

Ebstein, F.; Textoris-Taube, K.; Keller, C.; Golnik, R.; Vigneron, N.; Van den Eynde, B. J.; Schuler-Thurner, B.; Schadendorf, D.; Lorenz, F. K. M.; Uckert, W.; Urban, S.; Lehmann, A.; Albrecht-Koepke, N.; Janek, K.; Henklein, P.; Niewienda, A.; Kloetzel, P. M.; Mishto, M.

2016-01-01

Proteasome-catalyzed peptide splicing represents an additional catalytic activity of proteasomes contributing to the pool of MHC-class I-presented epitopes. We here biochemically and functionally characterized a new melanoma gp100 derived spliced epitope. We demonstrate that the gp100mel47–52/40–42 antigenic peptide is generated in vitro and in cellulo by a not yet described proteasomal condensation reaction. gp100mel47–52/40–42 generation is enhanced in the presence of the β5i/LMP7 proteasome-subunit and elicits a peptide-specific CD8+ T cell response. Importantly, we demonstrate that different gp100mel-derived spliced epitopes are generated and presented to CD8+ T cells with efficacies comparable to non-spliced canonical tumor epitopes and that gp100mel-derived spliced epitopes trigger activation of CD8+ T cells found in peripheral blood of half of the melanoma patients tested. Our data suggest that both transpeptidation and condensation reactions contribute to the frequent generation of spliced epitopes also in vivo and that their immune relevance may be comparable to non-spliced epitopes. PMID:27049119

Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

PubMed Central

Suh, E R; Waring, R B

1990-01-01

It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

Mis-Spliced Lr34 Transcript Events in Winter Wheat.

PubMed

Fang, Tilin; Carver, Brett F; Hunger, Robert M; Yan, Liuling

2017-01-01

Lr34 in wheat is a non-race-specific gene that confers resistance against multiple fungal pathogens. The resistant allele Lr34 and the susceptible allele Lr34s can be distinguished by three polymorphisms that cause alternation of deduced amino acid sequences of Lr34 at the protein level. In seedlings of a cultivar carrying the resistant Lr34r allele, only a portion (35%) of its transcripts was correctly spliced and the majority (65%) of its transcripts were incorrectly spliced due to multiple mis-splicing events. Lr34 mis-splicing events were also observed at adult plant age when this gene exerts its function. All of the mis-spliced Lr34r cDNA transcripts observed in this study resulted in a premature stop codon due to a shift of the open reading frame; hence, the mis-spliced Lr34r cDNAs were deduced to encode incomplete proteins. Even if a cultivar has a functional Lr34 gene, its transcripts might not completely splice in a correct pattern. These findings suggested that the partial resistance conferred by a quantitative gene might be due to mis-splicing events in its transcripts; hence, the resistance of the gene could be increased by eliminating or mutating regulators that cause mis-splicing events in wheat.

The Tissue-Specific RNA Binding Protein T-STAR Controls Regional Splicing Patterns of Neurexin Pre-mRNAs in the Brain

PubMed Central

Ehrmann, Ingrid; Dalgliesh, Caroline; Liu, Yilei; Danilenko, Marina; Crosier, Moira; Overman, Lynn; Arthur, Helen M.; Lindsay, Susan; Clowry, Gavin J.; Venables, Julian P.; Fort, Philippe; Elliott, David J.

2013-01-01

The RNA binding protein T-STAR was created following a gene triplication 520–610 million years ago, which also produced its two parologs Sam68 and SLM-1. Here we have created a T-STAR null mouse to identify the endogenous functions of this RNA binding protein. Mice null for T-STAR developed normally and were fertile, surprisingly, given the high expression of T-STAR in the testis and the brain, and the known infertility and pleiotropic defects of Sam68 null mice. Using a transcriptome-wide search for splicing targets in the adult brain, we identified T-STAR protein as a potent splicing repressor of the alternatively spliced segment 4 (AS4) exons from each of the Neurexin1-3 genes, and exon 23 of the Stxbp5l gene. T-STAR protein was most highly concentrated in forebrain-derived structures like the hippocampus, which also showed maximal Neurexin1-3 AS4 splicing repression. In the absence of endogenous T-STAR protein, Nrxn1-3 AS4 splicing repression dramatically decreased, despite physiological co-expression of Sam68. In transfected cells Neurexin3 AS4 alternative splicing was regulated by either T-STAR or Sam68 proteins. In contrast, Neurexin2 AS4 splicing was only regulated by T-STAR, through a UWAA-rich response element immediately downstream of the regulated exon conserved since the radiation of bony vertebrates. The AS4 exons in the Nrxn1 and Nrxn3 genes were also associated with distinct patterns of conserved UWAA repeats. Consistent with an ancient mechanism of splicing control, human T-STAR protein was able to repress splicing inclusion of the zebrafish Nrxn3 AS4 exon. Although Neurexin1-3 and Stxbp5l encode critical synaptic proteins, T-STAR null mice had no detectable spatial memory deficits, despite an almost complete absence of AS4 splicing repression in the hippocampus. Our work identifies T-STAR as an ancient and potent tissue-specific splicing regulator that uses a concentration-dependent mechanism to co-ordinately regulate regional splicing patterns of the Neurexin1-3 AS4 exons in the mouse brain. PMID:23637638

A Systems-Level Analysis Reveals Circadian Regulation of Splicing in Colorectal Cancer.

PubMed

El-Athman, Rukeia; Fuhr, Luise; Relógio, Angela

2018-06-20

Accumulating evidence points to a significant role of the circadian clock in the regulation of splicing in various organisms, including mammals. Both dysregulated circadian rhythms and aberrant pre-mRNA splicing are frequently implicated in human disease, in particular in cancer. To investigate the role of the circadian clock in the regulation of splicing in a cancer progression context at the systems-level, we conducted a genome-wide analysis and compared the rhythmic transcriptional profiles of colon carcinoma cell lines SW480 and SW620, derived from primary and metastatic sites of the same patient, respectively. We identified spliceosome components and splicing factors with cell-specific circadian expression patterns including SRSF1, HNRNPLL, ESRP1, and RBM 8A, as well as altered alternative splicing events and circadian alternative splicing patterns of output genes (e.g., VEGFA, NCAM1, FGFR2, CD44) in our cellular model. Our data reveals a remarkable interplay between the circadian clock and pre-mRNA splicing with putative consequences in tumor progression and metastasis. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Alternative splicing of natriuretic peptide A and B receptor transcripts in the rat brain.

PubMed

Francoeur, F; Gossard, F; Hamet, P; Tremblay, J

1995-12-01

1. In the present study we searched for variants of alternative splicing of guanylyl cyclase A and B mRNA in rats in vivo. 2. Guanylyl cyclase A2 and guanylyl cyclase B2 isoforms of guanylyl cyclase produced by alternative splicing leading to the deletion of exon 9 of both transcripts were quantified in several rat organs. 3. Only one alternative splicing was found in the regulatory domain, encoded by exons 8-15. 4. Quantification of the guanylyl cyclase B2 isoform in different rat organs and in cultured aortic smooth muscle cells showed that this alternative splicing was tissue-specific and occurred predominantly in the central nervous system where the alternatively spliced variant represented more than 50% of the guanylyl cyclase B mRNA. 5. The same alternative splicing existed for guanylyl cyclase A mRNA but at very low levels in the organs studied. 6. Alternative splicing of guanylyl cyclase B exon 9 in the brain may play an important role in signal transduction, since the expressed protein possesses a constitutionally active guanylyl cyclase acting independently of C-type natriuretic peptide regulation.

U2AF1 mutations alter splice site recognition in hematological malignancies.

PubMed

Ilagan, Janine O; Ramakrishnan, Aravind; Hayes, Brian; Murphy, Michele E; Zebari, Ahmad S; Bradley, Philip; Bradley, Robert K

2015-01-01

Whole-exome sequencing studies have identified common mutations affecting genes encoding components of the RNA splicing machinery in hematological malignancies. Here, we sought to determine how mutations affecting the 3' splice site recognition factor U2AF1 alter its normal role in RNA splicing. We find that U2AF1 mutations influence the similarity of splicing programs in leukemias, but do not give rise to widespread splicing failure. U2AF1 mutations cause differential splicing of hundreds of genes, affecting biological pathways such as DNA methylation (DNMT3B), X chromosome inactivation (H2AFY), the DNA damage response (ATR, FANCA), and apoptosis (CASP8). We show that U2AF1 mutations alter the preferred 3' splice site motif in patients, in cell culture, and in vitro. Mutations affecting the first and second zinc fingers give rise to different alterations in splice site preference and largely distinct downstream splicing programs. These allele-specific effects are consistent with a computationally predicted model of U2AF1 in complex with RNA. Our findings suggest that U2AF1 mutations contribute to pathogenesis by causing quantitative changes in splicing that affect diverse cellular pathways, and give insight into the normal function of U2AF1's zinc finger domains. © 2015 Ilagan et al.; Published by Cold Spring Harbor Laboratory Press.

Genome-wide analysis of alternative splicing during dendritic cell response to a bacterial challenge.

PubMed

Rodrigues, Raquel; Grosso, Ana Rita; Moita, Luís

2013-01-01

The immune system relies on the plasticity of its components to produce appropriate responses to frequent environmental challenges. Dendritic cells (DCs) are critical initiators of innate immunity and orchestrate the later and more specific adaptive immunity. The generation of diversity in transcriptional programs is central for effective immune responses. Alternative splicing is widely considered a key generator of transcriptional and proteomic complexity, but its role has been rarely addressed systematically in immune cells. Here we used splicing-sensitive arrays to assess genome-wide gene- and exon-level expression profiles in human DCs in response to a bacterial challenge. We find widespread alternative splicing events and splicing factor transcriptional signatures induced by an E. coli challenge to human DCs. Alternative splicing acts in concert with transcriptional modulation, but these two mechanisms of gene regulation affect primarily distinct functional gene groups. Alternative splicing is likely to have an important role in DC immunobiology because it affects genes known to be involved in DC development, endocytosis, antigen presentation and cell cycle arrest.

Extensive alternative splicing transitions during postnatal skeletal muscle development are required for calcium handling functions

PubMed Central

Brinegar, Amy E; Xia, Zheng; Loehr, James Anthony; Li, Wei; Rodney, George Gerald

2017-01-01

Postnatal development of skeletal muscle is a highly dynamic period of tissue remodeling. Here, we used RNA-seq to identify transcriptome changes from late embryonic to adult mouse muscle and demonstrate that alternative splicing developmental transitions impact muscle physiology. The first 2 weeks after birth are particularly dynamic for differential gene expression and alternative splicing transitions, and calcium-handling functions are significantly enriched among genes that undergo alternative splicing. We focused on the postnatal splicing transitions of the three calcineurin A genes, calcium-dependent phosphatases that regulate multiple aspects of muscle biology. Redirected splicing of calcineurin A to the fetal isoforms in adult muscle and in differentiated C2C12 slows the timing of muscle relaxation, promotes nuclear localization of calcineurin target Nfatc3, and/or affects expression of Nfatc transcription targets. The results demonstrate a previously unknown specificity of calcineurin isoforms as well as the broader impact of alternative splicing during muscle postnatal development. PMID:28826478

Role and convergent evolution of competing RNA secondary structures in mutually exclusive splicing

PubMed Central

Yue, Yuan; Hou, Shouqing; Wang, Xiu; Zhan, Leilei; Cao, Guozheng; Li, Guoli; Shi, Yang; Zhang, Peng; Hong, Weiling; Lin, Hao; Liu, Baoping; Shi, Feng; Yang, Yun; Jin, Yongfeng

2017-01-01

ABSTRACT Exon or cassette duplication is an important means of expanding protein and functional diversity through mutually exclusive splicing. However, the mechanistic basis of this process in non-arthropod species remains poorly understood. Here, we demonstrate that MRP1 genes underwent tandem exon duplication in Nematoda, Platyhelminthes, Annelida, Mollusca, Arthropoda, Echinodermata, and early-diverging Chordata but not in late-diverging vertebrates. Interestingly, these events were of independent origin in different phyla, suggesting convergent evolution of alternative splicing. Furthermore, we showed that multiple sets of clade-conserved RNA pairings evolved to guide species-specific mutually exclusive splicing in Arthropoda. Importantly, we also identified a similar structural code in MRP exon clusters of the annelid, Capitella teleta, and chordate, Branchiostoma belcheri, suggesting an evolutionarily conserved competing pairing-guided mechanism in bilaterians. Taken together, these data reveal the molecular determinants and RNA pairing-guided evolution of species-specific mutually exclusive splicing spanning more than 600 million years of bilaterian evolution. These findings have a significant impact on our understanding of the evolution of and mechanism underpinning isoform diversity and complex gene structure. PMID:28277933

Role and convergent evolution of competing RNA secondary structures in mutually exclusive splicing.

PubMed

Yue, Yuan; Hou, Shouqing; Wang, Xiu; Zhan, Leilei; Cao, Guozheng; Li, Guoli; Shi, Yang; Zhang, Peng; Hong, Weiling; Lin, Hao; Liu, Baoping; Shi, Feng; Yang, Yun; Jin, Yongfeng

2017-10-03

Exon or cassette duplication is an important means of expanding protein and functional diversity through mutually exclusive splicing. However, the mechanistic basis of this process in non-arthropod species remains poorly understood. Here, we demonstrate that MRP1 genes underwent tandem exon duplication in Nematoda, Platyhelminthes, Annelida, Mollusca, Arthropoda, Echinodermata, and early-diverging Chordata but not in late-diverging vertebrates. Interestingly, these events were of independent origin in different phyla, suggesting convergent evolution of alternative splicing. Furthermore, we showed that multiple sets of clade-conserved RNA pairings evolved to guide species-specific mutually exclusive splicing in Arthropoda. Importantly, we also identified a similar structural code in MRP exon clusters of the annelid, Capitella teleta, and chordate, Branchiostoma belcheri, suggesting an evolutionarily conserved competing pairing-guided mechanism in bilaterians. Taken together, these data reveal the molecular determinants and RNA pairing-guided evolution of species-specific mutually exclusive splicing spanning more than 600 million years of bilaterian evolution. These findings have a significant impact on our understanding of the evolution of and mechanism underpinning isoform diversity and complex gene structure.

Sequential recognition of the pre-mRNA branch point by U2AF65 and a novel spliceosome-associated 28-kDa protein.

PubMed Central

Gaur, R K; Valcárcel, J; Green, M R

1995-01-01

Splicing of pre-mRNAs occurs via a lariat intermediate in which an intronic adenosine, embedded within a branch point sequence, forms a 2',5'-phosphodiester bond (RNA branch) with the 5' end of the intron. How the branch point is recognized and activated remains largely unknown. Using site-specific photochemical cross-linking, we have identified two proteins that specifically interact with the branch point during the splicing reaction. U2AF65, an essential splicing factor that binds to the adjacent polypyrimidine tract, crosslinks to the branch point at the earliest stage of spliceosome formation in an ATP-independent manner. A novel 28-kDa protein, which is a constituent of the mature spliceosome, contacts the branch point after the first catalytic step. Our results indicate that the branch point is sequentially recognized by distinct splicing factors in the course of the splicing reaction. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 PMID:7493318

A genome-wide aberrant RNA splicing in patients with acute myeloid leukemia identifies novel potential disease markers and therapeutic targets.

PubMed

Adamia, Sophia; Haibe-Kains, Benjamin; Pilarski, Patrick M; Bar-Natan, Michal; Pevzner, Samuel; Avet-Loiseau, Herve; Lode, Laurence; Verselis, Sigitas; Fox, Edward A; Burke, John; Galinsky, Ilene; Dagogo-Jack, Ibiayi; Wadleigh, Martha; Steensma, David P; Motyckova, Gabriela; Deangelo, Daniel J; Quackenbush, John; Stone, Richard; Griffin, James D

2014-03-01

Despite new treatments, acute myeloid leukemia (AML) remains an incurable disease. More effective drug design requires an expanded view of the molecular complexity that underlies AML. Alternative splicing of RNA is used by normal cells to generate protein diversity. Growing evidence indicates that aberrant splicing of genes plays a key role in cancer. We investigated genome-wide splicing abnormalities in AML and based on these abnormalities, we aimed to identify novel potential biomarkers and therapeutic targets. We used genome-wide alternative splicing screening to investigate alternative splicing abnormalities in two independent AML patient cohorts [Dana-Farber Cancer Institute (DFCI) (Boston, MA) and University Hospital de Nantes (UHN) (Nantes, France)] and normal donors. Selected splicing events were confirmed through cloning and sequencing analysis, and than validated in 193 patients with AML. Our results show that approximately 29% of expressed genes genome-wide were differentially and recurrently spliced in patients with AML compared with normal donors bone marrow CD34(+) cells. Results were reproducible in two independent AML cohorts. In both cohorts, annotation analyses indicated similar proportions of differentially spliced genes encoding several oncogenes, tumor suppressor proteins, splicing factors, and heterogeneous-nuclear-ribonucleoproteins, proteins involved in apoptosis, cell proliferation, and spliceosome assembly. Our findings are consistent with reports for other malignances and indicate that AML-specific aberrations in splicing mechanisms are a hallmark of AML pathogenesis. Overall, our results suggest that aberrant splicing is a common characteristic for AML. Our findings also suggest that splice variant transcripts that are the result of splicing aberrations create novel disease markers and provide potential targets for small molecules or antibody therapeutics for this disease. ©2013 AACR

Insertion of part of an intron into the 5[prime] untranslated region of a Caenorhabditis elegans gene converts it into a trans-spliced gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Conrad, R.; Thomas, J.; Spieth, J.

In nematodes, the RNA products of some genes are trans-spliced to a 22-nucleotide spliced leader (SL), while the RNA products of other genes are not. In Caenorhabditis elegans, there are two SLs, Sl1 and SL2, donated by two distinct small nuclear ribonucleoprotein particles in a process functionally quite similar to nuclear intron removal. The authors demonstrate here that it is possible to convert a non-trans-spliced gene into a trans-spliced gene by placement of an intron missing only the 5[prime] splice site into the 5[prime] untranslated region. Stable transgenic strains were isolated expressing a gene in which 69 nucleotides of amore » vit-5 intron, including the 3[prime] splice site, were inserted into the 5[prime] untranslated region of a vit-2/vit-6 fusion gene. The RNA product of this gene was examined by primer extension and PCR amplification. Although the vit-2/vit-6 transgene product is not normally trans-spliced, the majority of transcripts from this altered gene were trans-spliced to SL1. They termed the region of a trans-spliced mRNA precursor between the 5[prime] end and the first 3[prime] splice site an 'outrun'. The results suggest that if a transcript begins with intronlike sequence followed by a 3[prime] splice site, this alone may constitute an outrun and be sufficient to demarcate a transcript as a trans-splice acceptor. These findings leave open the possibility that specific sequences are required to increase the efficiency of trans-splicing.« less

Intron-mediated alternative splicing of WOOD-ASSOCIATED NAC TRANSCRIPTION FACTOR1B regulates cell wall thickening during fiber development in Populus species.

PubMed

Zhao, Yunjun; Sun, Jiayan; Xu, Peng; Zhang, Rui; Li, Laigeng

2014-02-01

Alternative splicing is an important mechanism involved in regulating the development of multicellular organisms. Although many genes in plants undergo alternative splicing, little is understood of its significance in regulating plant growth and development. In this study, alternative splicing of black cottonwood (Populus trichocarpa) wood-associated NAC domain transcription factor (PtrWNDs), PtrWND1B, is shown to occur exclusively in secondary xylem fiber cells. PtrWND1B is expressed with a normal short-transcript PtrWND1B-s as well as its alternative long-transcript PtrWND1B-l. The intron 2 structure of the PtrWND1B gene was identified as a critical sequence that causes PtrWND1B alternative splicing. Suppression of PtrWND1B expression specifically inhibited fiber cell wall thickening. The two PtrWND1B isoforms play antagonistic roles in regulating cell wall thickening during fiber cell differentiation in Populus spp. PtrWND1B-s overexpression enhanced fiber cell wall thickening, while overexpression of PtrWND1B-l repressed fiber cell wall thickening. Alternative splicing may enable more specific regulation of processes such as fiber cell wall thickening during wood formation.

Intron-Mediated Alternative Splicing of WOOD-ASSOCIATED NAC TRANSCRIPTION FACTOR1B Regulates Cell Wall Thickening during Fiber Development in Populus Species1[W

PubMed Central

Zhao, Yunjun; Sun, Jiayan; Xu, Peng; Zhang, Rui; Li, Laigeng

2014-01-01

Alternative splicing is an important mechanism involved in regulating the development of multicellular organisms. Although many genes in plants undergo alternative splicing, little is understood of its significance in regulating plant growth and development. In this study, alternative splicing of black cottonwood (Populus trichocarpa) wood-associated NAC domain transcription factor (PtrWNDs), PtrWND1B, is shown to occur exclusively in secondary xylem fiber cells. PtrWND1B is expressed with a normal short-transcript PtrWND1B-s as well as its alternative long-transcript PtrWND1B-l. The intron 2 structure of the PtrWND1B gene was identified as a critical sequence that causes PtrWND1B alternative splicing. Suppression of PtrWND1B expression specifically inhibited fiber cell wall thickening. The two PtrWND1B isoforms play antagonistic roles in regulating cell wall thickening during fiber cell differentiation in Populus spp. PtrWND1B-s overexpression enhanced fiber cell wall thickening, while overexpression of PtrWND1B-l repressed fiber cell wall thickening. Alternative splicing may enable more specific regulation of processes such as fiber cell wall thickening during wood formation. PMID:24394777

Effects of airborne particulate matter on alternative pre-mRNA splicing in colon cancer cells.

PubMed

Buggiano, Valeria; Petrillo, Ezequiel; Alló, Mariano; Lafaille, Celina; Redal, María Ana; Alghamdi, Mansour A; Khoder, Mamdouh I; Shamy, Magdy; Muñoz, Manuel J; Kornblihtt, Alberto R

2015-07-01

Alternative pre-mRNA splicing plays key roles in determining tissue- and species-specific cell differentiation as well as in the onset of hereditary disease and cancer, being controlled by multiple post- and co-transcriptional regulatory mechanisms. We report here that airborne particulate matter, resulting from industrial pollution, inhibits expression and specifically affects alternative splicing at the 5' untranslated region of the mRNA encoding the bone morphogenetic protein BMP4 in human colon cells in culture. These effects are consistent with a previously reported role for BMP4 in preventing colon cancer development, suggesting that ingestion of particulate matter could contribute to the onset of colon cell proliferation. We also show that the underlying mechanism might involve changes in transcriptional elongation. This is the first study to demonstrate that particulate matter causes non-pleiotropic changes in alternative splicing. Copyright © 2015 Elsevier Inc. All rights reserved.

Implementing a rational and consistent nomenclature for serine/arginine-rich protein splicing factors (SR proteins) in plants.

PubMed

Barta, Andrea; Kalyna, Maria; Reddy, Anireddy S N

2010-09-01

Growing interest in alternative splicing in plants and the extensive sequencing of new plant genomes necessitate more precise definition and classification of genes coding for splicing factors. SR proteins are a family of RNA binding proteins, which function as essential factors for constitutive and alternative splicing. We propose a unified nomenclature for plant SR proteins, taking into account the newly revised nomenclature of the mammalian SR proteins and a number of plant-specific properties of the plant proteins. We identify six subfamilies of SR proteins in Arabidopsis thaliana and rice (Oryza sativa), three of which are plant specific. The proposed subdivision of plant SR proteins into different subfamilies will allow grouping of paralogous proteins and simple assignment of newly discovered SR orthologs from other plant species and will promote functional comparisons in diverse plant species.

Performance enhancing water skipping: successive free surface impacts of elastic spheres

NASA Astrophysics Data System (ADS)

Hurd, Randy; Truscott, Tadd; Belden, Jesse

2014-11-01

From naval gunners skipping cannonballs to children skipping stones, physicists have long been enamored with the repeated ricochet of objects on the water surface. Elastic spheres, such as the toy Waboba ball, make water skipping more accessible to the masses by expanding the range of impact parameters over which objects can be skipped. For example, it is not difficult to achieve more than twenty skips with such spheres, where skipping a stone twenty times is very difficult. In this talk we discuss the dynamics of water skipping elastic spheres over several successive skips. High-speed video captured using a unique experimental setup reveals how dynamics change with each skip as a result of lost kinetic energy. We place these observations in the context of previous work on single oblique impacts to identify material vibration modes that are excited during ricochet. The material modes excited with each successive impact are seen to decay from high-energy modes to low energy modes until water entry finally occurs. A model for estimating skipping outcome from initial conditions is proposed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Masatoshi, E-mail: msuzuki@nagasaki-u.ac.jp; Yamauchi, Motohiro; Oka, Yasuyoshi

Purpose: Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Methods and Materials: Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Results: Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% andmore » 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO{sub 2}-hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ss-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. Conclusions: The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation.« less

Skipping of Chinese characters does not rely on word-based processing.

PubMed

Lin, Nan; Angele, Bernhard; Hua, Huimin; Shen, Wei; Zhou, Junyi; Li, Xingshan

2018-02-01

Previous eye-movement studies have indicated that people tend to skip extremely high-frequency words in sentence reading, such as "the" in English and "/de" in Chinese. Two alternative hypotheses have been proposed to explain how this frequent skipping happens in Chinese reading: one assumes that skipping happens when the preview has been fully identified at the word level (word-based skipping); the other assumes that skipping happens whenever the preview character is easy to identify regardless of whether lexical processing has been completed or not (character-based skipping). Using the gaze-contingent display change paradigm, we examined the two hypotheses by substituting the preview of the third character of a four-character Chinese word with the high-frequency Chinese character "/de", which should disrupt the ongoing word-level processing. The character-based skipping hypothesis predicts that this manipulation will enhance the skipping probability of the target character (i.e., the third character of the target word), because the character "/de" has much higher character frequency than the original character. The word-based skipping hypothesis instead predicts a reduction of the skipping probability of the target character because the presence of the character "/de" is lexically infelicitous at word level. The results supported the character-based skipping hypothesis, indicating that in Chinese reading the decision of skipping a character can be made before integrating it into a word.

Co-expression networks reveal the tissue-specific regulation of transcription and splicing.

PubMed

Saha, Ashis; Kim, Yungil; Gewirtz, Ariel D H; Jo, Brian; Gao, Chuan; McDowell, Ian C; Engelhardt, Barbara E; Battle, Alexis

2017-11-01

Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the regulation of splicing and transcription. We built TWNs for 16 tissues and found that hubs in these networks were strongly enriched for splicing and RNA binding genes, demonstrating their utility in unraveling regulation of splicing in the human transcriptome. Next, we used a Bayesian biclustering model that identifies network edges unique to a single tissue to reconstruct Tissue-Specific Networks (TSNs) for 26 distinct tissues and 10 groups of related tissues. Finally, we found genetic variants associated with pairs of adjacent nodes in our networks, supporting the estimated network structures and identifying 20 genetic variants with distant regulatory impact on transcription and splicing. Our networks provide an improved understanding of the complex relationships of the human transcriptome across tissues. © 2017 Saha et al.; Published by Cold Spring Harbor Laboratory Press.

How do messenger RNA splicing alterations drive myelodysplasia?

PubMed Central

2017-01-01

Mutations in RNA splicing factors are the single most common class of genetic alterations in myelodysplastic syndrome (MDS) patients. Although much has been learned about how these mutations affect splicing at a global- and transcript-specific level, critical questions about the role of these mutations in MDS development and maintenance remain. Here we present the questions to be addressed in order to understand the unique enrichment of these mutations in MDS. PMID:28348147

Transcriptome Meta-Analysis of Lung Cancer Reveals Recurrent Aberrations in NRG1 and Hippo Pathway Genes

PubMed Central

Dhanasekaran, Saravana M.; Balbin, O. Alejandro; Chen, Guoan; Nadal, Ernest; Kalyana-Sundaram, Shanker; Pan, Jincheng; Veeneman, Brendan; Cao, Xuhong; Malik, Rohit; Vats, Pankaj; Wang, Rui; Huang, Stephanie; Zhong, Jinjie; Jing, Xiaojun; Iyer, Matthew; Wu, Yi-Mi; Harms, Paul W.; Lin, Jules; Reddy, Rishindra; Brennan, Christine; Palanisamy, Nallasivam; Chang, Andrew C.; Truini, Anna; Truini, Mauro; Robinson, Dan R.; Beer, David G.; Chinnaiyan, Arul M.

2014-01-01

Lung cancer is emerging as a paradigm for disease molecular subtyping, facilitating targeted therapy based on driving somatic alterations. Here, we perform transcriptome analysis of 153 samples representing lung adenocarcinomas, squamous cell carcinomas, large cell lung cancer, adenoid cystic carcinomas and cell lines. By integrating our data with The Cancer Genome Atlas and published sources, we analyze 753 lung cancer samples for gene fusions and other transcriptomic alterations. We show that higher numbers of gene fusions is an independent prognostic factor for poor survival in lung cancer. Our analysis confirms the recently reported CD74-NRG1 fusion and suggests that NRG1, NF1 and Hippo pathway fusions may play important roles in tumors without known driver mutations. In addition, we observe exon skipping events in c-MET, which are attributable to splice site mutations. These classes of genetic aberrations may play a significant role in the genesis of lung cancers lacking known driver mutations. PMID:25531467

Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

PubMed

Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

2002-06-01

Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

Brooke-Spiegler syndrome presenting multiple concurrent cutaneous and parotid gland neoplasms: cytologic findings on fine-needle sample and description of a novel mutation of the CYLD gene.

PubMed

Malzone, Maria Gabriella; Campanile, Anna Cipolletta; Losito, Nunzia Simona; Longo, Francesco; Perri, Francesco; Caponigro, Francesco; Schiavone, Concetta; Ionna, Franco; Maiello, Francesco; Martinuzzi, Claudia; Nasti, Sabina; Botti, Gerardo; Fulciniti, Franco

2015-08-01

Multiple dermal cylindromas and membranous basal cell adenoma of parotid gland in a 67-year-old woman with Brooke-Spiegler syndrome (BSS) were examined by fine-needle cytology. Histology, immunochemistry, and CYLD germline mutation testing were also performed. Cytomorphology and immunochemistry of the two lesions showed basaloid neoplasms, remarkably similar, composed by proliferating epithelial cells of basal type accompanied by a smaller proportion of myoepithelial cells. CYLD gene showed a novel germline splice acceptor site mutation (c.2042-1G>C) with skipping of the entire exon 15. The occurrence of analogous tumors, dermal cylindromas, and membranous basal cell adenoma of the parotid gland, in the same patient may result from the action of a single gene on ontogenetically similar stem cells. Therefore, patients with BSS should be offered a genetic counselling for an early and correct diagnosis. © 2015 Wiley Periodicals, Inc.

Integrative genome-wide analysis of the determinants of RNA splicing in kidney renal clear cell carcinoma.

PubMed

Lehmann, Kjong-Van; Kahles, André; Kandoth, Cyriac; Lee, William; Schultz, Nikolaus; Stegle, Oliver; Rätsch, Gunnar

2015-01-01

We present a genome-wide analysis of splicing patterns of 282 kidney renal clear cell carcinoma patients in which we integrate data from whole-exome sequencing of tumor and normal samples, RNA-seq and copy number variation. We proposed a scoring mechanism to compare splicing patterns in tumor samples to normal samples in order to rank and detect tumor-specific isoforms that have a potential for new biomarkers. We identified a subset of genes that show introns only observable in tumor but not in normal samples, ENCODE and GEUVADIS samples. In order to improve our understanding of the underlying genetic mechanisms of splicing variation we performed a large-scale association analysis to find links between somatic or germline variants with alternative splicing events. We identified 915 cis- and trans-splicing quantitative trait loci (sQTL) associated with changes in splicing patterns. Some of these sQTL have previously been associated with being susceptibility loci for cancer and other diseases. Our analysis also allowed us to identify the function of several COSMIC variants showing significant association with changes in alternative splicing. This demonstrates the potential significance of variants affecting alternative splicing events and yields insights into the mechanisms related to an array of disease phenotypes.

The chromatin remodeling complex Swi/Snf regulates splicing of meiotic transcripts in Saccharomyces cerevisiae

PubMed Central

Douglass, Stephen; Galivanche, Anoop R.

2017-01-01

Abstract Despite its relatively streamlined genome, there are important examples of regulated RNA splicing in Saccharomyces cerevisiae, such as splicing of meiotic transcripts. Like other eukaryotes, S. cerevisiae undergoes a dramatic reprogramming of gene expression during meiosis, including regulated splicing of a number of crucial meiosis-specific RNAs. Splicing of a subset of these is dependent upon the splicing activator Mer1. Here we show a crucial role for the chromatin remodeler Swi/Snf in regulation of splicing of meiotic genes and find that the complex affects meiotic splicing in two ways. First, we show that Swi/Snf regulates nutrient-dependent downregulation of ribosomal protein encoding RNAs, leading to the redistribution of spliceosomes from this abundant class of intron-containing RNAs (the ribosomal protein genes) to Mer1-regulated transcripts. We also demonstrate that Mer1 expression is dependent on Snf2, its acetylation state and histone H3 lysine 9 acetylation at the MER1 locus. Hence, Snf2 exerts systems level control of meiotic gene expression through two temporally distinct mechanisms, demonstrating that it is a key regulator of meiotic splicing in S. cerevisiae. We also reveal an evolutionarily conserved mechanism whereby the cell redirects its energy from maintaining its translational capacity to the process of meiosis. PMID:28637241

An EMT–Driven Alternative Splicing Program Occurs in Human Breast Cancer and Modulates Cellular Phenotype

PubMed Central

Flytzanis, Nicholas C.; Balsamo, Michele; Condeelis, John S.; Oktay, Maja H.; Burge, Christopher B.; Gertler, Frank B.

2011-01-01

Epithelial-mesenchymal transition (EMT), a mechanism important for embryonic development, plays a critical role during malignant transformation. While much is known about transcriptional regulation of EMT, alternative splicing of several genes has also been correlated with EMT progression, but the extent of splicing changes and their contributions to the morphological conversion accompanying EMT have not been investigated comprehensively. Using an established cell culture model and RNA–Seq analyses, we determined an alternative splicing signature for EMT. Genes encoding key drivers of EMT–dependent changes in cell phenotype, such as actin cytoskeleton remodeling, regulation of cell–cell junction formation, and regulation of cell migration, were enriched among EMT–associated alternatively splicing events. Our analysis suggested that most EMT–associated alternative splicing events are regulated by one or more members of the RBFOX, MBNL, CELF, hnRNP, or ESRP classes of splicing factors. The EMT alternative splicing signature was confirmed in human breast cancer cell lines, which could be classified into basal and luminal subtypes based exclusively on their EMT–associated splicing pattern. Expression of EMT–associated alternative mRNA transcripts was also observed in primary breast cancer samples, indicating that EMT–dependent splicing changes occur commonly in human tumors. The functional significance of EMT–associated alternative splicing was tested by expression of the epithelial-specific splicing factor ESRP1 or by depletion of RBFOX2 in mesenchymal cells, both of which elicited significant changes in cell morphology and motility towards an epithelial phenotype, suggesting that splicing regulation alone can drive critical aspects of EMT–associated phenotypic changes. The molecular description obtained here may aid in the development of new diagnostic and prognostic markers for analysis of breast cancer progression. PMID:21876675

RBFox1-mediated RNA splicing regulates cardiac hypertrophy and heart failure.

PubMed

Gao, Chen; Ren, Shuxun; Lee, Jae-Hyung; Qiu, Jinsong; Chapski, Douglas J; Rau, Christoph D; Zhou, Yu; Abdellatif, Maha; Nakano, Astushi; Vondriska, Thomas M; Xiao, Xinshu; Fu, Xiang-Dong; Chen, Jau-Nian; Wang, Yibin

2016-01-01

RNA splicing is a major contributor to total transcriptome complexity; however, the functional role and regulation of splicing in heart failure remain poorly understood. Here, we used a total transcriptome profiling and bioinformatic analysis approach and identified a muscle-specific isoform of an RNA splicing regulator, RBFox1 (also known as A2BP1), as a prominent regulator of alternative RNA splicing during heart failure. Evaluation of developing murine and zebrafish hearts revealed that RBFox1 is induced during postnatal cardiac maturation. However, we found that RBFox1 is markedly diminished in failing human and mouse hearts. In a mouse model, RBFox1 deficiency in the heart promoted pressure overload-induced heart failure. We determined that RBFox1 is a potent regulator of RNA splicing and is required for a conserved splicing process of transcription factor MEF2 family members that yields different MEF2 isoforms with differential effects on cardiac hypertrophic gene expression. Finally, induction of RBFox1 expression in murine pressure overload models substantially attenuated cardiac hypertrophy and pathological manifestations. Together, this study identifies regulation of RNA splicing by RBFox1 as an important player in transcriptome reprogramming during heart failure that influence pathogenesis of the disease.

Spatio-temporal regulations and functions of neuronal alternative RNA splicing in developing and adult brains.

PubMed

Iijima, Takatoshi; Hidaka, Chiharu; Iijima, Yoko

2016-08-01

Alternative pre-mRNA splicing is a fundamental mechanism that generates molecular diversity from a single gene. In the central nervous system (CNS), key neural developmental steps are thought to be controlled by alternative splicing decisions, including the molecular diversity underlying synaptic wiring, plasticity, and remodeling. Significant progress has been made in understanding the molecular mechanisms and functions of alternative pre-mRNA splicing in neurons through studies in invertebrate systems; however, recent studies have begun to uncover the potential role of neuronal alternative splicing in the mammalian CNS. This article provides an overview of recent findings regarding the regulation and function of neuronal alternative splicing. In particular, we focus on the spatio-temporal regulation of neurexin, a synaptic adhesion molecule, by neuronal cell type-specific factors and neuronal activity, which are thought to be especially important for characterizing neural development and function within the mammalian CNS. Notably, there is increasing evidence that implicates the dysregulation of neuronal splicing events in several neurological disorders. Therefore, understanding the detailed mechanisms of neuronal alternative splicing in the mammalian CNS may provide plausible treatment strategies for these diseases. Copyright © 2016 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.

RBFox1-mediated RNA splicing regulates cardiac hypertrophy and heart failure

PubMed Central

Gao, Chen; Ren, Shuxun; Lee, Jae-Hyung; Qiu, Jinsong; Chapski, Douglas J.; Rau, Christoph D.; Zhou, Yu; Abdellatif, Maha; Nakano, Astushi; Vondriska, Thomas M.; Xiao, Xinshu; Fu, Xiang-Dong; Chen, Jau-Nian; Wang, Yibin

2015-01-01

RNA splicing is a major contributor to total transcriptome complexity; however, the functional role and regulation of splicing in heart failure remain poorly understood. Here, we used a total transcriptome profiling and bioinformatic analysis approach and identified a muscle-specific isoform of an RNA splicing regulator, RBFox1 (also known as A2BP1), as a prominent regulator of alternative RNA splicing during heart failure. Evaluation of developing murine and zebrafish hearts revealed that RBFox1 is induced during postnatal cardiac maturation. However, we found that RBFox1 is markedly diminished in failing human and mouse hearts. In a mouse model, RBFox1 deficiency in the heart promoted pressure overload–induced heart failure. We determined that RBFox1 is a potent regulator of RNA splicing and is required for a conserved splicing process of transcription factor MEF2 family members that yields different MEF2 isoforms with differential effects on cardiac hypertrophic gene expression. Finally, induction of RBFox1 expression in murine pressure overload models substantially attenuated cardiac hypertrophy and pathological manifestations. Together, this study identifies regulation of RNA splicing by RBFox1 as an important player in transcriptome reprogramming during heart failure that influence pathogenesis of the disease. PMID:26619120

RBFOX and PTBP1 proteins regulate the alternative splicing of micro-exons in human brain transcripts

PubMed Central

Sanchez-Pulido, Luis; Haerty, Wilfried

2015-01-01

Ninety-four percent of mammalian protein-coding exons exceed 51 nucleotides (nt) in length. The paucity of micro-exons (≤ 51 nt) suggests that their recognition and correct processing by the splicing machinery present greater challenges than for longer exons. Yet, because thousands of human genes harbor processed micro-exons, specialized mechanisms may be in place to promote their splicing. Here, we survey deep genomic data sets to define 13,085 micro-exons and to study their splicing mechanisms and molecular functions. More than 60% of annotated human micro-exons exhibit a high level of sequence conservation, an indicator of functionality. While most human micro-exons require splicing-enhancing genomic features to be processed, the splicing of hundreds of micro-exons is enhanced by the adjacent binding of splice factors in the introns of pre-messenger RNAs. Notably, splicing of a significant number of micro-exons was found to be facilitated by the binding of RBFOX proteins, which promote their inclusion in the brain, muscle, and heart. Our analyses suggest that accurate regulation of micro-exon inclusion by RBFOX proteins and PTBP1 plays an important role in the maintenance of tissue-specific protein–protein interactions. PMID:25524026

The combinatorial control of alternative splicing in C. elegans

PubMed Central

2017-01-01

Normal development requires the right splice variants to be made in the right tissues at the right time. The core splicing machinery is engaged in all splicing events, but which precise splice variant is made requires the choice between alternative splice sites—for this to occur, a set of splicing factors (SFs) must recognize and bind to short RNA motifs in the pre-mRNA. In C. elegans, there is known to be extensive variation in splicing patterns across development, but little is known about the targets of each SF or how multiple SFs combine to regulate splicing. Here we combine RNA-seq with in vitro binding assays to study how 4 different C. elegans SFs, ASD-1, FOX-1, MEC-8, and EXC-7, regulate splicing. The 4 SFs chosen all have well-characterised biology and well-studied loss-of-function genetic alleles, and all contain RRM domains. Intriguingly, while the SFs we examined have varied roles in C. elegans development, they show an unexpectedly high overlap in their targets. We also find that binding sites for these SFs occur on the same pre-mRNAs more frequently than expected suggesting extensive combinatorial control of splicing. We confirm that regulation of splicing by multiple SFs is often combinatorial and show that this is functionally significant. We also find that SFs appear to combine to affect splicing in two modes—they either bind in close proximity within the same intron or they appear to bind to separate regions of the intron in a conserved order. Finally, we find that the genes whose splicing are regulated by multiple SFs are highly enriched for genes involved in the cytoskeleton and in ion channels that are key for neurotransmission. Together, this shows that specific classes of genes have complex combinatorial regulation of splicing and that this combinatorial regulation is critical for normal development to occur. PMID:29121637

Intron retention and transcript chimerism conserved across mammals: Ly6g5b and Csnk2b-Ly6g5b as examples

PubMed Central

2013-01-01

Background Alternative splicing (AS) is a major mechanism for modulating gene expression of an organism, allowing the synthesis of several structurally and functionally distinct mRNAs and protein isoforms from a unique gene. Related to AS is the Transcription Induced Chimerism (TIC) or Tandem Chimerism, by which chimeric RNAs between adjacent genes can be found, increasing combinatorial complexity of the proteome. The Ly6g5b gene presents particular behaviours in its expression, involving an intron retention event and being capable to form RNA chimera transcripts with the upstream gene Csnk2b. We wanted to characterise these events more deeply in four tissues in six different mammals and analyse their protein products. Results While canonical Csnk2b isoform was widely expressed, Ly6g5b canonical isoform was less ubiquitous, although the Ly6g5b first intron retained transcript was present in all the tissues and species analysed. Csnk2b-Ly6g5b chimeras were present in all the samples analysed, but with restricted expression patterns. Some of these chimeric transcripts maintained correct structural domains from Csnk2b and Ly6g5b. Moreover, we found Csnk2b, Ly6g5b, and Csnk2b-Ly6g5b transcripts that present exon skipping, alternative 5' and 3' splice site and intron retention events. These would generate truncated or aberrant proteins whose role remains unknown. Some chimeric transcripts would encode CSNK2B proteins with an altered C-terminus, which could affect its biological function broadening its substrate specificity. Over-expression of human CSNK2B, LY6G5B, and CSNK2B-LY6G5B proteins, show different patterns of post-translational modifications and cell distribution. Conclusions Ly6g5b intron retention and Csnk2b-Ly6g5b transcript chimerism are broadly distributed in tissues of different mammals. PMID:23521802

Evaluation of genetic and metabolic role of SKIP11 in Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Hassan, Muhammad Naeem ul; Ismail, Ismanizan

2015-09-01

Most of the regulatory proteins are degraded by 26S proteasome complex, only when they are tagged by Ubiquitin. A complex of four proteins, SKP1-Cullin-Ring box-F box (SCF) catalyses the final step to link the Ubiquitin tag with the target proteins. SCF complex interacts with the target proteins through F-box proteins, which confer the overall substrate specificity to the complex. F-box proteins, one of the largest family of proteins in plants have an N-terminal F-box domain and variable C-terminal domains, like leucine-rich repeat, WD-40 repeat and the kelch-repeat domains. In this study, we analysed the role of SKIP11, a kelch containing F-box protein (KFB) from Arabidopsis thaliana, by using reverse genetics strategy. The results show that SKIP11 is involved in the down-regulation of oxylipin pathway, possibly through the degradation of enzymes or/ and the regulatory factors of the pathway.

Splicing of goose parvovirus pre-mRNA influences cytoplasmic translation of the processed mRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Long; Pintel, David J., E-mail: pinteld@missouri.edu

2012-04-25

Translation of goose parvovirus (GPV) 72 kDa Rep 1 is initiated from unspliced P9-generated mRNAs in ORF1 from the first in-frame AUG (537 AUG); however, this AUG is bypassed in spliced P9-generated RNA: translation of the 52 kDa Rep 2 protein from spliced RNA is initiated in ORF2 at the next AUG downstream (650 AUG). Usage of the 537 AUG was restored in spliced RNA when the GPV intron was replaced with a chimeric SV40 intron, or following specific mutations of the GPV intron which did not appear in the final spliced mRNA. Additionally, 650 AUG usage was gained inmore » unspliced RNA when the GPV intron splice sites were debilitated. Splicing-dependent regulation of translation initiation was mediated in cis by GPV RNA surrounding the target AUGs. Thus, nuclear RNA processing of GPV P9-generated pre-mRNAs has a complex, but significant, effect on alternative translation initiation of the GPV Rep proteins.« less

Sex determination in beetles: Production of all male progeny by Parental RNAi knockdown of transformer

PubMed Central

Shukla, Jayendra Nath; Palli, Subba Reddy

2012-01-01

Sex in insects is determined by a cascade of regulators ultimately controlling sex-specific splicing of a transcription factor, Doublesex (Dsx). We recently identified homolog of dsx in the red flour beetle, Tribolium castaneum (Tcdsx). Here, we report on the identification and characterization of a regulator of Tcdsx splicing in T. castaneum. Two male-specific and one female-specific isoforms of T. castaneum transformer (Tctra) were identified. RNA interference-aided knockdown of Tctra in pupa or adults caused a change in sex from females to males by diverting the splicing of Tcdsx pre-mRNA to male-specific isoform. All the pupa and adults developed from Tctra dsRNA injected final instar larvae showed male-specific sexually dimorphic structures. Tctra parental RNAi caused an elimination of females from the progeny resulting in production of all male progeny. Transformer parental RNAi could be used to produce all male population for use in pest control though sterile male release methods. PMID:22924109

Water Bouncing Balls: how material stiffness affects water entry

NASA Astrophysics Data System (ADS)

Truscott, Tadd

2014-03-01

It is well known that one can skip a stone across the water surface, but less well known that a ball can also be skipped on water. Even though 17th century ship gunners were aware that cannonballs could be skipped on the water surface, they did not know that using elastic spheres rather than rigid ones could greatly improve skipping performance (yet would have made for more peaceful volleys). The water bouncing ball (Waboba®) is an elastic ball used in a game of aquatic keep away in which players pass the ball by skipping it along the water surface. The ball skips easily along the surface creating a sense that breaking the world record for number of skips could easily be achieved (51 rock skips Russell Byers 2007). We investigate the physics of skipping elastic balls to elucidate the mechanisms by which they bounce off of the water. High-speed video reveals that, upon impact with the water, the balls create a cavity and deform significantly due to the extreme elasticity; the flattened spheres resemble skipping stones. With an increased wetted surface area, a large hydrodynamic lift force is generated causing the ball to launch back into the air. Unlike stone skipping, the elasticity of the ball plays an important roll in determining the success of the skip. Through experimentation, we demonstrate that the deformation timescale during impact must be longer than the collision time in order to achieve a successful skip. Further, several material deformation modes can be excited upon free surface impact. The effect of impact velocity and angle on the two governing timescales and material wave modes are also experimentally investigated. Scaling for the deformation and collision times are derived and used to establish criteria for skipping in terms of relevant physical parameters.

Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population.

PubMed

Kutsuma, Ayano; Nakajima, Kei; Suwa, Kaname

2014-01-01

Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20-75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08-1.28), P = 0.0003, and 1.37 (1.24-1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population.

Reading skill and word skipping: Implications for visual and linguistic accounts of word skipping.

PubMed

Eskenazi, Michael A; Folk, Jocelyn R

2015-11-01

We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did not influence the probability of skipping five-letter words, but low-skill readers were less likely to skip three-letter words when foveal load was high. Thus, reading skill is likely to influence word skipping when the amount of information in the parafovea falls within the word identification span. We interpret the data in the context of visual-based (extended optimal viewing position model) and linguistic based (E-Z Reader model) accounts of word skipping. The models make different predictions about how and why a word and skipped; however, the data indicate that both models should take into account the fact that different factors influence skipping rates for high- and low-skill readers. (c) 2015 APA, all rights reserved).

DNAJC17 is localized in nuclear speckles and interacts with splicing machinery components.

PubMed

Pascarella, A; Ferrandino, G; Credendino, S C; Moccia, C; D'Angelo, F; Miranda, B; D'Ambrosio, C; Bielli, P; Spadaro, O; Ceccarelli, M; Scaloni, A; Sette, C; De Felice, M; De Vita, G; Amendola, E

2018-05-17

DNAJC17 is a heat shock protein (HSP40) family member, identified in mouse as susceptibility gene for congenital hypothyroidism. DNAJC17 knockout mouse embryos die prior to implantation. In humans, germline homozygous mutations in DNAJC17 have been found in syndromic retinal dystrophy patients, while heterozygous mutations represent candidate pathogenic events for myeloproliferative disorders. Despite widespread expression and involvement in human diseases, DNAJC17 function is still poorly understood. Herein, we have investigated its function through high-throughput transcriptomic and proteomic approaches. DNAJC17-depleted cells transcriptome highlighted genes involved in general functional categories, mainly related to gene expression. Conversely, DNAJC17 interactome can be classified in very specific functional networks, with the most enriched one including proteins involved in splicing. Furthermore, several splicing-related interactors, were independently validated by co-immunoprecipitation and in vivo co-localization. Accordingly, co-localization of DNAJC17 with SC35, a marker of nuclear speckles, further supported its interaction with spliceosomal components. Lastly, DNAJC17 up-regulation enhanced splicing efficiency of minigene reporter in live cells, while its knockdown induced perturbations of splicing efficiency at whole genome level, as demonstrated by specific analysis of RNAseq data. In conclusion, our study strongly suggests a role of DNAJC17 in splicing-related processes and provides support to its recognized essential function in early development.

Effects of airborne particulate matter on alternative pre-mRNA splicing in colon cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buggiano, Valeria; Petrillo, Ezequiel; Alló, Mariano

2015-07-15

Alternative pre-mRNA splicing plays key roles in determining tissue- and species-specific cell differentiation as well as in the onset of hereditary disease and cancer, being controlled by multiple post- and co-transcriptional regulatory mechanisms. We report here that airborne particulate matter, resulting from industrial pollution, inhibits expression and specifically affects alternative splicing at the 5′ untranslated region of the mRNA encoding the bone morphogenetic protein BMP4 in human colon cells in culture. These effects are consistent with a previously reported role for BMP4 in preventing colon cancer development, suggesting that ingestion of particulate matter could contribute to the onset of colonmore » cell proliferation. We also show that the underlying mechanism might involve changes in transcriptional elongation. This is the first study to demonstrate that particulate matter causes non-pleiotropic changes in alternative splicing. - Highlights: • Airborne particulate matter (PM10) affects alternative splicing in colon cells. • PM10 upregulates one of the two mRNA variants of the growth factor BMP-4. • This variant has a longer 5′ unstranslated region and introduces an upstream AUG. • By regulating BMP-4 mRNA splicing PM10 inhibits total expression of BMP-4 protein. • BMP-4 downregulation was previously reported to be associated to colon cancer.« less

HnRNP L and L-like cooperate in multiple-exon regulation of CD45 alternative splicing

PubMed Central

Preußner, Marco; Schreiner, Silke; Hung, Lee-Hsueh; Porstner, Martina; Jäck, Hans-Martin; Benes, Vladimir; Rätsch, Gunnar; Bindereif, Albrecht

2012-01-01

CD45 encodes a trans-membrane protein-tyrosine phosphatase expressed in diverse cells of the immune system. By combinatorial use of three variable exons 4–6, isoforms are generated that differ in their extracellular domain, thereby modulating phosphatase activity and immune response. Alternative splicing of these CD45 exons involves two heterogeneous ribonucleoproteins, hnRNP L and its cell-type specific paralog hnRNP L-like (LL). To address the complex combinatorial splicing of exons 4–6, we investigated hnRNP L/LL protein expression in human B-cells in relation to CD45 splicing patterns, applying RNA-Seq. In addition, mutational and RNA-binding analyses were carried out in HeLa cells. We conclude that hnRNP LL functions as the major CD45 splicing repressor, with two CA elements in exon 6 as its primary target. In exon 4, one element is targeted by both hnRNP L and LL. In contrast, exon 5 was never repressed on its own and only co-regulated with exons 4 and 6. Stable L/LL interaction requires CD45 RNA, specifically exons 4 and 6. We propose a novel model of combinatorial alternative splicing: HnRNP L and LL cooperate on the CD45 pre-mRNA, bridging exons 4 and 6 and looping out exon 5, thereby achieving full repression of the three variable exons. PMID:22402488

Interplay between estrogen receptor and AKT in Estradiol-induced alternative splicing

PubMed Central

2013-01-01

Background Alternative splicing is critical for generating complex proteomes in response to extracellular signals. Nuclear receptors including estrogen receptor alpha (ERα) and their ligands promote alternative splicing. The endogenous targets of ERα:estradiol (E2)-mediated alternative splicing and the influence of extracellular kinases that phosphorylate ERα on E2-induced splicing are unknown. Methods MCF-7 and its anti-estrogen derivatives were used for the majority of the assays. CD44 mini gene was used to measure the effect of E2 and AKT on alternative splicing. ExonHit array analysis was performed to identify E2 and AKT-regulated endogenous alternatively spliced apoptosis-related genes. Quantitative reverse transcription polymerase chain reaction was performed to verify alternative splicing. ERα binding to alternatively spliced genes was verified by chromatin immunoprecipitation assay. Bromodeoxyuridine incorporation-ELISA and Annexin V labeling assays were done to measure cell proliferation and apoptosis, respectively. Results We identified the targets of E2-induced alternative splicing and deconstructed some of the mechanisms surrounding E2-induced splicing by combining splice array with ERα cistrome and gene expression array. E2-induced alternatively spliced genes fall into at least two subgroups: coupled to E2-regulated transcription and ERα binding to the gene without an effect on rate of transcription. Further, AKT, which phosphorylates both ERα and splicing factors, influenced ERα:E2 dependent splicing in a gene-specific manner. Genes that are alternatively spliced include FAS/CD95, FGFR2, and AXIN-1. E2 increased the expression of FGFR2 C1 isoform but reduced C3 isoform at mRNA level. E2-induced alternative splicing of FAS and FGFR2 in MCF-7 cells correlated with resistance to FAS activation-induced apoptosis and response to keratinocyte growth factor (KGF), respectively. Resistance of MCF-7 breast cancer cells to the anti-estrogen tamoxifen was associated with ERα-dependent overexpression of FGFR2, whereas resistance to fulvestrant was associated with ERα-dependent isoform switching, which correlated with altered response to KGF. Conclusion E2 may partly alter cellular proteome through alternative splicing uncoupled to its effects on transcription initiation and aberration in E2-induced alternative splicing events may influence response to anti-estrogens. PMID:23758675

Skipped Stage Modeling and Testing of the CPAS Main Parachutes

NASA Technical Reports Server (NTRS)

Varela, Jose G.; Ray, Eric S.

2013-01-01

The Capsule Parachute Assembly System (CPAS) has undergone the transition from modeling a skipped stage event using a simulation that treats a cluster of parachutes as a single composite canopy to the capability of simulating each parachute individually. This capability along with data obtained from skipped stage flight tests has been crucial in modeling the behavior of a skipping canopy as well as the crowding effect on non-skipping ("lagging") neighbors. For the finite mass inflation of CPAS Main parachutes, the cluster is assumed to inflate nominally through the nominal fill time, at which point the skipping parachute continues inflating. This sub-phase modeling method was used to reconstruct three flight tests involving skipped stages. Best fit inflation parameters were determined for both the skipping and lagging canopies.

hnRNP L regulates differences in expression of mouse integrin alpha2beta1.

PubMed

Cheli, Yann; Kunicki, Thomas J

2006-06-01

There is a 2-fold variation in platelet integrin alpha2beta1 levels among inbred mouse strains. Decreased alpha2beta1 in 4 strains carrying Itga2 haplotype 2 results from decreased affinity of heterogeneous ribonucleoprotein L (hnRNP L) for a 6 CA repeat sequence (CA6) within intron 1. Seven strains bearing haplotype 1 and a 21 CA repeat sequence at this position (CA21) express twice the level of platelet alpha2beta1 and exhibit an equivalent gain of platelet function in vitro. By UV crosslinking and immunoprecipitation, hnRNP L binds more avidly to CA21, relative to CA6. By cell-free, in vitro mRNA splicing, decreased binding of hnRNP L results in decreased splicing efficiency and an increased proportion of alternatively spliced product. The splicing enhancer activity of CA21 in vivo is abolished by prior treatment with hnRNP L-specific siRNA. Thus, decreased surface alpha2beta1 results from decreased Itga2 pre-mRNA splicing regulated by hnRNP L and depends on CA repeat length at a specific site in intron 1.

hnRNP L regulates differences in expression of mouse integrin α2β1

PubMed Central

Cheli, Yann; Kunicki, Thomas J.

2006-01-01

There is a 2-fold variation in platelet integrin α2β1 levels among inbred mouse strains. Decreased α2β1 in 4 strains carrying Itga2 haplotype 2 results from decreased affinity of heterogeneous ribonucleoprotein L (hnRNP L) for a 6 CA repeat sequence (CA6) within intron 1. Seven strains bearing haplotype 1 and a 21 CA repeat sequence at this position (CA21) express twice the level of platelet α2β1 and exhibit an equivalent gain of platelet function in vitro. By UV crosslinking and immunoprecipitation, hnRNP L binds more avidly to CA21, relative to CA6. By cell-free, in vitro mRNA splicing, decreased binding of hnRNP L results in decreased splicing efficiency and an increased proportion of alternatively spliced product. The splicing enhancer activity of CA21 in vivo is abolished by prior treatment with hnRNP L–specific siRNA. Thus, decreased surface α2β1 results from decreased Itga2 pre-mRNA splicing regulated by hnRNP L and depends on CA repeat length at a specific site in intron 1. PMID:16455949

Factors influencing alternative splice site utilization in vivo.

PubMed Central

Fu, X Y; Manley, J L

1987-01-01

To study factors that influence the choice of alternative pre-mRNA splicing pathways, we introduced plasmids expressing either wild-type or mutated simian virus 40 (SV40) early regions into tissue culture cells and then measured the quantities of small-t and large-T RNAs produced. One important element controlling splice site selection was found to be the size of the intron removed in the production of small-t mRNA; expansion of this intron (from 66 to 77 or more nucleotides) resulted in a substantial increase in the amount of small-t mRNA produced relative to large-T mRNA. This suggests that in the normal course of SV40 early pre-mRNA processing, large-T splicing is at a competitive advantage relative to small-t splicing because of the small size of the latter intron. Several additional features of the pre-mRNA that can influence splice site selection were also identified by analyzing the effects of mutations containing splice site duplications. These include the strengths of competing 5' splice sites and the relative positions of splice sites in the pre-mRNA. Finally, we showed that the ratio of small-t to large-T mRNA was 10 to 15-fold greater in human 293 cells than in HeLa cells or other mammalian cell types. These results suggest the existence of cell-specific trans-acting factors that can dramatically alter the pattern of splice site selection in a pre-mRNA. Images PMID:3029566

Processing "the" in the Parafovea: Are Articles Skipped Automatically?

ERIC Educational Resources Information Center

Angele, Bernhard; Rayner, Keith

2013-01-01

One of the words that readers of English skip most often is the definite article "the". Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string…

Maple Syrup Urine Disease in Cypriot Families: Identification of Three Novel Mutations and Biochemical Characterization of the p.Thr211Met Mutation in the E1α Subunit

PubMed Central

Georgiou, Theodoros; Chuang, Jacinta L.; Wynn, R. Max; Stylianidou, Goula; Korson, Mark; Chuang, David T.

2009-01-01

We report five mutations, three of them novel, responsible for maple syrup urine disease in four unrelated Cypriot families. The five children studied are the first cases of classic maple syrup urine disease to be reported among Cypriots. The first novel mutation identified is a single-base deletion in exon 6 of the Elα gene (c.718delG), which leads to a frameshift after Ala240 and to a stop codon 89 residues further downstream. The other two novel mutations identified are in the Elβ subunit: a two-base deletion in exon 6, c.662_663delCC, which leads to a frameshift after Ala221 and creates a stop codon 17 residues further downstream, as well as a splice mutation, IVS3[+3]delA, which results in the skipping of exon 3. The two known mutations identified are in the Elα gene: the G > C transversion at the 3′-splice acceptor site, (IVS5-1G > C), which results in the deletion of the entire exon 6, and the missense mutation in exon 5 (c.632C > T), which corresponds to a p.Thr211Met substitution. The p.Thr211Met substitution is located in a potassium-ion pocket in the E1 component required for stability of the bound cofactor thiamine diphosphate. The mutant E1 protein harboring the p.Thr211Met substitution was shown unable to bind thiamine diphosphate, leading to undetectable E1 activity. PMID:19715473

Identification of a transformer homolog in the acorn worm, Saccoglossus kowalevskii, and analysis of its activity in insect cells.

PubMed

Suzuki, Masataka G; Tochigi, Mayuko; Sakaguchi, Honami; Aoki, Fugaku; Miyamoto, Norio

2015-06-01

The transformer (tra) gene is an intermediate component of the sex determination hierarchy in many insect species. The homolog of tra is also found in two branchiopod crustacean species but is not known outside arthropods. We have isolated a tra homolog in the acorn worm, Saccoglossus kowalevskii, which is a hemichordate belonging to the deuterostome superphylum. The full-length complementary DNA (cDNA) of the S. kowalevskii tra homolog (Sktra) has a 3786-bp open reading frame that encodes a 1261-amino acid sequence including a TRA-CAM domain and an arginine/serine (RS)-rich domain, both of which are characteristic of TRA orthologs. Reverse transcription PCR (RT-PCR) analyses demonstrated that Sktra showed no differences in expression patterns between testes and ovaries, but its expression level was approximately 7.5-fold higher in the testes than in the ovaries. TRA, together with the protein product of the transformer-2 (tra-2) gene, assembles on doublesex (dsx) pre-messenger RNA (mRNA) via the cis-regulatory element, enhancing female-specific splicing of dsx in Drosophila. To understand functional conservation of the SkTRA protein as a dsx-splicing activator, we investigated whether SkTRA is capable of inducing female-specific splicing of the Drosophila dsx. Ectopic expression of Sktra cDNA in insect cultured cells did not induce the female-specific splicing of dsx. On the other hand, forced expression of Sktra-2 (a tra-2 homolog of S. kowalevskii) was able to induce the female-specific dsx splicing. These results demonstrate that the function as a dsx-splicing activator is not conserved in SkTRA even though SkTRA-2 is capable of functionally replacing the Drosophila TRA-2. We have also found a tra homolog in an echinoderm genome. This study provides the first evidence that that tra is conserved not only in arthropods but also in basal species of deuterostoms.

Maternal provision of non-sex-specific transformer messenger RNA in sex determination of the wasp Asobara tabida.

PubMed

Geuverink, E; Verhulst, E C; van Leussen, M; van de Zande, L; Beukeboom, L W

2018-02-01

In many insect species maternal provision of sex-specifically spliced messenger RNA (mRNA) of sex determination genes is an essential component of the sex determination mechanism. In haplodiploid Hymenoptera, maternal provision in combination with genomic imprinting has been shown for the parasitoid Nasonia vitripennis, known as maternal effect genomic imprinting sex determination (MEGISD). Here, we characterize the sex determination cascade of Asobara tabida, another hymenopteran parasitoid. We show the presence of the conserved sex determination genes doublesex (dsx), transformer (tra) and transformer-2 (tra2) orthologues in As. tabida. Of these, At-dsx and At-tra are sex-specifically spliced, indicating a conserved function in sex determination. At-tra and At-tra2 mRNA is maternally provided to embryos but, in contrast to most studied insects, As. tabida females transmit a non-sex-specific splice form of At-tra mRNA to the eggs. In this respect, As. tabida sex determination differs from the MEGISD mechanism. How the paternal genome can induce female development in the absence of maternal provision of sex-specifically spliced mRNA remains an open question. Our study reports a hitherto unknown variant of maternal effect sex determination and accentuates the diversity of insect sex determination mechanisms. © 2017 The Authors. Insect Molecular Biology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society.

Oncogenes and RNA splicing of human tumor viruses

PubMed Central

Ajiro, Masahiko; Zheng, Zhi-Ming

2014-01-01

Approximately 10.8% of human cancers are associated with infection by an oncogenic virus. These viruses include human papillomavirus (HPV), Epstein–Barr virus (EBV), Merkel cell polyomavirus (MCV), human T-cell leukemia virus 1 (HTLV-1), Kaposi's sarcoma-associated herpesvirus (KSHV), hepatitis C virus (HCV) and hepatitis B virus (HBV). These oncogenic viruses, with the exception of HCV, require the host RNA splicing machinery in order to exercise their oncogenic activities, a strategy that allows the viruses to efficiently export and stabilize viral RNA and to produce spliced RNA isoforms from a bicistronic or polycistronic RNA transcript for efficient protein translation. Infection with a tumor virus affects the expression of host genes, including host RNA splicing factors, which play a key role in regulating viral RNA splicing of oncogene transcripts. A current prospective focus is to explore how alternative RNA splicing and the expression of viral oncogenes take place in a cell- or tissue-specific manner in virus-induced human carcinogenesis. PMID:26038756

Quantitative imaging of single mRNA splice variants in living cells

NASA Astrophysics Data System (ADS)

Lee, Kyuwan; Cui, Yi; Lee, Luke P.; Irudayaraj, Joseph

2014-06-01

Alternative messenger RNA (mRNA) splicing is a fundamental process of gene regulation, and errors in RNA splicing are known to be associated with a variety of different diseases. However, there is currently a lack of quantitative technologies for monitoring mRNA splice variants in cells. Here, we show that a combination of plasmonic dimer probes and hyperspectral imaging can be used to detect and quantify mRNA splice variants in living cells. The probes are made from gold nanoparticles functionalized with oligonucleotides and can hybridize to specific mRNA sequences, forming nanoparticle dimers that exhibit distinct spectral shifts due to plasmonic coupling. With this approach, we show that the spatial and temporal distribution of three selected splice variants of the breast cancer susceptibility gene, BRCA1, can be monitored at single-copy resolution by measuring the hybridization dynamics of the nanoplasmonic dimers. Our study provides insights into RNA and its transport in living cells, which could improve our understanding of cellular protein complexes, pharmacogenomics, genetic diagnosis and gene therapies.

Global impact of RNA splicing on transcriptome remodeling in the heart.

PubMed

Gao, Chen; Wang, Yibin

2012-08-01

In the eukaryotic transcriptome, both the numbers of genes and different RNA species produced by each gene contribute to the overall complexity. These RNA species are generated by the utilization of different transcriptional initiation or termination sites, or more commonly, from different messenger RNA (mRNA) splicing events. Among the 30,000+ genes in human genome, it is estimated that more than 95% of them can generate more than one gene product via alternative RNA splicing. The protein products generated from different RNA splicing variants can have different intracellular localization, activity, or tissue-distribution. Therefore, alternative RNA splicing is an important molecular process that contributes to the overall complexity of the genome and the functional specificity and diversity among different cell types. In this review, we will discuss current efforts to unravel the full complexity of the cardiac transcriptome using a deep-sequencing approach, and highlight the potential of this technology to uncover the global impact of RNA splicing on the transcriptome during development and diseases of the heart.

Alternative splicing of the tyrosinase gene transcript in normal human melanocytes and lymphocytes.

PubMed

Fryer, J P; Oetting, W S; Brott, M J; King, R A

2001-11-01

We have identified and isolated ectopically expressed tyrosinase transcripts in normal human melanocytes and lymphocytes and in a human melanoma (MNT-1) cell line to establish a baseline for the expression pattern of this gene in normal tissue. Tyrosinase mRNA from human lymphoblastoid cell lines was reverse transcribed and amplified using specific "nested" primers. This amplification yielded eight identifiable transcripts; five that resulted from alternative splicing patterns arising from the utilization of normal and alternative splice sequences. Identical splicing patterns were found in transcripts from human primary melanocytes in culture and a melanoma cell line, indicating that lymphoblastoid cell lines provide an accurate reflection of transcript processing in melanocytes. Similar splicing patterns have also been found with murine melanocyte tyrosinase transcripts. Our results demonstrate that alternative splicing of human tyrosinase gene transcript produces a number of predictable and identifiable transcripts, and that human lymphoblastoid cell lines provide a source of ectopically expressed transcripts that can be used to study the biology of tyrosinase gene expression in humans.

Overcoming imatinib resistance conferred by the BIM deletion polymorphism in chronic myeloid leukemia with splice-switching antisense oligonucleotides

PubMed Central

Liu, Jun; Bhadra, Malini; Sinnakannu, Joanna Rajeswary; Yue, Wan Lin; Tan, Cheryl Weiqi; Rigo, Frank; Ong, S.Tiong; Roca, Xavier

2017-01-01

Many tyrosine kinase-driven cancers, including chronic myeloid leukemia (CML), are characterized by high response rates to specific tyrosine kinase inhibitors (TKIs) like imatinib. In East Asians, primary imatinib resistance is caused by a deletion polymorphism in Intron 2 of the BIM gene, whose product is required for TKI-induced apoptosis. The deletion biases BIM splicing from exon 4 to exon 3, generating splice isoforms lacking the exon 4-encoded pro-apoptotic BH3 domain, which impairs the ability of TKIs to induce apoptosis. We sought to identify splice-switching antisense oligonucleotides (ASOs) that block exon 3 but enhance exon 4 splicing, and thereby resensitize BIM deletion-containing cancers to imatinib. First, we mapped multiple cis-acting splicing elements around BIM exon 3 by minigene mutations, and found an exonic splicing enhancer acting via SRSF1. Second, by a systematic ASO walk, we isolated ASOs that corrected the aberrant BIM splicing. Eight of 67 ASOs increased exon 4 levels in BIM deletion-containing cells, and restored imatinib-induced apoptosis and TKI sensitivity. This proof-of-principle study proves that resistant CML cells by BIM deletion polymorphism can be resensitized to imatinib via splice-switching BIM ASOs. Future optimizations might yield a therapeutic ASO as precision-medicine adjuvant treatment for BIM-polymorphism-associated TKI-resistant CML and other cancers. PMID:29100409

Overcoming imatinib resistance conferred by the BIM deletion polymorphism in chronic myeloid leukemia with splice-switching antisense oligonucleotides.

PubMed

Liu, Jun; Bhadra, Malini; Sinnakannu, Joanna Rajeswary; Yue, Wan Lin; Tan, Cheryl Weiqi; Rigo, Frank; Ong, S Tiong; Roca, Xavier

2017-09-29

Many tyrosine kinase-driven cancers, including chronic myeloid leukemia (CML), are characterized by high response rates to specific tyrosine kinase inhibitors (TKIs) like imatinib. In East Asians, primary imatinib resistance is caused by a deletion polymorphism in Intron 2 of the BIM gene, whose product is required for TKI-induced apoptosis. The deletion biases BIM splicing from exon 4 to exon 3, generating splice isoforms lacking the exon 4-encoded pro-apoptotic BH3 domain, which impairs the ability of TKIs to induce apoptosis. We sought to identify splice-switching antisense oligonucleotides (ASOs) that block exon 3 but enhance exon 4 splicing, and thereby resensitize BIM deletion-containing cancers to imatinib. First, we mapped multiple cis -acting splicing elements around BIM exon 3 by minigene mutations, and found an exonic splicing enhancer acting via SRSF1. Second, by a systematic ASO walk, we isolated ASOs that corrected the aberrant BIM splicing. Eight of 67 ASOs increased exon 4 levels in BIM deletion-containing cells, and restored imatinib-induced apoptosis and TKI sensitivity. This proof-of-principle study proves that resistant CML cells by BIM deletion polymorphism can be resensitized to imatinib via splice-switching BIM ASOs. Future optimizations might yield a therapeutic ASO as precision-medicine adjuvant treatment for BIM -polymorphism-associated TKI-resistant CML and other cancers.

SL2-like spliced leader RNAs in the basal nematode Prionchulus punctatus: New insight into the evolution of nematode SL2 RNAs.

PubMed

Harrison, Neale; Kalbfleisch, Andreas; Connolly, Bernadette; Pettitt, Jonathan; Müller, Berndt

2010-08-01

Spliced-leader (SL) trans-splicing has been found in all molecularly characterized nematode species to date, and it is likely to be a nematode synapomorphy. Most information regarding SL trans-splicing has come from the study of nematodes from a single monophyletic group, the Rhabditida, all of which employ SL RNAs that are identical to, or variants of, the SL1 RNA first characterized in Caenorhabditis elegans. In contrast, the more distantly related Trichinella spiralis, belonging to the subclass Dorylaimia, utilizes a distinct set of SL RNAs that display considerable sequence diversity. To investigate whether this is true of other members of the Dorylaimia, we have characterized SL RNAs from Prionchulus punctatus. Surprisingly, this revealed the presence of a set of SLs that show clear sequence similarity to the SL2 family of spliced leaders, which have previously only been found within the rhabditine group (which includes C. elegans). Expression of one of the P. punctatus SL RNAs in C. elegans reveals that it can compete specifically with the endogenous C. elegans SL2 spliced leaders, being spliced to the pre-mRNAs derived from downstream genes in operons, but does not compete with the SL1 spliced leaders. This discovery raises the possibility that SL2-like spliced leaders were present in the last common ancestor of the nematode phylum.

Social Inequalities in Young Children’s Meal Skipping Behaviors: The Generation R Study

PubMed Central

Wijtzes, Anne I.; Jansen, Wilma; Jaddoe, Vincent W. V.; Franco, Oscar H.; Hofman, Albert; van Lenthe, Frank J.; Raat, Hein

2015-01-01

Background Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. Methods We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Results Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Conclusion Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children’s meal skipping behaviors is warranted. PMID:26225757

Social Inequalities in Young Children's Meal Skipping Behaviors: The Generation R Study.

PubMed

Wijtzes, Anne I; Jansen, Wilma; Jaddoe, Vincent W V; Franco, Oscar H; Hofman, Albert; van Lenthe, Frank J; Raat, Hein

2015-01-01

Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children's meal skipping behaviors is warranted.

Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population

PubMed Central

Kutsuma, Ayano; Suwa, Kaname

2014-01-01

Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20–75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08–1.28), P = 0.0003, and 1.37 (1.24–1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population. PMID:24982814

Exon skipping of AGAMOUS homolog PrseAG in developing double flowers of Prunus lannesiana (Rosaceae).

PubMed

Liu, Zhixiong; Zhang, Dandan; Liu, Di; Li, Fenglan; Lu, Hai

2013-02-01

KEY MESSAGE : Two transcript isoforms of AGAMOUS homologs, from single and double flower Prunus lannesiana, respectively, showed different functions. The Arabidopsis floral homeotic C function gene AGAMOUS (AG) confers stamen and carpel identity. Loss of AG function results in homeotic conversions of stamens into petals and formation of double flowers. In order to present a molecular dissection of a double-flower cultivar in Prunus lannesiana (Rosaceae), we isolated and identified a single-copy gene, AG homolog from two genetically cognate P. lannesiana bearing single and double flowers, respectively. Sequence analysis revealed that the AG homolog, prseag-1, from double flowers showed a 170-bp exon skipping as compared to PrseAG (Prunus serrulata AGAMOUS) from the single flowers. Genomic DNA sequence revealed that abnormal splicing resulted in mutant prseag-1 protein with the C-terminal AG motifs I and II deletions. In addition, protein sequence alignment and phylogenetic analyses revealed that the PrseAG was grouped into the euAG lineage. A semi-quantitative PCR analysis showed that the expression of PrseAG was restricted to reproductive organs of stamens and carpels in single flowers of P. lannesiana 'speciosa', while the prseag-1 mRNA was highly transcribed throughout the petals, stamens, and carpels in double flowers from 'Albo-rosea'. The transgenic Arabidopsis containing 35S::PrseAG displayed extremely early flowering, bigger stamens and carpels and homeotic conversion of petals into staminoid organs, but ectopic expression of prseag-1 could not mimic the phenotypic ectopic expression of PrseAG in Arabidopsis. In general, this study provides evidences to show that double flower 'Albo-rosea' is a putative C functional ag mutant in P. lannesiana.

Cross-talk between PRMT1-mediated methylation and ubiquitylation on RBM15 controls RNA splicing.

PubMed

Zhang, Li; Tran, Ngoc-Tung; Su, Hairui; Wang, Rui; Lu, Yuheng; Tang, Haiping; Aoyagi, Sayura; Guo, Ailan; Khodadadi-Jamayran, Alireza; Zhou, Dewang; Qian, Kun; Hricik, Todd; Côté, Jocelyn; Han, Xiaosi; Zhou, Wenping; Laha, Suparna; Abdel-Wahab, Omar; Levine, Ross L; Raffel, Glen; Liu, Yanyan; Chen, Dongquan; Li, Haitao; Townes, Tim; Wang, Hengbin; Deng, Haiteng; Zheng, Y George; Leslie, Christina; Luo, Minkui; Zhao, Xinyang

2015-11-17

RBM15, an RNA binding protein, determines cell-fate specification of many tissues including blood. We demonstrate that RBM15 is methylated by protein arginine methyltransferase 1 (PRMT1) at residue R578, leading to its degradation via ubiquitylation by an E3 ligase (CNOT4). Overexpression of PRMT1 in acute megakaryocytic leukemia cell lines blocks megakaryocyte terminal differentiation by downregulation of RBM15 protein level. Restoring RBM15 protein level rescues megakaryocyte terminal differentiation blocked by PRMT1 overexpression. At the molecular level, RBM15 binds to pre-messenger RNA intronic regions of genes important for megakaryopoiesis such as GATA1, RUNX1, TAL1 and c-MPL. Furthermore, preferential binding of RBM15 to specific intronic regions recruits the splicing factor SF3B1 to the same sites for alternative splicing. Therefore, PRMT1 regulates alternative RNA splicing via reducing RBM15 protein concentration. Targeting PRMT1 may be a curative therapy to restore megakaryocyte differentiation for acute megakaryocytic leukemia.

Structural basis of RNA recognition and dimerization by the STAR proteins T-STAR and Sam68

PubMed Central

Feracci, Mikael; Foot, Jaelle N.; Grellscheid, Sushma N.; Danilenko, Marina; Stehle, Ralf; Gonchar, Oksana; Kang, Hyun-Seo; Dalgliesh, Caroline; Meyer, N. Helge; Liu, Yilei; Lahat, Albert; Sattler, Michael; Eperon, Ian C.; Elliott, David J.; Dominguez, Cyril

2016-01-01

Sam68 and T-STAR are members of the STAR family of proteins that directly link signal transduction with post-transcriptional gene regulation. Sam68 controls the alternative splicing of many oncogenic proteins. T-STAR is a tissue-specific paralogue that regulates the alternative splicing of neuronal pre-mRNAs. STAR proteins differ from most splicing factors, in that they contain a single RNA-binding domain. Their specificity of RNA recognition is thought to arise from their property to homodimerize, but how dimerization influences their function remains unknown. Here, we establish at atomic resolution how T-STAR and Sam68 bind to RNA, revealing an unexpected mode of dimerization different from other members of the STAR family. We further demonstrate that this unique dimerization interface is crucial for their biological activity in splicing regulation, and suggest that the increased RNA affinity through dimer formation is a crucial parameter enabling these proteins to select their functional targets within the transcriptome. PMID:26758068

DBATE: database of alternative transcripts expression.

PubMed

Bianchi, Valerio; Colantoni, Alessio; Calderone, Alberto; Ausiello, Gabriele; Ferrè, Fabrizio; Helmer-Citterich, Manuela

2013-01-01

The use of high-throughput RNA sequencing technology (RNA-seq) allows whole transcriptome analysis, providing an unbiased and unabridged view of alternative transcript expression. Coupling splicing variant-specific expression with its functional inference is still an open and difficult issue for which we created the DataBase of Alternative Transcripts Expression (DBATE), a web-based repository storing expression values and functional annotation of alternative splicing variants. We processed 13 large RNA-seq panels from human healthy tissues and in disease conditions, reporting expression levels and functional annotations gathered and integrated from different sources for each splicing variant, using a variant-specific annotation transfer pipeline. The possibility to perform complex queries by cross-referencing different functional annotations permits the retrieval of desired subsets of splicing variant expression values that can be visualized in several ways, from simple to more informative. DBATE is intended as a novel tool to help appreciate how, and possibly why, the transcriptome expression is shaped. DATABASE URL: http://bioinformatica.uniroma2.it/DBATE/.

Structural basis of RNA recognition and dimerization by the STAR proteins T-STAR and Sam68.

PubMed

Feracci, Mikael; Foot, Jaelle N; Grellscheid, Sushma N; Danilenko, Marina; Stehle, Ralf; Gonchar, Oksana; Kang, Hyun-Seo; Dalgliesh, Caroline; Meyer, N Helge; Liu, Yilei; Lahat, Albert; Sattler, Michael; Eperon, Ian C; Elliott, David J; Dominguez, Cyril

2016-01-13

Sam68 and T-STAR are members of the STAR family of proteins that directly link signal transduction with post-transcriptional gene regulation. Sam68 controls the alternative splicing of many oncogenic proteins. T-STAR is a tissue-specific paralogue that regulates the alternative splicing of neuronal pre-mRNAs. STAR proteins differ from most splicing factors, in that they contain a single RNA-binding domain. Their specificity of RNA recognition is thought to arise from their property to homodimerize, but how dimerization influences their function remains unknown. Here, we establish at atomic resolution how T-STAR and Sam68 bind to RNA, revealing an unexpected mode of dimerization different from other members of the STAR family. We further demonstrate that this unique dimerization interface is crucial for their biological activity in splicing regulation, and suggest that the increased RNA affinity through dimer formation is a crucial parameter enabling these proteins to select their functional targets within the transcriptome.

RBFOX and PTBP1 proteins regulate the alternative splicing of micro-exons in human brain transcripts.

PubMed

Li, Yang I; Sanchez-Pulido, Luis; Haerty, Wilfried; Ponting, Chris P

2015-01-01

Ninety-four percent of mammalian protein-coding exons exceed 51 nucleotides (nt) in length. The paucity of micro-exons (≤ 51 nt) suggests that their recognition and correct processing by the splicing machinery present greater challenges than for longer exons. Yet, because thousands of human genes harbor processed micro-exons, specialized mechanisms may be in place to promote their splicing. Here, we survey deep genomic data sets to define 13,085 micro-exons and to study their splicing mechanisms and molecular functions. More than 60% of annotated human micro-exons exhibit a high level of sequence conservation, an indicator of functionality. While most human micro-exons require splicing-enhancing genomic features to be processed, the splicing of hundreds of micro-exons is enhanced by the adjacent binding of splice factors in the introns of pre-messenger RNAs. Notably, splicing of a significant number of micro-exons was found to be facilitated by the binding of RBFOX proteins, which promote their inclusion in the brain, muscle, and heart. Our analyses suggest that accurate regulation of micro-exon inclusion by RBFOX proteins and PTBP1 plays an important role in the maintenance of tissue-specific protein-protein interactions. © 2015 Li et al.; Published by Cold Spring Harbor Laboratory Press.

Post-tensioning and splicing of precast/prestressed bridge beams to extend spans

NASA Astrophysics Data System (ADS)

Collett, Brandon S.; Saliba, Joseph E.

2002-06-01

This paper explores the status and techniques of post-tensioning and splicing precast concrete I-beams in bridge applications. It will look at the current practices that have been used in the United States and comment on the advantages of these techniques. Representative projects are presented to demonstrate the application and success of specific methods used. To demonstrate the benefits of using post-tensioning and splicing to extend spans, multiple analysis of simple span post-tensioned I-beams were performed varying such characteristics as beam spacing, beam sections, beam depth and concrete strength. Tables were then developed to compare the maximum span length of a prestressed I-beam versus a one segment or a spliced three segment post-tensioned I-beam. The lateral stability of the beam during fabrication, transportation and erection is also examined and discussed. These tables are intended to aid designers and owners in preliminary project studies to determine if post-tensioning can be beneficial to their situation. AASHTO Standard Specifications(2) will be used as basic guidelines and specifications. In many cases, post-tensioning was found to extend the maximum span length of a typical 72-inch precast I-beam more than 40 feet over conventional prestress.

SpliceCenter: A suite of web-based bioinformatic applications for evaluating the impact of alternative splicing on RT-PCR, RNAi, microarray, and peptide-based studies

PubMed Central

Ryan, Michael C; Zeeberg, Barry R; Caplen, Natasha J; Cleland, James A; Kahn, Ari B; Liu, Hongfang; Weinstein, John N

2008-01-01

Background Over 60% of protein-coding genes in vertebrates express mRNAs that undergo alternative splicing. The resulting collection of transcript isoforms poses significant challenges for contemporary biological assays. For example, RT-PCR validation of gene expression microarray results may be unsuccessful if the two technologies target different splice variants. Effective use of sequence-based technologies requires knowledge of the specific splice variant(s) that are targeted. In addition, the critical roles of alternative splice forms in biological function and in disease suggest that assay results may be more informative if analyzed in the context of the targeted splice variant. Results A number of contemporary technologies are used for analyzing transcripts or proteins. To enable investigation of the impact of splice variation on the interpretation of data derived from those technologies, we have developed SpliceCenter. SpliceCenter is a suite of user-friendly, web-based applications that includes programs for analysis of RT-PCR primer/probe sets, effectors of RNAi, microarrays, and protein-targeting technologies. Both interactive and high-throughput implementations of the tools are provided. The interactive versions of SpliceCenter tools provide visualizations of a gene's alternative transcripts and probe target positions, enabling the user to identify which splice variants are or are not targeted. The high-throughput batch versions accept user query files and provide results in tabular form. When, for example, we used SpliceCenter's batch siRNA-Check to process the Cancer Genome Anatomy Project's large-scale shRNA library, we found that only 59% of the 50,766 shRNAs in the library target all known splice variants of the target gene, 32% target some but not all, and 9% do not target any currently annotated transcript. Conclusion SpliceCenter provides unique, user-friendly applications for assessing the impact of transcript variation on the design and interpretation of RT-PCR, RNAi, gene expression microarrays, antibody-based detection, and mass spectrometry proteomics. The tools are intended for use by bench biologists as well as bioinformaticists. PMID:18638396

Television viewing, computer game play and book reading during meals are predictors of meal skipping in a cross-sectional sample of 12-, 14- and 16-year-olds.

PubMed

Custers, Kathleen; Van den Bulck, Jan

2010-04-01

To examine whether television viewing, computer game playing or book reading during meals predicts meal skipping with the aim of watching television, playing computer games or reading books (media meal skipping). A cross-sectional study was conducted using a standardized self-administered questionnaire. Analyses were controlled for age, gender and BMI. Data were obtained from a random sample of adolescents in Flanders, Belgium. Seven hundred and ten participants aged 12, 14 and 16 years. Of the participants, 11.8 % skipped meals to watch television, 10.5 % skipped meals to play computer games and 8.2 % skipped meals to read books. Compared with those who did not use these media during meals, the risk of skipping meals in order to watch television was significantly higher for those children who watched television during meals (2.9 times higher in those who watched television during at least one meal a day). The risk of skipping meals for computer game playing was 9.5 times higher in those who played computer games weekly or more while eating, and the risk of meal skipping in order to read books was 22.9 times higher in those who read books during meals less than weekly. The more meals the respondents ate with the entire family, the less likely they were to skip meals to watch television. The use of media during meals predicts meal skipping for using that same medium. Family meals appear to be inversely related to meal skipping for television viewing.

Yeast Mitochondrial Leucyl-tRNA Synthetase CP1 Domain Has Functionally Diverged to Accommodate RNA Splicing at Expense of Hydrolytic Editing*

PubMed Central

Sarkar, Jaya; Poruri, Kiranmai; Boniecki, Michal T.; McTavish, Katherine K.; Martinis, Susan A.

2012-01-01

The yeast mitochondrial leucyl-tRNA synthetase (ymLeuRS) performs dual essential roles in group I intron splicing and protein synthesis. A specific LeuRS domain called CP1 is responsible for clearing noncognate amino acids that are misactivated during aminoacylation. The ymLeuRS CP1 domain also plays a critical role in splicing. Herein, the ymLeuRS CP1 domain was isolated from the full-length enzyme and was active in RNA splicing in vitro. Unlike its Escherichia coli LeuRS CP1 domain counterpart, it failed to significantly hydrolyze misaminoacylated tRNALeu. In addition and in stark contrast to the yeast domain, the editing-active E. coli LeuRS CP1 domain failed to recapitulate the splicing activity of the full-length E. coli enzyme. Although LeuRS-dependent splicing activity is rooted in an ancient adaptation for its aminoacylation activity, these results suggest that the ymLeuRS has functionally diverged to confer a robust splicing activity. This adaptation could have come at some expense to the protein's housekeeping role in aminoacylation and editing. PMID:22383526

Development of Potent, Selective SRPK1 Inhibitors as Potential Topical Therapeutics for Neovascular Eye Disease.

PubMed

Batson, Jennifer; Toop, Hamish D; Redondo, Clara; Babaei-Jadidi, Roya; Chaikuad, Apirat; Wearmouth, Stephen F; Gibbons, Brian; Allen, Claire; Tallant, Cynthia; Zhang, Jingxue; Du, Chunyun; Hancox, Jules C; Hawtrey, Tom; Da Rocha, Joana; Griffith, Renate; Knapp, Stefan; Bates, David O; Morris, Jonathan C

2017-03-17

Serine/arginine-protein kinase 1 (SRPK1) regulates alternative splicing of VEGF-A to pro-angiogenic isoforms and SRPK1 inhibition can restore the balance of pro/antiangiogenic isoforms to normal physiological levels. The lack of potency and selectivity of available compounds has limited development of SRPK1 inhibitors, with the control of alternative splicing by splicing factor-specific kinases yet to be translated. We present here compounds that occupy a binding pocket created by the unique helical insert of SRPK1, and trigger a backbone flip in the hinge region, that results in potent (<10 nM) and selective inhibition of SRPK1 kinase activity. Treatment with these inhibitors inhibited SRPK1 activity and phosphorylation of serine/arginine splicing factor 1 (SRSF1), resulting in alternative splicing of VEGF-A from pro-angiogenic to antiangiogenic isoforms. This property resulted in potent inhibition of blood vessel growth in models of choroidal angiogenesis in vivo. This work identifies tool compounds for splice isoform selective targeting of pro-angiogenic VEGF, which may lead to new therapeutic strategies for a diversity of diseases where dysfunctional splicing drives disease development.

Quaking and PTB control overlapping splicing regulatory networks during muscle cell differentiation

PubMed Central

Hall, Megan P.; Nagel, Roland J.; Fagg, W. Samuel; Shiue, Lily; Cline, Melissa S.; Perriman, Rhonda J.; Donohue, John Paul; Ares, Manuel

2013-01-01

Alternative splicing contributes to muscle development, but a complete set of muscle-splicing factors and their combinatorial interactions are unknown. Previous work identified ACUAA (“STAR” motif) as an enriched intron sequence near muscle-specific alternative exons such as Capzb exon 9. Mass spectrometry of myoblast proteins selected by the Capzb exon 9 intron via RNA affinity chromatography identifies Quaking (QK), a protein known to regulate mRNA function through ACUAA motifs in 3′ UTRs. We find that QK promotes inclusion of Capzb exon 9 in opposition to repression by polypyrimidine tract-binding protein (PTB). QK depletion alters inclusion of 406 cassette exons whose adjacent intron sequences are also enriched in ACUAA motifs. During differentiation of myoblasts to myotubes, QK levels increase two- to threefold, suggesting a mechanism for QK-responsive exon regulation. Combined analysis of the PTB- and QK-splicing regulatory networks during myogenesis suggests that 39% of regulated exons are under the control of one or both of these splicing factors. This work provides the first evidence that QK is a global regulator of splicing during muscle development in vertebrates and shows how overlapping splicing regulatory networks contribute to gene expression programs during differentiation. PMID:23525800

Traceless splicing enabled by substrate-induced activation of the Nostoc punctiforme Npu DnaE intein after mutation of a catalytic cysteine to serine.

PubMed

Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine

2014-12-12

Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.

Conserved developmental alternative splicing of muscleblind-like (MBNL) transcripts regulates MBNL localization and activity.

PubMed

Terenzi, Fulvia; Ladd, Andrea N

2010-01-01

Muscleblind-like (MBNL) proteins have been shown to regulate pre-mRNA alternative splicing, and MBNL1 has been implicated in regulating fetal-to-adult transitions in alternative splicing in the heart. MBNL1 is highly conserved, exhibiting more than 95% identity at the amino acid level between birds and mammals. To investigate MBNL1 expression during embryonic heart development, we examined MBNL1 transcript and protein expression in the embryonic chicken heart from the formation of the primitive heart tube through cardiac morphogenesis (embryonic days 1.5 through 8). MBNL1 transcript levels remained steady throughout these stages, whereas MBNL1 protein levels increased and exhibited a shift in isoforms. MBNL1 has several alternatively spliced exons. Using RT-PCR, we determined that the inclusion of one of these, exon 5, decreases dramatically during cardiac morphogenesis. This developmental transition is conserved in mice. Functional analyses of MBNL1 isoforms containing or lacking exon 5-encoded sequences revealed that exon 5 is important for the regulation of the subcellular localization, RNA binding affinity, and alternative splicing activity of MBNL1 proteins. A second MBNL protein, MBNL2, is also expressed in the embryonic heart. We found that MBNL2 exon 5, which is paralogous to MBNL1 exon 5, is similarly regulated during embryonic heart development. Analysis of MBNL1 and MBNL2 transcripts in several embryonic tissues in chicken and mouse indicate that exon 5 alternative splicing is highly conserved and tissue-specific. Thus, we propose that conserved developmental stage- and tissue-specific alternative splicing of MBNL transcripts is an important mechanism by which MBNL activity is regulated during embryonic development.

Research on Splicing Method of Digital Relic Fragment Model

NASA Astrophysics Data System (ADS)

Yan, X.; Hu, Y.; Hou, M.

2018-04-01

In the course of archaeological excavation, a large number of pieces of cultural relics were unearthed, and the restoration of these fragments was done manually by traditional arts and crafts experts. In this process, cultural relics experts often try to splice the existing cultural relics, and then use adhesive to stick together the fragments of correct location, which will cause irreversible secondary damage to cultural relics. In order to minimize such damage, the surveyors combine 3D laser scanning with computer technology, and use the method of establishing digital cultural relics fragments model to make virtual splicing of cultural relics. The 3D software on the common market can basically achieve the model translation and rotation, using this two functions can be achieved manually splicing between models, mosaic records after the completion of the specific location of each piece of fragments, so as to effectively reduce the damage to the relics had tried splicing process.

The group II intron maturase: a reverse transcriptase and splicing factor go hand in hand.

PubMed

Zhao, Chen; Pyle, Anna Marie

2017-12-01

The splicing of group II introns in vivo requires the assistance of a multifunctional intron encoded protein (IEP, or maturase). Each IEP is also a reverse-transcriptase enzyme that enables group II introns to behave as mobile genetic elements. During splicing or retro-transposition, each group II intron forms a tight, specific complex with its own encoded IEP, resulting in a highly reactive holoenzyme. This review focuses on the structural basis for IEP function, as revealed by recent crystal structures of an IEP reverse transcriptase domain and cryo-EM structures of an IEP-intron complex. These structures explain how the same IEP scaffold is utilized for intron recognition, splicing and reverse transcription, while providing a physical basis for understanding the evolutionary transformation of the IEP into the eukaryotic splicing factor Prp8. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sex determination in insects: a binary decision based on alternative splicing.

PubMed

Salz, Helen K

2011-08-01

The gene regulatory networks that control sex determination vary between species. Despite these differences, comparative studies in insects have found that alternative splicing is reiteratively used in evolution to control expression of the key sex-determining genes. Sex determination is best understood in Drosophila where activation of the RNA binding protein-encoding gene Sex-lethal is the central female-determining event. Sex-lethal serves as a genetic switch because once activated it controls its own expression by a positive feedback splicing mechanism. Sex fate choice in is also maintained by self-sustaining positive feedback splicing mechanisms in other dipteran and hymenopteran insects, although different RNA binding protein-encoding genes function as the binary switch. Studies exploring the mechanisms of sex-specific splicing have revealed the extent to which sex determination is integrated with other developmental regulatory networks. Copyright © 2011 Elsevier Ltd. All rights reserved.

Fox-2 Splicing Factor Binds to a Conserved Intron Motif to PromoteInclusion of Protein 4.1R Alternative Exon 16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo

Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding tomore » the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.« less

The Choice of Alternative 5' Splice Sites in Influenza Virus M1 mRNA is Regulated by the Viral Polymerase Complex

NASA Astrophysics Data System (ADS)

Shih, Shin-Ru; Nemeroff, Martin E.; Krug, Robert M.

1995-07-01

The influenza virus M1 mRNA has two alternative 5' splice sites: a distal 5' splice site producing mRNA_3 that has the coding potential for 9 amino acids and a proximal 5' splice site producing M2 mRNA encoding the essential M2 ion-channel protein. Only mRNA_3 was made in uninfected cells transfected with DNA expressing M1 mRNA. Similarly, using nuclear extracts from uninfected cells, in vitro splicing of M1 mRNA yielded only mRNA_3. Only when the mRNA_3 5' splice site was inactivated by mutation was M2 mRNA made in uninfected cells and in uninfected cell extracts. In influenza virus-infected cells, M2 mRNA was made, but only after a delay, suggesting that newly synthesized viral gene product(s) were needed to activate the M2 5' splice site. We present strong evidence that these gene products are the complex of the three polymerase proteins, the same complex that functions in the transcription and replication of the viral genome. Gel shift experiments showed that the viral polymerase complex bound to the 5' end of the viral M1 mRNA in a sequence-specific and cap-dependent manner. During in vitro splicing catalyzed by uninfected cell extracts, the binding of the viral polymerase complex blocked the mRNA_3 5' splice site, resulting in the switch to the M2 mRNA 5' splice site and the production of M2 mRNA.

Photos

Science.gov Websites

Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

Newsroom

Science.gov Websites

Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

Abiotic Stresses Modulate Landscape of Poplar Transcriptome via Alternative Splicing, Differential Intron Retention, and Isoform Ratio Switching

PubMed Central

Filichkin, Sergei A.; Hamilton, Michael; Dharmawardhana, Palitha D.; Singh, Sunil K.; Sullivan, Christopher; Ben-Hur, Asa; Reddy, Anireddy S. N.; Jaiswal, Pankaj

2018-01-01

Abiotic stresses affect plant physiology, development, growth, and alter pre-mRNA splicing. Western poplar is a model woody tree and a potential bioenergy feedstock. To investigate the extent of stress-regulated alternative splicing (AS), we conducted an in-depth survey of leaf, root, and stem xylem transcriptomes under drought, salt, or temperature stress. Analysis of approximately one billion of genome-aligned RNA-Seq reads from tissue- or stress-specific libraries revealed over fifteen millions of novel splice junctions. Transcript models supported by both RNA-Seq and single molecule isoform sequencing (Iso-Seq) data revealed a broad array of novel stress- and/or tissue-specific isoforms. Analysis of Iso-Seq data also resulted in the discovery of 15,087 novel transcribed regions of which 164 show AS. Our findings demonstrate that abiotic stresses profoundly perturb transcript isoform profiles and trigger widespread intron retention (IR) events. Stress treatments often increased or decreased retention of specific introns – a phenomenon described here as differential intron retention (DIR). Many differentially retained introns were regulated in a stress- and/or tissue-specific manner. A subset of transcripts harboring super stress-responsive DIR events showed persisting fluctuations in the degree of IR across all treatments and tissue types. To investigate coordinated dynamics of intron-containing transcripts in the study we quantified absolute copy number of isoforms of two conserved transcription factors (TFs) using Droplet Digital PCR. This case study suggests that stress treatments can be associated with coordinated switches in relative ratios between fully spliced and intron-retaining isoforms and may play a role in adjusting transcriptome to abiotic stresses. PMID:29483921

Alternative splicing disabled by Nova2.

PubMed

Park, Tae-Ju; Curran, Tom

2010-06-24

Disabled-1 is a key signaling molecule in the Reelin pathway that plays a critical role in neuronal migration and positioning during brain development. In this issue of Neuron, Yano et al. demonstrate that the neuron-specific RNA binding protein Nova2 contributes to neuronal migration by regulating alternative splicing of disabled-1.

Residential Wiring: Electrical Connections [and] Tools and Equipment.

ERIC Educational Resources Information Center

Texas A and M Univ., College Station. Vocational Instructional Services.

Intended for student use, this unit focuses on making good electrical splices and electrical connections, and discusses tools and equipment used in house wiring jobs. Specific areas covered in the connections section are types of splices, solder equipment and supplies, and solderless connectors (plastic caps, split bolt connectors, crimp-type…

RNA splicing, cell signaling, and response to therapies.

PubMed

Abou Faycal, Cherine; Gazzeri, Sylvie; Eymin, Beatrice

2016-01-01

PremRNA alternative splicing is more a rule than an exception as it affects more than 90% of multiexons genes and plays a key role in proteome diversity. Here, we discuss some recent studies published in the extensively growing field linking RNA splicing and cancer. These last years, the development of high-throughput studies together with appropriate bioinformatic tools have led to the identification of new cancer-specific splicing patterns that allow to distinguish various cancer types, and provide new prognosis biomarkers. In addition, the functional consequences of hot spot mutations affecting various components of the spliceosome machinery in cancers have been described. As an example, missplicing of the enhancer of zeste homolog 2 histone methyltransferase premRNA in response to hot spot mutation of the splicing factor SRSF2 was found to participate to the pathogenesis of myelodysplastic syndrome. Moreover, proofs of principle that targeting the RNA splicing machinery can be used to correct aberrant missplicing, kill oncogene-driven cancer cells, or reverse resistance of tumor cells to targeted therapies have been done. As another example, the core spliceosomal function was recently found to be critical for the survival of Myc-driven breast cancer cells, rendering them hypersensitive to spliceosome inhibitors. Dysregulation of premRNA alternative splicing appears to be one of the hallmarks of cancer. The characterization of novel splicing signatures in cancer as well as the identification of original signaling networks involving RNA splicing regulators should allow to decipher novel oncogenic mechanisms and to develop new therapeutic strategies.

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation.

PubMed

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G; Xie, Jiuyong

2012-09-01

The molecular basis of cell signal-regulated alternative splicing at the 3' splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3' splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3' splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3' splice site usage.

A dual-specificity isoform of the protein kinase inhibitor PKI produced by alternate gene splicing.

PubMed

Kumar, Priyadarsini; Walsh, Donal A

2002-03-15

We have previously shown that the protein kinase inhibitor beta (PKIbeta) form of the cAMP-dependent protein kinase inhibitor exists in multiple isoforms, some of which are specific inhibitors of the cAMP-dependent protein kinase, whereas others also inhibit the cGMP-dependent enzyme [Kumar, Van Patten and Walsh (1997), J. Biol. Chem. 272, 20011-20020]. We have now demonstrated that the switch from a cAMP-dependent protein kinase (PKA)-specific inhibitor to one with dual specificity arises as a consequence of alternate gene splicing. We have confirmed using bacterially produced pure protein that a single inhibitor species has dual specificity for both PKA and cGMP-dependent protein kinase (PKG), inhibiting each with very high and closely similar inhibitory potencies. The gene splicing converted a protein with 70 amino acids into one of 109 amino acids, and did not change the inhibitory potency to PKA, but changed it from a protein that had no detectable PKG inhibitory activity to one that now inhibited PKG in the nanomolar range.

Characterization of the canine mda-7 gene, transcripts and expression patterns

PubMed Central

Sandey, Maninder; Bird, R. Curtis; Das, Swadesh K.; Sarkar, Devanand; Curiel, David T.; Fisher, Paul B.; Smith, Bruce F.

2014-01-01

Human melanoma differentiation associated gene-7/interleukin-24 (mda-7/IL-24) displays potent growth suppressing and cell killing activity against a wide variety of human and rodent cancer cells. In this study, we identified a canine ortholog of the human mda-7/IL-24 gene located within a cluster of IL-10 family members on chromosome 7. The full-length mRNA sequence of canine mda-7 was determined, which encodes a 186-amino acid protein that has 66% similarity to human MDA-7/IL-24. Canine MDA-7 is constitutively expressed in cultured normal canine epidermal keratinocytes (NCEKs), and its expression levels are increased after lipopolysaccharide stimulation. In cultured NCEKs, the canine mda-7 pre-mRNA is differentially spliced, via exon skipping and alternate 5′-splice donor sites, to yield five splice variants (canine mda-7sv1, canine mda-7sv2, canine mda-7sv3, canine mda-7sv4 and canine mda-7sv5) that encode four protein isoforms of the canine MDA-7 protein. These protein isoforms have a conserved N-terminus (signal peptide sequence) and are dissimilar in amino acid sequences at their C-terminus. Canine MDA-7 is not expressed in primary canine tumor samples, and most tumor derived cancer cell lines tested, like its human counterpart. Unlike human MDA-7/IL-24, canine mda-7 mRNA is not expressed in unstimulated or lipopolysaccharide (LPS), concanavalin A (ConA) or phytohemagglutinin (PHA) stimulated canine peripheral blood mononuclear cells (PBMCs). Furthermore, in-silico analysis revealed that canonical canine MDA-7 has a potential 28 amino acid signal peptide sequence that can target it for active secretion. This data suggests that canine mda-7 is indeed an ortholog of human mda-7/IL-24, its protein product has high amino acid similarity to human MDA-7/IL-24 protein and it may possess similar biological properties to human MDA-7/IL-24, but its expression pattern is more restricted than its human ortholog. PMID:24865935

Organellar maturases: A window into the evolution of the spliceosome.

PubMed

Schmitz-Linneweber, Christian; Lampe, Marie-Kristin; Sultan, Laure D; Ostersetzer-Biran, Oren

2015-09-01

During the evolution of eukaryotic genomes, many genes have been interrupted by intervening sequences (introns) that must be removed post-transcriptionally from RNA precursors to form mRNAs ready for translation. The origin of nuclear introns is still under debate, but one hypothesis is that the spliceosome and the intron-exon structure of genes have evolved from bacterial-type group II introns that invaded the eukaryotic genomes. The group II introns were most likely introduced into the eukaryotic genome from an α-proteobacterial predecessor of mitochondria early during the endosymbiosis event. These self-splicing and mobile introns spread through the eukaryotic genome and later degenerated. Pieces of introns became part of the general splicing machinery we know today as the spliceosome. In addition, group II introns likely brought intron maturases with them to the nucleus. Maturases are found in most bacterial introns, where they act as highly specific splicing factors for group II introns. In the spliceosome, the core protein Prp8 shows homology to group II intron-encoded maturases. While maturases are entirely intron specific, their descendant of the spliceosomal machinery, the Prp8 protein, is an extremely versatile splicing factor with multiple interacting proteins and RNAs. How could such a general player in spliceosomal splicing evolve from the monospecific bacterial maturases? Analysis of the organellar splicing machinery in plants may give clues on the evolution of nuclear splicing. Plants encode various proteins which are closely related to bacterial maturases. The organellar genomes contain one maturase each, named MatK in chloroplasts and MatR in mitochondria. In addition, several maturase genes have been found in the nucleus as well, which are acting on mitochondrial pre-RNAs. All plant maturases show sequence deviation from their progenitor bacterial maturases, and interestingly are all acting on multiple organellar group II intron targets. Moreover, they seem to function in the splicing of group II introns together with a number of additional nuclear-encoded splicing factors, possibly acting as an organellar proto-spliceosome. Together, this makes them interesting models for the early evolution of nuclear spliceosomal splicing. In this review, we summarize recent advances in our understanding of the role of plant maturases and their accessory factors in plants. This article is part of a Special Issue entitled: Chloroplast Biogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

Maternal and best friends' influences on meal-skipping behaviours.

PubMed

Pearson, Natalie; Williams, Lauren; Crawford, David; Ball, Kylie

2012-09-01

Skipping meals is particularly common during adolescence and can have a detrimental effect on multiple aspects of adolescent health. Understanding the correlates of meal-skipping behaviours is important for the design of nutrition interventions. The present study examined maternal and best friends' influences on adolescent meal-skipping behaviours. Frequency of skipping breakfast, lunch and dinner was assessed using a Web-based survey completed by 3001 adolescent boys and girls from years 7 and 9 of secondary schools in Victoria, Australia. Perceived best friend and maternal meal skipping, modelling of healthy eating (eating healthy food, limiting junk food, eating fruit and vegetables) and weight watching were assessed. Best friend and maternal factors were differentially associated with meal-skipping behaviours. For example, boys and girls who perceived that their best friend often skipped meals were more likely to skip lunch (OR = 2·01, 95 % CI 1·33, 3·04 and OR = 1·93, 95 % CI 1·41, 2·65; P < 0·001). Boys and girls who perceived that their mother often skipped meals were more likely to skip breakfast (OR = 1·48, 95 % CI 1·01, 2·15; P < 0·05 and OR = 1·93, 95 % CI 1·42, 2·59; P < 0·001) and lunch (OR = 2·05, 95 % CI 1·35, 3·12 and OR = 2·02, 95 % CI 1·43, 2·86; P < 0·001). Educating adolescents on how to assess and interpret unhealthy eating behaviours that they observe from significant others may be one nutrition promotion strategy to reduce meal-skipping behaviour. The involvement of mothers may be particularly important in such efforts. Encouraging a peer subculture that promotes regular consumption of meals and educates adolescents on the detrimental impact of meal-skipping behaviour on health may also offer a promising nutrition promotion strategy.

Global Profiling of the Cellular Alternative RNA Splicing Landscape during Virus-Host Interactions

PubMed Central

Boudreault, Simon; Martenon-Brodeur, Camille; Caron, Marie; Garant, Jean-Michel; Tremblay, Marie-Pier; Armero, Victoria E. S.; Durand, Mathieu; Lapointe, Elvy; Thibault, Philippe; Tremblay-Létourneau, Maude; Perreault, Jean-Pierre; Scott, Michelle S.; Lemay, Guy; Bisaillon, Martin

2016-01-01

Alternative splicing (AS) is a central mechanism of genetic regulation which modifies the sequence of RNA transcripts in higher eukaryotes. AS has been shown to increase both the variability and diversity of the cellular proteome by changing the composition of resulting proteins through differential choice of exons to be included in mature mRNAs. In the present study, alterations to the global RNA splicing landscape of cellular genes upon viral infection were investigated using mammalian reovirus as a model. Our study provides the first comprehensive portrait of global changes in the RNA splicing signatures that occur in eukaryotic cells following infection with a human virus. We identify 240 modified alternative splicing events upon infection which belong to transcripts frequently involved in the regulation of gene expression and RNA metabolism. Using mass spectrometry, we also confirm modifications to transcript-specific peptides resulting from AS in virus-infected cells. These findings provide additional insights into the complexity of virus-host interactions as these splice variants expand proteome diversity and function during viral infection. PMID:27598998

Global Profiling of the Cellular Alternative RNA Splicing Landscape during Virus-Host Interactions.

PubMed

Boudreault, Simon; Martenon-Brodeur, Camille; Caron, Marie; Garant, Jean-Michel; Tremblay, Marie-Pier; Armero, Victoria E S; Durand, Mathieu; Lapointe, Elvy; Thibault, Philippe; Tremblay-Létourneau, Maude; Perreault, Jean-Pierre; Scott, Michelle S; Lemay, Guy; Bisaillon, Martin

2016-01-01

Alternative splicing (AS) is a central mechanism of genetic regulation which modifies the sequence of RNA transcripts in higher eukaryotes. AS has been shown to increase both the variability and diversity of the cellular proteome by changing the composition of resulting proteins through differential choice of exons to be included in mature mRNAs. In the present study, alterations to the global RNA splicing landscape of cellular genes upon viral infection were investigated using mammalian reovirus as a model. Our study provides the first comprehensive portrait of global changes in the RNA splicing signatures that occur in eukaryotic cells following infection with a human virus. We identify 240 modified alternative splicing events upon infection which belong to transcripts frequently involved in the regulation of gene expression and RNA metabolism. Using mass spectrometry, we also confirm modifications to transcript-specific peptides resulting from AS in virus-infected cells. These findings provide additional insights into the complexity of virus-host interactions as these splice variants expand proteome diversity and function during viral infection.

A Targeted Oligonucleotide Enhancer of SMN2 Exon 7 Splicing Forms Competing Quadruplex and Protein Complexes in Functional Conditions

PubMed Central

Smith, Lindsay D.; Dickinson, Rachel L.; Lucas, Christian M.; Cousins, Alex; Malygin, Alexey A.; Weldon, Carika; Perrett, Andrew J.; Bottrill, Andrew R.; Searle, Mark S.; Burley, Glenn A.; Eperon, Ian C.

2014-01-01

Summary The use of oligonucleotides to activate the splicing of selected exons is limited by a poor understanding of the mechanisms affected. A targeted bifunctional oligonucleotide enhancer of splicing (TOES) anneals to SMN2 exon 7 and carries an exonic splicing enhancer (ESE) sequence. We show that it stimulates splicing specifically of intron 6 in the presence of repressing sequences in intron 7. Complementarity to the 5′ end of exon 7 increases U2AF65 binding, but the ESE sequence is required for efficient recruitment of U2 snRNP. The ESE forms at least three coexisting discrete states: a quadruplex, a complex containing only hnRNP F/H, and a complex enriched in the activator SRSF1. Neither hnRNP H nor quadruplex formation contributes to ESE activity. The results suggest that splicing limited by weak signals can be rescued by rapid exchange of TOES oligonucleotides in various complexes and raise the possibility that SR proteins associate transiently with ESEs. PMID:25263560

Novel down-regulatory mechanism of the surface expression of the vasopressin V2 receptor by an alternative splice receptor variant.

PubMed

Sarmiento, José M; Añazco, Carolina C; Campos, Danae M; Prado, Gregory N; Navarro, Javier; González, Carlos B

2004-11-05

In rat kidney, two alternatively spliced transcripts are generated from the V2 vasopressin receptor gene. The large transcript (1.2 kb) encodes the canonical V2 receptor, whereas the small transcript encodes a splice variant displaying a distinct sequence corresponding to the putative seventh transmembrane domain and the intracellular C terminus of the V2 receptor. This work showed that the small spliced transcript is translated in the rat kidney collecting tubules. However, the protein encoded by the small transcript (here called the V2b splice variant) is retained inside the cell, in contrast to the preferential surface distribution of the V2 receptor (here called the V2a receptor). Cells expressing the V2b splice variant do not exhibit binding to 3H-labeled vasopressin. Interestingly, we found that expression of the splice variant V2b down-regulates the surface expression of the V2a receptor, most likely via the formation of V2a.V2b heterodimers as demonstrated by co-immunoprecipitation and fluorescence resonance energy transfer experiments between the V2a receptor and the V2b splice variant. The V2b splice variant would then be acting as a dominant negative. The effect of the V2b splice variant is specific, as it does not affect the surface expression of the G protein-coupled interleukin-8 receptor (CXCR1). Furthermore, the sequence encompassing residues 242-339, corresponding to the C-terminal domain of the V2b splice variant, also down-regulates the surface expression of the V2a receptor. We suggest that some forms of nephrogenic diabetes insipidus are due to overexpression of the splice variant V2b, which could retain the wild-type V2a receptor inside the cell via the formation of V2a.V2b heterodimers.

Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing.

PubMed

Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

2003-01-01

Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing.

Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing

PubMed Central

Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

2003-01-01

Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing. PMID:14519201

Analysis of alternative splicing associated with aging and neurodegeneration in the human brain

PubMed Central

Tollervey, James R.; Wang, Zhen; Hortobágyi, Tibor; Witten, Joshua T.; Zarnack, Kathi; Kayikci, Melis; Clark, Tyson A.; Schweitzer, Anthony C.; Rot, Gregor; Curk, Tomaž; Zupan, Blaž; Rogelj, Boris; Shaw, Christopher E.; Ule, Jernej

2011-01-01

Age is the most important risk factor for neurodegeneration; however, the effects of aging and neurodegeneration on gene expression in the human brain have most often been studied separately. Here, we analyzed changes in transcript levels and alternative splicing in the temporal cortex of individuals of different ages who were cognitively normal, affected by frontotemporal lobar degeneration (FTLD), or affected by Alzheimer's disease (AD). We identified age-related splicing changes in cognitively normal individuals and found that these were present also in 95% of individuals with FTLD or AD, independent of their age. These changes were consistent with increased polypyrimidine tract binding protein (PTB)–dependent splicing activity. We also identified disease-specific splicing changes that were present in individuals with FTLD or AD, but not in cognitively normal individuals. These changes were consistent with the decreased neuro-oncological ventral antigen (NOVA)–dependent splicing regulation, and the decreased nuclear abundance of NOVA proteins. As expected, a dramatic down-regulation of neuronal genes was associated with disease, whereas a modest down-regulation of glial and neuronal genes was associated with aging. Whereas our data indicated that the age-related splicing changes are regulated independently of transcript-level changes, these two regulatory mechanisms affected expression of genes with similar functions, including metabolism and DNA repair. In conclusion, the alternative splicing changes identified in this study provide a new link between aging and neurodegeneration. PMID:21846794

Stability in skipping gaits

NASA Astrophysics Data System (ADS)

Andrada, Emanuel; Müller, Roy; Blickhan, Reinhard

2016-11-01

As an alternative to walking and running, humans are able to skip. However, adult humans avoid it. This fact seems to be related to the higher energetic costs associated with skipping. Still, children, some birds, lemurs and lizards use skipping gaits during daily locomotion. We combined experimental data on humans with numerical simulations to test whether stability and robustness motivate this choice. Parameters for modelling were obtained from 10 male subjects. They locomoted using unilateral skipping along a 12 m runway. We used a bipedal spring loaded inverted pendulum to model and to describe the dynamics of skipping. The subjects displayed higher peak ground reaction forces and leg stiffness in the first landing leg (trailing leg) compared to the second landing leg (leading leg). In numerical simulations, we found that skipping is stable across an amazing speed range from skipping on the spot to fast running speeds. Higher leg stiffness in the trailing leg permits longer strides at same system energy. However, this strategy is at the same time less robust to sudden drop perturbations than skipping with a stiffer leading leg. A slightly higher stiffness in the leading leg is most robust, but might be costlier.

Processing the in the parafovea: are articles skipped automatically?

PubMed

Angele, Bernhard; Rayner, Keith

2013-03-01

One of the words that readers of English skip most often is the definite article the. Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string t-h-e automatically. We tested whether skipping of articles in English is sensitive to context information or whether it is truly automatic in the sense that any occurrence of the letter string the will trigger a skip. This was done using the gaze-contingent boundary paradigm (Rayner, 1975) to provide readers with false parafoveal previews of the article the. All experimental sentences contained a short target verb, the preview of which could be correct (i.e., identical to the actual subsequent word in the sentence; e.g., ace), a nonword (tda), or an infelicitous article preview (the). Our results indicated that readers tended to skip the infelicitous the previews frequently, suggesting that, in many cases, they seemed to be unable to detect the syntactic anomaly in the preview and based their skipping decision solely on the orthographic properties of the article. However, there was some evidence that readers sometimes detected the anomaly, as they also showed increased skipping of the pretarget word in the the preview condition. (c) 2013 APA, all rights reserved.

Therapeutic NOTCH3 cysteine correction in CADASIL using exon skipping: in vitro proof of concept.

PubMed

Rutten, Julie W; Dauwerse, Hans G; Peters, Dorien J M; Goldfarb, Andrew; Venselaar, Hanka; Haffner, Christof; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke M; Lesnik Oberstein, Saskia A J

2016-04-01

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, or CADASIL, is a hereditary cerebral small vessel disease caused by characteristic cysteine altering missense mutations in the NOTCH3 gene. NOTCH3 mutations in CADASIL result in an uneven number of cysteine residues in one of the 34 epidermal growth factor like-repeat (EGFr) domains of the NOTCH3 protein. The consequence of an unpaired cysteine residue in an EGFr domain is an increased multimerization tendency of mutant NOTCH3, leading to toxic accumulation of the protein in the (cerebro)vasculature, and ultimately reduced cerebral blood flow, recurrent stroke and vascular dementia. There is no therapy to delay or alleviate symptoms in CADASIL. We hypothesized that exclusion of the mutant EGFr domain from NOTCH3 would abolish the detrimental effect of the unpaired cysteine and thus prevent toxic NOTCH3 accumulation and the negative cascade of events leading to CADASIL. To accomplish this NOTCH3 cysteine correction by EGFr domain exclusion, we used pre-mRNA antisense-mediated skipping of specific NOTCH3 exons. Selection of these exons was achieved using in silico studies and based on the criterion that skipping of a particular exon or exon pair would modulate the protein in such a way that the mutant EGFr domain is eliminated, without otherwise corrupting NOTCH3 structure and function. Remarkably, we found that this strategy closely mimics evolutionary events, where the elimination and fusion of NOTCH EGFr domains led to the generation of four functional NOTCH homologues. We modelled a selection of exon skip strategies using cDNA constructs and show that the skip proteins retain normal protein processing, can bind ligand and be activated by ligand. We then determined the technical feasibility of targeted NOTCH3 exon skipping, by designing antisense oligonucleotides targeting exons 2-3, 4-5 and 6, which together harbour the majority of distinct CADASIL-causing mutations. Transfection of these antisense oligonucleotides into CADASIL patient-derived cerebral vascular smooth muscle cells resulted in successful exon skipping, without abrogating NOTCH3 signalling. Combined, these data provide proof of concept for this novel application of exon skipping, and are a first step towards the development of a rational therapeutic approach applicable to up to 94% of CADASIL-causing mutations. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

CINT - Center for Integrated Nanotechnologies

Science.gov Websites

Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Search Site submit Facilities Discovery Platform Integration Lab User Facilities LUMOS Research Science Thrusts Integration Challenges Accepted User Proposals Data Management Becoming a User Call for Proposals Proposal Guidelines

Regulation of insulin preRNA splicing by glucose

PubMed Central

Wang, Juehu; Shen, Luping; Najafi, Habiba; Kolberg, Janice; Matschinsky, Franz M.; Urdea, Mickey; German, Michael

1997-01-01

Glucose tightly regulates the synthesis and secretion of insulin by β cells in the pancreatic islets of Langerhans. To investigate whether glucose regulates insulin synthesis at the level of insulin RNA splicing, we developed a method to detect and quantify a small amount of RNA by using the branched DNA (bDNA) signal-amplification technique. This assay is both sensitive and highly specific: mouse insulin II mRNA can be detected from a single β cell (βTC3 cells or mouse islets), whereas 1 million non-insulin-producing α cells (αTC1.6 cells) give no signal. By using intron and exon sequences, oligonucleotide probes were designed to distinguish the various unspliced and partially spliced insulin preRNAs from mature insulin mRNA. Insulin RNA splicing rates were estimated from the rate of disappearance of insulin preRNA signal from β cells treated with actinomycin D to block transcription. We found that the two introns in mouse insulin II are not spliced with the same efficiency. Intron 2 is spliced out more efficiently than intron 1. As a result, some mRNA retaining intron 1 enters the cytoplasm, making up ≈2-10% of insulin mRNA in the cell. This partially spliced cytoplasmic mRNA is quite stable, with a half-life similar to the completely spliced form. When islets grown in high glucose are shifted to low glucose medium, the level of insulin preRNA and the rate of splicing fall significantly. We conclude that glucose stimulates insulin gene transcription and insulin preRNA splicing. Previous estimates of insulin transcription rates based on insulin preRNA levels that did not consider the rate of splicing may have underestimated the effect of glucose on insulin gene transcription. PMID:9113994

A Novel Intra-U1 snRNP Cross-Regulation Mechanism: Alternative Splicing Switch Links U1C and U1-70K Expression

PubMed Central

Rösel-Hillgärtner, Tanja Dorothe; Hung, Lee-Hsueh; Khrameeva, Ekaterina; Le Querrec, Patrick; Gelfand, Mikhail S.; Bindereif, Albrecht

2013-01-01

The U1 small nuclear ribonucleoprotein (snRNP)-specific U1C protein participates in 5′ splice site recognition and regulation of pre-mRNA splicing. Based on an RNA-Seq analysis in HeLa cells after U1C knockdown, we found a conserved, intra-U1 snRNP cross-regulation that links U1C and U1-70K expression through alternative splicing and U1 snRNP assembly. To investigate the underlying regulatory mechanism, we combined mutational minigene analysis, in vivo splice-site blocking by antisense morpholinos, and in vitro binding experiments. Alternative splicing of U1-70K pre-mRNA creates the normal (exons 7–8) and a non-productive mRNA isoform, whose balance is determined by U1C protein levels. The non-productive isoform is generated through a U1C-dependent alternative 3′ splice site, which requires an adjacent cluster of regulatory 5′ splice sites and binding of intact U1 snRNPs. As a result of nonsense-mediated decay (NMD) of the non-productive isoform, U1-70K mRNA and protein levels are down-regulated, and U1C incorporation into the U1 snRNP is impaired. U1-70K/U1C-deficient particles are assembled, shifting the alternative splicing balance back towards productive U1-70K splicing, and restoring assembly of intact U1 snRNPs. Taken together, we established a novel feedback regulation that controls U1-70K/U1C homeostasis and ensures correct U1 snRNP assembly and function. PMID:24146627

Therapeutic strategies based on modified U1 snRNAs and chaperones for Sanfilippo C splicing mutations.

PubMed

Matos, Liliana; Canals, Isaac; Dridi, Larbi; Choi, Yoo; Prata, Maria João; Jordan, Peter; Desviat, Lourdes R; Pérez, Belén; Pshezhetsky, Alexey V; Grinberg, Daniel; Alves, Sandra; Vilageliu, Lluïsa

2014-12-10

Mutations affecting RNA splicing represent more than 20% of the mutant alleles in Sanfilippo syndrome type C, a rare lysosomal storage disorder that causes severe neurodegeneration. Many of these mutations are localized in the conserved donor or acceptor splice sites, while few are found in the nearby nucleotides. In this study we tested several therapeutic approaches specifically designed for different splicing mutations depending on how the mutations affect mRNA processing. For three mutations that affect the donor site (c.234 + 1G > A, c.633 + 1G > A and c.1542 + 4dupA), different modified U1 snRNAs recognizing the mutated donor sites, have been developed in an attempt to rescue the normal splicing process. For another mutation that affects an acceptor splice site (c.372-2A > G) and gives rise to a protein lacking four amino acids, a competitive inhibitor of the HGSNAT protein, glucosamine, was tested as a pharmacological chaperone to correct the aberrant folding and to restore the normal trafficking of the protein to the lysosome. Partial correction of c.234 + 1G > A mutation was achieved with a modified U1 snRNA that completely matches the splice donor site suggesting that these molecules may have a therapeutic potential for some splicing mutations. Furthermore, the importance of the splice site sequence context is highlighted as a key factor in the success of this type of therapy. Additionally, glucosamine treatment resulted in an increase in the enzymatic activity, indicating a partial recovery of the correct folding. We have assayed two therapeutic strategies for different splicing mutations with promising results for the future applications.

ACHP | News

Science.gov Websites

Search skip specific nav links Home arrow News Internal Revenue Service Wins Chairman's Award for Federal Redstone Castle WASHINGTON, DC-The Internal Revenue Service (IRS) received the Advisory Council on Historic

ACHP | News | ACHP Spring Business Meeting May 5

Science.gov Websites

Search skip specific nav links Home arrow News arrow ACHP Chairman Wayne Donaldson Celebrates with LA Preserve America Neighborhoods ACHP Chairman Wayne Donaldson Celebrates with LA Preserve America

ACHP | ACHP Native American Program: Guidance for Federal Agencies

Science.gov Websites

Working with Section 106 Federal, State, & Tribal Programs Training & Education Publications Search skip specific nav links Home arrow Working with Section 106 arrow ACHP Native American Program

The Clk/Sty protein kinase phosphorylates SR splicing factors and regulates their intranuclear distribution.

PubMed Central

Colwill, K; Pawson, T; Andrews, B; Prasad, J; Manley, J L; Bell, J C; Duncan, P I

1996-01-01

Mammalian Clk/Sty is the prototype for a family of dual specificity kinases (termed LAMMER kinases) that have been conserved in evolution, but whose physiological substrates are unknown. In a yeast two-hybrid screen, the Clk/Sty kinase specifically interacted with RNA binding proteins, particularly members of the serine/arginine-rich (SR) family of splicing factors. Clk/Sty itself has an serine/arginine-rich non-catalytic N-terminal region which is important for its association with SR splicing factors. In vitro, Clk/Sty efficiently phosphorylated the SR family member ASF/SF2 on serine residues located within its serine/arginine-rich region (the RS domain). Tryptic phosphopeptide mapping demonstrated that the sites on ASF/SF2 phosphorylated in vitro overlap with those phosphorylated in vivo. Immunofluorescence studies showed that a catalytically inactive form of Clk/Sty co-localized with SR proteins in nuclear speckles. Overexpression of the active Clk/Sty kinase caused a redistribution of SR proteins within the nucleus. These results suggest that Clk/Sty kinase directly regulates the activity and compartmentalization of SR splicing factors. Images PMID:8617202

New Phosphospecific Antibody Reveals Isoform-Specific Phosphorylation of CPEB3 Protein

PubMed Central

Sehgal, Kapil; Sylvester, Marc; Skubal, Magdalena; Josten, Michele; Steinhäuser, Christian; De Koninck, Paul; Theis, Martin

2016-01-01

Cytoplasmic Polyadenylation Element Binding proteins (CPEBs) are a family of polyadenylation factors interacting with 3’UTRs of mRNA and thereby regulating gene expression. Various functions of CPEBs in development, synaptic plasticity, and cellular senescence have been reported. Four CPEB family members of partially overlapping functions have been described to date, each containing a distinct alternatively spliced region. This region is highly conserved between CPEBs-2-4 and contains a putative phosphorylation consensus, overlapping with the exon seven of CPEB3. We previously found CPEBs-2-4 splice isoforms containing exon seven to be predominantly present in neurons, and the isoform expression pattern to be cell type-specific. Here, focusing on the alternatively spliced region of CPEB3, we determined that putative neuronal isoforms of CPEB3 are phosphorylated. Using a new phosphospecific antibody directed to the phosphorylation consensus we found Protein Kinase A and Calcium/Calmodulin-dependent Protein Kinase II to robustly phosphorylate CPEB3 in vitro and in primary hippocampal neurons. Interestingly, status epilepticus induced by systemic kainate injection in mice led to specific upregulation of the CPEB3 isoforms containing exon seven. Extensive analysis of CPEB3 phosphorylation in vitro revealed two other phosphorylation sites. In addition, we found plethora of potential kinases that might be targeting the alternatively spliced kinase consensus site of CPEB3. As this site is highly conserved between the CPEB family members, we suggest the existence of a splicing-based regulatory mechanism of CPEB function, and describe a robust phosphospecific antibody to study it in future. PMID:26915047

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Regulation and Functional Implications of Opioid Receptor Splicing in Opioid Pharmacology and HIV Pathogenesis

PubMed Central

Regan, Patrick M.; Langford, T. Dianne; Khalili, Kamel

2015-01-01

Despite the identification and characterization of four opioid receptor subtypes and the genes from which they are encoded, pharmacological data does not conform to the predications of a four opioid receptor model. Instead, current studies of opioid pharmacology suggest the existence of additional receptor subtypes; however, no additional opioid receptor subtype has been identified to date. It is now understood that this discrepancy is due to the generation of multiple isoforms of opioid receptor subtypes. While several mechanisms are utilized to generate these isoforms, the primary mechanism involves alternative splicing of the pre-mRNA transcript. Extensive alternative splicing patterns for opioid receptors have since been identified and discrepancies in opioid pharmacology are now partially attributed to variable expression of these isoforms. Recent studies have been successful in characterizing the localization of these isoforms as well as their specificity in ligand binding; however, the regulation of opioid receptor splicing specificity is poorly characterized. Furthermore, the functional significance of individual receptor isoforms and the extent to which opioid- and/or HIV-mediated changes in the opioid receptor isoform profile contributes to altered opioid pharmacology or the well-known physiological role of opioids in the exacerbation of HIV neurocognitive dysfunction is unknown. As such, the current review details constitutive splicing mechanisms as well as the specific architecture of opioid receptor genes, transcripts, and receptors in order to highlight the current understanding of opioid receptor isoforms, potential mechanisms of their regulation and signaling, and their functional significance in both opioid pharmacology and HIV-associated neuropathology. PMID:26529364

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

Analysis of alternative splicing events for cancer diagnosis using a multiplexing nanophotonic biosensor

PubMed Central

Huertas, César S.; Domínguez-Zotes, Santos; Lechuga, Laura M.

2017-01-01

Personalized medicine is a promising tool not only for prevention, screening and development of more efficient treatment strategies, but also for diminishing the side effects caused by current therapies. Deciphering gene regulation pathways provides a reliable prognostic analysis to elucidate the origin of grave diseases and facilitate the selection of the most adequate treatment for each individual. Alternative splicing of mRNA precursors is one of these gene regulation pathways and enables cells to generate different protein outputs from the same gene depending on their developmental or homeostatic status. Its deregulation is strongly linked to disease onset and progression constituting a relevant and innovative class of biomarker. Herein we report a highly selective and sensitive nanophotonic biosensor based on the direct monitoring of the aberrant alternative splicing of Fas gene. Unlike conventional methods, the nanobiosensor performs a real-time detection of the specific isoforms in the fM-pM range without any cDNA synthesis or PCR amplification requirements. The nanobiosensor has been proven isoform-specific with no crosshybridization, greatly minimizing detection biases. The demonstrated high sensitivity and specificity make our nanobiosensor ideal for examining significant tumor-associated expression shifts of alternatively spliced isoforms for the early and accurate theranostics of cancer. PMID:28120920

Analysis of alternative splicing events for cancer diagnosis using a multiplexing nanophotonic biosensor.

PubMed

Huertas, César S; Domínguez-Zotes, Santos; Lechuga, Laura M

2017-01-25

Personalized medicine is a promising tool not only for prevention, screening and development of more efficient treatment strategies, but also for diminishing the side effects caused by current therapies. Deciphering gene regulation pathways provides a reliable prognostic analysis to elucidate the origin of grave diseases and facilitate the selection of the most adequate treatment for each individual. Alternative splicing of mRNA precursors is one of these gene regulation pathways and enables cells to generate different protein outputs from the same gene depending on their developmental or homeostatic status. Its deregulation is strongly linked to disease onset and progression constituting a relevant and innovative class of biomarker. Herein we report a highly selective and sensitive nanophotonic biosensor based on the direct monitoring of the aberrant alternative splicing of Fas gene. Unlike conventional methods, the nanobiosensor performs a real-time detection of the specific isoforms in the fM-pM range without any cDNA synthesis or PCR amplification requirements. The nanobiosensor has been proven isoform-specific with no crosshybridization, greatly minimizing detection biases. The demonstrated high sensitivity and specificity make our nanobiosensor ideal for examining significant tumor-associated expression shifts of alternatively spliced isoforms for the early and accurate theranostics of cancer.

Impact, Characterization, and Rescue of Pre-mRNA Splicing Mutations in Lysosomal Storage Disorders.

PubMed

Dardis, Andrea; Buratti, Emanuele

2018-02-06

Lysosomal storage disorders (LSDs) represent a group of more than 50 severe metabolic diseases caused by the deficiency of specific lysosomal hydrolases, activators, carriers, or lysosomal integral membrane proteins, leading to the abnormal accumulation of substrates within the lysosomes. Numerous mutations have been described in each disease-causing gene; among them, about 5-19% affect the pre-mRNA splicing process. In the last decade, several strategies to rescue/increase normal splicing of mutated transcripts have been developed and LSDs represent excellent candidates for this type of approach: (i) most of them are inherited in an autosomic recessive manner and patients affected by late-onset (LO) phenotypes often retain a fair amount of residual enzymatic activity; thus, even a small recovery of normal splicing may be beneficial in clinical settings; (ii) most LSDs still lack effective treatments or are currently treated with extremely expensive approaches; (iii) in few LSDs, a single splicing mutation accounts for up to 40-70% of pathogenic alleles. At present, numerous preclinical studies support the feasibility of reverting the pathological phenotype by partially rescuing splicing defects in LSDs. This review provides an overview of the impact of splicing mutations in LSDs and the related therapeutic approaches currently under investigation in these disorders.

A protocol of rope skipping exercise for primary school children: A pilot test

NASA Astrophysics Data System (ADS)

Radzi, A. N. M.; Rambely, A. S.; Chellapan, K.

2014-06-01

This paper aims to investigate the methods and sample used in rope skipping as an exercise approach. A systematic literature review was approached in identifying skipping performance in the related researches. The methods were compared to determine the best methodological approach for the targeted skipping based research measure. A pilot test was performed among seven students below 12 years old. As the outcome of the review, a skipping protocol design has been proposed for 10 years old primary school students. The proposed protocol design is to be submitted to PPUKM Ethical Committee for approval prior to its implementation in investigation memory enhancement in relation to designed skipping activities.

The effect of high- and low-frequency previews and sentential fit on word skipping during reading

PubMed Central

Angele, Bernhard; Laishley, Abby; Rayner, Keith; Liversedge, Simon P.

2014-01-01

In a previous gaze-contingent boundary experiment, Angele and Rayner (2012) found that readers are likely to skip a word that appears to be the definite article the even when syntactic constraints do not allow for articles to occur in that position. In the present study, we investigated whether the word frequency of the preview of a three-letter target word influences a reader’s decision to fixate or skip that word. We found that the word frequency rather than the felicitousness (syntactic fit) of the preview affected how often the upcoming word was skipped. These results indicate that visual information about the upcoming word trumps information from the sentence context when it comes to making a skipping decision. Skipping parafoveal instances of the therefore may simply be an extreme case of skipping high-frequency words. PMID:24707791

Evolution of introns in the archaeal world.

PubMed

Tocchini-Valentini, Giuseppe D; Fruscoloni, Paolo; Tocchini-Valentini, Glauco P

2011-03-22

The self-splicing group I introns are removed by an autocatalytic mechanism that involves a series of transesterification reactions. They require RNA binding proteins to act as chaperones to correctly fold the RNA into an active intermediate structure in vivo. Pre-tRNA introns in Bacteria and in higher eukaryote plastids are typical examples of self-splicing group I introns. By contrast, two striking features characterize RNA splicing in the archaeal world. First, self-splicing group I introns cannot be found, to this date, in that kingdom. Second, the RNA splicing scenario in Archaea is uniform: All introns, whether in pre-tRNA or elsewhere, are removed by tRNA splicing endonucleases. We suggest that in Archaea, the protein recruited for splicing is the preexisting tRNA splicing endonuclease and that this enzyme, together with the ligase, takes over the task of intron removal in a more efficient fashion than the ribozyme. The extinction of group I introns in Archaea would then be a consequence of recruitment of the tRNA splicing endonuclease. We deal here with comparative genome analysis, focusing specifically on the integration of introns into genes coding for 23S rRNA molecules, and how this newly acquired intron has to be removed to regenerate a functional RNA molecule. We show that all known oligomeric structures of the endonuclease can recognize and cleave a ribosomal intron, even when the endonuclease derives from a strain lacking rRNA introns. The persistence of group I introns in mitochondria and chloroplasts would be explained by the inaccessibility of these introns to the endonuclease.

Control of alternative splicing by forskolin through hnRNP K during neuronal differentiation

PubMed Central

Cao, Wenguang; Razanau, Aleh; Feng, Dairong; Lobo, Vincent G.; Xie, Jiuyong

2012-01-01

The molecular basis of cell signal-regulated alternative splicing at the 3′ splice site remains largely unknown. We isolated a protein kinase A-responsive ribonucleic acid (RNA) element from a 3′ splice site of the synaptosomal-associated protein 25 (Snap25) gene for forskolin-inhibited splicing during neuronal differentiation of rat pheochromocytoma PC12 cells. The element binds specifically to heterogeneous nuclear ribonucleo protein (hnRNP) K in a phosphatase-sensitive way, which directly competes with the U2 auxiliary factor U2AF65, an essential component of early spliceosomes. Transcripts with similarly localized hnRNP K target motifs upstream of alternative exons are enriched in genes often associated with neurological diseases. We show that such motifs upstream of the Runx1 exon 6 also bind hnRNP K, and importantly, hnRNP K is required for forskolin-induced repression of the exon. Interestingly, this exon encodes the peptide domain that determines the switch of the transcriptional repressor/activator activity of Runx1, a change known to be critical in specifying neuron lineages. Consistent with an important role of the target genes in neurons, knocking down hnRNP K severely disrupts forskolin-induced neurite growth. Thus, through hnRNP K, the neuronal differentiation stimulus forskolin targets a critical 3′ splice site component of the splicing machinery to control alternative splicing of crucial genes. This also provides a regulated direct competitor of U2AF65 for cell signal control of 3′ splice site usage. PMID:22684629

Genome-Wide Survey of Cold Stress Regulated Alternative Splicing in Arabidopsis thaliana with Tiling Microarray

PubMed Central

Leviatan, Noam; Alkan, Noam; Leshkowitz, Dena; Fluhr, Robert

2013-01-01

Alternative splicing plays a major role in expanding the potential informational content of eukaryotic genomes. It is an important post-transcriptional regulatory mechanism that can increase protein diversity and affect mRNA stability. Alternative splicing is often regulated in a tissue-specific and stress-responsive manner. Cold stress, which adversely affects plant growth and development, regulates the transcription and splicing of plant splicing factors. This can affect the pre-mRNA processing of many genes. To identify cold regulated alternative splicing we applied Affymetrix Arabidopsis tiling arrays to survey the transcriptome under cold treatment conditions. A novel algorithm was used for detection of statistically relevant changes in intron expression within a transcript between control and cold growth conditions. A reverse transcription polymerase chain reaction (RT-PCR) analysis of a number of randomly selected genes confirmed the changes in splicing patterns under cold stress predicted by tiling array. Our analysis revealed new types of cold responsive genes. While their expression level remains relatively unchanged under cold stress their splicing pattern shows detectable changes in the relative abundance of isoforms. The majority of cold regulated alternative splicing introduced a premature termination codon (PTC) into the transcripts creating potential targets for degradation by the nonsense mediated mRNA decay (NMD) process. A number of these genes were analyzed in NMD-defective mutants by RT-PCR and shown to evade NMD. This may result in new and truncated proteins with altered functions or dominant negative effects. The results indicate that cold affects both quantitative and qualitative aspects of gene expression. PMID:23776682

Region-specific expression of brain-derived neurotrophic factor splice variants in morphine conditioned place preference in mice.

PubMed

Meng, Min; Zhao, Xinhan; Dang, Yonghui; Ma, Jingyuan; Li, Lixu; Gu, Shanzhi

2013-06-26

It is well established that brain-derived neurotrophic factor (BDNF) plays a pivotal role in brain plasticity-related processes, such as learning, memory and drug addiction. However, changes in expression of BDNF splice variants after acquisition, extinction and reinstatement of cue-elicited morphine seeking behavior have not yet been investigated. Real-time PCR was used to assess BDNF splice variants (I, II, IV and VI) in various brain regions during acquisition, extinction and reinstatement of morphine-conditioned place preference (CPP) in mice. Repeated morphine injections (10mg/kg, i.p.) increased expression of BDNF splice variants II, IV and VI in the hippocampus, caudate putamen (CPu) and nucleus accumbens (NAcc). Levels of BDNF splice variants decreased after extinction training and continued to decrease during reinstatement induced by a morphine priming injection (10mg/kg, i.p.). However, after reinstatement induced by exposure to 6 min of forced swimming (FS), expression of BDNF splice variants II, IV and VI was increased in the hippocampus, CPu, NAcc and prefrontal cortex (PFC). After reinstatement induced by 40 min of restraint, expression of BDNF splice variants was increased in PFC. These results show that exposure to either morphine or acute stress can induce reinstatement of drug-seeking, but expression of BDNF splice variants is differentially affected by chronic morphine and acute stress. Furthermore, BDNF splice variants II, IV and VI may play a role in learning and memory for morphine addiction in the hippocampus, CPu and NAcc. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

The Relation between Breakfast Skipping and School Performance in Adolescents

ERIC Educational Resources Information Center

Boschloo, Annemarie; Ouwehand, Carolijn; Dekker, Sanne; Lee, Nikki; de Groot, Renate; Krabbendam, Lydia; Jolles, Jelle

2012-01-01

Breakfast skipping is common in adolescents, but research on the effects of breakfast skipping on school performance is scarce. This current cross-sectional survey study of 605 adolescents aged 11-18 years investigated whether adolescents who habitually skip breakfast have lower end-of-term grades than adolescents who eat breakfast daily.…

Complex Tissue-Specific Patterns and Distribution of Multiple RAGE Splice Variants in Different Mammals

PubMed Central

López-Díez, Raquel; Rastrojo, Alberto; Villate, Olatz; Aguado, Begoña

2013-01-01

The receptor for advanced glycosylation end products (RAGE) is a multiligand receptor involved in diverse cell signaling pathways. Previous studies show that this gene expresses several splice variants in human, mouse, and dog. Alternative splicing (AS) plays an important role in expanding transcriptomic and proteomic diversity, and it has been related to disease. AS is also one of the main evolutionary mechanisms in mammalian genomes. However, limited information is available regarding the AS of RAGE in a wide context of mammalian tissues. In this study, we examined in detail the different RAGE mRNAs generated by AS from six mammals, including two primates (human and monkey), two artiodactyla (cow and pig), and two rodentia (mouse and rat) in 6–18 different tissues including fetal, adult, and tumor. By nested reverse transcription-polymerase chain reaction (RT-PCR) we identified a high number of splice variants including noncoding transcripts and predicted coding ones with different potential protein modifications affecting mainly the transmembrane and ligand-binding domains that could influence their biological function. However, analysis of RNA-seq data enabled detecting only the most abundant splice variants. More than 80% of the detected RT-PCR variants (87 of 101 transcripts) are novel (different exon/intron structure to the previously described ones), and interestingly, 20–60% of the total transcripts (depending on the species) are noncoding ones that present tissue specificity. Our results suggest that RAGE undergoes extensive AS in mammals, with different expression patterns among adult, fetal, and tumor tissues. Moreover, most splice variants seem to be species specific, especially the noncoding variants, with only two (canonical human Tv1-RAGE, and human N-truncated or Tv10-RAGE) conserved among the six different species. This could indicate a special evolution pattern of this gene at mRNA level. PMID:24273313

Is snack consumption associated with meal skipping in children and adolescents? The CASPIAN-IV study.

PubMed

Kelishadi, Roya; Mozafarian, Nafiseh; Qorbani, Mostafa; Motlagh, Mohammad Esmaeil; Safiri, Saeid; Ardalan, Gelayol; Keikhah, Mojtaba; Rezaei, Fatemeh; Heshmat, Ramin

2017-06-01

The present inquiry set to assess the relationship between snack consumption and meal skipping in Iranian children and adolescents. Overall, 14,880 students, aged 6-18 years, were selected via multistage cluster sampling method from rural and urban areas of 30 provinces of Iran. A validated questionnaire of food behaviors including questions on snacks consumption and taking/skipping meals was completed. Consuming and skipping meals and their related factors were reported in both crude and adjusted models. Overall, 13,486 students with a mean age of 12.47 ± 3.36 years completed the study (90.6% participation rate). Among them, 32.08, 8.89, and 10.90% skipped breakfast, lunch, and dinner, respectively. Compared to their counterpart groups, the frequency of meal skipping was higher in girls, urban inhabitants, and students in higher school grades (P < 0.05). Snack consumption was associated with an increased odds ratio of meal skipping in many types of snack groups. Meal skipping and snack consumption were frequent among Iranian children and adolescents. Evidence based interventions are proposed to improve the students' eating habits.

MicroRNA screening identifies a link between NOVA1 expression and a low level of IKAP in familial dysautonomia

PubMed Central

Hervé, Mylène

2016-01-01

ABSTRACT Familial dysautonomia (FD) is a rare neurodegenerative disease caused by a mutation in intron 20 of the IKBKAP gene (c.2204+6T>C), leading to tissue-specific skipping of exon 20 and a decrease in the synthesis of the encoded protein IKAP (also known as ELP1). Small non-coding RNAs known as microRNAs (miRNAs) are important post-transcriptional regulators of gene expression and play an essential role in the nervous system development and function. To better understand the neuronal specificity of IKAP loss, we examined expression of miRNAs in human olfactory ecto-mesenchymal stem cells (hOE-MSCs) from five control individuals and five FD patients. We profiled the expression of 373 miRNAs using microfluidics and reverse transcription coupled to quantitative PCR (RT-qPCR) on two biological replicate series of hOE-MSC cultures from healthy controls and FD patients. This led to the total identification of 26 dysregulated miRNAs in FD, validating the existence of a miRNA signature in FD. We then selected the nine most discriminant miRNAs for further analysis. The signaling pathways affected by these dysregulated miRNAs were largely within the nervous system. In addition, many targets of these dysregulated miRNAs had been previously demonstrated to be affected in FD models. Moreover, we found that four of our nine candidate miRNAs target the neuron-specific splicing factor NOVA1. We demonstrated that overexpression of miR-203a-3p leads to a decrease of NOVA1, counter-balanced by an increase of IKAP, supporting a potential interaction between NOVA1 and IKAP. Taken together, these results reinforce the choice of miRNAs as potential therapeutic targets and suggest that NOVA1 could be a regulator of FD pathophysiology. PMID:27483351

Exome Sequencing Identifies a REEP1 Mutation Involved in Distal Hereditary Motor Neuropathy Type V

PubMed Central

Beetz, Christian; Pieber, Thomas R.; Hertel, Nicole; Schabhüttl, Maria; Fischer, Carina; Trajanoski, Slave; Graf, Elisabeth; Keiner, Silke; Kurth, Ingo; Wieland, Thomas; Varga, Rita-Eva; Timmerman, Vincent; Reilly, Mary M.; Strom, Tim M.; Auer-Grumbach, Michaela

2012-01-01

The distal hereditary motor neuropathies (dHMNs) are a heterogeneous group of neurodegenerative disorders affecting the lower motoneuron. In a family with both autosomal-dominant dHMN and dHMN type V (dHMN/dHMN-V) present in three generations, we excluded mutations in all genes known to be associated with a dHMN phenotype through Sanger sequencing and defined three potential loci through linkage analysis. Whole-exome sequencing of two affected individuals revealed a single candidate variant within the linking regions, i.e., a splice-site alteration in REEP1 (c.304-2A>G). A minigene assay confirmed complete loss of splice-acceptor functionality and skipping of the in-frame exon 5. The resulting mRNA is predicted to be expressed at normal levels and to encode an internally shortened protein (p.102_139del). Loss-of-function REEP1 mutations have previously been identified in dominant hereditary spastic paraplegia (HSP), a disease associated with upper-motoneuron pathology. Consistent with our clinical-genetic data, we show that REEP1 is strongly expressed in the lower motoneurons as well. Upon exogeneous overexpression in cell lines we observe a subcellular localization defect for p.102_139del that differs from that observed for the known HSP-associated missense mutation c.59C>A (p.Ala20Glu). Moreover, we show that p.102_139del, but not p.Ala20Glu, recruits atlastin-1, i.e., one of the REEP1 binding partners, to the altered sites of localization. These data corroborate the loss-of-function nature of REEP1 mutations in HSP and suggest that a different mechanism applies in REEP1-associated dHMN. PMID:22703882

Genome-Wide Transcriptome Analysis Reveals Extensive Alternative Splicing Events in the Protoscoleces of Echinococcus granulosus and Echinococcus multilocularis

PubMed Central

Liu, Shuai; Zhou, Xiaosu; Hao, Lili; Piao, Xianyu; Hou, Nan; Chen, Qijun

2017-01-01

Alternative splicing (AS), as one of the most important topics in the post-genomic era, has been extensively studied in numerous organisms. However, little is known about the prevalence and characteristics of AS in Echinococcus species, which can cause significant health problems to humans and domestic animals. Based on high-throughput RNA-sequencing data, we performed a genome-wide survey of AS in two major pathogens of echinococcosis-Echinococcus granulosus and Echinococcus multilocularis. Our study revealed that the prevalence and characteristics of AS in protoscoleces of the two parasites were generally consistent with each other. A total of 6,826 AS events from 3,774 E. granulosus genes and 6,644 AS events from 3,611 E. multilocularis genes were identified in protoscolex transcriptomes, indicating that 33–36% of genes were subject to AS in the two parasites. Strikingly, intron retention instead of exon skipping was the predominant type of AS in Echinococcus species. Moreover, analysis of the Kyoto Encyclopedia of Genes and Genomes pathway indicated that genes that underwent AS events were significantly enriched in multiple pathways mainly related to metabolism (e.g., purine, fatty acid, galactose, and glycerolipid metabolism), signal transduction (e.g., Jak-STAT, VEGF, Notch, and GnRH signaling pathways), and genetic information processing (e.g., RNA transport and mRNA surveillance pathways). The landscape of AS obtained in this study will not only facilitate future investigations on transcriptome complexity and AS regulation during the life cycle of Echinococcus species, but also provide an invaluable resource for future functional and evolutionary studies of AS in platyhelminth parasites. PMID:28588571

The Splicing History of an mRNA Affects Its Level of Translation and Sensitivity to Cleavage by the Virion Host Shutoff Endonuclease during Herpes Simplex Virus Infections

PubMed Central

Sadek, Jouliana

2016-01-01

ABSTRACT During lytic herpes simplex virus (HSV) infections, the virion host shutoff (Vhs) (UL41) endoribonuclease degrades many cellular and viral mRNAs. In uninfected cells, spliced mRNAs emerge into the cytoplasm bound by exon junction complexes (EJCs) and are translated several times more efficiently than unspliced mRNAs that have the same sequence but lack EJCs. Notably, most cellular mRNAs are spliced, whereas most HSV mRNAs are not. To examine the effect of splicing on gene expression during HSV infection, cells were transfected with plasmids harboring an unspliced renilla luciferase (RLuc) reporter mRNA or RLuc constructs with introns near the 5′ or 3′ end of the gene. After splicing of intron-containing transcripts, all three RLuc mRNAs had the same primary sequence. Upon infection in the presence of actinomycin D, spliced mRNAs were much less sensitive to degradation by copies of Vhs from infecting virions than were unspliced mRNAs. During productive infections (in the absence of drugs), RLuc was expressed at substantially higher levels from spliced than from unspliced mRNAs. Interestingly, the stimulatory effect of splicing on RLuc expression was significantly greater in infected than in uninfected cells. The translational stimulatory effect of an intron during HSV-1 infections could be replicated by artificially tethering various EJC components to an unspliced RLuc transcript. Thus, the splicing history of an mRNA, and the consequent presence or absence of EJCs, affects its level of translation and sensitivity to Vhs cleavage during lytic HSV infections. IMPORTANCE Most mammalian mRNAs are spliced. In contrast, of the more than 80 mRNAs harbored by herpes simplex virus 1 (HSV-1), only 5 are spliced. In addition, synthesis of the immediate early protein ICP27 causes partial inhibition of pre-mRNA splicing, with the resultant accumulation of both spliced and unspliced versions of some mRNAs in the cytoplasm. A common perception is that HSV-1 infection necessarily inhibits the expression of spliced mRNAs. In contrast, this study demonstrates two instances in which pre-mRNA splicing actually enhances the synthesis of proteins from mRNAs during HSV-1 infections. Specifically, splicing stabilized an mRNA against degradation by copies of the Vhs endoribonuclease from infecting virions and greatly enhanced the amount of protein synthesized from spliced mRNAs at late times after infection. The data suggest that splicing, and the resultant presence of exon junction complexes on an mRNA, may play an important role in gene expression during HSV-1 infections. PMID:27681125

A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification

PubMed Central

Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.

2016-01-01

The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544

TSVdb: a web-tool for TCGA splicing variants analysis.

PubMed

Sun, Wenjie; Duan, Ting; Ye, Panmeng; Chen, Kelie; Zhang, Guanling; Lai, Maode; Zhang, Honghe

2018-05-29

Collaborative projects such as The Cancer Genome Atlas (TCGA) have generated various -omics and clinical data on cancer. Many computational tools have been developed to facilitate the study of the molecular characterization of tumors using data from the TCGA. Alternative splicing of a gene produces splicing variants, and accumulating evidence has revealed its essential role in cancer-related processes, implying the urgent need to discover tumor-specific isoforms and uncover their potential functions in tumorigenesis. We developed TSVdb, a web-based tool, to explore alternative splicing based on TCGA samples with 30 clinical variables from 33 tumors. TSVdb has an integrated and well-proportioned interface for visualization of the clinical data, gene expression, usage of exons/junctions and splicing patterns. Researchers can interpret the isoform expression variations between or across clinical subgroups and estimate the relationships between isoforms and patient prognosis. TSVdb is available at http://www.tsvdb.com , and the source code is available at https://github.com/wenjie1991/TSVdb . TSVdb will inspire oncologists and accelerate isoform-level advances in cancer research.