Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

PubMed

Lees, George E

2013-01-01

To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

Phenotype variability in a large Spanish family with Alport syndrome associated with novel mutations in COL4A3 gene.

PubMed

Cervera-Acedo, C; Coloma, A; Huarte-Loza, E; Sierra-Carpio, M; Domínguez-Garrido, E

2017-10-31

Alport syndrome is an inherited renal disorder characterized by glomerular basement membrane lesions with hematuria, proteinuria and frequent hearing defects and ocular abnormalities. The disease is associated with mutations in genes encoding α3, α4, or α5 chains of type IV collagen, namely COL4A3 and COL4A4 in chromosome 2 and COL4A5 in chromosome X. In contrast to the well-known X-linked and autosomal recessive phenotypes, there is very little information about the autosomal dominant. In view of the wide spectrum of phenotypes, an exact diagnosis is sometimes difficult to achieve. We investigated a Spanish family with variable phenotype of autosomal dominant Alport syndrome using clinical, histological, and genetic analysis. Mutational analysis of COL4A3 and COL4A4 genes showed a novel heterozygous mutation (c. 998G > A; p.G333E) in exon 18 of the COL4A3 gene. Among relatives carrying the novel mutation, the clinical phenotype was variable. Two additional COL4A3 mutations were found, a Pro-Leu substitution in exon 48 (p.P1461L) and a Ser-Cys substitution in exon 49 (p.S1492C), non-pathogenics alone. Carriers of p.G333E and p.P1461L or p.S1492C mutations in COL4A3 gene appear to be more severely affected than carriers of only p.G333E mutation, and the clinical findings has an earlier onset. In this way, we could speculate on a synergistic effect of compound heterozygosity that could explain the different phenotype observed in this family.

Advances in Alport syndrome diagnosis using next-generation sequencing

PubMed Central

Artuso, Rosangela; Fallerini, Chiara; Dosa, Laura; Scionti, Francesca; Clementi, Maurizio; Garosi, Guido; Massella, Laura; Epistolato, Maria Carmela; Mancini, Roberta; Mari, Francesca; Longo, Ilaria; Ariani, Francesca; Renieri, Alessandra; Bruttini, Mirella

2012-01-01

Alport syndrome (ATS) is a hereditary nephropathy often associated with sensorineural hypoacusis and ocular abnormalities. Mutations in the COL4A5 gene cause X-linked ATS. Mutations in COL4A4 and COL4A3 genes have been reported in both autosomal recessive and autosomal dominant ATS. The conventional mutation screening, performed by DHPLC and/or Sanger sequencing, is time-consuming and has relatively high costs because of the absence of hot spots and to the high number of exons per gene: 51 (COL4A5), 48 (COL4A4) and 52 (COL4A3). Several months are usually necessary to complete the diagnosis, especially in cases with less informative pedigrees. To overcome these limitations, we designed a next-generation sequencing (NGS) protocol enabling simultaneous detection of all possible variants in the three genes. We used a method coupling selective amplification to the 454 Roche DNA sequencing platform (Genome Sequencer junior). The application of this technology allowed us to identify the second mutation in two ATS patients (p.Ser1147Phe in COL4A3 and p.Arg1682Trp in COL4A4) and to reconsider the diagnosis of ATS in a third patient. This study, therefore, illustrates the successful application of NGS to mutation screening of Mendelian disorders with locus heterogeneity. PMID:21897443

Identification of a deep intronic mutation in the COL6A2 gene by a novel custom oligonucleotide CGH array designed to explore allelic and genetic heterogeneity in collagen VI-related myopathies

PubMed Central

2010-01-01

Background Molecular characterization of collagen-VI related myopathies currently relies on standard sequencing, which yields a detection rate approximating 75-79% in Ullrich congenital muscular dystrophy (UCMD) and 60-65% in Bethlem myopathy (BM) patients as PCR-based techniques tend to miss gross genomic rearrangements as well as copy number variations (CNVs) in both the coding sequence and intronic regions. Methods We have designed a custom oligonucleotide CGH array in order to investigate the presence of CNVs in the coding and non-coding regions of COL6A1, A2, A3, A5 and A6 genes and a group of genes functionally related to collagen VI. A cohort of 12 patients with UCMD/BM negative at sequencing analysis and 2 subjects carrying a single COL6 mutation whose clinical phenotype was not explicable by inheritance were selected and the occurrence of allelic and genetic heterogeneity explored. Results A deletion within intron 1A of the COL6A2 gene, occurring in compound heterozygosity with a small deletion in exon 28, previously detected by routine sequencing, was identified in a BM patient. RNA studies showed monoallelic transcription of the COL6A2 gene, thus elucidating the functional effect of the intronic deletion. No pathogenic mutations were identified in the remaining analyzed patients, either within COL6A genes, or in genes functionally related to collagen VI. Conclusions Our custom CGH array may represent a useful complementary diagnostic tool, especially in recessive forms of the disease, when only one mutant allele is detected by standard sequencing. The intronic deletion we identified represents the first example of a pure intronic mutation in COL6A genes. PMID:20302629

Arabidopsis TNL-WRKY domain receptor RRS1 contributes to temperature-conditioned RPS4 auto-immunity

PubMed Central

Heidrich, Katharina; Tsuda, Kenichi; Blanvillain-Baufumé, Servane; Wirthmueller, Lennart; Bautor, Jaqueline; Parker, Jane E.

2013-01-01

In plant effector-triggered immunity (ETI), intracellular nucleotide binding-leucine rich repeat (NLR) receptors are activated by specific pathogen effectors. The Arabidopsis TIR (Toll-Interleukin-1 receptor domain)-NLR (denoted TNL) gene pair, RPS4 and RRS1, confers resistance to Pseudomonas syringae pv tomato (Pst) strain DC3000 expressing the Type III-secreted effector, AvrRps4. Nuclear accumulation of AvrRps4, RPS4, and the TNL resistance regulator EDS1 is necessary for ETI. RRS1 possesses a C-terminal “WRKY” transcription factor DNA binding domain suggesting that important RPS4/RRS1 recognition and/or resistance signaling events occur at the nuclear chromatin. In Arabidopsis accession Ws-0, the RPS4Ws/RRS1Ws allelic pair governs resistance to Pst/AvrRps4 accompanied by host programed cell death (pcd). In accession Col-0, RPS4Col/RRS1Col effectively limits Pst/AvrRps4 growth without pcd. Constitutive expression of HA-StrepII tagged RPS4Col (in a 35S:RPS4-HS line) confers temperature-conditioned EDS1-dependent auto-immunity. Here we show that a high (28°C, non-permissive) to moderate (19°C, permissive) temperature shift of 35S:RPS4-HS plants can be used to follow defense-related transcriptional dynamics without a pathogen effector trigger. By comparing responses of 35S:RPS4-HS with 35S:RPS4-HS rrs1-11 and 35S:RPS4-HS eds1-2 mutants, we establish that RPS4Col auto-immunity depends entirely on EDS1 and partially on RRS1Col. Examination of gene expression microarray data over 24 h after temperature shift reveals a mainly quantitative RRS1Col contribution to up- or down-regulation of a small subset of RPS4Col-reprogramed, EDS1-dependent genes. We find significant over-representation of WRKY transcription factor binding W-box cis-elements within the promoters of these genes. Our data show that RRS1Col contributes to temperature-conditioned RPS4Col auto-immunity and are consistent with activated RPS4Col engaging RRS1Col for resistance signaling. PMID:24146667

Searching for a treatment for Alport syndrome using mouse models

PubMed Central

Katayama, Kan; Nomura, Shinsuke; Tryggvason, Karl; Ito, Masaaki

2014-01-01

Alport syndrome (AS) is a hereditary nephritis caused by mutations in COL4A3, COL4A4 or COL4A5 encoding the type IV collagen α3, α4, and α5 chains, which are major components of the glomerular basement membrane. About 20 years have passed since COL4A3, COL4A4, and COL4A5 were identified and the first Alport mouse model was developed using a knockout approach. The phenotype of Alport mice is similar to that of Alport patients, including characteristic thickening and splitting of the glomerular basement membrane. Alport mice have been widely used to study the pathogenesis of AS and to develop effective therapies. In this review, the newer therapies for AS, such as pharmacological interventions, genetic approaches and stem cell therapies, are discussed. Although some stem cell therapies have been demonstrated to slow the renal disease progression in Alport mice, these therapies demand continual refinement as research advances. In terms of the pharmacological drugs, angiotensin-converting enzyme inhibitors have been shown to be effective in Alport mice. Novel therapies that can provide a better outcome or lead to a cure are still awaited. PMID:25374816

Searching for a treatment for Alport syndrome using mouse models.

PubMed

Katayama, Kan; Nomura, Shinsuke; Tryggvason, Karl; Ito, Masaaki

2014-11-06

Alport syndrome (AS) is a hereditary nephritis caused by mutations in COL4A3, COL4A4 or COL4A5 encoding the type IV collagen α3, α4, and α5 chains, which are major components of the glomerular basement membrane. About 20 years have passed since COL4A3, COL4A4, and COL4A5 were identified and the first Alport mouse model was developed using a knockout approach. The phenotype of Alport mice is similar to that of Alport patients, including characteristic thickening and splitting of the glomerular basement membrane. Alport mice have been widely used to study the pathogenesis of AS and to develop effective therapies. In this review, the newer therapies for AS, such as pharmacological interventions, genetic approaches and stem cell therapies, are discussed. Although some stem cell therapies have been demonstrated to slow the renal disease progression in Alport mice, these therapies demand continual refinement as research advances. In terms of the pharmacological drugs, angiotensin-converting enzyme inhibitors have been shown to be effective in Alport mice. Novel therapies that can provide a better outcome or lead to a cure are still awaited.

COL4A6 is dispensable for autosomal recessive Alport syndrome.

PubMed

Murata, Tomohiro; Katayama, Kan; Oohashi, Toshitaka; Jahnukainen, Timo; Yonezawa, Tomoko; Sado, Yoshikazu; Ishikawa, Eiji; Nomura, Shinsuke; Tryggvason, Karl; Ito, Masaaki

2016-07-05

Alport syndrome is caused by mutations in the genes encoding α3, α4, or α5 (IV) chains. Unlike X-linked Alport mice, α5 and α6 (IV) chains are detected in the glomerular basement membrane of autosomal recessive Alport mice, however, the significance of this finding remains to be investigated. We therefore generated mice lacking both α3 and α6 (IV) chains and compared their renal function and survival with Col4a3 knockout mice of 129 × 1/Sv background. No significant difference was observed in the renal function or survival of the two groups, or when the mice were backcrossed once to C57BL/6 background. However, the survival of backcrossed double knockout mice was significantly longer than that of the mice of 129 × 1/Sv background, which suggests that other modifier genes were involved in this phenomenon. In further studies we identified two Alport patients who had a homozygous mutation in intron 46 of COL4A4. The α5 and α6 (IV) chains were focally detected in the glomerular basement membrane of these patients. These findings indicate that although α5 and α6 (IV) chains are induced in the glomerular basement membrane in autosomal recessive Alport syndrome, their induction does not seem to play a major compensatory role.

COL4A6 is dispensable for autosomal recessive Alport syndrome

PubMed Central

Murata, Tomohiro; Katayama, Kan; Oohashi, Toshitaka; Jahnukainen, Timo; Yonezawa, Tomoko; Sado, Yoshikazu; Ishikawa, Eiji; Nomura, Shinsuke; Tryggvason, Karl; Ito, Masaaki

2016-01-01

Alport syndrome is caused by mutations in the genes encoding α3, α4, or α5 (IV) chains. Unlike X-linked Alport mice, α5 and α6 (IV) chains are detected in the glomerular basement membrane of autosomal recessive Alport mice, however, the significance of this finding remains to be investigated. We therefore generated mice lacking both α3 and α6 (IV) chains and compared their renal function and survival with Col4a3 knockout mice of 129 × 1/Sv background. No significant difference was observed in the renal function or survival of the two groups, or when the mice were backcrossed once to C57BL/6 background. However, the survival of backcrossed double knockout mice was significantly longer than that of the mice of 129 × 1/Sv background, which suggests that other modifier genes were involved in this phenomenon. In further studies we identified two Alport patients who had a homozygous mutation in intron 46 of COL4A4. The α5 and α6 (IV) chains were focally detected in the glomerular basement membrane of these patients. These findings indicate that although α5 and α6 (IV) chains are induced in the glomerular basement membrane in autosomal recessive Alport syndrome, their induction does not seem to play a major compensatory role. PMID:27377778

Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

PubMed

Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

2014-05-01

Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

Elucidation of possible molecular mechanisms underlying the estrogen-induced disruption of cartilage development in zebrafish larvae.

PubMed

He, Hanliang; Wang, Chunqing; Tang, Qifeng; Yang, Fan; Xu, Youjia

2018-06-01

Estrogen can affect the cartilage development of zebrafish; however, the mechanism underlying its effects is not completely understood. Four-day-old zebrafish larvae were treated with 0.8 μM estrogen, the 5 days post fertilization (dpf) zebrafish larvae did not demonstrate obvious abnormalities during development; however, the 6 dpf and 7 dpf larvae exhibited abnormal craniofacial bone development along with craniofacial bone degradation. RNA deep sequencing was performed to elucidate the mechanism involved. Gene Ontology functional and KEGG pathway enrichment analysis of differentially expressed genes (DEGs) showed that the extracellular matrix (ECM), extracellular region, ECM-interaction receptor, focal adhesion, cell cycle, apoptosis, and bone-related signaling pathways were disrupted. In these signaling pathways, the expressions of key genes, such as collagen encoded (col19a1a, col7a1, col7al, col18a1, and col9a3), MAPK signaling pathway (fgf19, fgf6a), TGF-beta signaling pathway (tgfbr1), and cell cycle (cdnk1a) genes were altered. The qRT-PCR results showed that after treatment with 0.8 μM 17-β estradiol (E2), col19a1a, col7a1, col7al, col18a1, col9a3, fgf6a, cdkn1a were downregulated, and fgf19, tgfr1 were upregulated, which were consistent with deep sequencing analysis. Therefore, the effect of estrogen on cartilage development might occur via multiple mechanisms. The study results demonstrate the mechanism underlying the effect of estrogen on cartilage development. Copyright © 2018 Elsevier B.V. All rights reserved.

Genetic Variations of the COL4A1 Gene and Intracerebral Hemorrhage Risk: A Case-Control Study in a Chinese Han Population.

PubMed

Lin, Sen; Xia, Chao; He, Sha; Yang, Jie; Li, Hao; Zheng, Jun; Liu, Ming; You, Chao

2018-04-01

To investigate the association between single nucleotide polymorphisms or haplotypes of the COL4A1 gene and the risk of intracerebral hemorrhage (ICH). We conducted a case-control study that included 181 patients from the Chinese Han population with hypertensive ICH and 197 hypertension patients without ICH. Genomic DNA was extracted by DNA extraction kit, and the 6 single nucleotide polymorphism genotypes of the COL4A1 gene were detected with a MassARRAY Analyzer. Unphased 3.1.4 and SPSS 19.0 were used to analyze the association between alleles, genotypes, and haplotypes of the COL4A1 gene and the risk of ICH. Compared with the control group, patients in the ICH group were significantly younger. There were no differences in gender, diabetes, hyperlipidemia, current smoking, and alcohol consumption between the 2 groups. Our association analysis showed that the rs3742207 A, rs11069830 A, and rs679505 A alleles were association factors of the risks of ICH; rs11069830 AA, rs544012 AC, and rs679505 AA genotypes were association factors of the risk of ICH; AA haplotype (rs3742207-rs11069830) was an association factor of the risk of ICH. After adjusting age and gender by multivariate logistic regression, the rs544012 AC and rs679505 AA genotypes were independently associated with the risk of ICH. Our study showed that the rs544012 AC and rs679505 AA genotypes were independently associated with the risk of ICH in the Chinese Han population and that the AA haplotype (rs3742207-rs11069830) in the COL4A1 gene may be related to the risk of ICH in the Chinese Han population; these conclusions need further confirmation in future studies with larger samples. Copyright © 2018. Published by Elsevier Inc.

Localization, cloning, and sequence determination of the conjugative plasmid ColB2 pilin gene.

PubMed Central

Finlay, B B; Frost, L S; Paranchych, W

1984-01-01

ColB2 is a colicin-producing, 96-kilobase plasmid which encodes a conjugative system that is similar, but not identical, to F. A restriction map of this plasmid was generated, and DNA homology studies between F and ColB2 plasmids revealed homology only between their transfer operons. The locations of the ColB2 transfer operon and ColB2 pilin gene were localized on this restriction map. The gene encoding ColB2 pilin, traA, was cloned and sequenced. The pilin protein of ColB2 is identical to F, except at the amino terminus, where ala-gln of ColB2 pilin corresponds to Ala-Gly-Ser-Ser of F pilin. This is due to a 6-base-pair deletion in the ColB2 pilin gene. Biochemical studies on tryptic peptides derived from ColB2 pilin demonstrate the location of this gene to be correct. There is a putative signal peptidase cleavage site after the sequence Ala-Met-Ala, giving a signal peptide of 51 amino acids and a mature pilin protein of 68 amino acids (7,000 daltons). The amino terminus is blocked, probably with an acetyl group. A chimera containing the ColB2 pilin gene was able to complement an F traA mutant, demonstrating that the pilus assembly proteins of F can utilize the ColB2 pilin protein to form a pilus. Images PMID:6090427

Photobiomodulation changes type 1 collagen gene expression by pulp fibroblasts

NASA Astrophysics Data System (ADS)

Lourenço Ribeiro Vitor, Luciana; Tavares Oliveira Prado, Mariel; Lourenço Neto, Natalino; Cardoso de Oliveira, Rodrigo; Ferreira Santos, Carlos; Moreira Machado, Maria Aparecida Andrade; Marchini Oliveira, Thais

2018-06-01

This study aimed to evaluate type 1 collagen (COL1) gene expression by human pulp fibroblasts from primary teeth (HPF) after the variation of photobiomodulation (PBM) parameters. HPF were obtained from a biorepository, used at 4th passage, and irradiated (InGaAlP—660 nm) varying the power and application time according to the following groups: G1: 1.2 J cm‑2–05 mW–10 s G2: 2.5 J cm‑2–05 mW–20 s G3: 3.7 J cm‑2–05 mW–30 s G4: 5.0 J cm‑2–05 mW–40 s G5: 6.2 J cm‑2–05 mW–50 s G6: 2.5 J cm‑2–10 mW–10 s G7: 3.7 J cm‑2–15 mW–10 s G8: 5.0 J cm‑2–20 mW–10 s G9: 6.2 J cm‑2–25 mW–10 s. The control group (G10) was not irradiated and maintained with DMEM  +  10% SFB. RT-PCR was used to evaluate COL1 gene expression at 6, 12, and 24 h after irradiation. Intra- and intergroup comparisons were performed by two-way ANOVA followed by Tukey test (p  <  0.05). The intragroup comparison showed statistically significant differences among periods (p  <  0.05). In G1, G9, and G10 higher COL1 gene expression occurred at 12 h (p  =  0.07), while in G2 to G8, the peak of higher expression occurred at 6 h (p  =  0.02). The intergroup comparison did not show statistically significant differences (p  >  0.05). The energy densities from 2.5 to 5 J cm‑2, regardless of the variation in PBM parameters, biomodulated the COL1 gene expression. At the energy density of 6.2 J cm‑2, longer application time and smaller power changed the pattern of COL1 gene expression by pulp fibroblasts from human primary teeth.

A potential target gene for the host-directed therapy of mycobacterial infection in murine macrophages

PubMed Central

Bao, Zhang; Chen, Ran; Zhang, Pei; Lu, Shan; Chen, Xing; Yao, Yake; Jin, Xiaozheng; Sun, Yilan; Zhou, Jianying

2016-01-01

Mycobacterium tuberculosis (MTB), one of the major bacterial pathogens for lethal infectious diseases, is capable of surviving within the phagosomes of host alveolar macrophages; therefore, host genetic variations may alter the susceptibility to MTB. In this study, to identify host genes exploited by MTB during infection, genes were non-selectively inactivated using lentivirus-based antisense RNA methods in RAW264.7 macrophages, and the cells that survived virulent MTB infection were then screened. Following DNA sequencing of the surviving cell clones, 26 host genes affecting susceptibility to MTB were identified and their pathways were analyzed by bioinformatics analysis. In total, 9 of these genes were confirmed as positive regulators of collagen α-5(IV) chain (Col4a5) expression, a gene encoding a type IV collagen subunit present on the cell surface. The knockdown of Col4a5 consistently suppressed intracellular mycobacterial viability, promoting the survival of RAW264.7 macrophages following mycobacterial infection. Furthermore, Col4a5 deficiency lowered the pH levels of intracellular vesicles, including endosomes, lysosomes and phagosomes in the RAW264.7 cells. Finally, the knockdown of Col4a5 post-translationally increased microsomal vacuolar-type H+-ATPase activity in macrophages, leading to the acidification of intracellular vesicles. Our findings reveal a novel role for Col4a5 in the regulation of macrophage responses to mycobacterial infection and identify Col4a5 as a potential target for the host-directed anti-mycobacterial therapy. PMID:27432120

Identification of four novel mutations in the COL4A5 gene of patients with Alport syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lemmink, H.H.; Schroeder, C.H.; Brunner, H.G.

1993-08-01

The type IV collagen [alpha]5 chain (COL4A5) genes of patients with Alport syndrome were tested for major gene rearrangements by Southern blot analysis, using COL4A5 cDNA clones as probes. In addition, individual exons were screened for small mutations by single-strand conformation polymorphism (SSCP) analysis. Four new COL4A5 mutations were detected. A duplication of the nine most 3[prime] located nucleotides of exon 49 and the first nucleotide of intron 49 was identified in the COL4A5 gene of one patient. Two patients displayed single base substitutions leading to, respectively, a proline to threonine and an arginine to glutamine substitution in the C-terminalmore » end. Both substitutions involve amino acids conserved through evolution. In COL4A5 intron 41 a mutation changing the splice acceptor site from AG to AA was identified. All mutations cosegregate with the clinical phenotype of Alport syndrome in affected family members. In a control population of 50 individuals tested by PCR-SSCP these mutations were never identified. Together with two mutations reported previously, a total of six mutations were found in 26 patients with Alport syndrome (23%) after systematic screening of about 30% of the COL4A5 coding region. The clinical features of these six patients are described in detail. 21 refs., 2 figs., 3 tabs.« less

Regulation of Leukocyte Infiltration into Ovarian Cancer by Tumour-Stroma Interactions: A Microarray View of Cancer Microenvironment

DTIC Science & Technology

2006-03-01

PTGS2 STAT1 HIF1A INHBA CXCL9 DPP4 PLAU MMP7 NOTCH3 TWIST1 A B 20 08 42 9 20 08 C M IL 1β TN Fα H ey m oo dy O V H S C C L2 IN Fγ IL 18 IL 8 IL 8+ C C...Default Interpretation) Gene List: Figure 3a (75) MultiCC15 (82) IFI35 BST2 CYR61 IL6 COL6A3 BMP4 SERPINB2 COL5A3 PODXL MAP17 FN1 NOTCH3 HOXB2 MCM6 TNF

Pathology versus molecular genetics: (re)defining the spectrum of Alport syndrome

PubMed Central

Miner, Jeffrey H.

2014-01-01

Next generation sequencing applied to families with glomerular disease has been instrumental in identifying new genes and pathways involved in podocyte homeostasis. Malone et al. performed sequencing on 70 families with FSGS and discovered that 10% had variants in surprising “old” genes, COL4A3 and COL4A4, which are involved in Alport syndrome and thin basement membrane nephropathy. These data show that a subset of renal manifestations associated with COL4A3 or COL4A4 variants cannot be distinguished from FSGS by clinical data or by histopathology. Thus, a diagnosis of FSGS may sometimes fall within the spectrum of Alport syndrome. PMID:25427084

A novel, non-functional, COL1A1 polymorphism is not associated with lumbar disk disease in young male Greek subjects unlike that of the Sp1 site

PubMed Central

Bei, Thalia; Tilkeridis, Constantinos; Garantziotis, Stavros; Boikos, Sosipatros A.; Kazakos, Konstantinos; Simopoulos, Constantinos; Stratakis, Constantine A.

2011-01-01

OBJECTIVE We recently reported the association of the Sp1 site polymorphism of the COL1A1 gene with lumbar disk disease (LDD). In the present study we searched for a different polymorphism of the COL1A1 gene (which is usually not in linkage disequilibrium with the Sp1 site) in subjects with LDD. DESIGN Blood was collected from 24 Greek army recruits, aged 29±7.6 years, with LDD, and 66 healthy men, aged 26±4.38 years, matched for body mass index (BMI) and age, with normal BMD and with no history of trauma or fractures, who served as controls. DNA was extracted and the COL1A1 gene was sequenced. Of the control subjects, 12 were army recruits and 54 were selected from the general population. RESULTS The four base-pair insertion polymorphism in the COL1A1 gene analyzed by polymerase chain reaction amplification of DNA produces two different fragments (alleles A1 and A2): 14 patients (58.3%) were homozygous for A2A2, versus 35 controls (53%), while 3 patients (12.5%) were A1A1, and 8 of the control subjects (12%) had this genotype. There were no statistically significant differences in the presence of the two alleles of this polymorphism between patients with LDD and control subjects. CONCLUSIONS A four base-pair insertion polymorphism of the COL1A1 gene is not associated with the presence of LDD in young males, unlike the Sp1 site polymorphism of the same gene. These data reinforce the association between LDD and the functional polymorphisms of the Sp1 site by showing that other polymorphic sites of the of the COL1A1 gene in the same population of patients are not linked to the disease. PMID:18694864

Immediate Administration of Intraarticular Triamcinolone Acetonide after Joint Injury Modulates Molecular Outcomes Associated with Early Synovitis

PubMed Central

Sieker, Jakob T.; Ayturk, Ugur M.; Proffen, Benedikt L.; Weissenberger, Manuela H.; Kiapour, Ata M.; Murray, Martha M.

2016-01-01

Objective To test if intraarticular corticosteroid injection mitigates injury-induced synovitis and collagen degradation after anterior cruciate ligament (ACL) transection and characterize the synovial response using a functional genomics approach in a preclinical model of post- traumatic osteoarthritis. Methods Yorkshire pigs received untreated unilateral ACL transection (ACLT, n=6) or transection with immediate injection of 20mg triamcinolone acetonide (STEROID, n=6). Total synovial membrane cellularity and synovial fluid concentration of COL-2 3/4C short neoepitope bearing collagen fragments at 14 days post-injury were primary endpoints and compared between ACLT, STEROID and INTACT (n=6 uninjured knees). Cells were differentiated by histological phenotype and counted, while RNA-seq was used to quantify transcriptome-wide gene expression, monocyte, macrophage and lymphocyte markers. Results Total cellularity of 13% (95% confidence interval of 9–16) and COL-2 3/4C short levels of 0.24 Kg/ml (0.08–0.39) were determined in INTACT. Significant increases in total cellularity to 21% (16–27) and COL-2 3/4C short to 0.49 Kg/ml (0.39–0.59) were observed in ACLT. Compared to ACLT, total cellularity was non-significantly and COL-2 3/4C short was significantly decreased in STEROID to 17% (15–18, p=0.26) and 0.29 Kg/ml (0.23–0.35). Between ACLT and INTACT, 255 genes were differentially expressed and enriched pathways related to cellular immune response and proteolysis. Mononuclear leukocytes were the dominant cell type in cell dense areas. MARCO, SOCS3, CCR1, IL4R and MMP2 expression was significantly associated with COL-2 3/4C short levels. Conclusions Early intraarticular immunosuppression mitigated the injury-induced increase of collagen fragments, an outcome better predicted by specific marker expression than histological measures of synovitis. PMID:26866935

Identification of the Gene for Scleroderma in the Tsk/2 Mouse Strain: Implications for Human Scleroderma Pathogenesis and Subset Distinctions

DTIC Science & Technology

2015-09-01

skin)and)used)as) a)marker)of)fibrosis)[3,)4]),)we)assessed)both) protein )and)mRNA)levels)in)fibroblasts)that)received)DNA)from)a) plasmid...containing)a)single)allele)of)a)single)Col3a1%gene.)In)three)independent)experiments,)COL1A1) protein ) was)significantly)elevated)after)48)hours)of)transfection...Mouse& Col3a1eKO& fibroblasts& transfected& with& a& plasmid& bearing&the&mutant&Col3a1Tsk2&express&34%&more&COL1A1& protein &than& Col3a1WT

Regulation of Leukocyte Infiltration into Ovarian Cancer by Tumor-Stroma Interactions, a Microarray View of Cancer Microenvironment

DTIC Science & Technology

2007-03-01

HIF1A INHBA CXCL9 DPP4 PLAU MMP7 NOTCH3 TWIST1 A B 20 08 42 9 20 08 C M IL 1β TN Fα H ey m oo dy O V H S C C L2 IN Fγ IL 18 IL 8 IL 8+ C C L2 A C TA IL...Interpretation) Gene List: Figure 3a (75) MultiCC15 (82) IFI35 BST2 CYR61 IL6 COL6A3 BMP4 SERPINB2 COL5A3 PODXL MAP17 FN1 NOTCH3 HOXB2 MCM6 TNF OAS1 BAI3

Inferring transcriptional gene regulation network of starch metabolism in Arabidopsis thaliana leaves using graphical Gaussian model

PubMed Central

2012-01-01

Background Starch serves as a temporal storage of carbohydrates in plant leaves during day/night cycles. To study transcriptional regulatory modules of this dynamic metabolic process, we conducted gene regulation network analysis based on small-sample inference of graphical Gaussian model (GGM). Results Time-series significant analysis was applied for Arabidopsis leaf transcriptome data to obtain a set of genes that are highly regulated under a diurnal cycle. A total of 1,480 diurnally regulated genes included 21 starch metabolic enzymes, 6 clock-associated genes, and 106 transcription factors (TF). A starch-clock-TF gene regulation network comprising 117 nodes and 266 edges was constructed by GGM from these 133 significant genes that are potentially related to the diurnal control of starch metabolism. From this network, we found that β-amylase 3 (b-amy3: At4g17090), which participates in starch degradation in chloroplast, is the most frequently connected gene (a hub gene). The robustness of gene-to-gene regulatory network was further analyzed by TF binding site prediction and by evaluating global co-expression of TFs and target starch metabolic enzymes. As a result, two TFs, indeterminate domain 5 (AtIDD5: At2g02070) and constans-like (COL: At2g21320), were identified as positive regulators of starch synthase 4 (SS4: At4g18240). The inference model of AtIDD5-dependent positive regulation of SS4 gene expression was experimentally supported by decreased SS4 mRNA accumulation in Atidd5 mutant plants during the light period of both short and long day conditions. COL was also shown to positively control SS4 mRNA accumulation. Furthermore, the knockout of AtIDD5 and COL led to deformation of chloroplast and its contained starch granules. This deformity also affected the number of starch granules per chloroplast, which increased significantly in both knockout mutant lines. Conclusions In this study, we utilized a systematic approach of microarray analysis to discover the transcriptional regulatory network of starch metabolism in Arabidopsis leaves. With this inference method, the starch regulatory network of Arabidopsis was found to be strongly associated with clock genes and TFs, of which AtIDD5 and COL were evidenced to control SS4 gene expression and starch granule formation in chloroplasts. PMID:22898356

Influence of EARLI1-like genes on flowering time and lignin synthesis of Arabidopsis thaliana.

PubMed

Shi, Y; Zhang, X; Xu, Z-Y; Li, L; Zhang, C; Schläppi, M; Xu, Z-Q

2011-09-01

EARLI1 encodes a 14.7 kDa protein in the cell wall, is a member of the PRP (proline-rich protein) family and has multiple functions, including resistance to low temperature and fungal infection. RNA gel blot analyses in the present work indicated that expression of EARLI1-like genes, EARLI1, At4G12470 and At4G12490, was down-regulated in Col-FRI-Sf2 RNAi plants derived from transformation with Agrobacterium strain ABI, which contains a construct encoding a double-strand RNA targeting 8CM of EARLI1. Phenotype analyses revealed that Col-FRI-Sf2 RNAi plants of EARLI1 flowered earlier than Col-FRI-Sf2 wild-type plants. The average bolting time of Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants was 39.7 and 19.4 days, respectively, under a long-day photoperiod. In addition, there were significant differences in main stem length, internode number and rosette leaf number between Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants. RT-PCR showed that EARLI1-like genes might delay flowering time through the autonomous and long-day photoperiod pathways by maintaining the abundance of FLC transcripts. In Col-FRI-Sf2 RNAi plants, transcription of FLC was repressed, while expression of SOC1 and FT was activated. Microscopy observations showed that EARLI1-like genes were also associated with morphogenesis of leaf cells in Arabidopsis. Using histochemical staining, EARLI1-like genes were found to be involved in regulation of lignin synthesis in inflorescence stems, and Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants had 9.67% and 8.76% dry weight lignin, respectively. Expression analysis revealed that cinnamoyl-CoA reductase, a key enzyme in lignin synthesis, was influenced by EARLI1-like genes. These data all suggest that EARLI1-like genes could control the flowering process and lignin synthesis in Arabidopsis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

No association between polymorphisms and haplotypes of COL1A1 and COL1A2 genes and osteoporotic fracture in postmenopausal Chinese women

PubMed Central

Hu, Wei-wei; He, Jin-wei; Zhang, Hao; Wang, Chun; Gu, Jie-mei; Yue, Hua; Ke, Yao-hua; Hu, Yun-qiu; Fu, Wen-zhen; Li, Miao; Liu, Yu-juan; Zhang, Zhen-lin

2011-01-01

Aim: To study whether genetic polymorphisms of COL1A1 and COL1A2 genes affected the onset of fracture in postmenopausal Chinese women. Methods: SNPs in COL1A1 and COL1A2 genes were identified via direct sequencing in 32 unrelated postmenopausal Chinese women. Ten SNPs were genotyped in 1252 postmenopausal Chinese women. The associations were examined using both single-SNP and haplotype tests using logistic regression. Results: Twenty four (4 novel) and 28 (7 novel) SNPs were identified in COL1A1 and COL1A2 gene, respectively. The distribution frequencies of 2 SNPs in COL1A1 (rs2075554 and rs2586494) and 3 SNPs in COL1A2 (rs42517, rs1801182, and rs42524) were significantly different from those documented for the European Caucasian population. No significant difference was observed between fracture and control groups with respect to allele frequency or genotype distribution in 9 selected SNPs and haplotype. No significant association was found between fragility fracture and each SNP or haplotype. The results remained the same after additional corrections for other risk factors such as weight, height, and bone mineral density. Conclusion: Our results show no association between common genetic variations of COL1A1 and COL1A2 genes and fracture, suggesting the complex genetic background of osteoporotic fractures. PMID:21602843

Whole-Exome Sequencing to Identify Rare Variants and Gene Networks that Increase Susceptibility to Scleroderma in African Americans.

PubMed

Gourh, Pravitt; Remmers, Elaine F; Boyden, Steven E; Alexander, Theresa; Morgan, Nadia D; Shah, Ami A; Mayes, Maureen D; Doumatey, Ayo; Bentley, Amy R; Shriner, Daniel; Domsic, Robyn T; Medsger, Thomas A; Steen, Virginia D; Ramos, Paula S; Silver, Richard M; Korman, Benjamin; Varga, John; Schiopu, Elena; Khanna, Dinesh; Hsu, Vivien; Gordon, Jessica K; Saketkoo, Lesley Ann; Gladue, Heather; Kron, Brynn; Criswell, Lindsey A; Derk, Chris T; Bridges, S Louis; Shanmugam, Victoria K; Kolstad, Kathleen D; Chung, Lorinda; Jan, Reem; Bernstein, Elana J; Goldberg, Avram; Trojanowski, Marcin; Kafaja, Suzanne; Maksimowicz-McKinnon, Kathleen M; Mullikin, James C; Adeyemo, Adebowale; Rotimi, Charles; Boin, Francesco; Kastner, Daniel L; Wigley, Fredrick M

2018-05-06

Whole-exome sequencing (WES) studies in systemic sclerosis (SSc) patients of European American (EA) ancestry have identified variants in the ATP8B4 gene and enrichment of variants in genes in the extracellular matrix (ECM)-related pathway increasing SSc susceptibility. Our goal was to evaluate the association of the ATP8B4 gene and the ECM-related pathway with SSc in a cohort of African Americans (AA). SSc patients of AA ancestry were enrolled from 23 academic centers across the United States under the Genome Research in African American Scleroderma Patients (GRASP) consortium. Unrelated AA individuals without serological evidence of autoimmunity enrolled in the Howard University Family Study were used as unaffected controls. Functional variants in genes reported in the two WES studies in EA SSc were selected for gene association testing using the optimized sequence kernel association test (SKAT-O) and pathway analysis by Ingenuity pathway analysis in 379 patients and 411 controls. Principal components analysis demonstrated that the patients and controls had similar ancestral backgrounds with about equal proportions of mean European admixture. Using SKAT-O, we examined the association of individual genes that were previously reported in EAs, and none remained significant including ATP8B4 (P U nCorr =0.98). However, we confirm the previously reported association of the ECM-related pathway with enrichment of variants within the COL13A1, COL18A1, COL22A1, COL4A3, COL4A4, COL5A2, PROK1, and SERPINE1 genes (P C orr =1.95×10 -4 ). This is the largest genetic study in AAs with SSc to date, corroborating the role of functional variants aggregating in a fibrotic pathway and increasing SSc susceptibility. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Identification of collagenase as a critical virulence factor for invasiveness and transmission of pathogenic Leptospira species.

PubMed

Kassegne, Kokouvi; Hu, Weilin; Ojcius, David M; Sun, Dexter; Ge, Yumei; Zhao, Jinfang; Yang, X Frank; Li, Lanjuan; Yan, Jie

2014-04-01

 Leptospirosis is a global zoonotic disease. Transmission of Leptospira from animals to humans occurs through contact with water contaminated with leptospire-containing urine of infected animals. However, the molecular basis for the invasiveness of Leptospira and transmission of leptospirosis remains unknown.  Activity of Leptospira interrogans strain Lai colA gene product (ColA) to hydrolyze different collagenic substrates was determined by spectrophotometry. Expression and secretion of ColA during infection were detected by reverse-transcription quantitative polymerase chain reaction and Western blot assay. The colA gene-deleted (ΔcolA) and colA gene-complemented (CΔcolA) mutants were generated to determine the roles of ColA in transcytosis in vitro and virulence in hamsters.  Recombinant or native ColA hydrolyzed all the tested substrates in which type III collagen was the favorite substrate with 2.16 mg/mL Km and 35.6 h(-)(1) Kcat values. Coincubation of the spirochete with HUVEC or HEK293 cells directly caused the significant elevation of ColA expression and secretion. Compared with wild-type strain, ΔcolA mutant displayed much-attenuated transcytosis through HEK293 and HUVEC monolayers, and less leptospires in blood, lung, liver, kidney and urine and 25-fold-decreased 50% lethal dose and milder histopathological injury in hamsters.  The product of colA gene is a collagenase as a crucial virulence factor in the invasiveness and transmission of L. interrogans.

Conditional Mesenchymal Disruption of Pkd1 Results in Osteopenia and Polycystic Kidney Disease

PubMed Central

Cao, Li; David, Valentin; Quarles, Leigh Darryl

2012-01-01

Conditional deletion of Pkd1 in osteoblasts using either Osteocalcin(Oc)-Cre or Dmp1-Cre results in defective osteoblast-mediated postnatal bone formation and osteopenia. Pkd1 is also expressed in undifferentiated mesenchyme that gives rise to the osteoblast lineage. To examine the effects of Pkd1 on prenatal osteoblast development, we crossed Pkd1 flox/flox and Col1a1(3.6)-Cre mice, which has been used to achieve selective inactivation of Pkd1 earlier in the osteoblast lineage. Control Pkd1 flox/flox and Pkd1 flox/+, heterozygous Col1a1(3.6)-Cre;Pkd1 flox/+ and Pkd1 flox/null, and homozygous Col1a1(3.6)-Cre;Pkd1 flox/flox and Col1a1(3.6)-Cre;Pkd1 flox/null mice were analyzed at ages ranging from E14.5 to 8-weeks-old. Newborn Col1a1(3.6)-Cre;Pkd1 flox/null mice exhibited defective skeletogenesis in association with a greater reduction in Pkd1 expression in bone. Conditional Col1a1(3.6)-Cre;Pkd1 flox/+ and Col1a1(3.6)-Cre;Pkd1 flox/flox mice displayed a gene dose-dependent decrease in bone formation and increase in marrow fat at 6 weeks of age. Bone marrow stromal cell and primary osteoblast cultures from homozygous Col1a1(3.6)-Cre;Pkd1 flox/flox mice showed increased proliferation, impaired osteoblast development and enhanced adipogenesis ex vivo. Unexpectedly, we found evidence for Col1a1(3.6)-Cre mediated deletion of Pkd1 in extraskeletal tissues in Col1a1(3.6)-Cre;Pkd1 flox/flox mice. Deletion of Pkd1 in mesenchymal precursors resulted in pancreatic and renal, but not hepatic, cyst formation. The non-lethality of Col1a1(3.6)-Cre;Pkd1 flox/flox mice establishes a new model to study abnormalities in bone development and cyst formation in pancreas and kidney caused by Pkd1 gene inactivation. PMID:23029375

Mutational analysis of COL1A1 and COL1A2 genes among Estonian osteogenesis imperfecta patients.

PubMed

Zhytnik, Lidiia; Maasalu, Katre; Reimann, Ene; Prans, Ele; Kõks, Sulev; Märtson, Aare

2017-08-15

Osteogenesis imperfecta (OI) is a rare bone disorder. In 90% of cases, OI is caused by mutations in the COL1A1/2 genes, which code procollagen α1 and α2 chains. The main aim of the current research was to identify the mutational spectrum of COL1A1/2 genes in Estonian patients. The small population size of Estonia provides a unique chance to explore the collagen I mutational profile of 100% of OI families in the country. We performed mutational analysis of peripheral blood gDNA of 30 unrelated Estonian OI patients using Sanger sequencing of COL1A1 and COL1A2 genes, including all intron-exon junctions and 5'UTR and 3'UTR regions, to identify causative OI mutations. We identified COL1A1/2 mutations in 86.67% of patients (26/30). 76.92% of discovered mutations were located in the COL1A1 (n = 20) and 23.08% in the COL1A2 (n = 6) gene. Half of the COL1A1/2 mutations appeared to be novel. The percentage of quantitative COL1A1/2 mutations was 69.23%. Glycine substitution with serine was the most prevalent among missense mutations. All qualitative mutations were situated in the chain domain of pro-α1/2 chains. Our study shows that among the Estonian OI population, the range of collagen I mutations is quite high, which agrees with other described OI cohorts of Northern Europe. The Estonian OI cohort differs due to the high number of quantitative variants and simple missense variants, which are mostly Gly to Ser substitutions and do not extend the chain domain of COL1A1/2 products.

--No Title--

Science.gov Websites

media print { .col-sm-1, .col-sm-2, .col-sm-3, .col-sm-4, .col-sm-5, .col-sm-6, .col-sm-7, .col-sm { width: 41.66666667%; } .col-sm-4 { width: 33.33333333%; } .col-sm-3 { width: 25%; } .col-sm-2 { width : 41.66666667%; } .col-sm-pull-4 { right: 33.33333333%; } .col-sm-pull-3 { right: 25%; } .col-sm-pull-2 { right

Optimization of Soft Tissue Management, Spacer Design, and Grafting Strategies for Large Segmental Bone Defects using the Chronic Caprine Tibial Defect Model

DTIC Science & Technology

2015-12-01

found with Tukey’s HSD post hoc analysis. Several target genes such as Oct4, Sox2, TGFB, and Col1A1 were generally up-regulated in all sections. In...expression analysis from the Aim 1 samples presented several upregulated target genes such as Oct4, Sox2, TGFB, and Col1A1 in all sections. No...TGFB, and Col1A1 . • Data from cellular analysis, histology, gene expression analysis and microCT are being assembled for the predictive model

The transcription factor Lc-Maf participates in Col27a1 regulation during chondrocyte maturation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mayo, Jaime L.; Holden, Devin N.; Barrow, Jeffery R.

2009-08-01

The transcription factor Lc-Maf, which is a splice variant of c-Maf, is expressed in cartilage undergoing endochondral ossification and participates in the regulation of type II collagen through a cartilage-specific Col2a1 enhancer element. Type XXVII and type XI collagens are also expressed in cartilage during endochondral ossification, and so enhancer/reporter assays were used to determine whether Lc-Maf could regulate cartilage-specific enhancers from the Col27a1 and Col11a2 genes. The Col27a1 enhancer was upregulated over 4-fold by Lc-Maf, while the Col11a2 enhancer was downregulated slightly. To confirm the results of these reporter assays, rat chondrosarcoma (RCS) cells were transiently transfected with anmore » Lc-Maf expression plasmid, and quantitative RT-PCR was performed to measure the expression of endogenous Col27a1 and Col11a2 genes. Endogenous Col27a1 was upregulated 6-fold by Lc-Maf overexpression, while endogenous Col11a2 was unchanged. Finally, in situ hybridization and immunohistochemistry were performed in the radius and ulna of embryonic day 17 mouse forelimbs undergoing endochondral ossification. Results demonstrated that Lc-Maf and Col27a1 mRNAs are coexpressed in proliferating and prehypertrophic regions, as would be predicted if Lc-Maf regulates Col27a1 expression. Type XXVII collagen protein was also most abundant in prehypertrophic and proliferating chondrocytes. Others have shown that mice that are null for Lc-Maf and c-Maf have expanded hypertrophic regions with reduced ossification and delayed vascularization. Separate studies have indicated that Col27a1 may serve as a scaffold for ossification and vascularization. The work presented here suggests that Lc-Maf may affect the process of endochondral ossification by participating in the regulation of Col27a1 expression.« less

COL4A4 gene study of a European population: description of new mutations causing autosomal dominant Alport syndrome.

PubMed

Rosado, Consolación; Bueno, Elena; Felipe, Carmen; González-Sarmiento, Rogelio

2014-01-01

Autosomal forms of Alport syndrome represent 20% of all patients (15% recessive and 5% dominant). They are caused by mutations in the COL4A3 and COL4A4 genes, which encode a-3 and a-4 collagen IV chains of the glomerular basement membrane, cochlea and eye. Thin basement membrane nephropathy may affect up to 1% of the population. The pattern of inheritance in the 40% of cases is the same as autosomal dominant Alport syndrome: heterozygous mutations in these genes. The aim of this study is to detect new pathogenic mutations in the COL4A4 gene in the patients previously diagnosed with autosomal Alport syndrome and thin basement membrane nephropathy in our hospital. We conducted a clinical and genetic study in eleven patients belonging to six unrelated families with aforementioned clinical symptoms and a negative study of COL4A3 gene. The molecular study was made by conformation of sensitive gel electrophoresis (CSGE) and direct sequencing of the fragments that show an altered electrophoretic migration pattern. We found two pathogenic mutations, not yet described: IVS3 + 1G > C is a replacement of Guanine to Cytosine in position +1 of intron 3, in the splicing region, which leads to a pathogenic mutation. c.4267C > T; p.P1423S is a missense mutation, also considered pathogenic. We also found seven new polymorphisms. We describe two new pathogenic mutations, responsible for autosomal dominant Alport syndrome. The other families of the study were undiagnosed owing to problems in the method employed and the possibility of mutations in other genes, giving rise to other diseases with similar symptoms.

Exome Sequencing in 32 Patients with Anophthalmia/Microphthalmia and Developmental Eye Defects

PubMed Central

Slavotinek, Anne M.; Garcia, Sarah T.; Chandratillake, Gemma; Bardakjian, Tanya; Ullah, Ehsan; Wu, Di; Umeda, Kyle; Lao, Richard; Tang, Paul Ling-Fung; Wan, Eunice; Madireddy, Lohith; Lyalina, Svetlana; Mendelsohn, Bryce A.; Dugan, Sarah; Tirch, Jean; Tischler, Reana; Harris, Jason; Clark, Michael J.; Chervitz, Stephen; Patwardhan, Anil; West, John M.; Ursell, Phillip; de Alba Campomanes, Alejandra; Schneider, Adele; Kwok, Pui-yan; Baranzini, Sergio; Chen, Richard O.

2014-01-01

Anophthalmia/microphthalmia (A/M) is a genetically heterogeneous birth defect for which the etiology is unknown in more than 50% of patients. We used exome sequencing with the ACE Exome™ (Personalis, Inc; 18 cases) and UCSF Genomics Core (21 cases) to sequence 28 patients with A/M and four patients with varied developmental eye defects. In the 28 patients with A/M, we identified de novo mutations in three patients (OTX2, p.(Gln91His), RARB, p.Arg387Cys and GDF6, p.Ala249Glu) and inherited mutations in STRA6 in two patients. In patients with developmental eye defects, a female with cataracts and cardiomyopathy had a de novo COL4A1 mutation, p.(Gly773Arg), expanding the phenotype associated with COL4A1 to include cardiomyopathy. A male with a chorioretinal defect, microcephaly, seizures and sensorineural deafness had two PNPT1 mutations, p.(Ala507Ser) and c.401-1G>A, and we describe eye defects associated with this gene for the first time. Exome sequencing was efficient for identifying mutations in pathogenic genes for which there is no clinical testing available and for identifying cases that expand phenotypic spectra, such as the PNPT1 and COL4A1-associated disorders described here. PMID:25457163

Association analysis of the vitamin D receptor gene, the type I collagen gene COL1A1, and the estrogen receptor gene in idiopathic osteoarthritis.

PubMed

Loughlin, J; Sinsheimer, J S; Mustafa, Z; Carr, A J; Clipsham, K; Bloomfield, V A; Chitnavis, J; Bailey, A; Sykes, B; Chapman, K

2000-03-01

Evidence has accumulated supporting a role for genes in the etiology of osteoarthritis (OA). Several candidates have been targeted as potential susceptibility loci including genes that are involved in the regulation of bone density. Genetic association analysis has suggested a role for the vitamin D receptor gene (VDR) and the estrogen receptor gene (ER) in susceptibility. Such findings must be tested in additional independent cohorts. We tested for association of these 2 genes, plus a third gene implicated in bone density, COL1A1, with idiopathic OA. A case-control cohort of 371 affected probands and 369 unaffected spouses was used. Association was tested using 4 intragenic single nucleotide polymorphisms (SNP), one each for the VDR and COL1A1 genes, and 2 for the ER gene. The VDR and ER SNP are the same SNP that have been associated with OA. All 4 SNP affect restriction enzyme sites and were genotyped using polymerase chain reaction and enzyme digestion. Allele and genotype distributions for each SNP were compared between cases and controls and analyzed using Fisher's exact test. There was no evidence of association of the VDR or the ER gene SNP to OA. There was weak evidence of association of the COL1A1 SNP in female cases (p = 0.017), reflected by a difference in the distribution of genotypes at this SNP between female cases and controls (p = 0.027). However, when corrected for multiple testing, these results were not significant. If the VDR, ER, or COL1A1 genes do encode predisposition to OA then the 4 SNP tested are not associated with major susceptibility alleles at these 3 loci.

Estimation of the bacteriocin ColE7 conjugation-based "kill" - "anti-kill" antimicrobial system by real-time PCR, fluorescence staining and bioluminescence assays.

PubMed

Maslennikova, I L; Kuznetsova, M V; Toplak, N; Nekrasova, I V; Žgur Bertok, D; Starčič Erjavec, M

2018-05-07

The efficiency of the bacteriocin, colicin ColE7, bacterial conjugation-based "kill" - "anti-kill" antimicrobial system, was assessed using real-time PCR, flow cytometry and bioluminescence. The ColE7 antimicrobial system consists of the genetically modified Escherichia coli strain Nissle 1917 harbouring a conjugative plasmid (derivative of the F-plasmid) encoding the "kill" gene (ColE7 activity gene) and a chromosomally encoded "anti-kill" gene (ColE7 immunity gene). On the basis of traJ gene expression in the killer donor cells, our results showed that the efficiency of the here studied antimicrobial system against target E. coli was higher at 4 than at 24 h. Flow cytometry was used to indirectly estimate DNase activity of the antimicrobial system, as lysis of target E. coli cells in the conjugative mixture with the killer donor strain led to reduction in cell cytosol fluorescence. According to a lux assay, E. coli TG1 (pXen lux + Ap r ) with constitutive luminescence were killed already after 2 h of treatment. Target sensor E. coli C600 with DNA damage SOS-inducible luminescence showed significantly lower SOS induction 6 and 24 h following treatment with the killer donor strain. Our results thus showed that bioluminescent techniques are quick and suitable for estimation of the ColE7 bacterial conjugation-based antimicrobial system antibacterial activity. Bacterial antimicrobial resistance is worldwide rising and causing deaths of thousands of patients infected with multi-drug resistant bacterial strains. In addition, there is a lack of efficient alternative antimicrobial agents. The significance of our research is the use of a number of methods (real-time PCR, flow cytometry and bioluminescence-based technique) to assess the antibacterial activity of the bacteriocin, colicin ColE7, bacterial conjugation-based "kill" - "anti-kill" antimicrobial system. Bioluminescent techniques proved to be rapid and suitable for estimation of antibacterial activity of ColE7 bacterial conjugation-based antimicrobial system and possibly other related systems. © 2018 The Society for Applied Microbiology.

Mechanisms of action of acetaldehyde in the up-regulation of the human α2(I) collagen gene in hepatic stellate cells: key roles of Ski, SMAD3, SMAD4, and SMAD7.

PubMed

Reyes-Gordillo, Karina; Shah, Ruchi; Arellanes-Robledo, Jaime; Hernández-Nazara, Zamira; Rincón-Sánchez, Ana Rosa; Inagaki, Yutaka; Rojkind, Marcos; Lakshman, M Raj

2014-05-01

Alcohol-induced liver fibrosis and eventually cirrhosis is a leading cause of death. Acetaldehyde, the first metabolite of ethanol, up-regulates expression of the human α2(I) collagen gene (COL1A2). Early acetaldehyde-mediated effects involve phosphorylation and nuclear translocation of SMAD3/4-containing complexes that bind to COL1A2 promoter to induce fibrogenesis. We used human and mouse hepatic stellate cells to elucidate the mechanisms whereby acetaldehyde up-regulates COL1A2 by modulating the role of Ski and the expression of SMADs 3, 4, and 7. Acetaldehyde induced up-regulation of COL1A2 by 3.5-fold, with concomitant increases in the mRNA (threefold) and protein (4.2- and 3.5-fold) levels of SMAD3 and SMAD4, respectively. It also caused a 60% decrease in SMAD7 expression. Ski, a member of the Ski/Sno oncogene family, is colocalized in the nucleus with SMAD4. Acetaldehyde induces translocation of Ski and SMAD4 to the cytoplasm, where Ski undergoes proteasomal degradation, as confirmed by the ability of the proteasomal inhibitor lactacystin to blunt up-regulation of acetaldehyde-dependent COL1A2, but not of the nonspecific fibronectin gene (FN1). We conclude that acetaldehyde up-regulates COL1A2 by enhancing expression of the transactivators SMAD3 and SMAD4 while inhibiting the repressor SMAD7, along with promoting Ski translocation from the nucleus to cytoplasm. We speculate that drugs that prevent proteasomal degradation of repressors targeting COL1A2 may have antifibrogenic properties. Copyright © 2014 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

A Novel Mutation in a Kazakh Family with X-Linked Alport Syndrome

PubMed Central

Rakhimova, Saule E.; Nigmatullina, Nazym B.; Momynaliev, Kuvat T.; Ramanculov, Yerlan M.

2015-01-01

Alport syndrome is a genetic condition that results in hematuria, progressive renal impairment, hearing loss, and occasionally lenticonus and retinopathy. Approximately 80% of Alport syndrome cases are caused by X-linked mutations in the COL4A5 gene encoding type IV collagen. The objective of this study was to define the SNP profiles for COL4A5 in patients with hereditary nephritis and hematuria. For this, we examined four subjects from one Kazakh family clinically affected with X-linked Alport syndrome due to COL4A5 gene mutations. All 51 exons of the COL4A5 gene were screened by linkage analysis and direct DNA sequencing, resulting in the identification of a novel mutation (G641E) in exon 25. The mutation was found only in two affected family individuals but was not present in healthy family members or 200 unrelated healthy controls. This result demonstrates that this novel mutation is pathogenic and has meaningful implications for the diagnosis of patients with Alport syndrome. PMID:26168235

A Novel Mutation in a Kazakh Family with X-Linked Alport Syndrome.

PubMed

Baikara, Barshagul T; Zholdybayeva, Elena V; Rakhimova, Saule E; Nigmatullina, Nazym B; Momynaliev, Kuvat T; Ramanculov, Yerlan M

2015-01-01

Alport syndrome is a genetic condition that results in hematuria, progressive renal impairment, hearing loss, and occasionally lenticonus and retinopathy. Approximately 80% of Alport syndrome cases are caused by X-linked mutations in the COL4A5 gene encoding type IV collagen. The objective of this study was to define the SNP profiles for COL4A5 in patients with hereditary nephritis and hematuria. For this, we examined four subjects from one Kazakh family clinically affected with X-linked Alport syndrome due to COL4A5 gene mutations. All 51 exons of the COL4A5 gene were screened by linkage analysis and direct DNA sequencing, resulting in the identification of a novel mutation (G641E) in exon 25. The mutation was found only in two affected family individuals but was not present in healthy family members or 200 unrelated healthy controls. This result demonstrates that this novel mutation is pathogenic and has meaningful implications for the diagnosis of patients with Alport syndrome.

Mechanisms of Action of Acetaldehyde in the Up-Regulation of the Human α2(I) Collagen Gene in Hepatic Stellate Cells

PubMed Central

Reyes-Gordillo, Karina; Shah, Ruchi; Arellanes-Robledo, Jaime; Hernández-Nazara, Zamira; Rincón-Sánchez, Ana Rosa; Inagaki, Yutaka; Rojkind, Marcos; Lakshman, M. Raj

2015-01-01

Alcohol-induced liver fibrosis and eventually cirrhosis is a leading cause of death. Acetaldehyde, the first metabolite of ethanol, up-regulates expression of the human α2(I) collagen gene (COL1A2). Early acetaldehyde-mediated effects involve phosphorylation and nuclear translocation of SMAD3/4–containing complexes that bind to COL1A2 promoter to induce fibrogenesis. We used human and mouse hepatic stellate cells to elucidate the mechanisms whereby acetaldehyde up-regulates COL1A2 by modulating the role of Ski and the expression of SMADs 3, 4, and 7. Acetaldehyde induced up-regulation of COL1A2 by 3.5-fold, with concomitant increases in the mRNA (threefold) and protein (4.2- and 3.5-fold) levels of SMAD3 and SMAD4, respectively. It also caused a 60% decrease in SMAD7 expression. Ski, a member of the Ski/Sno oncogene family, is colocalized in the nucleus with SMAD4. Acetaldehyde induces translocation of Ski and SMAD4 to the cytoplasm, where Ski undergoes proteasomal degradation, as confirmed by the ability of the proteasomal inhibitor lactacystin to blunt up-regulation of acetaldehyde-dependent COL1A2, but not of the nonspecific fibronectin gene (FN1). We conclude that acetaldehyde up-regulates COL1A2 by enhancing expression of the transactivators SMAD3 and SMAD4 while inhibiting the repressor SMAD7, along with promoting Ski translocation from the nucleus to cytoplasm. We speculate that drugs that prevent proteasomal degradation of repressors targeting COL1A2 may have antifibrogenic properties. PMID:24641900

Drosophila type IV collagen mutation associates with immune system activation and intestinal dysfunction.

PubMed

Kiss, Márton; Kiss, András A; Radics, Monika; Popovics, Nikoletta; Hermesz, Edit; Csiszár, Katalin; Mink, Mátyás

2016-01-01

The basal lamina (BM) contains numerous components with a predominance of type IV collagens. Clinical manifestations associated with mutations of the human COL4A1 gene include perinatal cerebral hemorrhage and porencephaly, hereditary angiopathy, nephropathy, aneurysms and muscle cramps (HANAC), ocular dysgenesis, myopathy, Walker–Warburg syndrome and systemic tissue degeneration. In Drosophila, the phenotype associated with dominant temperature sensitive mutations of col4a1 include severe myopathy resulting from massive degradation of striated muscle fibers, and in the gut, degeneration of circular visceral muscle cells and epithelial cells following detachment from the BM. In order to determine the consequences of altered BMfunctions due to aberrant COL4A1 protein, we have carried out a series of tests using Drosophila DTS-L3 mutants from our allelic series of col4a1 mutations with confirmed degeneration of various cell types and lowest survival rate among the col4a1 mutant lines at restrictive temperature. Results demonstrated epithelial cell degeneration in the gut, shortened gut, enlarged midgut with multiple diverticulae, intestinal dysfunction and shortened life span. Midgut immunohistochemistry analyses confirmed altered expression and distribution of BM components integrin PSI and PSII alpha subunits, laminin gamma 1, and COL4A1 both in larvae and adults. Global gene expression analysis revealed activation of the effector AMP genes of the primary innate immune system including Metchnikowin, Diptericin, Diptericin B, and edin that preceded morphological changes. Attacin::GFP midgut expression pattern further supported these changes. An increase in ROS production and changes in gut bacterial flora were also noted and may have further enhanced an immune response. The phenotypic features of Drosophila col4a1 mutants confirmed an essential role for type IV collagen in maintaining epithelial integrity, gut morphology and intestinal function and suggest that aberrant structure and function of the COL4A1 protein may also be a significant factor in modulating immunity.

Evolution of Regions Containing Antibiotic Resistance Genes in FII-2-FIB-1 ColV-Colla Virulence Plasmids.

PubMed

Moran, Robert A; Hall, Ruth M

2018-05-01

Three ColV virulence plasmids carrying antibiotic resistance genes were assembled from draft genome sequences of commensal ST95, ST131, and ST2705 Escherichia coli isolates from healthy Australians. Plasmids pCERC4, pCERC5, and pCERC9 include almost identical backbones containing FII-2 and FIB-1 replicons and the conserved ColV virulence region with an additional ColIa determinant. Only pCERC5 includes a complete, uninterrupted F-like transfer region and was able to conjugate. pCERC5 and pCERC9 contain Tn1721, carrying the tet(A) tetracycline resistance determinant in the same location, with Tn2 (bla TEM ; ampicillin resistance) interrupting the Tn1721 in pCERC5. pCERC4 has a Tn1721/Tn21 hybrid transposon carrying dfrA5 (trimethoprim resistance) and sul1 (sulfamethoxazole resistance) in a class 1 integron. Four FII-2:FIB-1 ColV-ColIa plasmids in the GenBank nucleotide database have a related transposon in the same position, but an IS26 has reshaped the resistance gene region, deleting 2,069 bp of the integron 3'-CS, including sul1, and serving as a target for IS26 translocatable units containing bla TEM , sul2 and strAB (streptomycin resistance), or aphA1 (kanamycin/neomycin resistance). Another ColV-ColIa plasmid containing a related resistance gene region has lost the FII replicon and acquired a unique transfer region via recombination within the resistance region and at oriT. Eighteen further complete ColV plasmid sequences in GenBank contained FIB-1, but the FII replicons were of three types, FII-24, FII-18, and a variant of FII-36.

In epithelial cancers, aberrant COL17A1 promoter methylation predicts its misexpression and increased invasion.

PubMed

Thangavelu, Pulari U; Krenács, Tibor; Dray, Eloise; Duijf, Pascal H G

2016-01-01

Metastasis is a leading cause of death among cancer patients. In the tumor microenvironment, altered levels of extracellular matrix proteins, such as collagens, can facilitate the first steps of cancer cell metastasis, including invasion into surrounding tissue and intravasation into the blood stream. However, the degree of misexpression of collagen genes in tumors remains understudied, even though this knowledge could greatly facilitate the development of cancer treatment options aimed at preventing metastasis. We systematically evaluate the expression of all 44 collagen genes in breast cancer and assess whether their misexpression provides clinical prognostic significance. We use immunohistochemistry on 150 ductal breast cancers and 361 cervical cancers and study DNA methylation in various epithelial cancers. In breast cancer, various tests show that COL4A1 and COL4A2 overexpression and COL17A1 ( BP180 , BPAG2 ) underexpression provide independent prognostic strength (HR = 1.25, 95% CI = 1.17-1.34, p  = 3.03 × 10 -10 ; HR = 1.18, 95% CI = 1.11-1.25, p  = 8.11 × 10 -10 ; HR = 0.86, 95% CI = 0.81-0.92, p  = 4.57 × 10 -6 ; respectively). Immunohistochemistry on ductal breast cancers confirmed that the COL17A1 protein product, collagen XVII, is underexpressed. This strongly correlates with advanced stage, increased invasion, and postmenopausal status. In contrast, immunohistochemistry on cervical tumors showed that collagen XVII is overexpressed in cervical cancer and this is associated with increased local dissemination. Interestingly, consistent with the opposed direction of misexpression in these cancers, the COL17A1 promoter is hypermethylated in breast cancer and hypomethylated in cervical cancer. We also find that the COL17A1 promoter is hypomethylated in head and neck squamous cell carcinoma, lung squamous cell carcinoma, and lung adenocarcinoma, in all of which collagen XVII overexpression has previously been shown. Paradoxically, collagen XVII is underexpressed in breast cancer and overexpressed in cervical and other epithelial cancers. However, the COL17A1 promoter methylation status accurately predicts both the direction of misexpression and the increased invasive nature for five out of five epithelial cancers. This implies that aberrant epigenetic control is a key driver of COL17A1 gene misexpression and tumor cell invasion. These findings have significant clinical implications, suggesting that the COL17A1 promoter methylation status can be used to predict patient outcome. Moreover, epigenetic targeting of COL17A1 could represent a novel strategy to prevent metastasis in patients.

The role of molecular genetics in diagnosing familial hematuria(s).

PubMed

Deltas, Constantinos; Pierides, Alkis; Voskarides, Konstantinos

2012-08-01

Familial microscopic hematuria (MH) of glomerular origin represents a heterogeneous group of monogenic conditions involving several genes, some of which remain unknown. Recent advances have increased our understanding and our ability to use molecular genetics for diagnosing such patients, enabling us to study their clinical characteristics over time. Three collagen IV genes, COL4A3, COL4A4, and COL4A5 explain the autosomal and X-linked forms of Alport syndrome (AS), and a subset of thin basement membrane nephropathy (TBMN). A number of X-linked AS patients follow a milder course reminiscent of that of patients with heterozygous COL4A3/COL4A4 mutations and TBMN, while at the same time a significant subset of patients with TBMN and familial MH progress to chronic kidney disease (CKD) or end-stage kidney disease (ESKD). A mutation in CFHR5, a member of the complement factor H family of genes that regulate complement activation, was recently shown to cause isolated C3 glomerulopathy, presenting with MH in childhood and demonstrating a significant risk for CKD/ESKD after 40 years old. Through these results molecular genetics emerges as a powerful tool for a definite diagnosis when all the above conditions enter the differential diagnosis, while in many at-risk related family members, a molecular diagnosis may obviate the need for another renal biopsy.

Protoplast-Esculin Assay as a New Method to Assay Plant Sucrose Transporters: Characterization of AtSUC6 and AtSUC7 Sucrose Uptake Activity in Arabidopsis Col-0 Ecotype.

PubMed

Rottmann, Theresa M; Fritz, Carolin; Lauter, Anja; Schneider, Sabine; Fischer, Cornelia; Danzberger, Nina; Dietrich, Petra; Sauer, Norbert; Stadler, Ruth

2018-01-01

The best characterized function of sucrose transporters of the SUC family in plants is the uptake of sucrose into the phloem for long-distance transport of photoassimilates. This important step is usually performed by one specific SUC in every species. However, plants possess small families of several different SUCs which are less well understood. Here, we report on the characterization of AtSUC6 and AtSUC7, two members of the SUC family in Arabidopsis thaliana . Heterologous expression in yeast ( Saccharomyces cerevisiae ) revealed that AtSUC6 Col-0 is a high-affinity H + -symporter that mediates the uptake of sucrose and maltose across the plasma membrane at exceptionally low pH values. Reporter gene analyses revealed a strong expression of AtSUC6 Col-0 in reproductive tissues, where the protein product might contribute to sugar uptake into pollen tubes and synergid cells. A knockout of AtSUC6 did not interfere with vegetative development or reproduction, which points toward physiological redundancy of AtSUC6 Col-0 with other sugar transporters. Reporter gene analyses showed that AtSUC7 Col-0 is expressed in roots and pollen tubes and that this sink specific expression of AtSUC7 Col-0 is regulated by intragenic regions. Transport activity of AtSUC7 Col-0 could not be analyzed in baker's yeast or Xenopus oocytes because the protein was not correctly targeted to the plasma membrane in both heterologous expression systems. Therefore, a novel approach to analyze sucrose transporters in planta was developed. Plasma membrane localized SUCs including AtSUC6 Col-0 and also sucrose specific SWEETs were able to mediate transport of the fluorescent sucrose analog esculin in transformed mesophyll protoplasts. In contrast, AtSUC7 Col-0 is not able to mediate esculin transport across the plasma membrane which implicates that AtSUC7 Col-0 might be a non-functional pseudogene. The novel protoplast assay provides a useful tool for the quick and quantitative analysis of sucrose transporters in an in planta expression system.

Protoplast-Esculin Assay as a New Method to Assay Plant Sucrose Transporters: Characterization of AtSUC6 and AtSUC7 Sucrose Uptake Activity in Arabidopsis Col-0 Ecotype

PubMed Central

Rottmann, Theresa M.; Fritz, Carolin; Lauter, Anja; Schneider, Sabine; Fischer, Cornelia; Danzberger, Nina; Dietrich, Petra; Sauer, Norbert; Stadler, Ruth

2018-01-01

The best characterized function of sucrose transporters of the SUC family in plants is the uptake of sucrose into the phloem for long-distance transport of photoassimilates. This important step is usually performed by one specific SUC in every species. However, plants possess small families of several different SUCs which are less well understood. Here, we report on the characterization of AtSUC6 and AtSUC7, two members of the SUC family in Arabidopsis thaliana. Heterologous expression in yeast (Saccharomyces cerevisiae) revealed that AtSUC6Col-0 is a high-affinity H+-symporter that mediates the uptake of sucrose and maltose across the plasma membrane at exceptionally low pH values. Reporter gene analyses revealed a strong expression of AtSUC6Col-0 in reproductive tissues, where the protein product might contribute to sugar uptake into pollen tubes and synergid cells. A knockout of AtSUC6 did not interfere with vegetative development or reproduction, which points toward physiological redundancy of AtSUC6Col-0 with other sugar transporters. Reporter gene analyses showed that AtSUC7Col-0 is expressed in roots and pollen tubes and that this sink specific expression of AtSUC7Col-0 is regulated by intragenic regions. Transport activity of AtSUC7Col-0 could not be analyzed in baker’s yeast or Xenopus oocytes because the protein was not correctly targeted to the plasma membrane in both heterologous expression systems. Therefore, a novel approach to analyze sucrose transporters in planta was developed. Plasma membrane localized SUCs including AtSUC6Col-0 and also sucrose specific SWEETs were able to mediate transport of the fluorescent sucrose analog esculin in transformed mesophyll protoplasts. In contrast, AtSUC7Col-0 is not able to mediate esculin transport across the plasma membrane which implicates that AtSUC7Col-0 might be a non-functional pseudogene. The novel protoplast assay provides a useful tool for the quick and quantitative analysis of sucrose transporters in an in planta expression system. PMID:29740457

Constitutive neuropeptide Y Y4 receptor expression in human colonic adenocarcinoma cell lines

PubMed Central

Cox, Helen M; Tough, Iain R; Zandvliet, Dorothea W J; Holliday, Nicholas D

2001-01-01

Three human adenocarcinoma cell lines, Colony-24 (Col-24), Col-6 and Col-1 have been studied as confluent epithelial layers able to transport ions vectorially in response to basolateral vasoactive intestinal polypeptide (VIP) and pancreatic polypeptides (PP). Different species PP stimulated responses in Col-24 with Y4-like pharmacology. Bovine (b)PP, human (h)PP and porcine (p)PP were equipotent (EC50 values 3.0 – 5.0 nM) while rat (r)PP, avian (a)PP and [Leu31, Pro34]PYY (Pro34PYY) were significantly less potent. PYY was inactive. The PP pharmacology in Col-1 was comparable with Col-24. However, Col-6 cells were different; pPP had an EC50 intermediate (22.0 nM) between that of bPP (3.0 nM) and hPP (173.2 nM), with aPP and rPP being at least a further fold less potent. Deamidation of Tyr36 in bPP (by O-methylation or hydroxylation) or removal of the residue resulted in significant loss of activity in Col-24. GR231118 (1 μM) had no PP-like effects. In Col-24 and Col-1, GR231118 significantly attenuated bPP (30 nM) or hPP (100 nM) responses, but it did not alter bPP responses in Col-6. BIBP3226 and GR231118 both inhibited Y1-mediated responses which were only present in Col-6. RT – PCR analysis confirmed the presence of hY4 receptor mRNA in Col-24 and Col-1 epithelia but a barely visible hY4 product was observed in Col-6 and we suggest that an atypical Y4 receptor is expressed in this cell line. PMID:11156595

Exome sequencing in 32 patients with anophthalmia/microphthalmia and developmental eye defects.

PubMed

Slavotinek, A M; Garcia, S T; Chandratillake, G; Bardakjian, T; Ullah, E; Wu, D; Umeda, K; Lao, R; Tang, P L-F; Wan, E; Madireddy, L; Lyalina, S; Mendelsohn, B A; Dugan, S; Tirch, J; Tischler, R; Harris, J; Clark, M J; Chervitz, S; Patwardhan, A; West, J M; Ursell, P; de Alba Campomanes, A; Schneider, A; Kwok, P-Y; Baranzini, S; Chen, R O

2015-11-01

Anophthalmia/microphthalmia (A/M) is a genetically heterogeneous birth defect for which the etiology is unknown in more than 50% of patients. We used exome sequencing with the ACE Exome(TM) (Personalis, Inc; 18 cases) and UCSF Genomics Core (21 cases) to sequence 28 patients with A/M and four patients with varied developmental eye defects. In the 28 patients with A/M, we identified de novo mutations in three patients (OTX2, p.(Gln91His), RARB, p.Arg387Cys and GDF6, p.Ala249Glu) and inherited mutations in STRA6 in two patients. In patients with developmental eye defects, a female with cataracts and cardiomyopathy had a de novo COL4A1 mutation, p.(Gly773Arg), expanding the phenotype associated with COL4A1 to include cardiomyopathy. A male with a chorioretinal defect, microcephaly, seizures and sensorineural deafness had two PNPT1 mutations, p.(Ala507Ser) and c.401-1G>A, and we describe eye defects associated with this gene for the first time. Exome sequencing was efficient for identifying mutations in pathogenic genes for which there is no clinical testing available and for identifying cases that expand phenotypic spectra, such as the PNPT1 and COL4A1-associated disorders described here. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Optimizing Soft Tissue Management and Spacer Design in Segmental Bone Defects

DTIC Science & Technology

2015-10-01

were found with Tukey’s HSD post hoc analysis. Several target genes such as Oct4, Sox2, TGFB, and Col1A1 were generally up-regulated in all sections...samples presented several upregulated target genes such as Oct4, Sox2, TGFB, and Col1A1 in all sections. No significant main effects were found for

Familial Ehlers-Danlos syndrome with lethal arterial events caused by a mutation in COL5A1.

PubMed

Monroe, Glen R; Harakalova, Magdalena; van der Crabben, Saskia N; Majoor-Krakauer, Danielle; Bertoli-Avella, Aida M; Moll, Frans L; Oranen, Björn I; Dooijes, Dennis; Vink, Aryan; Knoers, Nine V; Maugeri, Alessandra; Pals, Gerard; Nijman, Isaac J; van Haaften, Gijs; Baas, Annette F

2015-06-01

Different forms of Ehlers-Danlos syndrome (EDS) exist, with specific phenotypes and associated genes. Vascular EDS, caused by heterozygous mutations in the COL3A1 gene, is characterized by fragile vasculature with a high risk of catastrophic vascular events at a young age. Classic EDS, caused by heterozygous mutations in the COL5A1 or COL5A2 genes, is characterized by fragile, hyperextensible skin and joint laxity. To date, vessel rupture in four unrelated classic EDS patients with a confirmed COL5A1 mutation has been reported. We describe familial occurrence of a phenotype resembling vascular EDS in a mother and her two sons, who all died at an early age from arterial ruptures. Diagnostic Sanger sequencing in the proband failed to detect aberrations in COL3A1, COL1A1, COL1A2, TGFBR1, TGFBR2, SMAD3, and ACTA2. Next, the proband's DNA was analyzed using a next-generation sequencing approach targeting 554 genes linked to vascular disease (VASCULOME project). A novel heterozygous mutation in COL5A1 was detected, resulting in an essential glycine substitution at the C-terminal end of the triple helix domain (NM_000093.4:c.4610G>T; p.Gly1537Val). This mutation was also present in DNA isolated from autopsy material of the index's brother. No material was available from the mother, but the mutation was excluded in her parents, siblings and in the father of her sons, suggesting that the COL5A1 mutation occurred in the mother's genome de novo. In conclusion, we report familial occurrence of lethal arterial events caused by a COL5A1 mutation. © 2015 Wiley Periodicals, Inc.

Proinflammatory and Anabolic Gene Expression Effects of Platelet-Rich Gel Supernatants on Equine Synovial Membrane Explants Challenged with Lipopolysaccharide

PubMed Central

Ríos, Diana L.; Pérez, Jorge E.

2017-01-01

Platelet-rich plasma (PRP) preparations are used in horses with osteoarthritis (OA). However, some controversies remain regarding the ideal concentration of platelets and leukocytes to produce an adequate anti-inflammatory and anabolic response in the synovial membrane. The aims of this study were to study the influence of leukoconcentrated platelet-rich gel (Lc-PRG) and leukoreduced platelet-rich gel (Lr-PRG) supernatants on the quantitative expression of some proinflammatory and anabolic genes in equine synovial membrane explants (SMEs) challenged with lipopolysaccharide (LPS). SMEs from six horses were cultured over 96 h. Then, SMEs were harvested for RNA extraction and quantitative gene expression analysis by RT-qPCR for nuclear factor kappa B (NFκB), matrix metalloproteinase 13 (MMP-13), a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS-4), collagen type I alpha 1 (COL1A1), collagen type II alpha 1 (COL2A1), and cartilage oligomeric matrix protein (COMP). The 25% and 50% Lc-PRG supernatants led to downregulation of NFκB, MMP-13, ADAMTS-4, COL1A1, COL2A1, and COMP in SMEs. Lr-PRG supernatants (particularly at the 50% concentration) induced downregulation of NFκB, MMP-13, ADAMTS-4, and COL1A1 and upregulation of COL2A1 and COMP. Lr-PRG supernatants should be used for the treatment of inflammatory arthropathies in horses because they have anti-inflammatory and anabolic effects in the synovial membrane. PMID:28761774

Proinflammatory and Anabolic Gene Expression Effects of Platelet-Rich Gel Supernatants on Equine Synovial Membrane Explants Challenged with Lipopolysaccharide.

PubMed

Carmona, Jorge U; Ríos, Diana L; López, Catalina; Álvarez, María E; Pérez, Jorge E

2017-01-01

Platelet-rich plasma (PRP) preparations are used in horses with osteoarthritis (OA). However, some controversies remain regarding the ideal concentration of platelets and leukocytes to produce an adequate anti-inflammatory and anabolic response in the synovial membrane. The aims of this study were to study the influence of leukoconcentrated platelet-rich gel (Lc-PRG) and leukoreduced platelet-rich gel (Lr-PRG) supernatants on the quantitative expression of some proinflammatory and anabolic genes in equine synovial membrane explants (SMEs) challenged with lipopolysaccharide (LPS). SMEs from six horses were cultured over 96 h. Then, SMEs were harvested for RNA extraction and quantitative gene expression analysis by RT-qPCR for nuclear factor kappa B (NF κ B), matrix metalloproteinase 13 (MMP-13), a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS-4), collagen type I alpha 1 (COL1A1), collagen type II alpha 1 (COL2A1), and cartilage oligomeric matrix protein (COMP). The 25% and 50% Lc-PRG supernatants led to downregulation of NF κ B, MMP-13, ADAMTS-4, COL1A1, COL2A1, and COMP in SMEs. Lr-PRG supernatants (particularly at the 50% concentration) induced downregulation of NF κ B, MMP-13, ADAMTS-4, and COL1A1 and upregulation of COL2A1 and COMP. Lr-PRG supernatants should be used for the treatment of inflammatory arthropathies in horses because they have anti-inflammatory and anabolic effects in the synovial membrane.

Gene Expression in Plant Lipid Metabolism in Arabidopsis Seedlings

PubMed Central

Hsiao, An-Shan; Haslam, Richard P.; Michaelson, Louise V.; Liao, Pan; Napier, Johnathan A.; Chye, Mee-Len

2014-01-01

Events in plant lipid metabolism are important during seedling establishment. As it has not been experimentally verified whether lipid metabolism in 2- and 5-day-old Arabidopsis thaliana seedlings is diurnally-controlled, quantitative real-time PCR analysis was used to investigate the expression of target genes in acyl-lipid transfer, β-oxidation and triacylglycerol (TAG) synthesis and hydrolysis in wild-type Arabidopsis WS and Col-0. In both WS and Col-0, ACYL-COA-BINDING PROTEIN3 (ACBP3), DIACYLGLYCEROL ACYLTRANSFERASE1 (DGAT1) and DGAT3 showed diurnal control in 2- and 5-day-old seedlings. Also, COMATOSE (CTS) was diurnally regulated in 2-day-old seedlings and LONG-CHAIN ACYL-COA SYNTHETASE6 (LACS6) in 5-day-old seedlings in both WS and Col-0. Subsequently, the effect of CIRCADIAN CLOCK ASSOCIATED1 (CCA1) and LATE ELONGATED HYPOCOTYL (LHY) from the core clock system was examined using the cca1lhy mutant and CCA1-overexpressing (CCA1-OX) lines versus wild-type WS and Col-0, respectively. Results revealed differential gene expression in lipid metabolism between 2- and 5-day-old mutant and wild-type WS seedlings, as well as between CCA1-OX and wild-type Col-0. Of the ACBPs, ACBP3 displayed the most significant changes between cca1lhy and WS and between CCA1-OX and Col-0, consistent with previous reports that ACBP3 is greatly affected by light/dark cycling. Evidence of oil body retention in 4- and 5-day-old seedlings of the cca1lhy mutant in comparison to WS indicated the effect of cca1lhy on storage lipid reserve mobilization. Lipid profiling revealed differences in primary lipid metabolism, namely in TAG, fatty acid methyl ester and acyl-CoA contents amongst cca1lhy, CCA1-OX, and wild-type seedlings. Taken together, this study demonstrates that lipid metabolism is subject to diurnal regulation in the early stages of seedling development in Arabidopsis. PMID:25264899

Expanding the clinical spectrum of COL1A1 mutations in different forms of glaucoma.

PubMed

Mauri, Lucia; Uebe, Steffen; Sticht, Heinrich; Vossmerbaeumer, Urs; Weisschuh, Nicole; Manfredini, Emanuela; Maselli, Edoardo; Patrosso, Mariacristina; Weinreb, Robert N; Penco, Silvana; Reis, André; Pasutto, Francesca

2016-08-02

Primary congenital glaucoma (PCG) and early onset glaucomas are one of the major causes of children and young adult blindness worldwide. Both autosomal recessive and dominant inheritance have been described with involvement of several genes including CYP1B1, FOXC1, PITX2, MYOC and PAX6. However, mutations in these genes explain only a small fraction of cases suggesting the presence of further candidate genes. To elucidate further genetic causes of these conditions whole exome sequencing (WES) was performed in an Italian patient, diagnosed with PCG and retinal detachment, and his unaffected parents. Sanger sequencing of the complete coding region of COL1A1 was performed in a total of 26 further patients diagnosed with PCG or early onset glaucoma. Exclusion of pathogenic variations in known glaucoma genes as CYP1B1, MYOC, FOXC1, PITX2 and PAX6 was additionally done per Sanger sequencing and Multiple Ligation-dependent Probe Amplification (MLPA) analysis. In the patient diagnosed with PCG and retinal detachment, analysis of WES data identified compound heterozygous variants in COL1A1 (p.Met264Leu; p.Ala1083Thr). Targeted COL1A1 screening of 26 additional patients detected three further heterozygous variants (p.Arg253*, p.Gly767Ser and p.Gly154Val) in three distinct subjects: two of them diagnosed with early onset glaucoma and mild form of osteogenesis imperfecta (OI), one patient with a diagnosis of PCG at age 4 years. All five variants affected evolutionary, highly conserved amino acids indicating important functional restrictions. Molecular modeling predicted that the heterozygous variants are dominant in effect and affect protein stability and thus the amount of available protein, while the compound heterozygous variants act as recessive alleles and impair binding affinity to two main COL1A1 binding proteins: Hsp47 and fibronectin. Dominant inherited mutations in COL1A1 are known causes of connective tissues disorders such as OI. These disorders are also associated with different ocular abnormalities, although recognition of the common pathology for both features is seldom being recognized. Our results expand the role of COL1A1 mutations in different forms of early-onset glaucoma with and without signs of OI. Thus, we suggest including COL1A1 mutation screening in the genetic work-up of glaucoma cases and detailed ophthalmic examinations with fundus analysis in patients with OI.

Linkage analysis of candidate genes as susceptibility loci for osteoarthritis-suggestive linkage of COL9A1 to female hip osteoarthritis.

PubMed

Mustafa, Z; Chapman, K; Irven, C; Carr, A J; Clipsham, K; Chitnavis, J; Sinsheimer, J S; Bloomfield, V A; McCartney, M; Cox, O; Sykes, B; Loughlin, J

2000-03-01

To examine 11 candidate genes as susceptibility loci for osteoarthritis (OA). A total of 481 families have been ascertained in which at least two siblings have had joint replacement surgery of the hip, or knee, or hip and knee for idiopathic OA. Each candidate gene was targeted using one or more intragenic or closely linked microsatellite marker. The linkage data were analysed unstratified and following stratification by sex and by joint replaced (hip or knee). The analyses revealed suggestive linkage of the type IX collagen gene COL9A1 (6q12-q13) to a subset of 132 families that contained affected females who were concordant for hip OA (female-hip) with a P-value of 0.00053 and logarithm of the odds (LOD) score of 2.33 [corrected P-value of 0. 0016, corrected LOD score of 1.85]. COL9A1 may therefore be a susceptibility locus for female hip OA. In addition, there was weak evidence of linkage to HLA/COL11A2 (6p21.3) in female hip OA with a corrected P-value of 0.016.

CINRG: Systems Biology of Glucocoricoids in Muscle Disease

DTIC Science & Technology

2014-12-01

1.76 CFL1 200021_at ɘ.001 1.695 CNN3 201445_at ɘ.001 2.274 COL1A1 202310_s_at ɘ.001 5.386 COL1A2 202404_s_at ɘ.001 4.89 COL3A1 211161_s_at ɘ.001...as TGF-, COL1A1 , COL4A1, COL4A2, and COL6A1, with the human muscle biopsy TGF- network associated with fibrosis (Fig. 1 B) and was similar to

Corrigendum to "A pathway-based network analysis of hypertension-related genes" [Physica A 444 (2016) 928-939

NASA Astrophysics Data System (ADS)

Wang, Huan; Hu, Jing-Bo; Xu, Chuan-Yun; Zhang, De-Hai; Yan, Qian; Xu, Ming; Cao, Ke-Fei; Zhang, Xu-Sheng

2016-04-01

The authors regret that the letter ;l; in the gene Creb3l2 was typed incorrectly as the number ;1; three times in the published paper. In this paper, the number of abbreviations used for genes should be nine because ;Col4a2_predicted; was also abbreviated as ;Col4a2;. Additionally, there were three minor errors in the production of the paper. The corrections are as follows:

Characterization and sequence analysis of pilin from F-like plasmids.

PubMed Central

Frost, L S; Finlay, B B; Opgenorth, A; Paranchych, W; Lee, J S

1985-01-01

Conjugative pili are expressed by derepressed plasmids and initiate cell-to-cell contact during bacterial conjugation. They are also the site of attachment for pilus-specific phages (f1, f2, and QB). In this study, the number of pili per cell and their ability to retract in the presence of cyanide was estimated for 13 derepressed plasmids. Selected pilus types were further characterized for reactivity with anti-F and anti-ColB2 pilus antisera as well as two F pilus-specific monoclonal antibodies, one of which is specific for a sequence common to most F-like pilin types (JEL92) and one which is specific for the amino terminus of F pilin (JEL93). The pilin genes from eight of these plasmids were cloned and sequenced, and the results were compared with information on F, ColB2, and pED208 pilin. Six pilus groups were defined: I, was F-like [F, pED202(R386), ColV2-K94, and ColVBtrp]; IIA was ColB2-like in sequence but had a lowered sensitivity to f1 phage due to its decreased ability for pilus retraction [pED236(ColB2) and pED203(ColB4)]; IIB was ColB2-like but retained f1 sensitivity [pED200(R124) and pED207(R538-1)]; III contained R1-19, which had a ColB2-like amino terminus but had an additional lysine residue at its carboxy terminus which may affect its phage sensitivity pattern and its antigenicity; IV was R100-1-like [R100-1 and presumably pED241(R136) and pED204(R6)] which had a unique amino-terminal sequence combined with a carboxy terminus similar to that of F. pED208(Folac) formed group V, which was multipiliated and exhibited poor pilus retraction although it retained full sensitivity to f1 phage. The pED208 pilin gene could not be cloned at this time since it shared no homology with the pilin gene of the F plasmid. Images PMID:2999074

New COL6A6 variant detected by whole-exome sequencing is linked to break points in intron 4 and 3′-UTR, deleting exon 5 of RHO, and causing adRP

PubMed Central

de Sousa Dias, Miguel; Hernan, Imma; Delás, Barbara; Pascual, Beatriz; Borràs, Emma; Gamundi, Maria José; Mañé, Begoña; Fernández-San José, Patricia; Ayuso, Carmen

2015-01-01

Purpose This study aimed to test a newly devised cost-effective multiplex PCR assay for the molecular diagnosis of autosomal dominant retinitis pigmentosa (adRP), as well as the use of whole-exome sequencing (WES) to detect disease-causing mutations in adRP. Methods Genomic DNA was extracted from peripheral blood lymphocytes of index patients with adRP and their affected and unaffected family members. We used a newly devised multiplex PCR assay capable of amplifying the genetic loci of RHO, PRPH2, RP1, PRPF3, PRPF8, PRPF31, IMPDH1, NRL, CRX, KLHL7, and NR2E3 to molecularly diagnose 18 index patients with adRP. We also performed WES in affected and unaffected members of four families with adRP in whom a disease-causing mutation was previously not found. Results We identified five previously reported mutations (p.Arg677X in the RP1 gene, p.Asp133Val and p.Arg195Leu in the PRPH2 gene, and p.Pro171Leu and p.Pro215Leu in the RHO gene) and one novel mutation (p.Val345Gly in the RHO gene) representing 33% detection of causative mutations in our adRP cohort. Comparative WES analysis showed a new variant (p.Gly103Arg in the COL6A6 gene) that segregated with the disease in one family with adRP. As this variant was linked with the RHO locus, we sequenced the complete RHO gene, which revealed a deletion in intron 4 that encompassed all of exon 5 and 28 bp of the 3′-untranslated region (UTR). Conclusions The novel multiplex PCR assay with next-generation sequencing (NGS) proved effective for detecting most of the adRP-causing mutations. A WES approach led to identification of a deletion in RHO through detection of a new linked variant in COL6A6. No pathogenic variants were identified in the remaining three families. Moreover, NGS and WES were inefficient for detecting the complete deletion of exon 5 in the RHO gene in one family with adRP. Carriers of this deletion showed variable clinical status, and two of these carriers had not previously been diagnosed with RP. PMID:26321861

X-linked Alport syndrome: An SSCP-based mutation survey over all 51 exons of the COL4A5 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Renieri, A.; Bruttini, M.; Galli, L.

1996-06-01

The COL4A5 gene encodes the {alpha}5 (type IV) collagen chain and is defective in X-linked Alport syndrome (AS). Here, we report the first systematic analysis of all 51 exons of COL4A5 gene in a series of 201 Italian AS patients. We have previously reported nine major rearrangements, as well as 18 small mutations identified in the same patient series by SSCP analysis of several exons. After systematic analysis of all 51 exons of COL4A5, we have now identified 30 different mutations: 10 glycine substitutions in the triple helical domain of the protein, 9 frameshift mutations, 4 in-frame deletions, 1 startmore » codon, 1 nonsense, and 5 splice-site mutations. These mutations were either unique or found in two unrelated families, thus excluding the presence of a common mutation in the coding part of the gene. Overall, mutations were detected in only 45% of individuals with a certain or likely diagnosis of X-linked AS. This finding suggests that mutations in noncoding segments of COL4A5 account for a high number of X-linked AS cases. An alternative hypothesis is the presence of locus heterogeneity, even within the X-linked form of the disease. A genotype/phenotype comparison enabled us to better substantiate a significant correlation between the degree of predicted disruption of the {alpha}5 chain and the severity of phenotype in affected male individuals. Our study has significant implications in the diagnosis and follow-up of AS patients. 44 refs., 3 figs., 4 tabs.« less

Early RAAS Blockade Exerts Renoprotective Effects in Autosomal Recessive Alport Syndrome.

PubMed

Uchida, Nao; Kumagai, Naonori; Nozu, Kandai; Fu, Xue Jun; Iijima, Kazumoto; Kondo, Yoshiaki; Kure, Shigeo

2016-11-01

Alport syndrome is a progressive renal disease caused by mutations in COL4A3, COL4A4, and COL4A5 genes that encode collagen type IV alpha 3, alpha 4, and alpha 5 chains, respectively. Because of abnormal collagen chain, glomerular basement membrane becomes fragile and most of the patients progress to end-stage renal disease in early adulthood. COL4A5 mutation causes X-linked form of Alport syndrome, and two mutations in either COL4A3 or COL4A4 causes an autosomal recessive Alport syndrome. Recently, renin-angiotensin-aldosterone system (RAAS) blockade has been shown to attenuate effectively disease progression in Alport syndrome. Here we present three Japanese siblings and their father all diagnosed with autosomal recessive Alport syndrome and with different clinical courses, suggesting the importance of the early initiation of RAAS blockade. The father was diagnosed with Alport syndrome. His consanguineous parents and his wife were healthy. All three siblings showed hematuria since infancy. Genetic analysis revealed that they shared the same gene mutations in COL4A3 in a compound heterozygous state: c.2330G>A (p.Gly777Ala) from the mother and c.4354A>T (p.Ser1452Cys) from the father. Although RAAS blockade was initiated for the older sister and brother when their renal function was already impaired, it did not attenuate disease progression. In the youngest brother, RAAS blockade was initiated during normal renal function stage. After the initiation, his renal function has been normal with the very mild proteinuria to date at the age of 17 years. We propose that in Alport syndrome, RAAS blockade should be initiated earlier than renal function is impaired.

An Analysis of C4I Effectiveness Using the RESA Wargame

DTIC Science & Technology

1994-06-01

the Target from Both comunities based on Warfare Specialty. SOURCE DF SS MS F p War Spec 1 1.0 1.0 0.02 0.898 ERROR 22 1372.6 62.4 TOTAL 23 1373.6...requirements. During the post Cold War era, a declining defense budget has forced complicated decisions concerning which systems the military will be...F-14 NFO 24. LT Donald Zwick, USN, EA-6B NFO 69 Appendix B: Basic Experimental Results Coil Col2 Col3 CoW4 Col5 Col6 Co17 War SpeC Level Stk Pack Sup

Molecular characterization of physis tissue by RNA sequencing.

PubMed

Paradise, Christopher R; Galeano-Garces, Catalina; Galeano-Garces, Daniela; Dudakovic, Amel; Milbrandt, Todd A; Saris, Daniel B F; Krych, Aaron J; Karperien, Marcel; Ferguson, Gabriel B; Evseenko, Denis; Riester, Scott M; van Wijnen, Andre J; Noelle Larson, A

2018-08-20

The physis is a well-established and anatomically distinct cartilaginous structure that is crucial for normal long-bone development and growth. Abnormalities in physis function are linked to growth plate disorders and other pediatric musculoskeletal diseases. Understanding the molecular pathways operative in the physis may permit development of regenerative therapies to complement surgically-based procedures that are the current standard of care for growth plate disorders. Here, we performed next generation RNA sequencing on mRNA isolated from human physis and other skeletal tissues (e.g., articular cartilage and bone; n = 7 for each tissue). We observed statistically significant enrichment of gene sets in the physis when compared to the other musculoskeletal tissues. Further analysis of these upregulated genes identified physis-specific networks of extracellular matrix proteins including collagens (COL2A1, COL6A1, COL9A1, COL14A1, COL16A1) and matrilins (MATN1, MATN2, MATN3), and signaling proteins in the WNT pathway (WNT10B, FZD1, FZD10, DKK2) or the FGF pathway (FGF10, FGFR4). Our results provide further insight into the gene expression networks that contribute to the physis' unique structural composition and regulatory signaling networks. Physis-specific expression profiles may guide ongoing initiatives in tissue engineering and cell-based therapies for treatment of growth plate disorders and growth modulation therapies. Furthermore, our findings provide new leads for therapeutic drug discovery that would permit future intervention through pharmacological rather than surgical strategies. Copyright © 2018 Elsevier B.V. All rights reserved.

Genomewide Association Study of Alcohol Dependence Identifies Risk Loci Altering Ethanol-response Behaviors in Model Organisms

PubMed Central

Adkins, Amy E.; Hack, Laura M.; Bigdeli, Tim B.; Williamson, Vernell S.; McMichael, G. Omari; Mamdani, Mohammed; Edwards, Alexis; Aliev, Fazil; Chan, Robin F.; Bhandari, Poonam; Raabe, Richard C.; Alaimo, Joseph T.; Blackwell, GinaMari G.; Moscati, Arden A.; Poland, Ryan S.; Rood, Benjamin; Patterson, Diana G.; Walsh, Dermot; Whitfield, John B.; Zhu, Gu; Montgomery, Grant W.; Henders, Anjali K.; Martin, Nicholas G.; Heath, Andrew C.; Madden, Pamela A.F.; Frank, Josef; Ridinger, Monika; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Ising, Marcus; Nöthen, Markus M; Kiefer, Falk; Rietschel, Marcella; Gelernter, Joel; Sherva, Richard; Koesterer, Ryan; Almasy, Laura; Zhao, Hongyu; Kranzler, Henry R.; Farrer, Lindsay A.; Maher, Brion S.; Prescott, Carol A.; Dick, Danielle M.; Bacanu, Silviu A.; Mathies, Laura D.; Davies, Andrew G.; Vladimirov, Vladimir I.; Grotewiel, Mike; Bowers, M. Scott; Bettinger, Jill C.; Webb, Bradley T.; Miles, Michael F.; Kendler, Kenneth S.; Riley, Brien P.

2017-01-01

Background Alcohol Dependence (AD) shows evidence for genetic liability, but genes influencing risk remain largely unidentified. Methods We conducted a genomewide association study in 706 related AD cases and 1748 unscreened population controls from Ireland. We sought replication in 15,496 samples of European descent. We used model organisms to assess the role of orthologous genes in ethanol response behaviors. We tested one primate-specific gene for expression differences in case/control post-mortem brain tissue. Results We detected significant association in COL6A3 and suggestive association in two previously implicated loci, KLF12 and RYR3. None of these signals are significant in replication. A suggestive signal in the long noncoding RNA LOC339975 is significant in case:control meta-analysis, but not in a population sample. Knockdown of a COL6A3 ortholog in C. elegans reduced ethanol sensitivity. Col6a3 expression correlated with handling-induced convulsions in mice. Loss of function of the KLF12 ortholog in C. elegans impaired development of acute functional tolerance. Klf12 expression correlated with locomotor activation following ethanol injection in mice. Loss of function of the RYR3 ortholog reduced ethanol sensitivity in C. elegans and rapid tolerance in Drosophila. The ryanodine receptor antagonist dantrolene reduced motivation to self-administer ethanol in rats. Expression of LOC339975 does not differ between cases and controls but is reduced in carriers of the associated rs11726136 allele in nucleus accumbens. Conclusions We detect association between AD and COL6A3, KLF12, RYR3 and LOC339975. Despite non-replication of COL6A3, KLF12 and RYR3 signals, orthologs of these genes influence behavioral response to ethanol in model organisms, suggesting potential involvement in human ethanol response and AD liability. The associated LOC339975 allele may influence gene expression in human nucleus accumbens. Although the functions of long noncoding RNAs are poorly understood, there is mounting evidence implicating these genes in multiple brain functions and disorders. PMID:28226201

Loss of the BMP antagonist USAG-1 ameliorates disease in a mouse model of the progressive hereditary kidney disease Alport syndrome.

PubMed

Tanaka, Mari; Asada, Misako; Higashi, Atsuko Y; Nakamura, Jin; Oguchi, Akiko; Tomita, Mayumi; Yamada, Sachiko; Asada, Nariaki; Takase, Masayuki; Okuda, Tomohiko; Kawachi, Hiroshi; Economides, Aris N; Robertson, Elizabeth; Takahashi, Satoru; Sakurai, Takeshi; Goldschmeding, Roel; Muso, Eri; Fukatsu, Atsushi; Kita, Toru; Yanagita, Motoko

2010-03-01

The glomerular basement membrane (GBM) is a key component of the filtering unit in the kidney. Mutations involving any of the collagen IV genes (COL4A3, COL4A4, and COL4A5) affect GBM assembly and cause Alport syndrome, a progressive hereditary kidney disease with no definitive therapy. Previously, we have demonstrated that the bone morphogenetic protein (BMP) antagonist uterine sensitization-associated gene-1 (USAG-1) negatively regulates the renoprotective action of BMP-7 in a mouse model of tubular injury during acute renal failure. Here, we investigated the role of USAG-1 in renal function in Col4a3-/- mice, which model Alport syndrome. Ablation of Usag1 in Col4a3-/- mice led to substantial attenuation of disease progression, normalization of GBM ultrastructure, preservation of renal function, and extension of life span. Immunohistochemical analysis revealed that USAG-1 and BMP-7 colocalized in the macula densa in the distal tubules, lying in direct contact with glomerular mesangial cells. Furthermore, in cultured mesangial cells, BMP-7 attenuated and USAG-1 enhanced the expression of MMP-12, a protease that may contribute to GBM degradation. These data suggest that the pathogenetic role of USAG-1 in Col4a3-/- mice might involve crosstalk between kidney tubules and the glomerulus and that inhibition of USAG-1 may be a promising therapeutic approach for the treatment of Alport syndrome.

A novel COL4A3 mutation causes autosomal-recessive Alport syndrome in a large Turkish family.

PubMed

Uzak, Asli Subasioglu; Tokgoz, Bulent; Dundar, Munis; Tekin, Mustafa

2013-03-01

Alport syndrome (AS) is a genetically heterogeneous disorder that is characterized by hematuria, progressive renal failure typically resulting in end-stage renal disease, sensorineural hearing loss, and variable ocular abnormalities. Only 15% of cases with AS are autosomal recessive and are caused by mutations in the COL4A3 or COL4A4 genes, encoding type IV collagen. Clinical data in a large consanguineous family with four affected members were reviewed, and genomic DNA was extracted. For mapping, 15 microsatellite markers flanking COL4A3, COL4A4, and COL4A5 in 16 family members were typed. For mutation screening, all coding exons of COL4A3 were polymerase chain reaction- amplified and Sanger-sequenced from genomic DNA. The disease locus was mapped to chromosome 2q36.3, where COL4A3 and COL4A4 reside. Sanger sequencing revealed a novel mis-sense mutation (c.2T>C; p.M1T) in exon 1 of COL4A3. The identified nucleotide change was not found in 100 healthy ethnicity-matched controls via Sanger sequencing. We present a large consanguineous Turkish family with AS that was found to have a COL4A3 mutation as the cause of the disease. Although the relationship between the various genotypes and phenotypes in AS has not been fully elucidated, detailed clinical and molecular analyses are helpful for providing data to be used in genetic counseling. It is important to identify new mutations to clarify their clinical importance, to assess the prognosis of the disease, and to avoid renal biopsy for final diagnosis.

Targeted next-generation sequencing in steroid-resistant nephrotic syndrome: mutations in multiple glomerular genes may influence disease severity.

PubMed

Bullich, Gemma; Trujillano, Daniel; Santín, Sheila; Ossowski, Stephan; Mendizábal, Santiago; Fraga, Gloria; Madrid, Álvaro; Ariceta, Gema; Ballarín, José; Torra, Roser; Estivill, Xavier; Ars, Elisabet

2015-09-01

Genetic diagnosis of steroid-resistant nephrotic syndrome (SRNS) using Sanger sequencing is complicated by the high genetic heterogeneity and phenotypic variability of this disease. We aimed to improve the genetic diagnosis of SRNS by simultaneously sequencing 26 glomerular genes using massive parallel sequencing and to study whether mutations in multiple genes increase disease severity. High-throughput mutation analysis was performed in 50 SRNS and/or focal segmental glomerulosclerosis (FSGS) patients, a validation cohort of 25 patients with known pathogenic mutations, and a discovery cohort of 25 uncharacterized patients with probable genetic etiology. In the validation cohort, we identified the 42 previously known pathogenic mutations across NPHS1, NPHS2, WT1, TRPC6, and INF2 genes. In the discovery cohort, disease-causing mutations in SRNS/FSGS genes were found in nine patients. We detected three patients with mutations in an SRNS/FSGS gene and COL4A3. Two of them were familial cases and presented a more severe phenotype than family members with mutation in only one gene. In conclusion, our results show that massive parallel sequencing is feasible and robust for genetic diagnosis of SRNS/FSGS. Our results indicate that patients carrying mutations in an SRNS/FSGS gene and also in COL4A3 gene have increased disease severity.

Autologous leukocyte-reduced platelet-rich plasma therapy for Achilles tendinopathy induced by collagenase in a rabbit model

PubMed Central

González, Juan C.; López, Catalina; Álvarez, María E.; Pérez, Jorge E.; Carmona, Jorge U.

2016-01-01

Leukocyte-reduced platelet-rich plasma (LR-PRP) is a therapy for tendinopathy of the Achilles tendon (TAT); however, there is scarce information regarding LR-PRP effects in rabbit models of TAT. We compared, at 4 and 12 weeks (w), the LR-PRP and placebo (PBS) effects on ultrasonography, histology and relative gene expression of collagen types I (COL1A1) and III (COL3A1) and vascular endothelial growth factor (VEGF) in 24 rabbits with TAT induced by collagenase. The rabbits (treated with both treatments) were euthanatised after either 4 or 12 w. A healthy group (HG (n = 6)) was included. At 4 and 12 w, the LR-PRP group had a no statistically different histology score to the HG. At w 4, the COL1A1 expression was significantly higher in the LR-PRP group when compared to HG, and the expression of COL3A1from both LR-PRP and PBS-treated tendons was significantly higher when compared to the HG. At w 12, the expression of COL3A1 remained significantly higher in the PBS group in comparison to the LR-PRP group and the HG. At w 4, the LR-PRP group presented a significantly higher expression of VEGF when compared to the PBS group and the HG. In conclusion, LR-PRP treatment showed regenerative properties in rabbits with TAT. PMID:26781753

Identification of the Gene for Scleroderma in the Tsk/2 Mouse Strain: Implications for Human Scleroderma Pathogenesis and subset Distinctions

DTIC Science & Technology

2014-07-01

onto an 8% SDS gel. Proteins were transferred to a polyvinylidene fluoride membrane, blocked in 5% nonfat milk in Tris-buffered saline, probed with...a)marker)of)fibrosis)[3,)4]),)we)assessed)both) protein )and)mRNA)levels)in)fibroblasts)that)received)DNA)from)a) plasmid)containing)a)single)allele...of)a)single)Col3a1%gene.)In)three)independent)experiments,)COL1A1) protein ) was)significantly)elevated)after)48)hours)of)transfection)with)Col3a1Tsk2

Identification and Characterization of an Arabidopsis thaliana Mutant lbt With High Tolerance to Boron Deficiency

PubMed Central

Huai, Zexun; Peng, Lishun; Wang, Sheliang; Zhao, Hua; Shi, Lei; Xu, Fangsen

2018-01-01

Boron (B) is an essential micronutrient of plants. In the present study, we characterized an Arabidopsis mutant lbt with significant low-boron tolerance that was identified based on our previous mapping of QTL for B efficiency in Arabidopsis. Multiple nutrient-deficiency analyses point out that lbt mutant is insensitive to only B-limitation stress. Compared with wild-type Col-0, the fresh weight, leaf area, root length and root elongation rate of lbt mutant were significantly improved under B deficiency during vegetative growth. lbt mutant also showed the improvements in plant height, branches and inflorescences compared with Col-0 during the reproductive stage under B limitation. Ultrastructure analysis of the leaves showed that starch accumulation in lbt mutant was significantly diminished compared with Col-0. Furthermore, there were no significant differences in the expression of transporter-related genes and B concentrations between Col-0 and lbt mutant under both normal B and low-B conditions. These results suggest that lbt mutant has a lower B demand than Col-0. Genetic analysis suggests that the low-B tolerant phenotype of lbt mutant is under the control of a monogenic recessive gene. Based on the high-density SNP linkage genetic map, only one QTL for low-B tolerance was mapped on chromosome 4 between 10.4 and 14.8 Mb. No any reported B-relative genes exist in the QTL interval, suggesting that a gene with unknown function controls the tolerance of lbt to B limitation. Taken together, lbt is a low-B tolerant mutant that does not depend on the uptake or transport of B and is controlled by a monogenic recessive gene mapped on chromosome 4, and cloning and functional analysis of LBT gene are expected to reveal novel mechanisms for plant resistance to B deficiency.

Whole-Exome Sequencing in Age-Related Macular Degeneration Identifies Rare Variants in COL8A1, a Component of Bruch's Membrane.

PubMed

Corominas, Jordi; Colijn, Johanna M; Geerlings, Maartje J; Pauper, Marc; Bakker, Bjorn; Amin, Najaf; Lores Motta, Laura; Kersten, Eveline; Garanto, Alejandro; Verlouw, Joost A M; van Rooij, Jeroen G J; Kraaij, Robert; de Jong, Paulus T V M; Hofman, Albert; Vingerling, Johannes R; Schick, Tina; Fauser, Sascha; de Jong, Eiko K; van Duijn, Cornelia M; Hoyng, Carel B; Klaver, Caroline C W; den Hollander, Anneke I

2018-04-26

Genome-wide association studies and targeted sequencing studies of candidate genes have identified common and rare variants that are associated with age-related macular degeneration (AMD). Whole-exome sequencing (WES) studies allow a more comprehensive analysis of rare coding variants across all genes of the genome and will contribute to a better understanding of the underlying disease mechanisms. To date, the number of WES studies in AMD case-control cohorts remains scarce and sample sizes are limited. To scrutinize the role of rare protein-altering variants in AMD cause, we performed the largest WES study in AMD to date in a large European cohort consisting of 1125 AMD patients and 1361 control participants. Genome-wide case-control association study of WES data. One thousand one hundred twenty-five AMD patients and 1361 control participants. A single variant association test of WES data was performed to detect variants that are associated individually with AMD. The cumulative effect of multiple rare variants with 1 gene was analyzed using a gene-based CMC burden test. Immunohistochemistry was performed to determine the localization of the Col8a1 protein in mouse eyes. Genetic variants associated with AMD. We detected significantly more rare protein-altering variants in the COL8A1 gene in patients (22/2250 alleles [1.0%]) than in control participants (11/2722 alleles [0.4%]; P = 7.07×10 -5 ). The association of rare variants in the COL8A1 gene is independent of the common intergenic variant (rs140647181) near the COL8A1 gene previously associated with AMD. We demonstrated that the Col8a1 protein localizes at Bruch's membrane. This study supported a role for protein-altering variants in the COL8A1 gene in AMD pathogenesis. We demonstrated the presence of Col8a1 in Bruch's membrane, further supporting the role of COL8A1 variants in AMD pathogenesis. Protein-altering variants in COL8A1 may alter the integrity of Bruch's membrane, contributing to the accumulation of drusen and the development of AMD. Copyright © 2018 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Accumulation of oxidized LDL in the tendon tissues of C57BL/6 or apolipoprotein E knock-out mice that consume a high fat diet: potential impact on tendon health.

PubMed

Grewal, Navdeep; Thornton, Gail M; Behzad, Hayedeh; Sharma, Aishwariya; Lu, Alex; Zhang, Peng; Reid, W Darlene; Granville Alex Scott, David J

2014-01-01

Clinical studies have suggested an association between dyslipidemia and tendon injuries or chronic tendon pain; the mechanisms underlying this association are not yet known. The objectives of this study were (1) to evaluate the impact of a high fat diet on the function of load-bearing tendons and on the distribution in tendons of oxidized low density lipoprotein (oxLDL), and (2) to examine the effect of oxLDL on tendon fibroblast proliferation and gene expression. Gene expression (Mmp2, Tgfb1, Col1a1, Col3a1), fat content (Oil Red O staining), oxLDL levels (immunohistochemistry) and tendon biomechanical properties were examined in mice (C57Bl/6 or ApoE -/-) receiving a standard or a high fat diet. Human tendon fibroblast proliferation and gene expression (COL1A1, COL3A1, MMP2) were examined following oxLDL exposure. In both types of mice (C57Bl/6 or ApoE -/-), consumption of a high fat diet led to a marked increase in oxLDL deposition in the load-bearing extracellular matrix of the tendon. The consumption of a high fat diet also reduced the failure stress and load of the patellar tendon in both mouse types, and increased Mmp2 expression. ApoE -/- mice exhibited more pronounced reductions in tendon function than wild-type mice, and decreased expression of Col1a1 compared to wild type mice. Human tendon fibroblasts responded to oxLDL by increasing their proliferation and their mRNA levels of MMP2, while decreasing their mRNA levels for COL1A1 and COL3A1. The consumption of a high fat diet resulted in deleterious changes in tendon function, and these changes may be explained in part by the effects of oxLDL, which induced a proliferative, matrix-degrading phenotype in human tenocytes.

Identification and characterization of CONSTANS-like (COL) gene family in upland cotton (Gossypium hirsutum L.).

PubMed

Cai, Darun; Liu, Hui; Sang, Na; Huang, Xianzhong

2017-01-01

The CONSTANS/FLOWERING LOCUS T (CO/FT) regulon plays a central role in the control of flowering time in photoperiod-sensitive plants. Flowering time in wild cotton (Gossypium spp.) has strict photoperiod sensitivity, but domesticated cotton is day-neutral. Information on the molecular characterization of the CO and CO-like (COL) genes in cotton is very limited. In this study, we identified 42 COL homologs (GhCOLs) in the G. hirsutum genome, and many of them were previously unreported. We studied their chromosome distribution, phylogenetic relationships, and structures of genes and proteins. Our results showed that GhCOLs were classified into three groups, and 14 COLs in group I showed conserved structure when compared with other plants. Two homoeologous pairs, GhCOL1-A and GhCOL1-D in Group I, showed the highest sequence similarity to Arabidopsis thaliana CO and rice CO homologous gene Heading date1 (Hd1). Tissue-specific expression showed that 42 GhCOL genes may function as tissue-specific regulators in different cells or organs. We cloned and sequenced the 14 GhCOL genes in Group I related to flowering induction to study their diurnal expression pattern, and found that their expression showed distinct circadian regulation. Most of them peaked at dawn and decreased rapidly to their minima at dusk, then started to accumulate until following dawn under long- or short-day conditions. Transgenic study in the Arabidopsis co-2 mutant demonstrated that GhCOL1-A and GhCOL1-D fully rescued the late-flowering phenotype, whereas GhCOL3-A, GhCOL3-D, GhCOL7-A, and GhCOL7-D partially rescued the late-flowering phenotype, and the other five homoeologous pairs in Group I did not promote flowering. These results indicate that GhCOL1-A and GhCOL1-D were potential flowering inducers, and are candidate genes for research in flowering regulation in cotton.

Identification, Characterization, and Utilization of Adult Meniscal Progenitor Cells

DTIC Science & Technology

2014-09-01

SMURF2 IPI00329664 30,9 7,9 16,2 3,7 COL1A1 IPI00304962 409,2 83,5 398,4 22,0 ACAN IPI00027377 86,7 54,6 100,7 25,8 COL6A2 IPI00983601 28,5 6,4 34,4...GGGTTCAGAGTGTTGTACAGTCC-30 NM_003239.2 RUNX2 50-TTCCAGACCAGCAGCACTC-30 50-CAGCGTCAACACCATCATT-30 NM_004348 COL1A1 50-TTCCCCCAGCCACAAAGAGTC-30 50

Isolation and characterization of two novel groups of kanamycin-resistance ColE1-like plasmids in Salmonella enterica serotypes from food animals.

PubMed

Chen, Chin-Yi; Strobaugh, Terence P; Nguyen, Ly-Huong T; Abley, Melanie; Lindsey, Rebecca L; Jackson, Charlene R

2018-01-01

While antimicrobial resistance in Salmonella enterica is mainly attributed to large plasmids, small plasmids may also harbor antimicrobial resistance genes. Previously, three major groups of ColE1-like plasmids conferring kanamycin-resistance (KanR) in various S. enterica serotypes from diagnostic samples of human or animals were reported. In this study, over 200 KanR S. enterica isolates from slaughter samples, collected in 2010 and 2011 as a part of the animal arm of the National Antimicrobial Resistance Monitoring System, were screened for the presence of ColE1-like plasmids. Twenty-three KanR ColE1-like plasmids were successfully isolated. Restriction fragment mapping revealed five major plasmid groups with subgroups, including two new groups, X (n = 3) and Y/Y2/Y3 (n = 4), in addition to the previously identified groups A (n = 7), B (n = 6), and C/C3 (n = 3). Nearly 75% of the plasmid-carrying isolates were from turkey and included all the isolates carrying X and Y plasmids. All group X plasmids were from serotype Hadar. Serotype Senftenberg carried all the group Y plasmids and one group B plasmid. All Typhimurium isolates (n = 4) carried group A plasmids, while Newport isolates (n = 3) each carried a different plasmid group (A, B, or C). The presence of the selection bias in the NARMS strain collection prevents interpretation of findings at the population level. However, this study demonstrated that KanR ColE1-like plasmids are widely distributed among different S. enterica serotypes in the NARMS isolates and may play a role in dissemination of antimicrobial resistance genes.

Isolation and characterization of two novel groups of kanamycin-resistance ColE1-like plasmids in Salmonella enterica serotypes from food animals

PubMed Central

Strobaugh, Terence P.; Nguyen, Ly-Huong T.; Abley, Melanie; Lindsey, Rebecca L.; Jackson, Charlene R.

2018-01-01

While antimicrobial resistance in Salmonella enterica is mainly attributed to large plasmids, small plasmids may also harbor antimicrobial resistance genes. Previously, three major groups of ColE1-like plasmids conferring kanamycin-resistance (KanR) in various S. enterica serotypes from diagnostic samples of human or animals were reported. In this study, over 200 KanR S. enterica isolates from slaughter samples, collected in 2010 and 2011 as a part of the animal arm of the National Antimicrobial Resistance Monitoring System, were screened for the presence of ColE1-like plasmids. Twenty-three KanR ColE1-like plasmids were successfully isolated. Restriction fragment mapping revealed five major plasmid groups with subgroups, including two new groups, X (n = 3) and Y/Y2/Y3 (n = 4), in addition to the previously identified groups A (n = 7), B (n = 6), and C/C3 (n = 3). Nearly 75% of the plasmid-carrying isolates were from turkey and included all the isolates carrying X and Y plasmids. All group X plasmids were from serotype Hadar. Serotype Senftenberg carried all the group Y plasmids and one group B plasmid. All Typhimurium isolates (n = 4) carried group A plasmids, while Newport isolates (n = 3) each carried a different plasmid group (A, B, or C). The presence of the selection bias in the NARMS strain collection prevents interpretation of findings at the population level. However, this study demonstrated that KanR ColE1-like plasmids are widely distributed among different S. enterica serotypes in the NARMS isolates and may play a role in dissemination of antimicrobial resistance genes. PMID:29513730

Mutation spectrum and differential gene expression in cystic and solid vestibular schwannoma.

PubMed

Zhang, Zhihua; Wang, Zhaoyan; Sun, Lianhua; Li, Xiaohua; Huang, Qi; Yang, Tao; Wu, Hao

2014-03-01

We sought to characterize the mutation spectrum of NF2 and the differential gene expression in cystic and solid vestibular schwannomas. We collected tumor tissue and blood samples of 31 cystic vestibular schwannomas and 114 solid vestibular schwannomas. Mutation screening of NF2 was performed in both tumor and blood DNA samples of all patients. cDNA microarray was used to analyze the differential gene expression between 11 cystic vestibular schwannomas and 6 solid vestibular schwannomas. Expression levels of top candidate genes were verified by quantitative reverse transcription PCR. NF2 mutations were identified in 34.5% of sporadic vestibular schwannomas, with all mutations being exclusively somatic. No significant difference was found between the mutation detection rates of cystic vestibular schwannoma (35.5%) and solid vestibular schwannoma (34.2%). cDNA microarray analysis detected a total of 46 differentially expressed genes between the cystic vestibular schwannoma and solid vestibular schwannoma samples. The significantly decreased expression of four top candidate genes, C1orf130, CNTF, COL4A3, and COL4A4, was verified by quantitative reverse transcription PCR. NF2 mutations are not directly involved in the cystic formation of vestibular schwannoma. In addition, the differential gene expression of cystic vestibular schwannoma reported in our study may provide useful insights into the molecular mechanism underlying this process.

Ethylenediaminetetraacetic acid induces antioxidant and anti-inflammatory activities in experimental liver fibrosis.

PubMed

González-Cuevas, J; Navarro-Partida, J; Marquez-Aguirre, A L; Bueno-Topete, M R; Beas-Zarate, C; Armendáriz-Borunda, J

2011-01-01

Experimental liver fibrosis induced by carbon tetrachloride (CCl(4)) is associated with oxidative stress, lipid peroxidation, and inflammation. This work was focused on elucidating the anti-inflammatory and antioxidant effects of ethylenediaminetetraacetic acid (EDTA) in this model of hepatotoxicity. Wistar male rats were treated with CCl(4) and EDTA (60, 120, or 240 mg/kg). Morphometric analyses were carried out in Masson's stained liver sections to determine fibrosis index. Coagulation tests prothrombin time (PT) and partial thromboplastin time (PTT) were also determined. Gene expression for transforming growth factor beta (TGF-beta1), alpha1(I) procollagen gene (alpha1 Col I), tumor necrosis factor alpha (TNF-alpha), interleukin-6 (IL-6), and superoxide dismutase (SOD) was monitored by real-time PCR. Antioxidant effect of EDTA was measured by its effects on lipid peroxidation; biological activity of ceruloplasmin (Cp), SOD, and catalase (Cat) were analyzed by zymography assays. Animals with CCl(4)-hepatic injury that received EDTA showed a decrement in fibrosis (20%) and lipid peroxidation (22%). The mRNA expression for TNF-alpha (55%), TGF-beta1 (50%), IL-6 (52%), and alpha1 Col I (60%) was also decreased. This group of animals showed increased Cp (62%) and SOD (25%) biological activities. Coagulation blood tests, Cat activity, and gene expression for SOD were not modified by EDTA treatment. This study demonstrates that EDTA treatment induces the activity of antioxidant enzymes, decreases lipid peroxidation, hepatic inflammation, and fibrosis in experimental liver fibrosis induced by CCl(4).

Tooth agenesis in osteogenesis imperfecta related to mutations in the collagen type I genes.

PubMed

Malmgren, B; Andersson, K; Lindahl, K; Kindmark, A; Grigelioniene, G; Zachariadis, V; Dahllöf, G; Åström, E

2017-01-01

Osteogenesis imperfecta (OI) is a heterogeneous group of disorders of connective tissue, mainly caused by mutations in the collagen type I genes (COL1A1 and COL1A2). Tooth agenesis is a common feature of OI. We investigated the association between tooth agenesis and collagen type I mutations in individuals with OI. In this cohort study, 128 unrelated individuals with OI were included. Panoramic radiographs were analyzed regarding dentinogenesis imperfecta (DGI) and congenitally missing teeth. The collagen I genes were sequenced in all individuals, and in 25, multiplex ligation-dependent probe amplification was performed. Mutations in the COL1A1 and COL1A2 genes were found in 104 of 128 individuals. Tooth agenesis was diagnosed in 17% (hypodontia 11%, oligodontia 6%) and was more frequent in those with DGI (P = 0.016), and in those with OI type III, 47%, compared to those with OI types I, 12% (P = 0.003), and IV, 13% (P = 0.017). Seventy-five percent of the individuals with oligodontia (≥6 missing teeth) had qualitative mutations, but there was no association with OI type, gender, or presence of DGI. The prevalence of tooth agenesis is high (17%) in individuals with OI, and OI caused by a qualitative collagen I mutation is associated with oligodontia. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A founder mutation in COL4A3 causes autosomal recessive Alport syndrome in the Ashkenazi Jewish population.

PubMed

Webb, B D; Brandt, T; Liu, L; Jalas, C; Liao, J; Fedick, A; Linderman, M D; Diaz, G A; Kornreich, R; Trachtman, H; Mehta, L; Edelmann, L

2014-08-01

Alport syndrome is an inherited progressive nephropathy arising from mutations in the type IV collagen genes, COL4A3, COL4A4, and COL4A5. Symptoms also include sensorineural hearing loss and ocular lesions. We determined the molecular basis of Alport syndrome in a non-consanguineous Ashkenazi Jewish family with multiple affected females using linkage analysis and next generation sequencing. We identified a homozygous COL4A3 mutation, c.40_63del, in affected individuals with mutant alleles inherited from each parent on partially conserved haplotypes. Large-scale population screening of 2017 unrelated Ashkenazi Jewish samples revealed a carrier frequency of 1 in 183 indicating that COL4A3 c.40_63del is a founder mutation which may be a common cause of Alport syndrome in this population. Additionally, we determined that heterozygous mutation carriers in this family do not meet criteria for a diagnosis of Thin Basement Membrane Nephropathy and concluded that carriers of c.40_63del are not likely to develop benign familial hematuria. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

[Analysis of the clinical audiological characteristics in 92 Chinese Alport syndrome cases].

PubMed

Chen, Li; Xue, Junfang; Zhang, Yanqin; Wang, Fang; Chen, Siqi; Duan, Jibo; Liu, Yuhe; Ding, Jie

2014-11-01

To analyze the clinical audiological characteristics in Chinese Alport syndrome, and investigate the relationship between the genotypes of Alport syndrome and hearing phenotype. The clinical hearing data of 92 cases diagnosed as Alport syndrome from 2008 August to 2013 August were reviewed and analyzed. All coding exons of COL4A3 and COL4A5 genes were PCR-amplified and sequenced from genomic DNA, or mRNA of COL4A5 gene was RT-PCR-amplified and sequenced from skin fibroblast in 17 cases. Eighty-seven out of 92 cases were found with X-linked dominant inheritance (XLAS); 5 cases with autosomal recessive (ARAS); 44 cases had normal hearing, but 14 young cases had abnormal OAE; 48 cases (52.2%, 35 male, 13 female) had sensorineural hearing loss. A total of 44 cases with XLAS had hearing loss (49.4%), wherein the incidence of hearing impairment was 55.0% in male XLAS, and 37.0% in female XLAS. Mild and moderate hearing loss were found in XLAS. Audiometric curves including groove type (21 cases), descending type (13 cases), flat type (10 cases), high frequency drop type (3 cases) and ascending type (1 case) were found in AS. Sixteen mutations of COL4A3, COL4A5 gene were found in 17 cases with Alport syndrome, including severe mutation in 8 cases with moderate hearing impairment. Mild and moderate hearing impairment, and groove type of audiometric curve are mainly found in Chinese Alport syndrome, which is different from Alport syndrome in western countries. OAE in the early diagnosis of hearing loss is important. Hearing phenotype is related certainly with genotype.

Accumulation of Oxidized LDL in the Tendon Tissues of C57BL/6 or Apolipoprotein E Knock-Out Mice That Consume a High Fat Diet: Potential Impact on Tendon Health

PubMed Central

Grewal, Navdeep; Thornton, Gail M.; Behzad, Hayedeh; Sharma, Aishwariya; Lu, Alex; Zhang, Peng; Reid, W. Darlene; Granville, David J.; Scott, Alex

2014-01-01

Objective Clinical studies have suggested an association between dyslipidemia and tendon injuries or chronic tendon pain; the mechanisms underlying this association are not yet known. The objectives of this study were (1) to evaluate the impact of a high fat diet on the function of load-bearing tendons and on the distribution in tendons of oxidized low density lipoprotein (oxLDL), and (2) to examine the effect of oxLDL on tendon fibroblast proliferation and gene expression. Methods Gene expression (Mmp2, Tgfb1, Col1a1, Col3a1), fat content (Oil Red O staining), oxLDL levels (immunohistochemistry) and tendon biomechanical properties were examined in mice (C57Bl/6 or ApoE -/-) receiving a standard or a high fat diet. Human tendon fibroblast proliferation and gene expression (COL1A1, COL3A1, MMP2) were examined following oxLDL exposure. Results In both types of mice (C57Bl/6 or ApoE -/-), consumption of a high fat diet led to a marked increase in oxLDL deposition in the load-bearing extracellular matrix of the tendon. The consumption of a high fat diet also reduced the failure stress and load of the patellar tendon in both mouse types, and increased Mmp2 expression. ApoE -/- mice exhibited more pronounced reductions in tendon function than wild-type mice, and decreased expression of Col1a1 compared to wild type mice. Human tendon fibroblasts responded to oxLDL by increasing their proliferation and their mRNA levels of MMP2, while decreasing their mRNA levels for COL1A1 and COL3A1. Conclusion The consumption of a high fat diet resulted in deleterious changes in tendon function, and these changes may be explained in part by the effects of oxLDL, which induced a proliferative, matrix-degrading phenotype in human tenocytes. PMID:25502628

Genetics Home Reference: osteogenesis imperfecta

MedlinePlus

... particular ethnic groups? Genetic Changes Mutations in the COL1A1 , COL1A2 , CRTAP , and P3H1 genes cause osteogenesis imperfecta . Mutations in the COL1A1 and COL1A2 genes are responsible for more than ...

Regulation of COL1A1 expression in type I collagen producing tissues: identification of a 49 base pair region which is required for transgene expression in bone of transgenic mice

NASA Technical Reports Server (NTRS)

Bedalov, A.; Salvatori, R.; Dodig, M.; Kronenberg, M. S.; Kapural, B.; Bogdanovic, Z.; Kream, B. E.; Woody, C. O.; Clark, S. H.; Mack, K.;

Temporal growth factor release from platelet-rich plasma, trehalose lyophilized platelets, and bone marrow aspirate and their effect on tendon and ligament gene expression.

PubMed

McCarrel, Taralyn; Fortier, Lisa

2009-08-01

Platelet-rich plasma (PRP) has generated substantial interest for tendon and ligament regeneration because of the high concentrations of growth factors in platelet alpha-granules. This study compared the temporal release of growth factors from bone marrow aspirate (BMA), PRP, and lyophilized platelet product (PP), and measured their effects on tendon and ligament gene expression. Blood and BMA were collected and processed to yield PRP and plasma. Flexor digitorum superficialis tendon (FDS) and suspensory ligament (SL) explants were cultured in 10% plasma in DMEM (control), BMA, PRP, or PP. TGF-beta1 and PDGF-BB concentrations were determined at 0, 24, and 96 h of culture using ELISA. Quantitative RT-PCR for collagen types I and III (COL1A1, COL3A1), cartilage oligomeric matrix protein (COMP), decorin, and matrix metalloproteinases-3 and 13 (MMP-3, MMP-13) was performed. TGF-beta1 and PDGF-BB concentrations were highest in PRP and PP. Growth factor quantity was unchanged in BMA, increased in PRP, and decreased in PP over 4 days. TGF-beta1 and platelet concentrations were positively correlated. Lyophilized PP and PRP resulted in increased COL1A1:COL3A1 ratio, increased COMP, and decreased MMP-13 expression. BMA resulted in decreased COMP and increased MMP-3 and MMP-13 gene expression. Platelet concentration was positively correlated with COL1A1, ratio of COL1A1:COL3A1, and COMP, and negatively correlated with COL3A1, MMP-13, and MMP-3. White blood cell concentration was positively correlated with COL3A1, MMP3, and MMP13, and negatively correlated with a ratio of COL1A1:COL3A1, COMP, and decorin. These findings support further in vivo investigation of PRP and PP for treatment of tendonitis and desmitis. Copyright 2009 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Identification of PaCOL1 and PaCOL2, two CONSTANS-like genes showing decreased transcript levels preceding short day induced growth cessation in Norway spruce.

PubMed

Holefors, Anna; Opseth, Lars; Ree Rosnes, Anne Katrine; Ripel, Linda; Snipen, Lars; Fossdal, Carl Gunnar; Olsen, Jorunn E

2009-02-01

In woody plants of the temperate zone short photoperiod (SD) leads to growth cessation. In angiosperms CONSTANS (CO) or CO-like genes play an important role in the photoperiodic control of flowering, tuberisation and shoot growth. To investigate the role of CO-like genes in photoperiodic control of shoot elongation in gymnosperms, PaCOL1 and PaCOL2 were isolated from Norway spruce. PaCOL1 encodes a 3.9kb gene with a predicted protein of 444 amino acids. PaCOL2 encodes a 1.2kb gene with a predicted protein of 385 amino acids. Both genes consist of two exons and have conserved domains found in other CO-like genes; two zinc finger domains, a CCT and a COOH domain. PaCOL1 and PaCOL2 fall into the group 1c clade of the CO-like genes, and are thus distinct from Arabidopsis CO that belongs to group 1a. Transcript levels of both PaCOL-genes appear to be light regulated, an increasing trend was observed upon transition from darkness to light, and a decreasing trend during darkness. The increasing trend at dawn was observed both in needles and shoot tips, whereas the decreasing trend in darkness was most prominent in shoot tips, and limited to the late part of the dark period in needles. The transcript levels of both genes decreased significantly in both tissues under SD prior to growth cessation and bud formation. This might suggest an involvement in photoperiodic control of shoot elongation or might be a consequence of regulation by light.

Disruption of ERBB2IP is not associated with dystrophic epidermolysis bullosa in both father and son carrying a balanced 5;13 translocation.

PubMed

Stefanova, Margarita; Zemke, Katrin; Dimitrov, Boyan; Has, Christina; Kern, Johannes S; Bruckner-Tuderman, Leena; Kutsche, Kerstin

2005-10-01

Mutations in the type VII collagen gene (COL7A1) cause autosomal recessive and autosomal dominant inherited dystrophic epidermolysis bullosa (DEB). We report a family with three individuals who present blistering, scarring, hypo- and hyperpigmentation, and nail dystrophy suggestive for DEB. Whereas father and son carry a 5;13 translocation, the daughter shows a normal karyotype. Segregation analysis revealed that all affected family members inherited the same COL7A1 allele. Mutation analysis disclosed a heterozygous missense mutation, c.6227G > A (p.G2076D), in COL7A1 in all affected individuals. Delineation of the translocation breakpoints showed that the ERBB2IP (erbb2 interacting protein or Erbin) gene is disrupted in 5q13.1 and GPC6 in 13q32. GPC6 encodes glypican 6 belonging to a family of cell surface heparan sulfate proteoglycans. The binding partners of Erbin, BP230 (BPAG1) and the integrin beta4 subunit, both involved in hemidesmosome (HD) function, and the presence of Erbin in HD suggested that it plays a role in establishment and maintenance of cell-basement membrane adhesions. However, loss of function of one ERBB2IP copy or expression of a putative novel ERBB2IP fusion protein did not apparently modulate the DEB phenotype in both translocation patients. Nonetheless, one cannot yet exclude that ERBB2IP is a candidate for human blistering disorders such as epidermolysis bullosa.

Optimization of Soft Tissue Management, Spacer Design, and Grafting Strategies for Large Segmental Bone Defects using the Chronic Caprine Tibial Defect Model

DTIC Science & Technology

2015-10-01

Several target genes such as Oct4, Sox2, TGFB, and Col1A1 were generally up-regulated in all sections. In distal sections, VWF, PDGFB, and EGFR were...TGFB, and Col1A1 in all sections. No significant main effects were found for target gene fold-change between outer or inner membrane position or distal

Differential expression levels of collagen 1A2, tissue inhibitor of metalloproteinase 4, and cathepsin B in intracranial aneurysms.

PubMed

Babu, R Arun; Paul, Pradip; Purushottam, Meera; Srinivas, Dwarakanath; Somanna, Sampath; Jain, Sanjeev

2016-01-01

Intracranial aneurysms (IAs) express a variety of differentially expressed genes when compared to the normal artery. The aim of this study was to evaluate the expression level of a few genes in the aneurysm wall and to correlate them with various clinicoradiological factors. The mRNA level of collagen 1A2 (COL1A2), tissue inhibitor of metalloproteinase 4 (TIMP4), and cathepsin B (CTSB) genes were studied in 23 aneurysmal walls and 19 superficial temporal arteries harvested from 23 patients undergoing clipping of IAs, by real-time polymerase chain reaction method. The mean fold change of COL1A2 gene between the aneurysm sample and the superficial temporal artery (STA) sample was 2.46 ± 0.12, that of TIMP4 gene was 0.31 ± 0, and that of CTSB gene was 31.47 ± 39.01. There was a positive correlation of TIMP4 expression level with maximum diameter of aneurysm (P = 0.008) and fundus of aneurysm (P = 0.012). The mean fold change of CTSB of patients who had preoperative hydrocephalus in the computed tomogram (CT) scan of the head at admission was 56.16 and that of the patients who did not have hydrocephalus was 13.51 (P = 0.008). The mean fold change of CTSB of patients who developed fresh postoperative deficits or worsening of the preexisting deficits was 23.64 and that of the patients who did not develop was 42.22 (P = 0.039). COL1A2 gene and CTSB genes were overexpressed, and TIMP4 gene was underexpressed in the aneurysmal sac compared to STA and their expression levels were associated with a few clinicoradiological factors.

Combinatorial prevention of carcinogenic risk in a model for familial colon cancer.

PubMed

Telang, Nitin; Katdare, Meena

2007-04-01

Germ line mutations in the tumor suppressor adenomatous polyposis coli (APC) gene, predispose for the clinical familial adenomatous polyposis (FAP) syndrome, a high risk precursor for early onset colon cancer. Similar mutations in the murine homolog of the APC gene, however, produce adenomas predominantly in the small intestine, rather than in the colon. The objectives of the present study were: i) to develop a preclinical cell culture model for human FAP syndrome and ii) to validate this model as a rapid mechanism-based approach for evaluation of the preventive efficacy of combinations of synthetic pharmacological agents or naturally-occurring phytochemicals, for the risk of colon carcinogenesis. The clonally selected 850Min COL-Cl1 cell line derived from histologically normal colon of ApcMin/+ mouse exhibited aberrant proliferation (64.7% decrease in population doubling time, 820% increase in saturation density, and 81.4% decrease in spontaneous apoptosis), relative to that observed in the colon epithelial cell line C57 COL established from Apc [+/+] C57BL/6J mouse. In addition, unlike the Apc [+/+] C57 COL cells, the Apc mutant cells exhibited enhanced risk for spontaneous carcinogenic transformation as evidenced by 100% increase in anchorage-independent colony formation (C57 COL: 0/12; 850Min COL-Cl1: 12/12, mean colony number 23.6+/-2.7). Treatment of Apc mutant cells with low dose combination of select mechanistically distinct synthetic chemopreventive agents such as celecoxib (CLX) + difluoro methylornithine (DFMO), or naturally-occurring epigallocatechin gallate (EGCG) + curcumin (CUR) produced 160-400% and 220-430% decrease in the viable cell number respectively, relative to these agents used independently. Furthermore, relative to independent agents, CLX+DFMO and EGCG+CUR combinations produced 31.5-82.1% and 45.9-105.4% greater reduction in the number of anchorage-independent colonies. Thus, aberrant proliferation and increased risk for carcinogenesis in the Apc mutant cells, and their susceptibility to low dose combinations of mechanistically distinct chemopreventive agents validate a rapid approach to prioritize efficacious combinations for long-term animal studies and future clinical trials on prevention of colon cancer.

COL5A1: Genetic mapping and exclusion as candidate gene in families with nail-patella syndrome, tuberous sclerosis 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenspan, D.S.; Northrup, H.; Au, K.S.

1995-02-10

COL5A1, the gene for the {alpha}1 chain of type V collagen, has been considered a candidate gene for certain diseases based on chromosomal location and/or disease phenotype. We have employed 3{prime}-untranslated region RFLPs to exclude COL5A1 as a candidate gene in families with tuberous sclerosis 1, Ehlers-Danlos syndrome type H, and nail-patella syndrome. In addition, we describe a polymorphic simple sequence repeat (SSR) within a COL5A1 intron. This SSR is used to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia (Osler-Rendu-Weber disease) and to add COL5A1 to the existing map of {open_quotes}index{close_quotes} markers of chromosome 9 by evaluationmore » of the COL5A1 locus on the CEPH 40-family reference pedigree set. This genetic mapping places COL5A1 between markers D9S66 and D9S67. 14 refs., 1 fig., 2 tabs.« less

Genetics Home Reference: Caffey disease

MedlinePlus

... ethnic groups? Genetic Changes A mutation in the COL1A1 gene causes Caffey disease . The COL1A1 gene provides instructions for making part of a ... form of collagen in the human body. The COL1A1 gene mutation that causes Caffey disease replaces the ...

Stabilization of Clostridium perfringens collagenase mRNA by VR-RNA-dependent cleavage in 5' leader sequence.

PubMed

Obana, Nozomu; Shirahama, Yu; Abe, Kimihiro; Nakamura, Kouji

2010-09-01

The small RNA (sRNA), VR-RNA that is directly regulated by the VirR/VirS two-component system, regulates many genes including toxin genes such as collagenase (colA) and phospholipase C (plc) in Clostridium perfringens. Although the VR-RNA 3' region is sufficient to regulate the colA and plc genes, the molecular mechanism of toxin gene regulation by VR-RNA remains unclear. Here, we found that colA mRNA is cleaved at position -79 and -78 from the A of the first codon (ATG) in the presence of VR-RNA. The processed transcripts were stable compared with longer intact transcripts. On the other hand, colA mRNA was labile in a VR-RNA-deficient strain, and processed transcripts were undetectable. The stability and processing of colA mRNA were restored by transformation of the 3' region of VR-RNA-expression vector. The 3' region of VR-RNA and colA mRNA had significant complementation and interacted in vitro. These results show that VR-RNA base pairs with colA mRNA and induces cleavage in the 5' untranslated region (UTR) of colA mRNA, which leads to the stabilization of colA mRNA and the activation of colA expression. © 2010 Blackwell Publishing Ltd.

Sp1 upregulates the proximal promoter activity of the mouse collagen α1(XI) gene (Col11a1) in chondrocytes.

PubMed

Watanabe, Keijirou; Hida, Mariko; Sasaki, Takako; Yano, Hiroyuki; Kawano, Kenji; Yoshioka, Hidekatsu; Matsuo, Noritaka

2016-02-01

Type XI collagen is a cartilage-specific extracellular matrix, and is important for collagen fibril formation and skeletal morphogenesis. We have previously reported that NF-Y regulated the proximal promoter activity of the mouse collagen α1(XI) gene (Col11a1) in chondrocytes (Hida et. al. In Vitro Cell. Dev. Biol. Anim. 2014). However, the mechanism of the Col11a1 gene regulation in chondrocytes has not been fully elucidated. In this study, we further characterized the proximal promoter activity of the mouse Col11a1 gene in chondrocytes. Cell transfection experiments with deletion and mutation constructs indicated that the downstream region of the NF-Y binding site (-116 to +1) is also necessary to regulate the proximal promoter activity of the mouse Col11a1 gene. This minimal promoter region has no TATA box and GC-rich sequence; we therefore examined whether the GC-rich sequence (-96 to -67) is necessary for the transcription regulation of the Col11a1 gene. Luciferase assays using a series of mutation constructs exhibited that the GC-rich sequence is a critical element of Col11a1 promoter activity in chondrocytes. Moreover, in silico analysis of this region suggested that one of the most effective candidates was transcription factor Sp1. Consistent with the prediction, overexpression of Sp1 significantly increased the promoter activity. Furthermore, knockdown of Sp1 expression by siRNA transfection suppressed the proximal promoter activity and the expression of endogenous transcript of the mouse Col11a1 gene. Taken together, these results indicate that the transcription factor Sp1 upregulates the proximal promoter activity of the mouse Col11a1 gene in chondrocytes.

DNA variant databases improve test accuracy and phenotype prediction in Alport syndrome.

PubMed

Savige, Judy; Ars, Elisabet; Cotton, Richard G H; Crockett, David; Dagher, Hayat; Deltas, Constantinos; Ding, Jie; Flinter, Frances; Pont-Kingdon, Genevieve; Smaoui, Nizar; Torra, Roser; Storey, Helen

2014-06-01

X-linked Alport syndrome is a form of progressive renal failure caused by pathogenic variants in the COL4A5 gene. More than 700 variants have been described and a further 400 are estimated to be known to individual laboratories but are unpublished. The major genetic testing laboratories for X-linked Alport syndrome worldwide have established a Web-based database for published and unpublished COL4A5 variants ( https://grenada.lumc.nl/LOVD2/COL4A/home.php?select_db=COL4A5 ). This conforms with the recommendations of the Human Variome Project: it uses the Leiden Open Variation Database (LOVD) format, describes variants according to the human reference sequence with standardized nomenclature, indicates likely pathogenicity and associated clinical features, and credits the submitting laboratory. The database includes non-pathogenic and recurrent variants, and is linked to another COL4A5 mutation database and relevant bioinformatics sites. Access is free. Increasing the number of COL4A5 variants in the public domain helps patients, diagnostic laboratories, clinicians, and researchers. The database improves the accuracy and efficiency of genetic testing because its variants are already categorized for pathogenicity. The description of further COL4A5 variants and clinical associations will improve our ability to predict phenotype and our understanding of collagen IV biochemistry. The database for X-linked Alport syndrome represents a model for databases in other inherited renal diseases.

Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis: a new X linked contiguous gene deletion syndrome?

PubMed Central

Jonsson, J J; Renieri, A; Gallagher, P G; Kashtan, C E; Cherniske, E M; Bruttini, M; Piccini, M; Vitelli, F; Ballabio, A; Pober, B R

1998-01-01

We describe a family with four members, a mother, two sons, and a daughter, who show clinical features consistent with X linked Alport syndrome. The two males presented with additional features including mental retardation, dysmorphic facies with marked midface hypoplasia, and elliptocytosis. The elliptocytosis was not associated with any detectable abnormalities in red cell membrane proteins; red cell membrane stability and rigidity was normal on ektacytometry. Molecular characterisation suggests a submicroscopic X chromosome deletion encompassing the entire COL4A5 gene. We propose that the additional abnormalities found in the affected males of this family are attributable to deletion or disruption of X linked recessive genes adjacent to the COL4A5 gene and that this constellation of findings may represent a new X linked contiguous gene deletion syndrome. Images PMID:9598718

Genome Dynamics Explain the Evolution of Flowering Time CCT Domain Gene Families in the Poaceae

PubMed Central

Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Bailey, Paul C.; O'Sullivan, Donal M.

2012-01-01

Numerous CCT domain genes are known to control flowering in plants. They belong to the CONSTANS-like (COL) and PREUDORESPONSE REGULATOR (PRR) gene families, which in addition to a CCT domain possess B-box or response-regulator domains, respectively. Ghd7 is the most recently identified COL gene to have a proven role in the control of flowering time in the Poaceae. However, as it lacks B-box domains, its inclusion within the COL gene family, technically, is incorrect. Here, we show Ghd7 belongs to a larger family of previously uncharacterized Poaceae genes which possess just a single CCT domain, termed here CCT MOTIF FAMILY (CMF) genes. We molecularly describe the CMF (and related COL and PRR) gene families in four sequenced Poaceae species, as well as in the draft genome assembly of barley (Hordeum vulgare). Genetic mapping of the ten barley CMF genes identified, as well as twelve previously unmapped HvCOL and HvPRR genes, finds the majority map to colinear positions relative to their Poaceae orthologues. Combined inter-/intra-species comparative and phylogenetic analysis of CMF, COL and PRR gene families indicates they evolved prior to the monocot/dicot divergence ∼200 mya, with Poaceae CMF evolution described as the interplay between whole genome duplication in the ancestral cereal, and subsequent clade-specific mutation, deletion and duplication events. Given the proven role of CMF genes in the modulation of cereals flowering, the molecular, phylogenetic and comparative analysis of the Poaceae CMF, COL and PRR gene families presented here provides the foundation from which functional investigation can be undertaken. PMID:23028921

Genome dynamics explain the evolution of flowering time CCT domain gene families in the Poaceae.

PubMed

Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Bailey, Paul C; O'Sullivan, Donal M

2012-01-01

Numerous CCT domain genes are known to control flowering in plants. They belong to the CONSTANS-like (COL) and PREUDORESPONSE REGULATOR (PRR) gene families, which in addition to a CCT domain possess B-box or response-regulator domains, respectively. Ghd7 is the most recently identified COL gene to have a proven role in the control of flowering time in the Poaceae. However, as it lacks B-box domains, its inclusion within the COL gene family, technically, is incorrect. Here, we show Ghd7 belongs to a larger family of previously uncharacterized Poaceae genes which possess just a single CCT domain, termed here CCT MOTIF FAMILY (CMF) genes. We molecularly describe the CMF (and related COL and PRR) gene families in four sequenced Poaceae species, as well as in the draft genome assembly of barley (Hordeum vulgare). Genetic mapping of the ten barley CMF genes identified, as well as twelve previously unmapped HvCOL and HvPRR genes, finds the majority map to colinear positions relative to their Poaceae orthologues. Combined inter-/intra-species comparative and phylogenetic analysis of CMF, COL and PRR gene families indicates they evolved prior to the monocot/dicot divergence ∼200 mya, with Poaceae CMF evolution described as the interplay between whole genome duplication in the ancestral cereal, and subsequent clade-specific mutation, deletion and duplication events. Given the proven role of CMF genes in the modulation of cereals flowering, the molecular, phylogenetic and comparative analysis of the Poaceae CMF, COL and PRR gene families presented here provides the foundation from which functional investigation can be undertaken.

Premature chain termination is a unifying mechanism for COL1A1 null alleles in osteogenesis imperfecta type I cell strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.C.; Deschenes, S.P.; Roberts, E.J.

Nonsense and frameshift mutations, which predict premature termination of translation, often cause a dramatic reduction in the amount of transcript from the mutant allele (nonsense-mediated mRNA decay). In some genes, these mutations also influence RNA splicing and induce skipping of the exon that contains the nonsense codon. To begin to dissect how premature termination alters the metabolism of RNA from the COL1A1 gene, we studied nonsense and frameshift mutations distributed over exons 11-49 of the gene. These mutations were originally identified in 10 unrelated families with osteogenesis imperfecta (OI) type I. We observed marked reduction in steady-state amounts of mRNAmore » from the mutant allele in both total cellular and nuclear RNA extracts of cells from affected individuals, suggesting that nonsense-mediated decay of COL1A1 RNA is a nuclear phenomenon. Position of the mutation within the gene did not influence this observation. None of the mutations induced skipping of either the exon containing the mutation or, for the frameshifts, the downstream exons with the new termination sites. Our data suggest that nonsense and frameshift mutations throughout most of the COL1A1 gene result in a null allele, which is associated with the predictable mild clinical phenotype, OI type I. 42 refs., 6 figs., 1 tab.« less

Interactions between meniscal cells and a self assembled biomimetic surface composed of hyaluronic acid, chitosan and meniscal extracellular matrix molecules.

PubMed

Tan, Guak-Kim; Dinnes, Donna L M; Butler, Lauren N; Cooper-White, Justin J

2010-08-01

Menisci are one of the most commonly injured parts of the knee with a limited healing potential. This study focuses on fabrication and characterization of biomimetic surfaces for meniscal tissue engineering. To achieve this, a combination of hyaluronic acid/chitosan (HA/CH) mutilayers with covalently immobilized major extracellular matrix (ECM) components of native meniscus, namely collagen I/II (COL.I/II) and chondroitin-6-sulfate (C6S) was employed. Adsorption of the biomolecules was monitored using a quartz crystal microbalance with dissipation (QCM-D) and fourier transform-surface plasmon resonance (FT-SPR). Immobilization of the biomolecules onto HA/CH mutilayers was achieved by sequential adsorption, with optimum binding at a molar ratio of 1.4:1 (COL.I/II: C6S). After adding COL.I/II, the layers became relatively more rigid and large aggregates were evident. The effects of the modified surfaces on cell proliferation, gene expression and proteoglycan production of rat meniscal cells were examined. Quantitative real-time reverse transcriptase polymerase chain reaction (RT-qPCR) analysis showed that primary meniscal cells dedifferentiated rapidly after one passage in monolayer culture. This process could be reversed by culturing the cells on C6S surfaces, as indicated by increases in both collagen II and aggrecan gene expression, as well as proteoglycan production. Cells with abundant lipid vacuoles were evident on all the surfaces over an extended culture period. The results demonstrate the feasibility of C6S surfaces to avoid the dedifferentiation that normally occurs during monolayer expansion of meniscal cells. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.

Urine-derived podocytes-lineage cells: A promising tool for precision medicine in Alport Syndrome.

PubMed

Daga, Sergio; Baldassarri, Margherita; Lo Rizzo, Caterina; Fallerini, Chiara; Imperatore, Valentina; Longo, Ilaria; Frullanti, Elisa; Landucci, Elisa; Massella, Laura; Pecoraro, Carmine; Garosi, Guido; Ariani, Francesca; Mencarelli, Maria Antonietta; Mari, Francesca; Renieri, Alessandra; Pinto, Anna Maria

2018-02-01

Alport Syndrome (ATS) is a rare genetic disorder caused by collagen IV genes mutations, leading to glomerular basement membrane damage up to end-stage renal disease. Podocytes, the main component of the glomerular structure, are the only cells able to produce all the three collagens IV alpha chains associated with ATS and thus, they are key players in ATS pathogenesis. However, podocytes-targeted therapeutic strategies have been hampered by the difficulty of non-invasively isolating them and transcripts-based diagnostic approaches are complicated by the inaccessibility of other COL4 chains-expressing cells. We firstly isolated podocyte-lineage cells from ATS patients' urine samples, in a non-invasive way. RT-PCR analysis revealed COL4A3, COL4A4, and COL4A5 expression. Transcripts analysis on RNA extracted from patient's urine derived podocyte-lineage cells allowed defining the pathogenic role of intronic variants, namely one mutation in COL4A3 (c.3882+5G>A), three mutations in COL4A4 (c.1623+2T>A, c.3699_3706+1del, c.2545+143T>A), and one mutation in COL4A5 (c.3454+2T>C). Therefore, our cellular model represents a novel tool, essential to unequivocally prove the effect of spliceogenic intronic variants on transcripts expressed exclusively at a glomerular level. This process is a key step for providing the patient with a definite molecular diagnosis and with a proper recurrence risk. The established system also opens up the possibility of testing personalized therapeutic approaches on disease-relevant cells. © 2017 Wiley Periodicals, Inc.

Confirming genes influencing risk to cleft lip with/without cleft palate in a case-parent trio study.

PubMed

Beaty, T H; Taub, M A; Scott, A F; Murray, J C; Marazita, M L; Schwender, H; Parker, M M; Hetmanski, J B; Balakrishnan, P; Mansilla, M A; Mangold, E; Ludwig, K U; Noethen, M M; Rubini, M; Elcioglu, N; Ruczinski, I

2013-07-01

A collection of 1,108 case-parent trios ascertained through an isolated, nonsyndromic cleft lip with or without cleft palate (CL/P) was used to replicate the findings from a genome-wide association study (GWAS) conducted by Beaty et al. (Nat Genet 42:525-529, 2010), where four different genes/regions were identified as influencing risk to CL/P. Tagging SNPs for 33 different genes were genotyped (1,269 SNPs). All four of the genes originally identified as showing genome-wide significance (IRF6, ABCA4 and MAF, plus the 8q24 region) were confirmed in this independent sample of trios (who were primarily of European and Southeast Asian ancestry). In addition, eight genes classified as 'second tier' hits in the original study (PAX7, THADA, COL8A1/FILIP1L, DCAF4L2, GADD45G, NTN1, RBFOX3 and FOXE1) showed evidence of linkage and association in this replication sample. Meta-analysis between the original GWAS trios and these replication trios showed PAX7, COL8A1/FILIP1L and NTN1 achieved genome-wide significance. Tests for gene-environment interaction between these 33 genes and maternal smoking found evidence for interaction with two additional genes: GRID2 and ELAVL2 among European mothers (who had a higher rate of smoking than Asian mothers). Formal tests for gene-gene interaction (epistasis) failed to show evidence of statistical interaction in any simple fashion. This study confirms that many different genes influence risk to CL/P.

Confirming genes influencing risk to cleft lip with/without cleft palate in a case-parent trio study

PubMed Central

Beaty, TH; Taub, MA; Scott, AF; Murray, JC; Marazita, ML; Schwender, H; Parker, MM; Hetmanski, JB; Balakrishnan, P; Mansilla, MA; Mangold, E; Ludwig, KU; Noethen, MM; Rubini, M; Elcioglu, N; Ruczinski, I

2013-01-01

A collection of 1,108 case-parent trios ascertained through an isolated, non-syndromic cleft lip with or without cleft palate (CL/P) was used to replicate the findings from a genome-wide association study (GWAS) conducted by Beaty et al. (2010) where four different genes/regions were identified as influencing risk to CL/P. Tagging SNPs for 33 different genes were genotyped (1,269 SNPs). All four of the genes originally identified as showing genome-wide significance (IRF6, ABCA4 and MAF, plus the 8q24 region) were confirmed in this independent sample of trios (who were primarily of European and Southeast Asian ancestry). In addition, eight genes classified as ‘second tier’ hits in the original study (PAX7, THADA, COL8A1/FILIP1L, DCAF4L2, GADD45G, NTN1, RBFOX3 and FOXE1) showed evidence of linkage and association in this replication sample. Meta-analysis between the original GWAS trios and these replication trios showed PAX7, COL8A1/FILIP1L and NTN1 achieved genome-wide significance. Tests for gene-environment interaction between these 33 genes and maternal smoking found evidence for interaction with two additional genes: GRID2 and ELAVL2 among European mothers (who had a higher rate of smoking than Asian mothers). Formal tests for gene-gene interaction (epistasis) failed to show evidence of statistical interaction in any simple fashion. This study confirms that many different genes influence risk to CL/P. PMID:23512105

A rare variant in COL11A1 is strongly associated with adult height in Chinese Han population.

PubMed

Shen, Changbing; Zheng, Xiaodong; Gao, Jing; Zhu, Caihong; Ko, Randy; Tang, Xianfa; Yang, Chao; Dou, Jinfa; Lin, Yan; Cheng, Yuyan; Liu, Lu; Xu, Shuangjun; Chen, Gang; Zuo, Xianbo; Yin, Xianyong; Sun, Liangdan; Cui, Yong; Yang, Sen; Zhang, Xuejun; Zhou, Fusheng

2016-09-20

Human height is a highly heritable trait in which multiple genes are involved. Recent genome-wide association studies (GWASs) have identified that COL11A1 is an important susceptibility gene for human height. To determine whether the variants of COL11A1 are associated with adult and children height, we analyzed splicing and coding single-nucleotide variants across COL11A1 through exome-targeted sequencing and two validation stages with a total 20,426 Chinese Han samples. A total of 105 variants were identified by exome-targeted sequencing, of which 30 SNPs were located in coding region. The strongest association signal was Chr1_103380393 with P value of 4.8 × 10(-7). Chr1_103380393 also showed nominal significance in the validation stage (P = 1.21 × 10(-6)). Combined analysis of 16,738 samples strengthened the original association of chr1_103380393 with adult height (Pcombined = 3.1 × 10(-8)), with an increased height of 0.292sd (standard deviation) per G allele (95% CI: 0.19-0.40). There was no evidence (P = 0.843) showing that chr1_103380393 altered child height in 3688 child samples. Only the group of 12-15 years showed slight significance with P value of 0.0258. This study firstly shows that genetic variants of COL11A1 contribute to adult height in Chinese Han population but not to children height, which expand our knowledge of the genetic factors underlying height variation and the biological regulation of human height. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. All rights reserved.

In situ hybridization reveals that type I and III collagens are produced by pericytes in the anterior pituitary gland of rats.

PubMed

Fujiwara, Ken; Jindatip, Depicha; Kikuchi, Motoshi; Yashiro, Takashi

2010-12-01

Type I and III collagens widely occur in the rat anterior pituitary gland and are the main components of the extracellular matrix (ECM). Although ECM components possibly play an important role in the function of the anterior pituitary gland, little is known about collagen-producing cells. Type I collagen is a heterotrimer of two α1(I) chains (the product of the col1a1 gene) and one α2(I) chain (the product of the col1a2 gene). Type III collagen is a homotrimer of α1(III) chains (the product of the col3a1 gene). We used in situ hybridization with digoxigenin-labeled cRNA probes to examine the expression of col1a1, col1a2, and col3a1 mRNAs in the pituitary gland of adult rats. mRNA expression for these collagen genes was clearly observed, and cells expressing col1a1, col1a2, and col3a1 mRNA were located around capillaries in the gland. We also investigated the possible double-staining of collagen mRNA and pituitary hormones, S-100 protein (a marker of folliculo-stellate cells), or desmin (a marker of pericytes). Col1a1 and col3a1 mRNA were identified in desmin-immunopositive cells. Thus, only pericytes produce type I and III collagens in the rat anterior pituitary gland.

A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle.

PubMed

Koltes, James E; Mishra, Bishnu P; Kumar, Dinesh; Kataria, Ranjit S; Totir, Liviu R; Fernando, Rohan L; Cobbold, Rowland; Steffen, David; Coppieters, Wouter; Georges, Michel; Reecy, James M

2009-11-17

Historically, dwarfism was the major genetic defect in U.S. beef cattle. Aggressive culling and sire testing were used to minimize its prevalence; however, neither of these practices can eliminate a recessive genetic defect. We assembled a 4-generation pedigree to identify the mutation underlying dwarfism in American Angus cattle. An adaptation of the Elston-Steward algorithm was used to overcome small pedigree size and missing genotypes. The dwarfism locus was fine-mapped to BTA6 between markers AFR227 and BM4311. Four candidate genes were sequenced, revealing a nonsense mutation in exon 15 of cGMP-dependant type II protein kinase (PRKG2). This C/T transition introduced a stop codon (R678X) that truncated 85 C-terminal amino acids, including a large portion of the kinase domain. Of the 75 mutations discovered in this region, only this mutation was 100% concordant with the recessive pattern of inheritance in affected and carrier individuals (log of odds score = 6.63). Previous research has shown that PRKG2 regulates SRY (sex-determining region Y) box 9 (SOX9)-mediated transcription of collagen 2 (COL2). We evaluated the ability of wild-type (WT) or R678X PRKG2 to regulate COL2 expression in cell culture. Real-time PCR results confirmed that COL2 is overexpressed in cells that overexpressed R678X PRKG2 as compared with WT PRKG2. Furthermore, COL2 and COL10 mRNA expression was increased in dwarf cattle compared with unaffected cattle. These experiments indicate that the R678X mutation is functional, resulting in a loss of PRKG2 regulation of COL2 and COL10 mRNA expression. Therefore, we present PRKG2 R678X as a causative mutation for dwarfism cattle.

A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle

PubMed Central

Koltes, James E.; Mishra, Bishnu P.; Kumar, Dinesh; Kataria, Ranjit S.; Totir, Liviu R.; Fernando, Rohan L.; Cobbold, Rowland; Steffen, David; Coppieters, Wouter; Georges, Michel; Reecy, James M.

2009-01-01

Historically, dwarfism was the major genetic defect in U.S. beef cattle. Aggressive culling and sire testing were used to minimize its prevalence; however, neither of these practices can eliminate a recessive genetic defect. We assembled a 4-generation pedigree to identify the mutation underlying dwarfism in American Angus cattle. An adaptation of the Elston-Steward algorithm was used to overcome small pedigree size and missing genotypes. The dwarfism locus was fine-mapped to BTA6 between markers AFR227 and BM4311. Four candidate genes were sequenced, revealing a nonsense mutation in exon 15 of cGMP-dependant type II protein kinase (PRKG2). This C/T transition introduced a stop codon (R678X) that truncated 85 C-terminal amino acids, including a large portion of the kinase domain. Of the 75 mutations discovered in this region, only this mutation was 100% concordant with the recessive pattern of inheritance in affected and carrier individuals (log of odds score = 6.63). Previous research has shown that PRKG2 regulates SRY (sex-determining region Y) box 9 (SOX9)-mediated transcription of collagen 2 (COL2). We evaluated the ability of wild-type (WT) or R678X PRKG2 to regulate COL2 expression in cell culture. Real-time PCR results confirmed that COL2 is overexpressed in cells that overexpressed R678X PRKG2 as compared with WT PRKG2. Furthermore, COL2 and COL10 mRNA expression was increased in dwarf cattle compared with unaffected cattle. These experiments indicate that the R678X mutation is functional, resulting in a loss of PRKG2 regulation of COL2 and COL10 mRNA expression. Therefore, we present PRKG2 R678X as a causative mutation for dwarfism cattle. PMID:19887637

A novel nonsteroidal antifibrotic oligo decoy containing the TGF-beta element found in the COL1A1 gene which regulates murine schistosomiasis liver fibrosis.

PubMed

Boros, D L; Singh, K P; Gerard, H C; Hudson, A P; White, S L; Cutroneo, K R

2005-08-01

Schistosomiasis mansoni disseminated worm eggs in mice and humans induce granulomatous inflammations and cumulative fibrosis causing morbidity and possibly mortality. In this study, intrahepatic and I.V. injections of a double-stranded oligodeoxynucleotide decoy containing the TGF-beta regulatory element found in the distal promoter of the COL1A1 gene into worm-infected mice suppressed TGF-beta1, COL1A1, tissue inhibitor of metalloproteinase-1, and decreased COL3A1 mRNAs to a lesser extent. Sequence comparisons within the mouse genome found homologous sequences within the COL3A1, TGF-beta1, and TIMP-1 5' flanking regions. Cold competition gel mobility shift assays using these homologous sequences with 5' and 3' flanking regions found in the natural COL1A1 gene showed competition. Competitive gel mobility assays in a separate experiment showed no competition using a 5-base mutated or scrambled sequence. Explanted liver granulomas from saline-injected mice incorporated 10.45 +/- 1.7% (3)H-proline into newly synthesized collagen, whereas decoy-treated mice showed no collagen synthesis. Compared with the saline control schistosomiasis mice phosphorothioate double-stranded oligodeoxynucleotide treatment decreased total liver collagen content (i.e. hydroxy-4-proline) by 34%. This novel molecular approach has the potential to be employed as a novel antifibrotic treatment modality. (c) 2005 Wiley-Liss, Inc.

Mutation Analysis of COL1A1 and COL1A2 in Fetuses with Osteogenesis Imperfecta Type II/III.

PubMed

Wang, Wenbo; Wu, Qichang; Cao, Lin; Sun, Li; Xu, Yasong; Guo, Qiwei

2015-01-27

Aim: To analyze COL1A1/2 mutations in prenatal-onset OI for determine the proportion of mutations in type I collagen genes among prenatal onset OI and to provide additional data for genotype-phenotype analyses. Material and Methods: Ten cases of severe fetal short-limb dwarfism detected by antenatal ultrasonography were referred to our center. Before the termination of pregnancy, cordocentesis was performed for fetal karyotype and COL1A1/2 gene sequencing analysis. Postmortem radiographic examination was performed at all instances for definitive diagnosis. Results: COL1A1 and COL1A2 SNP and mutations were identified in all the cases. Among these, one synonymous SNP and four synonymous SNPs were recognized in COL1A1/2, respectively, seven cases have distinct heterozygous mutations and six new COL1A1/2 gene mutations were identified. Conclusion: There has been substantial progress in the identification of the molecular defects responsible for skeletal dysplasias. With the constant increase in the number of identified mutations in COL1A1 and COL1A2, genotype-phenotype correlation is becoming increasingly pertinent. © 2015 S. Karger AG, Basel.

COL5A1: Fine genetic mapping, intron/exon organization, and exclusion as candidate gene in families with tuberous sclerosis complex 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenspan, D.S.; Papenberg, K.A.; Marchuk, D.A.

1994-09-01

Type V collagen is the only fibrillar collagen which has yet to be implicated in the pathogenesis of genetic diseases in humans or mice. To begin examining the possible role of type V collagen in genetic disease, we have previously mapped COL5A1, the gene for the {alpha}1 chain of type V collagen, to 9q23.2{r_arrow}q34.3 and described two restriction site polymorphisms which allowed us to exclude COL5A1 as candidate gene for nail-patella syndrome. We have now used these polymorphisms to exclude COL5A1 as candidate gene for tuberous sclerosis complex 1 and Ehlers-Danlos syndrome type II. In addition, we describe a CAmore » repeat, with observed heterozygosity of about 0.5, in a COL5A1 intron, which has allowed us to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia and to place COL5A1 on the CEPH family genetic map between markers D9S66 and D9S67. We have also determined the entire intron/exon organization of COL5A1, which will facilitate characterization of mutations in genetic diseases with which COL5A1 may be linked in future studies.« less

Early Diagnosis and Intervention Strategies for Post-Traumatic Heterotopic Ossification in Severely Injured Extremities

DTIC Science & Technology

2015-10-01

collagen, type X, alpha 1 COL11A1 collagen, type XI, alpha 1 COL1A1 collagen, type I, alpha 1 COL2A1 collagen, type II, alpha 1 COL4A3 collagen, type IV...Symbol  Fold Regulation (8  days post injury)  Gene Symbol  Fold Regulation (15  days post injury)  Spp1  172.4535 Spp1  1105.6776 Col1a1   137.7958 Tac1...130.0625 ll1b  67.3332 Cxcl5  86.3414 ll10  49.9631 Col1a1   84.2834 Has1  45.5771 ll1b  74.488 Tac1  42.9908 Mmp9  69.8933 Cxcl1  25.259 ll10  40.5062

CXCR6 deficiency attenuates pressure overload-induced monocytes migration and cardiac fibrosis through downregulating TNF-α-dependent MMP9 pathway

PubMed Central

Wang, Jia-Hong; Su, Feng; Wang, Shijun; Lu, Xian-Cheng; Zhang, Shao-Heng; Chen, De; Chen, Nan-Nan; Zhong, Jing-Quan

2014-01-01

An immerging role of TNF-α in collagen synthesis and cardiac fibrosis implies the significance of TNF-α production in the development of myocardial remodeling. Our previous study showed a reduction of TNF-α and attenuated cardiac remodeling in CXCR6 knockout (KO) mice after ischemia/reperfusion injury. However, the potential mechanism of TNF-α-mediated cardiac fibrosis with pressure overload has not been well elucidated. In the present study, we aim to investigate the role of CXCR6 in TNF-α release and myocardial remodeling in response to pressure overload. Pressure overload was performed by constriction of transverse aorta (TAC) surgery on CXCR6 KO mice and C57 wild-type (WT) counterparts. At 6 weeks after TAC, cardiac remodeling was assessed by echocardiography, cardiac TNF-α release and its type I receptor (TNFRI), were detected by ELISA and western blot, collagen genes Col1a1 (type I) and Col3a1 (type III) were examined by real-time PCR. Compared with CXCR6 WT mice, CXCR6 KO mice exhibited less cardiac dysfunction, reduced expression of TNFRI, Col1a1 and Col3a. In vitro, we confirmed that CXCR6 deficiency led to reduced homing and infiltration of CD11b+ monocytes, which contributed to attenuated TNF-α release in myocardium. Furthermore, TNFRI antagonist pretreatment blocked AT1 receptor signaling and NOX4 expression, reduced collagen synthesis, and blunted the activity of MMP9 in CXCR6 WT mice after TAC, but these were not observed in CXCR6 KO mice. In the present work, we propose a mechanism that CXCR6 is essential for pressure overload-mediated myocardial recruitment of monocytes, which contributes to cardiac fibrosis through TNF-α-dependent MMP9 activation and collagen synthesis. PMID:25400729

CXCR6 deficiency attenuates pressure overload-induced monocytes migration and cardiac fibrosis through downregulating TNF-α-dependent MMP9 pathway.

PubMed

Wang, Jia-Hong; Su, Feng; Wang, Shijun; Lu, Xian-Cheng; Zhang, Shao-Heng; Chen, De; Chen, Nan-Nan; Zhong, Jing-Quan

2014-01-01

An immerging role of TNF-α in collagen synthesis and cardiac fibrosis implies the significance of TNF-α production in the development of myocardial remodeling. Our previous study showed a reduction of TNF-α and attenuated cardiac remodeling in CXCR6 knockout (KO) mice after ischemia/reperfusion injury. However, the potential mechanism of TNF-α-mediated cardiac fibrosis with pressure overload has not been well elucidated. In the present study, we aim to investigate the role of CXCR6 in TNF-α release and myocardial remodeling in response to pressure overload. Pressure overload was performed by constriction of transverse aorta (TAC) surgery on CXCR6 KO mice and C57 wild-type (WT) counterparts. At 6 weeks after TAC, cardiac remodeling was assessed by echocardiography, cardiac TNF-α release and its type I receptor (TNFRI), were detected by ELISA and western blot, collagen genes Col1a1 (type I) and Col3a1 (type III) were examined by real-time PCR. Compared with CXCR6 WT mice, CXCR6 KO mice exhibited less cardiac dysfunction, reduced expression of TNFRI, Col1a1 and Col3a. In vitro, we confirmed that CXCR6 deficiency led to reduced homing and infiltration of CD11b(+) monocytes, which contributed to attenuated TNF-α release in myocardium. Furthermore, TNFRI antagonist pretreatment blocked AT1 receptor signaling and NOX4 expression, reduced collagen synthesis, and blunted the activity of MMP9 in CXCR6 WT mice after TAC, but these were not observed in CXCR6 KO mice. In the present work, we propose a mechanism that CXCR6 is essential for pressure overload-mediated myocardial recruitment of monocytes, which contributes to cardiac fibrosis through TNF-α-dependent MMP9 activation and collagen synthesis.

Characterisation of a collagen gene subfamily from the potato cyst nematode Globodera pallida.

PubMed

Gray, L J; Curtis, R H; Jones, J T

2001-01-24

We have isolated two full-length genomic DNA sequences, which encode the cuticle collagen proteins GP-COL-1 and GP-COL-2, from the potato cyst nematode Globodera pallida. A third, partial collagen gene ORF termed gp-col-t(t=truncated) has also been isolated and appears to represent an unexpressed pseudogene. The gp-col-1 and gp-col-2 genes both contain three short (<97 bp) introns which disrupt coding regions predicted to specify proteins with molecular weights of 33 and 32.7 kDa respectively. All three sequences show high similarity to each other and to the previously isolated G. pallida cDNA clone gp-col-8. The conserved pattern of cysteine residues and non-(Gly-X-Y)(n) region sequence similarity observed in all four G. pallida genes suggests that these molecules form part of the same subfamily of collagens. Southern analysis indicates that this subfamily is likely to contain further members. The G. pallida collagen sequences show striking similarity to twelve genes from Caenorhabditis elegans which collectively represent the recently classified Group 1a collagen subfamily. No data exists on the function of this subfamily in C. elegans. gp-col-1 and gp-col-2 are developmentally regulated with transcripts of both genes detected in adult virgin and gravid females but not in pre-parasitic second stage juveniles. A similar expression pattern is observed for the Group 1a collagen lemmi 5 from Meloidogyne incognita perhaps indicating a generic link between subfamily and function during the various changes in cuticular structure which accompany nematode growth and reproduction. Immunochemical studies indicate that the GP-COL-1 protein is specifically located in the hypodermis of G. pallida adult females.

Reverse Engineering of Modified Genes by Bayesian Network Analysis Defines Molecular Determinants Critical to the Development of Glioblastoma

PubMed Central

Kunkle, Brian W.; Yoo, Changwon; Roy, Deodutta

2013-01-01

In this study we have identified key genes that are critical in development of astrocytic tumors. Meta-analysis of microarray studies which compared normal tissue to astrocytoma revealed a set of 646 differentially expressed genes in the majority of astrocytoma. Reverse engineering of these 646 genes using Bayesian network analysis produced a gene network for each grade of astrocytoma (Grade I–IV), and ‘key genes’ within each grade were identified. Genes found to be most influential to development of the highest grade of astrocytoma, Glioblastoma multiforme were: COL4A1, EGFR, BTF3, MPP2, RAB31, CDK4, CD99, ANXA2, TOP2A, and SERBP1. All of these genes were up-regulated, except MPP2 (down regulated). These 10 genes were able to predict tumor status with 96–100% confidence when using logistic regression, cross validation, and the support vector machine analysis. Markov genes interact with NFkβ, ERK, MAPK, VEGF, growth hormone and collagen to produce a network whose top biological functions are cancer, neurological disease, and cellular movement. Three of the 10 genes - EGFR, COL4A1, and CDK4, in particular, seemed to be potential ‘hubs of activity’. Modified expression of these 10 Markov Blanket genes increases lifetime risk of developing glioblastoma compared to the normal population. The glioblastoma risk estimates were dramatically increased with joint effects of 4 or more than 4 Markov Blanket genes. Joint interaction effects of 4, 5, 6, 7, 8, 9 or 10 Markov Blanket genes produced 9, 13, 20.9, 26.7, 52.8, 53.2, 78.1 or 85.9%, respectively, increase in lifetime risk of developing glioblastoma compared to normal population. In summary, it appears that modified expression of several ‘key genes’ may be required for the development of glioblastoma. Further studies are needed to validate these ‘key genes’ as useful tools for early detection and novel therapeutic options for these tumors. PMID:23737970

Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta.

PubMed

Ho Duy, Binh; Zhytnik, Lidiia; Maasalu, Katre; Kändla, Ivo; Prans, Ele; Reimann, Ene; Märtson, Aare; Kõks, Sulev

2016-08-12

The genetics of osteogenesis imperfecta (OI) have not been studied in a Vietnamese population before. We performed mutational analysis of the COL1A1 and COL1A2 genes in 91 unrelated OI patients of Vietnamese origin. We then systematically characterized the mutation profiles of these two genes which are most commonly related to OI. Genomic DNA was extracted from EDTA-preserved blood according to standard high-salt extraction methods. Sequence analysis and pathogenic variant identification was performed with Mutation Surveyor DNA variant analysis software. Prediction of the pathogenicity of mutations was conducted using Alamut Visual software. The presence of variants was checked against Dalgleish's osteogenesis imperfecta mutation database. The sample consisted of 91 unrelated osteogenesis imperfecta patients. We identified 54 patients with COL1A1/2 pathogenic variants; 33 with COL1A1 and 21 with COL1A2. Two patients had multiple pathogenic variants. Seventeen novel COL1A1 and 10 novel COL1A2 variants were identified. The majority of identified COL1A1/2 pathogenic variants occurred in a glycine substitution (36/56, 64.3 %), usually serine (23/36, 63.9 %). We found two pathogenic variants of the COL1A1 gene c.2461G > A (p.Gly821Ser) in four unrelated patients and one, c.2005G > A (p.Ala669Thr), in two unrelated patients. Our data showed a lower number of collagen OI pathogenic variants in Vietnamese patients compared to reported rates for Asian populations. The OI mutational profile of the Vietnamese population is unique and related to the presence of a high number of recessive mutations in non-collagenous OI genes. Further analysis of OI patients negative for collagen mutations, is required.

COL4A3 founder mutations in Greek-Cypriot families with thin basement membrane nephropathy and focal segmental glomerulosclerosis dating from around 18th century.

PubMed

Voskarides, Konstantinos; Patsias, Charalampos; Pierides, Alkis; Deltas, Constantinos

2008-06-01

Mutations in the COL4A3/COL4A4 genes of type IV collagen account for about 40% of cases of thin basement membrane nephropathy, a condition that is estimated to affect 1% or more of the general population. We recently described 10 Cypriot families with familial hematuria and thin basement membrane nephropathy in the presence of focal segmental glomerulosclerosis, with founder mutations on COL4A3 gene. Seven of the families carried mutation G1334E on haplotype K, and another three carried mutation G871C on haplotype Ky. In this report we performed extension of the haplotypes with additional polymorphic markers, 12 for haplotype K and 22 for haplotype Ky, to estimate the linkage disequilibrium value between the mutation and flanking noncommon markers. Haplotype Ky extended to 13.71 Mb, but we did not attempt further analysis owing to the small number of chromosomes. Haplotype K extended to 3.83 Mb, thereby suggesting that it was a much older event compared to mutation G871C. Mutation G1334E was calculated to be about 5-10 generations old with a possible origin between 1693 and 1818 AD, during the Ottoman ruling of the island. Both mutations are clustered in specific geographic regions with apparently formerly isolated populations, although mutation G1334E has been detected elsewhere on the island. The identification of founder mutations in large families with microscopic hematuria greatly facilitates presymptomatic diagnosis and provides useful information on the history of the population, while it may also assist in association studies in search for disease modifier genes.

Collagen XVII (BP180) modulates keratinocyte expression of the proinflammatory chemokine, IL-8.

PubMed

Van den Bergh, Françoise; Eliason, Steven L; Burmeister, Brian T; Giudice, George J

2012-08-01

Collagen XVII (COL17), a transmembrane protein expressed in epidermal keratinocytes (EK), is targeted by pathogenic autoantibodies in bullous pemphigoid. Treatment of EK with anti-COL17 autoantibodies triggers the production of proinflammatory cytokines. In this study, we test the hypothesis that COL17 is involved in the regulation of the EK proinflammatory response, using IL-8 expression as the primary readout. The absence of COL17 in EK derived from a junctional epidermolysis bullosa patient or shRNA-mediated knockdown of COL17 in normal EK resulted in a dysregulation of IL-8 responses under various conditions. The COL17-deficient cells showed an abnormally high IL-8 response after treatment with lipopolysaccharide (LPS), ultraviolet-B radiation or tumor necrosis factor, but exhibited a blunted IL-8 response to phorbol 12-myristate 13-acetate exposure. Induction of COL17 expression in COL17-negative EK led to a normalization of the LPS-induced proinflammatory response. Although α6β4 integrin was found to be up-regulated in COL17-deficient EK, siRNA-mediated knockdown of the α6 and β4 subunits revealed that COL17's effects on the LPS IL-8 response are not dependent on this integrin. In LPS-treated cells, inhibition of NF-kappa B activity in COL17-negative EK resulted in a normalization of their IL-8 response, and expression of an NF-kappa B-driven reporter was shown to be higher in COL17-deficient, compared with normal EK. These findings support the hypothesis that COL17 plays an important regulatory role in the EK proinflammatory response, acting largely via NF-kappa B. Future investigations will focus on further defining the molecular basis of this novel control network. © 2012 John Wiley & Sons A/S.

Integrated analysis of microRNA and gene expression profiles reveals a functional regulatory module associated with liver fibrosis.

PubMed

Chen, Wei; Zhao, Wenshan; Yang, Aiting; Xu, Anjian; Wang, Huan; Cong, Min; Liu, Tianhui; Wang, Ping; You, Hong

2017-12-15

Liver fibrosis, characterized with the excessive accumulation of extracellular matrix (ECM) proteins, represents the final common pathway of chronic liver inflammation. Ever-increasing evidence indicates microRNAs (miRNAs) dysregulation has important implications in the different stages of liver fibrosis. However, our knowledge of miRNA-gene regulation details pertaining to such disease remains unclear. The publicly available Gene Expression Omnibus (GEO) datasets of patients suffered from cirrhosis were extracted for integrated analysis. Differentially expressed miRNAs (DEMs) and genes (DEGs) were identified using GEO2R web tool. Putative target gene prediction of DEMs was carried out using the intersection of five major algorithms: DIANA-microT, TargetScan, miRanda, PICTAR5 and miRWalk. Functional miRNA-gene regulatory network (FMGRN) was constructed based on the computational target predictions at the sequence level and the inverse expression relationships between DEMs and DEGs. DAVID web server was selected to perform KEGG pathway enrichment analysis. Functional miRNA-gene regulatory module was generated based on the biological interpretation. Internal connections among genes in liver fibrosis-related module were determined using String database. MiRNA-gene regulatory modules related to liver fibrosis were experimentally verified in recombinant human TGFβ1 stimulated and specific miRNA inhibitor treated LX-2 cells. We totally identified 85 and 923 dysregulated miRNAs and genes in liver cirrhosis biopsy samples compared to their normal controls. All evident miRNA-gene pairs were identified and assembled into FMGRN which consisted of 990 regulations between 51 miRNAs and 275 genes, forming two big sub-networks that were defined as down-network and up-network, respectively. KEGG pathway enrichment analysis revealed that up-network was prominently involved in several KEGG pathways, in which "Focal adhesion", "PI3K-Akt signaling pathway" and "ECM-receptor interaction" were remarked significant (adjusted p<0.001). Genes enriched in these pathways coupled with their regulatory miRNAs formed a functional miRNA-gene regulatory module that contains 7 miRNAs, 22 genes and 42 miRNA-gene connections. Gene interaction analysis based on String database revealed that 8 out of 22 genes were highly clustered. Finally, we experimentally confirmed a functional regulatory module containing 5 miRNAs (miR-130b-3p, miR-148a-3p, miR-345-5p, miR-378a-3p, and miR-422a) and 6 genes (COL6A1, COL6A2, COL6A3, PIK3R3, COL1A1, CCND2) associated with liver fibrosis. Our integrated analysis of miRNA and gene expression profiles highlighted a functional miRNA-gene regulatory module associated with liver fibrosis, which, to some extent, may provide important clues to better understand the underlying pathogenesis of liver fibrosis. Copyright © 2017. Published by Elsevier B.V.

Collagen XVII (BP180) Modulates Keratinocyte Expression of the Proinflammatory Chemokine, IL-8

PubMed Central

Van den Bergh, Françoise; Eliason, Steven L.; Burmeister, Brian T.; Giudice, George J.

2012-01-01

Collagen XVII (COL17), a transmembrane protein expressed in epidermal keratinocytes (EK), is targeted by pathogenic autoantibodies in bullous pemphigoid. Treatment of EK with anti-COL17 autoantibodies triggers the production of proinflammatory cytokines. In this paper we test the hypothesis that COL17 is involved in the regulation of the EK proinflammatory response, using IL-8 expression as the primary readout. The absence of COL17 in EK derived from a junctional epidermolysis bullosa patient or shRNA-mediated knockdown of COL17 in normal EK resulted in a dysregulation of IL-8 responses under various conditions. The COL17-deficient cells showed an abnormally high IL-8 response after treatment with lipopolysaccharide (LPS), ultraviolet-B radiation or tumor necrosis factor, but exhibited a blunted IL-8 response to phorbol 12-myristate 13-acetate exposure. Induction of COL17 expression in COL17-negative EK led to a normalization of the LPS-induced proinflammatory response. Although α6β4 integrin was found to be up-regulated in COL17-deficient EK, siRNA-mediated knockdown of the α6 and β4 subunits revealed that COL17’s effects on the LPS IL-8 response are not dependent on this integrin. In LPS-treated cells, inhibition of NF-kappa B activity in COL17-negative EK resulted in a normalization of their IL-8 response, and expression of an NF-kappa B-driven reporter was shown to be higher in COL17-deficient, compared with normal, EK. These findings support the hypothesis that COL17 plays an important regulatory role in the EK proinflammatory response, acting largely via NF-kappa B. Future investigations will focus on further defining the molecular basis of this novel control network. PMID:22775995

Autophagy activation in COL6 myopathic patients by a low-protein-diet pilot trial.

PubMed

Castagnaro, Silvia; Pellegrini, Camilla; Pellegrini, Massimo; Chrisam, Martina; Sabatelli, Patrizia; Toni, Silvia; Grumati, Paolo; Ripamonti, Claudio; Pratelli, Loredana; Maraldi, Nadir M; Cocchi, Daniela; Righi, Valeria; Faldini, Cesare; Sandri, Marco; Bonaldo, Paolo; Merlini, Luciano

2016-12-01

A pilot clinical trial based on nutritional modulation was designed to assess the efficacy of a one-year low-protein diet in activating autophagy in skeletal muscle of patients affected by COL6/collagen VI-related myopathies. Ullrich congenital muscular dystrophy and Bethlem myopathy are rare inherited muscle disorders caused by mutations of COL6 genes and for which no cure is yet available. Studies in col6 null mice revealed that myofiber degeneration involves autophagy defects and that forced activation of autophagy results in the amelioration of muscle pathology. Seven adult patients affected by COL6 myopathies underwent a controlled low-protein diet for 12 mo and we evaluated the presence of autophagosomes and the mRNA and protein levels for BECN1/Beclin 1 and MAP1LC3B/LC3B in muscle biopsies and blood leukocytes. Safety measures were assessed, including muscle strength, motor and respiratory function, and metabolic parameters. After one y of low-protein diet, autophagic markers were increased in skeletal muscle and blood leukocytes of patients. The treatment was safe as shown by preservation of lean:fat percentage of body composition, muscle strength and function. Moreover, the decreased incidence of myofiber apoptosis indicated benefits in muscle homeostasis, and the metabolic changes pointed at improved mitochondrial function. These data provide evidence that a low-protein diet is able to activate autophagy and is safe and tolerable in patients with COL6 myopathies, pointing at autophagy activation as a potential target for therapeutic applications. In addition, our findings indicate that blood leukocytes are a promising noninvasive tool for monitoring autophagy activation in patients.

Autosomal dominant (Beukes) premature degenerative osteoarthropathy of the hip joint unlinked to COL2A1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beighton, P.; Ramesar, R.; Cilliers, H.J.

1994-12-01

Molecular investigations have been undertaken in several separate large South African families with autosomal dominant skeletal dysplasias in which premature degenerative osteoarthropathy of the hip joint was the major manifestation. There are sometimes additional minor changes in the spine and these conditions fall into the general spondyloepiphyseal dysplasia (SED) nosological category. In some kindreds, linkage between phenotype and the type II collagen gene (COL2A1) has been established, while in others there is no linkage. We have now completed molecular linkage investigations in an Afrikaner family named Beukes, in which 47 members in 6 generations have premature osteoarthropathy of the hipmore » joint. A LOD score of minus infinity indicates that this condition is not the result of a defect of the COL2A1 gene. 12 refs., 2 figs., 1 tab.« less

Molecular characterization and expression profiles of MaCOL1, a CONSTANS-like gene in banana fruit.

PubMed

Chen, Jiao; Chen, Jian-Ye; Wang, Jun-Ning; Kuang, Jian-Fei; Shan, Wei; Lu, Wang-Jin

2012-04-01

CONSTANS (CO) gene is a key transcription regulator that controls the long-day induction of flowering in Arabidopsis plant. However, CO gene involved in fruit ripening and stress responses is poorly understood. In the present study, a novel cDNA encoding CONSTANS-like gene, designated as MaCOL1 was isolated and characterized from banana fruit. The full length cDNA sequence was 1887bp with an open reading frame (ORF) of 1242bp, encoding 414 amino acids with a molecular weight of 46.20kDa and a theoretical isoelectric point of 5.40. Sequence alignment showed that MaCOL1 contained two B-box zinc finger motifs and a CCT domain. In addition, MaCOL1 showed transcriptional activity in yeast and was a nucleus-localized protein. Real-time PCR analysis showed that MaCOL1 was differentially expressed among various banana plant organs, with higher expression in flower. Expression of MaCOL1 in peel changed slightly, while accumulation of MaCOL1 transcripts in pulp obviously increased during natural or ethylene-induced fruit ripening, suggesting that MaCOL1 might be associated with the pulp ripening of banana fruit. Moreover, accumulation of MaCOL1 transcript was obviously enhanced by abiotic and biotic stresses, such as chilling and pathogen Colletotrichum musae infection. Taken together, our results suggest that MaCOL1 is a transcription activator and may be involved in fruit ripening and stress responses. Copyright © 2012 Elsevier B.V. All rights reserved.

A PTEN-COL17A1 fusion gene and its novel regulatory role in Collagen XVII expression and GBM malignance.

PubMed

Yan, Xiaoyan; Zhang, Chuanbao; Liang, Tingyu; Yang, Fan; Wang, Haoyuan; Wu, Fan; Wang, Wen; Wang, Zheng; Cheng, Wen; Xu, Jiangnan; Jiang, Tao; Chen, Jing; Ding, Yaozhong

2017-10-17

Collagen XVII expression has recently been demonstrated to be correlated with the tumor malignance. While Collagen XVII is known to be widely distributed in neurons of the human brain, its precise role in pathogenesis of glioblastoma multiforme (GBM) is unknown. In this study, we identified and characterized a new PTEN-COL17A1 fusion gene in GMB using transcriptome sequencing. Although fusion gene did not result in measurable fusion protein production, its presence is accompanied with high levels of COL17A1 expression, revealed a novel regulatory mechanism of Collagen XVII expression by PTEN-COL17A1 gene fusion. Knocked down Collagen XVII expression in glioma cell lines resulted in decreased tumor invasiveness, along with significant reduction of MMP9 expression, while increased Collagen XVII expression promotes invasive activities of glioma cells and associated with GBM recurrences. Together, our results uncovered a new PTEN-COL17A1 fusion gene and its novel regulatory role in Collagen XVII expression and GBM malignance, and demonstrated that COL17A1 could serve as a useful prognostic biomarker and therapeutic targets for GBM.

A novel approach to the use of doxycycline-loaded biodegradable membrane and EDTA root surface etching in chronic periodontitis: a randomized clinical trial.

PubMed

Gamal, Ahmed Y; Kumper, Radi M

2012-09-01

The release profile of 25% doxycycline (DOX) gel loaded on a biodegradable collagen membrane (COL) after 24% EDTA root surface etching was evaluated. Thirty systemically healthy patients, each with at least one pair of contralateral interproximal intrabony defects ≥4 mm deep, along with an interproximal probing depth ≥6 mm and clinical attachment loss ≥4 mm, were randomized into two groups. Group 1 consisted of sites treated with open-flap debridement followed by placement of DOX gel-loaded COL (DOX-COL), whereas group 2 sites were treated with flap surgery followed by the placement of DOX-COL after EDTA etching of the exposed root surfaces (DOX-COL + EDTA). Samples of gingival crevicular fluid were obtained 1, 3, 7, 14, and 21 days after surgery. Separation was performed, and quantitative measurements of DOX were taken with a high-performance liquid chromatography. Clinical evaluation and follow-up for 6 months were performed. At 21 days, DOX-COL + EDTA group showed 5.3 μg/mL value. However, no DOX was detected in samples of the DOX-COL group. DOX-COL + EDTA-treated group retained more DOX during the periods of 3, 7, 10, and 14 days than did the DOX-COL group. EDTA root surface etching could enhance DOX availability in the gingival crevicular fluid after its release from the collagen membrane.

Actin microfilaments participate in the regulation of the COL1A1 promoter activity in ROS17/2.8 cells under simulated microgravity

NASA Astrophysics Data System (ADS)

Dai, Zhongquan; Li, Yinghui; Ding, Bai; Zhang, Xiaoyou; Tan, Yingjun; Wan, Yumin

2006-01-01

IntroductionMicrogravity is thought to decrease osteoblastic activity and induce osteoporosis during spaceflight, but the mechanisms, particularly the attendant changes in gene expression, are not well understood. It is suspected that the cytoskeletal system is involved in the manifold changes of cell shape, function, and signaling under microgravity conditions. MethodsWe constructed cell lines stably transfected with pJI36EGFP and pJI23EGFP, which contained a 3.6 and a 2.3 kb fragment, respectively, of the α1(I) collagen gene (COL1A1) promoter fused with the enhanced green fluorescence protein (EGFP) reporter gene. We then developed a semi-quantitative analysis of EGFP fluorescence intensity to evaluate the effects of clinorotation and/or cytochalasin B on the activity of the COL1A1 promoter. Simultaneously, we assessed the collagen type I protein content versus total protein content in clinorotated or control osteoblasts, using immunocytochemistry and the Bradford method, respectively. ResultsThe fluorescence intensity analysis revealed that the expression of COL1A1-EGFP increased in GFP-ROS cells clinorotated for 24 or 48 h, as compared with stationary control cultures. We observed a similar trend in collagen type I content, as assessed by immunocytochemistry. We found that the osteoblast microfilaments tended to disassemble and show a reduction in stress fibers under space flight and clinorotation. Treatment with cytochalasin B in normal gravity resulted in a dose-dependent increase of EGFP fluorescence intensity, indicating that disruption of the actin system was associated with increased activity of the COL1A1 promoter. ConclusionOur study demonstrates that disrupting the actin cytoskeleton by treatment with cytochalasin B and real or simulated microgravity conditions led to altered COL1A1 promoter activity. Together, these results suggest that actin may participate in the regulation of the COL1A1 promoter activity under microgravity conditions.

Synergistic interaction of platelet derived growth factor (PDGF) with the surface of PLLA/Col/HA and PLLA/HA scaffolds produces rapid osteogenic differentiation.

PubMed

Raghavendran, Hanumantha Rao Balaji; Mohan, Saktiswaren; Genasan, Krishnamurithy; Murali, Malliga Raman; Naveen, Sangeetha Vasudevaraj; Talebian, Sepehr; McKean, Robert; Kamarul, Tunku

2016-03-01

Scaffolds with structural features similar to the extracellular matrix stimulate rapid osteogenic differentiation in favorable microenvironment and with growth factor supplementation. In this study, the osteogenic potential of electrospun poly-l-lactide/hydroxyapatite/collagen (PLLA/Col/HA, PLLA/HA and PLLA/Col) scaffolds were tested in vitro with the supplementation of platelet derived growth factor-BB (PDGF-BB). Cell attachment and topography, mineralization, extracellular matrix protein localization, and gene expression of the human mesenchymal stromal cells were compared between the fibrous scaffolds PLLA/Col/HA, PLLA/Col, and PLLA/HA. The levels of osteocalcin, calcium, and mineralization were significantly greater in the PLLA/Col/HA and PLLA/HA compared with PLLA/Col. High expression of fibronectin, intracellular adhesion molecule, cadherin, and collagen 1 (Col1) suggests that PLLA/Col/HA and PLLA/HA scaffolds had superior osteoinductivity than PLLA/Col. Additionally, osteopontin, osteocalcin, osterix, Runt-related transcription factor 2 (Runx2), and bone morphogenic protein (BMP2) expression were higher in PLLA/Col/HA and PLLA/HA compared with PLLA/Col. In comparison with PLLA/Col, the PLLA/Col/HA and PLLA/HA scaffolds presented a significant upregulation of the genes Runx2, Col 1, Integrin, osteonectin (ON), bone gamma-carboxyglutamic acid-containing protein (BGALP), osteopontin (OPN), and BMP2. The upregulation of these genes was further increased with PDGF-BB supplementation. These results show that PDGF-BB acts synergistically with PLLA/Col/HA and PLLA/HA to enhance the osteogenic differentiation potential. Therefore, this combination can be used for the rapid expansion of bone marrow stromal cells into bone-forming cells for tissue engineering. Copyright © 2015 Elsevier B.V. All rights reserved.

1,25-Dihydroxyvitamin D3 inhibition of col1a1 promoter expression in calvariae from neonatal transgenic mice

NASA Technical Reports Server (NTRS)

Bedalov, A.; Salvatori, R.; Dodig, M.; Kapural, B.; Pavlin, D.; Kream, B. E.; Clark, S. H.; Woody, C. O.; Rowe, D. W.; Lichtler, A. C.

1998-01-01

We studied the effect of 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) on organ cultures of transgenic mouse calvariae containing segments of the Col1a1 promoter extending to -3518, -2297, -1997, -1794, -1763, and -1719 bp upstream of the transcription start site fused to the chloramphenicol acetyltransferase (CAT) reporter gene. 1,25(OH)2D3 had a dose-dependent inhibitory effect on the expression of the -3518 bp promoter construct (ColCAT3.6), with maximal inhibition of about 50% at 10 nM. This level of inhibition was consistent with the previously observed effect on the endogenous Col1a1 gene in bone cell models. All of the shorter constructs were also inhibited by 10 nM 1,25(OH)2D3, suggesting that the sequences required for 1, 25(OH)2D3 inhibition are downstream of -1719 bp. The inhibitory effect of 1,25(OH)2D3 on transgene mRNA was maintained in the presence of the protein synthesis inhibitor cycloheximide, suggesting that the inhibitory effect on Col1a1 gene transcription does not require de novo protein synthesis. We also examined the in vivo effect of 1,25(OH)2D3 treatment of transgenic mice on ColCAT activity, and found that 48 h treatment caused a dose-dependent inhibition of CAT activity in calvariae comparable to that observed in organ cultures. In conclusion, we demonstrated that 1,25(OH)2D3 inhibits Col1A1 promoter activity in transgenic mouse calvariae, both in vivo and in vitro. The results indicate that there is a 1, 25(OH)2D3 responsive element downstream of -1719 bp. The inhibitory effect does not require new protein synthesis.

Functional and evolutionary characterization of the CONSTANS gene family in short-day photoperiodic flowering in soybean.

PubMed

Wu, Faqiang; Price, Brian William; Haider, Waseem; Seufferheld, Gabriela; Nelson, Randall; Hanzawa, Yoshie

2014-01-01

CONSTANS (CO) plays a central role in photoperiodic flowering control of plants. However, much remains unknown about the function of the CO gene family in soybean and the molecular mechanisms underlying short-day photoperiodic flowering of soybean. We identified 26 CO homologs (GmCOLs) in the soybean genome, many of them previously unreported. Phylogenic analysis classified GmCOLs into three clades conserved among flowering plants. Two homeologous pairs in Clade I, GmCOL1a/GmCOL1b and GmCOL2a/GmCOL2b, showed the highest sequence similarity to Arabidopsis CO. The mRNA abundance of GmCOL1a and GmCOL1b exhibited a strong diurnal rhythm under flowering-inductive short days and peaked at dawn, which coincided with the rise of GmFT5a expression. In contrast, the mRNA abundance of GmCOL2a and GmCOL2b was extremely low. Our transgenic study demonstrated that GmCOL1a, GmCOL1b, GmCOL2a and GmCOL2b fully complemented the late flowering effect of the co-1 mutant in Arabidopsis. Together, these results indicate that GmCOL1a and GmCOL1b are potential inducers of flowering in soybean. Our data also indicate rapid regulatory divergence between GmCOL1a/GmCOL1b and GmCOL2a/GmCOL2b but conservation of their protein function. Dynamic evolution of GmCOL regulatory mechanisms may underlie the evolution of photoperiodic signaling in soybean.

Secretory leukocyte protease inhibitor gene deletion alters bleomycin-induced lung injury, but not development of pulmonary fibrosis.

PubMed

Habgood, Anthony N; Tatler, Amanda L; Porte, Joanne; Wahl, Sharon M; Laurent, Geoffrey J; John, Alison E; Johnson, Simon R; Jenkins, Gisli

2016-06-01

Idiopathic pulmonary fibrosis is a progressive, fatal disease with limited treatment options. Protease-mediated transforming growth factor-β (TGF-β) activation has been proposed as a pathogenic mechanism of lung fibrosis. Protease activity in the lung is tightly regulated by protease inhibitors, particularly secretory leukocyte protease inhibitor (SLPI). The bleomycin model of lung fibrosis was used to determine the effect of increased protease activity in the lungs of Slpi(-/-) mice following injury. Slpi(-/-), and wild-type, mice received oropharyngeal administration of bleomycin (30 IU) and the development of pulmonary fibrosis was assessed. Pro and active forms of matrix metalloproteinase (MMP)-2 and MMP-9 were measured. Lung fibrosis was determined by collagen subtype-specific gene expression, hydroxyproline concentration, and histological assessment. Alveolar TGF-β activation was measured using bronchoalveolar lavage cell pSmad2 levels and global TGF-β activity was assessed by pSmad2 immunohistochemistry. The active-MMP-9 to pro-MMP-9 ratio was significantly increased in Slpi(-/-) animals compared with wild-type animals, demonstrating enhanced metalloproteinase activity. Wild-type animals showed an increase in TGF-β activation following bleomycin, with a progressive and sustained increase in collagen type I, alpha 1 (Col1α1), III, alpha 1(Col3α1), IV, alpha 1(Col4α1) mRNA expression, and a significant increase in total lung collagen 28 days post bleomycin. In contrast Slpi(-/-) mice showed no significant increase of alveolar TGF-β activity following bleomycin, above their already elevated levels, although global TGF-β activity did increase. Slpi(-/-) mice had impaired collagen gene expression but animals demonstrated minimal reduction in lung fibrosis compared with wild-type animals. These data suggest that enhanced proteolysis does not further enhance TGF-β activation, and inhibits sustained Col1α1, Col3α1, and Col4α1 gene expression following lung injury. However, these changes do not prevent the development of lung fibrosis. Overall, these data suggest that the absence of Slpi does not markedly modify the development of lung fibrosis following bleomycin-induced lung injury.

Collagen type IV alpha 1 (COL4A1) and collagen type XIII alpha 1 (COL13A1) produced in cancer cells promote tumor budding at the invasion front in human urothelial carcinoma of the bladder

PubMed Central

Miyake, Makito; Hori, Shunta; Morizawa, Yosuke; Tatsumi, Yoshihiro; Toritsuka, Michihiro; Ohnishi, Sayuri; Shimada, Keiji; Furuya, Hideki; Khadka, Vedbar S.; Deng, Youping; Ohnishi, Kenta; Iida, Kota; Gotoh, Daisuke; Nakai, Yasushi; Inoue, Takeshi; Anai, Satoshi; Torimoto, Kazumasa; Aoki, Katsuya; Tanaka, Nobumichi; Konishi, Noboru; Fujimoto, Kiyohide

2017-01-01

Current knowledge of the molecular mechanism driving tumor budding is limited. Here, we focused on elucidating the detailed mechanism underlying tumor budding in urothelial cancer of the bladder. Invasive urothelial cancer was pathologically classified into three groups as follows: nodular, trabecular, and infiltrative (tumor budding). Pathohistological analysis of the orthotopic tumor model revealed that human urothelial cancer cell lines MGH-U3, UM-UC-14, and UM-UC-3 displayed typical nodular, trabecular, and infiltrative patterns, respectively. Based on the results of comprehensive gene expression analysis using microarray (25 K Human Oligo chip), we identified two collagens, COL4A1 and COL13A1, which may contribute to the formation of the infiltrative pattern. Visualization of protein interaction networks revealed that proteins associated with connective tissue disorders, epithelial-mesenchymal transition, growth hormone, and estrogen were pivotal factors in tumor cells. To evaluate the invasion pattern of tumor cells in vitro, 3-D collective cell invasion assay using Matrigel was performed. Invadopodial formation was evaluated using Gelatin Invadopodia Assay. Knockdown of collagens with siRNA led to dramatic changes in invasion patterns and a decrease in invasion capability through decreased invadopodia. The in vivo orthotopic experimental model of bladder tumors showed that intravesical treatment with siRNA targeting COL4A1 and COL13A1 inhibited the formation of the infiltrative pattern. COL4A1 and COL13A1 production by cancer cells plays a pivotal role in tumor invasion through the induction of tumor budding. Blocking of these collagens may be an attractive therapeutic approach for treatment of human urothelial cancer of the bladder. PMID:28415608

A mouse collagen4α4 mutation causing Alport glomerulosclerosis with abnormal collagen α3α4α5(IV) trimers

PubMed Central

Korstanje, Ron; Caputo, Christina; Doty, Rosalinda; Cook, Susan; Bronson, Roderick; Davisson, Muriel; Miner, Jeffrey H.

2013-01-01

A spontaneous mutation termed bilateral wasting kidneys (bwk) was identified in a colony of NONcNZO recombinant inbred mice. These mice exhibit a rapid increase of urinary albumin at an early age associated with glomerulosclerosis, interstitial nephritis, and tubular atrophy. The mutation was mapped to a location on Chromosome 1 containing the Col4a3 and Col4a4 genes, for which mutations in the human orthologs cause the hereditary nephritis Alport syndrome. DNA sequencing identified a G to A mutation in the conserved GT splice donor of Col4a4 intron 30, resulting in skipping of exon 30 but maintaining the mRNA reading frame. Protein analyses showed that mutant collagen α3α4α5(IV) trimers were secreted and incorporated into the glomerular basement membrane (GBM), but levels were low, and GBM lesions typical of Alport syndrome were observed. Moving the mutation into the more renal damage-prone DBA/2J and 129S1/SvImJ backgrounds revealed differences in albuminuria and its rate of increase, suggesting an interaction between the Col4a4 mutation and modifier genes. This novel mouse model of Alport syndrome is the only one shown to accumulate abnormal collagen α3α4α5(IV) in the GBM, as also found in a subset of Alport patients. These mice will be valuable for testing potential therapies, for understanding abnormal collagen IV structure and assembly, for gaining better insights into the mechanisms leading to Alport syndrome and to the variability in the age of onset and associated phenotypes. PMID:24522496

Airway transplantation of adipose stem cells protects against bleomycin-induced pulmonary fibrosis.

PubMed

Llontop, Pedro; Lopez-Fernandez, Daniel; Clavo, Bernardino; Afonso Martín, Juan Luis; Fiuza-Pérez, María D; García Arranz, Mariano; Calatayud, Joaquín; Molins López-Rodó, Laureano; Alshehri, Khalid; Ayub, Adil; Raad, Wissam; Bhora, Faiz; Santana-Rodríguez, Norberto

2018-04-01

Idiopathic pulmonary fibrosis (IPF) is a progressive interstitial lung disease with poor prognosis. Adipose-derived stem cells (ADSC) have demonstrated regenerative properties in several tissues. The hypothesis of this study was that airway transplantation of ADSC could protect against bleomycin (BLM)-induced pulmonary fibrosis (PF). Fifty-eight lungs from 29 male Sprague-Dawley rats were analyzed. Animals were randomly divided into five groups: a) control (n=3); b) sham (n=6); c) BLM (n=6); d) BLM+ADSC-2d (n=6); and e) BLM+ADSC-14d (n=8). Animals received 500 µL saline (sham), 2.5 UI/kg BLM in 500 µL saline (BLM), and 2×10 6  ADSC in 100 µL saline intratracheally at 2 (BLM+ADSC-2d) and 14 days (BLM+ADSC-14d) after BLM. Animals were sacrificed at 28 days. Blinded Ashcroft score was used to determine pulmonary fibrosis extent on histology. Hsp27, Vegf, Nfkβ, IL-1, IL-6, Col4, and Tgfβ1 mRNA gene expression were determined using real-time quantitative-PCR. Ashcroft index was: control=0; sham=0.37±0.07; BLM=6.55±0.34 vs sham (P=0.006). BLM vs BLM+ADSC-2d=4.63±0.38 (P=0.005) and BLM+ADSC-14d=3.77±0.46 (P=0.005). BLM vs sham significantly increased Hsp27 (P=0.018), Nfkβ (P=0.009), Col4 (P=0.004), Tgfβ1 (P=0.006) and decreased IL-1 (P=0.006). BLM+ADSC-2d vs BLM significantly decreased Hsp27 (P=0.009) and increased Vegf (P=0.006), Nfkβ (P=0.009). BLM+ADSC-14d vs BLM significantly decreased Hsp27 (P=0.028), IL-6 (P=0.013), Col4 (P=0.002), and increased Nfkβ (P=0.040) and Tgfβ1 (P=0.002). Airway transplantation of ADSC significantly decreased the fibrosis rate in both early and established pulmonary fibrosis, modulating the expression of Hsp27, Vegfa, Nfkβ, IL-6, Col4, and Tgfβ1. From a translational perspective, this technique could become a new adjuvant treatment for patients with IPF. © American Federation for Medical Research (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

The DNA-mimic antirestriction proteins ArdA ColIB-P9, Arn T4, and Ocr T7 as activators of H-NS-dependent gene transcription.

PubMed

Melkina, Olga E; Goryanin, Ignatiy I; Zavilgelsky, Gennadii B

2016-11-01

The antirestriction proteins ArdA ColIb-P9, Arn T4 and Ocr T7 specifically inhibit type I and type IV restriction enzymes and belong to the family of DNA-mimic proteins because their three-dimensional structure is similar to the double-helical B-form DNA. It is proposed that the DNA-mimic proteins are able to bind nucleoid protein H-NS and alleviate H-NS-silencing of the transcription of bacterial genes. Escherichia coli lux biosensors were constructed by inserting H-NS-dependent promoters into a vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE operon. It was demonstrated that the DNA-mimic proteins ArdA, Arn and Ocr activate the transcription of H-NS-dependent promoters of the lux operon of marine luminescent bacteria (mesophilic Aliivibrio fischeri and psychrophilic Aliivibrio logei), and the dps gene from E. coli. It was also demonstrated that the ArdA antirestriction protein, the genes of which are located on transmissive plasmids ColIb-P9, R64, PK101, decreases levels of H-NS silencing of the PluxC promoter during conjugation in the recipient bacteria. Copyright © 2016 Elsevier GmbH. All rights reserved.

Identification of the collagen type 1 alpha 1 gene (COL1A1) as a candidate survival-related factor associated with hepatocellular carcinoma

PubMed Central

2014-01-01

Background Hepatocellular carcinoma (HCC) is one of the major causes of cancer-related death especially among Asian and African populations. It is urgent that we identify carcinogenesis-related genes to establish an innovative treatment strategy for this disease. Methods Triple-combination array analysis was performed using one pair each of HCC and noncancerous liver samples from a 68-year-old woman. This analysis consists of expression array, single nucleotide polymorphism array and methylation array. The gene encoding collagen type 1 alpha 1 (COL1A1) was identified and verified using HCC cell lines and 48 tissues from patients with primary HCC. Results Expression array revealed that COL1A1 gene expression was markedly decreased in tumor tissues (log2 ratio –1.1). The single nucleotide polymorphism array showed no chromosomal deletion in the locus of COL1A1. Importantly, the methylation value in the tumor tissue was higher (0.557) than that of the adjacent liver tissue (0.008). We verified that expression of this gene was suppressed by promoter methylation. Reactivation of COL1A1 expression by 5-aza-2′-deoxycytidine treatment was seen in HCC cell lines, and sequence analysis identified methylated CpG sites in the COL1A1 promoter region. Among 48 pairs of surgical specimens, 13 (27.1%) showed decreased COL1A1 mRNA expression in tumor sites. Among these 13 cases, 10 had promoter methylation at the tumor site. The log-rank test indicated that mRNA down-regulated tumors were significantly correlated with a poor overall survival rate (P = 0.013). Conclusions Triple-combination array analysis successfully identified COL1A1 as a candidate survival-related gene in HCCs. Epigenetic down-regulation of COL1A1 mRNA expression might have a role as a prognostic biomarker of HCC. PMID:24552139

Protective Effects of Standardized Siegesbeckia glabrescens Extract and Its Active Compound Kirenol against UVB-Induced Photoaging through Inhibition of MAPK/NF-κB Pathways.

PubMed

Kim, Jongwook; Kim, Mi-Bo; Yun, Jun Gon; Hwang, Jae Kwan

2017-02-28

Anti-photoaging effects of standardized Siegesbeckia glabrescens extract (SGE) and its major active compound kirenol were investigated using Hs68 human dermal fibroblasts and hairless mice, respectively. UVB-irradiated hairless mice that received oral SGE (600 mg/kg/day) showed reduced wrinkle formation and skinfold thickness compared with the UVB-irradiated control. Furthermore, SGE treatment increased the mRNA levels of collagen synthesis genes (COL1A1, COL3A1, COL4A1, and COL7A1) and activated antioxidant enzyme (catalase), while suppressing matrix metalloproteinase (MMP-2, -3, -9, and -13) expression. In Hs68 fibroblasts, kirenol also significantly suppressed MMP expression while increasing the expression of COL1A1, COL3A1, and COL7A1. Collectively, our data demonstrate that both SGE and kirenol attenuated UVB-induced photoaging in hairless mice and fibroblasts through inhibition of the mitogen-activated protein kinases and nuclear factor kappa B pathways, suggesting that SGE has potential to serve as a natural anti-photoaging nutraceutical.

Inflammation Modulatory Protein TSG-6 for Chemical Injuries to the Cornea

DTIC Science & Technology

2015-10-01

Col1a1 (collagen, type I, alpha 1) Col1a1 C o l1 a 1 /G A P D H co...0.25 Col1a1 C o l1 a 1 /G A P D H PB S TS G- 6 0.0 0.5 1.0 1.5 2.0 2.5 Thrombomodulin (CD141) ELANE (Neutrophil elastase) Emr1 (EGF-like module...TS G- 6 0.00 0.01 0.02 0.03 0.04 0.05 Thbd T h b d /G A P D H PB S TS G- 6 0.00 0.05 0.10 0.15 Col1a1 C o l1 a 1 /G A P D H PB S TS G- 6 0 1 2 3 4

Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

NASA Astrophysics Data System (ADS)

Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

2015-09-01

In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

Evaluation the COL9A2 gene with high myopia

NASA Astrophysics Data System (ADS)

Zhang, Dingding; Huang, Maomin

2017-11-01

This paper investigates the association of the COL9A2 gene between high myopia and normal controls in the Han Chinese population. It shows that the frameshift mutation (D281fs) in the COL9A2 gene is not associated with high myopia in the Han Chinese population, and the two novel variants(c.143G＞C and c.884G＞A) may contribute to the development of high myopia.

VizieR Online Data Catalog: Pulsation model data for delta Cep and eta Aql (Merand+, 2015)

NASA Astrophysics Data System (ADS)

Merand, A.; Kervella, P.; Breitfelder, J.; Gallenne, A.; Coude du Foresto, V.; ten Brummelaar, T. A.; McAlister, H. A.; Ridgway, S.; Sturmann, L.; Sturmann, J.; Turner, N. H.

2015-09-01

FITS files containing the stars' (delta Cep and eta Aql) data and model presented in the paper. Each fits file has 3 HDU: 1- primary HDU: contains no data apart from the header. The header has the parameters of the model (keywords 'HIERARCH PARAM') as well as some other quantities derived from the modeling (keywords 'HIERARCH MODEL'). These quantities are aimed at people who would like to reproduce or compare their results with us. 2- 'DATA' HDU: this contains the data used for the fit. Each line is a scalar measurement described as follow: col1='MJD' (E) modified Julian date of the observations col2='OBS' (A50) description of the data point: the string before ";" defines the type, after ";" is the source. after | are anciliary data: for diam, UDdiam: [wavelengthum, interfbaseline_m] for mag: photometric band for color: photometric band1 - photometric band2 col3='MEAS' (E) the actual measurements. units are km/s for Vpuls or Vrad (which includes the p-factor correction), and mas (milli-arcseconds) for diameters (diam of UDdiam). col4='ERR' (E) the uncertainty on the measurement. col5='MODEL' (E) corresponding value predicted by the model col6='PHASE' (E) pulsation phase computed from the model ranges from 0 to 1. col7='PERIOD' (E) pulsation period computed from the model in days 3- 'MODEL' HDU: a tabulation of the pulsation model, as a function of pulsation phase. col1='PHASE' (E) phase from 0 to 1. col2='Vpuls' (E) pulsation velocity, in km/s. col3='Vrad' (E) radial velocity, in km/s. It is Vpuls/p-factor + Vgamma. col4='diam' (E) Rosseland angular diameter, in milliarcseconds (mas). col5='Teff' (E) effective temperature, in Kelvin. col6='Lum' (E) Luminosity in solar luminosities. col7='logg' (E) surface gravity, in log_10(cm/s2). col8,9,10='diamK xxxm' (E) biased angular diameters measured by an interferometer at baselines xxx (in m), for xxx=[100, 200, 300]. In milliarcseconds col>=11= 'MAG ...' or 'COLOR ...' (E) reddenned magnitudes or colors in various bands, depending on the data entry. '...' is the name of band for magnitudes, and pair of bands for colors. (6 data files).

Gene expression profiles reveal key genes for early diagnosis and treatment of adamantinomatous craniopharyngioma.

PubMed

Yang, Jun; Hou, Ziming; Wang, Changjiang; Wang, Hao; Zhang, Hongbing

2018-04-23

Adamantinomatous craniopharyngioma (ACP) is an aggressive brain tumor that occurs predominantly in the pediatric population. Conventional diagnosis method and standard therapy cannot treat ACPs effectively. In this paper, we aimed to identify key genes for ACP early diagnosis and treatment. Datasets GSE94349 and GSE68015 were obtained from Gene Expression Omnibus database. Consensus clustering was applied to discover the gene clusters in the expression data of GSE94349 and functional enrichment analysis was performed on gene set in each cluster. The protein-protein interaction (PPI) network was built by the Search Tool for the Retrieval of Interacting Genes, and hubs were selected. Support vector machine (SVM) model was built based on the signature genes identified from enrichment analysis and PPI network. Dataset GSE94349 was used for training and testing, and GSE68015 was used for validation. Besides, RT-qPCR analysis was performed to analyze the expression of signature genes in ACP samples compared with normal controls. Seven gene clusters were discovered in the differentially expressed genes identified from GSE94349 dataset. Enrichment analysis of each cluster identified 25 pathways that highly associated with ACP. PPI network was built and 46 hubs were determined. Twenty-five pathway-related genes that overlapped with the hubs in PPI network were used as signatures to establish the SVM diagnosis model for ACP. The prediction accuracy of SVM model for training, testing, and validation data were 94, 85, and 74%, respectively. The expression of CDH1, CCL2, ITGA2, COL8A1, COL6A2, and COL6A3 were significantly upregulated in ACP tumor samples, while CAMK2A, RIMS1, NEFL, SYT1, and STX1A were significantly downregulated, which were consistent with the differentially expressed gene analysis. SVM model is a promising classification tool for screening and early diagnosis of ACP. The ACP-related pathways and signature genes will advance our knowledge of ACP pathogenesis and benefit the therapy improvement.

Whole exome analysis identifies dominant COL4A1 mutations in patients with complex ocular phenotypes involving microphthalmia.

PubMed

Deml, B; Reis, L M; Maheshwari, M; Griffis, C; Bick, D; Semina, E V

2014-11-01

Anophthalmia/microphthalmia (A/M) is a developmental ocular malformation defined as complete absence or reduction in size of the eye. A/M is a heterogenous disorder with numerous causative genes identified; however, about half the cases lack a molecular diagnosis. We undertook whole exome sequencing in an A/M family with two affected siblings, two unaffected siblings, and unaffected parents; the ocular phenotype was isolated with only mild developmental delay/learning difficulties reported and a normal brain magnetic resonance imaging (MRI) in the proband at 16 months. No pathogenic mutations were identified in 71 known A/M genes. Further analysis identified a shared heterozygous mutation in COL4A1, c.2317G>A, p.(Gly773Arg) that was not seen in the unaffected parents and siblings. Analysis of 24 unrelated A/M exomes identified a novel c.2122G>A, p.(Gly708Arg) mutation in an additional patient with unilateral microphthalmia, bilateral microcornea and Peters anomaly; the mutation was absent in the unaffected mother and the unaffected father was not available. Mutations in COL4A1 have been linked to a spectrum of human disorders; the most consistent feature is cerebrovascular disease with variable ocular anomalies, kidney and muscle defects. This study expands the spectrum of COL4A1 phenotypes and indicates screening in patients with A/M regardless of MRI findings or presumed inheritance pattern. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Gene expression profile of collagen types, osteopontin in the tympanic membrane of patients with tympanosclerosis.

PubMed

Sakowicz-Burkiewicz, Monika; Kuczkowski, Jerzy; Przybyła, Tomasz; Grdeń, Marzena; Starzyńska, Anna; Pawełczyk, Tadeusz

2017-09-01

Tympanosclerosis is a pathological process involving the middle ear. The hallmark of this disease is the formation of calcium deposits. In the submucosal layer, as well as in the right layer of the tympanic membrane, the calcium deposits result in a significant increase in the activity of fibroblasts and deposition of collagen fibers. The aim of our study was to examine the expression level of genes encoding collagen type I, II, III and IV (COL1A1, COL2A1, COL3A1, COL4A1) and osteopontin (SPP1) in the tympanic membrane of patients with tympanosclerosis. The total RNA was isolated from middle ear tissues with tympanosclerosis, received from 25 patients and from 19 normal tympanic membranes. The gene expression level was determined by real-time RT-PCR. The gene expression levels were correlated with clinical Tos classification of tympanosclerosis. We observed that in the tympanic membrane of patients with tympanosclerosis, the expression of type I collagen is decreased, while the expression of type II and IV collagen and osteopontin is increased. Moreover, mRNA levels of the investigated genes strongly correlated with the clinical stages of tympanosclerosis. The strong correlations between the expression of type I, II, IV collagen and osteopontin and the clinical stage of tympanosclerosis indicate the involvement of these proteins in excessive fibrosis and pathological remodeling of the tympanic membrane. In the future, a treatment aiming to modulate these gene expressions and/or regulation of the degradation of their protein products could be used as a new medical approach for patients with tympanosclerosis.

Prevalence of ColE1-like plasmids and kanamycin resistance genes in Salmonella enterica serovars.

PubMed

Chen, Chin-Yi; Lindsey, Rebecca L; Strobaugh, Terence P; Frye, Jonathan G; Meinersmann, Richard J

2010-10-01

Multi-antimicrobial-resistant Salmonella enterica strains frequently carry resistance genes on plasmids. Recent studies focus heavily on large conjugative plasmids, and the role that small plasmids play in resistance gene transfer is largely unknown. To expand our previous studies in assessing the prevalence of the isolates harboring ColE1-like plasmids carrying the aph gene responsible for kanamycin resistance (Kan(r)) phenotypes, 102 Kan(r) Salmonella isolates collected through the National Antimicrobial Resistance Monitoring System (NARMS) in 2005 were screened by PCR using ColE1 primer sets. Thirty isolates were found to be positive for ColE1-like replicon. Plasmids from 23 isolates were able to propagate in Escherichia coli and were subjected to further characterization. Restriction mapping revealed three major plasmid groups found in three or more isolates, with each group consisting of two to three subtypes. The aph genes from the Kan(r) Salmonella isolates were amplified by PCR, sequenced, and showed four different aph(3')-I genes. The distribution of the ColE1 plasmid groups in association with the aph gene, Salmonella serovar, and isolate source demonstrated a strong linkage of the plasmid with S. enterica serovar Typhimurium DT104. Due to their high copy number and mobility, the ColE1-like plasmids may play a critical role in transmission of antibiotic resistance genes among enteric pathogens, and these findings warrant a close monitoring of this plasmid incompatibility group.

Prevalence of ColE1-Like Plasmids and Kanamycin Resistance Genes in Salmonella enterica Serovars ▿

PubMed Central

Chen, Chin-Yi; Lindsey, Rebecca L.; Strobaugh, Terence P.; Frye, Jonathan G.; Meinersmann, Richard J.

2010-01-01

Multi-antimicrobial-resistant Salmonella enterica strains frequently carry resistance genes on plasmids. Recent studies focus heavily on large conjugative plasmids, and the role that small plasmids play in resistance gene transfer is largely unknown. To expand our previous studies in assessing the prevalence of the isolates harboring ColE1-like plasmids carrying the aph gene responsible for kanamycin resistance (Kanr) phenotypes, 102 Kanr Salmonella isolates collected through the National Antimicrobial Resistance Monitoring System (NARMS) in 2005 were screened by PCR using ColE1 primer sets. Thirty isolates were found to be positive for ColE1-like replicon. Plasmids from 23 isolates were able to propagate in Escherichia coli and were subjected to further characterization. Restriction mapping revealed three major plasmid groups found in three or more isolates, with each group consisting of two to three subtypes. The aph genes from the Kanr Salmonella isolates were amplified by PCR, sequenced, and showed four different aph(3′)-I genes. The distribution of the ColE1 plasmid groups in association with the aph gene, Salmonella serovar, and isolate source demonstrated a strong linkage of the plasmid with S. enterica serovar Typhimurium DT104. Due to their high copy number and mobility, the ColE1-like plasmids may play a critical role in transmission of antibiotic resistance genes among enteric pathogens, and these findings warrant a close monitoring of this plasmid incompatibility group. PMID:20693446

Significant impact of amount of PCR input templates on various PCR-based DNA methylation analysis and countermeasure.

PubMed

Liu, Zhaojun; Zhou, Jing; Gu, Liankun; Deng, Dajun

2016-08-30

Methylation changes of CpG islands can be determined using PCR-based assays. However, the exact impact of the amount of input templates (TAIT) on DNA methylation analysis has not been previously recognized. Using COL2A1 gene as an input reference, TAIT difference between human tissues with methylation-positive and -negative detection was calculated for two representative genes GFRA1 and P16. Results revealed that TAIT in GFRA1 methylation-positive frozen samples (n = 332) was significantly higher than the methylation-negative ones (n = 44) (P < 0.001). Similar difference was found in P16 methylation analysis. The TAIT-related effect was also observed in methylation-specific PCR (MSP) and denatured high performance liquid chromatography (DHPLC) analysis. Further study showed that the minimum TAIT for a successful MethyLight PCR reaction should be ≥ 9.4 ng (CtCOL2A1 ≤ 29.3), when the cutoff value of the methylated-GFRA1 proportion for methylation-positive detection was set at 1.6%. After TAIT of the methylation non-informative frozen samples (n = 94; CtCOL2A1 > 29.3) was increased above the minimum TAIT, the methylation-positive rate increased from 72.3% to 95.7% for GFRA1 and 26.6% to 54.3% for P16, respectively (Ps < 0.001). Similar results were observed in the FFPE samples. In conclusion, TAIT critically affects results of various PCR-based DNA methylation analyses. Characterization of the minimum TAIT for target CpG islands is essential to avoid false-negative results.

Serum- and Growth-Factor-Free Three-Dimensional Culture System Supports Cartilage Tissue Formation by Promoting Collagen Synthesis via Sox9–Col2a1 Interaction

PubMed Central

Ahmed, Nazish; Iu, Jonathan; Brown, Chelsea E.; Taylor, Drew Wesley

2014-01-01

Objective: One of the factors preventing clinical application of regenerative medicine to degenerative cartilage diseases is a suitable source of cells. Chondrocytes, the only cell type of cartilage, grown in vitro under culture conditions to expand cell numbers lose their phenotype along with the ability to generate hyaline cartilaginous tissue. In this study we determine that a serum- and growth-factor-free three-dimensional (3D) culture system restores the ability of the passaged chondrocytes to form cartilage tissue in vitro, a process that involves sox9. Methods: Bovine articular chondrocytes were passaged twice to allow for cell number expansion (P2) and cultured at high density on 3D collagen-type-II-coated membranes in high glucose content media supplemented with insulin and dexamethasone (SF3D). The cells were characterized after monolayer expansion and following 3D culture by flow cytometry, gene expression, and histology. The early changes in signaling transduction pathways during redifferentiation were characterized. Results: The P2 cells showed a progenitor-like antigen profile of 99% CD44+ and 40% CD105+ and a gene expression profile suggestive of interzone cells. P2 in SF3D expressed chondrogenic genes and accumulated extracellular matrix. Downregulating insulin receptor (IR) with HNMPA-(AM3) or the PI-3/AKT kinase pathway (activated by insulin treatment) with Wortmannin inhibited collagen synthesis. HNMPA-(AM3) reduced expression of Col2, Col11, and IR genes as well as Sox6 and -9. Co-immunoprecipitation and chromatin immunoprecipitation analyses of HNMPA-(AM3)-treated cells showed binding of the coactivators Sox6 and Med12 with Sox9 but reduced Sox9–Col2a1 binding. Conclusions: We describe a novel culture method that allows for increase in the number of chondrocytes and promotes hyaline-like cartilage tissue formation in part by insulin-mediated Sox9–Col2a1 binding. The suitability of the tissue generated via this approach for use in joint repair needs to be examined in vivo. PMID:24606204

Construction of noninterpenetrating and interpenetrating Co(ii) networks with halogenated carboxylate modulated by auxiliary N-donor co-ligands: structural diversity, electrochemical and photocatalytic properties.

PubMed

Hao, Shao Yun; Hou, Suo Xia; Van Hecke, Kristof; Cui, Guang Hua

2017-02-14

Six Co(ii)-based coordination polymers (CPs) with characteristic frameworks and topologies-namely, [Co(L1)(DCTP)] n (1), [Co(L2)(DCTP)] n (2), [Co(L3)(DCTP)] n (3), {[Co 3 (L4) 3 (DCTP) 3 ·H 2 O]·H 2 O} n (4), [Co(L5) 1.5 (DCTP)] n (5) and [Co(L6)(DCTP)] n (6)-were successfully hydrothermally synthesized by employing the halogenated linear ligand 2,5-dichloroterephthalic acid (H 2 DCTP). The interpenetrated structures could be rationally modulated by auxiliary N-donor co-ligands containing 1,1'-(1,4-butanediyl)bis-1H-benzimidazole (L1), 1,4-bis(5,6-dimethylbenzimidazol-1-yl)-2-butylene (L2), 1,2-bis(2-methylbenzimidazol-1-ylmethyl)benzene (L3), 1,4-bis(2-methylbenzimidazol-1-ylmethyl)benzene (L4), 1,2-bis(5,6-dimethylbenzimidazol-1-ylmethyl)benzene (L5) and 1,4-bis(5,6-dimethylbenzimidazol-1-ylmethyl)benzene (L6). These diaphanous crystals were clearly characterized by elemental analysis, infrared (IR) spectra and X-ray powder diffraction (XRPD) as well as single-crystal X-ray diffraction analysis. With the aid of the flexible N-donor co-ligands, CP 1 occupies a non-interpenetrated 2D sheet with the point symbol {4 4 ·6 2 } sql net topology, CP 2 possesses a 3D hexagon-shaped network with the point symbol {6 6 } three-fold interpenetrated sqc6 topology, CP 3 exhibits a 2D layer with the point symbol {4 4 ·6 2 } sql net topology, CP 4 reveals an unusual 3D framework with the point symbol {4 2 ·6 3 ·8} three-fold interpenetrated sra topology, CP 5 has a 3D hexagon-shaped network with the point symbol {6 6 } two-fold interpenetrated sqc6 topology, while CP 6 displays a 3D hexagon-shaped network with the point symbol {6 6 } three-fold interpenetrated sqc6 topology. The diverse structures of CPs 1-6 illustrate that the substitute group and position of the methyl group of the bis(benzimidazole) derivatives play a significant role in the assembly of such interpenetrated frameworks. Moreover, luminescence properties and thermal behavior, as well as the electrochemical and photocatalytic properties of CPs 1-6 on the degradation of methylene blue, are also presented.

Metalloproteinase inhibition prevents acute respiratory distress syndrome.

PubMed

Carney, D E; McCann, U G; Schiller, H J; Gatto, L A; Steinberg, J; Picone, A L; Nieman, G F

2001-08-01

The acute respiratory distress syndrome (ARDS) occurs in patients with clearly identifiable risk factors, and its treatment remains merely supportive. We postulated that patients at risk for ARDS can be protected against lung injury by a prophylactic treatment strategy that targets neutrophil-derived proteases. We hypothesized that a chemically modified tetracycline 3 (COL-3), a potent inhibitor of neutrophil matrix metalloproteinases (MMPs) and neutrophil elastase (NE) with minimal toxicity, would prevent ARDS in our porcine endotoxin-induced ARDS model. Yorkshire pigs were anesthetized, intubated, surgically instrumented for hemodynamic monitoring, and randomized into three groups: (1) control (n = 4), surgical instrumentation only; (2) lipopolysaccharide (LPS) (n = 4), infusion of Escherichia coli lipopolysaccharide at 100 microg/kg; and (3) COL-3 + LPS (n = 5), ingestion of COL-3 (100 mg/kg) 12 h before LPS infusion. All animals were monitored for 6 h following LPS or sham LPS infusion. Serial bronchoalveolar lavage (BAL) samples were analyzed for MMP concentration by gelatin zymography. Lung tissue was fixed for morphometric assessment at necropsy. LPS infusion was marked by significant (P < 0.05) physiological deterioration as compared with the control group, including increased plateau airway pressure (P(plat)) (control = 15.7 +/- 0.4 mm Hg, LPS = 23.0 +/- 1.5 mm Hg) and a decrement in arterial oxygen partial pressure (P(a)O(2)) (LPS = 66 +/- 15 mm Hg, Control = 263 +/- 25 mm Hg) 6 h following LPS or sham LPS infusion, respectively. Pretreatment with COL-3 reduced the above pathophysiological changes 6 h following LPS infusion (P(plat) = 18.5 +/- 1.7 mm Hg, P(a)O(2) = 199 +/- 35 mm Hg; P = NS vs control). MMP-9 and MMP-2 concentration in BAL fluid was significantly increased between 2 and 4 h post-LPS infusion; COL-3 reduced the increase in MMP-9 and MMP-2 concentration at all time periods. Morphometrically LPS caused a significant sequestration of neutrophils and monocytes into pulmonary tissue. Pretreatment with COL-3 ameliorated this response. The wet/dry lung weight ratio was significantly greater (P < 0.05) in the LPS group (10.1 +/- 1.0 ratio) than in either the control (6.4 +/- 0.5 ratio) or LPS+COL-3 (7.4 +/- 0.6 ratio) group. A single prophylactic treatment with COL-3 prevented lung injury in our model of endotoxin-induced ARDS. The proposed mechanism of COL-3 is a synergistic inhibition of the terminal neutrophil effectors MMPs and NE. Similar to the universal practice of prophylaxis against gastric stress ulceration and deep venous thromboses in trauma patients, chemically modified tetracyclines may likewise be administered to prevent acute lung injury in critically injured patients at risk of developing ARDS. Copyright 2001 Academic Press.

Histone deacetylase 3 supports endochondral bone formation by controlling cytokine signaling and matrix remodeling

PubMed Central

Carpio, Lomeli R.; Bradley, Elizabeth W.; McGee-Lawrence, Meghan E.; Weivoda, Megan M.; Poston, Daniel D.; Dudakovic, Amel; Xu, Ming; Tchkonia, Tamar; Kirkland, James L.; van Wijnen, Andre J.; Oursler, Merry Jo; Westendorf, Jennifer J.

2017-01-01

Histone deacetylase (HDAC) inhibitors are efficacious epigenetic-based therapies for some cancers and neurological disorders; however, each of these drugs inhibits multiple HDACs and has detrimental effects on the skeleton. To better understand how HDAC inhibitors affect endochondral bone formation, we conditionally deleted one of their targets, Hdac3, pre- and postnatally in type II collagen α1 (Col2α1)–expressing chondrocytes. Embryonic deletion was lethal, but postnatal deletion of Hdac3 delayed secondary ossification center formation, altered maturation of growth plate chondrocytes, and increased osteoclast activity in the primary spongiosa. HDAC3-deficient chondrocytes exhibited increased expression of cytokine and matrix-degrading genes (Il-6, Mmp3, Mmp13, and Saa3) and a reduced abundance of genes related to extracellular matrix production, bone development, and ossification (Acan, Col2a1, Ihh, and Col10a1). Histone acetylation increased at and near genes that had increased expression. The acetylation and activation of nuclear factor κB (NF-κB) were also increased in HDAC3-deficient chondrocytes. Increased cytokine signaling promoted autocrine activation of Janus kinase (JAK)–signal transducer and activator of transcription (STAT) and NF-κB pathways to suppress chondrocyte maturation, as well as paracrine activation of osteoclasts and bone resorption. Blockade of interleukin-6 (IL-6)–JAK–STAT signaling, NF-κB signaling, and bromodomain extraterminal proteins, which recognize acetylated lysines and promote transcriptional elongation, significantly reduced Il-6 and Mmp13 expression in HDAC3-deficient chondrocytes and secondary activation in osteoclasts. The JAK inhibitor ruxolitinib also reduced osteoclast activity in Hdac3 conditional knockout mice. Thus, HDAC3 controls the temporal and spatial expression of tissue-remodeling genes and inflammatory responses in chondrocytes to ensure proper endochondral ossification during development. PMID:27507649

A sensitive method for determination of COL-3, a chemically modified tetracycline, in human plasma using high-performance liquid chromatography and ultraviolet detection.

PubMed

Rudek, Michelle A; Hartke, Carol; Zabelina, Yelena; Zhao, Ming; New, Pamela; Baker, Sharyn D

2005-04-01

COL-3, 6-deoxy-6-desmethyl-4-desdimethylamino-tetracycline, is a matrix metalloproteinase inhibitor currently in clinical development. A HPLC-UV method to quantitate COL-3 in human plasma was developed. COL-3 was extracted from plasma using solid-phase extraction cartridges. COL-3 is separated on a Waters Symmetry Shield RP8 (3.9 mm x150 mm, 5 microm) column with EDTA (0.001 M) in sodium acetate (0.01 M, pH 3.5)-acetonitrile mobile phase using a gradient profile at a flow rate of 1 ml/min for 22 min. Carryover was eliminated by using an extended needle wash of methanol:acetonitrile:dichloromethane (1:1:1, v/v/v). Detection of COL-3 and the internal standard, chrysin, was observed at 350 nm. COL-3 and chrysin elute at 8.9 and 9.9 min, respectively. The lower limit of quantitation in human plasma of COL-3 was 75 ng/ml, linearity was observed from 75 to 10,000 ng/ml. A 30,000 ng/ml sample that was diluted 1:50 with plasma was accurately quantitated. This method is rapid, widely applicable, and suitable for quantifying COL-3 in patient samples enabling further clinical pharmacology characterization of COL-3.

Alport syndrome: a unified classification of genetic disorders of collagen IV α345: a position paper of the Alport Syndrome Classification Working Group.

PubMed

Kashtan, Clifford E; Ding, Jie; Garosi, Guido; Heidet, Laurence; Massella, Laura; Nakanishi, Koichi; Nozu, Kandai; Renieri, Alessandra; Rheault, Michelle; Wang, Fang; Gross, Oliver

2018-05-01

Mutations in the genes COL4A3, COL4A4, and COL4A5 affect the synthesis, assembly, deposition, or function of the collagen IV α345 molecule, the major collagenous constituent of the mature mammalian glomerular basement membrane. These mutations are associated with a spectrum of nephropathy, from microscopic hematuria to progressive renal disease leading to ESRD, and with extrarenal manifestations such as sensorineural deafness and ocular anomalies. The existing nomenclature for these conditions is confusing and can delay institution of appropriate nephroprotective therapy. Herein we propose a new classification of genetic disorders of the collagen IV α345 molecule with the goal of improving renal outcomes through regular monitoring and early treatment. Copyright © 2018 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

Role of Flightless-I (Drosophila) homolog in the transcription activation of type I collagen gene mediated by transforming growth factor beta

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, Mi-Sun; Jeong, Kwang Won, E-mail: kwjeong@gachon.ac.kr

Highlights: • FLII activates TGFβ-mediated expression of COL1A2 gene. • TGFβ induces the association of FLII with SMAD3 and BRG1 in A549 cells. • FLII is required for the recruitment of SWI/SNF complex and chromatin accessibility to COL1A2 promoter. - Abstract: Flightless-I (Drosophila) homolog (FLII) is a nuclear receptor coactivator that is known to interact with other transcriptional regulators such as the SWI/SNF complex, an ATP-dependent chromatin-remodeling complex, at the promoter or enhancer region of estrogen receptor (ER)-α target genes. However, little is known about the role of FLII during transcription initiation in the transforming growth factor beta (TGFβ)/SMAD-dependent signalingmore » pathway. Here, we demonstrate that FLII functions as a coactivator in the expression of type I collagen gene induced by TGFβ in A549 cells. FLII activates the reporter gene driven by COL1A2 promoter in a dose-dependent manner. Co-expression of GRIP1, CARM1, or p300 did not show any synergistic activation of transcription. Furthermore, the level of COL1A2 expression correlated with the endogenous level of FLII mRNA level. Depletion of FLII resulted in a reduction of TGFβ-induced expression of COL1A2 gene. In contrast, over-expression of FLII caused an increase in the endogenous expression of COL1A2. We also showed that FLII is associated with Brahma-related gene 1 (BRG1) as well as SMAD in A549 cells. Notably, the recruitment of BRG1 to the COL1A2 promoter region was decreased in FLII-depleted A549 cells, suggesting that FLII is required for TGFβ-induced chromatin remodeling, which is carried out by the SWI/SNF complex. Furthermore, formaldehyde-assisted isolation of regulatory elements (FAIRE)-quantitative polymerase chain reaction (qPCR) experiments revealed that depletion of FLII caused a reduction in chromatin accessibility at the COL1A2 promoter. These results suggest that FLII plays a critical role in TGFβ/SMAD-mediated transcription of the COL1A2 gene through its role in recruiting the SWI/SNF complex to facilitate chromatin accessibility.« less

Synthesis and Characterization of Hydroxyapatite-Collagen-Chitosan (HA/Col/Chi) Composite Coated on Ti6Al4V

NASA Astrophysics Data System (ADS)

Charlena; Bikharudin, Ahmad; Wahyudi, Setyanto Tri

2018-01-01

HA-collagen-chitosan (HA/col/chi) composite is developed to increase bioactivity adhesiveness between the metal and the material composite and to improve corrosion resistance. The Ti6Al4V alloy was coated by soaking in HA/col/chi composite at room temperature and then allowed to stand for 5, 6, and 7 days. Diffraction pattern analysis of the coated Ti6Al4V alloy showed that the dominant phase were HA and Ti6Al4V alloy. Corrosion resistance test in media by using 0.9% NaCl showed the corrosion rate at the level of 0.3567 mpy, which was better than that of the uncoated Ti6Al4V alloy (0.4152 mpy). In vitro cytocompatibility assay on endothelial cell of calf pulmonary artery endothelium (CPAE) (ATCC-CCL 209) showed there was no toxicity in the cell culture with the percent inhibition of 33.33% after 72 hours of incubation.

Growth Performance and Root Transcriptome Remodeling of Arabidopsis in Response to Mars-Like Levels of Magnesium Sulfate

PubMed Central

Visscher, Anne M.; Paul, Anna-Lisa; Kirst, Matias; Guy, Charles L.; Schuerger, Andrew C.; Ferl, Robert J.

2010-01-01

Background Martian regolith (unconsolidated surface material) is a potential medium for plant growth in bioregenerative life support systems during manned missions on Mars. However, hydrated magnesium sulfate mineral levels in the regolith of Mars can reach as high as 10 wt%, and would be expected to be highly inhibitory to plant growth. Methodology and Principal Findings Disabling ion transporters AtMRS2-10 and AtSULTR1;2, which are plasma membrane localized in peripheral root cells, is not an effective way to confer tolerance to magnesium sulfate soils. Arabidopsis mrs2-10 and sel1-10 knockout lines do not mitigate the growth inhibiting impacts of high MgSO4·7H2O concentrations observed with wildtype plants. A global approach was used to identify novel genes with potential to enhance tolerance to high MgSO4·7H2O (magnesium sulfate) stress. The early Arabidopsis root transcriptome response to elevated concentrations of magnesium sulfate was characterized in Col-0, and also between Col-0 and the mutant line cax1-1, which was confirmed to be relatively tolerant of high levels of MgSO4·7H2O in soil solution. Differentially expressed genes in Col-0 treated for 45 min. encode enzymes primarily involved in hormone metabolism, transcription factors, calcium-binding proteins, kinases, cell wall related proteins and membrane-based transporters. Over 200 genes encoding transporters were differentially expressed in Col-0 up to 180 min. of exposure, and one of the first down-regulated genes was CAX1. The importance of this early response in wildtype Arabidopsis is exemplified in the fact that only four transcripts were differentially expressed between Col-0 and cax1-1 at 180 min. after initiation of treatment. Conclusions/Significance The results provide a solid basis for the understanding of the metabolic response of plants to elevated magnesium sulfate soils; it is the first transcriptome analysis of plants in this environment. The results foster the development of Mars soil-compatible plants by showing that cax1 mutants exhibit partial tolerance to magnesium sulfate, and by elucidating a small subset (500 vs. >10,000) of candidate genes for mutation or metabolic engineering that will enhance tolerance to magnesium sulfate soils. PMID:20808807

Splitting of IVP bovine blastocyst affects morphology and gene expression of resulting demi-embryos during in vitro culture and in vivo elongation.

PubMed

Velasquez, Alejandra E; Castro, Fidel O; Veraguas, Daniel; Cox, Jose F; Lara, Evelyn; Briones, Mario; Rodriguez-Alvarez, Lleretny

2016-02-01

Embryo splitting might be used to increase offspring yield and for molecular analysis of embryo competence. How splitting affects developmental potential of embryos is unknown. This research aimed to study the effect of bovine blastocyst splitting on morphological and gene expression homogeneity of demi-embryos and on embryo competence during elongation. Grade I bovine blastocyst produced in vitro were split into halves and distributed in nine groups (3 × 3 setting according to age and stage before splitting; age: days 7-9; stage: early, expanded and hatched blastocysts). Homogeneity and survival rate in vitro after splitting (12 h, days 10 and 13) and the effect of splitting on embryo development at elongation after embryo transfer (day 17) were assessed morphologically and by RT-qPCR. The genes analysed were OCT4, SOX2, NANOG, CDX2, TP1, TKDP1, EOMES, and BAX. Approximately 90% of split embryos had a well conserved defined inner cell mass (ICM), 70% of the halves had similar size with no differences in gene expression 12 h after splitting. Split embryos cultured further conserved normal and comparable morphology at day 10 of development; this situation changes at day 13 when embryo morphology and gene expression differed markedly among demi-embryos. Split and non-split blastocysts were transferred to recipient cows and were recovered at day 17. Fifty per cent of non-split embryos were larger than 100 mm (33% for split embryos). OCT4, SOX2, TP1 and EOMES levels were down-regulated in elongated embryos derived from split blastocysts. In conclusion, splitting day-8 blastocysts yields homogenous demi-embryos in terms of developmental capability and gene expression, but the initiation of the filamentous stage seems to be affected by the splitting.

Wound healing genes and susceptibility to cutaneous leishmaniasis in Brazil: Role of COL1A1

PubMed Central

Almeida, Lucas; Oliveira, Joyce; Guimarães, Luiz Henrique; Carvalho, Edgar M; Blackwell, Jenefer M

2015-01-01

Previous studies have demonstrated a role for wound healing genes in resolution of cutaneous lesions caused by Leishmania spp. in both mice and humans, including the gene FLI1 encoding Friend leukaemia virus integration 1. Reduction of Fli1 expression in mice has been shown to result in up-regulation of collagen type I alpha 1 (Col1a1) and alpha 2 (Col1a2) genes and, conversely, in down-regulation of the matrix metalloproteinase 1 (Mmp1) gene, suggesting that Fli1 suppression is involved in activation of the profibrotic gene program. Here we examined single nucleotide polymorphisms (SNPs) in these genes as risk factors for cutaneous (CL) and mucosal leishmaniasis (ML), and leishmaniasis per se, caused by L. braziliensis in humans. SNPs were genotyped in 168 nuclear families (250 CL; 87 ML cases) and replicated in 157 families (402 CL; 39 ML cases). Family-based association tests (FBAT) showed the strongest association between SNPs rs1061237 (combined P=0.002) and rs2586488 (combined P=0.027) at COL1A1 and CL disease. This contributes to our further understanding of the role of wound healing in the resolution of CL disease, providing potential for therapies modulating COL1A1 via drugs acting on FLI1. PMID:25562121

Alport syndrome: impact of digenic inheritance in patients management.

PubMed

Fallerini, C; Baldassarri, M; Trevisson, E; Morbidoni, V; La Manna, A; Lazzarin, R; Pasini, A; Barbano, G; Pinciaroli, A R; Garosi, G; Frullanti, E; Pinto, A M; Mencarelli, M A; Mari, F; Renieri, A; Ariani, F

2017-07-01

Alport syndrome (ATS) is a genetically heterogeneous nephropathy with considerable phenotypic variability and different transmission patterns, including monogenic (X-linked/autosomal) and digenic inheritance (DI). Here we present a new series of families with DI and we discuss the consequences for genetic counseling and risk assessment. Out of five families harboring variants in more than one COL4 gene detected by next generation sequencing (NGS), minigene-splicing assay allowed us to identify four as true digenic. Two families showed COL4A3/A4 mutations in cis, mimicking an autosomal dominant inheritance with a more severe phenotype and one showed COL4A3/A4 mutations in trans, mimicking an autosomal recessive inheritance with a less severe phenotype. In a fourth family, a de novo mutation (COL4A5) combined with an inherited mutation (COL4A3) triggered a more severe phenotype. A fifth family, predicted digenic on the basis of silico tools, rather showed monogenic X-linked inheritance due to a hypomorphic mutation, in accordance with a milder phenotype. In conclusion, this study highlights the impact of DI in ATS and explains the associated atypical presentations. More complex inheritance should be therefore considered when reviewing prognosis and recurrence risks. On the other side, these findings emphasize the importance to accompany NGS with splicing assays in order to avoid erroneous identification of at risk members. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Exome sequencing in Thai patients with familial obesity.

PubMed

Kaewsutthi, S; Santiprabhob, J; Phonrat, B; Tungtrongchitr, A; Lertrit, P; Tungtrongchitr, R

2016-07-14

Obesity is a major worldwide health issue, with increasing prevalence in adults and children from developed and developing countries. Obesity causes several chronic diseases, including cardiovascular and respiratory diseases, osteoarthritis, hypertension, stroke, type II diabetes, obstructive sleep apnea, and several types of cancer. Previous genome-wide association studies have identified several genes associated with obesity, including LEP, LEPR, POMC, PCSK1, FTO, MC3R, MC4R, GNPDA2, TMEM18, QPCTL/GIPR, BDNF, ETV5, MAP2K5/SKOR1, SEC16B, SIM1, and TNKS/MSRA. However, most of these variants are found in the intronic or intergenic regions, making it difficult to elucidate the underlying mechanisms. Therefore, in this study, we performed a whole exome sequencing of the protein-coding regions in the total genome (exome) of two obese and one normal subject belonging to the same Thai family to identify the genes responsible for obesity. We identified 709 functional variants that were differentially expressed between obese and normal subjects; of these, 65 were predicted to be deleterious to protein structure or function. The minor allele frequency of 14 of these genes (ALOX5AP, COL9A2, DEFB126, GDPD4, HCRTR1, MLL3, OPLAH, OR4C45, PRIM2, RXFP2, TIGD6, TRPM8, USP49, and ZNF596) was low, indicating causal variants that could be associated with complex traits or diseases. Genotyping revealed HCRTR1, COL9A2, and TRPM8 to be associated with the regulation of feeding behavior and energy expenditure. These genes constituted a network of pathways, including lipid metabolism, signaling transduction, immune, membrane transport, and gene regulation pathways, and seemed to play important roles in obesity.

Epigenomic and functional analyses reveal roles of epialleles in the loss of photoperiod sensitivity during domestication of allotetraploid cottons.

PubMed

Song, Qingxin; Zhang, Tianzhen; Stelly, David M; Chen, Z Jeffrey

2017-05-31

Polyploidy is a pervasive evolutionary feature of all flowering plants and some animals, leading to genetic and epigenetic changes that affect gene expression and morphology. DNA methylation changes can produce meiotically stable epialleles, which are transmissible through selection and breeding. However, the relationship between DNA methylation and polyploid plant domestication remains elusive. We report comprehensive epigenomic and functional analyses, including ~12 million differentially methylated cytosines in domesticated allotetraploid cottons and their tetraploid and diploid relatives. Methylated genes evolve faster than unmethylated genes; DNA methylation changes between homoeologous loci are associated with homoeolog-expression bias in the allotetraploids. Significantly, methylation changes induced in the interspecific hybrids are largely maintained in the allotetraploids. Among 519 differentially methylated genes identified between wild and cultivated cottons, some contribute to domestication traits, including flowering time and seed dormancy. CONSTANS (CO) and CO-LIKE (COL) genes regulate photoperiodicity in Arabidopsis. COL2 is an epiallele in allotetraploid cottons. COL2A is hypermethylated and silenced, while COL2D is repressed in wild cottons but highly expressed due to methylation loss in all domesticated cottons tested. Inhibiting DNA methylation activates COL2 expression, and repressing COL2 in cultivated cotton delays flowering. We uncover epigenomic signatures of domestication traits during cotton evolution. Demethylation of COL2 increases its expression, inducing photoperiodic flowering, which could have contributed to the suitability of cotton for cultivation worldwide. These resources should facilitate epigenetic engineering, breeding, and improvement of polyploid crops.

Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

PubMed Central

Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

2015-01-01

Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

Targeted deletion of RANKL in M cell inducer cells by the Col6a1-Cre driver.

PubMed

Nagashima, Kazuki; Sawa, Shinichiro; Nitta, Takeshi; Prados, Alejandro; Koliaraki, Vasiliki; Kollias, George; Nakashima, Tomoki; Takayanagi, Hiroshi

2017-11-04

The gut-associated lymphoid tissues (GALTs), including Peyer's patches (PPs), cryptopatches (CPs) and isolated lymphoid follicles (ILFs), establish a host-microbe symbiosis by the promotion of immune reactions against gut microbes. Microfold cell inducer (MCi) cells in GALTs are the recently identified mesenchymal cells that express the cytokine RANKL and initiate bacteria-specific immunoglobulin A (IgA) production via induction of microfold (M) cell differentiation. In the previous study, the Twist2-Cre driver was utilized for gene deletion in mesenchymal cells including MCi cells. In order to investigate MCi cells more extensively, it will be necessary to develop experimental tools in addition to the Twist2-Cre driver mice and characterize such drivers in specificity and efficiency. Here we show that M cell differentiation and IgA production are impaired in the targeted deletion of RANKL by the Col6a1-Cre driver. We compared Col6a1-Cre with Twist2-Cre in terms of the specificity for mesenchymal cells in GALTs. Col6a1-Cre CAG-CAT-EGFP mice exhibited EGFP expression in podoplanin + CD31 - cells including MCi cells, while Twist2-Cre mice were shown to target endothelial cells and podoplanin + CD31 - cells. Tnfsf11 fl/Δ Col6a1-Cre mice exhibited the absence of M cells and severe IgA reduction together with an alteration in gut microbial composition. Moreover, we analyzed germ free mice to test whether changes in the microbiota are the cause of M cell deficiency. M cell differentiation was normal in the CPs/ILFs of germ free mice, indicating that MCi cells induce M cells independently of microbial colonization. This study demonstrates that Col6a1-Cre driver mice are as useful as Twist2-Cre driver mice for functional analyses of GALT-resident mesenchymal cells, including MCi cells. Copyright © 2017 Elsevier Inc. All rights reserved.

DNA sequence of a ColV plasmid and prevalence of selected plasmid-encoded virulence genes among avian Escherichia coli strains.

PubMed

Johnson, Timothy J; Siek, Kylie E; Johnson, Sara J; Nolan, Lisa K

2006-01-01

ColV plasmids have long been associated with the virulence of Escherichia coli, despite the fact that their namesake trait, ColV production, does not appear to contribute to virulence. Such plasmids or their associated sequences appear to be quite common among avian pathogenic E. coli (APEC) and are strongly linked to the virulence of these organisms. In the present study, a 180-kb ColV plasmid was sequenced and analyzed. This plasmid, pAPEC-O2-ColV, possesses a 93-kb region containing several putative virulence traits, including iss, tsh, and four putative iron acquisition and transport systems. The iron acquisition and transport systems include those encoding aerobactin and salmochelin, the sit ABC iron transport system, and a putative iron transport system novel to APEC, eit. In order to determine the prevalence of the virulence-associated genes within this region among avian E. coli strains, 595 APEC and 199 avian commensal E. coli isolates were examined for genes of this region using PCR. Results indicate that genes contained within a portion of this putative virulence region are highly conserved among APEC and that the genes of this region occur significantly more often in APEC than in avian commensal E. coli. The region of pAPEC-O2-ColV containing genes that are highly prevalent among APEC appears to be a distinguishing trait of APEC strains.

DNA Sequence of a ColV Plasmid and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Escherichia coli Strains

PubMed Central

Johnson, Timothy J.; Siek, Kylie E.; Johnson, Sara J.; Nolan, Lisa K.

2006-01-01

ColV plasmids have long been associated with the virulence of Escherichia coli, despite the fact that their namesake trait, ColV production, does not appear to contribute to virulence. Such plasmids or their associated sequences appear to be quite common among avian pathogenic E. coli (APEC) and are strongly linked to the virulence of these organisms. In the present study, a 180-kb ColV plasmid was sequenced and analyzed. This plasmid, pAPEC-O2-ColV, possesses a 93-kb region containing several putative virulence traits, including iss, tsh, and four putative iron acquisition and transport systems. The iron acquisition and transport systems include those encoding aerobactin and salmochelin, the sit ABC iron transport system, and a putative iron transport system novel to APEC, eit. In order to determine the prevalence of the virulence-associated genes within this region among avian E. coli strains, 595 APEC and 199 avian commensal E. coli isolates were examined for genes of this region using PCR. Results indicate that genes contained within a portion of this putative virulence region are highly conserved among APEC and that the genes of this region occur significantly more often in APEC than in avian commensal E. coli. The region of pAPEC-O2-ColV containing genes that are highly prevalent among APEC appears to be a distinguishing trait of APEC strains. PMID:16385064

Six stroma-based RNA markers diagnostic for prostate cancer in European-Americans validated at the RNA and protein levels in patients in China

PubMed Central

Zhu, Jianguo; Pan, Cong; Jiang, Jun; Deng, Mingsen; Gao, Hengjun; Men, Bozhao; McClelland, Michael; Mercola, Dan; Zhong, Wei-De; Jia, Zhenyu

2015-01-01

We previously analyzed human prostate tissue containing stroma near to tumor and from cancer-negative tissues of volunteers. Over 100 candidate gene expression differences were identified and used to develop a classifier that could detect nearby tumor with an accuracy of 97% (sensitivity = 98% and specificity = 88%) based on 364 independent test cases from primarily European American cases. These stroma-based gene signatures have the potential to identify cancer patients among those with negative biopsies. In this study, we used prostate tissues from Chinese cases to validate six of these markers (CAV1, COL4A2, HSPB1, ITGB3, MAP1A and MCAM). In validation by real-time PCR, four genes (COL4A2, HSPB1, ITGB3, and MAP1A) demonstrated significantly lower expression in tumor-adjacent stroma compared to normal stroma (p value ≤ 0.05). Next, we tested whether these expression differences could be extended to the protein level. In IHC assays, all six selected proteins showed lower expression in tumor-adjacent stroma compared to the normal stroma, of which COL4A2, HSPB1 and ITGB3 showed significant differences (p value ≤ 0.05). These results suggest that biomarkers for diagnosing prostate cancer based on tumor microenvironment may be applicable across multiple racial groups. PMID:26158290

Three new genetic loci (R1210C in CFH, variants in COL8A1 and RAD51B) are independently related to progression to advanced macular degeneration.

PubMed

Seddon, Johanna M; Reynolds, Robyn; Yu, Yi; Rosner, Bernard

2014-01-01

To assess the independent impact of new genetic variants on conversion to advanced stages of AMD, controlling for established risk factors, and to determine the contribution of genes in predictive models. In this prospective longitudinal study of 2765 individuals, 777 subjects progressed to neovascular disease (NV) or geographic atrophy (GA) in either eye over 12 years. Recently reported genetic loci were assessed for their independent effects on incident advanced AMD after controlling for 6 established loci in 5 genes, and demographic, behavioral, and macular characteristics. New variants which remained significantly related to progression were then added to a final multivariate model to assess their independent effects. The contribution of genes to risk models was assessed using reclassification tables by determining risk within cross-classified quintiles for alternative models. THREE NEW GENETIC VARIANTS WERE SIGNIFICANTLY RELATED TO PROGRESSION: rare variant R1210C in CFH (hazard ratio (HR) 2.5, 95% confidence interval [CI] 1.2-5.3, P = 0.01), and common variants in genes COL8A1 (HR 2.0, 95% CI 1.1-3.5, P = 0.02) and RAD51B (HR 0.8, 95% CI 0.60-0.97, P = 0.03). The area under the curve statistic (AUC) was significantly higher for the 9 gene model (.884) vs the 0 gene model (.873), P = .01. AUC's for the 9 vs 6 gene models were not significantly different, but reclassification analyses indicated significant added information for more genes, with adjusted odds ratios (OR) for progression within 5 years per one quintile increase in risk score of 2.7, P<0.001 for the 9 vs 6 loci model, and OR 3.5, P<0.001 for the 9 vs. 0 gene model. Similar results were seen for NV and GA. Rare variant CFH R1210C and common variants in COL8A1 and RAD51B plus six genes in previous models contribute additional predictive information for advanced AMD beyond macular and behavioral phenotypes.

Three New Genetic Loci (R1210C in CFH, Variants in COL8A1 and RAD51B) Are Independently Related to Progression to Advanced Macular Degeneration

PubMed Central

Seddon, Johanna M.; Reynolds, Robyn; Yu, Yi; Rosner, Bernard

2014-01-01

Objectives To assess the independent impact of new genetic variants on conversion to advanced stages of AMD, controlling for established risk factors, and to determine the contribution of genes in predictive models. Methods In this prospective longitudinal study of 2765 individuals, 777 subjects progressed to neovascular disease (NV) or geographic atrophy (GA) in either eye over 12 years. Recently reported genetic loci were assessed for their independent effects on incident advanced AMD after controlling for 6 established loci in 5 genes, and demographic, behavioral, and macular characteristics. New variants which remained significantly related to progression were then added to a final multivariate model to assess their independent effects. The contribution of genes to risk models was assessed using reclassification tables by determining risk within cross-classified quintiles for alternative models. Results Three new genetic variants were significantly related to progression: rare variant R1210C in CFH (hazard ratio (HR) 2.5, 95% confidence interval [CI] 1.2–5.3, P = 0.01), and common variants in genes COL8A1 (HR 2.0, 95% CI 1.1–3.5, P = 0.02) and RAD51B (HR 0.8, 95% CI 0.60–0.97, P = 0.03). The area under the curve statistic (AUC) was significantly higher for the 9 gene model (.884) vs the 0 gene model (.873), P = .01. AUC’s for the 9 vs 6 gene models were not significantly different, but reclassification analyses indicated significant added information for more genes, with adjusted odds ratios (OR) for progression within 5 years per one quintile increase in risk score of 2.7, P<0.001 for the 9 vs 6 loci model, and OR 3.5, P<0.001 for the 9 vs. 0 gene model. Similar results were seen for NV and GA. Conclusions Rare variant CFH R1210C and common variants in COL8A1 and RAD51B plus six genes in previous models contribute additional predictive information for advanced AMD beyond macular and behavioral phenotypes. PMID:24498017

Induction of type 1 iodothyronine deiodinase expression inhibits proliferation and migration of renal cancer cells.

PubMed

Poplawski, Piotr; Rybicka, Beata; Boguslawska, Joanna; Rodzik, Katarzyna; Visser, Theo J; Nauman, Alicja; Piekielko-Witkowska, Agnieszka

2017-02-15

Type 1 iodothyronine deiodinase (DIO1) regulates peripheral metabolism of thyroid hormones that control cellular proliferation, differentiation and metabolism. The significance of DIO1 in cancer is unknown. In this study we hypothesized that diminished expression of DIO1, observed in renal cancer, contributes to the carcinogenic process in the kidney. Here, we demonstrate that ectopic expression of DIO1 in renal cancer cells changes the expression of genes controlling cell cycle, including cyclin E1 and E2F5, and results in inhibition of proliferation. The expression of genes encoding collagens (COL1A1, COL4A2, COL5A1), integrins (ITGA4, ITGA5, ITGB3) and transforming growth factor-β-induced (TGFBI) is significantly altered in renal cancer cells with induced expression of DIO1. Finally, we show that overexpression of DIO1 inhibits migration of renal cancer cells. In conclusion, we demonstrate for the first time that loss of DIO1 contributes to renal carcinogenesis and that its induced expression protects cells against cancerous proliferation and migration. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

A new mutation in the COL4A3 gene responsible for autosomal dominant Alport syndrome, which only generates hearing loss in some carriers.

PubMed

Rosado, Consolación; Bueno, Elena; Fraile, Pilar; García-Cosmes, Pedro; González-Sarmiento, Rogelio

2015-01-01

Bilateral sensorineural hearing loss is a characteristic feature of Alport syndrome, which is always linked to renal manifestations so they have a parallel evolution and prognosis, and deafness helps to identify the renal disease. We report a family that suffers an autosomal dominant Alport syndrome caused by a previously undescribed mutation in the COL4A3 gene, in which several members have hearing impairment as the only clinical manifestation, suggesting that in this family deafness can occur independent of renal disease. This mutation is also present in a patient with anterior lenticonus, an observation only found in families with recessive and sex-linked Alport disease. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

The ColRS signal transduction system responds to the excess of external zinc, iron, manganese, and cadmium

PubMed Central

2014-01-01

Background The ColRS two-component system has been shown to contribute to the membrane functionality and stress tolerance of Pseudomonas putida as well as to the virulence of Pseudomonas aeruginosa and plant pathogenic Xanthomonas species. However, the conditions activating the ColRS pathway and the signal(s) sensed by ColS have remained unknown. Here we aimed to analyze the role of the ColRS system in metal tolerance of P. putida and to test whether ColS can respond to metal excess. Results We show that the ColRS system is necessary for P. putida to tolerate the excess of iron and zinc, and that it also contributes to manganese and cadmium tolerance. Excess of iron, zinc, manganese or cadmium activates ColRS signaling and as a result modifies the expression of ColR-regulated genes. Our data suggest that the genes in the ColR regulon are functionally redundant, as several loci have to be deleted to observe a significant decrease in metal tolerance. Site-directed mutagenesis of ColS revealed that excess of iron and, surprisingly, also zinc are sensed by a conserved ExxE motif in ColS’s periplasmic domain. While ColS is able to sense different metals, it still discriminates between the two oxidation states of iron, specifically responding to ferric and not ferrous iron. We propose a signal perception model involving a dimeric ColS, where each monomer donates one ExxE motif for metal binding. Conclusions Several transition metals are essential for living organisms in certain amounts, but toxic in excess. We show that ColRS is a sensor system which detects and responds to the excess of physiologically important metals such as zinc, iron and manganese. Thus, the ColRS system is an important factor for metal homeostasis and tolerance in P. putida. PMID:24946800

In vivo gene expression and immunoreactivity of Leptospira collagenase.

PubMed

Janwitthayanan, Weena; Keelawat, Somboon; Payungporn, Sunchai; Lowanitchapat, Alisa; Suwancharoen, Duangjai; Poovorawan, Yong; Chirathaworn, Chintana

2013-06-12

Pulmonary hemorrhage is an increasing cause of death of leptospirosis patients. Bacterial collagenase has been shown to be involved in lung hemorrhage induced by various infectious agents. According to Leptospira whole genome study, colA, a gene suggested to code for bacterial collagenase has been identified. We investigated colA gene expression in lung tissues of Leptospira infected hamsters. Golden Syrian Hamsters were injected intraperitoneally with Leptospira interrogans serovar Pyrogenes. The hamsters were sacrificed on days 3, 5 and 7 post-infection and lung tissues were collected for histological examination and RNA extraction. Lung pathologies including atelectasis and hemorrhage were observed. Expression of colA gene in lung tissues was demonstrated by both RT-PCR and real time PCR. In addition, ColA protein was cloned and the purified protein could react with sera from leptospirosis patients. Leptospira ColA protein may play a role in Leptospira survival or pathogenesis in vivo. Its reaction with leptospirosis sera suggests that this protein is immunogenic and could be another candidate for vaccine development. Copyright © 2012 Elsevier GmbH. All rights reserved.

Distinct colicin M-like bacteriocin-immunity pairs in Burkholderia.

PubMed

Ghequire, Maarten G K; De Mot, René

2015-11-27

The Escherichia coli bacteriocin colicin M (ColM) acts via degradation of the cell wall precursor lipid II in target cells. ColM producers avoid self-inhibition by a periplasmic immunity protein anchored in the inner membrane. In this study, we identified colM-like bacteriocin genes in genomes of several β-proteobacterial strains belonging to the Burkholderia cepacia complex (Bcc) and the Burkholderia pseudomallei group. Two selected Burkholderia ambifaria proteins, designated burkhocins M1 and M2, were produced recombinantly and showed antagonistic activity against Bcc strains. In their considerably sequence-diverged catalytic domain, a conserved aspartate residue equally proved pivotal for cytotoxicity. Immunity to M-type burkhocins is conferred upon susceptible strains by heterologous expression of a cognate gene located either upstream or downstream of the toxin gene. These genes lack homology with currently known ColM immunity genes and encode inner membrane-associated proteins of two distinct types, differing in predicted transmembrane topology and moiety exposed to the periplasm. The addition of burkhocins to the bacteriocin complement of Burkholderia reveals a wider phylogenetic distribution of ColM-like bacteriotoxins, beyond the γ-proteobacterial genera Escherichia, Pectobacterium and Pseudomonas, and illuminates the diversified nature of immunity-providing proteins.

C-peptide prevents SMAD3 binding to alpha promoters to inhibit collagen type IV synthesis.

PubMed

Li, Yanning; Zhong, Yan; Gong, Wenjian; Gao, Xuehan; Qi, Huanli; Liu, Kun; Qi, Jinsheng

2018-07-01

Activation of transforming growth factor β1 (TGFB1)/SMAD3 signaling may lead to additional synthesis of collagen type IV (COL4), which is a major contributor to extracellular matrix (ECM) accumulation in diabetic nephropathy (DN). C-peptide can attenuate fibrosis to have unique beneficial effects in DN. However, whether and how C-peptide affects TGFB1/SMAD3-activated COL4 synthesis is unclear. In this study, pathological changes, expression of COL4 a1-a5 chains ( Col4a1-a5 ), COL4 distribution and protein and TGFB1 and SMAD3 protein were first assessed in a rat model of diabetes. Then, rat mesangial cells were treated with high glucose (HG) and/or C-peptide to investigate the underlying mechanism. Col4a1-a5 expression, COL4 protein and secretion, TGFB1 protein, SMAD3 nuclear translocation and binding of SMAD3 to its cognate sites in the promoters of Col4a1a2 , Col4a3a4 and Col4a5 were measured. It was found that C-peptide attenuated glomerular pathological changes and suppressed renal Col4a1 -a5 mRNA expression, COL4 protein content and TGFB1 protein content. C-peptide had a dose-dependent effect to inhibit Col4a1-a5 mRNA expression, COL4 protein content and secretion, in HG-stimulated mesangial cells. In addition, the HG-induced increase in TGFB1 protein content was significantly reduced by C-peptide. Although not apparently affecting SMAD3 nuclear translocation, C-peptide prevented SMAD3 from binding to its sites in the Col4a1a2 , Col4a3a4 and Col4a5 promoters in HG-stimulated mesangial cells. In conclusion, C-peptide could prevent SMAD3 from binding to its sites in the Col4a1a2 , Col4a3a4 and Col4a5 promoters, to inhibit COL4 generation. These results may provide a mechanism for the alleviation of fibrosis in DN by C-peptide. © 2018 Society for Endocrinology.

Cobalt(II) complexes with bis(N-imidazolyl/benzimidazolyl) pyridazine: Structures, photoluminescent and photocatalytic properties

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jin-Ping; Fan, Jian-Zhong; Wang, Duo-Zhi, E-mail: wangdz@xju.edu.cn

2016-07-15

Six new Co{sup II} complexes [Co(L{sup 1}){sub 4}(OH){sub 2}] (1), {[Co(L"1)(H_2O)_4]·2ClO_4}{sub ∞} (2), {[Co(L"1)(H_2O)_4]·SiF_6}{sub ∞} (3), {[Co(L"1)_3]·2ClO_4}{sub ∞} (4), [Co(L{sup 2})Cl{sub 2}]{sub ∞} (5) and {[Co(L"2)_2]·SiF_6}{sub ∞} (6) [L{sup 1}=3,6-bis(N-imidazolyl) pyridazine, L{sup 2}=3,6-bis (N-benzimidazolyl) pyridazine] have been synthesized and characterized by elemental analysis, IR spectra and single crystal X-ray diffraction. Complex 1 has a mononuclear structure, while complexes 2 and 3 have 1-D chain structures. Considering the Co{sup II} centers were linked by the L{sup 1} ligands, the 3-D framework of complex 4 can be rationalized to be a {4^12.6^3} 6-c topological net with the stoichiometry uninodal net. 5 revealsmore » a coordination 1-D zigzag chain structure consisting of a neutral chain [Co(L{sup 2})Cl{sub 2}]{sub n} with the Co{sup II} centers. Complex 6 has a rhombohedral grid with a (4, 4) topology. The TGA property, fluorescent property and photocatalytic activity of complexes 1–6 have been investigated and discussed. - Graphical abstract: Six Co{sup II} complexes of bis(N-imidazolyl/benzimidazolyl)pyridazine were synthesized and structurally characterized. The fluorescence properties and photocatalytic activity for dye degradation under UV light of all complexes have been investigated and discussed. Display Omitted - Highlights: • Six new Co{sup II} complexes with bis(N-imidazolyl/benzimidazolyl) pyridazine. • Structural analysis of all complexes. • Fluorescent property of all complexes. • Photocatalytic activity for dye degradation under UV light of all complexes.« less

Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

PubMed Central

Cosgrove, Dominic; Liu, Shiguang

2016-01-01

Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

Amplified 7q21-22 gene MCM7 and its intronic miR-25 suppress COL1A2 associated genes to sustain intestinal gastric cancer features.

PubMed

Tamilzhalagan, Sembulingam; Rathinam, Dhanasekaran; Ganesan, Kumaresan

2017-06-01

Frequent amplification of 7q21-22 genomic region is known in gastric cancer. Multiple genes including SHFM1, MCM7, and COL1A2 were reported to be the potential cancer candidate genes of this 20 Mb amplicon. This amplicon has two polycistrionic miRNA clusters and in the present study, miR-106b-25 cluster located in intron-13 of MCM7 was identified to express in gastric tumors. Among the 7q21-22 candidate genes, SHFM1 and MCM7 are expressed in intestinal type gastric tumors, whereas COL1A2 is expressed in diffuse type gastric tumors. Across gastric tumors, miR-25 was identified to co-express with MCM7 and SHFM1. On the other hand, negative correlation was observed between miR-25 and COL1A2 expression. miR-25 originating from MCM7 was found capable of selectively targeting the adjacent gene COL1A2. Silencing of miR-25 was found capable of elevating the expression of COL1A2 and inhibiting E-cadherin expression, revealing the diffuse type gastric cancer suppressive role conferred by miR-25. miR-25 was also found to suppress p53, and activate c-Src revealing its intestinal type gastric cancer associated oncogenic functions. Genome-wide expression profiling upon miR-25 silencing reveals that miR-25 is capable of suppressing 40 genes which are co-expressed with COL1A2, involved in epithelial to mesenchymal transition and angiogenesis which are the typical diffuse type gastric cancer features. The results clearly demonstrate 7q21-22 amplification, MCM7, and its intronic miR-25 are the major molecular switches involved in the complex oncogenic circuits of gastric cancer. © 2017 Wiley Periodicals, Inc.

cea-kil operon of the ColE1 plasmid.

PubMed Central

Sabik, J F; Suit, J L; Luria, S E

1983-01-01

We isolated a series of Tn5 transposon insertion mutants and chemically induced mutants with mutations in the region of the ColE1 plasmid that includes the cea (colicin) and imm (immunity) genes. Bacterial cells harboring each of the mutant plasmids were tested for their response to the colicin-inducing agent mitomycin C. All insertion mutations within the cea gene failed to bring about cell killing after mitomycin C treatment. A cea- amber mutation exerted a polar effect on killing by mitomycin C. Two insertions beyond the cea gene but within or near the imm gene also prevented the lethal response to mitomycin C. These findings suggest the presence in the ColE1 plasmid of an operon containing the cea and kil genes whose product is needed for mitomycin C-induced lethality. Bacteria carrying ColE1 plasmids with Tn5 inserted within the cea gene produced serologically cross-reacting fragments of the colicin E1 molecule, the lengths of which were proportional to the distance between the insertion and the promoter end of the cea gene. Images PMID:6298187

A de novo interstitial 6q deletion in a boy with a split hand malformation.

PubMed

Duran-Gonzalez, Jorge; Gutierrez-Angulo, Melva; Garcia-Cruz, Diana; Ayala, Maria de la Luz; Padilla, Miguel; Davalos, Ingrid P

2007-01-01

We report on a de novo interstitial deletion of (6)(q15q22.2) in a 5-year-old boy with developmental delay, microcephaly, facial dysmorphism, cryptorchidism, congenital heart defect, and split-hand malformation. Previous reports and this patient suggest that 6q21 may contain a gene or genes related either directly or indirectly to limb development.

Next generation sequencing as a useful tool in the diagnostics of mosaicism in Alport syndrome.

PubMed

Beicht, Sonja; Strobl-Wildemann, Gertrud; Rath, Sabine; Wachter, Oliver; Alberer, Martin; Kaminsky, Elke; Weber, Lutz T; Hinrichsen, Tanja; Klein, Hanns-Georg; Hoefele, Julia

2013-09-10

Alport syndrome (ATS) is a progressive hereditary nephropathy characterized by hematuria and/or proteinuria with structural defects of the glomerular basement membrane. It can be associated with extrarenal manifestations (high-tone sensorineural hearing loss and ocular abnormalities). Somatic mutations in COL4A5 (X-linked), COL4A3 and COL4A4 genes (both autosomal recessive and autosomal dominant) cause Alport syndrome. Somatic mosaicism in Alport patients is very rare. The reason for this may be due to the difficulty of detection. We report the case of a boy and his mother who presented with Alport syndrome. Mutational analysis showed the novel hemizygote pathogenic mutation c.2396-1G>A (IVS29-1G>A) at the splice acceptor site of the intron 29 exon 30 boundary of the COL4A5 gene in the boy. The mutation in the mother would not have been detected by Sanger sequencing without the knowledge of the mutational analysis result of her son. Further investigation of the mother using next generation sequencing showed somatic mosaicism and implied potential germ cell mosaicism. The mutation in the mother has most likely occurred during early embryogenesis. Analysis of tissue of different embryonic origin in the mother confirmed mosaicism in both mesoderm and ectoderm. Low grade mosaicism is very difficult to detect by Sanger sequencing. Next generation sequencing is increasingly used in the diagnostics and might improve the detection of mosaicism. In the case of definite clinical symptoms of ATS and missing detection of a mutation by Sanger sequencing, mutational analysis should be performed by next generation sequencing. Copyright © 2013 Elsevier B.V. All rights reserved.

Matrilin-3 induction of IL-1 receptor antagonist is required for up-regulating collagen II and aggrecan and down-regulating ADAMTS-5 gene expression.

PubMed

Jayasuriya, Chathuraka T; Goldring, Mary B; Terek, Richard; Chen, Qian

2012-09-11

Deletion or mutation of the gene encoding the cartilage extracellular matrix (ECM) protein matrilin-3 (MATN3) results in the early onset of osteoarthritis (OA), suggesting chondroprotective properties of MATN3. To understand the mechanisms underlying these properties, we determined the effects of MATN3 protein on the expression of several key anabolic and catabolic genes involved in chondrocyte homeostasis, and the dependence of such regulation on the anti-inflammatory cytokine: IL-1 receptor antagonist (IL-1Ra). The effects of recombinant human (rh) MATN3 protein were examined in C28/I2 immortalized human chondrocytes, primary human chondrocytes (PHCs), and primary mouse chondrocytes (PMCs). Messenger RNA levels of IL-1Ra, COL2A1, ACAN, MMP-13, and ADAMTS-4 and -5 were determined using real-time RT-PCR. Knocking down IL-1Ra was achieved by siRNA gene silencing. IL-1Ra protein levels were quantified by ELISA and the Bio-Plex Suspension Array System. COL2A1 protein level was quantified using Western blot analysis. Statistic analysis was done using the two-tailed t-test or one-way ANOVA. rhMATN3 protein induced gene expression of IL-1Ra in C28/I2 cells, PHCs, and PMCs in a dose- and time-dependent manner. Treatment of C28/I2 cells and PHCs with MATN3 protein stimulated gene expression of COL2A1 and ACAN. Conversely, mRNA levels of COL2A1 and ACAN were decreased in MATN3 KO mice. MATN3 protein treatment inhibited IL-1β-induced MMP-13, ADAMTS-4 and ADAMTS-5 in C28/I2 cells and PHCs. Knocking down IL-1Ra abolished the MATN3-mediated stimulation of COL2A1 and ACAN and inhibition of ADAMTS-5, but had no effect on MATN3 inhibition of MMP-13 mRNA. Our findings point to a novel regulatory role of MATN3 in cartilage homeostasis due to its capacity to induce IL-1Ra, to upregulate gene expression of the major cartilage matrix components, and to downregulate the expression of OA-associated matrix-degrading proteinases in chondrocytes. The chondroprotective properties of endogenous MATN3 depend partly on its induction of IL-1Ra. Our findings raise a possibility to use rhMATN3 protein for anti-inflammatory and chondroprotective therapy.

Multiplex transcriptional analysis of paraffin-embedded liver needle biopsy from patients with liver fibrosis

PubMed Central

2012-01-01

Background The possibility of extracting RNA and measuring RNA expression from paraffin sections can allow extensive investigations on stored paraffin samples obtained from diseased livers and could help with studies of the natural history of liver fibrosis and inflammation, and in particular, correlate basic mechanisms to clinical outcomes. Results To address this issue, a pilot study of multiplex gene expression using branched-chain DNA technology was conducted to directly measure mRNA expression in formalin-fixed paraffin-embedded needle biopsy samples of human liver. Twenty-five genes were selected for evaluation based on evidence obtained from human fibrotic liver, a rat BDL model and in vitro cultures of immortalized human hepatic stellate cells. The expression levels of these 25 genes were then correlated with liver fibrosis and inflammation activity scores. Statistical analysis revealed that three genes (COL3A1, KRT18, and TUBB) could separate fibrotic from non-fibrotic samples and that the expression of ten genes (ANXA2, TIMP1, CTGF, COL4A1, KRT18, COL1A1, COL3A1, ACTA2, TGFB1, LOXL2) were positively correlated with the level of liver inflammation activity. Conclusion This is the first report describing this multiplex technique for liver fibrosis and has provided the proof of concept of the suitability of RNA extracted from paraffin sections for investigating the modulation of a panel of proinflammatory and profibrogenic genes. This pilot study suggests that this technique will allow extensive investigations on paraffin samples from diseased livers and possibly from any other tissue. Using identical or other genes, this multiplex expression technique could be applied to samples obtained from extensive patient cohorts with stored paraffin samples in order to correlate gene expression with valuable clinically relevant information. This method could be used to provide a better understanding of the mechanisms of liver fibrosis and inflammation, its progression, and help development of new therapeutic approaches for this indication. PMID:23270325

Site-specific genome editing for correction of induced pluripotent stem cells derived from dominant dystrophic epidermolysis bullosa.

PubMed

Shinkuma, Satoru; Guo, Zongyou; Christiano, Angela M

2016-05-17

Genome editing with engineered site-specific endonucleases involves nonhomologous end-joining, leading to reading frame disruption. The approach is applicable to dominant negative disorders, which can be treated simply by knocking out the mutant allele, while leaving the normal allele intact. We applied this strategy to dominant dystrophic epidermolysis bullosa (DDEB), which is caused by a dominant negative mutation in the COL7A1 gene encoding type VII collagen (COL7). We performed genome editing with TALENs and CRISPR/Cas9 targeting the mutation, c.8068_8084delinsGA. We then cotransfected Cas9 and guide RNA expression vectors expressed with GFP and DsRed, respectively, into induced pluripotent stem cells (iPSCs) generated from DDEB fibroblasts. After sorting, 90% of the iPSCs were edited, and we selected four gene-edited iPSC lines for further study. These iPSCs were differentiated into keratinocytes and fibroblasts secreting COL7. RT-PCR and Western blot analyses revealed gene-edited COL7 with frameshift mutations degraded at the protein level. In addition, we confirmed that the gene-edited truncated COL7 could neither associate with normal COL7 nor undergo triple helix formation. Our data establish the feasibility of mutation site-specific genome editing in dominant negative disorders.

ATF4, A Novel Mediator of the Anabolic Actions of PTH on Bone

DTIC Science & Technology

2010-07-01

increased the expression of genes known to be associated with osteoblast differentiation including osteocalcin (Ocn), bone sialoprotein (Bsp...differentiation including osteocalcin (Ocn) (2.2-fold), bone sialoprotein (Bsp) (4.2-fold), alkaline phosphatase (Alp) (3.2-fold), a1(I) collagen (Col1... sialoprotein (BSP) gene transcription is mediated through a pituitary-specific transcription factor-1 (Pit-1) motif in the rat BSP gene promoter. Matrix Biol

An apple B-box protein, MdCOL11, is involved in UV-B- and temperature-induced anthocyanin biosynthesis.

PubMed

Bai, Songling; Saito, Takanori; Honda, Chikako; Hatsuyama, Yoshimichi; Ito, Akiko; Moriguchi, Takaya

2014-11-01

Our studies showed that an apple B-box protein, MdCOL11, the homolog of AtBBX22, is involved in UV-B- and temperature-induced anthocyanin biosynthesis in apple peel. Anthocyanin is responsible for the red pigmentation in apple peel and a R2R3 MYB gene, MdMYBA/1/10, a homolog of MdMYBA, controls its accumulation. Arabidopsis PAP1 is under the control of a series of upstream factors involved in light signal transduction and photomorphogenesis, such as ELONGATED HYPOCOTYL 5 (HY5) and B-box family (BBX) proteins. In this study, we identified and characterized the homolog of Arabidopsis BBX22 in apple, designated as MdCOL11. Overexpression of MdCOL11 in Arabidopsis enhanced the accumulation of anthocyanin. In apples, MdCOL11 was differentially expressed in all tissues, with the highest expression in petals and the lowest expression in the xylem. Transcripts of MdCOL11 noticeably accumulated at the ripening stage, concomitant with increases in the expressions of anthocyanin biosynthesis-related genes. In an in vitro treatment experiment, MdCOL11 was upregulated in an ultra-violet (UV)-B- and temperature-dependent manner, together with the inductions of anthocyanin biosynthesis-related genes and anthocyanin accumulation in apple peel. Furthermore, a dual-luciferase assay indicated that (1) MdCOL11 regulated the expression of MdMYBA and (2) MdCOL11 was a target of MdHY5. Taken together, our results suggest that MdCOL11 is involved in MdHY5-mediated signal transduction and regulates anthocyanin accumulation in apple peel, which sheds new light on anthocyanin accumulation in apples.

Use of an activated beta-catenin to identify Wnt pathway target genes in caenorhabditis elegans, including a subset of collagen genes expressed in late larval development.

PubMed

Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M

2014-04-16

The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.

COL4A3/COL4A4 mutations and features in individuals with autosomal recessive Alport syndrome.

PubMed

Storey, Helen; Savige, Judy; Sivakumar, Vanessa; Abbs, Stephen; Flinter, Frances A

2013-12-01

Alport syndrome is an inherited disease characterized by hematuria, progressive renal failure, hearing loss, and ocular abnormalities. Autosomal recessive Alport syndrome is suspected in consanguineous families and when female patients develop renal failure. Fifteen percent of patients with Alport syndrome have autosomal recessive inheritance caused by two pathogenic mutations in either COL4A3 or COL4A4. Here, we describe the mutations and clinical features in 40 individuals including 9 children and 21 female individuals (53%) with autosomal recessive inheritance indicated by the detection of two mutations. The median age was 31 years (range, 6-54 years). The median age at end stage renal failure was 22.5 years (range, 10-38 years), but renal function was normal in nine adults (29%). Hearing loss and ocular abnormalities were common (23 of 35 patients [66%] and 10 of 18 patients [56%], respectively). Twenty mutation pairs (50%) affected COL4A3 and 20 pairs affected COL4A4. Of the 68 variants identified, 39 were novel, 12 were homozygous changes, and 9 were present in multiple individuals, including c.2906C>G (p.(Ser969*)) in COL4A4, which was found in 23% of the patients. Thirty-six variants (53%) resulted directly or indirectly in a stop codon, and all 17 individuals with early onset renal failure had at least one such mutation, whereas these mutations were less common in patients with normal renal function or late-onset renal failure. In conclusion, patient phenotypes may vary depending on the underlying mutations, and genetic testing should be considered for the routine diagnosis of autosomal recessive Alport syndrome.

COL4A3/COL4A4 Mutations and Features in Individuals with Autosomal Recessive Alport Syndrome

PubMed Central

Savige, Judy; Sivakumar, Vanessa; Abbs, Stephen; Flinter, Frances A.

2013-01-01

Alport syndrome is an inherited disease characterized by hematuria, progressive renal failure, hearing loss, and ocular abnormalities. Autosomal recessive Alport syndrome is suspected in consanguineous families and when female patients develop renal failure. Fifteen percent of patients with Alport syndrome have autosomal recessive inheritance caused by two pathogenic mutations in either COL4A3 or COL4A4. Here, we describe the mutations and clinical features in 40 individuals including 9 children and 21 female individuals (53%) with autosomal recessive inheritance indicated by the detection of two mutations. The median age was 31 years (range, 6–54 years). The median age at end stage renal failure was 22.5 years (range, 10–38 years), but renal function was normal in nine adults (29%). Hearing loss and ocular abnormalities were common (23 of 35 patients [66%] and 10 of 18 patients [56%], respectively). Twenty mutation pairs (50%) affected COL4A3 and 20 pairs affected COL4A4. Of the 68 variants identified, 39 were novel, 12 were homozygous changes, and 9 were present in multiple individuals, including c.2906C>G (p.(Ser969*)) in COL4A4, which was found in 23% of the patients. Thirty-six variants (53%) resulted directly or indirectly in a stop codon, and all 17 individuals with early onset renal failure had at least one such mutation, whereas these mutations were less common in patients with normal renal function or late-onset renal failure. In conclusion, patient phenotypes may vary depending on the underlying mutations, and genetic testing should be considered for the routine diagnosis of autosomal recessive Alport syndrome. PMID:24052634

Fli1 Represses Transcription of the Human α2(I) Collagen Gene by Recruitment of the HDAC1/p300 Complex

PubMed Central

Asano, Yoshihide; Trojanowska, Maria

2013-01-01

Fli1, a member of the Ets transcription factor family, is a key repressor of the human α2(I) collagen (COL1A2) gene. Although our previous studies have delineated that TGF-β induces displacement of Fli1 from the COL1A2 promoter through sequential post-translational modifications, the detailed mechanism by which Fli1 functions as a potent transcriptional repressor of the COL1A2 gene has not been fully investigated. To address this issue, we carried out a series of experiments especially focusing on protein-protein interaction and epigenetic transcriptional regulation. The combination of tandem affinity purification and mass spectrometry identified HDAC1 as a Fli1 interacting protein. Under quiescent conditions, HDAC1 induced deacetylation of Fli1 resulting in an increase of Fli1 DNA binding ability and p300 enhanced this process by promoting the formation of a Fli1-HDAC1-p300 complex. TGF-β-induced phosphorylation of Fli1 at threonine 312 led to disassembly of this protein complex. In quiescent dermal fibroblasts Fli1, HDAC1, and p300 occupied the −404 to −237 region, including the Fli1 binding site, of the COL1A2 promoter. TGF-β induced Fli1 and HDAC1 dissociation from the COL1A2 promoter, while promoting Ets1 and p300 recruitment. Furthermore, acetylation levels of histone H3 around the Fli1 binding site in the COL1A2 promoter inversely correlated with the DNA occupancy of Fli1 and HDAC1, while positively correlating with that of Ets1 and p300. In the functional studies, HDAC1 overexpression magnified the inhibitory effect of Fli1 on the COL1A2 promoter. Moreover, pharmacological blockade of HDAC1 by entinostat enhanced collagen production in dermal fibroblasts. Collectively, these results indicate that under quiescent conditions Fli1 recruits HDAC1/p300 to the COL1A2 promoter and suppresses the expression of the COL1A2 gene by chromatin remodeling through histone deacetylation. TGF-β-dependent phosphorylation of Fli1 at threonine 312 is a critical step regulating the remodeling of the Fli1 transcription repressor complex, leading to transcriptional activation of the COL1A2 gene. PMID:24058639

The relationships among spatiotemporal collagen gene expression, histology, and biomechanics following full-length injury in the murine patellar tendon.

PubMed

Dyment, Nathaniel A; Kazemi, Namdar; Aschbacher-Smith, Lindsey E; Barthelery, Nicolas J; Kenter, Keith; Gooch, Cynthia; Shearn, Jason T; Wylie, Christopher; Butler, David L

2012-01-01

Tendon injuries are major orthopedic problems that worsen as the population ages. Type-I (Col1) and type-II (Col2) collagens play important roles in tendon midsubstance and tendon-to-bone insertion healing, respectively. Using double transgenic mice, this study aims to spatiotemporally monitor Col1 and Col2 gene expression, histology, and biomechanics up to 8 weeks following a full-length patellar tendon injury. Gene expression and histology were analyzed weekly for up to 5 weeks while mechanical properties were measured at 1, 2, 5, and 8 weeks. At week 1, the healing region displayed loose granulation tissue with little Col1 expression. Col1 expression peaked at 2 weeks, but the ECM was highly disorganized and hypercellular. By 3 weeks, Col1 expression had reduced and by 5 weeks, the ECM was generally aligned along the tendon axis. Col2 expression was not seen in the healing midsubstance or insertion at any time point. The biomechanics of the healing tissue was inadequate at all time points, achieving ultimate loads and stiffnesses of 48% and 63% of normal values by 8 weeks. Future studies will further characterize the cells within the healing midsubstance and insertion using tenogenic markers and compare these results to those of tendon cells during normal development. Copyright © 2011 Orthopaedic Research Society.

Collagen type III alpha I is a gastro-oesophageal reflux disease susceptibility gene and a male risk factor for hiatus hernia.

PubMed

Asling, B; Jirholt, J; Hammond, P; Knutsson, M; Walentinsson, A; Davidson, G; Agreus, L; Lehmann, A; Lagerström-Fermer, M

2009-08-01

Gastro-oesophageal reflux disease (GORD) is a common gastrointestinal disorder with a genetic component. Our aim was to identify genetic factors associated with GORD. Four separate patient cohorts were analysed using a step-wise approach. (1) Whole genome linkage analysis was performed in 36 families. (2) Candidate genes were tested for GORD association in a trio cohort. (3) Genetic association was replicated in a case-control cohort. We also investigated genetic association to hiatus hernia (HH). (4) Protein expression was analysed in oesophageal biopsies. A region on chromosome 2, containing collagen type III alpha 1 (COL3A1), was identified (LOD = 3.3) in families with dominant transmission of GORD, stratified for hiatus hernia (HH). COL3A1 showed significant association with GORD in an independent paediatric trio cohort (p(corr) = 0.003). The association was male specific (p(corr) = 0.018). The COL3A1 association was replicated in an independent adult case control cohort (p(corr) = 0.022). Moreover, male specific association to HH (p(corr) = 0.019) was found for a SNP not associated to GORD. Collagen type III protein was more abundant in oesophageal biopsies from male patients with GORD (p = 0.03). COL3A1 is a disease-associated gene in both paediatric and adult GORD. Furthermore, we show that COL3A1 is genetically associated with HH in adult males. The GORD- and HH-associated alleles are different, indicating two separate mechanisms leading to disease. Our data provides new insight into GORD aetiology, identifying a connective tissue component and indicating a tissue remodelling mechanism in GORD. Our results implicate gender differences in the genetic risk for both for GORD and HH.

COL1A1 promotes metastasis in colorectal cancer by regulating the WNT/PCP pathway

PubMed Central

Zhang, Zheying; Wang, Yongxia; Zhang, Jinghang; Zhong, Jiateng; Yang, Rui

2018-01-01

Colorectal cancer (CRC) is the third leading cause of cancer-associated mortality, and is a major health problem. Collagen type I α 1 (COL1A1) is a major component of collagen type I. Recently, it was reported to be overexpressed in a variety of tumor tissues and cells. However, the function of COL1A1 in CRC remains unclear. Herein, the present study demonstrated that COL1A1 was upregulated in CRC tissues and the paired lymph node tissues. Transwell assays showed that COL1A1 promoted CRC cell migration in vitro. Moreover, it was revealed that COL1A1 levels were correlated with those of WNT/planar cell polarity (PCP) signaling pathway genes; inhibition of COL1A1 decreased the expression levels of Ras-related C3 botulinum toxin substrate 1-GTP, phosphorylated-c-Jun N-terminal kinase, and RhoA-GTP, all of which are key genes in the WNT/PCP signaling pathway. These results may indicate the mechanisms underlying the oncogenic role of COL1A1 in CRC. In summary, the present data indicated that COL1A1 may serve as an oncoprotein, and that it may be used as a potential therapeutic target in CRC. PMID:29393423

Influence of tra genes of IncP and F plasmids on the mobilization of small Kanamycin resistance ColE1-Like plasmids in bacterial biofilms

USDA-ARS?s Scientific Manuscript database

Background: Horizontal gene transfer is a mechanism for movement of antibiotic resistance genes among bacteria. Some small kanamycin resistance (KanR) ColE1-like plasmids isolated from different serotypes of Salmonella enterica were shown to carry mobilization genes; although not self-transmissibl...

Tumor Tension Induces Persistent Inflammation and Promotes Breast Cancer Aggression

DTIC Science & Technology

2015-10-01

assessing collagen crosslinking, fibrillar collagen I deposition, and macrophage infiltration in a pilot study using MMTV-PyMT; Col1a1 -tTA;TetO_mLOX model...where LOX was overexpressed in Col1a1 + activated fibroblasts (Figure 4B-C). The second model is an inducible LOX knockout model: MMTV-PyMT; Col1a1 ...cells were isolated and analyzed using flow cytometry. (B) MMTV-PyMT; Col1a1 -tTA;TetO_mLOX mice have been taken off DOX treatment at 6 weeks of age

Comparison of gene expression profiles between dental pulp and periodontal ligament tissues in humans

PubMed Central

Gong, Ai-Xiu; Zhang, Jing-Han; Li, Jing; Wu, Jun; Wang, Lin; Miao, Deng-Shun

2017-01-01

There are anatomical and functional differences between human dental pulp (DP) and periodontal ligament (PDL). However, the molecular biological differences and function of these tissues are poorly understood. In the present study, we employed a cDNA microarray array to screen for differentially expressed genes (DEGs) between human DP and PDL tissues, and used the online software WebGestalt to perform the functional analysis of the DEGs. In addition, the STRING database and KEGG pathway analysis were applied for interaction network and pathway analysis of the DEGs. DP and PDL samples were obtained from permanent premolars (n=16) extracted for orthodontic purposes. The results of the microarray assay were confirmed by RT-qPCR. The DEGs were found to be significantly associated with the extracellular matrix and focal adhesion. A total of 10 genes were selected to confirm the results. The mRNA levels of integrin alpha 4 (ITGA4), integrin alpha 8 (ITGA8), neurexin 1 (NRXN1) and contactin 1 (CNTN1) were significantly higher in the DP than in the PDL tissues. However, the levels of collagen type XI alpha 1 (COL11A1), aggrecan (ACAN), collagen type VI alpha 1 (COL6A1), chondroadherin (CHAD), laminin gamma 2 (LAMC2) and laminin alpha 3 (LAMA3) were higher in the PDL than in the DP samples. The gene expression profiles provide novel insight into the characterization of DP and PDL tissues, and contribute to our understanding of the potential molecular mechanisms of dental tissue mineralization and regeneration. PMID:28713908

Osteogenesis imperfecta Type IV: a newly identified variant at position c.560 (G > T; p.Gly187Val) in the COL1A2 gene.

PubMed

Usta, Akin; Karademir, Dilay; Sen, Eylem; Yazici, Selcuk; Adali, Ertan; Erdem, Erkan; Karacan, Meric

2017-01-01

Osteogenesis imperfecta is a clinically heterogenous disease caused by defective collagen syntesis associated with a mutation in the COL1A1 or COL1A2 genes. In this report, we present a case of osteogenesis imperfecta (OI) type IV, seen in a female fetus with incurved femurs at 18 weeks of gestation. Molecular analysis of the newborn revealed a novel mutation at position c.560 (c.560 G > T) of the exon 12 in the COL1A2 gene; which lead to the glycine modification with valine (p.Gly187Val) at codon 187. The pregnancy follow-up was uneventful. After delivery, the newborn underwent biphosponat therapy and no fracture was detected until 1 year old.

Genome-wide Mechanosensitive MicroRNA (MechanomiR) Screen Uncovers Dysregulation of Their Regulatory Networks in the mdm Mouse Model of Muscular Dystrophy*

PubMed Central

Mohamed, Junaith S.; Hajira, Ameena; Lopez, Michael A.; Boriek, Aladin M.

2015-01-01

Muscular dystrophies (MDs) are a heterogeneous group of genetic and neuromuscular disorders, which result in severe loss of motor ability and skeletal muscle mass and function. Aberrant mechanotransduction and dysregulated-microRNA pathways are often associated with the progression of MD. Here, we hypothesized that dysregulation of mechanosensitive microRNAs (mechanomiRs) in dystrophic skeletal muscle plays a major role in the progression of MD. To test our hypothesis, we performed a genome-wide expression profile of anisotropically regulated mechanomiRs and bioinformatically analyzed their target gene networks. We assessed their functional roles in the advancement of MD using diaphragm muscles from mdm (MD with myositis) mice, an animal model of human tibial MD (titinopathy), and their wild-type littermates. We were able to show that ex vivo anisotropic mechanical stretch significantly alters the miRNA expression profile in diaphragm muscles from WT and mdm mice; as a result, some of the genes associated with MDs are dysregulated in mdm mice due to differential regulation of a distinct set of mechanomiRs. Interestingly, we found a contrasting expression pattern of the highly expressed let-7 family mechanomiRs, let-7e-5p and miR-98–5p, and their target genes associated with the extracellular matrix and TGF-β pathways, respectively, between WT and mdm mice. Gain- and loss-of-function analysis of let-7e-5p in myocytes isolated from the diaphragms of WT and mdm mice confirmed Col1a1, Col1a2, Col3a1, Col24a1, Col27a1, Itga1, Itga4, Scd1, and Thbs1 as target genes of let-7e-5p. Furthermore, we found that miR-98 negatively regulates myoblast differentiation. Our study therefore introduces additional biological players in the regulation of skeletal muscle structure and myogenesis that may contribute to unexplained disorders of MD. PMID:26272747

A Children's Oncology Group and TARGET initiative exploring the genetic landscape of Wilms tumor. | Office of Cancer Genomics

Cancer.gov

We performed genome-wide sequencing and analyzed mRNA and miRNA expression, DNA copy number, and DNA methylation in 117 Wilms tumors, followed by targeted sequencing of 651 Wilms tumors. In addition to genes previously implicated in Wilms tumors (WT1, CTNNB1, AMER1, DROSHA, DGCR8, XPO5, DICER1, SIX1, SIX2, MLLT1, MYCN, and TP53), we identified mutations in genes not previously recognized as recurrently involved in Wilms tumors, the most frequent being BCOR, BCORL1, NONO, MAX, COL6A3, ASXL1, MAP3K4, and ARID1A.

Alport Syndrome: De Novo Mutation in the COL4A5 Gene Converting Glycine 1205 to Valine.

PubMed

Antón-Martín, Pilar; Aparicio López, Cristina; Ramiro-León, Soraya; Santillán Garzón, Sonia; Santos-Simarro, Fernando; Gil-Fournier, Belén

2012-01-01

Alport syndrome is a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family. It is a genetically heterogeneous disease with different mutations and forms of inheritance that presents with renal affection, hearing loss and eye defects. Several new mutations related to X-linked forms have been previously determined. We report the case of a 12 years old male and his family diagnosed with Alport syndrome after genetic analysis was performed. A new mutation determining a nucleotide change c.3614G > T (p.Gly1205Val) in hemizygosis in the COL4A5 gene was found. This molecular defect has not been previously described. Molecular biology has helped us to comprehend the mechanisms of pathophysiology in Alport syndrome. Genetic analysis provides the only conclusive diagnosis of the disorder at the moment. Our contribution with a new mutation further supports the need of more sophisticated molecular methods to increase the mutation detection rates with lower costs and less time.

Collagen V haploinsufficiency in a murine model of classic Ehlers-Danlos syndrome is associated with deficient structural and mechanical healing in tendons.

PubMed

Johnston, Jessica M; Connizzo, Brianne K; Shetye, Snehal S; Robinson, Kelsey A; Huegel, Julianne; Rodriguez, Ashley B; Sun, Mei; Adams, Sheila M; Birk, David E; Soslowsky, Louis J

2017-12-01

Classic Ehlers-Danlos syndrome (EDS) patients suffer from connective tissue hyperelasticity, joint instability, skin hyperextensibility, tissue fragility, and poor wound healing due to heterozygous mutations in COL5a1 or COL5a2 genes. This study investigated the roles of collagen V in establishing structure and function in uninjured patellar tendons as well as in the injury response using a Col5a1 +/- mouse, a model for classic EDS. These analyses were done comparing tendons from a classic EDS model (Col5a1 +/- ) with wild-type controls. Tendons were subjected to mechanical testing, histological, and fibril analysis before injury as well as 3 and 6 weeks after injury. We found that Col5a1 +/- tendons demonstrated diminished recovery of mechanical competency after injury as compared to normal wild-type tendons, which recovered their pre-injury values by 6 weeks post injury. Additionally, the Col5a1 +/- tendons demonstrated altered fibril morphology and diameter distributions compared to the wild-type tendons. This study indicates that collagen V plays an important role in regulating collagen fibrillogenesis and the associated recovery of mechanical integrity in tendons after injury. In addition, the dysregulation with decreased collagen V expression in EDS is associated with a diminished injury response. The results presented herein have the potential to direct future targeted therapeutics for classic EDS patients. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:2707-2715, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Influence of cartilage extracellular matrix molecules on cell phenotype and neocartilage formation.

PubMed

Grogan, Shawn P; Chen, Xian; Sovani, Sujata; Taniguchi, Noboru; Colwell, Clifford W; Lotz, Martin K; D'Lima, Darryl D

2014-01-01

Interaction between chondrocytes and the cartilage extracellular matrix (ECM) is essential for maintaining the cartilage's role as a low-friction and load-bearing tissue. In this study, we examined the influence of cartilage zone-specific ECM on human articular chondrocytes (HAC) in two-dimensional and three-dimensional (3D) environments. Two culture systems were used. SYSTEM 1: HAC were cultured on cell-culture plates that had been precoated with the following ECM molecules for 7 days: decorin, biglycan, tenascin C (superficial zone), collagen type II, hyaluronan (HA) (middle and deep zones), and osteopontin (deep zone). Uncoated standard culture plates were used as controls. Expanded cells were examined for phenotypic changes using real-time polymerase chain reaction. In addition, expanded cells were placed into high-density pellet cultures for 14 days. Neocartilage formation was assessed via gene expression and histology evaluations. SYSTEM 2: HAC that were cultured on untreated plates and encapsulated in a 3D alginate scaffold were mixed with one of the zone-specific ECM molecules. Cell viability, gene expression, and histology assessments were conducted on 14-day-old tissues. In HAC monolayer culture, exposure to decorin, HA, and osteopontin increased COL2A1 and aggrecan messenger RNA (mRNA) levels compared with controls. Biglycan up-regulated aggrecan without a significant impact on COL2A1 expression; Tenascin C reduced COL2A1 expression. Neocartilage formed after preculture on tenascin C and collagen type II expressed higher COL2A1 mRNA compared with control pellets. Preculture of HAC on HA decreased both COL2A1 and aggrecan expression levels compared with controls, which was consistent with histology. Reduced proteoglycan 4 (PRG4) mRNA levels were observed in HAC pellets that had been precultured with biglycan and collagen type II. Exposing HAC to HA directly in 3D-alginate culture most effectively induced neocartilage formation, showing increased COL2A1 and aggrecan, and reduced COL1A1 compared with controls. Decorin treatments increased HAC COL2A1 mRNA levels. These data indicate that an appropriate exposure to cartilage-specific ECM proteins could be used to enhance cartilage formation and to even induce the formation of zone-specific phenotypes to improve cartilage regeneration.

Muscle Weakness and Fibrosis Due to Cell Autonomous and Non-cell Autonomous Events in Collagen VI Deficient Congenital Muscular Dystrophy.

PubMed

Noguchi, Satoru; Ogawa, Megumu; Malicdan, May Christine; Nonaka, Ikuya; Nishino, Ichizo

2017-02-01

Congenital muscular dystrophies with collagen VI deficiency are inherited muscle disorders with a broad spectrum of clinical presentation and are caused by mutations in one of COL6A1-3 genes. Muscle pathology is characterized by fiber size variation and increased interstitial fibrosis and adipogenesis. In this study, we define critical events that contribute to muscle weakness and fibrosis in a mouse model with collagen VI deficiency. The Col6a1 GT/GT mice develop non-progressive weakness from younger age, accompanied by stunted muscle growth due to reduced IGF-1 signaling activity. In addition, the Col6a1 GT/GT mice have high numbers of interstitial skeletal muscle mesenchymal progenitor cells, which dramatically increase with repeated myofiber necrosis/regeneration. Our results suggest that impaired neonatal muscle growth and the activation of the mesenchymal cells in skeletal muscles contribute to the pathology of collagen VI deficient muscular dystrophy, and more importantly, provide the insights on the therapeutic strategies for collagen VI deficiency. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

A second mutation in the type II procollagen gene (COL2AI) causing stickler syndrome (arthro-ophthalmopathy) is also a premature termination codon.

PubMed Central

Ahmad, N N; McDonald-McGinn, D M; Zackai, E H; Knowlton, R G; LaRossa, D; DiMascio, J; Prockop, D J

1993-01-01

Genetic linkage analyses suggest that mutations in type II collagen may be responsible for Stickler syndrome, or arthro-ophthalmopathy (AO), in many families. In the present study oligonucleotide primers were developed to amplify and directly sequence eight of the first nine exons of the gene for type II procollagen (COL2A1). Analysis of the eight exons in 10 unrelated probands with AO revealed that one had a single-base mutation in one allele that changed the codon of -CGA- for arginine at amino acid position alpha 1-9 in exon 7 to a premature termination signal for translation. The second mutation found to cause AO was, therefore, similar to the first in that both created premature termination signals in the COL2A1 gene. Since mutations producing premature termination signals have not previously been detected in genes for fibrillar collagens, the results raise the possibility that such mutations in the COL2A1 gene are a common cause of AO. Images Figure 2 Figure 3 PMID:8434604

Collagen VII plays a dual role in wound healing

PubMed Central

Nyström, Alexander; Velati, Daniela; Mittapalli, Venugopal R.; Fritsch, Anja; Kern, Johannes S.; Bruckner-Tuderman, Leena

2013-01-01

Although a host of intracellular signals is known to contribute to wound healing, the role of the cell microenvironment in tissue repair remains elusive. Here we employed 2 different mouse models of genetic skin fragility to assess the role of the basement membrane protein collagen VII (COL7A1) in wound healing. COL7A1 secures the attachment of the epidermis to the dermis, and its mutations cause a human skin fragility disorder coined recessive dystrophic epidermolysis bullosa (RDEB) that is associated with a constant wound burden. We show that COL7A1 is instrumental for skin wound closure by 2 interconnected mechanisms. First, COL7A1 was required for re-epithelialization through organization of laminin-332 at the dermal-epidermal junction. Its loss perturbs laminin-332 organization during wound healing, which in turn abrogates strictly polarized expression of integrin α6β4 in basal keratinocytes and negatively impacts the laminin-332/integrin α6β4 signaling axis guiding keratinocyte migration. Second, COL7A1 supported dermal fibroblast migration and regulates their cytokine production in the granulation tissue. These findings, which were validated in human wounds, identify COL7A1 as a critical player in physiological wound healing in humans and mice and may facilitate development of therapeutic strategies not only for RDEB, but also for other chronic wounds. PMID:23867500

Clinical and molecular characterization of 40 patients with classic Ehlers–Danlos syndrome: identification of 18 COL5A1 and 2 COL5A2 novel mutations

PubMed Central

2013-01-01

Background Classic Ehlers–Danlos syndrome (cEDS) is a rare autosomal dominant connective tissue disorder that is primarily characterized by skin hyperextensibility, abnormal wound healing/atrophic scars, and joint hypermobility. A recent study demonstrated that more than 90% of patients who satisfy all of these major criteria harbor a type V collagen (COLLV) defect. Methods This cohort included 40 patients with cEDS who were clinically diagnosed according to the Villefranche nosology. The flowchart that was adopted for mutation detection consisted of sequencing the COL5A1 gene and, if no mutation was detected, COL5A2 analysis. In the negative patients the presence of large genomic rearrangements in COL5A1 was investigated using MLPA, and positive results were confirmed via SNP-array analysis. Results We report the clinical and molecular characterization of 40 patients from 28 families, consisting of 14 pediatric patients and 26 adults. A family history of cEDS was present in 9 patients. The majority of the patients fulfilled all the major diagnostic criteria for cEDS; atrophic scars were absent in 2 females, skin hyperextensibility was not detected in a male and joint hypermobility was negative in 8 patients (20% of the entire cohort). Wide inter- and intra-familial phenotypic heterogeneity was observed. We identified causal mutations with a detection rate of approximately 93%. In 25/28 probands, COL5A1 or COL5A2 mutations were detected. Twenty-one mutations were in the COL5A1 gene, 18 of which were novel (2 recurrent). Of these, 16 mutations led to nonsense-mediated mRNA decay (NMD) and to COLLV haploinsufficiency and 5 mutations were structural. Two novel COL5A2 splice mutations were detected in patients with the most severe phenotypes. The known p. (Arg312Cys) mutation in the COL1A1 gene was identified in one patient with vascular-like cEDS. Conclusions Our findings highlight that the three major criteria for cEDS are useful and sufficient for cEDS clinical diagnosis in the large majority of the patients. The borderline patients for whom these criteria fail can be diagnosed when minor signs of connective tissue diseases and family history are present and when genetic testing reveals a defect in COLLV. Our data also confirm that COL5A1 and COL5A2 are the major, if not the only, genes involved in cEDS. PMID:23587214

HABP2 p.G534E variant in patients with family history of thyroid and breast cancer

PubMed Central

Pinheiro, Maisa; Drigo, Sandra Aparecida; Tonhosolo, Renata; Andrade, Sonia C.S.; Marchi, Fabio Albuquerque; Jurisica, Igor; Kowalski, Luiz Paulo; Achatz, Maria Isabel; Rogatto, Silvia Regina

2017-01-01

Familial Papillary Thyroid Carcinoma (PTC) has been described as a hereditary predisposition cancer syndrome associated with mutations in candidate genes including HABP2. Two of 20 probands from families with history of PTC and breast carcinoma (BC) were evaluated by whole exome sequencing (WES) revealing HABP2 p.G534E. Sanger sequencing was used to confirm the involvement of this variant in three families (F1: 7 relatives; F2: 3 and F3: 3). The proband and his sister (with no malignant tumor so far) from F1 were homozygous for the variant whereas one relative with PTC from F2 was negative for the variant. Although the proband of the F3 with PTC was HABP2 wild type, three relatives presented the variant. Five of 170 healthy Brazilian individuals with no family history of BC or PTC and three of 50 sporadic PTC presented the p.G534E. These findings suggested no association of this variant with our familial PTC cases. Genes potentially associated with deregulation of the extracellular matrix organization pathway (CTSB, TNXB, COL4A3, COL16A1, COL24A1, COL5A2, NID1, LOXL2, MMP11, TRIM24 and MUSK) and DNA repair function (NBN and MSH2) were detected by WES, suggesting that other cancer-associated genes have pathogenic effects in the risk of familial PTC development. PMID:28402931

The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells.

PubMed

Huang, Xiaobin; Zhong, Leilei; Hendriks, Jan; Post, Janine N; Karperien, Marcel

2018-02-13

Mesenchymal stem cells (MSCs) are multipotent cells, mainly from bone marrow, and an ideal source of cells in bone and cartilage tissue engineering. A study of the chondrogenic differentiation of MSCs is of particular interest for MSCs-based cartilage regeneration. In this study, we aimed to optimize the conditions for the chrondogenic differentiation of MSCs by regulating WNT signaling using the small molecule WNT inhibitor PKF118-310 and activator BIO. Human mesenchymal stem cells (hMSCs) were isolated from bone marrow aspirates and cultured in hMSCs proliferation medium. Pellet culture was subsequently established for three-dimensional chondrogenic differentiation of 5 weeks. WNT signaling was increased by the small molecule glycogen synthase kinase-3 inhibitor 6-bromoindirubin-3-oxim (BIO) and decreased by the WNT inhibitor PKF118-310 (PKF). The effects of BIO and PKF on the chondrogenesis of hMSCs was examined by real-time PCR, histological methods, and ELISA. We found that activation of canonical WNT-signaling by BIO significantly downregulated the expression of cartilage-specific genes SOX9 , COL2A1, and ACAN , and matrix metalloproteinase genes MMP1/3/9/13, but increased ADAMTS 4/5 . Inhibition of WNT signaling by PKF increased the expression of SOX9 , COL2A1 , ACAN , and MMP9, but decreased MMP13 and ADAMTS4/5 . In addition, a high level of WNT signaling induced the expression of hypertrophic markers COL10A1, ALPL , and RUNX2, the dedifferentiation marker COL1A1 , and glycolysis genes GULT1 and PGK1 . Deposition of glycosaminoglycan (GAG) and collagen type II in the pellet matrix was significantly lost in the BIO-treated group and increased in the PKF-treated group. The protein level of COL10A1 was also highly induced in the BIO group. Interestingly, BIO decreased the number of apoptotic cells while PKF significantly induced apoptosis during chondrogenesis. The natural WNT antagonist DKK1 and the protein level of MMP1 in the pellet culture medium were decreased after PKF treatment. All of these chondrogenic effects appeared to be mediated through the canonical WNT signaling pathway, since the target gene Axin2 and other WNT members, such as TCF4 and β-catenin , were upregulated by BIO and downregulated by PKF, respectively, and BIO induced nuclear translocation of β-catenin while PKF inhibited β-catenin translocation into the nucleus. We concluded that addition of BIO to a chondrogenic medium of hMSCs resulted in a loss of cartilage formation, while PKF induced chondrogenic differentiation and cartilage matrix deposition and inhibited hypertrophic differentiation. However, BIO promoted cell survival by inhibiting apoptosis while PKF induced cell apoptosis. This result indicates that either an overexpression or overinhibition of WNT signaling to some extent causes harmful effects on chondrogenic differentiation. Cartilage tissue engineering could benefit from the adjustment of the critical level of WNT signaling during chondrogenesis of hMSC.

Juxtaposed genes in 7q21-22 amplicon contribute for two major gastric cancer sub-Types by mutual exclusive expression.

PubMed

Tamilzhalagan, Sembulingam; Muthuswami, Muthulakshmi; Ganesan, Kumaresan

2017-04-01

Genomic Copy Number Variations (CNV) and the associated gene signatures are useful for cancer prognosis, diagnosis, and targeted therapeutics. Earlier, 7q21-22 region was reported for frequent amplification in gastric cancer and potential candidate genes were identified. An analysis of the expression pattern of the 159 genes located in this amplicon revealed the consistent elevated expression of 21 genes in gastric tumors. These genes are closely arranged within the 20 Mb region, and they showed a bimodal expression pattern. SHFM1 and 14 other genes are expressed in intestinal type gastric tumors. COL1A2 and PCOLCE genes of this region are expressed in diffuse type gastric tumors. Similarly, genome-wide expression neighbors of SHFM1 and COL1A2 also showed mutually exclusive expression pattern, and stratify intestinal and diffuse type gastric tumors. The expression of COL1A2 gene-set is associated with poor prognosis, whereas the SHFM1 gene-set is associated with better prognosis among the gastric cancer patients. Despite being physical neighbors, the SHFM1 and COL1A2 genes express differentially in the two major clinical sub-types of gastric cancer in a mutually exclusive manner. The tight gene regulations operating between these juxtaposed genes deserve investigation to understand the molecular regulatory switch defining the determinants of the gastric cancer sub-types. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Upregulated Expression of Integrin α1 in Mesangial Cells and Integrin α3 and Vimentin in Podocytes of Col4a3-Null (Alport) Mice

PubMed Central

Steenhard, Brooke M.; Vanacore, Roberto; Friedman, David; Zelenchuk, Adrian; Stroganova, Larysa; Isom, Kathryn; St. John, Patricia L.; Hudson, Billy G.; Abrahamson, Dale R.

2012-01-01

Alport disease in humans, which usually results in proteinuria and kidney failure, is caused by mutations to the COL4A3, COL4A4, or COL4A5 genes, and absence of collagen α3α4α5(IV) networks found in mature kidney glomerular basement membrane (GBM). The Alport mouse harbors a deletion of the Col4a3 gene, which also results in the lack of GBM collagen α3α4α5(IV). This animal model shares many features with human Alport patients, including the retention of collagen α1α2α1(IV) in GBMs, effacement of podocyte foot processes, gradual loss of glomerular barrier properties, and progression to renal failure. To learn more about the pathogenesis of Alport disease, we undertook a discovery proteomics approach to identify proteins that were differentially expressed in glomeruli purified from Alport and wild-type mouse kidneys. Pairs of cy3- and cy5-labeled extracts from 5-week old Alport and wild-type glomeruli, respectively, underwent 2-dimensional difference gel electrophoresis. Differentially expressed proteins were digested with trypsin and prepared for mass spectrometry, peptide ion mapping/fingerprinting, and protein identification through database searching. The intermediate filament protein, vimentin, was upregulated ∼2.5 fold in Alport glomeruli compared to wild-type. Upregulation was confirmed by quantitative real time RT-PCR of isolated Alport glomeruli (5.4 fold over wild-type), and quantitative confocal immunofluorescence microscopy localized over-expressed vimentin specifically to Alport podocytes. We next hypothesized that increases in vimentin abundance might affect the basement membrane protein receptors, integrins, and screened Alport and wild-type glomeruli for expression of integrins likely to be the main receptors for GBM type IV collagen and laminin. Quantitative immunofluorescence showed an increase in integrin α1 expression in Alport mesangial cells and an increase in integrin α3 in Alport podocytes. We conclude that overexpression of mesangial integrin α1 and podocyte vimentin and integrin α3 may be important features of glomerular Alport disease, possibly affecting cell-signaling, cell shape and cellular adhesion to the GBM. PMID:23236390

Inhibition of microRNA-214-5p promotes cell survival and extracellular matrix formation by targeting collagen type IV alpha 1 in osteoblastic MC3T3-E1 cells.

PubMed

Li, Q S; Meng, F Y; Zhao, Y H; Jin, C L; Tian, J; Yi, X J

2017-08-01

This study aimed to investigate the functional effects of microRNA (miR)-214-5p on osteoblastic cells, which might provide a potential role of miR-214-5p in bone fracture healing. Blood samples were obtained from patients with hand fracture or intra-articular calcaneal fracture and from healthy controls (HCs). Expression of miR-214-5p was monitored by qRT-PCR at day 7, 14 and 21 post-surgery. Mouse osteoblastic MC3T3-E1 cells were transfected with antisense oligonucleotides (ASO)-miR-214-5p, collagen type IV alpha 1 (COL4A1) vector or their controls; thereafter, cell viability, apoptotic rate, and the expression of collagen type I alpha 1 (COL1A1), type II collagen (COL-II), and type X collagen (COL-X) were determined. Luciferase reporter assay, qRT-PCR, and Western blot were performed to ascertain whether COL4A1 was a target of miR-214-5p. Plasma miR-214-5p was highly expressed in patients with bone fracture compared with HCs after fracture (p < 0.05 or p < 0.01). Inhibition of miR-214-5p increased the viability of MC3T3-E1 cells and the expressions of COL1A1 and COL-X, but decreased the apoptotic rate and COL-II expression (p < 0.05 or p < 0.01). COL4A1 was a target of miR-214-5p, and was negatively regulated by miR-214-5p (p < 0.05 or p < 0.01). Overexpression of COL4A1 showed a similar impact on cell viability, apoptotic rate, and COL1A1, COL-II, and COL-X expressions inhibiting miR-214-5p (p < 0.01). Inhibition of miR-214-5p promotes cell survival and extracellular matrix (ECM) formation of osteoblastic MC3T3-E1 cells by targeting COL4A1. Cite this article: Q. S. Li, F. Y. Meng, Y. H. Zhao, C. L. Jin, J. Tian, X. J. Yi. Inhibition of microRNA-214-5p promotes cell survival and extracellular matrix formation by targeting collagen type IV alpha 1 in osteoblastic MC3T3-E1 cells. Bone Joint Res 2017;6:464-471. DOI: 10.1302/2046-3758.68.BJR-2016-0208.R2. © 2017 Yi et al.

Absence of collagen IX accelerates hypertrophic differentiation in the embryonic mouse spine through a disturbance of the Ihh-PTHrP feedback loop.

PubMed

Kamper, Matthias; Paulsson, Mats; Zaucke, Frank

2017-02-01

Collagen IX (Col IX) is a component of the cartilage extracellular matrix and contributes to its structural integrity. Polymorphisms in the genes encoding the Col IX ɑ2- and ɑ3-chains are associated with early onset of disc degeneration. Col IX-deficient mice already display changes in the spine at the newborn stage and premature disc degeneration starting at 6 months of age. To determine the role of Col IX in early spine development and to identify molecular mechanisms underlying disc degeneration, the embryonic development of the spine was analyzed in Col IX -/- mice. Histological staining was used to show tissue morphology at different time points. Localization of extracellular matrix proteins as well as components of signaling pathways were analyzed by immunohistochemistry. Developing vertebral bodies of Col IX -/- mice were smaller and already appeared more compact at E12.5. At E15.5, vertebral bodies of Col IX -/- mice revealed an increased number of hypertrophic chondrocytes as well as enhanced staining for the terminal differentiation markers alkaline phosphatase and collagen X. This correlates with an imbalance in the Ihh-PTHrP signaling pathway at this time point, reflected by an increase of Ihh and a concomitant decrease of PTHrP expression. An accelerated hypertrophic differentiation caused by a disturbed Ihh-PTHrP signaling pathway may lead to a higher bone mineral density in the vertebral bodies of newborn Col IX -/- mice and, as a result, to the early onset of disc degeneration.

A novel COL11A1 mutation affecting splicing in a patient with Stickler syndrome.

PubMed

Kohmoto, Tomohiro; Naruto, Takuya; Kobayashi, Haruka; Watanabe, Miki; Okamoto, Nana; Masuda, Kiyoshi; Imoto, Issei; Okamoto, Nobuhiko

2015-01-01

Stickler syndrome is a clinically and genetically heterogeneous collagenopathy characterized by ocular, auditory, skeletal and orofacial abnormalities, commonly occurring as an autosomal dominant trait. We conducted target resequencing to analyze candidate genes associated with known clinical phenotypes from a 4-year-old girl with Stickler syndrome. We detected a novel heterozygous intronic mutation (NM_001854.3:c.3168+5G>A) in COL11A1 that may impair splicing, which was suggested by in silico prediction and a minigene assay.

A novel COL11A1 mutation affecting splicing in a patient with Stickler syndrome

PubMed Central

Kohmoto, Tomohiro; Naruto, Takuya; Kobayashi, Haruka; Watanabe, Miki; Okamoto, Nana; Masuda, Kiyoshi; Imoto, Issei; Okamoto, Nobuhiko

2015-01-01

Stickler syndrome is a clinically and genetically heterogeneous collagenopathy characterized by ocular, auditory, skeletal and orofacial abnormalities, commonly occurring as an autosomal dominant trait. We conducted target resequencing to analyze candidate genes associated with known clinical phenotypes from a 4-year-old girl with Stickler syndrome. We detected a novel heterozygous intronic mutation (NM_001854.3:c.3168+5G>A) in COL11A1 that may impair splicing, which was suggested by in silico prediction and a minigene assay. PMID:27081549

Role of Klotho in Osteoporosis and Renal Osteodystrophy

DTIC Science & Technology

2015-10-01

uremia induced increases in FGF23 transcription (Figure 6). VEGFa Runx2 Osx Col1a1 ALP OC 0 2 4 6 8 KL fl/fl Prx1-Cre; KL fl/fl m R N A ex pr es...week old mice revealed that Prx1cre;Klothofl/fl mice have significantly higher expression of osteoblastic and osteocytic markers such as Col1a1 , Runx2

Potential effect of exercise in ameliorating insulin resistance at transcriptome level.

PubMed

Hu, Zhigang; Zhou, Lei; He, Tingting

2017-10-24

Insulin resistance can lead to the pathogenesis of type 2 diabetes and exercise can increase insulin sensitivity. And different exercises may have different influences on the mitigation of insulin resistance. It's still unclear how exercise affects inherited insulin resistance at transcriptome level. The purpose of our study was to analyze the potential effects of exercise in ameliorating insulin resistance at transcriptome level. Herein, we analyzed two skeletal muscle transcriptome profiles, including gene profiles between inherited insulin resistant patients and matched healthy controls, and between trained and sedentary subjects (young and old subjects, respectively). Analysis of differentially expressed genes revealed that 12 genes (SGK1, LOC101929876, MYL5, COL6A3, MLF1, LUM, MSTN, COL1A2, COL3A1, IL32, IRS2 and ID1) associated with insulin resistance were reversed by exercise in young subjects, while six genes (MSTN, CFHR1, PFKFB3, IL32, RGCC and NMRK2) were identified in old subjects, suggesting that those genes play potential roles in insulin resistance response to exercise. In addition, we observed that two insulin resistance-related genes, MSTN and IL32, were identified in muscle cells of both young and old subjects, indicating their important roles in the mechanisms behind the beneficial effects of exercise on humans with inherited insulin resistance. Several pathways were also identified, such as "collagen metabolic process", "focal adhesion" and "negative regulation of myoblast differentiation". Taken together, our findings provide novel markers in insulin resistant patients and exercise, and some valuable information for future functional studies on how exercise ameliorating insulin resistance.

Enhanced hyaline cartilage matrix synthesis in collagen sponge scaffolds by using siRNA to stabilize chondrocytes phenotype cultured with bone morphogenetic protein-2 under hypoxia.

PubMed

Legendre, Florence; Ollitrault, David; Hervieu, Magalie; Baugé, Catherine; Maneix, Laure; Goux, Didier; Chajra, Hanane; Mallein-Gerin, Frédéric; Boumediene, Karim; Galera, Philippe; Demoor, Magali

2013-07-01

Cartilage healing by tissue engineering is an alternative strategy to reconstitute functional tissue after trauma or age-related degeneration. However, chondrocytes, the major player in cartilage homeostasis, do not self-regenerate efficiently and lose their phenotype during osteoarthritis. This process is called dedifferentiation and also occurs during the first expansion step of autologous chondrocyte implantation (ACI). To ensure successful ACI therapy, chondrocytes must be differentiated and capable of synthesizing hyaline cartilage matrix molecules. We therefore developed a safe procedure for redifferentiating human chondrocytes by combining appropriate physicochemical factors: hypoxic conditions, collagen scaffolds, chondrogenic factors (bone morphogenetic protein-2 [BMP-2], and insulin-like growth factor I [IGF-I]) and RNA interference targeting the COL1A1 gene. Redifferentiation of dedifferentiated chondrocytes was evaluated using gene/protein analyses to identify the chondrocyte phenotypic profile. In our conditions, under BMP-2 treatment, redifferentiated and metabolically active chondrocytes synthesized a hyaline-like cartilage matrix characterized by type IIB collagen and aggrecan molecules without any sign of hypertrophy or osteogenesis. In contrast, IGF-I increased both specific and noncharacteristic markers (collagens I and X) of chondrocytes. The specific increase in COL2A1 gene expression observed in the BMP-2 treatment was shown to involve the specific enhancer region of COL2A1 that binds the trans-activators Sox9/L-Sox5/Sox6 and Sp1, which are associated with a decrease in the trans-inhibitors of COL2A1, c-Krox, and p65 subunit of NF-kappaB. Our procedure in which BMP-2 treatment under hypoxia is associated with a COL1A1 siRNA, significantly increased the differentiation index of chondrocytes, and should offer the opportunity to develop new ACI-based therapies in humans.

Nanofibers grafted on titanium alloy: the effects of fiber alignment and density on osteoblast mineralization.

PubMed

Lin, Hsin-Yi; Peng, Zhao-Xiang

2017-08-17

The surface of medical implant alloy Ti-6Al-4V was chemically modified to allow it to covalently bond with collagen/PVA nanofibers. These nanofibers were successfully attached to the Ti-6Al-4V surface in three different morphologies: randomly oriented high-density fiber, COL(H); randomly oriented low-density fiber, COL(L); and aligned high-density fiber, COL(A). The effects of the morphology of these covalently-bound collagen nanofibers on the growth and differentiation of osteoblasts were studied for 21 days. The low-density nanofibers covered approximately 80% of the Ti64 surface, while the high-density nanofibers covered nearly 100%. These covalently attached fibrous coatings remained attached to the metal surface after 3 weeks of cell culture. In the first week the aligned fibers of COL(A) allowed the osteoblasts to stretch and elongate in the direction of the fibers. This directional elongation was not seen in the cells on the randomly-oriented samples. Cells proliferated and differentiated on all three surfaces over time. By the end of the test, the amount of type I collagen secreted by the cells on COL(H) was the highest, while the degree of mineralization was highest on COL(A) among the three samples (p < 0.05). Different nanofiber morphologies changed the cell morphology and the secretion of cellular products. The mechanisms remained to be investigated. The surface of medical implant alloy Ti-6Al-4V was chemically modified to allow it to covalently bond with collagen/PVA nanofibers. The SEM micrographs in the top row show the random and aligned morphology of the collagen-PVA nanofibers. The nanofibers on COL(A) were aligned in the general direction indicated by the arrow. The second row are images from EDX titanium element mapping. The location of the titanium elements are shown as bright dots. The low-density nanofibers, COL(L), covered approximately 80% of the Ti64 surface, while the high-density nanofibers, COL(H) and COL(A), covered nearly 100%. All three surfaces demonstrated good biocompatibility for the cultured osteoblasts. The fiber alignment seemed to have an effect on early cellular morphology (day 7), collagen secretion and calcium deposition, while the density of the fibers seemed to have no significant effect on cell behavior. SEM micrographs of osteoblasts after 7 and 14 days of cell culture are shown in the third and fourth rows. The surface of COL(L) has more cell-free spots indicated by (*) on day 7 as other two surfaces were covered by cells. The nanofibers could no longer be observed and were covered with mineralized granules (circles) after 14 days of cell culture. The cells appear stretched out on the mineralized granules.

Validation in mesenchymal progenitor cells of a mutation-independent ex vivo approach to gene therapy for osteogenesis imperfecta.

PubMed

Millington-Ward, Sophia; Allers, Carolina; Tuohy, Gearóid; Conget, Paulette; Allen, Danny; McMahon, Helena P; Kenna, Paul F; Humphries, Peter; Farrar, G Jane

2002-09-15

Over 100 dominant-negative mutations within the COL1A1 gene have been identified in osteogenesis imperfecta (OI). In terms of human therapeutics, targeting each of these mutations independently is unlikely to be feasible. Here we show that the hammerhead ribozyme Rzpol1a1, targeting a common polymorphism within transcripts from the COL1A1 gene, downregulates COL1A1 transcript in human mesenchymal progenitor cells at a ribozyme to transcript ratio of only 1:1. Downregulation was confirmed at the protein level. Transducing stem cells with Rzpol1A1 ex vivo followed by autologous transplantation could provide a gene therapy for a large proportion of OI patients with gain-of-function mutations using a single therapeutic.

Stickler syndrome caused by COL2A1 mutations: genotype–phenotype correlation in a series of 100 patients

PubMed Central

Hoornaert, Kristien P; Vereecke, Inge; Dewinter, Chantal; Rosenberg, Thomas; Beemer, Frits A; Leroy, Jules G; Bendix, Laila; Björck, Erik; Bonduelle, Maryse; Boute, Odile; Cormier-Daire, Valerie; De Die-Smulders, Christine; Dieux-Coeslier, Anne; Dollfus, Hélène; Elting, Mariet; Green, Andrew; Guerci, Veronica I; Hennekam, Raoul C M; Hilhorts-Hofstee, Yvonne; Holder, Muriel; Hoyng, Carel; Jones, Kristi J; Josifova, Dragana; Kaitila, Ilkka; Kjaergaard, Suzanne; Kroes, Yolande H; Lagerstedt, Kristina; Lees, Melissa; LeMerrer, Martine; Magnani, Cinzia; Marcelis, Carlo; Martorell, Loreto; Mathieu, Michèle; McEntagart, Meriel; Mendicino, Angela; Morton, Jenny; Orazio, Gabrielli; Paquis, Véronique; Reish, Orit; Simola, Kalle O J; Smithson, Sarah F; Temple, Karen I; Van Aken, Elisabeth; Van Bever, Yolande; van den Ende, Jenneke; Van Hagen, Johanna M; Zelante, Leopoldo; Zordania, Riina; De Paepe, Anne; Leroy, Bart P; De Buyzere, Marc; Coucke, Paul J; Mortier, Geert R

2010-01-01

Stickler syndrome is an autosomal dominant connective tissue disorder caused by mutations in different collagen genes. The aim of our study was to define more precisely the phenotype and genotype of Stickler syndrome type 1 by investigating a large series of patients with a heterozygous mutation in COL2A1. In 188 probands with the clinical diagnosis of Stickler syndrome, the COL2A1 gene was analyzed by either a mutation scanning technique or bidirectional fluorescent DNA sequencing. The effect of splice site alterations was investigated by analyzing mRNA. Multiplex ligation-dependent amplification analysis was used for the detection of intragenic deletions. We identified 77 different COL2A1 mutations in 100 affected individuals. Analysis of the splice site mutations showed unusual RNA isoforms, most of which contained a premature stop codon. Vitreous anomalies and retinal detachments were found more frequently in patients with a COL2A1 mutation compared with the mutation-negative group (P<0.01). Overall, 20 of 23 sporadic patients with a COL2A1 mutation had either a cleft palate or retinal detachment with vitreous anomalies. The presence of vitreous anomalies, retinal tears or detachments, cleft palate and a positive family history were shown to be good indicators for a COL2A1 defect. In conclusion, we confirm that Stickler syndrome type 1 is predominantly caused by loss-of-function mutations in the COL2A1 gene as >90% of the mutations were predicted to result in nonsense-mediated decay. On the basis of binary regression analysis, we developed a scoring system that may be useful when evaluating patients with Stickler syndrome. PMID:20179744

Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks

PubMed Central

Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain

2015-01-01

Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530

Effectiveness of a Layer-by-Layer Microbubbles-Based Delivery System for Applying Minoxidil to Enhance Hair Growth.

PubMed

Liao, Ai-Ho; Lu, Ying-Jui; Lin, Yi-Chun; Chen, Hang-Kang; Sytwu, Huey-Kang; Wang, Chih-Hung

2016-01-01

Minoxidil (Mx) is a conventional drug for treating androgenetic alopecia, preventing hair loss, and promoting hair growth. The solubility of Mx has been improved using chemical enhancement methods to increase its skin permeability over the long term. This study created a new ultrasound (US) contrast agent-albumin-shelled microbubbles (MBs) that absorb chitosan oligosaccharide lactate (COL) and Mx-and combined it with sonication by US energy in the water phase to enhance hair growth while shortening the treatment period. COL and Mx grafted with MBs (mean diameter of 1480 nm) were synthesized into self-assembled complexes of COL-MBs and Mx-COL-MBs that had mean diameters of 4150 and 4500 nm, respectively. The US was applied at 3 W/cm(2) for 1 min, and combined with Mx-COL-MBs containing 0.3% Mx. The diffusion of Mx through the dialysis membrane from Mx-COL-MB during US (US+Mx-COL-MB) was more rapid at pH 4 than at pH 7.4, which is favorable given that the environment of the scalp is mildly acidic (pH=4.5-5.5). In Franz diffusion experiments performed in vitro, the release rates at 18 hours in the US+Mx-COL-MBs and US+MBs+Mx groups resulted in 2.3 and 1.7 times the penetration and deposition, respectively, of Mx relative to the group with Mx alone. During 21 days treatment in animal experiments, the growth rates at days 10 and 14 in the US+Mx-COL-MBs group increased by 22.6% and 64.7%, respectively, and there were clear significant differences (p<0.05) between the US+Mx-COL-MBs group and the other four groups. The use of US+Mx-COL-MB in the water phase can increased the effects of Mx so as to shorten the telogen phase, and also increase both the diameter of keratinized hair shafts and the size of hair follicles without causing skin damage.

Antibiotic resistance due to an unusual ColE1-type replicon plasmid in Aeromonas salmonicida.

PubMed

Vincent, Antony T; Emond-Rheault, Jean-Guillaume; Barbeau, Xavier; Attéré, Sabrina A; Frenette, Michel; Lagüe, Patrick; Charette, Steve J

2016-06-01

Aeromonas salmonicida subsp. salmonicida is a fish pathogen known to have a rich plasmidome. In the present study, we discovered an isolate of this bacterium bearing an additional unidentified small plasmid. After having sequenced the DNA of that isolate by next-generation sequencing, it appeared that the new small plasmid is a ColE1-type replicon plasmid, named here pAsa7. This plasmid bears a functional chloramphenicol-acetyltransferase-encoding gene (cat-pAsa7) previously unknown in A. salmonicida and responsible for resistance to chloramphenicol. A comparison of pAsa7 with pAsa2, the only known ColE1-type replicon plasmid usually found in A. salmonicida subsp. salmonicida, revealed that even if both plasmids share a high structural similarity, it is still unclear if pAsa7 is a derivative of pAsa2 since they showed several mutations at the nucleotide level. Transcriptomic analysis revealed that the cat-pAsa4 gene, another chloramphenicol-acetyltransferase-encoding gene, found on the large plasmid pAsa4, was significantly more transcribed than cat-pAsa7. This was correlated with a higher chloramphenicol resistance for isolates bearing pAsa4 compared with the one having pAsa7. Finally, a phylogenetic analysis showed that both CAT-pAsa4 and CAT-pAsa7 proteins were in different clusters. The clustering was supported by the identity of residues involved in the catalytic site. In addition, to give a better understanding of the large drug-resistance panel of A. salmonicida, this study reinforces the hypothesis that A. salmonicida subsp. salmonicida is a considerable reservoir for mobile genetic elements such as plasmids.

A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko

Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primersmore » from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.« less

Activation of Arabidopsis Seed Hair Development by Cotton Fiber-Related Genes

PubMed Central

Pang, Mingxiong; Shi, Xiaoli; Stelly, David M.; Chen, Z. Jeffrey

2011-01-01

Each cotton fiber is a single-celled seed trichome or hair, and over 20,000 fibers may develop semi-synchronously on each seed. The molecular basis for seed hair development is unknown but is likely to share many similarities with leaf trichome development in Arabidopsis. Leaf trichome initiation in Arabidopsis thaliana is activated by GLABROUS1 (GL1) that is negatively regulated by TRIPTYCHON (TRY). Using laser capture microdissection and microarray analysis, we found that many putative MYB transcription factor and structural protein genes were differentially expressed in fiber and non-fiber tissues. Gossypium hirsutum MYB2 (GhMYB2), a putative GL1 homolog, and its downstream gene, GhRDL1, were highly expressed during fiber cell initiation. GhRDL1, a fiber-related gene with unknown function, was predominately localized around cell walls in stems, sepals, seed coats, and pollen grains. GFP:GhRDL1 and GhMYB2:YFP were co-localized in the nuclei of ectopic trichomes in siliques. Overexpressing GhRDL1 or GhMYB2 in A. thaliana Columbia-0 (Col-0) activated fiber-like hair production in 4–6% of seeds and had on obvious effects on trichome development in leaves or siliques. Co-overexpressing GhRDL1 and GhMYB2 in A. thaliana Col-0 plants increased hair formation in ∼8% of seeds. Overexpressing both GhRDL1 and GhMYB2 in A. thaliana Col-0 try mutant plants produced seed hair in ∼10% of seeds as well as dense trichomes inside and outside siliques, suggesting synergistic effects of GhRDL1 and GhMYB2 with try on development of trichomes inside and outside of siliques and seed hair in A. thaliana. These data suggest that a different combination of factors is required for the full development of trichomes (hairs) in leaves, siliques, and seeds. A. thaliana can be developed as a model a system for discovering additional genes that control seed hair development in general and cotton fiber in particular. PMID:21779324

Exome Array Analysis of Susceptibility to Pneumococcal Meningitis

PubMed Central

Kloek, Anne T.; van Setten, Jessica; van der Ende, Arie; Bots, Michiel L.; Asselbergs, Folkert W.; Serón, Mercedes Valls; Brouwer, Matthijs C.; van de Beek, Diederik; Ferwerda, Bart

2016-01-01

Host genetic variability may contribute to susceptibility of bacterial meningitis, but which genes contribute to the susceptibility to this complex disease remains undefined. We performed a genetic association study in 469 community-acquired pneumococcal meningitis cases and 2072 population-based controls from the Utrecht Health Project in order to find genetic variants associated with pneumococcal meningitis susceptibility. A HumanExome BeadChip was used to genotype 102,097 SNPs in the collected DNA samples. Associations were tested with the Fisher exact test. None of the genetic variants tested reached Bonferroni corrected significance (p-value <5 × 10−7). Our strongest signals associated with susceptibility to pneumococcal meningitis were rs139064549 on chromosome 1 in the COL11A1 gene (p = 1.51 × 10−6; G allele OR 3.21 [95% CI 2.05–5.02]) and rs9309464 in the EXOC6B gene on chromosome 2 (p = 6.01 × 10−5; G allele OR 0.66 [95% CI 0.54–0.81]). The sequence kernel association test (SKAT) tests for associations between multiple variants in a gene region and pneumococcal meningitis susceptibility yielded one significant associated gene namely COL11A1 (p = 1.03 × 10−7). Replication studies are needed to validate these results. If replicated, the functionality of these genetic variations should be further studied to identify by which means they influence the pathophysiology of pneumococcal meningitis. PMID:27389768

Construction and validation of an RNA trans-splicing molecule suitable to repair a large number of COL7A1 mutations.

PubMed

Tockner, B; Kocher, T; Hainzl, S; Reichelt, J; Bauer, J W; Koller, U; Murauer, E M

2016-11-01

RNA trans-splicing has become a versatile tool in the gene therapy of monogenetic diseases. This technique is especially valuable for the correction of mutations in large genes such as COL7A1, which underlie the dystrophic subtype of the skin blistering disease epidermolysis bullosa. Over 800 mutations spanning the entire length of the COL7A1 gene have been associated with defects in type VII collagen, leading to excessive fragility of epithelial tissues, the hallmark of dystrophic epidermolysis bullosa (DEB). In the present study, we designed an RNA trans-splicing molecule (RTM) that is capable of repairing any given mutation within a 4200 nucleotide region spanning the 3' half of COL7A1. The selected RTM, RTM28, was able to induce accurate trans-splicing into endogenous COL7A1 pre-mRNA transcripts in a type VII collagen-deficient DEB patient-derived cell line. Correct trans-splicing was detected at the RNA level by semiquantitative RT-PCR and correction of full-length type VII collagen was confirmed at the protein level by immunofluorescence and western blot analyses. Our results demonstrate that RTM28, which covers >60% of all mutations reported in DEB and is thus the longest RTM described so far for the repair of COL7A1, represents a promising candidate for therapeutic applications.

Examining Fundamental Movement Competency and Closed-Chain Upper-Extremity Dynamic Balance in Swimmers.

PubMed

Bullock, Garrett S; Brookreson, Nate; Knab, Amy M; Butler, Robert J

2017-06-01

Abnormal fundamental movement patterns and upper-quarter dynamic balance are proposed mechanisms affecting athletic performance and injury risk. There are few studies investigating functional movement and closed-chain upper-extremity dynamic stability in swimmers. The purpose of this study was to determine differences in fundamental movement competency and closed-chain upper-extremity dynamic balance, using the Functional Movement Screen (FMS) and Upper-Quarter Y Balance Test (YBT-UQ), of high school (HS; n = 70) and collegiate (COL; n = 70) swimmers. Variables included the individual movement tests on the FMS and the average normalized reach (percent limb length [%LL]) for each direction, with the YBT-UQ. Statistical analysis was completed using a chi square for the independent test scores on the FMS while independent samples t-test to examine performance on the YBT-UQ (p ≤ 0.05). HS swimmers exhibited a statistically significant greater percentage of below average performance (score of 0 or 1) on the following FMS tests: lunge (HS: 22.9%, COL: 4.3%), hurdle step (HS: 31.4%, COL: 7.1%), and push-up (HS: 61.4%, COL: 31.4%). Furthermore, COL males performed worse in the lunge (male: 9%, female: 0%), whereas COL females had poorer efficiency in the push-up (male: 17.6%, female: 44%). Significant effects of competition level and sex were observed in YBT-UQ medial reach (HS: female 92.06, male 101.63; COL: female 101.3, male 101.5% LL). Individual fundamental movement patterns that involved lumbopelvic neuromuscular control differed between HS and COL swimmers. General upper-extremity dynamic balance differed between competition levels. These data may be helpful in understanding injury and performance-based normative data for participation and return to swimming.

Polymorphisms within the COL5A1 gene and regulators of the extracellular matrix modify the risk of Achilles tendon pathology in a British case-control study.

PubMed

Brown, Karryn L; Seale, Kirsten B; El Khoury, Louis Y; Posthumus, Michael; Ribbans, William J; Raleigh, Stuart M; Collins, Malcolm; September, Alison V

2017-08-01

Several genetic loci have been associated with risk of Achilles tendon pathology (ATP) within South African and Australian populations. The aim of this study was, therefore, to evaluate eight previously implicated genetic variants in an independent British population. A total of 130 asymptomatic controls (CON) and 112 participants clinically diagnosed with ATP comprising 87 individuals with chronic Achilles tendinopathy (TEN) and 25 with Achilles tendon ruptures (RUP) were included. All participants were genotyped for variants within the COL5A1, MIR608, IL-1β, IL-6 and CASP8 genes. Primary findings implicated COL5A1 and CASP8. Three inferred allele combinations constructed from COL5A1 rs12722, rs3196378 and rs71746744 were identified as risk modifiers. The T-C-D combination was associated with increased risk of ATP (P = 0.023) and RUP (P < 0.001), the C-A-I combination was associated with increased risk of ATP (P = 0.011), TEN (P = 0.011) and RUP (P = 0.011) and the C-C-D combination was associated with decreased risk of ATP (P = 0.011) and RUP (P = 0.004). The CASP8 rs3834129 DD genotype was associated with decreased risk of TEN (P = 0.020, odds ratio: 0.45, 95% confidence interval: 0.22-0.90) and the CASP8 I-G (rs3834129-rs1045485) inferred allele combination was associated with increased risk of TEN (P = 0.031). This study further highlights the importance of polymorphisms within COL5A1 and CASP8 in the aetiology of ATP.

Col4a1 mutations cause progressive retinal neovascular defects and retinopathy

PubMed Central

Alavi, Marcel V.; Mao, Mao; Pawlikowski, Bradley T.; Kvezereli, Manana; Duncan, Jacque L.; Libby, Richard T.; John, Simon W. M.; Gould, Douglas B.

2016-01-01

Mutations in collagen, type IV, alpha 1 (COL4A1), a major component of basement membranes, cause multisystem disorders in humans and mice. In the eye, these include anterior segment dysgenesis, optic nerve hypoplasia and retinal vascular tortuosity. Here we investigate the retinal pathology in mice carrying dominant-negative Col4a1 mutations. To this end, we examined retinas longitudinally in vivo using fluorescein angiography, funduscopy and optical coherence tomography. We assessed retinal function by electroretinography and studied the retinal ultrastructural pathology. Retinal examinations revealed serous chorioretinopathy, retinal hemorrhages, fibrosis or signs of pathogenic angiogenesis with chorioretinal anastomosis in up to approximately 90% of Col4a1 mutant eyes depending on age and the specific mutation. To identify the cell-type responsible for pathogenesis we generated a conditional Col4a1 mutation and determined that primary vascular defects underlie Col4a1-associated retinopathy. We also found focal activation of Müller cells and increased expression of pro-angiogenic factors in retinas from Col4a1+/Δex41mice. Together, our findings suggest that patients with COL4A1 and COL4A2 mutations may be at elevated risk of retinal hemorrhages and that retinal examinations may be useful for identifying patients with COL4A1 and COL4A2 mutations who are also at elevated risk of hemorrhagic strokes. PMID:26813606

Assessment of Fine Needle Aspiration Feasibility and Specimen Adequacy for Molecular Diagnostics of Benign Vocal Fold Lesions

PubMed Central

Li, Nicole Y. K.; Dailey, Seth; Thibeault, Susan L.

2014-01-01

Objectives/Hypothesis The use of molecular testing is becoming more significant for the diagnosis and classification of disease. The application of fine-needle aspiration (FNA) biopsy as the means of sampling lesions in union with molecular testing could be a powerful combination in laryngology. The objectives of this study were to investigate 1) if FNA was feasible to sample benign vocal fold lesions; 2) if FNA samples provided sufficient RNA quality for molecular analysis; and 3) if gene expression of FNA samples matched paired surgical excised specimens. Study Design Prospective cross-sectional. Methods Fifteen vocal fold specimens were obtained from adult patients undergoing routine surgical removal for benign vocal fold lesions using FNA and surgical excision. Comparisons were made between FNA and excision biopsies for RNA quality. Correlative analysis was completed for RNA expression of nine genes, including decorin (DCN), connective tissue growth factor (CTGF), vascular endothelial growth factor (VEGF), collagen type VI alpha 3 (COL6A3), superoxide dismutase 1 (SOD1), glutathione S-transferase (GST2), collagen type I alpha 2 (COL1A2), ATP binding cassette (ABC), and procollagen I alpha 1 (COL1A1). Results FNA and excision samples demonstrated similar RNA quality (P > 0.05). Per gene expression, four out of nine genes were moderately correlated between the paired samples (P < 0.05). Conclusions FNA of the vocal fold lamina propria is technically feasible to perform. Further improvement in the FNA technology is desirable to optimize RNA quality for reliable gene expression analysis. PMID:23404571

Distribution of genes for parathyroid hormone (PTH)-related peptide, Indian hedgehog, PTH receptor and patched in the process of experimental spondylosis in mice.

PubMed

Nakase, Takanobu; Ariga, Kenta; Meng, Wenxiang; Iwasaki, Motoki; Tomita, Tetsuya; Myoui, Akira; Yonenobu, Kazuo; Yoshikawa, Hideki

2002-07-01

Little is known about the molecular mechanisms underlying the process of spondylosis. The authors determined the extent of genetic localization of major regulators of chondrogenesis such as Indian hedgehog (Ihh) and parathyroid hormone (PTH)-related peptide (PTHrP) and their receptors during the development of spondylosis in their previously established experimental mouse model. Experimental spondylosis was induced in 5-week-old ICR mice. The cervical spines were chronologically harvested, and histological sections were prepared. Messenger (m) RNA for PTHrP, Ihh, PTH receptor (PTHR; a receptor for PTHrP), patched (Ptc; a receptor for Ihh), bone morphogenetic protein (BMP)-6, and collagen type X (COL10; a marker for mature chondrocyte) was localized in the tissue sections by performing in situ hybridization. In the early stage, mRNA for COL10, Ihh, and BMP-6 was absent; however, mRNA for PTHrP, PTHR, and Ptc was detected in the anterior margin of the cervical discs. In the late stage, evidence of COL10 mRNA began to be detected, and transcripts for Ihh, PTHrP, and BMP-6 were localized in hypertrophic chondrocytes adjacent to the bone-forming area in osteophyte. Messenger RNA for Ptc and PTHR continued to localize at this stage. In control mice, expression of these genes was absent. The localization of PTHrP, Ihh, BMP-6, and the receptors PTHR and Ptc demonstrated in the present experimental model indicates the possible involvement of molecular signaling by PTHrP (through the PTHR), Ihh (through the Ptc), and BMP-6 in the regulation of chondrocyte maturation leading to endochondral ossification in spondylosis.

Two Site-Directed Mutations are Required for the Conversion of a Sugar Dehydratase into an Aminotransferase¶

PubMed Central

Cook, Paul D.; Kubiak, Rachel L.; Toomey, Daniel P.; Holden, Hazel M.

2009-01-01

l-colitose and d-perosamine are unusual sugars found in the O-antigens of some Gram-negative bacteria such as Escherichia coli, Vibrio cholerae, and Salmonella enterica, among others. The biosynthetic pathways for these two sugars begin with the formation of GDP-mannose from d-mannose-1-phosphate and GTP followed by the subsequent dehydration and oxidation of GDP-mannose to yield GDP-4-keto-6-deoxymannose. Following the production of GDP-4-keto-6-deoxymannose, the two pathways diverge. In the case of GDP-perosamine biosynthesis, the next step involves an amination reaction at the C-4′ position of the sugar, whereas in GDP-colitose production, the 3′-hydroxyl group is removed. The enzymes catalyzing these reactions are GDP-perosamine synthase and GDP-4-keto-6-deoxymannose-3-dehydratase (ColD), respectively. Both of these enzymes are pyridoxal-5′-phosphate (PLP)-dependent and their three-dimensional structures place them into the well-characterized aspartate aminotransferase superfamily. A comparison of the active site architecture of ColD from Escherichia coli (Strain 5a, type O55:H7) to that of GDP-perosamine synthase from Caulobacter crescentus CB15, suggested that only two mutations would be required to convert ColD into an aminotransferase. Here we present a combined structural and functional analysis of the ColD S187N/H188K mutant protein that, indeed, has been converted from a dehydratase into an aminotransferase. PMID:19402712

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene.

PubMed

Dale, Rodney M; Topczewski, Jacek

2011-09-15

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5' of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene

PubMed Central

Dale, Rodney M.; Topczewski, Jacek

2011-01-01

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. PMID:21723274

Collagen type III alpha I is a gastro-oesophageal reflux disease susceptibility gene and a male risk factor for hiatus hernia

PubMed Central

Åsling, B; Jirholt, J; Hammond, P; Knutsson, M; Walentinsson, A; Davidson, G; Agreus, L; Lehmann, A; Lagerström-Fermer, M

2009-01-01

Background and objectives: Gastro-oesophageal reflux disease (GORD) is a common gastrointestinal disorder with a genetic component. Our aim was to identify genetic factors associated with GORD. Patients and methods: Four separate patient cohorts were analysed using a step-wise approach. (1) Whole genome linkage analysis was performed in 36 families. (2) Candidate genes were tested for GORD association in a trio cohort. (3) Genetic association was replicated in a case–control cohort. We also investigated genetic association to hiatus hernia (HH). (4) Protein expression was analysed in oesophageal biopsies. Results: A region on chromosome 2, containing collagen type III alpha 1 (COL3A1), was identified (LOD = 3.3) in families with dominant transmission of GORD, stratified for hiatus hernia (HH). COL3A1 showed significant association with GORD in an independent paediatric trio cohort (pcorr = 0.003). The association was male specific (pcorr = 0.018). The COL3A1 association was replicated in an independent adult case control cohort (pcorr = 0.022). Moreover, male specific association to HH (pcorr = 0.019) was found for a SNP not associated to GORD. Collagen type III protein was more abundant in oesophageal biopsies from male patients with GORD (p = 0.03). Conclusion: COL3A1 is a disease-associated gene in both paediatric and adult GORD. Furthermore, we show that COL3A1 is genetically associated with HH in adult males. The GORD- and HH-associated alleles are different, indicating two separate mechanisms leading to disease. Our data provides new insight into GORD aetiology, identifying a connective tissue component and indicating a tissue remodelling mechanism in GORD. Our results implicate gender differences in the genetic risk for both for GORD and HH. PMID:19398442

[From cytogenetics to cytogenomics of dermatofibrosarcoma protuberans family of tumors].

PubMed

Bianchini, Laurence; Maire, Georges; Pedeutour, Florence

2007-02-01

Dermatofibrosarcoma protuberans (DP) is a rare, slow growing dermal neoplasm of intermediate malignancy. It is made of spindle-shaped tumor cells in a storiform pattern often positive for CD34. The preferred treatment for DP is a surgical wide excision with pathologically sane margins of 3 cm. At the cytogenetic level, DP cells are characterized by either supernumerary ring chromosomes composed of sequences derived from chromosomes 17 and 22 or more rarely of translocations t(17;22). Rings have been mainly observed in adults whereas translocations have been reported in all pediatric cases. These chromosomal rearrangements lead to the formation of a specific fusion gene : COL1A1-PDGFB detected in rings as well as in translocations. DP is therefore a unique example of tumor in which the same molecular event occurs either on rings or linear translocation derivatives and the chromosomal abnormalities display an age-related pattern. So far, the COL1A1-PDGFB fusion gene remains the only fusion gene identified in this tumor. It is also present in variant forms of DP such as giant cell fibroblastoma, Bednar tumor, adult superficial fibrosarcoma and the granular cell variant of DP demonstrating that these tumors are not distinct entities but morphological variants of DP. The breakpoint localization in PDGFB was found to be remarkably constant, placing exon 2 of PDGFB under the control of the COL1A1 promoter. In contrast, the COL1A1 breakpoint was found to be variably located within the exons of the alpha-helical coding region (exons 7-47). No correlation between the breakpoint location in COL1A1 and the age of the patient or any clinical or histological particularity has been established. Moreover, no preferential breakpoint appears to be more particularly linked to one or another variant of DP. The COL1A1-PDGFB fusion gene is detectable either by multiplex RT-PCR with a combination of forward primers designed from a variety of COL1A1 exons and one reverse primer for PDGFB exon 2, or by in situ fluorescence hybridization (FISH) on interphase nuclei from frozen or fixed paraffin-embbeded sections. The COL1A1-PDGFB fusion gene is not found in approximately 8% of DP cases, suggesting that genes other than COL1A1 or PDGFB might be involved in a small subset of cases. It has been proposed that PDGFB acts as a mitogen in DP cells by autocrine stimulation of the PDGF receptor. The PDGF receptor tyrosine kinase antagonist imatinib mesylate has recently been used in clinical trials; its efficiency has been demonstrated in several cases, which allows it to be considered as a novel treatment strategy for metastatic or locally advanced DP.

Skeletal mineralization deficits and impaired biogenesis and function of chondrocyte-derived matrix vesicles in Phospho1−/− and Phospho1/Pit1 double knockout mice

PubMed Central

Yadav, Manisha C.; Bottini, Massimo; Cory, Esther; Bhattacharya, Kunal; Kuss, Pia; Narisawa, Sonoko; Sah, Robert L.; Beck, Laurent; Fadeel, Bengt; Farquharson, Colin; Millán, José Luis

2016-01-01

We have previously shown that ablation of either the Phospho1 or Alpl gene, encoding PHOSPHO1 and tissue-nonspecific alkaline phosphatase (TNAP) respectively, lead to hyperosteoidosis but that their chondrocyte- and osteoblast-derived matrix vesicles (MVs) are able to initiate mineralization. In contrast, the double ablation of Phospho1 and Alpl completely abolish initiation and progression of skeletal mineralization. We argued that MVs initiate mineralization by a dual mechanism: PHOSPHO1-mediated intravesicular generation of Pi and phosphate transporter-mediated influx of Pi. To test this hypothesis, we generated mice with col2a1-driven cre-mediated ablation of Slc20a1, hereafter referred to as Pit1, alone or in combination with a Phospho1 gene deletion. Pit1col2/col2 mice did not show any major phenotypic abnormalities, while severe skeletal deformities were observed in the [Phospho1−/−; Pit1col2/col2] double knockout mice that were more pronounced than those observed in the Phospho1−/− mice. Histological analysis of [Phospho1−/−; Pit1col2/col2] bones showed growth plate abnormalities with a shorter hypertrophic chondrocyte zone and extensive hyperosteoidosis. The [Phospho1−/−; Pit1col2/col2] skeleton displayed significantly decreases in BV/TV%, trabecular number and bone mineral density, as well as decreased stiffness, decreased strength, and increased post-yield deflection compared to Phospho1−/− mice. Using atomic force microscopy we found that ~80% of [Phospho1−/−; Pit1col2/col2] MVs were devoid of mineral in comparison to ~50 % for the Phospho1−/− MVs and ~25% for the WT and Pit1col2/col2 MVs. We also found a significant decrease in the number of MVs produced by both Phospho1−/− and [Phospho1−/−; Pit1col2/col2] chondrocytes. These data support the involvement of PiT-1 in the initiation of skeletal mineralization and provide compelling evidence that PHOSPHO1 function is involved in MV biogenesis. PMID:26773408

Novel recurrently mutated genes and a prognostic mutation signature in colorectal cancer.

PubMed

Yu, Jun; Wu, William K K; Li, Xiangchun; He, Jun; Li, Xiao-Xing; Ng, Simon S M; Yu, Chang; Gao, Zhibo; Yang, Jie; Li, Miao; Wang, Qiaoxiu; Liang, Qiaoyi; Pan, Yi; Tong, Joanna H; To, Ka F; Wong, Nathalie; Zhang, Ning; Chen, Jie; Lu, Youyong; Lai, Paul B S; Chan, Francis K L; Li, Yingrui; Kung, Hsiang-Fu; Yang, Huanming; Wang, Jun; Sung, Joseph J Y

2015-04-01

Characterisation of colorectal cancer (CRC) genomes by next-generation sequencing has led to the discovery of novel recurrently mutated genes. Nevertheless, genomic data has not yet been used for CRC prognostication. To identify recurrent somatic mutations with prognostic significance in patients with CRC. Exome sequencing was performed to identify somatic mutations in tumour tissues of 22 patients with CRC, followed by validation of 187 recurrent and pathway-related genes using targeted capture sequencing in additional 160 cases. Seven significantly mutated genes, including four reported (APC, TP53, KRAS and SMAD4) and three novel recurrently mutated genes (CDH10, FAT4 and DOCK2), exhibited high mutation prevalence (6-14% for novel cancer genes) and higher-than-expected number of non-silent mutations in our CRC cohort. For prognostication, a five-gene-signature (CDH10, COL6A3, SMAD4, TMEM132D, VCAN) was devised, in which mutation(s) in one or more of these genes was significantly associated with better overall survival independent of tumor-node-metastasis (TNM) staging. The median survival time was 80.4 months in the mutant group versus 42.4 months in the wild type group (p=0.0051). The prognostic significance of this signature was successfully verified using the data set from the Cancer Genome Atlas study. The application of next-generation sequencing has led to the identification of three novel significantly mutated genes in CRC and a mutation signature that predicts survival outcomes for stratifying patients with CRC independent of TNM staging. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Genome-wide Mechanosensitive MicroRNA (MechanomiR) Screen Uncovers Dysregulation of Their Regulatory Networks in the mdm Mouse Model of Muscular Dystrophy.

PubMed

Mohamed, Junaith S; Hajira, Ameena; Lopez, Michael A; Boriek, Aladin M

2015-10-09

Muscular dystrophies (MDs) are a heterogeneous group of genetic and neuromuscular disorders, which result in severe loss of motor ability and skeletal muscle mass and function. Aberrant mechanotransduction and dysregulated-microRNA pathways are often associated with the progression of MD. Here, we hypothesized that dysregulation of mechanosensitive microRNAs (mechanomiRs) in dystrophic skeletal muscle plays a major role in the progression of MD. To test our hypothesis, we performed a genome-wide expression profile of anisotropically regulated mechanomiRs and bioinformatically analyzed their target gene networks. We assessed their functional roles in the advancement of MD using diaphragm muscles from mdm (MD with myositis) mice, an animal model of human tibial MD (titinopathy), and their wild-type littermates. We were able to show that ex vivo anisotropic mechanical stretch significantly alters the miRNA expression profile in diaphragm muscles from WT and mdm mice; as a result, some of the genes associated with MDs are dysregulated in mdm mice due to differential regulation of a distinct set of mechanomiRs. Interestingly, we found a contrasting expression pattern of the highly expressed let-7 family mechanomiRs, let-7e-5p and miR-98-5p, and their target genes associated with the extracellular matrix and TGF-β pathways, respectively, between WT and mdm mice. Gain- and loss-of-function analysis of let-7e-5p in myocytes isolated from the diaphragms of WT and mdm mice confirmed Col1a1, Col1a2, Col3a1, Col24a1, Col27a1, Itga1, Itga4, Scd1, and Thbs1 as target genes of let-7e-5p. Furthermore, we found that miR-98 negatively regulates myoblast differentiation. Our study therefore introduces additional biological players in the regulation of skeletal muscle structure and myogenesis that may contribute to unexplained disorders of MD. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Global gene profiling of aging lungs in Atp8b1 mutant mice.

PubMed

Soundararajan, Ramani; Stearns, Timothy M; Czachor, Alexander; Fukumoto, Jutaro; Turn, Christina; Westermann-Clark, Emma; Breitzig, Mason; Tan, Lee; Lockey, Richard F; King, Benjamin L; Kolliputi, Narasaiah

2016-09-29

Recent studies implicate cardiolipin oxidation in several age-related diseases. Atp8b1 encoding Type 4 P-type ATPases is a cardiolipin transporter. Mutation in Atp8b1 gene or inflammation of the lungs impairs the capacity of Atp8b1 to clear cardiolipin from lung fluid. However, the link between Atp8b1 mutation and age-related gene alteration is unknown. Therefore, we investigated how Atp8b1 mutation alters age-related genes. We performed Affymetrix gene profiling of lungs isolated from young (7-9 wks, n=6) and aged (14 months, 14 M, n=6) C57BL/6 and Atp8b1 mutant mice. In addition, Ingenuity Pathway Analysis (IPA) was performed. Differentially expressed genes were validated by quantitative real-time PCR (qRT-PCR). Global transcriptome analysis revealed 532 differentially expressed genes in Atp8b1 lungs, 157 differentially expressed genes in C57BL/6 lungs, and 37 overlapping genes. IPA of age-related genes in Atp8b1 lungs showed enrichment of Xenobiotic metabolism and Nrf2-mediated signaling pathways. The increase in Adamts2 and Mmp13 transcripts in aged Atp8b1 lungs was validated by qRT-PCR. Similarly, the decrease in Col1a1 and increase in Cxcr6 transcripts was confirmed in both Atp8b1 mutant and C57BL/6 lungs. Based on transcriptome profiling, our study indicates that Atp8b1 mutant mice may be susceptible to age-related lung diseases.

A COL11A2 mutation in Labrador retrievers with mild disproportionate dwarfism.

PubMed

Frischknecht, Mirjam; Niehof-Oellers, Helena; Jagannathan, Vidhya; Owczarek-Lipska, Marta; Drögemüller, Cord; Dietschi, Elisabeth; Dolf, Gaudenz; Tellhelm, Bernd; Lang, Johann; Tiira, Katriina; Lohi, Hannes; Leeb, Tosso

2013-01-01

We describe a mild form of disproportionate dwarfism in Labrador Retrievers, which is not associated with any obvious health problems such as secondary arthrosis. We designate this phenotype as skeletal dysplasia 2 (SD2). It is inherited as a monogenic autosomal recessive trait with incomplete penetrance primarily in working lines of the Labrador Retriever breed. Using 23 cases and 37 controls we mapped the causative mutation by genome-wide association and homozygosity mapping to a 4.44 Mb interval on chromosome 12. We re-sequenced the genome of one affected dog at 30x coverage and detected 92 non-synonymous variants in the critical interval. Only two of these variants, located in the lymphotoxin A (LTA) and collagen alpha-2(XI) chain gene (COL11A2), respectively, were perfectly associated with the trait. Previously described COL11A2 variants in humans or mice lead to skeletal dysplasias and/or deafness. The dog variant associated with disproportionate dwarfism, COL11A2:c.143G>C or p.R48P, probably has only a minor effect on collagen XI function, which might explain the comparatively mild phenotype seen in our study. The identification of this candidate causative mutation thus widens the known phenotypic spectrum of COL11A2 mutations. We speculate that non-pathogenic COL11A2 variants might even contribute to the heritable variation in height.

A COL11A2 Mutation in Labrador Retrievers with Mild Disproportionate Dwarfism

PubMed Central

Frischknecht, Mirjam; Niehof-Oellers, Helena; Jagannathan, Vidhya; Owczarek-Lipska, Marta; Drögemüller, Cord; Dietschi, Elisabeth; Dolf, Gaudenz; Tellhelm, Bernd; Lang, Johann; Tiira, Katriina; Lohi, Hannes; Leeb, Tosso

2013-01-01

We describe a mild form of disproportionate dwarfism in Labrador Retrievers, which is not associated with any obvious health problems such as secondary arthrosis. We designate this phenotype as skeletal dysplasia 2 (SD2). It is inherited as a monogenic autosomal recessive trait with incomplete penetrance primarily in working lines of the Labrador Retriever breed. Using 23 cases and 37 controls we mapped the causative mutation by genome-wide association and homozygosity mapping to a 4.44 Mb interval on chromosome 12. We re-sequenced the genome of one affected dog at 30x coverage and detected 92 non-synonymous variants in the critical interval. Only two of these variants, located in the lymphotoxin A (LTA) and collagen alpha-2(XI) chain gene (COL11A2), respectively, were perfectly associated with the trait. Previously described COL11A2 variants in humans or mice lead to skeletal dysplasias and/or deafness. The dog variant associated with disproportionate dwarfism, COL11A2:c.143G>C or p.R48P, probably has only a minor effect on collagen XI function, which might explain the comparatively mild phenotype seen in our study. The identification of this candidate causative mutation thus widens the known phenotypic spectrum of COL11A2 mutations. We speculate that non-pathogenic COL11A2 variants might even contribute to the heritable variation in height. PMID:23527306

Analysis of four families with the Stickler syndrome by linkage studies. Identification of a new premature stop codon in the COL2A1 gene in a family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonaventure, J.; Lasselin, C.; Toutain, A.

1994-09-01

The Stickler syndrome is an arthro-ophthalmopathy which associates progressive myopia with vitreal degeneration and retinal detachment. Cleft palate, cranio-facial abnormalities, deafness and osteoarthritis are often associated symptoms. Genetic heterogeneity of this autosomal dominant disease was consistent with its large clinical variability. Linkage studies have provided evidence for cosegregation of the disease with COL2A1, the gene coding for type II collagen, in about 50% of the families. Four additional families are reported here. Linkage analyses by using a VNTR located in the 3{prime} region of the gene were achieved. In three families, positive lod scores were obtained with a cumulative maximalmore » value of 3.5 at a recombination fraction of 0. In one of these families, single strand conformation analysis of 25 exons disclosed a new mutation in exon 42. Codon for glutamic acid at position a1-803 was converted into a stop codon. The mutation was detected in DNA samples from all the affected members of the family but not in the unaffected. This result confirms that most of the Stickler syndromes linked to COL2A1 are due to premature stop codons. In a second family, an abnormal SSCP pattern of exon 34 was detected in all the affected individuals. The mutation is likely to correspond to a splicing defect in the acceptor site of intron 33. In one family the disease did not segregate with the COL2A1 locus. Further linkage studies with intragenic dimorphic sites in the COL10A1 gene and highly polymorphic markers close to the COL9A1 locus indicated that this disorder did not result from defects in these two genes.« less

Travelling and splitting of a wave of hedgehog expression involved in spider-head segmentation.

PubMed

Kanayama, Masaki; Akiyama-Oda, Yasuko; Nishimura, Osamu; Tarui, Hiroshi; Agata, Kiyokazu; Oda, Hiroki

2011-10-11

During development segmentation is a process that generates a spatial periodic pattern. Peak splitting of waves of gene expression is a mathematically predicted, simple strategy accounting for this type of process, but it has not been well characterized biologically. Here we show temporally repeated splitting of gene expression into stripes that is associated with head axis growth in the spider Achaearanea embryo. Preceding segmentation, a wave of hedgehog homologue gene expression is observed to travel posteriorly during development stage 6. This stripe, co-expressing an orthodenticle homologue, undergoes two cycles of splitting and shifting accompanied by convergent extension, serving as a generative zone for the head segments. The two orthodenticle and odd-paired homologues are identified as targets of Hedgehog signalling, and evidence suggests that their activities mediate feedback to maintain the head generative zone and to promote stripe splitting in this zone. We propose that the 'stripe-splitting' strategy employs genetic components shared with Drosophila blastoderm subdivision, which are required for participation in an autoregulatory signalling network.

Analysis of preplate splitting and early cortical development illuminates the biology of neurological disease.

PubMed

Olson, Eric C

2014-01-01

The development of the layered cerebral cortex starts with a process called preplate splitting. Preplate splitting involves the establishment of prospective cortical layer 6 (L6) neurons within a plexus of pioneer neurons called the preplate. The forming layer 6 splits the preplate into a superficial layer of pioneer neurons called the marginal zone and a deeper layer of pioneer neurons called the subplate. Disruptions of this early developmental event by toxin exposure or mutation are associated with neurological disease including severe intellectual disability. This review explores recent findings that reveal the dynamism of gene expression and morphological differentiation during this early developmental period. Over 1000 genes show expression increases of ≥2-fold during this period in differentiating mouse L6 neurons. Surprisingly, 88% of previously identified non-syndromic intellectual-disability (NS-ID) genes are expressed at this time and show an average expression increase of 1.6-fold in these differentiating L6 neurons. This changing genetic program must, in part, support the dramatic cellular reorganizations that occur during preplate splitting. While different models have been proposed for the formation of a layer of L6 cortical neurons within the preplate, original histological studies and more recent work exploiting transgenic mice suggest that the process is largely driven by the coordinated polarization and coalescence of L6 neurons rather than by cellular translocation or migration. The observation that genes associated with forms of NS-ID are expressed during very early cortical development raises the possibility of studying the relevant biological events at a time point when the cortex is small, contains relatively few cell types, and few functional circuits. This review then outlines how explant models may prove particularly useful in studying the consequence of toxin and mutation on the etiology of some forms of NS-ID.

Genetic associations of body composition, flexibility and injury risk with ACE, ACTN3 and COL5A1 polymorphisms in Korean ballerinas

PubMed Central

Kim, Jun Ho; Jung, Eun Sun; Kim, Chul-Hyun; Youn, Hyeon; Kim, Hwa Rye

2014-01-01

[Purpose] The purpose of this study was to exam the association of body composition, flexibility, and injury risk to genetic polymorphisms including ACE ID, ACTN3 RX, and COL5A1 polymorphisms in ballet dancers in Korea. [Methods] For the purpose of this study, elite ballerinas (n = 97) and normal female adults (n = 203) aged 18 to 39 were recruited and these participants were tested for body weight, height, body fat, fat free mass, flexibility, injury risks on the joints and gene polymorphisms (ACE, ACTN3, COL5A1 polymorphism). [Results] As results, the ACE DD genotype in ballerinas was associated with higher body fat and percentage of body fat than the ACE II and ID genotypes (p < 0.05). In the study on the ACTN3 polymorphism and ballerinas, the XX genotype in ballerinas had lower body weight and lower fat-free mass than the RR and RX genotype (p < 0.005). Also, the means of sit and reach test for flexibility was lower in the ACTN3 XX genotype of ballerinas than the RR and RX genotype of ballerinas (p < 0.05). Among the sports injuries, the ankle injury of the XX-genotyped ballerinas was in significantly more prevalence than the RR and XX-genotyped ballerinas (p < 0.05). According to the odd ratio analysis, XX-genotyped ballerinas have the injury risk on the ankle about 4.7 (95% CI: 1.6~13.4, p < 0.05) times more than the RR and RX-genotyped ballerinas. Meanwhile, the COL5A1 polymorphism in ballerinas has no association with any factors including flexibility and injury risks. [Conclusion] In conclusion, ACE polymorphism and ACTN3 polymorphism were associated with ballerinas' performance capacity; COL5A1 was not associated with any factors of performance of Ballerinas. The results suggested that the ACE DD genotype is associated with high body fat, the ACTN3 XX genotype is associated with low fat-free mass, low flexibility, and higher risk of ankle-joint injury. PMID:25566457

Genetics Home Reference: COL4A1-related brain small-vessel disease

MedlinePlus

... COL4A1-related brain small-vessel disease COL4A1-related brain small-vessel disease Printable PDF Open All Close ... view the expand/collapse boxes. Description COL4A1 -related brain small-vessel disease is part of a group ...

Upregulation of distinct collagen transcripts in post-surgery scar tissue: a study of conjunctival fibrosis.

PubMed

Seet, Li-Fong; Toh, Li Zhen; Chu, Stephanie W L; Finger, Sharon N; Chua, Jocelyn L L; Wong, Tina T

2017-06-01

Excessive accumulation of collagen is often used to assess the development of fibrosis. This study aims to identify collagen genes that define fibrosis in the conjunctiva following glaucoma filtration surgery (GFS). Using the mouse model of GFS, we have identified collagen transcripts that were upregulated in the fibrotic phase of wound healing via RNA-seq. The collagen transcripts that were increased the most were encoded by Col8a1 , Col11a1 and Col8a2 Further analysis of the Col8a1 , Col11a1 and Col8a2 transcripts revealed their increase by 67-, 54- and 18-fold, respectively, in the fibrotic phase, compared with 12-fold for Col1a1 , the most commonly evaluated collagen gene for fibrosis. However, only type I collagen was significantly upregulated at the protein level in the fibrotic phase. Type VIII and type I collagens colocalized in fibrous structures and in ACTA2-positive pericytes, and appeared to compensate for each other in expression levels. Type XI collagen showed low colocalization with both type VIII and type I collagens but can be found in association with macrophages. Furthermore, we show that both mouse and human conjunctival fibroblasts expressed elevated levels of the most highly expressed collagen genes in response to TGFβ2 treatment. Importantly, conjunctival tissues from individuals whose GF surgeries have failed due to scarring showed 3.60- and 2.78-fold increases in type VIII and I collagen transcripts, respectively, compared with those from individuals with no prior surgeries. These data demonstrate that distinct collagen transcripts are expressed at high levels in the conjunctiva after surgery and their unique expression profiles may imply differential influences on the fibrotic outcome. © 2017. Published by The Company of Biologists Ltd.

Effectiveness of a Layer-by-Layer Microbubbles-Based Delivery System for Applying Minoxidil to Enhance Hair Growth

PubMed Central

Liao, Ai-Ho; Lu, Ying-Jui; Lin, Yi-Chun; Chen, Hang-Kang; Sytwu, Huey-Kang; Wang, Chih-Hung

2016-01-01

Minoxidil (Mx) is a conventional drug for treating androgenetic alopecia, preventing hair loss, and promoting hair growth. The solubility of Mx has been improved using chemical enhancement methods to increase its skin permeability over the long term. This study created a new ultrasound (US) contrast agent—albumin-shelled microbubbles (MBs) that absorb chitosan oligosaccharide lactate (COL) and Mx—and combined it with sonication by US energy in the water phase to enhance hair growth while shortening the treatment period. COL and Mx grafted with MBs (mean diameter of 1480 nm) were synthesized into self-assembled complexes of COL-MBs and Mx-COL-MBs that had mean diameters of 4150 and 4500 nm, respectively. The US was applied at 3 W/cm2 for 1 min, and combined with Mx-COL-MBs containing 0.3% Mx. The diffusion of Mx through the dialysis membrane from Mx-COL-MB during US (US+Mx-COL-MB) was more rapid at pH 4 than at pH 7.4, which is favorable given that the environment of the scalp is mildly acidic (pH=4.5-5.5). In Franz diffusion experiments performed in vitro, the release rates at 18 hours in the US+Mx-COL-MBs and US+MBs+Mx groups resulted in 2.3 and 1.7 times the penetration and deposition, respectively, of Mx relative to the group with Mx alone. During 21 days treatment in animal experiments, the growth rates at days 10 and 14 in the US+Mx-COL-MBs group increased by 22.6% and 64.7%, respectively, and there were clear significant differences (p<0.05) between the US+Mx-COL-MBs group and the other four groups. The use of US+Mx-COL-MB in the water phase can increased the effects of Mx so as to shorten the telogen phase, and also increase both the diameter of keratinized hair shafts and the size of hair follicles without causing skin damage. PMID:27162552

Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

PubMed

Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

2016-12-01

Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

Identification of the Gene for Scleroderma in the Tsk/2 Mouse Strain: Implications for Human Scleroderma Pathogenesis and Subset Distinctions

DTIC Science & Technology

2014-09-01

onto an 8% SDS gel. Proteins were transferred to a polyvinylidene fluoride membrane, blocked in 5% nonfat milk in Tris-buffered saline, probed with...fibrosis (shown to be expressed at high levels in Tsk2/+ skin and used as  a marker of fibrosis [3, 4]), we assessed both  protein  and mRNA levels in...fibroblasts that received DNA from a  plasmid containing a single allele of a single Col3a1 gene. In three independent experiments, COL1A1  protein   was

Comparison between chondroprotective effects of glucosamine, curcumin, and diacerein in IL-1beta-stimulated C-28/I2 chondrocytes.

PubMed

Toegel, S; Wu, S Q; Piana, C; Unger, F M; Wirth, M; Goldring, M B; Gabor, F; Viernstein, H

2008-10-01

To compare the effects of glucosamine (GlcN), curcumin, and diacerein in immortalized human C-28/I2 chondrocytes at the cellular and the gene expression level. This study aimed to provide insights into the proposed beneficial effects of these agents and to assess the applicability of the C-28/I2 cell line as a model for the evaluation of chondroprotective action. Interleukin-1beta (IL-1beta)-stimulated C-28/I2 cells were cultured in the presence of GlcN, curcumin, and diacerein prior to the evaluation of parameters such as viability, morphology and proliferation. The impact of GlcN, curcumin, and diacerein on gene expression was determined using quantitative real-time RT-PCR (qPCR). At the transcriptional level, 5 mM GlcN and 50 microM diacerein increased the expression of cartilage-specific genes such as aggrecan (AGC) and collagen type II (COL2), while reducing collagen type I (COL1) mRNA levels. Moreover, the IL-1beta-mediated shift in gene expression pattern was antagonized by GlcN and diacerein. These effects were associated with a significant reduction in cellular proliferation and the development of chondrocyte-specific cell morphology. In contrast, curcumin was not effective at lower concentrations but even damaged the cells at higher amounts. Both GlcN and diacerein promoted a differentiated chondrocytic phenotype of immortalized human C-28/I2 chondrocytes by altering proliferation, morphology, and COL2/COL1 mRNA ratios. Moreover, both agents antagonized inhibitory effects of IL-1beta by enhancing AGC and COL2 as well as by reducing COL1 mRNA levels.

X-Linked Glomerulopathy Due to COL4A5 Founder Variant.

PubMed

Barua, Moumita; John, Rohan; Stella, Lorenzo; Li, Weili; Roslin, Nicole M; Sharif, Bedra; Hack, Saidah; Lajoie-Starkell, Ginette; Schwaderer, Andrew L; Becknell, Brian; Wuttke, Matthias; Köttgen, Anna; Cattran, Daniel; Paterson, Andrew D; Pei, York

2018-03-01

Alport syndrome is a rare hereditary disorder caused by rare variants in 1 of 3 genes encoding for type IV collagen. Rare variants in COL4A5 on chromosome Xq22 cause X-linked Alport syndrome, which accounts for ∼80% of the cases. Alport syndrome has a variable clinical presentation, including progressive kidney failure, hearing loss, and ocular defects. Exome sequencing performed in 2 affected related males with an undefined X-linked glomerulopathy characterized by global and segmental glomerulosclerosis, mesangial hypercellularity, and vague basement membrane immune complex deposition revealed a COL4A5 sequence variant, a substitution of a thymine by a guanine at nucleotide 665 (c.T665G; rs281874761) of the coding DNA predicted to lead to a cysteine to phenylalanine substitution at amino acid 222, which was not seen in databases cataloguing natural human genetic variation, including dbSNP138, 1000 Genomes Project release version 01-11-2004, Exome Sequencing Project 21-06-2014, or ExAC 01-11-2014. Review of the literature identified 2 additional families with the same COL4A5 variant leading to similar atypical histopathologic features, suggesting a unique pathologic mechanism initiated by this specific rare variant. Homology modeling suggests that the substitution alters the structural and dynamic properties of the type IV collagen trimer. Genetic analysis comparing members of the 3 families indicated a distant relationship with a shared haplotype, implying a founder effect. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

Generation of integration-free induced pluripotent stem cell lines derived from two patients with X-linked Alport syndrome (XLAS).

PubMed

Kuebler, Bernd; Aran, Begoña; Miquel-Serra, Laia; Muñoz, Yolanda; Ars, Elisabet; Bullich, Gemma; Furlano, Monica; Torra, Roser; Marti, Merce; Veiga, Anna; Raya, Angel

2017-12-01

Skin biopsies were obtained from two male patients with X-linked Alport syndrome (XLAS) with hemizygous COL4A5 mutations in exon 41 or exon 46. Dermal fibroblasts were extracted and reprogrammed by nucleofection with episomal plasmids carrying OCT3/4, SOX2, KLF4 LIN28, L-MYC and p53 shRNA. The generated induced Pluripotent Stem Cell (iPSC) lines AS-FiPS2-Ep6F-28 and AS-FiPS3-Ep6F-9 were free of genomically integrated reprogramming genes, had the specific mutations, a stable karyotype, expressed pluripotency markers and generated embryoid bodies which were differentiated towards the three germ layers in vitro. These iPSC lines offer a useful resource to study Alport syndrome pathomechanisms and drug testing. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Jellyfish collagen and alginate: Combined marine materials for superior chondrogenesis of hMSC.

PubMed

Pustlauk, W; Paul, B; Gelinsky, M; Bernhardt, A

2016-07-01

Marine, hybrid constructs of porous scaffolds from fibrillized jellyfish collagen and alginate hydrogel are mimicking both of the main tissue components of cartilage, thus being a promising approach for chondrogenic differentiation of human mesenchymal stem cells (hMSC). Investigating their potential for articular cartilage repair, the present study examined scaffolds being either infiltrated with an alginate-cell-suspension (ACS) or seeded with hMSC and embedded in alginate after cell adhesion (EAS). Hybrid constructs with 2×10(5) and 4.5×10(5)hMSC/scaffold were compared to hMSC encapsulated in pure alginate discs, both chondrogenically stimulated for 21days. Typical round, chondrocyte-like morphology was observed in pure alginate gels and ACS scaffolds, while cells in EAS were elongated and tightly attached to the collagen pores. Col 2 gene expression was comparable in all scaffold types examined. However, the Col 2/Col 1 ratio was higher for pure alginate discs and ACS scaffolds compared to EAS. In contrast, cells in EAS scaffolds displayed higher gene expression of Sox 9, Col 11 and ACAN compared to ACS and pure alginate. Secretion of sulfated glycosaminoglycans (sGAG) was comparable for ACS and EAS scaffolds. In conclusion hybrid constructs of jellyfish collagen and alginate support hMSC chondrogenic differentiation and provide more stable and constructs compared to pure hydrogels. Copyright © 2016 Elsevier B.V. All rights reserved.

Digital gene expression analysis of corky split vein caused by boron deficiency in 'Newhall' Navel Orange (Citrus sinensis Osbeck) for selecting differentially expressed genes related to vascular hypertrophy.

PubMed

Yang, Cheng-Quan; Liu, Yong-Zhong; An, Ji-Cui; Li, Shuang; Jin, Long-Fei; Zhou, Gao-Feng; Wei, Qing-Jiang; Yan, Hui-Qing; Wang, Nan-Nan; Fu, Li-Na; Liu, Xiao; Hu, Xiao-Mei; Yan, Ting-Shuai; Peng, Shu-Ang

2013-01-01

Corky split vein caused by boron (B) deficiency in 'Newhall' Navel Orange was studied in the present research. The boron-deficient citrus exhibited a symptom of corky split vein in mature leaves. Morphologic and anatomical surveys at four representative phases of corky split veins showed that the symptom was the result of vascular hypertrophy. Digital gene expression (DGE) analysis was performed based on the Illumina HiSeq™ 2000 platform, which was applied to analyze the gene expression profilings of corky split veins at four morphologic phases. Over 5.3 million clean reads per library were successfully mapped to the reference database and more than 22897 mapped genes per library were simultaneously obtained. Analysis of the differentially expressed genes (DEGs) revealed that the expressions of genes associated with cytokinin signal transduction, cell division, vascular development, lignin biosynthesis and photosynthesis in corky split veins were all affected. The expressions of WOL and ARR12 involved in the cytokinin signal transduction pathway were up-regulated at 1(st) phase of corky split vein development. Furthermore, the expressions of some cell cycle genes, CYCs and CDKB, and vascular development genes, WOX4 and VND7, were up-regulated at the following 2(nd) and 3(rd) phases. These findings indicated that the cytokinin signal transduction pathway may play a role in initiating symptom observed in our study.

A novel COL1A1 mutation in a family with osteogenesis imperfecta associated with phenotypic variabilities

PubMed Central

Seto, Toshiyuki; Yamamoto, Toshiyuki; Shimojima, Keiko; Shintaku, Haruo

2017-01-01

Osteogenesis imperfecta (OI) is a heterogeneous disorder that is characterized by bone fragility and systemic complications, and is mainly caused by gene mutations in COL1A1 or COL1A2. A novel COL1A1 splicing mutation, c.750+2T>A, was identified in a Japanese OI family. Only the proband in this family showed various complications, such as heart valve diseases and severe scoliosis. The clinical heterogeneity in the family is discussed in this study. PMID:28326186

Biocompatibility of a Sonicated Silk Gel for Cervical Injection During Pregnancy

PubMed Central

Critchfield, Agatha S.; Mccabe, Reid; Klebanov, Nikolai; Richey, Lauren; Socrate, Simona; Norwitz, Errol R.; Kaplan, David L.; House, Michael

2014-01-01

Objective: To evaluate the biocompatibility of silk gel for cervical injection. Study Design: Silk gel was injected into the cervix of pregnant rats on day 13 (n = 11) and harvested at day 17. Histology of silk gel was compared with suture controls. Also, human cervical fibroblasts were cultured on silk gel and tissue culture plastic (TCP) in vitro. Cell viability, proliferation, metabolic activity, gene expression (COL1A1, COL3A1, and COX2), and release of proinflammatory mediators (interleukin [IL] 6 and IL-8) were evaluated. Results: In vivo, a mild foreign body response was seen surrounding the silk gel and suture controls. In vitro, cervical fibroblasts were viable, metabolically active, and proliferating at 72 hours. Release of IL-6 and IL-8 was similar on silk gel and TCP. Collagen and COX2 gene expression was similar or slightly decreased compared with TCP. Conclusions: Silk gel was well tolerated in vivo and in vitro, which supports continuing efforts to develop silk gels as an alternative to cervical cerclage. PMID:24520079

Identification of the Gene for Scleroderma in the Tsk/2 Mouse Strain: Implicationsfor Human Scleroderma Pathogenesis and Subset Distinctions

DTIC Science & Technology

2013-07-01

www.le.ac.uk/ge/collagen/), in addition to mutations on COL1A1 and COL5A2. These mutations result in amino acid substitutions, RNA splicing...fibrillogenesis of type I collagen resulting in thinner collagen fibrils [29]. In the absence of PIIINP, Romanic and colleagues demonstrate that COL1A1 is...larger, shorter, and apparently stiffer; whereas in the presence of PIIINP/ COL1A1 copolymer, the type I collagen was longer, thinner, and more

Is the COL5A1 rs12722 gene polymorphism associated with running economy?

PubMed

Bertuzzi, Rômulo; Pasqua, Leonardo A; Bueno, Salomão; Lima-Silva, Adriano Eduardo; Matsuda, Monique; Marquezini, Monica; Saldiva, Paulo H

2014-01-01

The COL5A1 rs12722 polymorphism is considered to be a novel genetic marker for endurance running performance. It has been postulated that COL5A1 rs12722 may influence the elasticity of tendons and the energetic cost of running. To date, there are no experimental data in the literature supporting the relationship between range of motion, running economy, and the COL5A1 rs12722 gene polymorphism. Therefore, the main purpose of the current study was to analyze the influence of the COL5A1rs12722 polymorphism on running economy and range of motion. One hundred and fifty (n = 150) physically active young men performed the following tests: a) a maximal incremental treadmill test, b) two constant-speed running tests (10 km · h(-1)) and 12 km · h(-1)) to determine the running economy, and c) a sit-and-reach test to determine the range of motion. All of the subjects were genotyped for the COL5A1 rs12722 single-nucleotide polymorphism. The genotype frequencies were TT = 27.9%, CT = 55.8%, and CC = 16.3%. There were no significant differences between COL5A1 genotypes for running economy measured at 10 km · h(-1) (p = 0.232) and 12 km · h(-1) (p = 0.259). Similarly, there were no significant differences between COL5A1 genotypes for range of motion (p = 0.337). These findings suggest that the previous relationship reported between COL5A1 rs12722 genotypes and running endurance performance might not be mediated by the energetic cost of running.

Is the COL5A1 rs12722 Gene Polymorphism Associated with Running Economy?

PubMed Central

Bertuzzi, Rômulo; Pasqua, Leonardo A.; Bueno, Salomão; Lima-Silva, Adriano Eduardo; Matsuda, Monique; Marquezini, Monica; Saldiva, Paulo H.

2014-01-01

The COL5A1 rs12722 polymorphism is considered to be a novel genetic marker for endurance running performance. It has been postulated that COL5A1 rs12722 may influence the elasticity of tendons and the energetic cost of running. To date, there are no experimental data in the literature supporting the relationship between range of motion, running economy, and the COL5A1 rs12722 gene polymorphism. Therefore, the main purpose of the current study was to analyze the influence of the COL5A1rs12722 polymorphism on running economy and range of motion. One hundred and fifty (n = 150) physically active young men performed the following tests: a) a maximal incremental treadmill test, b) two constant-speed running tests (10 km•h−1 and 12 km•h−1) to determine the running economy, and c) a sit-and-reach test to determine the range of motion. All of the subjects were genotyped for the COL5A1 rs12722 single-nucleotide polymorphism. The genotype frequencies were TT = 27.9%, CT = 55.8%, and CC = 16.3%. There were no significant differences between COL5A1 genotypes for running economy measured at 10 km•h−1 (p = 0.232) and 12 km•h−1 (p = 0.259). Similarly, there were no significant differences between COL5A1 genotypes for range of motion (p = 0.337). These findings suggest that the previous relationship reported between COL5A1 rs12722 genotypes and running endurance performance might not be mediated by the energetic cost of running. PMID:25188268

The transmembrane collagen COL-99 guides longitudinally extending axons in C. elegans.

PubMed

Taylor, Jesse; Unsoeld, Thomas; Hutter, Harald

2018-06-01

We have identified the transmembrane collagen, COL-99, in a genetic screen for novel genes involved in axon guidance in the nematode C. elegans. COL-99 is similar to transmembrane collagens type XIII, XXIII and XXV in vertebrates. col-99 mutants exhibit guidance defects in axons extending along the major longitudinal axon tracts, most prominently the left ventral nerve cord (VNC). COL-99 is expressed in the hypodermis during the time of axon outgrowth. We provide evidence that a furin cleavage site in COL-99 is essential for function, suggesting that COL-99 is released from the cells producing it. Vertebrate homologs of COL-99 have been shown to be expressed in mammalian nervous systems and linked to various neurological disease but have not been associated with guidance of extending neurons. col-99 acts genetically with the discoidin domain receptors ddr-1 and ddr-2, which are expressed by neurons affected in col-99 mutants. Discoidin domain receptors are activated by collagens in vertebrates. DDR-1 and DDR-2 may function as receptors for COL-99. Our results establish a novel role for a transmembrane collagen in axonal guidance and asymmetry establishment of the VNC. Copyright © 2018 Elsevier Inc. All rights reserved.

Fine Time Course Expression Analysis Identifies Cascades of Activation and Repression and Maps a Putative Regulator of Mammalian Sex Determination

PubMed Central

Looger, Loren L.; Ohler, Uwe; Capel, Blanche

2013-01-01

In vertebrates, primary sex determination refers to the decision within a bipotential organ precursor to differentiate as a testis or ovary. Bifurcation of organ fate begins between embryonic day (E) 11.0–E12.0 in mice and likely involves a dynamic transcription network that is poorly understood. To elucidate the first steps of sexual fate specification, we profiled the XX and XY gonad transcriptomes at fine granularity during this period and resolved cascades of gene activation and repression. C57BL/6J (B6) XY gonads showed a consistent ∼5-hour delay in the activation of most male pathway genes and repression of female pathway genes relative to 129S1/SvImJ, which likely explains the sensitivity of the B6 strain to male-to-female sex reversal. Using this fine time course data, we predicted novel regulatory genes underlying expression QTLs (eQTLs) mapped in a previous study. To test predictions, we developed an in vitro gonad primary cell assay and optimized a lentivirus-based shRNA delivery method to silence candidate genes and quantify effects on putative targets. We provide strong evidence that Lmo4 (Lim-domain only 4) is a novel regulator of sex determination upstream of SF1 (Nr5a1), Sox9, Fgf9, and Col9a3. This approach can be readily applied to identify regulatory interactions in other systems. PMID:23874228

RAAS inhibition and the course of Alport syndrome.

PubMed

Savva, Isavella; Pierides, Alkis; Deltas, Constantinos

2016-05-01

Alport syndrome (AS) is a hereditary progressive glomerulonephritis with a high life-time risk for end-stage renal disease (ESRD). Most patients will reach ESRD before the age of 30 years, while a subset of them with milder mutations will do so at older ages, even after 50 years. Frequent extrarenal manifestations are hearing loss and ocular abnormalities. AS is a genetically heterogeneous collagen IV nephropathy, with 85% of the cases caused by mutations in the X-linked COL4A5 gene and the rest by homozygous or compound heterozygous mutations in either the COL4A3 or the COL4A4 gene on chromosome 2q36-37. There is no radical cure for the disease and attempts to use various stem cell therapies in animal models have been met with ambiguous success. However, effective treatment has been accomplished with pharmacological intervention at the renin-angiotensin-aldosterone system (RAAS), first in animal models of AS and more recently in humans. Angiotensin converting enzyme inhibitors (ACEis) and angiotensin receptor blockers (ARBs) have been shown to significantly delay the progression of chronic kidney disease and the onset of ESRD. Also, renin inhibitors and aldosterone blockade were used with positive results, while the combination of ACEis and ARBs was met with mixed success. An important study, the EARLY-PROTECT, aims at evaluating the efficacy of ACEis when administered very early on in children with AS. Novel therapies are also tested experimentally or are under design in animal models by several groups, including the use of amniotic fluid stem cells and synthetic chaperones. Copyright © 2016 Elsevier Ltd. All rights reserved.

Essential role for the alpha 1 chain of type VIII collagen in zebrafish notochord formation.

PubMed

Gansner, John M; Gitlin, Jonathan D

2008-12-01

Several zebrafish mutants identified in large-scale forward genetic screens exhibit notochord distortion. We now report the cloning and further characterization of one such mutant, gulliver(m208) (gul(m208)). The notochord defect in gul(m208) mutants is exacerbated under conditions of copper depletion or lysyl oxidase cuproenzyme inhibition that are without a notochord effect on wild-type embryos. The gul(m208) phenotype results from a missense mutation in the gene encoding Col8a1, a lysyl oxidase substrate, and morpholino knockdown of col8a1 recapitulates the notochord distortion observed in gul(m208) mutants. Of interest, the amino acid mutated in gul(m208) Col8a1 is highly conserved, and the equivalent substitution in a closely related human protein, COL10A1, causes Schmid metaphyseal chondrodysplasia. Taken together, the data identify a new protein essential for notochord morphogenesis, extend our understanding of gene-nutrient interactions in early development, and suggest that human mutations in COL8A1 may cause structural birth defects. (c) 2008 Wiley-Liss, Inc.

Negative Staining for COL4A5 Correlates With Worse Prognosis and More Severe Ultrastructural Alterations in Males With Alport Syndrome.

PubMed

Said, Samar M; Fidler, Mary E; Valeri, Anthony M; McCann, Brooke; Fiedler, Wade; Cornell, Lynn D; Alexander, Mariam Priya; Alkhunaizi, Ahmed M; Sullivan, Anne; Cramer, Carl H; Hogan, Marie C; Nasr, Samih H

2017-01-01

Alport syndrome (AS) is a genetic disorder characterized by progressive hematuric nephropathy with or without sensorineural hearing loss and ocular lesions. Previous studies on AS included mostly children. To determine the prognostic value of loss of staining for collagen type IV alpha 5 (COL4A5) and its relationship with the ultrastructural glomerular basement membrane alterations, we performed direct immunofluorescence using a mixture of fluorescein isothiocyanate-conjugated and Texas-red conjugated antibodies against COL4A5 and COL4A2, respectively, on renal biopsies of 25 males with AS (including 16 who were diagnosed in adulthood). All patients showed normal positive staining of glomerular basement membranes and tubular basement membranes for COL4A2. Of the 25 patients, 10 (40%) patients showed loss of staining for COL4A5 (including 89% of children and 13% of adults) and the remaining 15 (60%) had intact staining for COL4A5. Compared with patients with intact staining for COL4A5, those with loss of staining had more prominent ultrastructural glomerular basement membrane alterations and were younger at the time of biopsy. By Kaplan-Meier survival analysis and Cox regression analysis, loss of staining for COL4A5 predicted earlier progression to overt proteinuria and stage 2 chronic kidney disease or worse. By multivariate Cox regression analysis, loss of staining for COL4A5 was an independent predictor of the development of overt proteinuria and stage 2 chronic kidney disease or worse. Thus, the COL4A5 expression pattern has an important prognostic value and it correlates with the severity of ultrastructural glomerular basement membrane alterations in males with AS. Loss of COL4A5 staining is uncommon in patients with AS diagnosed in their adulthood.

A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish.

PubMed

Radev, Zlatko; Hermel, Jean-Michel; Elipot, Yannick; Bretaud, Sandrine; Arnould, Sylvain; Duchateau, Philippe; Ruggiero, Florence; Joly, Jean-Stéphane; Sohm, Frédéric

2015-01-01

Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders.

A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish

PubMed Central

Elipot, Yannick; Bretaud, Sandrine; Arnould, Sylvain; Duchateau, Philippe; Ruggiero, Florence; Joly, Jean-Stéphane; Sohm, Frédéric

2015-01-01

Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders. PMID:26221953

Morphological and proteomic analysis of early stage of osteoblast differentiation in osteoblastic progenitor cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Dun; Orthopedic Department, Taizhou Hospital, Wenzhou Medical College, Linhai, Zhejiang 317000; Chen, Hai-Xiao, E-mail: Hxchen-1@163.net

Bone remodeling relies on a dynamic balance between bone formation and resorption, mediated by osteoblasts and osteoclasts, respectively. Under certain stimuli, osteoprogenitor cells may differentiate into premature osteoblasts and further into mature osteoblasts. This process is marked by increased alkaline phosphatase (ALP) activity and mineralized nodule formation. In this study, we induced osteoblast differentiation in mouse osteoprogenitor MC3T3-E1 cells and divided the process into three stages. In the first stage (day 3), the MC3T3-E1 cell under osteoblast differentiation did not express ALP or deposit a mineralized nodule. In the second stage, the MC3T3-E1 cell expressed ALP but did not formmore » a mineralized nodule. In the third stage, the MC3T3-E1 cell had ALP activity and formed mineralized nodules. In the present study, we focused on morphological and proteomic changes of MC3T3-E1 cells in the early stage of osteoblast differentiation - a period when premature osteoblasts transform into mature osteoblasts. We found that mean cell area and mean stress fiber density were increased in this stage due to enhanced cell spreading and decreased cell proliferation. We further analyzed the proteins in the signaling pathway of regulation of the cytoskeleton using a proteomic approach and found upregulation of IQGAP1, gelsolin, moesin, radixin, and Cfl1. After analyzing the focal adhesion signaling pathway, we found the upregulation of FLNA, LAMA1, LAMA5, COL1A1, COL3A1, COL4A6, and COL5A2 as well as the downregulation of COL4A1, COL4A2, and COL4A4. In conclusion, the signaling pathway of regulation of the cytoskeleton and focal adhesion play critical roles in regulating cell spreading and actin skeleton formation in the early stage of osteoblast differentiation.« less

Col2-Cre and tamoxifen-inducible Col2-CreER target different cell populations in the knee joint

PubMed Central

Nagao, Masashi; Cheong, Chan Wook; Olsen, Bjorn

2015-01-01

Objective Collagen type 2 (Col2)-Cre or tamoxifen-inducible Col2-CreER transgenic mouse lines have been used for studies to explore the cellular and molecular pathogenesis of osteoarthritis (OA). The purpose of this study is to investigate whether the targeted cells are the same or different in the two mouse lines. Methods We crossed tamoxifen inducible Col2-CreER and Col2-Cre mice with Rosa tdTomato reporter mice and analyzed the labeling patterns at different time points. Results In the Col2-CreER mice, 90.8 [95% confidence interval (CI) (88.3, 93.2)] and 82.8 (77.4, 88.3) % of the articular surface cells are Tomato positive when tamoxifen was administered at 2 and 2.5 weeks of age and strong activity was observed even 4.5 months after injection. However, 46.0 (32.8, 59.1) and 22.2 (11.7, 32.6) % of the surface cells were Tomato positive when tamoxifen was administered at 3 and 4 weeks of age, respectively. Little to no Tomato activity in the articular surface cells was observed when tamoxifen was administered at 8 weeks of age. At any stage of tamoxifen injection, the Tomato activity was detected in growth plate and epiphyseal bone in addition to articular chondrocytes, but little in endothelium and not in the synovium and ligament. In contrast, the targeted tissues in the Col2-Cre mouse line were articular cartilage, growth plate, meniscus, endosteum, ligament, bone and synovium. Conclusions This study demonstrates that the pattern of targeted cells in the inducible Col2-CreER mice are partially overlapping with but different from that of targeted cells in Col2-Cre mice and the pattern varies dependent on when tamoxifen is administered. PMID:26256767

Identification of gene expression profiles and key genes in subchondral bone of osteoarthritis using weighted gene coexpression network analysis.

PubMed

Guo, Sheng-Min; Wang, Jian-Xiong; Li, Jin; Xu, Fang-Yuan; Wei, Quan; Wang, Hai-Ming; Huang, Hou-Qiang; Zheng, Si-Lin; Xie, Yu-Jie; Zhang, Chi

2018-06-15

Osteoarthritis (OA) significantly influences the quality life of people around the world. It is urgent to find an effective way to understand the genetic etiology of OA. We used weighted gene coexpression network analysis (WGCNA) to explore the key genes involved in the subchondral bone pathological process of OA. Fifty gene expression profiles of GSE51588 were downloaded from the Gene Expression Omnibus database. The OA-associated genes and gene ontologies were acquired from JuniorDoc. Weighted gene coexpression network analysis was used to find disease-related networks based on 21756 gene expression correlation coefficients, hub-genes with the highest connectivity in each module were selected, and the correlation between module eigengene and clinical traits was calculated. The genes in the traits-related gene coexpression modules were subject to functional annotation and pathway enrichment analysis using ClusterProfiler. A total of 73 gene modules were identified, of which, 12 modules were found with high connectivity with clinical traits. Five modules were found with enriched OA-associated genes. Moreover, 310 OA-associated genes were found, and 34 of them were among hub-genes in each module. Consequently, enrichment results indicated some key metabolic pathways, such as extracellular matrix (ECM)-receptor interaction (hsa04512), focal adhesion (hsa04510), the phosphatidylinositol 3'-kinase (PI3K)-Akt signaling pathway (PI3K-AKT) (hsa04151), transforming growth factor beta pathway, and Wnt pathway. We intended to identify some core genes, collagen (COL)6A3, COL6A1, ITGA11, BAMBI, and HCK, which could influence downstream signaling pathways once they were activated. In this study, we identified important genes within key coexpression modules, which associate with a pathological process of subchondral bone in OA. Functional analysis results could provide important information to understand the mechanism of OA. © 2018 Wiley Periodicals, Inc.

A dermatofibrosarcoma protuberans-like tumor with COL1A1 copy number gain in the absence of t(17;22)

PubMed Central

Saab, Jad; Rosenthal, Ian M.; Wang, Lu; Busam, Klaus J.; Nehal, Kishwer S.; Dickson, Mark; Hameed, Meera; Hollmann, Travis J.

2017-01-01

A 57 year-old woman presented with a three year history of a progressive firm plaque on the right cheek. Skin biopsies revealed a bland, storiform, spindle cell proliferation involving the deep dermis and subcutaneous fat. By immunohistochemistry the tumor cells were diffusely positive for CD34 and caldesmon with multifocal reactivity for EMA and focal, weak staining for SMA. Retinoblastoma protein expression was not detectable in tumor cells by immunohistochemistry. An interphase FISH analysis for PDGFB gene rearrangement was negative. A SNP-array study detected 1) a gain of chromosome segment 17q21.33-q25.3 which overlapped the entire COL1A1 gene with a breakpoint at 17q21.33, approximately 250 Kb centromeric to the 3′ end of COL1A1 gene, 2) several segmental gains on chromosome 11 and 3) an RB1 gene locus with normal copy number and allele frequency. While the current case resembles DFSP, it is unique in that it demonstrates a copy number gain of chromosome 17q in the absence of fusion of COL1A1 and PDGFB genes and an unusual immunohistochemical staining profile. The morphologic and molecular findings suggest a novel molecular variant of DFSP not detectable with standard FISH for PDGFB rearrangement. This variant appears to respond to imatinib after 9 months of follow-up. PMID:27984233

Bromodomain and Extra-terminal (BET) Protein Inhibitors Suppress Chondrocyte Differentiation and Restrain Bone Growth.

PubMed

Niu, Ningning; Shao, Rui; Yan, Guang; Zou, Weiguo

2016-12-23

Small molecule inhibitors for bromodomain and extra-terminal (BET) proteins have recently emerged as potential therapeutic agents in clinical trials for various cancers. However, to date, it is unknown whether these inhibitors have side effects on bone structures. Here, we report that inhibition of BET bromodomain proteins may suppress chondrocyte differentiation and restrain bone growth. We generated a luciferase reporter system using the chondrogenic cell line ATDC5 in which the luciferase gene was driven by the promoter of Col2a1, an elementary collagen of the chondrocyte. The Col2a1-luciferase ATDC5 system was used for rapidly screening both activators and repressors of human collagen Col2a1 gene expression, and we found that BET bromodomain inhibitors reduce the Col2a1-luciferase. Consistent with the luciferase assay, BET inhibitors decrease the expression of Col2a1 Furthermore, we constructed a zebrafish line in which the enhanced green fluorescent protein (EGFP) expression was driven by col2a1 promoter. The transgenic (col2a1-EGFP) zebrafish line demonstrated that BET inhibitors I-BET151 and (+)-JQ1 may affect EGFP expression in zebrafish. Furthermore, we found that I-BET151 and (+)-JQ1 may affect chondrocyte differentiation in vitro and inhibit zebrafish growth in vivo Mechanistic analysis revealed that BET inhibitors influenced the depletion of RNA polymerase II from the Col2a1 promoter. Collectively, these results suggest that BET bromodomain inhibition may have side effects on skeletal bone structures. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Upregulation of genes related to bone formation by γ-amino butyric acid and γ-oryzanol in germinated brown rice is via the activation of GABAB-receptors and reduction of serum IL-6 in rats.

PubMed

Muhammad, Sani Ismaila; Maznah, Ismail; Mahmud, Rozi; Zuki, Abu Bakar Zakaria; Imam, Mustapha Umar

2013-01-01

Osteoporosis and other bone degenerative diseases are among the most challenging non-communicable diseases to treat. Previous works relate bone loss due to osteoporosis with oxidative stress generated by free radicals and inflammatory cytokines. Alternative therapy to hormone replacement has been an area of interest to researchers for almost three decades due to hormone therapy-associated side effects. In this study, we investigated the effects of gamma-amino butyric acid (GABA), gamma-oryzanol (ORZ), acylated steryl glucosides (ASG), and phenolic extracts from germinated brown rice (GBR) on the expression of genes related to bone metabolism, such as bone morphogenic protein-2 (BMP-2), secreted protein acidic and rich in cysteine (SPARC), runt-related transcription factor 2 (RUNX-2), osteoblast-specific transcription factor osterix (Osx), periostin, osteoblast specific factor (Postn), collagen 1&2 (Col1&2), calcitonin receptor gene (CGRP); body weight measurement and also serum interleukin-6 (IL-6) and osteocalcin, in serum and bone. Rats were treated with GBR, ORZ, GABA, and ASG at (100 and 200 mg/kg); estrogen (0.2 mg/kg), or remifemin (10 and 20 mg/kg), compared to ovariectomized non-treated group as well as non-ovariectomized non-treated (sham) group. Enzyme-linked immunosorbent assay was used to measure the IL-6 and osteocalcin levels at week 2, 4, and 8, while the gene expression in the bone tissue was determined using the Genetic Analysis System (Beckman Coulter Inc., Brea, CA, USA). The results indicate that groups treated with GABA (100 and 200 mg/kg) showed significant upregulation of SPARC, calcitonin receptor, and BMP-2 genes (P < 0.05), while the ORZ-treated group (100 and 200 mg/kg) revealed significant (P < 0.05) upregulation of Osx, Postn, RUNX-2, and Col1&2. Similarly, IL-6 concentration decreased, while osteocalcin levels increased significantly (P < 0.05) in the treated groups as compared to ovariectomized non-treated groups. GABA and ORZ from GBR stimulates osteoblastogenesis by upregulation of bone formation genes, possibly via the activation of GABAB receptors and by inhibiting the activity of inflammatory cytokines and reactive oxygen species. Therefore, it could be used effectively in the management of osteoporosis.

Upregulation of genes related to bone formation by γ-amino butyric acid and γ-oryzanol in germinated brown rice is via the activation of GABAB-receptors and reduction of serum IL-6 in rats

PubMed Central

Muhammad, Sani Ismaila; Maznah, Ismail; Mahmud, Rozi; Zuki, Abu Bakar Zakaria; Imam, Mustapha Umar

2013-01-01

Background Osteoporosis and other bone degenerative diseases are among the most challenging non-communicable diseases to treat. Previous works relate bone loss due to osteoporosis with oxidative stress generated by free radicals and inflammatory cytokines. Alternative therapy to hormone replacement has been an area of interest to researchers for almost three decades due to hormone therapy-associated side effects. Methods In this study, we investigated the effects of gamma-amino butyric acid (GABA), gamma-oryzanol (ORZ), acylated steryl glucosides (ASG), and phenolic extracts from germinated brown rice (GBR) on the expression of genes related to bone metabolism, such as bone morphogenic protein-2 (BMP-2), secreted protein acidic and rich in cysteine (SPARC), runt-related transcription factor 2 (RUNX-2), osteoblast-specific transcription factor osterix (Osx), periostin, osteoblast specific factor (Postn), collagen 1&2 (Col1&2), calcitonin receptor gene (CGRP); body weight measurement and also serum interleukin-6 (IL-6) and osteocalcin, in serum and bone. Rats were treated with GBR, ORZ, GABA, and ASG at (100 and 200 mg/kg); estrogen (0.2 mg/kg), or remifemin (10 and 20 mg/kg), compared to ovariectomized non-treated group as well as non-ovariectomized non-treated (sham) group. Enzyme-linked immunosorbent assay was used to measure the IL-6 and osteocalcin levels at week 2, 4, and 8, while the gene expression in the bone tissue was determined using the Genetic Analysis System (Beckman Coulter Inc., Brea, CA, USA). Results The results indicate that groups treated with GABA (100 and 200 mg/kg) showed significant upregulation of SPARC, calcitonin receptor, and BMP-2 genes (P < 0.05), while the ORZ-treated group (100 and 200 mg/kg) revealed significant (P < 0.05) upregulation of Osx, Postn, RUNX-2, and Col1&2. Similarly, IL-6 concentration decreased, while osteocalcin levels increased significantly (P < 0.05) in the treated groups as compared to ovariectomized non-treated groups. Conclusion GABA and ORZ from GBR stimulates osteoblastogenesis by upregulation of bone formation genes, possibly via the activation of GABAB receptors and by inhibiting the activity of inflammatory cytokines and reactive oxygen species. Therefore, it could be used effectively in the management of osteoporosis. PMID:24098073

Sectioning studies of biomimetic collagen-hydroxyapatite coatings on Ti-6Al-4V substrates using focused ion beam

NASA Astrophysics Data System (ADS)

Hu, Changmin; Yu, Le; Wei, Mei

2018-06-01

A biomimetic bone-like collagen-hydroxyapatite (Col-HA) composite coating was formed on a surface-treated Ti-6Al-4V alloy substrate via simultaneous collagen self-assembly and hydroxyapatite nucleation. The coating process has been carried out by immersing sand-blasted, acid-etched and UV irradiated Ti-6Al-4V alloy in type I collagen-containing modified simulated body fluid (m-SBF). The surface morphology and phase composition of the coating were characterized using various techniques. More importantly, dual-beam FIB/SEMs with either gallium ion source (GFIB) or xenon plasma ion source (PFIB) were used to investigate the cross-sectional features of the biomimetic Col-HA composite coating in great details. As a result, the cross-sectional images and thin transmission electron microscopy (TEM) specimens were successfully obtained from the composite coating with no obvious damages or milling ion implantations. Both the cross-sectional SEM and TEM results have confirmed that the Col-HA coating demonstrates a similar microstructure to that of pure HA coating with homogeneously distributed elements across the whole cross section. Both coatings consist of a uniform, crack-free gradient structure with a dense layer adjacent to the interface between the Ti-6Al-4V substrate and the coating facilitating a strong bonding, while a porous structure at the coating surface aiding cell attachment.

The association between different molecular weights of hyaluronic acid and CHAD, HIF-1α, COL2A1 expression in chondrocyte cultures

PubMed Central

Sirin, Duygu Yasar; Kaplan, Necati; Yilmaz, Ibrahim; Karaarslan, Numan; Ozbek, Hanefi; Akyuva, Yener; Kaya, Yasin Emre; Oznam, Kadir; Akkaya, Nuray; Guler, Olcay; Akkaya, Semih; Mahirogullari, Mahir

2018-01-01

The aim of the present study was to investigate the effects of three different formulations of hyaluronic acid (HA): Low molecular weight (MW) Sinovial One®, medium MW Viscoplus® and high MW Durolane®, on chondrocyte proliferation and collagen type II (COL2A1), hypoxia-inducible factor 1α (HIF-1α) and chondroadherin (CHAD) expression in primary chondrocyte cultures. Standard primary chondrocyte cultures were established from osteochondral tissues surgically obtained from 6 patients with gonarthrosis. Cell morphology was evaluated using an inverted light microscope; cell proliferation was determined with a MTT assay and confirmed with acridine orange/propidium iodide staining. Levels of CHAD, COL2A1 and HIF-1α expression were assessed using specific TaqMan gene expression assays. The results demonstrated the positive effect of HA treatment on cell proliferation, which was independent from the MW. COL2A1 expression increased in the medium and high MW HA treated groups. It was observed that HIF-1α expression increased in the high MW treated group alone. CHAD expression increased only in the medium MW HA treated group. Evaluation of gene expression revealed that levels of expression increased as the duration of HA application increased, in the medium and high MW HA treated groups. In terms of increased viability and proliferation, a longer duration of HA application was more effective. Taken together, it may be concluded that the administration of medium and high MW HA may be a successful way of treating diseases affecting chondrocytes in a clinical setting. PMID:29849772

Comparative analyses of lung transcriptomes in patients with alveolar capillary dysplasia with misalignment of pulmonary veins and in foxf1 heterozygous knockout mice.

PubMed

Sen, Partha; Dharmadhikari, Avinash V; Majewski, Tadeusz; Mohammad, Mahmoud A; Kalin, Tanya V; Zabielska, Joanna; Ren, Xiaomeng; Bray, Molly; Brown, Hannah M; Welty, Stephen; Thevananther, Sundararajah; Langston, Claire; Szafranski, Przemyslaw; Justice, Monica J; Kalinichenko, Vladimir V; Gambin, Anna; Belmont, John; Stankiewicz, Pawel

2014-01-01

Alveolar Capillary Dysplasia with Misalignment of Pulmonary Veins (ACDMPV) is a developmental disorder of the lungs, primarily affecting their vasculature. FOXF1 haploinsufficiency due to heterozygous genomic deletions and point mutations have been reported in most patients with ACDMPV. The majority of mice with heterozygous loss-of-function of Foxf1 exhibit neonatal lethality with evidence of pulmonary hemorrhage in some of them. By comparing transcriptomes of human ACDMPV lungs with control lungs using expression arrays, we found that several genes and pathways involved in lung development, angiogenesis, and in pulmonary hypertension development, were deregulated. Similar transcriptional changes were found in lungs of the postnatal day 0.5 Foxf1+/- mice when compared to their wildtype littermate controls; 14 genes, COL15A1, COL18A1, COL6A2, ESM1, FSCN1, GRINA, IGFBP3, IL1B, MALL, NOS3, RASL11B, MATN2, PRKCDBP, and SIRPA, were found common to both ACDMPV and Foxf1 heterozygous lungs. Our results advance knowledge toward understanding of the molecular mechanism of ACDMPV, lung development, and its vasculature pathology. These data may also be useful for understanding etiologies of other lung disorders, e.g. pulmonary hypertension, bronchopulmonary dysplasia, or cancer.

A novel zinc finger protein 219-like (ZNF219L) is involved in the regulation of collagen type 2 alpha 1a (col2a1a) gene expression in zebrafish notochord.

PubMed

Lien, Huang-Wei; Yang, Chung-Hsiang; Cheng, Chia-Hsiung; Hung, Chin-Chun; Liao, Wei-Hao; Hwang, Pung-Pung; Han, Yu-San; Huang, Chang-Jen

2013-01-01

The notochord is required for body plan patterning in vertebrates, and defects in notochord development during embryogenesis can lead to diseases affecting the adult. It is therefore important to elucidate the gene regulatory mechanism underlying notochord formation. In this study, we cloned the zebrafish zinc finger 219-like (ZNF219L) based on mammalian ZNF219, which contains nine C2H2-type zinc finger domains. Through whole-mount in situ hybridization, we found that znf219L mRNA is mainly expressed in the zebrafish midbrain-hindbrain boundary, hindbrain, and notochord during development. The znf219L morpholino knockdown caused partial abnormal notochord phenotype and reduced expression of endogenous col2a1a in the notochord specifically. In addition, ZNF219L could recognize binding sites with GGGGG motifs and trigger augmented activity of the col2a1a promoter in a luciferase assay. Furthermore, in vitro binding experiments revealed that ZNF219L recognizes the GGGGG motifs in the promoter region of the zebrafish col2a1a gene through its sixth and ninth zinc finger domains. Taken together, our results reveal that ZNF219L is involved in regulating the expression of col2a1a in zebrafish notochord specifically.

A Novel Zinc Finger Protein 219-like (ZNF219L) is Involved in the Regulation of Collagen Type 2 Alpha 1a (col2a1a) Gene Expression in Zebrafish Notochord

PubMed Central

Lien, Huang-Wei; Yang, Chung-Hsiang; Cheng, Chia-Hsiung; Hung, Chin-Chun; Liao, Wei-Hao; Hwang, Pung-Pung; Han, Yu-San; Huang, Chang-Jen

2013-01-01

The notochord is required for body plan patterning in vertebrates, and defects in notochord development during embryogenesis can lead to diseases affecting the adult. It is therefore important to elucidate the gene regulatory mechanism underlying notochord formation. In this study, we cloned the zebrafish zinc finger 219-like (ZNF219L) based on mammalian ZNF219, which contains nine C2H2-type zinc finger domains. Through whole-mount in situ hybridization, we found that znf219L mRNA is mainly expressed in the zebrafish midbrain-hindbrain boundary, hindbrain, and notochord during development. The znf219L morpholino knockdown caused partial abnormal notochord phenotype and reduced expression of endogenous col2a1a in the notochord specifically. In addition, ZNF219L could recognize binding sites with GGGGG motifs and trigger augmented activity of the col2a1a promoter in a luciferase assay. Furthermore, in vitro binding experiments revealed that ZNF219L recognizes the GGGGG motifs in the promoter region of the zebrafish col2a1a gene through its sixth and ninth zinc finger domains. Taken together, our results reveal that ZNF219L is involved in regulating the expression of col2a1a in zebrafish notochord specifically. PMID:24155663

Molecular and Genetic Analyses of Collagen Type IV Mutant Mouse Models of Spontaneous Intracerebral Hemorrhage Identify Mechanisms for Stroke Prevention.

PubMed

Jeanne, Marion; Jorgensen, Jeff; Gould, Douglas B

2015-05-05

Collagen type IV alpha1 (COL4A1) and alpha2 (COL4A2) form heterotrimers critical for vascular basement membrane stability and function. Patients with COL4A1 or COL4A2 mutations suffer from diverse cerebrovascular diseases, including cerebral microbleeds, porencephaly, and fatal intracerebral hemorrhage (ICH). However, the pathogenic mechanisms remain unknown, and there is a lack of effective treatment. Using Col4a1 and Col4a2 mutant mouse models, we investigated the genetic complexity and cellular mechanisms underlying the disease. We found that Col4a1 mutations cause abnormal vascular development, which triggers small-vessel disease, recurrent hemorrhagic strokes, and age-related macroangiopathy. We showed that allelic heterogeneity, genetic context, and environmental factors such as intense exercise or anticoagulant medication modulated disease severity and contributed to phenotypic heterogeneity. We found that intracellular accumulation of mutant collagen in vascular endothelial cells and pericytes was a key triggering factor of ICH. Finally, we showed that treatment of mutant mice with a US Food and Drug Administration-approved chemical chaperone resulted in a decreased collagen intracellular accumulation and a significant reduction in ICH severity. Our data are the first to show therapeutic prevention in vivo of ICH resulting from Col4a1 mutation and imply that a mechanism-based therapy promoting protein folding might also prevent ICH in patients with COL4A1 and COL4A2 mutations. © 2015 American Heart Association, Inc.

Bulbous epiphysis and popcorn calcification as related to growth plate differentiation in osteogenesis imperfecta.

PubMed

Brizola, Evelise; McCarthy, Edward; Shapiro, Jay Robert

2015-01-01

Osteogenesis Imperfecta (OI) is an heritable systemic disorder of connective tissue due to different sequence variants in genes affecting both the synthesis of type I collagen and osteoblast function. Dominant and recessive inheritance is recognized. Approximately 90% of the OI cases are due to mutations in COL1A1/A2 genes. We clinically and radiologically describes an adult male with type III osteogenesis imperfecta who presents a rare bone dysplasia termed bulbous epiphyseal deformity in association with popcorn calcifications. Popcorn calcifications may occur with bulbous epiphyseal deformity or independently. Molecular analysis was performed for COL1A1, COL1A2, LEPRE1 and WNT1 genes. An uncommon COL1A1 mutation was identified. Clinical and radiological exams confirmed a distinctive bulbous epiphyseal deformity with popcorn calcifications in distal femurs. We have identified four additional OI patients reported in current literature, whose X-rays show bulbous epiphyseal deformity related to mutations in CR-TAP, LEPRE1 and WNT1 genes. The mutation identified here had been previously described twice in OI patients and no previous correlation with bulbous epiphyseal deformity was described. The occurrence of this bone dysplasia focuses attention on alterations in normal growth plate differentiation and the subsequent effect on endochondral bone formation in OI.

COL1A1 transgene expression in stably transfected osteoblastic cells. Relative contributions of first intron, 3'-flanking sequences, and sequences derived from the body of the human COL1A1 minigene

NASA Technical Reports Server (NTRS)

Breault, D. T.; Lichtler, A. C.; Rowe, D. W.

1997-01-01

Collagen reporter gene constructs have be used to identify cell-specific sequences needed for transcriptional activation. The elements required for endogenous levels of COL1A1 expression, however, have not been elucidated. The human COL1A1 minigene is expressed at high levels and likely harbors sequence elements required for endogenous levels of activity. Using stably transfected osteoblastic Py1a cells, we studied a series of constructs (pOBColCAT) designed to characterize further the elements required for high level of expression. pOBColCAT, which contains the COL1A1 first intron, was expressed at 50-100-fold higher levels than ColCAT 3.6, which lacks the first intron. This difference is best explained by improved mRNA processing rather than a transcriptional effect. Furthermore, variation in activity observed with the intron deletion constructs is best explained by altered mRNA splicing. Two major regions of the human COL1A1 minigene, the 3'-flanking sequences and the minigene body, were introduced into pOBColCAT to assess both transcriptional enhancing activity and the effect on mRNA stability. Analysis of the minigene body, which includes the first five exons and introns fused with the terminal six introns and exons, revealed an orientation-independent 5-fold increase in CAT activity. In contrast the 3'-flanking sequences gave rise to a modest 61% increase in CAT activity. Neither region increased the mRNA half-life of the parent construct, suggesting that CAT-specific mRNA instability elements may serve as dominant negative regulators of stability. This study suggests that other sites within the body of the COL1A1 minigene are important for high expression, e.g. during periods of rapid extracellular matrix production.

[Alport syndrome: Hereditary nephropathy associated with mutations in genes coding for type IV collagen chains].

PubMed

Heidet, Laurence; Gubler, Marie-Claire

2016-12-01

Alport syndrome is an inherited disorder characterized by the association of a progressive haematuric nephropathy with ultrastructural abnormalities of the glomerular basement membranes, a progressive sensorineural hearing loss and sometimes ocular involvement. Its incidence is less than 1 per 5000 individuals and the disease is the cause of about 2% of end stage renal disease in Europe and the United States. Alport syndrome is clinically and genetically heterogeneous. It is related to mutations in the genes encoding one of three chains, α3, α4 α5 of type IV collagen, the main component of basement membranes, expressed in the glomerular basement membrane. COL4A5 mutations are associated with X-linked Alport syndrome, which represents 80 to 85% of cases and is more severe in boys than in girls. Mutations in COL4A3 or COL4A4 are associated with autosomal Alport syndrome. The expression of collagen chains in skin and kidney basement membranes allows for the diagnosis and characterization of the mode of transmission in most patients. It is necessary to diagnose this syndrome because its family involvement, its severity, and the importance of genetic counseling. Angiotensin blockers are increasingly prescribed in proteinuric patients. Prospective studies are needed to assess the effectiveness of these treatments on proteinuria and progression of kidney failure, and to specify indications. Animal studies have shown the potential value of different molecules (protease inhibitors, chemokine receptor blockers, transforming growth factor-β1 inhibitors, hydroxy-methyl-coenzyme A reductase inhibitors, bone morphogenetic protein-7 inhibitors), hematopoietic stem cells, and of a anti-micro-RNA. Copyright © 2016. Published by Elsevier SAS.

Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

PubMed Central

Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

2015-01-01

Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

Advances and unmet needs in genetic, basic and clinical science in Alport syndrome: report from the 2015 International Workshop on Alport Syndrome

PubMed Central

Gross, Oliver; Kashtan, Clifford E.; Rheault, Michelle N.; Flinter, Frances; Savige, Judith; Miner, Jeffrey H.; Torra, Roser; Ars, Elisabet; Deltas, Constantinos; Savva, Isavella; Perin, Laura; Renieri, Alessandra; Ariani, Francesca; Mari, Francesca; Baigent, Colin; Judge, Parminder; Knebelman, Bertrand; Heidet, Laurence; Lagas, Sharon; Blatt, Dave; Ding, Jie; Zhang, Yanqin; Gale, Daniel P.; Prunotto, Marco; Xue, Yong; Schachter, Asher D.; Morton, Lori C.G.; Blem, Jacqui; Huang, Michael; Liu, Shiguang; Vallee, Sebastien; Renault, Daniel; Schifter, Julia; Skelding, Jules; Gear, Susie; Friede, Tim; Turner, A. Neil; Lennon, Rachel

2017-01-01

Abstract Alport syndrome (AS) is a genetic disease characterized by haematuric glomerulopathy variably associated with hearing loss and anterior lenticonus. It is caused by mutations in the COL4A3, COL4A4 or COL4A5 genes encoding the α3α4α5(IV) collagen heterotrimer. AS is rare, but it accounts for >1% of patients receiving renal replacement therapy. Angiotensin-converting enzyme inhibition slows, but does not stop, the progression to renal failure; therefore, there is an urgent requirement to expand and intensify research towards discovering new therapeutic targets and new therapies. The 2015 International Workshop on Alport Syndrome targeted unmet needs in basic science, genetics and diagnosis, clinical research and current clinical care. In three intensive days, more than 100 international experts including physicians, geneticists, researchers from academia and industry, and patient representatives from all over the world participated in panel discussions and breakout groups. This report summarizes the most important priority areas including (i) understanding the crucial role of podocyte protection and regeneration, (ii) targeting mutations by new molecular techniques for new animal models and potential gene therapy, (iii) creating optimal interaction between nephrologists and geneticists for early diagnosis, (iv) establishing standards for mutation screening and databases, (v) improving widespread accessibility to current standards of clinical care, (vi) improving collaboration with the pharmaceutical/biotech industry to investigate new therapies, (vii) research in hearing loss as a huge unmet need in Alport patients and (viii) the need to evaluate the risk and benefit of novel (including ‘repurposing’) therapies on an international basis. PMID:27190345

Advances and unmet needs in genetic, basic and clinical science in Alport syndrome: report from the 2015 International Workshop on Alport Syndrome.

PubMed

Gross, Oliver; Kashtan, Clifford E; Rheault, Michelle N; Flinter, Frances; Savige, Judith; Miner, Jeffrey H; Torra, Roser; Ars, Elisabet; Deltas, Constantinos; Savva, Isavella; Perin, Laura; Renieri, Alessandra; Ariani, Francesca; Mari, Francesca; Baigent, Colin; Judge, Parminder; Knebelman, Bertrand; Heidet, Laurence; Lagas, Sharon; Blatt, Dave; Ding, Jie; Zhang, Yanqin; Gale, Daniel P; Prunotto, Marco; Xue, Yong; Schachter, Asher D; Morton, Lori C G; Blem, Jacqui; Huang, Michael; Liu, Shiguang; Vallee, Sebastien; Renault, Daniel; Schifter, Julia; Skelding, Jules; Gear, Susie; Friede, Tim; Turner, A Neil; Lennon, Rachel

2017-06-01

Alport syndrome (AS) is a genetic disease characterized by haematuric glomerulopathy variably associated with hearing loss and anterior lenticonus. It is caused by mutations in the COL4A3, COL4A4 or COL4A5 genes encoding the α3α4α5(IV) collagen heterotrimer. AS is rare, but it accounts for >1% of patients receiving renal replacement therapy. Angiotensin-converting enzyme inhibition slows, but does not stop, the progression to renal failure; therefore, there is an urgent requirement to expand and intensify research towards discovering new therapeutic targets and new therapies. The 2015 International Workshop on Alport Syndrome targeted unmet needs in basic science, genetics and diagnosis, clinical research and current clinical care. In three intensive days, more than 100 international experts including physicians, geneticists, researchers from academia and industry, and patient representatives from all over the world participated in panel discussions and breakout groups. This report summarizes the most important priority areas including (i) understanding the crucial role of podocyte protection and regeneration, (ii) targeting mutations by new molecular techniques for new animal models and potential gene therapy, (iii) creating optimal interaction between nephrologists and geneticists for early diagnosis, (iv) establishing standards for mutation screening and databases, (v) improving widespread accessibility to current standards of clinical care, (vi) improving collaboration with the pharmaceutical/biotech industry to investigate new therapies, (vii) research in hearing loss as a huge unmet need in Alport patients and (viii) the need to evaluate the risk and benefit of novel (including 'repurposing') therapies on an international basis. © The Author 2016. Published by Oxford University Press on behalf of ERAEDTA.

Early Diagnosis and Intervention Strategies for Post-Traumatic Heterotopic Ossification in Severely Injured Extremities

DTIC Science & Technology

2014-10-01

Adipoq, BMP4, Col4a3, IGF2, MyoD1, Smad3); 3-20 fold lower elevation of expression of Col1a1 ; and 3-10 fold higher expression of MMP9 and Spp1...XI, alpha 1 COL1A1 collagen, type I, alpha 1 COL2A1 collagen, type II, alpha 1 COL4A3 collagen, type IV, alpha 3 COMP cartilage oligomeric matrix

Identification of the Gene for Scleroderma in the Tsk/2 Mouse Strain: Implications for Human Scleroderma Pathogenesis and Subset Distinctions

DTIC Science & Technology

2013-07-01

in addition to mutations on  COL1A1  and  COL5A2. These mutations result in amino acid substitutions, RNA splicing alterations, deletions, or null...Romanic and colleagues demonstrate  that  COL1A1   is  larger,  shorter,  and  apparently  stiffer; whereas  in  the  presence  of  PIIINP/ COL1A1

Extensive Analysis of GmFTL and GmCOL Expression in Northern Soybean Cultivars in Field Conditions.

PubMed

Guo, Guangyu; Xu, Kun; Zhang, Xiaomei; Zhu, Jinlong; Lu, Mingyang; Chen, Fulu; Liu, Linpo; Xi, Zhang-Ying; Bachmair, Andreas; Chen, Qingshan; Fu, Yong-Fu

2015-01-01

The FLOWERING LOCUS T (FT) gene is a highly conserved florigen gene among flowering plants. Soybean genome encodes six homologs of FT, which display flowering activity in Arabidopsis thaliana. However, their contributions to flowering time in different soybean cultivars, especially in field conditions, are unclear. We employed six soybean cultivars with different maturities to extensively investigate expression patterns of GmFTLs (Glycine max FT-like) and GmCOLs (Glycine max CO-like) in the field conditions. The results show that GmFTL3 is an FT homolog with the highest transcript abundance in soybean, but other GmFTLs may also contribute to flower induction with different extents, because they have more or less similar expression patterns in developmental-, leaf-, and circadian-specific modes. And four GmCOL genes (GmCOL1/2/5/13) may confer to the expression of GmFTL genes. Artificial manipulation of GmFTL expression by transgenic strategy (overexpression and RNAi) results in a distinct change in soybean flowering time, indicating that GmFTLs not only impact on the control of flowering time, but have potential applications in the manipulation of photoperiodic adaptation in soybean. Additionally, transgenic plants show that GmFTLs play a role in formation of the first flowers and in vegetative growth.

Extensive Analysis of GmFTL and GmCOL Expression in Northern Soybean Cultivars in Field Conditions

PubMed Central

Zhu, Jinlong; Lu, Mingyang; Chen, Fulu; Liu, Linpo; Xi, Zhang-Ying; Bachmair, Andreas; Chen, Qingshan; Fu, Yong-Fu

2015-01-01

The FLOWERING LOCUS T (FT) gene is a highly conserved florigen gene among flowering plants. Soybean genome encodes six homologs of FT, which display flowering activity in Arabidopsis thaliana. However, their contributions to flowering time in different soybean cultivars, especially in field conditions, are unclear. We employed six soybean cultivars with different maturities to extensively investigate expression patterns of GmFTLs (Glycine max FT-like) and GmCOLs (Glycine max CO-like) in the field conditions. The results show that GmFTL3 is an FT homolog with the highest transcript abundance in soybean, but other GmFTLs may also contribute to flower induction with different extents, because they have more or less similar expression patterns in developmental-, leaf-, and circadian-specific modes. And four GmCOL genes (GmCOL1/2/5/13) may confer to the expression of GmFTL genes. Artificial manipulation of GmFTL expression by transgenic strategy (overexpression and RNAi) results in a distinct change in soybean flowering time, indicating that GmFTLs not only impact on the control of flowering time, but have potential applications in the manipulation of photoperiodic adaptation in soybean. Additionally, transgenic plants show that GmFTLs play a role in formation of the first flowers and in vegetative growth. PMID:26371882

Association Between Polymorphisms of VDR, COL1A1, and LCT genes and bone mineral density in Belarusian women with severe postmenopausal osteoporosis.

PubMed

Marozik, Pavel; Mosse, Irma; Alekna, Vidmantas; Rudenko, Ema; Tamulaitienė, Marija; Ramanau, Heorhi; Strazdienė, Vaidilė; Samokhovec, Volha; Ameliyanovich, Maxim; Byshnev, Nikita; Gonchar, Alexander; Kundas, Liubov; Zhur, Krystsina

2013-01-01

BACKGROUND AND OBJECTIVE. Variation of osteoporosis in the population is the result of an interaction between the genotype and the environment, and the genetic causes of osteoporosis are being widely investigated. The aim of this study was to analyze the association between the polymorphisms of the vitamin D receptor (VDR), type I collagen (COL1A1), and lactase (LCT) genes and severe postmenopausal osteoporosis as well as bone mineral density (BMD). MATERIAL AND METHODS. A total of 54 women with severe postmenopausal osteoporosis and 77 controls (mean age, 58.3 years [SD, 6.2] and 56.7 years [SD, 7.42], respectively) were included into the study. The subjects were recruited at the City Center for Osteoporosis Prevention (Minsk, Belarus). Dual-energy x-ray absorptiometry was used to measure bone mineral density at the lumbar spine and the femoral neck. Severe osteoporosis was diagnosed in the women with the clinical diagnosis of postmenopausal osteoporosis and at least 1 fragility fracture. The control group included women without osteoporosis. Polymorphic sites in osteoporosis predisposition genes (ApaI, BsmI, TaqI, and Cdx2 of the VDR gene, G2046T of the COL1A1 gene, and T-13910C of the LCT gene) were determined using the polymerase chain reaction on the deoxyribonucleic acid isolated from dried bloodspots. RESULTS. The data showed that the ApaI and BsmI polymorphisms of the VDR gene and T- 13910C of the LCT gene were associated with severe postmenopausal osteoporosis in the analyzed Belarusian women (P<0.01). A statistically significant positive correlation between the VDR risk genotypes ApaI and TaqI and bone mineral density was found (P<0.05). CONCLUSIONS. The findings of this study suggest that at least the ApaI and BsmI polymorphisms of the VDR gene and T-13910C of the LCT gene are associated with the risk of postmenopausal osteoporosis in our sample of the Belarusian women.

Preparation and characterization of an advanced collagen aggregate from porcine acellular dermal matrix.

PubMed

Liu, Xinhua; Dan, Nianhua; Dan, Weihua

2016-07-01

The objective of this study was to extract and characterize an advanced collagen aggregate (Ag-col) from porcine acellular dermal matrix (pADM). Based on histological examination, scanning electron microscopy (SEM) and atomic force microscope (AFM), Ag-col was composed of the D-periodic cross-striated collagen fibrils and thick collagen fiber bundles with uneven diameters and non-orientated arrangement. Fourier transform infrared (FTIR) spectra of pADM, Ag-col and Col were similar and revealed the presence of the triple helix. Circular dichroism (CD) analysis exhibited a slightly higher content of α-helix but inappreciably less amount of random coil structure in Ag-col compared to Col. Moreover, imino acid contents of pADM, Ag-col and Col were 222.43, 218.30 and 190.01 residues/1000 residues, respectively. From zeta potential analysis, a net charge of zero was found at pH 6.45 and 6.11 for Ag-col and Col, respectively. Differential scanning calorimetry (DSC) study suggested that the Td of Ag-col was 20°C higher than that of Col as expected, and dynamic mechanical analysis (DMA) indicated that Ag-col possessed a higher storage modulus but similar loss factor compared to Col. Therefore, the collagen aggregate from pADM could serve as a better alternative source of collagens for further applications in food and biological industries. Copyright © 2016 Elsevier B.V. All rights reserved.

Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

PubMed Central

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

2004-01-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

PubMed

Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

2004-05-01

Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

The 2014International Workshop on Alport Syndrome.

PubMed

Miner, Jeffrey H; Baigent, Colin; Flinter, Frances; Gross, Oliver; Judge, Parminder; Kashtan, Clifford E; Lagas, Sharon; Savige, Judith; Blatt, Dave; Ding, Jie; Gale, Daniel P; Midgley, Julian P; Povey, Sue; Prunotto, Marco; Renault, Daniel; Skelding, Jules; Turner, A Neil; Gear, Susie

2014-10-01

Alport syndrome, historically referred to as hereditary glomerulonephritis with sensorineural deafness and anterior lenticonus, is a genetic disease of collagen α3α4α5(IV) resulting in renal failure. The collagen α3α4α5(IV) heterotrimer forms a network that is a major component of the kidney glomerular basement membrane (GBM) and basement membranes in the cochlea and eye. Alport syndrome, estimated to affect 1 in 5000-10,000 individuals, is caused by mutations in any one of the three genes that encode the α chain components of the collagen α3α4α5(IV) heterotrimer: COL4A3, COL4A4, and COL4A5. Although angiotensin-converting enzyme inhibition is effective in Alport syndrome patients for slowing progression to end-stage renal disease, it is neither a cure nor an adequate long-term protector. The 2014 International Workshop on Alport Syndrome, held in Oxford, UK, from January 3-5, was organized by individuals and families living with Alport syndrome, in concert with international experts in the clinical, genetic, and basic science aspects of the disease. Stakeholders from diverse communities-patient families, physicians, geneticists, researchers, Pharma, and funding organizations-were brought together so that they could meet and learn from each other and establish strategies and collaborations for the future, with the overall aim of discovering much needed new treatments to prolong kidney function.

The 2014 International Workshop on Alport Syndrome

PubMed Central

Miner, Jeffrey H; Baigent, Colin; Flinter, Frances; Gross, Oliver; Judge, Parminder; Kashtan, Clifford E; Lagas, Sharon; Savige, Judith; Blatt, Dave; Ding, Jie; Gale, Daniel P; Midgley, Julian P; Povey, Sue; Prunotto, Marco; Renault, Daniel; Skelding, Jules; Turner, A Neil; Gear, Susie

2014-01-01

Alport syndrome, historically referred to as hereditary glomerulonephritis with sensorineural deafness and anterior lenticonus, is a genetic disease of collagen α3α4α5(IV) resulting in renal failure. The collagen α3α4α5(IV) heterotrimer forms a network that is a major component of the kidney glomerular basement membrane (GBM) and basement membranes in the cochlea and eye. Alport syndrome, estimated to affect 1 in 5000–10,000 individuals, is caused by mutations in any one of the three genes that encode the α chain components of the collagen α3α4α5(IV) heterotrimer: COL4A3, COL4A4, and COL4A5. Although angiotensin-converting enzyme inhibition is effective in Alport syndrome patients for slowing progression to end-stage renal disease, it is neither a cure nor an adequate long-term protector. The 2014 International Workshop on Alport Syndrome, held in Oxford, UK, from January 3–5, was organized by individuals and families living with Alport syndrome, in concert with international experts in the clinical, genetic, and basic science aspects of the disease. Stakeholders from diverse communities—patient families, physicians, geneticists, researchers, Pharma, and funding organizations—were brought together so that they could meet and learn from each other and establish strategies and collaborations for the future, with the overall aim of discovering much needed new treatments to prolong kidney function. PMID:24988067

Chondrogenesis in a hyaluronic acid scaffold: comparison between chondrocytes and MSC from bone marrow and adipose tissue.

PubMed

Jakobsen, Rune B; Shahdadfar, Aboulghassem; Reinholt, Finn P; Brinchmann, Jan E

2010-10-01

Treatment of focal lesions of the articular cartilage of the knee using chondrocytes in a hyaluronic acid (HA) scaffold is already being investigated in clinical trials. An alternative may be to use mesenchymal stem cells (MSC). We have compared articular chondrocytes with MSC from human bone marrow (BM) and adipose tissue (AT), all cultured in HA scaffolds, for their ability to express genes and synthesize proteins associated with chondrogenesis. The cells were expanded in monolayer cultures. After seeding into the scaffold, the chondrocytes were maintained in medium, while the two MSC populations were given a chondrogenic differentiation medium. Chondrogenesis was assessed by real-time RT-PCR for chondrocyte-associated genes, by immunohistochemistry and by ELISA for collagens in the supernatant. Redifferentiation of the dedifferentiated chondrocytes in the HA scaffold was shown by a modest increase in type II collagen mRNA (COL2A1) and reduction in COL1A1. BM-MSC expressed 600-fold higher levels of COL2A1 than chondrocytes after 3 weeks in the scaffold. The levels of aggrecan (AGC1) and COL1A1 were similar for chondrocyte and BM-MSC scaffold cultures, while COL10A1 was higher in the BM-MSC. AT-MSC expressed levels of COL2A1 and COL1A1 similar to chondrocytes, but less AGC1 and COL10A1. Surprisingly, little collagen II protein was observed in the scaffold. Instead, collagen II was found in the culture medium. Chondrogenesis in HA scaffolds was more efficient using BM-MSC than AT-MSC or chondrocytes. Some of the secreted collagen II escaped entrapment in the extracellular space and was detected in the culture medium.

The phenotypic spectrum in patients with arginine to cysteine mutations in the COL2A1 gene

PubMed Central

Hoornaert, K P; Dewinter, C; Vereecke, I; Beemer, F A; Courtens, W; Fryer, A; Fryssira, H; Lees, M; Müllner‐Eidenböck, A; Rimoin, D L; Siderius, L; Superti‐Furga, A; Temple, K; Willems, P J; Zankl, A; Zweier, C; De Paepe, A; Coucke, P; Mortier, G R

2006-01-01

Background The majority of COL2A1 missense mutations are substitutions of obligatory glycine residues in the triple helical domain. Only a few non‐glycine missense mutations have been reported and among these, the arginine to cysteine substitutions predominate. Objective To investigate in more detail the phenotype resulting from arginine to cysteine mutations in the COL2A1 gene. Methods The clinical and radiographic phenotype of all patients in whom an arginine to cysteine mutation in the COL2A1 gene was identified in our laboratory, was studied and correlated with the abnormal genotype. The COL2A1 genotyping involved DHPLC analysis with subsequent sequencing of the abnormal fragments. Results Six different mutations (R75C, R365C, R519C, R704C, R789C, R1076C) were found in 11 unrelated probands. Each mutation resulted in a rather constant and site‐specific phenotype, but a perinatally lethal disorder was never observed. Spondyloarthropathy with normal stature and no ocular involvement were features of patients with the R75C, R519C, or R1076C mutation. Short third and/or fourth toes was a distinguishing feature of the R75C mutation and brachydactyly with enlarged finger joints a key feature of the R1076C substitution. Stickler dysplasia with brachydactyly was observed in patients with the R704C mutation. The R365C and R789C mutations resulted in classic Stickler dysplasia and spondyloepiphyseal dysplasia congenita (SEDC), respectively. Conclusions Arginine to cysteine mutations are rather infrequent COL2A1 mutations which cause a spectrum of phenotypes including classic SEDC and Stickler dysplasia, but also some unusual entities that have not yet been recognised and described as type II collagenopathies. PMID:16155195

Synthesis, characterization, and chiral properties of CoIII2AgI3 pentanuclear, CoIII4ZnII4 octanuclear, and CoIII mononuclear complexes with aza-capped hexadentate-N3S3 thiolate ligands: crystal structures of.

PubMed

Tokuda, K; Okamoto, K; Konno, T

2000-01-24

The reaction of an S-bridged Co2(III)Ag3(I) pentanuclear complex, [Ag3[Co(aet)3]2][BF4]3 (aet = NH2CH2CH2S-), with paraformaldehyde in basic acetonitrile, followed by adding aqueous ammonia, produced an aza-capped Co2(III)-Ag3(I) complex, [Ag3[Co(L)]2]3+ ([1]3+) (L = N(CH2NHCH2CH2S-)3). The crystal structure of [1]3+ was determined by X-ray crystallography. [1][PF6]3 x H2O, empirical formula C18H44Ag3Co2F18N8OP3S6, crystallizes in the tetragonal space group 142m with a = 13.012(1) A, c = 24.707(2) A, and Z = 4. In [1]3+ the two aza-capped [Co(L)] units are linked by three Ag(I) atoms, such that the two Co(III) atoms are encapsulated in a macrobicyclic metallocage, [Ag3(I)(L)2]3-. [1]3+ was converted to an aza-capped Co4(III)Zn4(II) octanuclear complex, [Zn4O[Co(L)]4]6+ ([2]6+), by reaction with I- in the presence of Zn2+ and ZnO in water. The crystal structure of [2]6+ was also determined by X-ray crystallography. [2][PF6]6 x 8H2O, empirical formula C36H100Co4F36N16O9P6S12Zn4, crystallizes in the monoclinic space group P2(1/n) with a = 14.33(7) A, b = 25.67(10) A, c = 24.83(6) A, beta = 101.3(3) degrees , and Z = 4. In [2]6+ each of four [Co(L)] units is bound to each trigonal Zn3(II) face of the tetrahedral [Zn4(II)O]6+ core, such that each Co(III) atom is encapsulated in a macrobicyclic [Zn4(II)O(L)] fragment. Treatment of [2]6+ with a basic aqueous solution resulted in a cleavage of the Zn-S bonds to produce an aza-capped Co(III) mononuclear complex, [Co(L)] ([3]), from which [1]3+ is readily reproduced by the reaction with Ag+ in water. All the reactions were found to proceed with retention of the absolute configuration (delta or lambda) of the Co(III) chiral centers; deltadelta-[1]3+, deltadeltadeltadelta-[2]6+, and A-[3] were derived from deltadelta-[Ag3[Co(aet)3]2]3+. The contributions to circular dichroism (CD) from the triple helicity in [1]3+, besides from the asymmetric N and S donor atoms and the Co(III) chiral centers in [1]3+ and [2]6+, were estimated by comparing the CD spectra of deltadelta-[1]3+, deltadeltadeltadelta-[2]6+, and delta-[3].

LGALS4, CEACAM6, TSPAN8, and COL1A2: Blood Markers for Colorectal Cancer-Validation in a Cohort of Subjects With Positive Fecal Immunochemical Test Result.

PubMed

Rodia, Maria Teresa; Solmi, Rossella; Pasini, Francesco; Nardi, Elena; Mattei, Gabriella; Ugolini, Giampaolo; Ricciardiello, Luigi; Strippoli, Pierluigi; Miglio, Rossella; Lauriola, Mattia

2018-06-01

A noninvasive blood test for the early detection of colorectal cancer (CRC) is highly required. We evaluated a panel of 4 mRNAs as putative markers of CRC. We tested LGALS4, CEACAM6, TSPAN8, and COL1A2, referred to as the CELTiC panel, using quantitative reverse transcription polymerase chain reaction, on subjects with positive fecal immunochemical test (FIT) results and undergoing colonoscopy. Using a nonparametric test and multinomial logistic model, FIT-positive subjects were compared with CRC patients and healthy individuals. All the genes of the CELTiC panel displayed statistically significant differences between the healthy subjects (n = 67), both low-risk (n = 36) and high-risk/CRC (n = 92) subjects, and those in the negative-colonoscopy, FIT-positive group (n = 36). The multinomial logistic model revealed LGALS4 was the most powerful marker discriminating the 4 groups. When assessing the diagnostic values by analysis of the areas under the receiver operating characteristic curves (AUCs), the CELTiC panel reached an AUC of 0.91 (sensitivity, 79%; specificity, 94%) comparing normal subjects to low-risk subjects, and 0.88 (sensitivity, 75%; specificity, 87%) comparing normal and high-risk/CRC subjects. The comparison between the normal subjects and the negative-colonoscopy, FIT-positive group revealed an AUC of 0.93 (sensitivity, 82%; specificity, 97%). The CELTiC panel could represent a useful tool for discriminating subjects with positive FIT findings and for the early detection of precancerous adenomatous lesions and CRC. Copyright © 2017 Elsevier Inc. All rights reserved.

Deletion of the transforming growth factor β receptor type II gene in articular chondrocytes leads to a progressive osteoarthritis-like phenotype in mice.

PubMed

Shen, Jie; Li, Jia; Wang, Baoli; Jin, Hongting; Wang, Meina; Zhang, Yejia; Yang, Yunzhi; Im, Hee-Jeong; O'Keefe, Regis; Chen, Di

2013-12-01

While transforming growth factor β (TGFβ) signaling plays a critical role in chondrocyte metabolism, the TGFβ signaling pathways and target genes involved in cartilage homeostasis and the development of osteoarthritis (OA) remain unclear. Using an in vitro cell culture method and an in vivo mouse genetic approach, we undertook this study to investigate TGFβ signaling in chondrocytes and to determine whether Mmp13 and Adamts5 are critical downstream target genes of TGFβ signaling. TGFβ receptor type II (TGFβRII)-conditional knockout (KO) (TGFβRII(Col2ER)) mice were generated by breeding TGFβRII(flox/flox) mice with Col2-CreER-transgenic mice. Histologic, histomorphometric, and gene expression analyses were performed. In vitro TGFβ signaling studies were performed using chondrogenic rat chondrosarcoma cells. To determine whether Mmp13 and Adamts5 are critical downstream target genes of TGFβ signaling, TGFβRII/matrix metalloproteinase 13 (MMP-13)- and TGFβRII/ADAMTS-5-double-KO mice were generated and analyzed. Inhibition of TGFβ signaling (deletion of the Tgfbr2 gene in chondrocytes) resulted in up-regulation of Runx2, Mmp13, and Adamts5 expression in articular cartilage tissue and progressive OA development in TGFβRII(Col2ER) mice. Deletion of the Mmp13 or Adamts5 gene significantly ameliorated the OA-like phenotype induced by the loss of TGFβ signaling. Treatment of TGFβRII(Col2ER) mice with an MMP-13 inhibitor also slowed OA progression. Mmp13 and Adamts5 are critical downstream target genes involved in the TGFβ signaling pathway during the development of OA. Copyright © 2013 by the American College of Rheumatology.

Novel in Vitro Modification of Bone for an Allograft with Improved Toughness Osteoconductivity

DTIC Science & Technology

2014-04-01

of bone-characteristic genes, osteocalcin, Runx2, and col1a1 by RT-PCR. High-performance liquid chromatography and fluorescence microscopy will be...of molecular markers of mineralization, osteocalcin, Runx2 and col1a1 using quantitative RT-PCR with specific primers. (Months 8-15.) The purpose...bone specific Collagen, type I, alpha 1 ( COL1A1 ) Associated with cell adhesion, proliferation and differentiation of the osteoblast phenotype and

Zebrafish Collagen Type I: Molecular and Biochemical Characterization of the Major Structural Protein in Bone and Skin

PubMed Central

Gistelinck, C.; Gioia, R.; Gagliardi, A.; Tonelli, F.; Marchese, L.; Bianchi, L.; Landi, C.; Bini, L.; Huysseune, A.; Witten, P. E.; Staes, A.; Gevaert, K.; De Rocker, N.; Menten, B.; Malfait, F.; Leikin, S.; Carra, S.; Tenni, R.; Rossi, A.; De Paepe, A.; Coucke, P.; Willaert, A.; Forlino, A.

2016-01-01

Over the last years the zebrafish imposed itself as a powerful model to study skeletal diseases, but a limit to its use is the poor characterization of collagen type I, the most abundant protein in bone and skin. In tetrapods collagen type I is a trimer mainly composed of two α1 chains and one α2 chain, encoded by COL1A1 and COL1A2 genes, respectively. In contrast, in zebrafish three type I collagen genes exist, col1a1a, col1a1b and col1a2 coding for α1(I), α3(I) and α2(I) chains. During embryonic and larval development the three collagen type I genes showed a similar spatio-temporal expression pattern, indicating their co-regulation and interdependence at these stages. In both embryonic and adult tissues, the presence of the three α(I) chains was demonstrated, although in embryos α1(I) was present in two distinct glycosylated states, suggesting a developmental-specific collagen composition. Even though in adult bone, skin and scales equal amounts of α1(I), α3(I) and α2(I) chains are present, the presented data suggest a tissue-specific stoichiometry and/or post-translational modification status for collagen type I. In conclusion, this data will be useful to properly interpret results and insights gained from zebrafish models of skeletal diseases. PMID:26876635

A shift in the collagen V antigenic epitope leads to T helper phenotype switch and immune response to self-antigen leading to chronic lung allograft rejection.

PubMed

Tiriveedhi, V; Angaswamy, N; Brand, D; Weber, J; Gelman, A G; Hachem, R; Trulock, E P; Meyers, B; Patterson, G; Mohanakumar, T

2012-01-01

Immune responses to human leucocyte antigen (HLA) and self-antigen collagen V (Col-V) have been proposed in the pathogenesis of chronic rejection (bronchiolitis obliterans syndrome, BOS) following human lung transplantation (LTx). In this study, we defined the role for the shift in immunodominant epitopes of Col-V in inducing T helper phenotype switch leading to immunity to Col-V and BOS. Sera and lavage from BOS(+) LTx recipients with antibodies to Col-V were analysed. Two years prior to BOS, patients developed antibodies to both Col-V,α1(V) and α2(V) chains. However, at clinical diagnosis of BOS, antibodies became restricted to α1(V). Further, lung biopsy from BOS(+) patients bound to antibodies to α1(V), indicating that these epitopes are exposed. Fourteen Col-V peptides [pep1-14, pep1-4 specific to α1(V), pep5-8 to α1,2(V) and pep9-14 to α2(V)] which bind to HLA-DR4 and -DR7, demonstrated that prior to BOS, pep 6, 7, 9, 11 and 14 were immunodominant and induced interleukin (IL)-10. However, at BOS, the response switched to pep1, 4 and 5 and induced interferon (IFN)-γ and IL-17 responses, but not IL-10. The T helper (Th) phenotype switch is accompanied by decreased frequency of regulatory T cells (T(regs) ) in the lavage. LTx recipients with antibodies to α1(V) also demonstrated increased matrix metalloproteinase (MMP) activation with decreased MMP inhibitor, tissue inhibitor of metalloproteinase (TIMP), suggesting that MMP activation may play a role in the exposure of new Col-V antigenic epitopes. We conclude that a shift in immunodominance of self-antigenic determinants of Col-V results in induction of IFN-γ and IL-17 with loss of tolerance leading to autoimmunity to Col-V, which leads to chronic lung allograft rejection. © 2011 The Authors. Clinical and Experimental Immunology © 2011 British Society for Immunology.

Improved genetic counseling in Alport syndrome by new variants of COL4A5 gene.

PubMed

Fernandez-Rosado, Francisco; Campos, Ana; Alvarez-Cubero, Maria Jesus; Ruiz, Ana; Entrala-Bernal, Carmen

2015-07-01

There are current requirements of using genetic databases for offering a better genetic assistance to patients of some syndromes, especially those with X-linked heredity patterns (like Alport Syndrome) for the high probability of having descendants affected by the disease. We describe the first reported case of COL4A5 gene missense c.1499 G>T mutation in a 16-year-old girl confirmed to be affected by Alport Syndrome after genetic counseling. Next Generation Sequencing procedures let discover this mutation and offer an accurate clinical treatment to this patient. Current scientific understanding of genetic syndromes suggests the high importance of updated databases and the inclusion of Variant of Unknown Significance related to clinical cases. All of this updating could enable patients to have a better opportunity of diagnosis and having genetic and clinical counseling. This event is even more important in women planning to start a family to have correct genetic counseling regarding the risk posed to offspring, and allowing the decision to undergo prenatal testing. © 2015 Asian Pacific Society of Nephrology.

Targeted next-generation sequencing makes new molecular diagnoses and expands genotype-phenotype relationship in Ehlers-Danlos syndrome.

PubMed

Weerakkody, Ruwan A; Vandrovcova, Jana; Kanonidou, Christina; Mueller, Michael; Gampawar, Piyush; Ibrahim, Yousef; Norsworthy, Penny; Biggs, Jennifer; Abdullah, Abdulshakur; Ross, David; Black, Holly A; Ferguson, David; Cheshire, Nicholas J; Kazkaz, Hanadi; Grahame, Rodney; Ghali, Neeti; Vandersteen, Anthony; Pope, F Michael; Aitman, Timothy J

2016-11-01

Ehlers-Danlos syndrome (EDS) comprises a group of overlapping hereditary disorders of connective tissue with significant morbidity and mortality, including major vascular complications. We sought to identify the diagnostic utility of a next-generation sequencing (NGS) panel in a mixed EDS cohort. We developed and applied PCR-based NGS assays for targeted, unbiased sequencing of 12 collagen and aortopathy genes to a cohort of 177 unrelated EDS patients. Variants were scored blind to previous genetic testing and then compared with results of previous Sanger sequencing. Twenty-eight pathogenic variants in COL5A1/2, COL3A1, FBN1, and COL1A1 and four likely pathogenic variants in COL1A1, TGFBR1/2, and SMAD3 were identified by the NGS assays. These included all previously detected single-nucleotide and other short pathogenic variants in these genes, and seven newly detected pathogenic or likely pathogenic variants leading to clinically significant diagnostic revisions. Twenty-two variants of uncertain significance were identified, seven of which were in aortopathy genes and required clinical follow-up. Unbiased NGS-based sequencing made new molecular diagnoses outside the expected EDS genotype-phenotype relationship and identified previously undetected clinically actionable variants in aortopathy susceptibility genes. These data may be of value in guiding future clinical pathways for genetic diagnosis in EDS.Genet Med 18 11, 1119-1127.

Natural variation of H3K27me3 distribution between two Arabidopsis accessions and its association with flanking transposable elements

PubMed Central

2012-01-01

Background Histone H3 lysine 27 tri-methylation and lysine 9 di-methylation are independent repressive chromatin modifications in Arabidopsis thaliana. H3K27me3 is established and maintained by Polycomb repressive complexes whereas H3K9me2 is catalyzed by SUVH histone methyltransferases. Both modifications can spread to flanking regions after initialization and were shown to be mutually exclusive in Arabidopsis. Results We analyzed the extent of natural variation of H3K27me3 in the two accessions Landsberg erecta (Ler) and Columbia (Col) and their F1 hybrids. The majority of H3K27me3 target genes in Col were unchanged in Ler and F1 hybrids. A small number of Ler-specific targets were detected and confirmed. Consistent with a cis-regulatory mechanism for establishing H3K27me3, differential targets showed allele-specific H3K27me3 in hybrids. Five Ler-specific targets showed the active mark H3K4me3 in Col and for this group, differential H3K27me3 enrichment accorded to expression variation. On the other hand, the majority of Ler-specific targets were not expressed in Col, Ler or 17 other accessions. Instead of H3K27me3, the antagonistic mark H3K9me2 and other heterochromatic features were observed at these loci in Col. These loci were frequently flanked by transposable elements, which were often missing in the Ler genome assembly. Conclusion There is little variation in H3K27me3 occupancy within the species, although H3K27me3 targets were previously shown as overrepresented among differentially expressed genes. The existing variation in H3K27me3 seems mostly explained by flanking polymorphic transposable elements. These could nucleate heterochromatin, which then spreads into neighboring H3K27me3 genes, thus converting them to H3K9me2 targets. PMID:23253144

Bulbous epiphysis and popcorn calcification as related to growth plate differentiation in osteogenesis imperfecta

PubMed Central

Brizola, Evelise; McCarthy, Edward; Shapiro, Jay Robert

2015-01-01

Summary Background Osteogenesis Imperfecta (OI) is an heritable systemic disorder of connective tissue due to different sequence variants in genes affecting both the synthesis of type I collagen and osteoblast function. Dominant and recessive inheritance is recognized. Approximately 90% of the OI cases are due to mutations in COL1A1/A2 genes. We clinically and radiologically describes an adult male with type III osteogenesis imperfecta who presents a rare bone dysplasia termed bulbous epiphyseal deformity in association with popcorn calcifications. Popcorn calcifications may occur with bulbous epiphyseal deformity or independently. Methods Molecular analysis was performed for COL1A1, COL1A2, LEPRE1 and WNT1 genes. Results An uncommon COL1A1 mutation was identified. Clinical and radiological exams confirmed a distinctive bulbous epiphyseal deformity with popcorn calcifications in distal femurs. We have identified four additional OI patients reported in current literature, whose X-rays show bulbous epiphyseal deformity related to mutations in CR-TAP, LEPRE1 and WNT1 genes. Conclusion The mutation identified here had been previously described twice in OI patients and no previous correlation with bulbous epiphyseal deformity was described. The occurrence of this bone dysplasia focuses attention on alterations in normal growth plate differentiation and the subsequent effect on endochondral bone formation in OI. PMID:26604951

The Properties of 3 Different Plasma Formulations and Their Effects on Tendinopathic Cells.

PubMed

Rubio-Azpeitia, Eva; Bilbao, Ane M; Sánchez, Pello; Delgado, Diego; Andia, Isabel

2016-08-01

Tendinopathies are attributed to failure of the healing process and inadequate tissue remodeling. Plasma injections can trigger regenerative responses by modifying the molecular microenvironment. To examine the differences in the mitotic, chemotactic, anabolic, and inflammatory effects between leukocyte- and platelet-rich plasma (L-PRP), platelet-rich plasma (PRP), and platelet-poor plasma (PPP). Controlled laboratory study. Tendinopathic cells were cultured in 3-dimensional (3D) hydrogels formed using PPP, PRP, and L-PRP. Cell migration was evaluated using a μ-Slide chemotaxis chamber with video microscopy. Proliferation was assessed using XTT assays. Expression of genes associated with matrix turnover, including type 1 collagen (COL1A1), COL3A1, aggrecan, decorin, fibronectin, matrix metalloproteinase 1 (MMP-1), MMP-3, A Disintegrin-Like And Metalloprotease With Thrombospondin Type 1 Motif proteins 4 (ADAMTS-4), and ADAMTS-5, was assessed using real-time reverse-transcription polymerase chain reaction. Secreted inflammatory proteins, including interleukin (IL)-1β, IL-6, IL-8, monocyte chemotactic protein 1 (MCP-1), and regulated on activation, normal T cell expressed and secreted (RANTES), as well as vascular endothelial growth factor (VEGF) and connective tissue growth factor (CTGF), were quantified using enzyme-linked immunosorbent assay. Tendinopathic cells migrate at a higher velocity along L-PRP and PRP than along PPP gradients. PRP and L-PRP promote hypercellularity. PPP and PRP showed more pronounced anabolic properties, as demonstrated by enhanced COL1A1 and COL3A1 and reduced MMP-1 expression. Decorin, fibronectin, and aggrecan were downregulated in L-PRP compared with PPP and PRP. L-PRP and PRP were shown to be more proinflammatory than PPP in terms of IL-6 secretion, but cells in PPP showed MCP-1(high) phenotype. CTGF secretion was significantly reduced in L-PRP compared with PPP and PRP. The main advantages of L-PRP and PRP use, compared with PPP, include their stronger chemotactic and proliferative properties. While PPP and PRP stimulate matrix anabolism, L-PRP is more proinflammatory. Emphasis should be placed on the temporal needs and biological characteristics of injured tendons, and plasma formulations need to be tailored accordingly. Versatile systems allowing the preparation of different plasma formulations, such as PPP, PRP, or L-PRP, can help refine clinical applications by taking advantage of their different biological properties. © 2016 The Author(s).

A mutation causing Alport syndrome with tardive hearing loss is common in the western United States

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barker, D.F.; Denison, J.C.; Atkin, C.L.

1996-06-01

Mutations in the COL4A5 gene, located at Xq22, cause Alport syndrome (AS), a nephritis characterized by progressive deterioration of the glomerular basement membrane and usually associated with progressive hearing loss. We have identified a novel mutation, L1649R, present in 9 of 121 independently ascertained families. Affected males shared the same haplotype of eight polymorphic markers tightly linked to COL4A5, indicating common ancestry. Genealogical studies place the birth of this ancestor >200 years ago. The L1649R mutation is a relatively common cause of Alport syndrome in the western United States, in part because of the rapid growth and migratory expansion ofmore » mid-nineteenth-century pioneer populations carrying the gene. L1649R affects a highly conserved residue in the NC1 domain, which is involved in key inter- and intramolecular interactions, but results in a relatively mild disease phenotype. Renal failure in an L1649R male typically occurs in the 4th or 5th decade and precedes the onset of significant hearing loss by {approximately}10 years. 45 refs., 5 figs.« less

Dexmedetomidine Protects PC12 Cells from Lidocaine-Induced Cytotoxicity Through Downregulation of COL3A1 Mediated by miR-let-7b.

PubMed

Wang, Qiong; She, Yingjun; Bi, Xiaobao; Zhao, Baisong; Ruan, Xiangcai; Tan, Yonghong

2017-07-01

Safety concerns of some local anesthetics, such as lidocaine, have been raised in recent years due to potential neurological impairment. Dexmedetomidine may protect humans from neurotoxicity, and miR-let-7b is activated by nerve injury; however, the roles of miR-let-7b and its target gene in lidocaine-induced cytotoxicity are not well known. Through bioinformatics and a luciferase reporter assay, COL3A1 was suggested as a direct target gene of miR-let-7b. Here, we confirmed by measuring mRNA and protein levels that miR-let-7b was downregulated and COL3A1 was upregulated in lidocaine-treated cells, an observation that was reversed by dexmedetomidine. Similar to miR-let-7b mimics or knockdown of COL3A1, dexmedetomidine treatment reduced the expression of COL3A1, suppressed cell apoptosis and cell migration/invasion ability, and induced cell cycle progression and cell proliferation in PC12 cells, effects that were reversed by the miR-let-7b inhibitor. Meanwhile, proteins involved in cell apoptosis, such as Bcl2 and caspase 3, were impacted as well. Taken together, dexmedetomidine may protect PC12 cells from lidocaine-induced cytotoxicity through miR-let-7b and COL3A1, while also increasing Bcl2 and inhibiting caspase 3. Therefore, miR-let-7b and COL3A1 might play critical roles in neuronal injury, and they are potential therapeutic targets.

Collagen VI disorders: Insights on form and function in the extracellular matrix and beyond.

PubMed

Lamandé, Shireen R; Bateman, John F

2017-12-22

Mutations in the three canonical collagen VI genes, COL6A1, COL6A2 and COL6A3, cause a spectrum of muscle disease from Bethlem myopathy at the mild end to the severe Ullrich congenital muscular dystrophy. Mutations can be either dominant or recessive and the resulting clinical severity is influenced by the way mutations impact the complex collagen VI assembly process. Most mutations are found towards the N-terminus of the triple helical collagenous domain and compromise extracellular microfibril assembly. Outside the triple helix collagen VI is highly polymorphic and discriminating mutations from rare benign changes remains a major diagnostic challenge. Collagen VI deficiency alters extracellular matrix structure and biomechanical properties and leads to increased apoptosis and oxidative stress, decreased autophagy, and impaired muscle regeneration. Therapies that target these downstream consequences have been tested in a collagen VI null mouse and also in small human trials where they show modest clinical efficacy. An important role for collagen VI in obesity, cancer and diabetes is emerging. A major barrier to developing effective therapies is the paucity of information about how collagen VI deficiency in the extracellular matrix signals the final downstream consequences - the receptors involved and the intracellular messengers await further characterization. Copyright © 2017 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

Fibrocyte-like cells recruited to the spleen support innate and adaptive immune responses to acute injury or infection

PubMed Central

von Köckritz-Blickwede, Maren; Reichart, Donna; McGillvray, Shauna M.; Wingender, Gerhard; Kronenberg, Mitchell; Glass, Christopher K.; Nizet, Victor; Brenner, David A.

2011-01-01

Bone marrow (BM)-derived fibrocytes are a population of CD45+ and collagen Type I-expressing cells that migrate to the spleen and to target injured organs, such as skin, lungs, kidneys, and liver. While CD45+Col+ fibrocytes contribute to collagen deposition at the site of injury, the role of CD45+Col+ cells in spleen has not been elucidated. Here, we demonstrate that hepatotoxic injury (CCl4), TGF-β1, lipopolysaccharide, or infection with Listeria monocytogenes induce rapid recruitment of CD45+Col+ fibrocyte-like cells to the spleen. These cells have a gene expression pattern that includes antimicrobial factors (myleoperoxidase, cathelicidin, and defensins) and MHC II at higher levels than found on quiescent or activated macrophages. The immune functions of these splenic CD45+Col+ fibrocyte-like cells include entrapment of bacteria into extracellular DNA-based structures containing cathelicidin and presentation of antigens to naïve CD8+ T cells to induce their proliferation. Stimulation of these splenic fibrocyte-like cells with granulocyte macrophage-colony stimulating factor or macrophage-colony stimulating factor induces downregulation of collagen expression and terminal differentiation into the dendritic cells or macrophage. Thus, splenic CD45+Col+ cells are a population of rapidly mobilized BM-derived fibrocyte-like cells that respond to inflammation or infection to participate in innate and adaptive immune responses. PMID:21499735

Hyperactive antifreeze protein from an Antarctic sea ice bacterium Colwellia sp. has a compound ice-binding site without repetitive sequences.

PubMed

Hanada, Yuichi; Nishimiya, Yoshiyuki; Miura, Ai; Tsuda, Sakae; Kondo, Hidemasa

2014-08-01

Antifreeze proteins (AFPs) are structurally diverse macromolecules that bind to ice crystals and inhibit their growth to protect the organism from injuries caused by freezing. An AFP identified from the Antarctic bacterium Colwellia sp. strain SLW05 (ColAFP) is homologous to AFPs from a wide variety of psychrophilic microorganisms. To understand the antifreeze function of ColAFP, we have characterized its antifreeze activity and determined the crystal structure of this protein. The recombinant ColAFP exhibited thermal hysteresis activity of approximately 4 °C at a concentration of 0.14 mm, and induced rapid growth of ice crystals in the hexagonal direction. Fluorescence-based ice plane affinity analysis showed that ColAFP binds to multiple planes of ice, including the basal plane. These observations show that ColAFP is a hyperactive AFP. The crystal structure of ColAFP determined at 1.6 Å resolution revealed an irregular β-helical structure, similar to known homologs. Mutational and molecular docking studies showed that ColAFP binds to ice through a compound ice-binding site (IBS) located at a flat surface of the β-helix and the adjoining loop region. The IBS of ColAFP lacks the repetitive sequences that are characteristic of hyperactive AFPs. These results suggest that ColAFP exerts antifreeze activity through a compound IBS that differs from the characteristic IBSs shared by other hyperactive AFPs. This study demonstrates a novel method for protection from freezing by AFPs in psychrophilic microorganisms. Structural data for ColAFP have been submitted to the Protein Data Bank (PDB) under accession number 3WP9. © 2014 FEBS.

Osteogenesis Imperfecta: A Review with Clinical Examples

PubMed Central

van Dijk, F.S.; Cobben, J.M.; Kariminejad, A.; Maugeri, A.; Nikkels, P.G.J.; van Rijn, R.R.; Pals, G.

2011-01-01

Osteogenesis imperfecta (OI) is characterized by susceptibility to bone fractures, with a severity ranging from subtle increase in fracture frequency to prenatal fractures. The first scientific description of OI dates from 1788. Since then, important milestones in OI research and treatment have, among others, been the classification of OI into 4 types (the ‘Sillence classification’), the discovery of defects in collagen type I biosynthesis as a cause of most cases of OI and the use of bisphosphonate therapy. Furthermore, in the past 5 years, it has become clear that OI comprises a group of heterogeneous disorders, with an estimated 90% of cases due to a causative variant in the COL1A1 or COL1A2 genes and with the remaining 10% due to causative recessive variants in the 8 genes known so far, or in other currently unknown genes. This review aims to highlight the current knowledge around the history, epidemiology, pathogenesis, clinical/radiological features, management, and future prospects of OI. The text will be illustrated with clinical descriptions, including radiographs and, where possible, photographs of patients with OI. PMID:22570641

Regulation of gene expression in plasmid ColE1: delayed expression of the kil gene.

PubMed Central

Zhang, S P; Yan, L F; Zubay, G

1988-01-01

cea, imm, and kil are a cluster of three functionally related genes of the plasmid ColE1. The cea and kil genes are in the same inducible operon, with transcription being initiated from a promoter adjacent to the cea gene. The imm gene is located between the cea and kil genes, but it is transcribed in the opposite direction. Complementary interaction between the imm mRNA and the anti-imm sequences in the middle of the cea-kil transcript causes a pronounced delay in expression of the kil gene when the cea-kil operon is induced. A segment in the overlapping region between the cea and imm genes causes delayed expression of the kil gene in the absence of imm gene transcription. This delay effect increases the yields of colicin synthesized in induced cells. Images PMID:3142845

A specific collagen type II gene (COL2A1) mutation presenting as spondyloperipheral dysplasia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zabel, B.; Hilbert, K.; Spranger, J.

1996-05-03

We report on a patient with a skeletal dysplasia characterized by short stature, spondylo-epiphyseal involvement, and brachydactyly E-like changes. This condition has been described as spondyloperipheral dysplasia and the few published cases suggest autosomal dominant inheritance with considerable clinical variability. We found our sporadic case to be due to a collagen type II defect resulting from a specific COL2A1 mutation. This mutation is the first to be located at the C-terminal outside the helical domain of COL2A1. A frameshift as consequence of a 5 bp duplication in exon 51 leads to a stop codon. The resulting truncated C-propeptide region seemsmore » to affect helix formation and produces changes of chondrocyte morphology, collagen type II fibril structure and cartilage matrix composition. Our case with its distinct phenotype adds another chondrodysplasia to the clinical spectrum of type II collagenopathies. 16 refs., 4 figs.« less

Reversible five-coordinate ⇄ six-coordinate transformation in cobalt(II) complexes

NASA Astrophysics Data System (ADS)

Xiao, Linda; Bhadbhade, Mohan; Baker, Anthony T.

2018-04-01

The heterocyclic ligands 2,6-bis(pyrazol-1-yl)pyridine (L1) and 2,6-bis(benzimidazol-2-yl)pyridine (L2) and their cobalt(II) complexes were synthesized. The blue five-coordinate complex [Co(L1)Cl2] isolated initially from the reaction mixture rapidly absorbed water vapour from the atmosphere to yield the pink six-coordinate complex [Co(L1)(H2O)3]Cl2. This change is reversible upon desiccation or transferring [Co(L1)(H2O)3]Cl2 into acetonitrile. The five coordinate complex [Co(L2)Cl2], however, remains stable under similar conditions. The structures of the complexes [Co(L1)Cl2], [Co(L1)(H2O)3]Cl2 and [Co(L2)Cl2] have been determined by x-ray crystallography. The magnetic susceptibilities and the electronic spectra for [Co(L1)Cl2], [Co(L2)Cl2] and [Co(L1)(H2O)3]Cl2 are presented.

Outcomes of Corneal Cross-Linking Correlate With Cone-Specific Lysyl Oxidase Expression in Patients With Keratoconus.

PubMed

Shetty, Rohit; Rajiv Kumar, Nimisha; Pahuja, Natasha; Deshmukh, Rashmi; Vunnava, KrishnaPoojita; Abilash, Valsala Gopalakrishnan; Sinha Roy, Abhijit; Ghosh, Arkasubhra

2018-03-01

To evaluate the correlation of visual and keratometry outcomes after corneal cross-linking (CXL) in patients with keratoconus with cone epithelium-specific gene expression levels. Corneal epithelium was obtained from 35 eyes that underwent accelerated CXL (KXLII, 9 mW/cm for 10 min). Using corneal topography, epithelium over the cone and periphery was obtained separately from each subject. The ratio of gene expression for lysyl oxidase (LOX), matrix metalloproteinase 9 (MMP9), bone morphogenic protein 7, tissue inhibitor of metalloproteinase 1, collagen, type I, alpha 1, and collagen, type IV, alpha 1 (COL IVA1) from the cone and peripheral cornea was correlated with the outcome of cross-linking surgery. Patients were assessed for visual acuity, keratometry, refraction, and corneal densitometry before and 6 months after surgery. Based on the change in corneal flattening indicated by ΔKmax, the outcomes were classified as a higher response or lower response. Reduction in keratometric indices correlated with improved spherical equivalent after CXL. Preoperative levels of cone-specific LOX expression in cases with a higher response were significant (P = 0.001). COL IVA1, bone morphogenic protein 7, and tissue inhibitor of metalloproteinase 1 gene expressions were reduced in the cones of the subjects with a lower response. MMP9 levels were relatively lower in cases with a higher response compared with those with a lower response. Our study demonstrates that preoperative levels of molecular factors such as LOX, MMP9, and COL IVA1 aid in understanding CXL outcomes at the tissue level.

Col1A1 Production and Apoptotic Resistance in TGF-β1-Induced Epithelial-to-Mesenchymal Transition-Like Phenotype of 603B Cells

PubMed Central

Liu, Jun; Eischeid, Alex N.; Chen, Xian-Ming

2012-01-01

Recent studies have suggested that proliferating cholangiocytes have an important role in the induction of fibrosis, either directly via epithelial-to-mesenchymal transition (EMT), or indirectly via activation of other liver cell types. Transforming growth factor beta 1 (TGF-β1), a critical fibrotic cytokine for hepatic fibrosis, is a potent EMT inducer. This study aimed to clarify the potential contributions of TGF-β1-induced EMT-like cholangiocyte phenotype to collagen production and cell survival of cholangiocytes in vitro. Mouse cholangiocytes (603B cells) were treated with TGF-β1 and EMT-like phenotype alterations were monitored by morphological changes and expression of EMT-associated genes. Alterations in Col1A1 gene, Col1A1-associated miR-29s, and pro-apoptotic genes were measured in TGF-β1-treated 603B cells. Snail1 knockdown was achieved using shRNA to evaluate the contribution of EMT-associated changes to Col1A1 production and cell survival. We found TGF-β1 treatment induced partial EMT-like phenotype transition in 603B cells in a Snail1-dependent manner. TGF-β1 also stimulated collagen α1(I) expression in 603B cells. However, this induction was not parallel to the EMT-like alterations and independent of Snail1 or miR-29 expression. Cells undergoing EMT-like changes showed a modest down-regulation of multiple pro-apoptotic genes and displayed resistance to TNF-α-induced apoptosis. TGF-β1-induced apoptosis resistance was attenuated in Snail1 knockdown 603B cells. TGF-β1-induced Col1A1 production seems to be independent of EMT-like transition and miR-29 expression. Nevertheless, TGF-β1-induced EMT may contribute to the increased survival capacity of cholangiocytes via modulating the expression of pro-apoptotic genes. PMID:23236489

Critical early roles for col27a1a and col27a1b in zebrafish notochord morphogenesis, vertebral mineralization and post-embryonic axial growth.

PubMed

Christiansen, Helena E; Lang, Michael R; Pace, James M; Parichy, David M

2009-12-29

Fibrillar collagens are well known for their links to human diseases, with which all have been associated except for the two most recently identified fibrillar collagens, type XXIV collagen and type XXVII collagen. To assess functions and potential disease phenotypes of type XXVII collagen, we examined its roles in zebrafish embryonic and post-embryonic development. We identified two type XXVII collagen genes in zebrafish, col27a1a and col27a1b. Both col27a1a and col27a1b were expressed in notochord and cartilage in the embryo and early larva. To determine sites of type XXVII collagen function, col27a1a and col27a1b were knocked down using morpholino antisense oligonucleotides. Knockdown of col27a1a singly or in conjunction with col27a1b resulted in curvature of the notochord at early stages and formation of scoliotic curves as well as dysmorphic vertebrae at later stages. These defects were accompanied by abnormal distributions of cells and protein localization in the notochord, as visualized by transmission electron microscopy, as well as delayed vertebral mineralization as detected histologically. Together, our findings indicate a key role for type XXVII collagen in notochord morphogenesis and axial skeletogenesis and suggest a possible human disease phenotype.

Biological Warfare and American Strategic Risk

DTIC Science & Technology

2000-06-01

pandemics. 43 Col Ronald F. Bellamy and Col Craig H. Llewellyn, “Preventable Casualties: Rommel’s Flaw...of Air Power. New York: Free Press, 1989. Cook- Deegan , Robert. The Gene Wars: Science, Politics, and the Human Genome. New York: W.W. Norton and Co...and Col Craig H. Llewellyn. “Preventable Casualties: Rommel’s Flaw, Slim’s Edge.” Army (May 1990): 52-56. Burrows, W. Dickinson and Sara E. Renner

Large-scale gene-centric analysis identifies novel variants for coronary artery disease.

PubMed

2011-09-01

Coronary artery disease (CAD) has a significant genetic contribution that is incompletely characterized. To complement genome-wide association (GWA) studies, we conducted a large and systematic candidate gene study of CAD susceptibility, including analysis of many uncommon and functional variants. We examined 49,094 genetic variants in ∼2,100 genes of cardiovascular relevance, using a customised gene array in 15,596 CAD cases and 34,992 controls (11,202 cases and 30,733 controls of European descent; 4,394 cases and 4,259 controls of South Asian origin). We attempted to replicate putative novel associations in an additional 17,121 CAD cases and 40,473 controls. Potential mechanisms through which the novel variants could affect CAD risk were explored through association tests with vascular risk factors and gene expression. We confirmed associations of several previously known CAD susceptibility loci (eg, 9p21.3:p<10(-33); LPA:p<10(-19); 1p13.3:p<10(-17)) as well as three recently discovered loci (COL4A1/COL4A2, ZC3HC1, CYP17A1:p<5×10(-7)). However, we found essentially null results for most previously suggested CAD candidate genes. In our replication study of 24 promising common variants, we identified novel associations of variants in or near LIPA, IL5, TRIB1, and ABCG5/ABCG8, with per-allele odds ratios for CAD risk with each of the novel variants ranging from 1.06-1.09. Associations with variants at LIPA, TRIB1, and ABCG5/ABCG8 were supported by gene expression data or effects on lipid levels. Apart from the previously reported variants in LPA, none of the other ∼4,500 low frequency and functional variants showed a strong effect. Associations in South Asians did not differ appreciably from those in Europeans, except for 9p21.3 (per-allele odds ratio: 1.14 versus 1.27 respectively; P for heterogeneity = 0.003). This large-scale gene-centric analysis has identified several novel genes for CAD that relate to diverse biochemical and cellular functions and clarified the literature with regard to many previously suggested genes.

Differential expression of alternatively spliced transcripts related to energy metabolism in colorectal cancer.

PubMed

Snezhkina, Anastasiya Vladimirovna; Krasnov, George Sergeevich; Zaretsky, Andrew Rostislavovich; Zhavoronkov, Alex; Nyushko, Kirill Mikhailovich; Moskalev, Alexey Alexandrovich; Karpova, Irina Yurievna; Afremova, Anastasiya Isaevna; Lipatova, Anastasiya Valerievna; Kochetkov, Dmitriy Vladimitovich; Fedorova, Maria Sergeena; Volchenko, Nadezhda Nikolaevna; Sadritdinova, Asiya Fayazovna; Melnikova, Nataliya Vladimirovna; Sidorov, Dmitry Vladimirovich; Popov, Anatoly Yurievich; Kalinin, Dmitry Valerievich; Kaprin, Andrey Dmitrievich; Alekseev, Boris Yakovlevich; Dmitriev, Alexey Alexandrovich; Kudryavtseva, Anna Viktorovna

2016-12-28

Colorectal cancer (CRC) is one of the most common malignant tumors worldwide. CRC molecular pathogenesis is heterogeneous and may be followed by mutations in oncogenes and tumor suppressor genes, chromosomal and microsatellite instability, alternative splicing alterations, hypermethylation of CpG islands, oxidative stress, impairment of different signaling pathways and energy metabolism. In the present work, we have studied the alterations of alternative splicing patterns of genes related to energy metabolism in CRC. Using CrossHub software, we analyzed The Cancer Genome Atlas (TCGA) RNA-Seq datasets derived from colon tumor and matched normal tissues. The expression of 1014 alternative mRNA isoforms involved in cell energy metabolism was examined. We found 7 genes with differentially expressed alternative transcripts whereas overall expression of these genes was not significantly altered in CRC. A set of 8 differentially expressed transcripts of interest has been validated by qPCR. These eight isoforms encoded by OGDH, COL6A3, ICAM1, PHPT1, PPP2R5D, SLC29A1, and TRIB3 genes were up-regulated in colorectal tumors, and this is in concordance with the bioinformatics data. The alternative transcript NM_057167 of COL6A3 was also strongly up-regulated in breast, lung, prostate, and kidney tumors. Alternative transcript of SLC29A1 (NM_001078177) was up-regulated only in CRC samples, but not in the other tested tumor types. We identified tumor-specific expression of alternative spliced transcripts of seven genes involved in energy metabolism in CRC. Our results bring new knowledge on alternative splicing in colorectal cancer and suggest a set of mRNA isoforms that could be used for cancer diagnosis and development of treatment methods.

Association of gene variants of transcription factors PPARγ, RUNX2, Osterix genes and COL2A1, IGFBP3 genes with the development of osteonecrosis of the femoral head in Chinese population.

PubMed

Song, Yang; Du, Zhenwu; Ren, Ming; Yang, Qiwei; Wang, Qingyu; Chen, Gaoyang; Zhao, Haiyue; Li, Zhaoyan; Wang, Jincheng; Zhang, Guizhen

2017-08-01

The molecular pathogenesis of osteonecrosis of the femoral head (ONFH) has been remained obscure so that its prevalence has been increasing in recent decades. Different transcription factors play critical roles in maintaining the balance between osteogenesis and adipogenesis. However, it has been unclear that the genes variants of the transcription factors exert the effects on the imbalance between steogenesis and adipogenesis during the development of ONFH. Here, we selected the 11SNPs from steogenesis, adipogenesis-specific transcription factors RUNX2, Osterix, and PPARγ genes, chondrogenesis or adipogenesis key factors COL2A1, IGFBP3 genes and analysed the genotypes, alleles, haplotypes and their association with the risk and clinical phenotypes of ONFH through Mass ARRAY® platformin in 200 ONFH patients and 177controls. The patients with ONFH (132 males, 68 females; age: 53.46±11.48yr) were consecutively enrolled at the Department of Orthopedics, the Second Clinical College of Jilin University, from March 2014 to June 2015 and were diagnosed and classified into 10 cases of stage II (5.6%), 54 cases of stage III (30.2%) and 115 cases (64.2%) of stage IV and alcohol-induced (71 cases (39.7%)), idiopathic (64 cases (34.0%)), and steroid-induced osteonecrosis (47 cases (26.3%)) subgroup, respectively. Our results showed that all models of logistical regression analysis, the co-dominants, dominants, and recessives of PPARγrs2920502, significantly associated with the increased risk of ONFH (p=0.004, p=0.013, p=0.016), respectively. Both the minor homozygous CC genotype and the allele C of rs2920502 were evidently correlated with the enhanced risk of ONFH (p=0.005, p=0.0005),respectively. The recessives models of IGFBP3rs2132572 (G/A) as well as RUNX2 rs3763190(G/A) were statistically associated with the higher ONFH risk, p=0.030, p=0.029, respectively; the minor homozygous(AA) of IGFBP3rs2132572 (G/A) was also related to the increased risk of bilateral hips lesions, p=0.039. Moreover, the ages on set of major homozygous(GG) and heterozygous(GT) of COL2A1rs2070739(G/A) were significantly younger than that of the minor homozygous(AA) of the SNP(p=0.008) while the A-T-G-A haplotype of COL2A1 gene revealed significant association with the decreased the risk of bilateral hip lesions, p=0.01, OR:0.258. More important, the serum HDL-c level and the ratio of LDL-c/HDL-c in the ONFH group were significantly decreased and increased compared with those of the control group (p=0.02, p=0.0001), respectively. Particularly, the CC genotype of PPARγ rs2920502 was statistically correlated with the enhanced serum TG level, p=0.011.These results suggest that the variants of PPARγ, RUNX2, COL2A1, and IGFBP3 genes closely associated with the development of ONFH. Copyright © 2017. Published by Elsevier Inc.

Novel Immortal Cell Lines Support Cellular Heterogeneity in the Human Annulus Fibrosus

PubMed Central

van den Akker, Guus G. H.; Surtel, Don A. M.; Cremers, Andy; Richardson, Stephen M.; Hoyland, Judith A.; van Rhijn, Lodewijk W.

2016-01-01

Introduction Loss of annulus fibrosus (AF) integrity predisposes to disc herniation and is associated with IVD degeneration. Successful implementation of biomedical intervention therapy requires in-depth knowledge of IVD cell biology. We recently generated unique clonal human nucleus pulposus (NP) cell lines. Recurring functional cellular phenotypes from independent donors provided pivotal evidence for cell heterogeneity in the mature human NP. In this study we aimed to generate and characterize immortal cell lines for the human AF from matched donors. Methods Non-degenerate healthy disc material was obtained as surplus surgical material. AF cells were immortalized by simian virus Large T antigen (SV40LTAg) and human telomerase (hTERT) expression. Early passage cells and immortalized cell clones were characterized based on marker gene expression under standardized culturing and in the presence of Transforming Growth factor β (TGFβ). Results The AF-specific expression signature included COL1A1, COL5A1, COL12A1, SFRP2 and was largely maintained in immortal AF cell lines. Remarkably, TGFβ induced rapid 3D sheet formation in a subgroup of AF clones. This phenotype was associated with inherent differences in Procollagen type I processing and maturation, and correlated with differential mRNA expression of Prolyl 4-hydroxylase alpha polypeptide 1 and 3 (P4HA1,3) and Lysyl oxidase (LOX) between clones and differential P4HA3 protein expression between AF cells in histological sections. Conclusion We report for the first time the generation of representative human AF cell lines. Gene expression profile analysis and functional comparison of AF clones revealed variation between immortalized cells and suggests phenotypic heterogeneity in the human AF. Future characterization of AF cellular (sub-)populations aims to combine identification of additional specific AF marker genes and their biological relevance. Ultimately this knowledge will contribute to clinical application of cell-based technology in IVD repair. PMID:26794306

Novel Immortal Cell Lines Support Cellular Heterogeneity in the Human Annulus Fibrosus.

PubMed

van den Akker, Guus G H; Surtel, Don A M; Cremers, Andy; Richardson, Stephen M; Hoyland, Judith A; van Rhijn, Lodewijk W; Voncken, Jan Willem; Welting, Tim J M

2016-01-01

Loss of annulus fibrosus (AF) integrity predisposes to disc herniation and is associated with IVD degeneration. Successful implementation of biomedical intervention therapy requires in-depth knowledge of IVD cell biology. We recently generated unique clonal human nucleus pulposus (NP) cell lines. Recurring functional cellular phenotypes from independent donors provided pivotal evidence for cell heterogeneity in the mature human NP. In this study we aimed to generate and characterize immortal cell lines for the human AF from matched donors. Non-degenerate healthy disc material was obtained as surplus surgical material. AF cells were immortalized by simian virus Large T antigen (SV40LTAg) and human telomerase (hTERT) expression. Early passage cells and immortalized cell clones were characterized based on marker gene expression under standardized culturing and in the presence of Transforming Growth factor β (TGFβ). The AF-specific expression signature included COL1A1, COL5A1, COL12A1, SFRP2 and was largely maintained in immortal AF cell lines. Remarkably, TGFβ induced rapid 3D sheet formation in a subgroup of AF clones. This phenotype was associated with inherent differences in Procollagen type I processing and maturation, and correlated with differential mRNA expression of Prolyl 4-hydroxylase alpha polypeptide 1 and 3 (P4HA1,3) and Lysyl oxidase (LOX) between clones and differential P4HA3 protein expression between AF cells in histological sections. We report for the first time the generation of representative human AF cell lines. Gene expression profile analysis and functional comparison of AF clones revealed variation between immortalized cells and suggests phenotypic heterogeneity in the human AF. Future characterization of AF cellular (sub-)populations aims to combine identification of additional specific AF marker genes and their biological relevance. Ultimately this knowledge will contribute to clinical application of cell-based technology in IVD repair.

RNAi of COL1A1 in mesenchymal progenitor cells.

PubMed

Millington-Ward, Sophia; McMahon, Helena P; Allen, Danny; Tuohy, Gearóid; Kiang, Anna-Sophia; Palfi, Arpad; Kenna, Paul F; Humphries, Peter; Farrar, G Jane

2004-10-01

Given that mutant COL1A1 is known to cause Osteogenesis Imperfecta (OI), tools to modulate COL1A1 expression are likely to be of significant therapeutic value. In this context, we have evaluated RNA interference (RNAi) as a means to downregulate COL1A1 expression in Cos-7 cells and in human mesenchymal progenitor stem cells (MPCs), the latter cells giving rise to bone and therefore representing a target cell type for collagen-related disorders. In addition, allele-specificity, a key factor to the success of RNAi-based suppression, was explored with a view to developing a mutation-independent RNAi-based therapeutic for OI by targeting an intragenic SNP within transcripts derived from the COL1A1 gene. Preferential suppression of individual polymorphic alleles that differed by a single nucleotide was observed.

Mosaicism for dominant collagen 6 mutations as a cause for intrafamilial phenotypic variability.

PubMed

Donkervoort, Sandra; Hu, Ying; Stojkovic, Tanya; Voermans, Nicol C; Foley, A Reghan; Leach, Meganne E; Dastgir, Jahannaz; Bolduc, Véronique; Cullup, Thomas; de Becdelièvre, Alix; Yang, Lin; Su, Hai; Meilleur, Katherine; Schindler, Alice B; Kamsteeg, Erik-Jan; Richard, Pascale; Butterfield, Russell J; Winder, Thomas L; Crawford, Thomas O; Weiss, Robert B; Muntoni, Francesco; Allamand, Valérie; Bönnemann, Carsten G

2015-01-01

Collagen 6-related dystrophies and myopathies (COL6-RD) are a group of disorders that form a wide phenotypic spectrum, ranging from severe Ullrich congenital muscular dystrophy, intermediate phenotypes, to the milder Bethlem myopathy. Both inter- and intrafamilial variable expressivity are commonly observed. We present clinical, immunohistochemical, and genetic data on four COL6-RD families with marked intergenerational phenotypic heterogeneity. This variable expression seemingly masquerades as anticipation is due to parental mosaicism for a dominant mutation, with subsequent full inheritance and penetrance of the mutation in the heterozygous offspring. We also present an additional fifth simplex patient identified as a mosaic carrier. Parental mosaicism was confirmed in the four families through quantitative analysis of the ratio of mutant versus wild-type allele (COL6A1, COL6A2, and COL6A3) in genomic DNA from various tissues, including blood, dermal fibroblasts, and saliva. Consistent with somatic mosaicism, parental samples had lower ratios of mutant versus wild-type allele compared with the fully heterozygote offspring. However, there was notable variability of the mutant allele levels between tissues tested, ranging from 16% (saliva) to 43% (fibroblasts) in one mosaic father. This is the first report demonstrating mosaicism as a cause of intrafamilial/intergenerational variability of COL6-RD, and suggests that sporadic and parental mosaicism may be more common than previously suspected. © 2014 WILEY PERIODICALS, INC.

Comparing effects of perfusion and hydrostatic pressure on gene profiles of human chondrocyte.

PubMed

Zhu, Ge; Mayer-Wagner, Susanne; Schröder, Christian; Woiczinski, Matthias; Blum, Helmut; Lavagi, Ilaria; Krebs, Stefan; Redeker, Julia I; Hölzer, Andreas; Jansson, Volkmar; Betz, Oliver; Müller, Peter E

2015-09-20

Hydrostatic pressure and perfusion have been shown to regulate the chondrogenic potential of articular chondrocytes. In order to compare the effects of hydrostatic pressure plus perfusion (HPP) and perfusion (P) we investigated the complete gene expression profiles of human chondrocytes under HPP and P. A simplified bioreactor was constructed to apply loading (0.1 MPa for 2 h) and perfusion (2 ml) through the same piping by pressurizing the medium directly. High-density monolayer cultures of human chondrocytes were exposed to HPP or P for 4 days. Controls (C) were maintained in static cultures. Gene expression was evaluated by sequencing (RNAseq) and quantitative real-time PCR analysis. Both treatments changed gene expression levels of human chondrocytes significantly. Specifically, HPP and P increased COL2A1 expression and decreased COL1A1 and MMP-13 expression. Despite of these similarities, RNAseq revealed a list of cartilage genes including ACAN, ITGA10 and TNC, which were differentially expressed by HPP and P. Of these candidates, adhesion related molecules were found to be upregulated in HPP. Both HPP and P treatment had beneficial effects on chondrocyte differentiation and decreased catabolic enzyme expression. The study provides new insight into how hydrostatic pressure and perfusion enhance cartilage differentiation and inhibit catabolic effects. Copyright © 2015 Elsevier B.V. All rights reserved.

A Children's Oncology Group and TARGET initiative exploring the genetic landscape of Wilms tumor.

PubMed

Gadd, Samantha; Huff, Vicki; Walz, Amy L; Ooms, Ariadne H A G; Armstrong, Amy E; Gerhard, Daniela S; Smith, Malcolm A; Auvil, Jaime M Guidry; Meerzaman, Daoud; Chen, Qing-Rong; Hsu, Chih Hao; Yan, Chunhua; Nguyen, Cu; Hu, Ying; Hermida, Leandro C; Davidsen, Tanja; Gesuwan, Patee; Ma, Yussanne; Zong, Zusheng; Mungall, Andrew J; Moore, Richard A; Marra, Marco A; Dome, Jeffrey S; Mullighan, Charles G; Ma, Jing; Wheeler, David A; Hampton, Oliver A; Ross, Nicole; Gastier-Foster, Julie M; Arold, Stefan T; Perlman, Elizabeth J

2017-10-01

We performed genome-wide sequencing and analyzed mRNA and miRNA expression, DNA copy number, and DNA methylation in 117 Wilms tumors, followed by targeted sequencing of 651 Wilms tumors. In addition to genes previously implicated in Wilms tumors (WT1, CTNNB1, AMER1, DROSHA, DGCR8, XPO5, DICER1, SIX1, SIX2, MLLT1, MYCN, and TP53), we identified mutations in genes not previously recognized as recurrently involved in Wilms tumors, the most frequent being BCOR, BCORL1, NONO, MAX, COL6A3, ASXL1, MAP3K4, and ARID1A. DNA copy number changes resulted in recurrent 1q gain, MYCN amplification, LIN28B gain, and MIRLET7A loss. Unexpected germline variants involved PALB2 and CHEK2. Integrated analyses support two major classes of genetic changes that preserve the progenitor state and/or interrupt normal development.

A Children's Oncology Group and TARGET Initiative Exploring the Genetic Landscape of Wilms Tumor

PubMed Central

Gadd, Samantha; Huff, Vicki; Walz, Amy L.; Ooms, Ariadne H.A.G.; Armstrong, Amy E.; Gerhard, Daniela S.; Smith, Malcolm A.; Guidry Auvil, Jaime M.; Meerzaman, Daoud; Chen, Qing-Rong; Hsu, Chih Hao; Yan, Chunhua; Nguyen, Cu; Hu, Ying; Hermida, Leandro C.; Davidsen, Tanja; Gesuwan, Patee; Ma, Yussanne; Zong, Zusheng; Mungall, Andrew J.; Moore, Richard A.; Marra, Marco A.; Dome, Jeffrey S.; Mullighan, Charles G.; Ma, Jing; Wheeler, David A.; Hampton, Oliver A.; Ross, Nicole; Gastier-Foster, Julie M.; Arold, Stefan T.; Perlman, Elizabeth J.

2017-01-01

Genome-wide sequencing, mRNA and miRNA expression, DNA copy number and methylation analyses were performed on 117 Wilms tumors, followed by targeted sequencing of 651 Wilms tumors. In addition to genes previously implicated in Wilms tumors (WT1, CTNNB1, FAM123B, DROSHA, DGCR8, XPO5, DICER1, SIX1, SIX2, MLLT1, MYCN, and TP53), mutations were identified in genes not previously recognized as recurrently involved in Wilms tumors, the most frequent being BCOR, BCORL1, NONO, MAX, COL6A3, ASXL1, MAP3K4, and ARID1A. DNA copy number changes resulted in recurrent 1q gain, MYCN amplification, LIN28B gain, and let-7a loss. Unexpected germline variants involved PALB2 and CHEK2. Integrated analyses support two major classes of genetic changes that preserve the progenitor state and/or interrupt normal development. PMID:28825729

Changes in the Transcriptome of the Human Endometrial Ishikawa Cancer Cell Line Induced by Estrogen, Progesterone, Tamoxifen, and Mifepristone (RU486) as Detected by RNA-Sequencing

PubMed Central

Tamm-Rosenstein, Karin; Simm, Jaak; Suhorutshenko, Marina; Salumets, Andres; Metsis, Madis

2013-01-01

Background Estrogen (E2) and progesterone (P4) are key players in the maturation of the human endometrium. The corresponding steroid hormone modulators, tamoxifen (TAM) and mifepristone (RU486) are widely used in breast cancer therapy and for contraception purposes, respectively. Methodology/Principal findings Gene expression profiling of the human endometrial Ishikawa cancer cell line treated with E2 and P4 for 3 h and 12 h, and TAM and RU486 for 12 h, was performed using RNA-sequencing. High levels of mRNA were detected for genes, including PSAP, ATP5G2, ATP5H, and GNB2L1 following E2 or P4 treatment. A total of 82 biomarkers for endometrial biology were identified among E2 induced genes, and 93 among P4 responsive genes. Identified biomarkers included: EZH2, MDK, MUC1, SLIT2, and IL6ST, which are genes previously associated with endometrial receptivity. Moreover, 98.8% and 98.6% of E2 and P4 responsive genes in Ishikawa cells, respectively, were also detected in two human mid-secretory endometrial biopsy samples. TAM treatment exhibited both antagonistic and agonistic effects of E2, and also regulated a subset of genes independently. The cell cycle regulator cyclin D1 (CCND1) showed significant up-regulation following treatment with TAM. RU486 did not appear to act as a pure antagonist of P4 and a functional analysis of RU486 response identified genes related to adhesion and apoptosis, including down-regulated genes associated with cell-cell contacts and adhesion as CTNND1, JUP, CDH2, IQGAP1, and COL2A1. Conclusions Significant changes in gene expression by the Ishikawa cell line were detected after treatments with E2, P4, TAM, and RU486. These transcriptome data provide valuable insight into potential biomarkers related to endometrial receptivity, and also facilitate an understanding of the molecular changes that take place in the endometrium in the early stages of breast cancer treatment and contraception usage. PMID:23874806

Osteogenesis imperfecta: recent findings shed new light on this once well-understood condition.

PubMed

Basel, Donald; Steiner, Robert D

2009-06-01

Osteogenesis imperfecta is a systemic heritable disorder of connective tissue whose cardinal manifestation is bone fragility. In approximately 90% of individuals with osteogenesis imperfecta, mutations in either of the genes encoding the pro-alpha1 or pro-alpha2 chains of type I collagen (COL1A1 or COL1A2) can be identified. Of those without collagen mutations, a number of them will have mutations involving the enzyme complex responsible for posttranslational hydroxylation of the position 3 proline residue of COL1A1. Two of the genes encoding proteins involved in that enzyme complex, LEPRE1 and cartilage-associated protein, when mutated have been shown to cause autosomal recessive osteogenesis imperfecta, which has a moderate to severe clinical phenotype, often indistinguishable from osteogenesis imperfecta types II or III. Mutations in COL1A1 or COL1A2 which result in an abnormal protein still capable of forming a triple helix cause a more severe phenotype than mutations that lead to decreased collagen production as a result of the dominant negative effect mediated by continuous protein turnover. The current standard of care includes a multidisciplinary approach with surgical intervention when necessary, proactive physiotherapy, and consideration for the use of bisphosphonates all in attempts to improve quality of life.

Functional assessment of a novel COL4A5 splice region variant and immunostaining of plucked hair follicles as an alternative method of diagnosis in X-linked Alport syndrome.

PubMed

Malone, Andrew F; Funk, Steven D; Alhamad, Tarek; Miner, Jeffrey H

2017-06-01

Many COL4A5 splice region variants have been described in patients with X-linked Alport syndrome, but few have been confirmed by functional analysis to actually cause defective splicing. We sought to demonstrate that a novel COL4A5 splice region variant in a family with Alport syndrome is pathogenic using functional studies. We also describe an alternative method of diagnosis. Targeted next-generation sequencing results of an individual with Alport syndrome were analyzed and the results confirmed by Sanger sequencing in family members. A splicing reporter minigene assay was used to examine the variant's effect on splicing in transfected cells. Plucked hair follicles from patients and controls were examined for collagen IV proteins using immunofluorescence microscopy. A novel splice region mutation in COL4A5, c.1780-6T>G, was identified and segregated with disease in this family. This variant caused frequent skipping of exon 25, resulting in a frameshift and truncation of collagen α5(IV) protein. We also developed and validated a new approach to characterize the expression of collagen α5(IV) protein in the basement membranes of plucked hair follicles. Using this approach we demonstrated reduced collagen α5(IV) protein in affected male and female individuals in this family, supporting frequent failure of normal splicing. Differing normal to abnormal transcript ratios in affected individuals carrying splice region variants may contribute to variable disease severity observed in Alport families. Examination of plucked hair follicles in suspected X-linked Alport syndrome patients may offer a less invasive alternative method of diagnosis and serve as a pathogenicity test for COL4A5 variants of uncertain significance.

Functional assessment of a novel COL4A5 splice region variant and immunostaining of plucked hair follicles as an alternative method of diagnosis in X-linked Alport syndrome

PubMed Central

Malone, Andrew F.; Funk, Steven D.; Alhamad, Tarek; Miner, Jeffrey H.

2016-01-01

Introduction Many COL4A5 splice region variants have been described in patients with X-linked Alport syndrome, but few have been confirmed by functional analysis to actually cause defective splicing. We sought to demonstrate that a novel COL4A5 splice region variant in a family with Alport syndrome is pathogenic using functional studies. We also describe an alternative method of diagnosis. Methods We analyzed targeted next-generation sequencing results of an individual with Alport syndrome and confirmed results by Sanger sequencing in family members. A splicing reporter minigene assay was used to examine the variant’s effect on splicing in transfected cells. Plucked hair follicles from patients and controls were examined for collagen IV proteins using immunofluorescence microscopy. Results A novel splice region mutation in COL4A5, c.1780-6T>G, was identified and segregated with disease in this family. This variant caused frequent skipping of exon 25, resulting in a frameshift and truncation of collagen α5(IV) protein. We also developed and validated a new approach to characterize the expression of collagen α5(IV) protein in the basement membranes of plucked hair follicles. We demonstrated reduced collagen α5(IV) protein in affected male and female individuals in this family, supporting frequent failure of normal splicing. Conclusions Differing normal to abnormal transcript ratios in affected individuals carrying splice region variants may contribute to variable disease severity observed in Alport families. Examination of plucked hair follicles in suspected X-linked Alport syndrome patients may offer a less invasive alternative method of diagnosis and serve as a pathogenicity test for COL4A5 variants of uncertain significance. PMID:28013382

Variability and distribution of COL1A2 (type I collagen) polymorphisms in the central-eastern Mediterranean Basin.

PubMed

Scorrano, Gabriele; Lelli, Roberta; Martínez-Labarga, Cristina; Scano, Giuseppina; Contini, Irene; Hafez, Hani S; Rudan, Pavao; Rickards, Olga

2016-01-01

The most abundant of the collagen protein family, type I collagen is encoded by the COL1A2 gene. The COL1A2 restriction fragment length polymorphisms (RFLPs) EcoRI, RsaI and MspI in samples from several different central-eastern Mediterranean populations were analysed and found to be potentially informative anthropogenetic markers. The objective was to define the genetic variability of COL1A2 in the central-eastern Mediterranean and to shed light on its genetic distribution in human groups over a wide geographic area. PCR-RFLP analysis of EcoRI, RsaI and MspI polymorphisms of the COL1A2 gene was performed on oral swab and blood samples from 308 individuals from the central-eastern Mediterranean Basin. The genetic similarities among these groups and other populations described in the literature were investigated through correspondence analysis. Single-marker data and haplotype frequencies seemed to suggest a genetic homogeneity within the European populations, whereas a certain degree of differentiation was noted for the Egyptians and the Turks. The genetic variability in the central-eastern Mediterranean area is probably a result of the geographical barrier of the Mediterranean Sea, which separated European and African populations over time.

Structures of three polycystic kidney disease-like domains from Clostridium histolyticum collagenases ColG and ColH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bauer, Ryan; Janowska, Katarzyna; Taylor, Kelly

Clostridium histolyticumcollagenases ColG and ColH are segmental enzymes that are thought to be activated by Ca 2+-triggered domain reorientation to cause extensive tissue destruction. The collagenases consist of a collagenase module (s1), a variable number of polycystic kidney disease-like (PKD-like) domains (s2a and s2b in ColH and s2 in ColG) and a variable number of collagen-binding domains (s3 in ColH and s3a and s3b in ColG). The X-ray crystal structures of Ca 2+-bound holo s2b (1.4 Å resolution,R= 15.0%,R free= 19.1%) and holo s2a (1.9 Å resolution,R= 16.3%,R free= 20.7%), as well as of Ca 2+-free apo s2a (1.8 Åmore » resolution,R= 20.7%,R free= 27.2%) and two new forms of N-terminally truncated apo s2 (1.4 Å resolution,R= 16.9%,R free= 21.2%; 1.6 Å resolution,R= 16.2%,R free= 19.2%), are reported. The structurally similar PKD-like domains resemble the V-set Ig fold. In addition to a conserved β-bulge, the PKD-like domains feature a second bulge that also changes the allegiance of the subsequent β-strand. This β-bulge and the genesis of a Ca 2+pocket in the archaeal PKD-like domain suggest a close kinship between bacterial and archaeal PKD-like domains. Different surface properties and indications of different dynamics suggest unique roles for the PKD-like domains in ColG and in ColH. Surface aromatic residues found on ColH s2a-s2b, but not on ColG s2, may provide the weak interaction in the biphasic collagen-binding mode previously found in s2b-s3.B-factor analyses suggest that in the presence of Ca 2+the midsection of s2 becomes more flexible but the midsections of s2a and s2b stay rigid. The different surface properties and dynamics of the domains suggest that the PKD-like domains of M9B bacterial collagenase can be grouped into either a ColG subset or a ColH subset. The conserved properties of PKD-like domains in ColG and in ColH include Ca 2+binding. Conserved residues not only interact with Ca 2+, but also position the Ca 2+-interacting water molecule. Ca 2+aligns the N-terminal linker approximately parallel to the major axis of the domain. Ca 2+binding also increases stability against heat and guanidine hydrochloride, and may improve the longevity in the extracellular matrix. The results of this study will further assist in developing collagen-targeting vehicles for various signal molecules.« less

Structures of three polycystic kidney disease-like domains from Clostridium histolyticum collagenases ColG and ColH

DOE PAGES

Bauer, Ryan; Janowska, Katarzyna; Taylor, Kelly; ...

2015-03-01

Clostridium histolyticumcollagenases ColG and ColH are segmental enzymes that are thought to be activated by Ca 2+-triggered domain reorientation to cause extensive tissue destruction. The collagenases consist of a collagenase module (s1), a variable number of polycystic kidney disease-like (PKD-like) domains (s2a and s2b in ColH and s2 in ColG) and a variable number of collagen-binding domains (s3 in ColH and s3a and s3b in ColG). The X-ray crystal structures of Ca 2+-bound holo s2b (1.4 Å resolution,R= 15.0%,R free= 19.1%) and holo s2a (1.9 Å resolution,R= 16.3%,R free= 20.7%), as well as of Ca 2+-free apo s2a (1.8 Åmore » resolution,R= 20.7%,R free= 27.2%) and two new forms of N-terminally truncated apo s2 (1.4 Å resolution,R= 16.9%,R free= 21.2%; 1.6 Å resolution,R= 16.2%,R free= 19.2%), are reported. The structurally similar PKD-like domains resemble the V-set Ig fold. In addition to a conserved β-bulge, the PKD-like domains feature a second bulge that also changes the allegiance of the subsequent β-strand. This β-bulge and the genesis of a Ca 2+pocket in the archaeal PKD-like domain suggest a close kinship between bacterial and archaeal PKD-like domains. Different surface properties and indications of different dynamics suggest unique roles for the PKD-like domains in ColG and in ColH. Surface aromatic residues found on ColH s2a-s2b, but not on ColG s2, may provide the weak interaction in the biphasic collagen-binding mode previously found in s2b-s3.B-factor analyses suggest that in the presence of Ca 2+the midsection of s2 becomes more flexible but the midsections of s2a and s2b stay rigid. The different surface properties and dynamics of the domains suggest that the PKD-like domains of M9B bacterial collagenase can be grouped into either a ColG subset or a ColH subset. The conserved properties of PKD-like domains in ColG and in ColH include Ca 2+binding. Conserved residues not only interact with Ca 2+, but also position the Ca 2+-interacting water molecule. Ca 2+aligns the N-terminal linker approximately parallel to the major axis of the domain. Ca 2+binding also increases stability against heat and guanidine hydrochloride, and may improve the longevity in the extracellular matrix. The results of this study will further assist in developing collagen-targeting vehicles for various signal molecules.« less

Multiple origins of interdependent endosymbiotic complexes in a genus of cicadas.

PubMed

Łukasik, Piotr; Nazario, Katherine; Van Leuven, James T; Campbell, Matthew A; Meyer, Mariah; Michalik, Anna; Pessacq, Pablo; Simon, Chris; Veloso, Claudio; McCutcheon, John P

2018-01-09

Bacterial endosymbionts that provide nutrients to hosts often have genomes that are extremely stable in structure and gene content. In contrast, the genome of the endosymbiont Hodgkinia cicadicola has fractured into multiple distinct lineages in some species of the cicada genus Tettigades To better understand the frequency, timing, and outcomes of Hodgkinia lineage splitting throughout this cicada genus, we sampled cicadas over three field seasons in Chile and performed genomics and microscopy on representative samples. We found that a single ancestral Hodgkinia lineage has split at least six independent times in Tettigades over the last 4 million years, resulting in complexes of between two and six distinct Hodgkinia lineages per host. Individual genomes in these symbiotic complexes differ dramatically in relative abundance, genome size, organization, and gene content. Each Hodgkinia lineage retains a small set of core genes involved in genetic information processing, but the high level of gene loss experienced by all genomes suggests that extensive sharing of gene products among symbiont cells must occur. In total, Hodgkinia complexes that consist of multiple lineages encode nearly complete sets of genes present on the ancestral single lineage and presumably perform the same functions as symbionts that have not undergone splitting. However, differences in the timing of the splits, along with dissimilar gene loss patterns on the resulting genomes, have led to very different outcomes of lineage splitting in extant cicadas.

Mutation in a gene for type I procollagen (COL1A2) in a woman with postmenopausal osteoporosis: Evidence for phenotypic and genotypic overlap with mild osteogenesis imperfecta

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spotila, L.D.; Constantinou, C.D.; Sereda, L.

Mutations in the two genes for type I collagen (COL1A1 or COL1A2) cause osteogenesis imperfecta (OI), a heritable disease characterized by moderate to extreme brittleness of bone early in life. Here, the authors show that a 52-year-old post menopausal woman with severe osteopenia and a compression fracture of a thoracic vertebra had a mutation in the gene for the {alpha}2(I) chain of type I collagen (COL1A2) similar to mutations that cause OI. cDNA was prepared from the woman's skin fibroblast RNA and assayed for the presence of a mutation by treating DNA heteroduplexes with carbodiimide. The results indicated a sequencemore » variation in the region encoding amino acid residues 660-667 of the {alpha}2(I) chain. Further analysis demonstrated a single-base mutation that caused a serine-for-glycine substitution at position 661 of the {alpha}2(I) triple-helical domain. The substitution produced posttranslational overmodification of the collagen triple helix, as is seen with most glycine substitutions that cause OI. The patient had a history of five previous fractures, slightly blue sclerae, and slight hearing loss. Therefore, the results suggest that there may be phenotypic and genotypic overlap between mild osteogenesis imperfecta and postmenopausal osteoporosis, and that a subset of women with postmenopausal osteoporosis may have mutations in the genes for type I procollagen.« less

Hepatocyte Growth Factor and Interleukin-6 in Prostate Cancer Bone Metastasis

DTIC Science & Technology

2006-06-01

Wif1 Wnt inhibitory factor 1 ## ## ## ## Cxcl4 Chemokine (C-X-C motif) ligand 4 ## ## ## ## Cxcl12 Chemokine (C-X-C motif) ligand 12...CGGCTGAAGAACAACAACAG GGCGTCTGACTCACACCTCT Clu CAGCTGGCTAACCTCACACA AACAGCTTCACCACCACCTC Cxcl4 AGTCCTGAGCTGCTGCTTCT CCCAGAGGAGATGGTCTTCA Col1A1 GAGAGCATGACCGATGGATT

Multigenic Delineation of Lower Jaw Deformity in Triploid Atlantic Salmon (Salmo salar L.)

PubMed Central

Amoroso, Gianluca; Ventura, Tomer; Elizur, Abigail; Carter, Chris G.

2016-01-01

Lower jaw deformity (LJD) is a skeletal anomaly affecting farmed triploid Atlantic salmon (Salmo salar L.) which leads to considerable economic losses for industry and has animal welfare implications. The present study employed transcriptome analysis in parallel with real-time qPCR techniques to characterise for the first time the LJD condition in triploid Atlantic salmon juveniles using two independent sample sets: experimentally-sourced salmon (60 g) and commercially produced salmon (100 g). A total of eleven genes, some detected/identified through the transcriptome analysis (fbn2, gal and gphb5) and others previously determined to be related to skeletal physiology (alp, bmp4, col1a1, col2a1, fgf23, igf1, mmp13, ocn), were tested in the two independent sample sets. Gphb5, a recently discovered hormone, was significantly (P < 0.05) down-regulated in LJD affected fish in both sample sets, suggesting a possible hormonal involvement. In-situ hybridization detected gphb5 expression in oral epithelium, teeth and skin of the lower jaw. Col2a1 showed the same consistent significant (P < 0.05) down-regulation in LJD suggesting a possible cartilaginous impairment as a distinctive feature of the condition. Significant (P < 0.05) differential expression of other genes found in either one or the other sample set highlighted the possible effect of stage of development or condition progression on transcription and showed that anomalous bone development, likely driven by cartilage impairment, is more evident at larger fish sizes. The present study improved our understanding of LJD suggesting that a cartilage impairment likely underlies the condition and col2a1 may be a marker. In addition, the involvement of gphb5 urges further investigation of a hormonal role in LJD and skeletal physiology in general. PMID:27977809

Multigenic Delineation of Lower Jaw Deformity in Triploid Atlantic Salmon (Salmo salar L.).

PubMed

Amoroso, Gianluca; Ventura, Tomer; Cobcroft, Jennifer M; Adams, Mark B; Elizur, Abigail; Carter, Chris G

2016-01-01

Lower jaw deformity (LJD) is a skeletal anomaly affecting farmed triploid Atlantic salmon (Salmo salar L.) which leads to considerable economic losses for industry and has animal welfare implications. The present study employed transcriptome analysis in parallel with real-time qPCR techniques to characterise for the first time the LJD condition in triploid Atlantic salmon juveniles using two independent sample sets: experimentally-sourced salmon (60 g) and commercially produced salmon (100 g). A total of eleven genes, some detected/identified through the transcriptome analysis (fbn2, gal and gphb5) and others previously determined to be related to skeletal physiology (alp, bmp4, col1a1, col2a1, fgf23, igf1, mmp13, ocn), were tested in the two independent sample sets. Gphb5, a recently discovered hormone, was significantly (P < 0.05) down-regulated in LJD affected fish in both sample sets, suggesting a possible hormonal involvement. In-situ hybridization detected gphb5 expression in oral epithelium, teeth and skin of the lower jaw. Col2a1 showed the same consistent significant (P < 0.05) down-regulation in LJD suggesting a possible cartilaginous impairment as a distinctive feature of the condition. Significant (P < 0.05) differential expression of other genes found in either one or the other sample set highlighted the possible effect of stage of development or condition progression on transcription and showed that anomalous bone development, likely driven by cartilage impairment, is more evident at larger fish sizes. The present study improved our understanding of LJD suggesting that a cartilage impairment likely underlies the condition and col2a1 may be a marker. In addition, the involvement of gphb5 urges further investigation of a hormonal role in LJD and skeletal physiology in general.

Tumor Microenvironment Gene Signature as a Prognostic Classifier and Therapeutic Target

DTIC Science & Technology

2016-06-01

smooth muscle actin (αSMA, encoded by gene ACTA2), fibroblast activation protein ( FAP ), podoplanin (PDPN), palladin (PALLD), tenascin-C (TNC...0.73 0.75 0.752 4 COL3A1 0.85 0.7 0.88 0.64 0.85 0.68 0.63 0.83 0.86 0.85 0.54 0.66 0.79 0.751 5 FAP 0.77 0.72 0.83 0.55 0.69 0.75 0.63 0.77 0.77 0.85

Support of positive association in family-based genetic analysis between COL27A1 and Tourette syndrome.

PubMed

Liu, Shiguo; Yu, Xiaoxia; Xu, Quanchen; Cui, Jiajia; Yi, Mingji; Zhang, Xinhua; Ge, Yinlin; Ma, Xu

2015-08-03

Recently, a genome-wide association study has indicated associations between single nucleotide polymorphisms in the Collagen Type XXVII Alpha 1 gene (COL27A1) and Tourette syndrome in several ethnic populations. To clarify the global relevance of the previously identified SNPs in the development of Tourette syndrome, the associations between polymorphisms in COL27A1 and Tourette syndrome were assessed in Chinese trios. PCR-directed sequencing was used to evaluate the genetic contributions of three SNPs in COL27A1(rs4979356, rs4979357 and rs7868992) using haplotype relative risk (HRR) and transmission disequilibrium tests (TDT) with a total of 260 Tourette syndrome trios. The family-based association was significant between Tourette syndrome and rs4979356 (TDT: χ2 = 4.804, P = 0.033; HRR = 1.75, P = 0.002; HHRR = 1.32, P = 0.027), and transmission disequilibrium was suspected for rs4979357 (TDT: χ2 = 3.969, P = 0.053; HRR = 1.84, P = 0.001; HHRR = 1.29, P = 0.044). No statistically significant allele transfer was found for rs7868992 (TDT: χ2 = 2.177, P = 0.158). Although the TDT results did not remain significant after applying the conservative Bonferroni correction (p = 0.005), the significant positive HRR analysis confirmed the possibility of showing transmission disequilibrium, which provides evidence for an involvement of COL27A1in the development of TS. However, these results need to be verified with larger datasets from different populations.

BMP-non-responsive Sca1+ CD73+ CD44+ mouse bone marrow derived osteoprogenitor cells respond to combination of VEGF and BMP-6 to display enhanced osteoblastic differentiation and ectopic bone formation.

PubMed

Madhu, Vedavathi; Li, Ching-Ju; Dighe, Abhijit S; Balian, Gary; Cui, Quanjun

2014-01-01

Clinical trials on fracture repair have challenged the effectiveness of bone morphogenetic proteins (BMPs) but suggest that delivery of mesenchymal stem cells (MSCs) might be beneficial. It has also been reported that BMPs could not increase mineralization in several MSCs populations, which adds ambiguity to the use of BMPs. However, an exogenous supply of MSCs combined with vascular endothelial growth factor (VEGF) and BMPs is reported to synergistically enhance fracture repair in animal models. To elucidate the mechanism of this synergy, we investigated the osteoblastic differentiation of cloned mouse bone marrow derived MSCs (D1 cells) in vitro in response to human recombinant proteins of VEGF, BMPs (-2, -4, -6, -9) and the combination of VEGF with BMP-6 (most potent BMP). We further investigated ectopic bone formation induced by MSCs pre-conditioned with VEGF, BMP-6 or both. No significant increase in mineralization, phosphorylation of Smads 1/5/8 and expression of the ALP, COL1A1 and osterix genes was observed upon addition of VEGF or BMPs alone to the cells in culture. The lack of CD105, Alk1 and Alk6 expression in D1 cells correlated with poor response to BMPs indicating that a greater care in the selection of MSCs is necessary. Interestingly, the combination of VEGF and BMP-6 significantly increased the expression of ALP, COL1A1 and osterix genes and D1 cells pre-conditioned with VEGF and BMP-6 induced greater bone formation in vivo than the non-conditioned control cells or the cells pre-conditioned with either VEGF or BMP-6 alone. This enhanced bone formation by MSCs correlated with higher CADM1 expression and OPG/RANKL ratio in the implants. Thus, combined action of VEGF and BMP on MSCs enhances osteoblastic differentiation of MSCs and increases their bone forming ability, which cannot be achieved through use of BMPs alone. This strategy can be effectively used for bone repair.

α1β1 Integrin/Rac1-Dependent Mesangial Invasion of Glomerular Capillaries in Alport Syndrome

PubMed Central

Zallocchi, Marisa; Johnson, Brianna M.; Meehan, Daniel T.; Delimont, Duane; Cosgrove, Dominic

2014-01-01

Alport syndrome, hereditary glomerulonephritis with hearing loss, results from mutations in type IV collagen COL4A3, COL4A4, or COL4A5 genes. The mechanism for delayed glomerular disease onset is unknown. Comparative analysis of Alport mice and CD151 knockout mice revealed progressive accumulation of laminin 211 in the glomerular basement membrane. We show mesangial processes invading the capillary loops of both models as well as in human Alport glomeruli, as the likely source of this laminin. l-NAME salt–induced hypertension accelerated mesangial cell process invasion. Cultured mesangial cells showed reduced migratory potential when treated with either integrin-linked kinase inhibitor or Rac1 inhibitor, or by deletion of integrin α1. Treatment of Alport mice with Rac1 inhibitor or deletion of integrin α1 reduced mesangial cell process invasion of the glomerular capillary tuft. Laminin α2–deficient Alport mice show reduced mesangial process invasion, and cultured laminin α2–null cells showed reduced migratory potential, indicating a functional role for mesangial laminins in progression of Alport glomerular pathogenesis. Collectively, these findings predict a role for biomechanical insult in the induction of integrin α1β1–dependent Rac1-mediated mesangial cell process invasion of the glomerular capillary tuft as an initiation mechanism of Alport glomerular pathology. PMID:23911822

THE SOLAR NEIGHBORHOOD. XXVI. AP Col: THE CLOSEST (8.4 pc) PRE-MAIN-SEQUENCE STAR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riedel, Adric R.; Henry, Todd J.; Jao, Wei-Chun

2011-10-15

We present the results of a multi-technique investigation of the M4.5Ve flare star AP Col, which we discover to be the nearest pre-main-sequence star. These include astrometric data from the CTIO 0.9 m, from which we derive a proper motion of 342.0 {+-} 0.5 mas yr{sup -1}, a trigonometric parallax of 119.21 {+-} 0.98 mas (8.39 {+-} 0.07 pc), and photometry and photometric variability at optical wavelengths. We also provide spectroscopic data, including radial velocity (22.4 {+-} 0.3 km s{sup -1}), lithium equivalent width (EW) (0.28 {+-} 0.02 A), H{alpha} EW (-6.0 to -35 A), vsin i (11 {+-} 1more » km s{sup -1}), and gravity indicators from the Siding Spring 2.3 m WiFeS, Lick 3 m Hamilton echelle, and Keck-I HIRES echelle spectrographs. The combined observations demonstrate that AP Col is the closer of only two known systems within 10 pc of the Sun younger than 100 Myr. Given its space motion and apparent age of 12-50 Myr, AP Col is likely a member of the recently proposed {approx}40 Myr old Argus/IC 2391 Association.« less

Loss of notochordal cell phenotype in 3D-cell cultures: implications for disc physiology and disc repair.

PubMed

Omlor, G W; Nerlich, A G; Tirlapur, U K; Urban, J P; Guehring, T

2014-12-01

Embryonic notochordal disc nucleus cells (NC) have been identified to protect disc tissue against disc degeneration but in human beings NC phenotype gets lost with aging and the pathophysiological mechanisms are poorly understood. NC may stimulate other cells via soluble factors, and NC-conditioned medium can be used to stimulate matrix production of other disc cells and mesenchymal stem cells and thus may be of special interest for biological disc repair. As this stimulatory effect is associated with the NC phenotype, we investigated how cell morphology and gene-expression of the NC phenotype changes with time in 3D-cell culture. NC and inner annulus chondrocyte-like cells (CLC) from immature pigtails (freshly isolated cells/tissue, 3D-alginate beads, 3D-clusters) were cultured for up to 16 days under normoxia and hypoxia. Protein-expression was analysed by immunohistology and gene-expression analysis was carried out on freshly isolated cells and cultured cells. Cell morphology and proliferation were analysed by two-photon-laser-microscopy. Two-photon-laser-microscopy showed a homogenous and small CLC population in the inner annulus, which differed from the large vacuole-containing NC in the nucleus. Immunohistology found 93 % KRT8 positive cells in the nucleus and intracellular and pericellular Col2, IL6, and IL12 staining while CLC were KRT8 negative. Freshly isolated NC showed significantly higher KRT8 and CAIII but lower Col2 gene-expression than CLC. NC in 3D-cultures demonstrated significant size reduction and loss of vacuoles with culture time, all indicating a loss of the characteristic NC morphology. Hypoxia reduced the rate of decrease in NC size and vacuoles. Gene-expression of KRT8 and CAIII in NC fell significantly early in culture while Col2 did not decrease significantly within the culture period. In CLC, KRT8 and CAIII gene-expression was low and did not change noticeably in culture, whereas Col2 expression fell with time in culture. 3D-culture caused a rapid loss of NC phenotype towards a CLC phenotype with disappearance of vacuoles, reduced cell size, increased proliferation, and gene-expression changes. These findings may be related to NC nutritional demands and support the latest hypothesis of NC maturation into CLC opposing the idea that NC get lost in human discs by cell death or apoptosis to be replaced by CLC from the inner annulus.

Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

PubMed Central

Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

1974-01-01

DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

Effect of Split-File Digital Workflow on Crown Margin Adaptation

DTIC Science & Technology

2017-03-30

you in your future publication/presentation efforts. LINDA STEEL -GOODWIN, Col, USAF, BSC Director, Clinical Investigations & Research Support...METHODS Multiple pilot studies were completed to define a working model with appropriate restoration settings ( cement gap 20 µm, extra cement gap 40...depressions for standardization. Right: Zirconia and e.max restorations had a cement gap (CG) = 20 µm ; extra cement gap (ECG) = 40 µm, and distance to

Laser-capture micro dissection combined with next-generation sequencing analysis of cell type-specific deafness gene expression in the mouse cochlea.

PubMed

Nishio, Shin-Ya; Takumi, Yutaka; Usami, Shin-Ichi

2017-05-01

Cochlear implantation (CI), which directly stimulates the cochlear nerves, is the most effective and widely used medical intervention for patients with severe to profound sensorineural hearing loss. The etiology of the hearing loss is speculated to have a major influence of CI outcomes, particularly in cases resulting from mutations in genes preferentially expressed in the spiral ganglion region. To elucidate precise gene expression levels in each part of the cochlea, we performed laser-capture micro dissection in combination with next-generation sequencing analysis and determined the expression levels of all known deafness-associated genes in the organ of Corti, spiral ganglion, lateral wall, and spiral limbs. The results were generally consistent with previous reports based on immunocytochemistry or in situ hybridization. As a notable result, the genes associated with many kinds of syndromic hearing loss (such as Clpp, Hars2, Hsd17b4, Lars2 for Perrault syndrome, Polr1c and Polr1d for Treacher Collins syndrome, Ndp for Norrie Disease, Kal for Kallmann syndrome, Edn3 and Snai2 for Waardenburg Syndrome, Col4a3 for Alport syndrome, Sema3e for CHARGE syndrome, Col9a1 for Sticker syndrome, Cdh23, Cib2, Clrn1, Pcdh15, Ush1c, Ush2a, Whrn for Usher syndrome and Wfs1 for Wolfram syndrome) showed higher levels of expression in the spiral ganglion than in other parts of the cochlea. This dataset will provide a base for more detailed analysis in order to clarify gene functions in the cochlea as well as predict CI outcomes based on gene expression data. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Integration-free induced pluripotent stem cells derived from a patient with autosomal recessive Alport syndrome (ARAS).

PubMed

Kuebler, Bernd; Aran, Begoña; Miquel-Serra, Laia; Muñoz, Yolanda; Ars, Elisabet; Bullich, Gemma; Furlano, Monica; Torra, Roser; Marti, Merce; Veiga, Anna; Raya, Angel

2017-12-01

A skin biopsy was obtained from a 25-year-old female patient with autosomal recessive Alport syndrome (ARAS) with the homozygous COL4A3 mutation c.345delG, p.(P166Lfs*37). Dermal fibroblasts were derived and reprogrammed by nucleofection with episomal plasmids carrying OCT3/4, SOX2, KLF4 LIN28, L-MYC and p53shRNA. The generated induced Pluripotent Stem Cell (iPSC) clone AS FiPS1 Ep6F-2 was free of genomically integrated reprogramming genes, had the specific homozygous mutation, a stable karyotype, expressed pluripotency markers and generated embryoid bodies which were differentiated towards the three germ layers in vitro. This iPSC line offers a useful resource to study Alport syndrome pathomechanisms and drug testing. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

The influence of chronic IL-6 exposure, in vivo, on rat Achilles tendon extracellular matrix.

PubMed

Katsma, Mark S; Patel, Shivam H; Eldon, Erica; Corbell, Kathryn A; Shimkus, Kevin L; Fluckey, James D; Carroll, Chad C

2017-05-01

When compared to placebo, acetaminophen (APAP) reduces tendon stiffness and collagen cross-linking. APAP also enhances the exercise-induced increase in peritendinous levels of IL-6. Elevated levels of IL-6 are associated with tendinopathy, thus we hypothesized that chronic, elevated peritendinous IL-6 would alter tendon extracellular matrix (ECM). IL-6 (∼3000pgml -1 ) was injected (3dwk -1 for 8-wks) into the Achilles peritendinous region of male Wistar rats (n=16) with the opposite leg serving as a sham. Fractional synthesis rates (FSR) were determined using deuterium oxide. Collagen (hydroxyproline) and hydroxylysl pyridinoline (HP) cross-linking were analyzed by HPLC. ECM and IL-6 related genes were evaluated using qRT-PCR. Relative to sham, collagen (Col) 1a1 but not Col3a1 expression was suppressed (47%) in tendons exposed to IL-6 (p<0.05). Lysyl oxidase (LOX) and MMP-1 expression were also reduced (37%) in IL-6 treated tendons (p<0.05). Relative to sham the expression of MMP-2, -3, -9, and TIMP-1 were not altered by IL-6 treatment (p>0.05). Interleukin-6 receptor subunit beta precursor (IL6st) was lower (16%) in IL-6 treated tendons when compared to sham (p<0.05). Suppressor of cytokine signaling 3 (Socs3), signal transducer and activator of transcription 3 (STAT3), and protein inhibitor of activated STAT 1 (Pias1) were not altered by IL-6 exposure (p>0.05). Neither collagen nor cross-linking content were altered by IL-6 (p>0.05). Additionally, IL-6 treatment did not alter tendon FSR. Chronic treatment with physiologically relevant levels of IL-6 suppresses expression of Col1a1 and LOX while also altering expression of select MMPs but does not alter Achilles tendon collagen synthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Progression of Alport Kidney Disease in Col4a3 Knock Out Mice Is Independent of Sex or Macrophage Depletion by Clodronate Treatment

PubMed Central

Kim, Munkyung; Piaia, Alessandro; Shenoy, Neeta; Kagan, David; Gapp, Berangere; Kueng, Benjamin; Weber, Delphine; Dietrich, William; Ksiazek, Iwona

2015-01-01

Alport syndrome is a genetic disease of collagen IV (α3, 4, 5) resulting in renal failure. This study was designed to investigate sex-phenotype correlations and evaluate the contribution of macrophage infiltration to disease progression using Col4a3 knock out (Col4a3KO) mice, an established genetic model of autosomal recessive Alport syndrome. No sex differences in the evolution of body mass loss, renal pathology, biomarkers of tubular damage KIM-1 and NGAL, or deterioration of kidney function were observed during the life span of Col4a3KO mice. These findings confirm that, similar to human autosomal recessive Alport syndrome, female and male Col4a3KO mice develop renal failure at the same age and with similar severity. The specific contribution of macrophage infiltration to Alport disease, one of the prominent features of the disease in human and Col4a3KO mice, remains unknown. This study shows that depletion of kidney macrophages in Col4a3KO male mice by administration of clodronate liposomes, prior to clinical onset of disease and throughout the study period, does not protect the mice from renal failure and interstitial fibrosis, nor delay disease progression. These results suggest that therapy targeting macrophage recruitment to kidney is unlikely to be effective as treatment of Alport syndrome. PMID:26555339

Type 1 collagenopathy presenting with a Russell-Silver phenotype.

PubMed

Parker, Michael J; Deshpande, Charulata; Rankin, Julia; Wilson, Louise C; Balasubramanian, Meena; Hall, Christine M; Wagner, Bart E; Pollitt, Rebecca; Dalton, Ann; Bishop, Nicholas J

2011-06-01

Osteogenesis imperfecta (OI) is a heterogeneous group of inherited disorders of bone formation, resulting in low bone mass and an increased propensity to fracture. It exhibits a broad spectrum of clinical severity, ranging from multiple fractures in utero and perinatal death, to normal adult stature and low fracture incidence. Extra-skeletal features of OI include blue sclera, hearing loss, skin hyperlaxity, joint hyperextensibility, and dentinogenesis imperfecta. The proα1(I) and proα2(I) chains of collagen 1 are encoded by the COL1A1 and COL1A2 genes, respectively; quantitative or qualitative defects in type I collagen synthesis usually manifest as types of OI or some sub-types of EDS. The majority of patients (about 90%) with a clinical diagnosis of OI have a mutation in the COL1A1 or COL1A2 genes, which shows an autosomal dominant pattern of inheritance. Six other genes, CRTAP, LEPRE1, FKBP10, PP1B, SP7/Osterix (OSX), and SERPINH1, are associated with autosomal recessive forms of OI. However, other, rare phenotypes have also been described. There are many differential diagnoses of the short, syndromic child, including chromosomal, single gene, and multifactorial causes. However, one condition of particular relevance in the context of this report is the Russell-Silver syndrome (RSS). As originally described, the RSS is a very specific condition. However, it has subsequently become an umbrella term for a heterogeneous group of conditions presenting with short stature and triangular shape to the face. A significant proportion of these are now believed to be due to imprinting defects at 11p15. However, the cause in many cases remains unknown. We describe two cases with a phenotypic overlap between OI and RSS who both have COL1A1 mutations. Thus, a type 1 collagenopathy should be considered in the differential diagnosis of syndromic short stature. Copyright © 2011 Wiley-Liss, Inc.

Basement Membrane Defects in Genetic Kidney Diseases

PubMed Central

Chew, Christine; Lennon, Rachel

2018-01-01

The glomerular basement membrane (GBM) is a specialized structure with a significant role in maintaining the glomerular filtration barrier. This GBM is formed from the fusion of two basement membranes during development and its function in the filtration barrier is achieved by key extracellular matrix components including type IV collagen, laminins, nidogens, and heparan sulfate proteoglycans. The characteristics of specific matrix isoforms such as laminin-521 (α5β2γ1) and the α3α4α5 chain of type IV collagen are essential for the formation of a mature GBM and the restricted tissue distribution of these isoforms makes the GBM a unique structure. Detailed investigation of the GBM has been driven by the identification of inherited abnormalities in matrix proteins and the need to understand pathogenic mechanisms causing severe glomerular disease. A well-described hereditary GBM disease is Alport syndrome, associated with a progressive glomerular disease, hearing loss, and lens defects due to mutations in the genes COL4A3, COL4A4, or COL4A5. Other proteins associated with inherited diseases of the GBM include laminin β2 in Pierson syndrome and LMX1B in nail patella syndrome. The knowledge of these genetic mutations associated with GBM defects has enhanced our understanding of cell–matrix signaling pathways affected in glomerular disease. This review will address current knowledge of GBM-associated abnormalities and related signaling pathways, as well as discussing the advances toward disease-targeted therapies for patients with glomerular disease. PMID:29435440

Naproxen Induces Type X Collagen Expression in Human Bone-Marrow-Derived Mesenchymal Stem Cells Through the Upregulation of 5-Lipoxygenase

PubMed Central

Alaseem, Abdulrahman M.; Madiraju, Padma; Aldebeyan, Sultan A.; Noorwali, Hussain; Antoniou, John

2015-01-01

Several studies have shown that type X collagen (COL X), a marker of late-stage chondrocyte hypertrophy, is expressed in mesenchymal stem cells (MSCs) from osteoarthritis (OA) patients. We recently found that Naproxen, but not other nonsteroidal anti-inflammatory drugs (NSAIDs) (Ibuprofen, Celebrex, Diclofenac), can induce type X collagen gene (COL10A1) expression in bone-marrow-derived MSCs from healthy and OA donors. In this study we determined the effect of Naproxen on COL X protein expression and investigated the intracellular signaling pathways that mediate Naproxen-induced COL10A1 expression in normal and OA hMSCs. MSCs of OA patients were isolated from aspirates from the intramedullary canal of donors (50–80 years of age) undergoing hip replacement surgery for OA and were treated with or without Naproxen (100 μg/mL). Protein expression and phosphorylation were determined by immunoblotting using specific antibodies (COL X, p38 mitogen-activated protein kinase [p38], phosphorylated-p38, c-Jun N-terminal kinase [JNK], phosphorylated-JNK, extracellular signal-regulated kinase [ERK], and phosphorylated-ERK). Real-time reverse transcription polymerase chain reaction (RT-PCR) was performed to determine the expression of COL10A1 and Runt-related transcription factor 2 gene (Runx2). Our results show that Naproxen significantly stimulated COL X protein expression after 72 h of exposure both in normal and OA hMSCs. The basal phosphorylation of mitogen-activated protein kinases (MAPKs) (ERK, JNK, and p38) in OA hMSCs was significantly higher than in normal. Naproxen significantly increased the MAPK phosphorylation in normal and OA hMSCs. NSAID cellular effects include cyclooxygenase, 5-lipoxygenase, and p38 MAPK signaling pathways. To investigate the involvement of these pathways in the Naproxen-induced COL10A1 expression, we incubated normal and OA hMSCs with Naproxen with and without inhibitors of ERK (U0126), JNK (BI-78D3), p38 (SB203580), and 5-lipoxygenase (MK-886). Our results showed that increased basal COL10A1 expression in OA hMSCs was significantly suppressed in the presence of JNK and p38 inhibitors, whereas Naproxen-induced COL10A1 expression was suppressed by 5-lipoxygenase inhibitor. This study shows that Naproxen induces COL X both at transcriptional and translational levels in normal and OA hMSCs. Elevated basal COL10A1 expression in OA hMSCs is probably through the activation of MAPK pathway and Naproxen-induced COL10A1 expression is through the increased 5-lipoxygenase signaling. PMID:25091567

Interactions between COL5A1 Gene and Risk of the Anterior Cruciate Ligament Rupture.

PubMed

Lulińska-Kuklik, Ewelina; Rahim, Masouda; Domańska-Senderowska, Daria; Ficek, Krzysztof; Michałowska-Sawczyn, Monika; Moska, Waldemar; Kaczmarczyk, Mariusz; Brzeziański, Michał; Brzeziańska-Lasota, Ewa; Cięszczyk, Paweł; September, Alison V

2018-06-01

Collagen alpha-1(V) chain, encoded by the COL5A1 gene, plays a crucial role in abundant fibrillar collagens supporting many tissues in the body containing type I collagen and appears to regulate the association between heterotypic fibers composed of both type I and type V collagen occurring among others in muscles, tendons and ligaments. Taking this fact into consideration we decided to examine the association between COL5A1 rs12722 and rs13946 polymorphisms, individually and as inferred haplotypes, with anterior cruciate ligament rupture risk (ACLR) in professional soccer players. A total of 134 male professional soccer players with surgically diagnosed primary anterior cruciate ligament ruptures and 211 apparently healthy male professional soccer players, who were without any self-reported history of ligament or tendon injury, were included in the study. Both the cases and the healthy controls were recruited from the same soccer teams, of a similar age category, and had a comparable level of exposure to anterior cruciate ligament injury. Genomic DNA was extracted from oral epithelial cells using GenElute Mammalian Genomic DNA MiniprepKit. All samples were genotyped for the rs12722 and rs13946 polymorphisms using a Rotor-Gene realtime polymerase chain reaction. Statistically significant differences in the genotype frequencies for the COL5A1 rs13946 polymorphisms in dominant modes of inheritance occurred (p = 0.039). Statistically significant differences were documented only in the dominant model under the representation tendency of the C-C haplotype in the ACLR group compared to controls (p = 0.038). Our results suggest that variation in the COL5A1 gene may be one of the non-modifiable factors associated with the ACL injury in professional soccer players. The C-C rs12722-rs13946 haplotype provides a protective effect against the ACL tear.

Collagen VI Null Mice as a Model for Early Onset Muscle Decline in Aging.

PubMed

Capitanio, Daniele; Moriggi, Manuela; De Palma, Sara; Bizzotto, Dario; Molon, Sibilla; Torretta, Enrica; Fania, Chiara; Bonaldo, Paolo; Gelfi, Cecilia; Braghetta, Paola

2017-01-01

Collagen VI is an extracellular matrix (ECM) protein playing a key role in skeletal muscles and whose deficiency leads to connective tissue diseases in humans and in animal models. However, most studies have been focused on skeletal muscle features. We performed an extensive proteomic profiling in two skeletal muscles (diaphragm and gastrocnemius) of wild-type and collagen VI null ( Col6a1 -/- ) mice at different ages, from 6- (adult) to 12- (aged) month-old to 24 (old) month-old. While in wild-type animals the number of proteins and the level of modification occurring during aging were comparable in the two analyzed muscles, Col6a1 -/- mice displayed a number of muscle-type specific variations. In particular, gastrocnemius displayed a limited number of dysregulated proteins in adult mice, while in aged muscles the modifications were more pronounced in terms of number and level. In diaphragm, the differences displayed by 6-month-old Col6a1 -/- mice were more pronounced compared to wild-type mice and persisted at 12 months of age. In adult Col6a1 -/- mice, the major variations were found in the enzymes belonging to the glycolytic pathway and the tricarboxylic acid (TCA) cycle, as well as in autophagy-related proteins. When compared to wild-type animals Col6a1 -/- mice displayed a general metabolic rewiring which was particularly prominent the diaphragm at 6 months of age. Comparison of the proteomic features and the molecular analysis of metabolic and autophagic pathways in adult and aged Col6a1 -/- diaphragm indicated that the effects of aging, culminating in lipotoxicity and autophagic impairment, were already present at 6 months of age. Conversely, the effects of aging in Col6a1 -/- gastrocnemius were similar but delayed becoming apparent at 12 months of age. A similar metabolic rewiring and autophagic impairment was found in the diaphragm of 24-month-old wild-type mice, confirming that fatty acid synthase (FASN) increment and decreased microtubule-associated proteins 1A/1B light chain 3B (LC3B) lipidation are hallmarks of the aging process. Altogether these data indicate that the diaphragm of Col6a1 -/- animal model can be considered as a model of early skeletal muscle aging.

Collagen VI Null Mice as a Model for Early Onset Muscle Decline in Aging

PubMed Central

Capitanio, Daniele; Moriggi, Manuela; De Palma, Sara; Bizzotto, Dario; Molon, Sibilla; Torretta, Enrica; Fania, Chiara; Bonaldo, Paolo; Gelfi, Cecilia; Braghetta, Paola

2017-01-01

Collagen VI is an extracellular matrix (ECM) protein playing a key role in skeletal muscles and whose deficiency leads to connective tissue diseases in humans and in animal models. However, most studies have been focused on skeletal muscle features. We performed an extensive proteomic profiling in two skeletal muscles (diaphragm and gastrocnemius) of wild-type and collagen VI null (Col6a1−/−) mice at different ages, from 6- (adult) to 12- (aged) month-old to 24 (old) month-old. While in wild-type animals the number of proteins and the level of modification occurring during aging were comparable in the two analyzed muscles, Col6a1−/− mice displayed a number of muscle-type specific variations. In particular, gastrocnemius displayed a limited number of dysregulated proteins in adult mice, while in aged muscles the modifications were more pronounced in terms of number and level. In diaphragm, the differences displayed by 6-month-old Col6a1−/− mice were more pronounced compared to wild-type mice and persisted at 12 months of age. In adult Col6a1−/− mice, the major variations were found in the enzymes belonging to the glycolytic pathway and the tricarboxylic acid (TCA) cycle, as well as in autophagy-related proteins. When compared to wild-type animals Col6a1−/− mice displayed a general metabolic rewiring which was particularly prominent the diaphragm at 6 months of age. Comparison of the proteomic features and the molecular analysis of metabolic and autophagic pathways in adult and aged Col6a1−/− diaphragm indicated that the effects of aging, culminating in lipotoxicity and autophagic impairment, were already present at 6 months of age. Conversely, the effects of aging in Col6a1−/− gastrocnemius were similar but delayed becoming apparent at 12 months of age. A similar metabolic rewiring and autophagic impairment was found in the diaphragm of 24-month-old wild-type mice, confirming that fatty acid synthase (FASN) increment and decreased microtubule-associated proteins 1A/1B light chain 3B (LC3B) lipidation are hallmarks of the aging process. Altogether these data indicate that the diaphragm of Col6a1−/− animal model can be considered as a model of early skeletal muscle aging. PMID:29114203

Transcriptome analysis of skin fibroblasts with dominant negative COL3A1 mutations provides molecular insights into the etiopathology of vascular Ehlers-Danlos syndrome

PubMed Central

Chiarelli, Nicola; Carini, Giulia; Zoppi, Nicoletta; Ritelli, Marco

2018-01-01

Vascular Ehlers-Danlos syndrome (vEDS) is a dominantly inherited connective tissue disorder caused by mutations in the COL3A1 gene that encodes type III collagen (COLLIII), which is the major expressed collagen in blood vessels and hollow organs. The majority of disease-causing variants in COL3A1 are glycine substitutions and in-frame splice mutations in the triple helix domain that through a dominant negative effect are associated with the severe clinical spectrum potentially lethal of vEDS, characterized by fragility of soft connective tissues with arterial and organ ruptures. To shed lights into molecular mechanisms underlying vEDS, we performed gene expression profiling in cultured skin fibroblasts from three patients with different structural COL3A1 mutations. Transcriptome analysis revealed significant changes in the expression levels of several genes involved in maintenance of cell redox and endoplasmic reticulum (ER) homeostasis, COLLs folding and extracellular matrix (ECM) organization, formation of the proteasome complex, and cell cycle regulation. Protein analyses showed that aberrant COLLIII expression is associated with the disassembly of many structural ECM constituents, such as fibrillins, EMILINs, and elastin, as well as with the reduction of the proteoglycans perlecan, decorin, and versican, all playing an important role in the vascular system. Furthermore, the altered distribution of the ER marker protein disulfide isomerase PDI and the strong reduction of the COLLs-modifying enzyme FKBP22 are consistent with the disturbance of ER-related homeostasis and COLLs biosynthesis and post-translational modifications, indicated by microarray analysis. Our findings add new insights into the pathophysiology of this severe vascular disorder, since they provide a picture of the gene expression changes in vEDS skin fibroblasts and highlight that dominant negative mutations in COL3A1 also affect post-translational modifications and deposition into the ECM of several structural proteins crucial to the integrity of soft connective tissues. PMID:29346445

Transcriptome analysis of skin fibroblasts with dominant negative COL3A1 mutations provides molecular insights into the etiopathology of vascular Ehlers-Danlos syndrome.

PubMed

Chiarelli, Nicola; Carini, Giulia; Zoppi, Nicoletta; Ritelli, Marco; Colombi, Marina

2018-01-01

Vascular Ehlers-Danlos syndrome (vEDS) is a dominantly inherited connective tissue disorder caused by mutations in the COL3A1 gene that encodes type III collagen (COLLIII), which is the major expressed collagen in blood vessels and hollow organs. The majority of disease-causing variants in COL3A1 are glycine substitutions and in-frame splice mutations in the triple helix domain that through a dominant negative effect are associated with the severe clinical spectrum potentially lethal of vEDS, characterized by fragility of soft connective tissues with arterial and organ ruptures. To shed lights into molecular mechanisms underlying vEDS, we performed gene expression profiling in cultured skin fibroblasts from three patients with different structural COL3A1 mutations. Transcriptome analysis revealed significant changes in the expression levels of several genes involved in maintenance of cell redox and endoplasmic reticulum (ER) homeostasis, COLLs folding and extracellular matrix (ECM) organization, formation of the proteasome complex, and cell cycle regulation. Protein analyses showed that aberrant COLLIII expression is associated with the disassembly of many structural ECM constituents, such as fibrillins, EMILINs, and elastin, as well as with the reduction of the proteoglycans perlecan, decorin, and versican, all playing an important role in the vascular system. Furthermore, the altered distribution of the ER marker protein disulfide isomerase PDI and the strong reduction of the COLLs-modifying enzyme FKBP22 are consistent with the disturbance of ER-related homeostasis and COLLs biosynthesis and post-translational modifications, indicated by microarray analysis. Our findings add new insights into the pathophysiology of this severe vascular disorder, since they provide a picture of the gene expression changes in vEDS skin fibroblasts and highlight that dominant negative mutations in COL3A1 also affect post-translational modifications and deposition into the ECM of several structural proteins crucial to the integrity of soft connective tissues.

Identification of Differentially Expressed IGFBP5-Related Genes in Breast Cancer Tumor Tissues Using cDNA Microarray Experiments.

PubMed

Akkiprik, Mustafa; Peker, İrem; Özmen, Tolga; Amuran, Gökçe Güllü; Güllüoğlu, Bahadır M; Kaya, Handan; Özer, Ayşe

2015-11-10

IGFBP5 is an important regulatory protein in breast cancer progression. We tried to identify differentially expressed genes (DEGs) between breast tumor tissues with IGFBP5 overexpression and their adjacent normal tissues. In this study, thirty-eight breast cancer and adjacent normal breast tissue samples were used to determine IGFBP5 expression by qPCR. cDNA microarrays were applied to the highest IGFBP5 overexpressed tumor samples compared to their adjacent normal breast tissue. Microarray analysis revealed that a total of 186 genes were differentially expressed in breast cancer compared with normal breast tissues. Of the 186 genes, 169 genes were downregulated and 17 genes were upregulated in the tumor samples. KEGG pathway analyses showed that protein digestion and absorption, focal adhesion, salivary secretion, drug metabolism-cytochrome P450, and phenylalanine metabolism pathways are involved. Among these DEGs, the prominent top two genes (MMP11 and COL1A1) which potentially correlated with IGFBP5 were selected for validation using real time RT-qPCR. Only COL1A1 expression showed a consistent upregulation with IGFBP5 expression and COL1A1 and MMP11 were significantly positively correlated. We concluded that the discovery of coordinately expressed genes related with IGFBP5 might contribute to understanding of the molecular mechanism of the function of IGFBP5 in breast cancer. Further functional studies on DEGs and association with IGFBP5 may identify novel biomarkers for clinical applications in breast cancer.

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

Exposure to transforming growth factor-β1 after basic fibroblast growth factor promotes the fibroblastic differentiation of human periodontal ligament stem/progenitor cell lines.

PubMed

Kono, Kiyomi; Maeda, Hidefumi; Fujii, Shinsuke; Tomokiyo, Atsushi; Yamamoto, Naohide; Wada, Naohisa; Monnouchi, Satoshi; Teramatsu, Yoko; Hamano, Sayuri; Koori, Katsuaki; Akamine, Akifumi

2013-05-01

Basic fibroblast growth factor (bFGF) is a cytokine that promotes the regeneration of the periodontium, the specialized tissues supporting the teeth. bFGF, does not, however, induce the synthesis of smooth muscle actin alpha 2 (ACTA2), type I collagen (COL1), or COL3, which are principal molecules in periodontal ligament (PDL) tissue, a component of the periodontium. We have suggested the feasibility of using transforming growth factor-β1 (TGFβ1) to induce fibroblastic differentiation of PDL stem/progenitor cells (PDLSCs). Here, we investigated the effect of the subsequent application of TGFβ1 after bFGF (bFGF/TGFβ1) on the differentiation of PDLSCs into fibroblastic cells. We first confirmed the expression of bFGF and TGFβ1 in rat PDL tissue and primary human PDL cells. Receptors for both bFGF and TGFβ1 were expressed in the human PDLSC lines 1-11 and 1-17. Exposure to bFGF for 2 days promoted vascular endothelial growth factor gene and protein expression in both cell lines and down-regulated the expression of ACTA2, COL1, and COL3 mRNA in both cell lines and the gene fibrillin 1 (FBN1) in cell line 1-11 alone. Furthermore, bFGF stimulated cell proliferation of these cell lines and significantly increased the number of cells in phase G2/M in the cell lines. Exposure to TGFβ1 for 2 days induced gene expression of ACTA2 and COL1 in both cell lines and FBN1 in cell line 1-11 alone. BFGF/TGFβ1 treatment significantly up-regulated ACTA2, COL1, and FBN1 expression as compared with the group treated with bFGF alone or the untreated control. This method might thus be useful for accelerating the generation and regeneration of functional periodontium.

Osthole Promotes Bone Fracture Healing through Activation of BMP Signaling in Chondrocytes.

PubMed

Wang, Pinger; Ying, Jun; Luo, Cheng; Jin, Xing; Zhang, Shanxing; Xu, Taotao; Zhang, Lei; Mi, Meng; Chen, Di; Tong, Peijian; Jin, Hongting

2017-01-01

Osthole is a bioactive coumarin derivative and has been reported to be able to enhance bone formation and improve fracture healing. However, the molecular mechanism of Osthole in bone fracture healing has not been fully defined. In this study we determined if Osthole enhances bone fracture healing through activation of BMP2 signaling in mice. We performed unilateral open transverse tibial fracture procedure in 10-week-old C57BL/6 mice which were treated with or without Osthole. Our previous studies demonstrated that chondrocyte BMP signaling is required for bone fracture healing, in this study we also performed tibial fracture procedure in Cre-negative and Col2-Cre;Bmp2 flox/flox conditional knockout (KO) mice ( Bmp2 Col2Cre ) to determine if Osthole enhances fracture healing in a BMP2-dependent manner. Fracture callus tissues were collected and analyzed by X-ray, micro-CT (μCT), histology, histomorphometry, immunohistochemistry (IHC), biomechanical testing and quantitative gene expression analysis. In addition, mouse chondrogenic ATDC5 cells were cultured with or without Osthole and the expression levels of chondrogenic marker genes were examined. The results demonstrated that Osthole promotes bone fracture healing in wild-type (WT) or Cre - control mice. In contrast, Osthole failed to promote bone fracture healing in Bmp2 Col2Cre conditional KO mice. In the mice receiving Osthole treatment, expression of cartilage marker genes was significantly increased. We conclude that Osthole could promote bone strength and enhance fracture healing by activation of BMP2 signaling. Osthole may be used as an alternative approach in the orthopaedic clinic for the treatment of fracture healing.

Osthole Promotes Bone Fracture Healing through Activation of BMP Signaling in Chondrocytes

PubMed Central

Wang, Pinger; Ying, Jun; Luo, Cheng; Jin, Xing; Zhang, Shanxing; Xu, Taotao; Zhang, Lei; Mi, Meng; Chen, Di; Tong, Peijian; Jin, Hongting

2017-01-01

Osthole is a bioactive coumarin derivative and has been reported to be able to enhance bone formation and improve fracture healing. However, the molecular mechanism of Osthole in bone fracture healing has not been fully defined. In this study we determined if Osthole enhances bone fracture healing through activation of BMP2 signaling in mice. We performed unilateral open transverse tibial fracture procedure in 10-week-old C57BL/6 mice which were treated with or without Osthole. Our previous studies demonstrated that chondrocyte BMP signaling is required for bone fracture healing, in this study we also performed tibial fracture procedure in Cre-negative and Col2-Cre;Bmp2flox/flox conditional knockout (KO) mice (Bmp2Col2Cre) to determine if Osthole enhances fracture healing in a BMP2-dependent manner. Fracture callus tissues were collected and analyzed by X-ray, micro-CT (μCT), histology, histomorphometry, immunohistochemistry (IHC), biomechanical testing and quantitative gene expression analysis. In addition, mouse chondrogenic ATDC5 cells were cultured with or without Osthole and the expression levels of chondrogenic marker genes were examined. The results demonstrated that Osthole promotes bone fracture healing in wild-type (WT) or Cre- control mice. In contrast, Osthole failed to promote bone fracture healing in Bmp2Col2Creconditional KO mice. In the mice receiving Osthole treatment, expression of cartilage marker genes was significantly increased. We conclude that Osthole could promote bone strength and enhance fracture healing by activation of BMP2 signaling. Osthole may be used as an alternative approach in the orthopaedic clinic for the treatment of fracture healing. PMID:28924381

ER stress and basement membrane defects combine to cause glomerular and tubular renal disease resulting from Col4a1 mutations in mice

PubMed Central

Jones, Frances E.; Bailey, Matthew A.; Murray, Lydia S.; Lu, Yinhui; McNeilly, Sarah; Schlötzer-Schrehardt, Ursula; Lennon, Rachel; Sado, Yoshikazu; Brownstein, David G.; Mullins, John J.; Kadler, Karl E.; Van Agtmael, Tom

2016-01-01

ABSTRACT Collagen IV is a major component of basement membranes, and mutations in COL4A1, which encodes collagen IV alpha chain 1, cause a multisystemic disease encompassing cerebrovascular, eye and kidney defects. However, COL4A1 renal disease remains poorly characterized and its pathomolecular mechanisms are unknown. We show that Col4a1 mutations in mice cause hypotension and renal disease, including proteinuria and defects in Bowman's capsule and the glomerular basement membrane, indicating a role for Col4a1 in glomerular filtration. Impaired sodium reabsorption in the loop of Henle and distal nephron despite elevated aldosterone levels indicates that tubular defects contribute to the hypotension, highlighting a novel role for the basement membrane in vascular homeostasis by modulation of the tubular response to aldosterone. Col4a1 mutations also cause diabetes insipidus, whereby the tubular defects lead to polyuria associated with medullary atrophy and a subsequent reduction in the ability to upregulate aquaporin 2 and concentrate urine. Moreover, haematuria, haemorrhage and vascular basement membrane defects confirm an important vascular component. Interestingly, although structural and compositional basement membrane defects occurred in the glomerulus and Bowman's capsule, no tubular basement membrane defects were detected. By contrast, medullary atrophy was associated with chronic ER stress, providing evidence for cell-type-dependent molecular mechanisms of Col4a1 mutations. These data show that both basement membrane defects and ER stress contribute to Col4a1 renal disease, which has important implications for the development of treatment strategies for collagenopathies. PMID:26839400

Thrombospondin-1 deficiency causes a shift from fibroproliferative to inflammatory kidney disease and delays onset of renal failure.

PubMed

Zeisberg, Michael; Tampe, Björn; LeBleu, Valerie; Tampe, Desiree; Zeisberg, Elisabeth M; Kalluri, Raghu

2014-10-01

Thrombospondin-1 (TSP1) is a multifunctional matricellular protein known to promote progression of chronic kidney disease. To gain insight into the underlying mechanisms through which TSP1 accelerates chronic kidney disease, we compared disease progression in Col4a3 knockout (KO) mice, which develop spontaneous kidney failure, with that of Col4a3;Tsp1 double-knockout (DKO) mice. Decline of excretory renal function was significantly delayed in the absence of TSP1. Although Col4a3;Tsp1 DKO mice did progress toward end-stage renal failure, their kidneys exhibited distinct histopathological lesions, compared with creatinine level-matched Col4a3 KO mice. Although kidneys of both Col4a3 KO and Col4a3;Tsp1 DKO mice exhibited a widened tubulointerstitium, predominant lesions in Col4a3 KO kidneys were collagen deposition and fibroblast accumulation, whereas in Col4a3;Tsp1 DKO kidney inflammation was predominant, with less collagen deposition. Altered disease progression correlated with impaired activation of transforming growth factor-β1 (TGF-β1) in vivo and in vitro in the absence of TSP1. In summary, our findings suggest that TSP1 contributes to progression of chronic kidney disease by catalyzing activation of latent TGF-β1, resulting in promotion of a fibroproliferative response over an inflammatory response. Furthermore, the findings suggest that fibroproliferative and inflammatory lesions are independent entities, both of which contribute to decline of renal function. Copyright © 2014 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

CONSTANS-like 9 (COL9) delays the flowering time in Oryza sativa by repressing the Ehd1 pathway.

PubMed

Liu, Hao; Gu, Fengwei; Dong, Shuangyu; Liu, Wei; Wang, Hui; Chen, Zhiqiang; Wang, Jiafeng

2016-10-14

Flowering or heading is one of most important agronomic traits in rice. It has been characterized that CONSTANS (CO) and CONSTANS-like (COL) proteins are critical flowering regulators in response to photoperiodic stress in plants. We have previously identified that the COL family member OsCOL9 can positively enhance the rice blast resistance. In the present study, we aimed to explore the functional role of OsCOL9 in modulating the photoperiodic flowering. Our data showed that overexpression of OsCOL9 delayed the flowering time under both short-day (SD) and long-day (LD) conditions, leading to suppressed expressions of EHd1, RFT and Hd3a at the mRNA Level. OsCOL9 expression exhibited two types of circadian patterns under different daylight conditions, and it could delay the heading date by suppressing the Ehd1 photoperiodic flowering pathway. In contrast, the expressions of previously reported flowering regulators were not significantly changed in OsCOL9 transgenic plants, indicating that OsCOL9 functioned independently of other flowering pathways. In addition, OsCOL9 served as a potential yield gene, and its deficiency reduced the grain number of main panicle in plants. Furthermore, yeast two-hybrid assay indicated that OsCOL9 physically interacted with Receptor for Activated C-kinase 1 (OsRACK1). Rhythmic pattern analysis suggested that OsRACK1 responded to the change of daylight, which was regulated by the circadian clock. Taken together, our results revealed that OsCOL9 could delay the flowering time in rice by repressing the Ehd1 pathway. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Conditional Expression of Wnt4 during Chondrogenesis Leads to Dwarfism in Mice

PubMed Central

Lee, Hu-Hui; Behringer, Richard R.

2007-01-01

Wnts are expressed in the forming long bones, suggesting roles in skeletogenesis. To examine the action of Wnts in skeleton formation, we developed a genetic system to conditionally express Wnt4 in chondrogenic tissues of the mouse. A mouse Wnt4 cDNA was introduced into the ubiquitously expressed Rosa26 (R26) locus by gene targeting in embryonic stem (ES) cells. The expression of Wnt4 from the R26 locus was blocked by a neomycin selection cassette flanked by loxP sites (floxneo) that was positioned between the Rosa26 promoter and the Wnt4 cDNA, creating the allele designated R26floxneoWnt4. Wnt4 expression was activated during chondrogenesis using Col2a1-Cre transgenic mice that express Cre recombinase in differentiating chondrocytes. R26floxneoWnt4; Col2a1-Cre double heterozygous mice exhibited a growth deficiency, beginning approximately 7 to 10 days after birth, that resulted in dwarfism. In addition, they also had craniofacial abnormalities, and delayed ossification of the lumbar vertebrae and pelvic bones. Histological analysis revealed a disruption in the organization of the growth plates and a delay in the onset of the primary and secondary ossification centers. Molecular studies showed that Wnt4 overexpression caused decreased proliferation and altered maturation of chondrocytes. In addition, R26floxneoWnt4; Col2a1-Cre mice had decreased expression of vascular endothelial growth factor (VEGF). These studies demonstrate that Wnt4 overexpression leads to dwarfism in mice. The data indicate that Wnt4 levels must be regulated in chondrocytes for normal growth plate development and skeletogenesis. Decreased VEGF expression suggests that defects in vascularization may contribute to the dwarf phenotype. PMID:17505543

miRNA-29a targets COL3A1 to regulate the level of type III collagen in pig.

PubMed

Chuan-Hao, Li; Wei, Chen; Jia-Qing, Hu; Yan-Dong, Wang; Shou-Dong, Wang; Yong-Qing, Zeng; Hui, Wang

2016-10-30

COL3A1 encodes the protein, collagen type III alpha 1, which is an important component of collagen. Collagen can have a considerable effect on the processing quality of meat, and is nutritious. Bioinformatic analysis using Targetscan showed that COL3A1 could be a target gene of miRNA-29a. Moreover, we found that Laiwu pigs have higher levels of type III collagen and lower levels of miRNA-29a than Landrace pigs. Therefore, we hypothesized that miRNA-29a suppresses the expression of COL3A1 by targeting its 3'-UTR. miRNA-29a appears to play an inhibitory role in the regulation of COL3A1 in PK15 cells because of the following: (1) overexpression of miRNA-29a resulted in a significant down-regulation of COL3A1 protein levels (2) overexpression of miRNA-29a significantly decreased the level of COL3A1 mRNA. (3) The activity of a COL3A1 luciferase reporter was significant reduced by miRNA-29a. Furthermore, the levels of miRNA-29a and collagen type III in four tissues in Laiwu and Landrace pigs were consistent with the above observations. In this study, we identified COL3A1 as a direct target for miRNA-29a, which will inform further studies of meat quality. Copyright © 2016 Elsevier B.V. All rights reserved.

Expression of the cloned ColE1 kil gene in normal and Kilr Escherichia coli.

PubMed Central

Altieri, M; Suit, J L; Fan, M L; Luria, S E

1986-01-01

The kil gene of the ColE1 plasmid was cloned under control of the lac promoter. Its expression under this promoter gave rise to the same pattern of bacterial cell damage and lethality as that which accompanies induction of the kil gene in the colicin operon by mitomycin C. This confirms that cell damage after induction is solely due to expression of kil and is independent of the cea or imm gene products. Escherichia coli derivatives resistant to the lethal effects of kil gene expression under either the normal or the lac promoter were isolated and found to fall into several classes, some of which were altered in sensitivity to agents that affect the bacterial envelope. PMID:2946661

Decreased physical function and increased pain sensitivity in mice deficient for type IX collagen.

PubMed

Allen, Kyle D; Griffin, Timothy M; Rodriguiz, Ramona M; Wetsel, William C; Kraus, Virginia B; Huebner, Janet L; Boyd, Lawrence M; Setton, Lori A

2009-09-01

In mice with Col9a1 gene inactivation (Col9a1(-/-)), osteoarthritis (OA) and intervertebral disc degeneration develop prematurely. The aim of this study was to investigate Col9a1(-/-) mice for functional and symptomatic changes that may be associated with these pathologies. Col9a1(-/-) and wild-type mice were investigated for reflexes, functional impairment (beam walking, pole climbing, wire hang, grip strength), sensorimotor skills (rotarod), mechanical sensitivity (von Frey hair), and thermal sensitivity (hot plate/tail flick). Gait was also analyzed to determine velocity, stride frequency, symmetry, percentage stance time, stride length, and step width. Postmortem, sera obtained from the mice were analyzed for hyaluronan, and their knees and spines were graded histologically for degeneration. Col9a1(-/-) mice had compensatory gait changes, increased mechanical sensitivity, and impaired physical ability. Col9a1(-/-) mice ambulated with gaits characterized by increased percentage stance times and shorter stride lengths. These mice also had heightened mechanical sensitivity and were deficient in contact righting, wire hang, rotarod, and pole climbing tasks. Male Col9a1(-/-) mice had the highest mean serum hyaluronan levels and strong histologic evidence of cartilage erosion. Intervertebral disc degeneration was also detected, with Col9a1(-/-) mice having an increased incidence of disc tears. These data describe a Col9a1(-/-) behavioral phenotype characterized by altered gait, increased mechanical sensitivity, and impaired function. These gait and functional differences suggest that Col9a1(-/-) mice select locomotive behaviors that limit joint loads. The nature and magnitude of behavioral changes were largest in male mice, which also had the greatest evidence of knee degeneration. These findings suggest that Col9a1(-/-) mice present behavioral changes consistent with anatomic signs of OA and intervertebral disc degeneration.

Heteroduplex analysis can increase the informativeness of PCR-amplified VNTR markers: Application using a marker tightly linked to the COL2A1 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilkin, D.J.; Cohn, D.H.; Koprivnikar, K.E.

1993-02-01

Variable number of tandem repeat (VNTR) polymorphism provide a high degree of informativeness in linkage studies. Whether performed by standard methods or by polymerase chain reaction (PCR), analysis of these markers involves assessment of the length of each allele. VNTR alleles usually differ in the number of tandem repeats. During PCR amplification of a VNTR closely linked to the type II collagen gene (COL2A1), we identified allelic microheterogeneity through the analysis of unique heteroduplexes between amplified strands of the two alleles. In one large pedigree, heteroduplex analysis identified only three distinct alleles. The identification of these heteroduplexes allowed the determinationmore » of the COL2A1 inheritance pattern in the family, which otherwise would have been noninformative. 26 refs., 3 figs.« less

Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression

PubMed Central

Camps, Manel

2010-01-01

ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961

Transportability Testing of the Army Tactical Missile System (ATACMS)

DTIC Science & Technology

1989-09-01

QUANTITY OP TIEDOWN ANCHORS LATERALLY ADJACENT TO BACH 0OTHER. WIUIIN 114 CARRYING VEHICLE It WARY K NECESSARY TO LOCATE 341 LADING LONGITUDINALLY IN/ON...camdl4f DSI - ---- -. =~24 F.otG f 6AP".K WQ S TH~6IS inft6 at CASS -a- CI.L=4%. APO A COAST Cusco ClAsS -C. fti Cu11GsfletG .’COL*LS IUCW1D IIMit’ CAN4

Development of Improved Seals and Closures for Dry Diving Suits.

DTIC Science & Technology

1979-01-31

7 AA SIS 17 2 BATTELLE COL4 4 St LABS 0O 4 F/6 6/17DEVLOPMENT OF IMPROVED SEALS AND CLOSURES FOR DRY DIVAlM SUITS--ETC (U) ULS JAN 79 M61331-76-C...A I Columbus Laboratories Report DTI ELIT V~ omn mbIIap" pww =dt 0lu FINAL REPORT on DEVELOPMENT OF IMPROVED SEALS AND CLOSURES FOR DRY DIVING SUITS...6 Multiple Lip Wrist Seal ..................................... 6 Closures

Antiviral activity of an extract of Cordia salicifolia on herpes simplex virus type 1.

PubMed

Hayashi, K; Hayashi, T; Morita, N; Niwayama, S

1990-10-01

A partially purified extract (COL 1-6) from whole plant of Cordia salicifolia showed an inhibitory effect on herpes simplex virus type 1 (HSV-1). The activity of COL 1-6 on different steps of HSV-1 replication in HeLa cells was investigated. Under single-cycle replication conditions, COL 1-6 exerted a greater than 99.9% inhibition in virus yield when added to the cells 3 h or 1.5 h before infection, and even when added 8 h after infection the extract still caused a greater than 99% inhibition. The extract has been shown to have a direct virucidal activity. And also, analysis of early events following infection showed that COL 1-6 affected viral penetration in HeLa cells but did not interfere with adsorption to the cells.

The Complete Sequence and Comparative Analysis of a Multidrug-Resistance and Virulence Multireplicon IncFII Plasmid pEC302/04 from an Extraintestinal Pathogenic Escherichia coli EC302/04 Indicate Extensive Diversity of IncFII Plasmids.

PubMed

Ho, Wing Sze; Yap, Kien-Pong; Yeo, Chew Chieng; Rajasekaram, Ganeswrie; Thong, Kwai Lin

2015-01-01

Extraintestinal pathogenic Escherichia coli (ExPEC) that causes extraintestinal infections often harbor plasmids encoding fitness traits such as resistance and virulence determinants that are of clinical importance. We determined the complete nucleotide sequence of plasmid pEC302/04 from a multidrug-resistant E. coli EC302/04 which was isolated from the tracheal aspirate of a patient in Malaysia. In addition, we also performed comparative sequence analyses of 18 related IncFIIA plasmids to determine the phylogenetic relationship and diversity of these plasmids. The 140,232 bp pEC302/04 is a multireplicon plasmid that bears three replication systems (FII, FIA, and FIB) with subtype of F2:A1:B1. The plasmid is self-transmissible with a complete transfer region. pEC302/04 also carries antibiotic resistance genes such as bla TEM-1 and a class I integron containing sul1, cml and aadA resistance genes, conferring multidrug resistance (MDR) to its host, E. coli EC302/04. Besides, two iron acquisition systems (SitABCD and IutA-IucABCD) which are the conserved virulence determinants of ExPEC-colicin V or B and M (ColV/ColBM)-producing plasmids were identified in pEC302/04. Multiple toxin-antitoxin (TA)-based addiction systems (i.e., PemI/PemK, VagC/VagD, CcdA/CcdB, and Hok/Sok) and a plasmid partitioning system, ParAB, and PsiAB, which are important for plasmid maintenance were also found. Comparative plasmid analysis revealed only one conserved gene, the repA1 as the core genome, showing that there is an extensive diversity among the IncFIIA plasmids. The phylogenetic relationship of 18 IncF plasmids based on the core regions revealed that ColV/ColBM-plasmids and non-ColV/ColBM plasmids were separated into two distinct groups. These plasmids, which carry highly diverse genetic contents, are also mosaic in nature. The atypical combination of genetic materials, i.e., the MDR- and ColV/ColBM-plasmid-virulence encoding regions in a single ExPEC plasmid is rare but of clinical importance. Such phenomenon is bothersome when the plasmids are transmissible, facilitating the spread of virulence and resistance plasmids among pathogenic bacteria. Notably, certain TA systems are more commonly found in particular ExPEC plasmid types, indicating the possible relationships between certain TA systems and ExPEC pathogenesis.

17 CFR 210.12-14 - Investments in and advances to affiliates.

Code of Federal Regulations, 2010 CFR

2010-04-01

... § 210.12-14 Investments in and advances to affiliates. [For management investment companies only] Col. A Col. B Col. C Col. D Col. E Name of issuer and title of issue or nature of indebtedness 1 Number of... close of period 2,3,4,5 (1) Credited to income (2) Other 1 (a) List each issue separately and group (1...

A fungal transcription factor essential for starch degradation affects integration of carbon and nitrogen metabolism

DOE PAGES

Xiong, Yi; Wu, Vincent W.; Lubbe, Andrea; ...

2017-05-03

In Neurospora crassa, the transcription factor COL-26 functions as a regulator of glucose signaling and metabolism. Its loss leads to resistance to carbon catabolite repression. Here, we report that COL-26 is necessary for the expression of amylolytic genes in N. crassa and is required for the utilization of maltose and starch. Additionally, the Δcol-26 mutant shows growth defects on preferred carbon sources, such as glucose, an effect that was alleviated if glutamine replaced ammonium as the primary nitrogen source. This rescue did not occur when maltose was used as a sole carbon source. Transcriptome and metabolic analyses of the Δcol-26more » mutant relative to its wild type parental strain revealed that amino acid and nitrogen metabolism, the TCA cycle and GABA shunt were adversely affected. Phylogenetic analysis showed a single col-26 homolog in Sordariales, Ophilostomatales, and the Magnaporthales, but an expanded number of col-26 homologs in other filamentous fungal species. Deletion of the closest homolog of col-26 in Trichoderma reesei, bglR, resulted in a mutant with similar preferred carbon source growth deficiency, and which was alleviated if glutamine was the sole nitrogen source, suggesting conservation of COL-26 and BglR function. Our finding provides novel insight into the role of COL-26 for utilization of starch and in integrating carbon and nitrogen metabolism for balanced metabolic activities for optimal carbon and nitrogen distribution.« less

A fungal transcription factor essential for starch degradation affects integration of carbon and nitrogen metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiong, Yi; Wu, Vincent W.; Lubbe, Andrea

In Neurospora crassa, the transcription factor COL-26 functions as a regulator of glucose signaling and metabolism. Its loss leads to resistance to carbon catabolite repression. Here, we report that COL-26 is necessary for the expression of amylolytic genes in N. crassa and is required for the utilization of maltose and starch. Additionally, the Δcol-26 mutant shows growth defects on preferred carbon sources, such as glucose, an effect that was alleviated if glutamine replaced ammonium as the primary nitrogen source. This rescue did not occur when maltose was used as a sole carbon source. Transcriptome and metabolic analyses of the Δcol-26more » mutant relative to its wild type parental strain revealed that amino acid and nitrogen metabolism, the TCA cycle and GABA shunt were adversely affected. Phylogenetic analysis showed a single col-26 homolog in Sordariales, Ophilostomatales, and the Magnaporthales, but an expanded number of col-26 homologs in other filamentous fungal species. Deletion of the closest homolog of col-26 in Trichoderma reesei, bglR, resulted in a mutant with similar preferred carbon source growth deficiency, and which was alleviated if glutamine was the sole nitrogen source, suggesting conservation of COL-26 and BglR function. Our finding provides novel insight into the role of COL-26 for utilization of starch and in integrating carbon and nitrogen metabolism for balanced metabolic activities for optimal carbon and nitrogen distribution.« less

A fungal transcription factor essential for starch degradation affects integration of carbon and nitrogen metabolism

PubMed Central

Xiong, Yi; Qin, Lina; Kennedy, Megan; Bauer, Diane; Barry, Kerrie; Northen, Trent R.; Grigoriev, Igor V.

2017-01-01

In Neurospora crassa, the transcription factor COL-26 functions as a regulator of glucose signaling and metabolism. Its loss leads to resistance to carbon catabolite repression. Here, we report that COL-26 is necessary for the expression of amylolytic genes in N. crassa and is required for the utilization of maltose and starch. Additionally, the Δcol-26 mutant shows growth defects on preferred carbon sources, such as glucose, an effect that was alleviated if glutamine replaced ammonium as the primary nitrogen source. This rescue did not occur when maltose was used as a sole carbon source. Transcriptome and metabolic analyses of the Δcol-26 mutant relative to its wild type parental strain revealed that amino acid and nitrogen metabolism, the TCA cycle and GABA shunt were adversely affected. Phylogenetic analysis showed a single col-26 homolog in Sordariales, Ophilostomatales, and the Magnaporthales, but an expanded number of col-26 homologs in other filamentous fungal species. Deletion of the closest homolog of col-26 in Trichoderma reesei, bglR, resulted in a mutant with similar preferred carbon source growth deficiency, and which was alleviated if glutamine was the sole nitrogen source, suggesting conservation of COL-26 and BglR function. Our finding provides novel insight into the role of COL-26 for utilization of starch and in integrating carbon and nitrogen metabolism for balanced metabolic activities for optimal carbon and nitrogen distribution. PMID:28467421

Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

PubMed

Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

2005-04-01

The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

Large-Scale Gene-Centric Analysis Identifies Novel Variants for Coronary Artery Disease

PubMed Central

2011-01-01

Coronary artery disease (CAD) has a significant genetic contribution that is incompletely characterized. To complement genome-wide association (GWA) studies, we conducted a large and systematic candidate gene study of CAD susceptibility, including analysis of many uncommon and functional variants. We examined 49,094 genetic variants in ∼2,100 genes of cardiovascular relevance, using a customised gene array in 15,596 CAD cases and 34,992 controls (11,202 cases and 30,733 controls of European descent; 4,394 cases and 4,259 controls of South Asian origin). We attempted to replicate putative novel associations in an additional 17,121 CAD cases and 40,473 controls. Potential mechanisms through which the novel variants could affect CAD risk were explored through association tests with vascular risk factors and gene expression. We confirmed associations of several previously known CAD susceptibility loci (eg, 9p21.3:p<10−33; LPA:p<10−19; 1p13.3:p<10−17) as well as three recently discovered loci (COL4A1/COL4A2, ZC3HC1, CYP17A1:p<5×10−7). However, we found essentially null results for most previously suggested CAD candidate genes. In our replication study of 24 promising common variants, we identified novel associations of variants in or near LIPA, IL5, TRIB1, and ABCG5/ABCG8, with per-allele odds ratios for CAD risk with each of the novel variants ranging from 1.06–1.09. Associations with variants at LIPA, TRIB1, and ABCG5/ABCG8 were supported by gene expression data or effects on lipid levels. Apart from the previously reported variants in LPA, none of the other ∼4,500 low frequency and functional variants showed a strong effect. Associations in South Asians did not differ appreciably from those in Europeans, except for 9p21.3 (per-allele odds ratio: 1.14 versus 1.27 respectively; P for heterogeneity = 0.003). This large-scale gene-centric analysis has identified several novel genes for CAD that relate to diverse biochemical and cellular functions and clarified the literature with regard to many previously suggested genes. PMID:21966275

Mifepristone inhibits extracellular matrix formation in uterine leiomyoma.

PubMed

Patel, Amrita; Malik, Minnie; Britten, Joy; Cox, Jeris; Catherino, William H

2016-04-01

To characterize the efficacy of mifepristone treatment on extracellular matrix (ECM) production in leiomyomas. Laboratory study. University research laboratory. None. Treatment of human immortalized two-dimensional (2D) and three-dimensional (3D) leiomyoma and myometrial cells with mifepristone and the progestin promegestone (R5020). Expression of COL1A1, fibronectin, versican variant V0, and dermatopontin in treated leiomyoma cells by Western blot analysis and confirmatory immunohistochemistry staining of treated 3D cultures. Treatment with progestin stimulated production of COL1A1, fibronectin, versican, and dermatopontin. Mifepristone treatment inhibited protein production of these genes, most notably with versican expression. Combination treatment with both the agonist and antagonist further inhibited protein expression of these genes. Immunohistochemistry performed on 3D cultures demonstrated generalized inhibition of ECM protein concentration. Our study demonstrated that the progesterone agonist R5020 directly stimulated extracellular matrix components COL1A1, fibronectin, versican, and dermatopontin production in human leiomyoma cells. Progesterone antagonist mifepristone decreased protein production of these genes to levels comparable with untreated leiomyoma cells. Published by Elsevier Inc.

Distribution of three SNPs related to low bone mineral density in Amerindian groups and Mestizos from Mexico.

PubMed

Nuño-Arana, Ismael; Sahagún-Núñez, Valeria Del Rocío; Muñoz-Valle, José Francisco; Sandoval, Lucila; Pinto-Escalante, Doris; Páez-Riberos, Luis Antonio; Lazalde, Brissia; Maldonado-González, Montserrat; Rangel-Villalobos, Héctor

2012-01-01

Some Single nucleotide polymorphisms (SNPs) of several candidate genes have been associated with low bone mineral density (BMD) and fracture risk. As the genetic variability of such SNPs in Hispanic and Native American populations is scarce, we analyzed the three SNPs that have been related with bone mass disorders (Sp1, A163G, and BsmI) located in the genes of Type I Collagen (COL1A1), Osteoprotegerin (OPG), and Vitamin D receptor (VDR) in Mexican Mestizos (people resulting from post-Columbian admixture) and five Amerindian populations. We genotyped these three SNPs by Polymerase chain reaction (PCR) and Restriction fragment length polymorphisms (RFLPs) in 523 individuals from five Mexican Amerindian groups (Nahua, Maya, Purépecha, Tarahumara, and Huichol) and 227 western Mestizos (Jalisco state). The modal allele was the same in all the six populations for Sp1-COL1A1 (S > 77%), A163G-OPG (A > 80%), and BsmI-VDR (b > 62%). Genotype distribution was in Hardy-Weinberg equilibrium in all SNPs/populations, excepting Sp1-COL1A1 in the Purépecha group and BsmI-VDR in Mestizo. In terms of the presumably Sp1-COL1A1 risk allele to low BMD (allele "s"), the Purépecha group showed the highest allele (23%) and homozygous (14.5%) frequencies. If the role of this allele as a genetic predisposing factor to low BMD were confirmed, this would mean increased susceptibility of Purépechas with regard to Europeans (14.5 vs. 6.8%). This finding presumably could influence the genetic susceptibility to low BMD in Purépechas. For the SNPs, BsmI-VDR and A163G-OPG, relative homogeneity was observed among the Mexican populations analyzed here. Copyright © 2012 Wiley Periodicals, Inc.

α1β1 integrin/Rac1-dependent mesangial invasion of glomerular capillaries in Alport syndrome.

PubMed

Zallocchi, Marisa; Johnson, Brianna M; Meehan, Daniel T; Delimont, Duane; Cosgrove, Dominic

2013-10-01

Alport syndrome, hereditary glomerulonephritis with hearing loss, results from mutations in type IV collagen COL4A3, COL4A4, or COL4A5 genes. The mechanism for delayed glomerular disease onset is unknown. Comparative analysis of Alport mice and CD151 knockout mice revealed progressive accumulation of laminin 211 in the glomerular basement membrane. We show mesangial processes invading the capillary loops of both models as well as in human Alport glomeruli, as the likely source of this laminin. L-NAME salt-induced hypertension accelerated mesangial cell process invasion. Cultured mesangial cells showed reduced migratory potential when treated with either integrin-linked kinase inhibitor or Rac1 inhibitor, or by deletion of integrin α1. Treatment of Alport mice with Rac1 inhibitor or deletion of integrin α1 reduced mesangial cell process invasion of the glomerular capillary tuft. Laminin α2-deficient Alport mice show reduced mesangial process invasion, and cultured laminin α2-null cells showed reduced migratory potential, indicating a functional role for mesangial laminins in progression of Alport glomerular pathogenesis. Collectively, these findings predict a role for biomechanical insult in the induction of integrin α1β1-dependent Rac1-mediated mesangial cell process invasion of the glomerular capillary tuft as an initiation mechanism of Alport glomerular pathology. Copyright © 2013 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

PubMed

Calonge, María Julia; Seoane, Joan; Massagué, Joan

2004-05-28

A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.

The type of variants at the COL3A1 gene associates with the phenotype and severity of vascular Ehlers–Danlos syndrome

PubMed Central

Frank, Michael; Albuisson, Juliette; Ranque, Brigitte; Golmard, Lisa; Mazzella, Jean-Michael; Bal-Theoleyre, Laurence; Fauret, Anne-Laure; Mirault, Tristan; Denarié, Nicolas; Mousseaux, Elie; Boutouyrie, Pierre; Fiessinger, Jean-Noël; Emmerich, Joseph; Messas, Emmanuel; Jeunemaitre, Xavier

2015-01-01

Vascular Ehlers–Danlos syndrome (vEDS) is a rare and severe autosomal dominant disorder caused by variants at the COL3A1 gene. Clinical characteristics and course of disease of 215 molecularly proven patients (146 index cases and 69 relatives) were analysed. We found 126 distincts variants that were divided into five groups: (1) Glycine substitutions (n=71), (2) splice-site and in-frame insertions–deletions (n=36), (3) variants leading to haplo-insufficiency (n=7), (4) non-glycine missense variants within the triple helix (n=4 variants), and (5) non-glycine missense variants or in-frame insertions–deletions, in the N- or C-terminal part of the protein (n=8). Overall, our cohort confirmed the severity of the disease with a median age at first complication of 29 years (IQR 22–39), the most frequent being arterial (48%) and digestive (24%) ruptures. Groups 2 and 1 were significantly more severe than groups 3–5, with extreme median ages at first major complication of 23–47 years. Patients of groups 3–5 had a less typical phenotype and remarkably absence of digestive events. The distribution of glycine-replacing amino acids was strongly biased towards more destabilizing residues of the collagen assembly. Thus the natural course of vEDS and the clinical phenotype of patients are influenced by the type of COL3A1 variant. This study also confirms that patients with variants located in the C- and N-termini or leading to haplo-insufficiency have milder course of the disease and less prevalent diagnostic criteria. These findings may help refine diagnostic strategy, genetic counselling and clinical care. PMID:25758994

Comparison of the effects between animal-derived trypsin and recombinant trypsin on human skin cells proliferation, gene and protein expression.

PubMed

Manira, Maarof; Khairul Anuar, Khairoji; Seet, Wan Tai; Ahmad Irfan, Abd Wahab; Ng, Min Hwei; Chua, Kien Hui; Mohd Heikal, Mohd Yunus; Aminuddin, Bin Saim; Ruszymah, Bt Hj Idrus

2014-03-01

Animal-derivative free reagents are preferred in skin cell culture for clinical applications. The aim of this study was to compare the performance and effects between animal-derived trypsin and recombinant trypsin for skin cells culture and expansion. Full thickness human skin was digested in 0.6 % collagenase for 6 h to liberate the fibroblasts, followed by treatment with either animal-derived trypsin; Trypsin EDTA (TE) or recombinant trypsin; TrypLE Select (TS) to liberate the keratinocytes. Both keratinocytes and fibroblasts were then culture-expanded until passage 2. Trypsinization for both cell types during culture-expansion was performed using either TE or TS. Total cells yield was determined using a haemocytometer. Expression of collagen type I, collagen type III (Col-III), cytokeratin 10, and cytokeratin 14 genes were quantified via RT-PCR and further confirmed with immunocytochemical staining. The results of our study showed that the total cell yield for both keratinocytes and fibroblasts treated with TE or TS were comparable. RT-PCR showed that expression of skin-specific genes except Col-III was higher in the TS treated group compared to that in the TE group. Expression of proteins specific to the two cell types were confirmed by immunocytochemical staining in both TE and TS groups. In conclusion, the performance of the recombinant trypsin is comparable with the well-established animal-derived trypsin for human skin cell culture expansion in terms of cell yield and expression of specific cellular markers.

Meta-analysis of the association between COL9A2 genetic polymorphisms and lumbar disc disease susceptibility.

PubMed

Zhang, Zhaobo; Zhang, Jingsheng; Ding, Lingzhi; Teng, Xiao

2014-09-15

Meta-analysis to collect all the relevant studies to date to further investigate whether or not the COL9A2 gene rs12077871, rs12722877, and rs7533552 polymorphism are associated with susceptibility to lumbar disc disease (LDD). The aim of this study was to assess the association between the COL9A2 gene rs12077871, rs12722877, and rs7533552 and LDD. LDD is a common musculoskeletal disease with strong genetic determinants. COL9A2 encodes the α2 (IX) chain of type IX collagen, which is the major collagen component of the hyaline cartilage. Growing numbers of studies have revealed the association between COL9A2 polymorphisms and susceptibility to LDD. However, those studies have yielded contradictory results. Data were collected from the following electronic databases: PubMed, Web of Knowledge, and China National Knowledge Infrastructure, with the last report up to November 30, 2013. The odds ratio (OR) and 95% confidence interval (CI) were used to assess the strength of association under the allelic genetic model. We summarized the data on the association between COL9A2 rs12077871, rs12722877, and rs7533552 polymorphism and LDD in the overall studies. Nine case-control studies, including 1522 LDD cases and 1646 controls, were identified. The results indicated that the rs12077871, rs12722877, and rs7533552 variants in COL9A2 were not associated with LDD (rs12077871: C vs. T, OR = 0.541, 95% CI = 0.256-1.147, P = 0.109; rs12722877: C vs. G, OR = 1.199, 95% CI = 0.992-1.448, P = 0.06; rs7533552: A vs. G, OR = 0.993, 95% CI = 0.815-1.069, P = 0.320). Furthermore, the Egger test and the Begg funnel plot did not show any evidence of publication bias. Our results suggest that the COL9A2 rs12077871, rs12722877, and rs7533552 polymorphisms may not be associated with LDD. More studies based on larger sample sizes and homogeneous samples of patients with LDD are needed to confirm these findings. 2.

The Egyptian Military Elite: An Operational Code

DTIC Science & Technology

1977-09-01

17 Jan 1955. 6. Salem, Major Salah, "Mehalla’s Great Welcome For Major Salem," Egyptian Gazette, p. 1, 7 Jan 1955. 7. Muhieldin, Lt. Col. Zakaria, "The...Wheel of Reform Will Not Turn Back," Egyptian Gazette, p. 1, 26 Jan 1955. 8. Gohar, Lt. Col. Salah, "Imaginary Incident Explored," Egyptian Gazette...Says Army is Fully Prepared," Al Akhbar , FBIS Vol. 172, p. Al, 4 Sept 1956. 12. Sadat, Anwar al, "Western Powers Determined to Grab Canal," Al

A role for circadian evening elements in cold-regulated gene expression in Arabidopsis.

PubMed

Mikkelsen, Michael D; Thomashow, Michael F

2009-10-01

The plant transcriptome is dramatically altered in response to low temperature. The cis-acting DNA regulatory elements and trans-acting factors that regulate the majority of cold-regulated genes are unknown. Previous bioinformatic analysis has indicated that the promoters of cold-induced genes are enriched in the Evening Element (EE), AAAATATCT, a DNA regulatory element that has a role in circadian-regulated gene expression. Here we tested the role of EE and EE-like (EEL) elements in cold-induced expression of two Arabidopsis genes, CONSTANS-like 1 (COL1; At5g54470) and a gene encoding a 27-kDa protein of unknown function that we designated COLD-REGULATED GENE 27 (COR27; At5g42900). Mutational analysis indicated that the EE/EEL elements were required for cold induction of COL1 and COR27, and that their action was amplified through coupling with ABA response element (ABRE)-like (ABREL) motifs. An artificial promoter consisting solely of four EE motifs interspersed with three ABREL motifs was sufficient to impart cold-induced gene expression. Both COL1 and COR27 were found to be regulated by the circadian clock at warm growth temperatures and cold-induction of COR27 was gated by the clock. These results suggest that cold- and clock-regulated gene expression are integrated through regulatory proteins that bind to EE and EEL elements supported by transcription factors acting at ABREL sequences. Bioinformatic analysis indicated that the coupling of EE and EEL motifs with ABREL motifs is highly enriched in cold-induced genes and thus may constitute a DNA regulatory element pair with a significant role in configuring the low-temperature transcriptome.

Minimal influence of G-protein null mutations on ozone-induced changes in gene expression, foliar injury, gas exchange and peroxidase activity in Arabidopsis thaliana L

PubMed Central

Booker, Fitzgerald; Burkey, Kent; Morgan, Patrick; Fiscus, Edwin; Jones, Alan

2016-01-01

Ozone (O3) uptake by plants leads to an increase in reactive oxygen species (ROS) in the intercellular space of leaves and induces signalling processes reported to involve the membrane-bound heterotrimeric G-protein complex. Therefore, potential G-protein-mediated response mechanisms to O3 were compared between Arabidopsis thaliana L. lines with null mutations in the α- and β-subunits (gpa1-4, agb1-2 and gpa1-4/agb1-2) and Col-0 wild-type plants. Plants were treated with a range of O3 concentrations (5, 125, 175 and 300 nL L−1) for 1 and 2 d in controlled environment chambers. Transcript levels of GPA1, AGB1 and RGS1 transiently increased in Col-0 exposed to 125 nL L−1 O3 compared with the 5 nL L−1 control treatment. However, silencing of α and β G-protein genes resulted in little alteration of many processes associated with O3 injury, including the induction of ROS-signalling genes, increased leaf tissue ion leakage, decreased net photosynthesis and stomatal conductance, and increased peroxidase activity, especially in the leaf apoplast. These results indicated that many responses to O3 stress at physiological levels were not detectably influenced by α and β G-proteins. PMID:21988569

CNV analysis in Tourette syndrome implicates large genomic rearrangements in COL8A1 and NRXN1.

PubMed

Nag, Abhishek; Bochukova, Elena G; Kremeyer, Barbara; Campbell, Desmond D; Muller, Heike; Valencia-Duarte, Ana V; Cardona, Julio; Rivas, Isabel C; Mesa, Sandra C; Cuartas, Mauricio; Garcia, Jharley; Bedoya, Gabriel; Cornejo, William; Herrera, Luis D; Romero, Roxana; Fournier, Eduardo; Reus, Victor I; Lowe, Thomas L; Farooqi, I Sadaf; Mathews, Carol A; McGrath, Lauren M; Yu, Dongmei; Cook, Ed; Wang, Kai; Scharf, Jeremiah M; Pauls, David L; Freimer, Nelson B; Plagnol, Vincent; Ruiz-Linares, Andrés

2013-01-01

Tourette syndrome (TS) is a neuropsychiatric disorder with a strong genetic component. However, the genetic architecture of TS remains uncertain. Copy number variation (CNV) has been shown to contribute to the genetic make-up of several neurodevelopmental conditions, including schizophrenia and autism. Here we describe CNV calls using SNP chip genotype data from an initial sample of 210 TS cases and 285 controls ascertained in two Latin American populations. After extensive quality control, we found that cases (N = 179) have a significant excess (P = 0.006) of large CNV (>500 kb) calls compared to controls (N = 234). Amongst 24 large CNVs seen only in the cases, we observed four duplications of the COL8A1 gene region. We also found two cases with ∼400 kb deletions involving NRXN1, a gene previously implicated in neurodevelopmental disorders, including TS. Follow-up using multiplex ligation-dependent probe amplification (and including 53 more TS cases) validated the CNV calls and identified additional patients with rearrangements in COL8A1 and NRXN1, but none in controls. Examination of available parents indicates that two out of three NRXN1 deletions detected in the TS cases are de-novo mutations. Our results are consistent with the proposal that rare CNVs play a role in TS aetiology and suggest a possible role for rearrangements in the COL8A1 and NRXN1 gene regions.

CNV Analysis in Tourette Syndrome Implicates Large Genomic Rearrangements in COL8A1 and NRXN1

PubMed Central

Nag, Abhishek; Bochukova, Elena G.; Kremeyer, Barbara; Campbell, Desmond D.; Muller, Heike; Valencia-Duarte, Ana V.; Cardona, Julio; Rivas, Isabel C.; Mesa, Sandra C.; Cuartas, Mauricio; Garcia, Jharley; Bedoya, Gabriel; Cornejo, William; Herrera, Luis D.; Romero, Roxana; Fournier, Eduardo; Reus, Victor I.; Lowe, Thomas L.; Farooqi, I. Sadaf; Mathews, Carol A.; McGrath, Lauren M.; Yu, Dongmei; Cook, Ed; Wang, Kai; Scharf, Jeremiah M.; Pauls, David L.; Freimer, Nelson B.; Plagnol, Vincent; Ruiz-Linares, Andrés

2013-01-01

Tourette syndrome (TS) is a neuropsychiatric disorder with a strong genetic component. However, the genetic architecture of TS remains uncertain. Copy number variation (CNV) has been shown to contribute to the genetic make-up of several neurodevelopmental conditions, including schizophrenia and autism. Here we describe CNV calls using SNP chip genotype data from an initial sample of 210 TS cases and 285 controls ascertained in two Latin American populations. After extensive quality control, we found that cases (N = 179) have a significant excess (P = 0.006) of large CNV (>500 kb) calls compared to controls (N = 234). Amongst 24 large CNVs seen only in the cases, we observed four duplications of the COL8A1 gene region. We also found two cases with ∼400kb deletions involving NRXN1, a gene previously implicated in neurodevelopmental disorders, including TS. Follow-up using multiplex ligation-dependent probe amplification (and including 53 more TS cases) validated the CNV calls and identified additional patients with rearrangements in COL8A1 and NRXN1, but none in controls. Examination of available parents indicates that two out of three NRXN1 deletions detected in the TS cases are de-novo mutations. Our results are consistent with the proposal that rare CNVs play a role in TS aetiology and suggest a possible role for rearrangements in the COL8A1 and NRXN1 gene regions. PMID:23533600

Mouse genome-wide association study identifies polymorphisms on chromosomes 4, 11, and 15 for age-related cardiac fibrosis.

PubMed

Li, Qiaoli; Berndt, Annerose; Sundberg, Beth A; Silva, Kathleen A; Kennedy, Victoria E; Cario, Clinton L; Richardson, Matthew A; Chase, Thomas H; Schofield, Paul N; Uitto, Jouni; Sundberg, John P

2016-06-01

Dystrophic cardiac calcinosis (DCC), also called epicardial and myocardial fibrosis and mineralization, has been detected in mice of a number of laboratory inbred strains, most commonly C3H/HeJ and DBA/2J. In previous mouse breeding studies between these DCC susceptible and the DCC-resistant strain C57BL/6J, 4 genetic loci harboring genes involved in DCC inheritance were identified and subsequently termed Dyscalc loci 1 through 4. Here, we report susceptibility to cardiac fibrosis, a sub-phenotype of DCC, at 12 and 20 months of age and close to natural death in a survey of 28 inbred mouse strains. Eight strains showed cardiac fibrosis with highest frequency and severity in the moribund mice. Using genotype and phenotype information of the 28 investigated strains, we performed genome-wide association studies (GWAS) and identified the most significant associations on chromosome (Chr) 15 at 72 million base pairs (Mb) (P < 10(-13)) and Chr 4 at 122 Mb (P < 10(-11)) and 134 Mb (P < 10(-7)). At the Chr 15 locus, Col22a1 and Kcnk9 were identified. Both have been reported to be morphologically and functionally important in the heart muscle. The strongest Chr 4 associations were located approximately 6 Mb away from the Dyscalc 2 quantitative trait locus peak within the boundaries of the Extl1 gene and in close proximity to the Trim63 and Cap1 genes. In addition, a single-nucleotide polymorphism association was found on chromosome 11. This study provides evidence for more than the previously reported 4 genetic loci determining cardiac fibrosis and DCC. The study also highlights the power of GWAS in the mouse for dissecting complex genetic traits.

Mouse genome-wide association study identifies polymorphisms on chromosomes 4, 11 and 15 for age-related cardiac fibrosis

PubMed Central

Li, Qiaoli; Berndt, Annerose; Sundberg, Beth A.; Silva, Kathleen A.; Kennedy, Victoria E.; Cario, Clinton L; Richardson, Matthew A.; Chase, Thomas H.; Schofield, Paul N.; Uitto, Jouni; Sundberg, John P.

2017-01-01

Dystrophic cardiac calcinosis (DCC), also called epicardial and myocardial fibrosis and mineralization, has been detected in mice of a number of laboratory inbred strains, most commonly C3H/HeJ and DBA/2J. In previous mouse breeding studies between these DCC susceptible and the DCC resistant strain C57BL/6J, 4 genetic loci harboring genes involved in DCC inheritance were identified and subsequently termed Dyscal loci 1 through 4. Here we report susceptibility to cardiac fibrosis, a sub-phenotype of DCC, at 12 and 20 months of age and close to natural death in a survey of 28 inbred mouse strains. Eight strains showed cardiac fibrosis with highest frequency and severity in the moribund mice. Using genotype and phenotype information of the 28 investigated strains we performed genome-wide association studies (GWAS) and identified the most significant associations on chromosome (Chr) 15 at 72 million base pairs (Mb) (P < 10−13) and Chr 4 at 122 Mb (P < 10−11) and 134 Mb (P < 10−7). At the Chr 15 locus Col22a1 and Kcnk9 were identified. Both have been reported to be morphologically and functionally important in the heart muscle. The strongest Chr 4 associations were located approximate 6 Mb away from the Dyscal 2 quantitative trait locus peak within the boundaries of the Extl1 gene and in close proximity to the Trim63 and Cap1 genes. In addition, a single nucleotide polymorphism association was found on chromosome 11. This study provides evidence for more than the previously reported 4 genetic loci determining cardiac fibrosis and DCC. The study also highlights the power of GWAS in the mouse for dissecting complex genetic traits. PMID:27126641

Transcriptome sequencing of Atlantic salmon (Salmo salar L.) notochord prior to development of the vertebrae provides clues to regulation of positional fate, chordoblast lineage and mineralisation.

PubMed

Wang, Shou; Furmanek, Tomasz; Kryvi, Harald; Krossøy, Christel; Totland, Geir K; Grotmol, Sindre; Wargelius, Anna

2014-02-19

In teleosts such as Atlantic salmon (Salmo salar L.), segmentation and subsequent mineralisation of the notochord during embryonic stages are essential for normal vertebrae formation. However, the molecular mechanisms leading to segmentation and mineralisation of the notochord are poorly understood. The aim of this study was to identify genes/pathways acting in gradients over time and along the anterior-posterior axis during notochord segmentation and immediately prior to mineralisation of the vertebral bodies in Atlantic salmon. Notochord samples were collected from unsegmented, pre-segmented and segmented developmental stages. In each stage, the cellular core of the notochord was cut into three pieces along the longitudinal axis (anterior, mid, posterior). RNA was sequenced (22 million pair-end 100 bp/ library) and mapped to the salmon genome. 66569 transcripts were predicted and 55775 were annotated. In order to identify possible gradients leading to segmentation of the notochord, all 71 notochord-expressed hox genes were investigated, most of them displaying a typical anterior-posterior expression pattern along the notochord axis. The clustering of hox genes revealed a pattern that could be related to notochord segmentation. We further investigated how mineralisation is initiated in the notochord, and several factors related to chondrogenic lineage were identified (sox9, sox5, sox6, tgfb3, ihhb and col2a1), suggesting a cartilage-like character of the notochord. KEGG analysis of differentially expressed genes between stages revealed down-regulation of pathways associated with ECM, cell division, metabolism and development at onset of notochord segmentation. This implies that inhibitory signals produce segmentation of the notochord. One such potential inhibitory signal was identified, col11a2, which was detected in segments of non-mineralising notochord. An incomplete salmon genome was successfully used to analyse RNA-seq data from the cellular core of the Atlantic salmon notochord. In transcriptome we found; hox gene patterns possibly linked to segmentation; down-regulation of pathways in the notochord at onset of segmentation; segmented expression of col11a2 in non-mineralised segments of the notochord; and a chondroblast-like footprint in the notochord.

CHARACTERIZING THE ROLE OF THE NELL1 GENE IN CARDIOVASCULAR DEVELOPMENT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, L. Y.; Culiat, C.

Nell1{sup 6R} is a chemically-induced point mutation in a novel cell-signaling gene, Nell1, which results in truncation of the protein and degradation of the Nell16R transcript. Earlier studies revealed that loss of Nell1 function reduces expression of numerous extracellular matrix (ECM) proteins required for differentiation of bone and cartilage precursor cells, thereby causing severe skull and spinal defects. Since skeletal and cardiovascular development are closely linked biological processes, this research focused on: a) examining Nell16R mutant mice for cardiovascular defects, b) determining Nell1 expression in fetal and adult hearts, and c) establishing how ECM genes affected by Nell1 infl uencemore » heart development. Structural heart defects in Nell16R mutant fetuses were analyzed by heart length and width measurements and standard histological methods (haematoxylin and eosin staining). Nell1 expression was assayed in fetal and adult hearts using reverse transcription polymerase chain reaction (RT-PCR). A comprehensive bioinformatics analysis using public databases (Stanford SOURCE Search, Integrated Cartilage Gene Database, Mouse Genome Informatics, and NCBI UniGene) was undertaken to investigate the relationship between cardiovascular development and each of twentyeight genes affected by Nell1. Nell1-defi cient mice have signifi cantly enlarged hearts (particularly the heart width), dramatically reduced blood fl ow out of the heart and unexpanded lungs. Isolation of total RNAs from hearts of adult (control and heterozygote) and fetal (control and homozygous mutant) mice have been completed and RT-PCR assays are in progress. The bioinformatics analysis showed that the majority of genes with reduced expression in Nell1-defi cient mice are normally expressed in the heart (79%; 22/28), blood vessels (71%; 20/28) and bone marrow (61%; 17/28). Moreover, mouse mutations in seven of these genes (Col15a1, Osf-2, Bmpr1a, Pkd1, Mfge8, Ptger4, Col5a1) manifest abnormalities in cardiovascular development. These data demonstrate for the fi rst time that Nell1 has a role in early mammalian cardiovascular development, mediated by its regulation of ECM proteins necessary for normal cell growth and differentiation. In addition, understanding the mechanisms by which Nell1 and its associated ECM genes affect the cardiovascular system can provide future strategies for the treatment of heart and blood vessel defects.« less

Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

PubMed

Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

2015-04-02

Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

Severe Hemolytic Jaundice in a Neonate with a Novel COL4A1 Mutation.

PubMed

Tomotaki, Seiichi; Mizumoto, Hiroshi; Hamabata, Takayuki; Kumakura, Akira; Shiota, Mitsutaka; Arai, Hiroshi; Haginoya, Kazuhiro; Hata, Daisuke

2016-12-01

We report our experience with a preterm infant with severe hemolytic jaundice who required exchange transfusion just after birth. The patient was negative for alloimmune hemolysis as a result of maternal-fetal blood type incompatibility, and tests for inherited defects in erythrocyte metabolism, membrane function, and hemoglobin synthesis were normal. We also performed a bone marrow examination, but could not identify the cause of hemolysis. The patient had several other complications, including porencephaly, epilepsy, elevated serum levels of creatine kinase, and persistent microscopic hematuria. Later, we detected a genetic mutation in COL4A1, which was recently found to be associated with hemolytic anemia. We therefore believe that all of the patient's clinical features, including hemolytic anemia, were due to the mutation in COL4A1. Genetic testing for COL4A1 mutations is recommended in neonates who exhibit hemolytic disease of unknown etiology, especially when other complications compatible with COL4A1-related disorders are present. Copyright © 2014. Published by Elsevier B.V.

Horizontal gene transfer of a ColV plasmid has resulted in a dominant avian clonal type of Salmonella enterica serovar Kentucky.

PubMed

Johnson, Timothy J; Thorsness, Jessica L; Anderson, Cole P; Lynne, Aaron M; Foley, Steven L; Han, Jing; Fricke, W Florian; McDermott, Patrick F; White, David G; Khatri, Mahesh; Stell, Adam L; Flores, Cristian; Singer, Randall S

2010-12-22

Salmonella enterica continues to be a significant cause of foodborne gastrointestinal illness in humans. A wide variety of Salmonella serovars have been isolated from production birds and from retail poultry meat. Recently, though, S. enterica subsp. enterica serovar Kentucky has emerged as one of the prominent Salmonella serovars isolated from broiler chickens. Recent work suggests that its emergence apparently coincides with its acquisition of a ColV virulence plasmid. In the present study, we examined 902 Salmonella isolates belonging to 59 different serovars for the presence of this plasmid. Of the serovars examined, the ColV plasmid was found only among isolates belonging to the serovars Kentucky (72.9%), Typhimurium (15.0%) and Heidelberg (1.7%). We demonstrated that a single PFGE clonal type of S. Kentucky harbors this plasmid, and acquisition of this plasmid by S. Kentucky significantly increased its ability to colonize the chicken cecum and cause extraintestinal disease. Comparison of the completed sequences of three ColV plasmids from S. Kentucky isolated from different geographical locales, timepoints and sources revealed a nearly identical genetic structure with few single nucleotide changes or insertions/deletions. Overall, it appears that the ColV plasmid was recently acquired by a single clonal type S. Kentucky and confers to its host enhanced colonization and fitness capabilities. Thus, the potential for horizontal gene transfer of virulence and fitness factors to Salmonella from other enteric bacteria exists in poultry, representing a potential human health hazard.

Arabidopsis ABI5 plays a role in regulating ROS homeostasis by activating CATALASE 1 transcription in seed germination.

PubMed

Bi, Chao; Ma, Yu; Wu, Zhen; Yu, Yong-Tao; Liang, Shan; Lu, Kai; Wang, Xiao-Fang

2017-05-01

It has been known that ABA INSENSITIVE 5 (ABI5) plays a vital role in regulating seed germination. In the present study, we showed that inhibition of the catalase activity with 3-amino-1,2,4-triazole (3-AT) inhibits seed germination of Col-0, abi5 mutants and ABI5-overexpression transgenic lines. Compared with Col-0, the seeds of abi5 mutants showed more sensitive to 3-AT during seed germination, while the seeds of ABI5-overexpression transgenic lines showed more insensitive. H 2 O 2 showed the same effect on seed germination of Col-0, abi5 mutants and ABI5-overexpression transgenic lines as 3-AT. These results suggest that ROS is involved in the seed germination mediated by ABI5. Further, we observed that T-DNA insertion mutants of the three catalase members in Arabidopsis displayed 3-AT-insensitive or -hypersensitive phenotypes during seed germination, suggesting that these catalase members regulate ROS homeostasis in a highly complex way. ABI5 affects reactive oxygen species (ROS) homeostasis by affecting CATALASE expression and catalase activity. Furthermore, we showed that ABI5 directly binds to the CAT1 promoter and activates CAT1 expression. Genetic evidence supports the idea that CAT1 functions downstream of ABI5 in ROS signaling during seed germination. RNA-sequencing analysis indicates that the transcription of the genes involved in ROS metabolic process or genes responsive to ROS stress is impaired in abi5-1 seeds. Additionally, expression changes in some genes correlative to seed germination were showed due to the change in ABI5 expression under 3-AT treatment. Together, all the findings suggest that ABI5 regulates seed germination at least partly by affecting ROS homeostasis.

A Carbon Dioxide Limitation-Inducible Protein, ColA, Supports the Growth of Synechococcus sp. PCC 7002.

PubMed

Shimakawa, Ginga; Watanabe, Satoru; Miyake, Chikahiro

2017-12-15

A limitation in carbon dioxide (CO₂), which occurs as a result of natural environmental variation, suppresses photosynthesis and has the potential to cause photo-oxidative damage to photosynthetic cells. Oxygenic phototrophs have strategies to alleviate photo-oxidative damage to allow life in present atmospheric CO₂ conditions. However, the mechanisms for CO₂ limitation acclimation are diverse among the various oxygenic phototrophs, and many mechanisms remain to be discovered. In this study, we found that the gene encoding a CO₂ limitation-inducible protein, ColA, is required for the cyanobacterium Synechococcus sp. PCC 7002 (S. 7002) to acclimate to limited CO₂ conditions. An S. 7002 mutant deficient in ColA (Δ colA ) showed lower chlorophyll content, based on the amount of nitrogen, than that in S. 7002 wild-type (WT) under ambient air but not high CO₂ conditions. Both thermoluminescence and protein carbonylation detected in the ambient air grown cells indicated that the lack of ColA promotes oxidative stress in S. 7002. Alterations in the photosynthetic O₂ evolution rate and relative electron transport rate in the short-term response, within an hour, to CO₂ limitation were the same between the WT and Δ colA . Conversely, these photosynthetic parameters were mostly lower in the long-term response of a few days in Δ colA than in the WT. These data suggest that ColA is required to sustain photosynthetic activity for living under ambient air in S. 7002. The unique phylogeny of ColA revealed diverse strategies to acclimate to CO₂ limitation among cyanobacteria.

Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

PubMed Central

Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

2012-01-01

Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

The dlx5a/dlx6a Genes Play Essential Roles in the Early Development of Zebrafish Median Fin and Pectoral Structures

PubMed Central

Heude, Églantine; Shaikho, Sarah; Ekker, Marc

2014-01-01

The Dlx5 and Dlx6 genes encode homeodomain transcription factors essential for the proper development of limbs in mammalian species. However, the role of their teleost counterparts in fin development has received little attention. Here, we show that dlx5a is an early marker of apical ectodermal cells of the pectoral fin buds and of the median fin fold, but also of cleithrum precursor cells during pectoral girdle development. We propose that early median fin fold establishment results from the medial convergence of dlx5a-expressing cells at the lateral edges of the neural keel. Expression analysis also shows involvement of dlx5a during appendage skeletogenesis. Using morpholino-mediated knock down, we demonstrate that disrupted dlx5a/6a function results in pectoral fin agenesis associated with misexpression of bmp4, fgf8a, and1 and msx genes. In contrast, the median fin fold presents defects in mesenchymal cell migration and actinotrichia formation, whereas the initial specification seems to occur normally. Our results demonstrate that the dlx5a/6a genes are essential for the induction of pectoral fin outgrowth, but are not required during median fin fold specification. The dlx5a/6a knock down also causes a failure of cleithrum formation associated with a drastic loss of runx2b and col10a1 expression. The data indicate distinct requirements for dlx5a/6a during median and pectoral fin development suggesting that initiation of unpaired and paired fin formation are not directed through the same molecular mechanisms. Our results refocus arguments on the mechanistic basis of paired appendage genesis during vertebrate evolution. PMID:24858471

A New COL3A1 Mutation in Ehlers-Danlos Syndrome Vascular Type With Different Phenotypes in the Same Family.

PubMed

Cortini, Francesca; Marinelli, Barbara; Romi, Silvia; Seresini, Agostino; Pesatori, Angela Cecilia; Seia, Manuela; Montano, Nicola; Bassotti, Alessandra

2017-04-01

Vascular Ehlers-Danlos syndrome (vEDS) is a rare and severe connective tissue disorder caused by mutations in the collagen type III alpha I chain ( COL3A1) gene. We describe a pathogenetic heterozygous COL3A1 mutation c.3140 G>A, p. Gly1047Asp, identified using next-generation sequencing, in a 40-year-old Italian female. The genetic test performed on her relatives, which present different clinical phenotypes, confirmed that they carry the same mutation in heterozygous state. This finding confirms that mutations causing vEDS have an incomplete penetrance.

The Spine in Patients With Osteogenesis Imperfecta.

PubMed

Wallace, Maegen J; Kruse, Richard W; Shah, Suken A

2017-02-01

Osteogenesis imperfecta is a genetic disorder of type I collagen. Although multiple genotypes and phenotypes are associated with osteogenesis imperfecta, approximately 90% of the mutations are in the COL1A1 and COL1A2 genes. Osteogenesis imperfecta is characterized by bone fragility. Patients typically have multiple fractures or limb deformity; however, the spine can also be affected. Spinal manifestations include scoliosis, kyphosis, craniocervical junction abnormalities, and lumbosacral pathology. The incidence of lumbosacral spondylolysis and spondylolisthesis is higher in patients with osteogenesis imperfecta than in the general population. Use of diphosphonates has been found to decrease the rate of progression of scoliosis in patients with osteogenesis imperfecta. A lateral cervical radiograph is recommended in patients with this condition before age 6 years for surveillance of craniocervical junction abnormalities, such as basilar impression. Intraoperative and anesthetic considerations in patients with osteogenesis imperfecta include challenges related to fracture risk, airway management, pulmonary function, and blood loss.

Joint mouse–human phenome-wide association to test gene function and disease risk

DOE PAGES

Wang, Xusheng; Pandey, Ashutosh K.; Mulligan, Megan K.; ...

2016-02-02

Phenome-wide association is a novel reverse genetic strategy to analyze genome-to-phenome relations in human clinical cohorts. Here we test this approach using a large murine population segregating for ~5 million sequence variants, and we compare our results to those extracted from a matched analysis of gene variants in a large human cohort. For the mouse cohort, we amassed a deep and broad open-access phenome consisting of ~4,500 metabolic, physiological, pharmacological and behavioural traits, and more than 90 independent expression quantitative trait locus (QTL), transcriptome, proteome, metagenome and metabolome data sets-by far the largest coherent phenome for any experimental cohort (www.genenetwork.org).more » Here, we tested downstream effects of subsets of variants and discovered several novel associations, including a missense mutation in fumarate hydratase that controls variation in the mitochondrial unfolded protein response in both mouse and Caenorhabditis elegans, and missense mutations in Col6a5 that underlies variation in bone mineral density in both mouse and human.« less

Lignification induced by pseudomonads harboring avirulent genes on Arabidopsis.

PubMed

Lee, S; Sharm, Y; Lee, T K; Chang, M; Davis, K R

2001-08-31

The responses of Arabidopsis thaliana ecotypes to the bacterial pathogen Pseudomonas syringae pv. maculicola 4326 (Psm4326) harboring cloned avirulence genes avrB and avrRpt2 from P. syringae pv. glycinea were examined. Psm4326 containing avirulent genes, avrB and avrRpt2 induced lignification and peroxidase activities in the bacteria infiltrated leaves of Col-O only and not in Mt-O, Bla-2 and Po-1. However, Arabidopsis ecotypes infiltrated with Psm4326 harboring with and without avirulent genes all showed differential induction of mRNA for peroxidase gene and lignin accumulation up to 24 h after infiltration. Only avrB gene in Col-O showed strong corelationship between peroxidase mRNA expression as well as lignification gradually up to 36 h after infiltration. These results extend previous observations that avirulence genes from pathogens of one host plant can be recognized by non-host plants and provide the genetic framework for analysis of the plant-specific response to the bacterial avirulent gene products in A. thaliana.

Potassium Retention under Salt Stress Is Associated with Natural Variation in Salinity Tolerance among Arabidopsis Accessions

PubMed Central

Sun, Yanling; Kong, Xiangpei; Li, Cuiling; Liu, Yongxiu; Ding, Zhaojun

2015-01-01

Plants are exposed to various environmental stresses during their life cycle such as salt, drought and cold. Natural variation mediated plant growth adaptation has been employed as an effective approach in response to the diverse environmental cues such as salt stress. However, the molecular mechanism underlying this process is not well understood. In the present study, a collection of 82 Arabidopsis thaliana accessions (ecotypes) was screened with a view to identify variation for salinity tolerance. Seven accessions showed a higher level of tolerance than Col-0. The young seedlings of the tolerant accessions demonstrated a higher K+ content and a lower Na+/K+ ratio when exposed to salinity stress, but its Na+ content was the same as that of Col-0. The K+ transporter genes AtHAK5, AtCHX17 and AtKUP1 were up-regulated significantly in almost all the tolerant accessions, even in the absence of salinity stress. There was little genetic variation or positive transcriptional variation between the selections and Col-0 with respect to Na+-related transporter genes, as AtSOS genes, AtNHX1 and AtHKT1;1. In addition, under salinity stress, these selections accumulated higher compatible solutes and lower reactive oxygen species than did Col-0. Taken together, our results showed that natural variation in salinity tolerance of Arabidopsis seems to have been achieved by the strong capacity of K+ retention. PMID:25993093

Deletion Genotypes Reduce Occlusion Body Potency but Increase Occlusion Body Production in a Colombian Spodoptera frugiperda Nucleopolyhedrovirus Population

PubMed Central

Barrera, Gloria; Williams, Trevor; Villamizar, Laura; Caballero, Primitivo; Simón, Oihane

2013-01-01

A Colombian field isolate (SfCOL-wt) of Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV) is a mixture of different genotypes. To evaluate the insecticidal properties of the different genotypic variants, 83 plaque purified virus were characterized. Ten distinct genotypes were identified (named A through J). SfCOL-A was the most prevalent (71±2%; mean ± SE) showing a PstI restriction profile indistinguishable to that of SfCOL-wt. The remaining nine genotypes presented genomic deletions of 3.8 - 21.8 Kb located mainly between nucleotides 11,436 and 33,883 in the reference genome SfMNPV-B, affecting the region between open reading frames (ORFs) sf20 and sf33. The insecticidal activity of each genotype from SfCOL-wt and several mixtures of genotypes was compared to that of SfCOL-wt. The potency of SfCOL-A occlusion bodies (OBs) was 4.4-fold higher than SfCOL-wt OBs, whereas the speed of kill of SfCOL-A was similar to that of SfCOL-wt. Deletion genotype OBs were similarly or less potent than SfCOL-wt but six deletion genotypes were faster killing than SfCOL-wt. The potency of genotype mixtures co-occluded within OBs were consistently reduced in two-genotype mixtures involving equal proportions of SfCOL-A and one of three deletion genotypes (SfCOL-C, -D or -F). Speed of kill and OB production were improved only when the certain genotype mixtures were co-occluded, although OB production was higher in the SfCOL-wt isolate than in any of the component genotypes, or mixtures thereof. Deleted genotypes reduced OB potency but increased OB production of the SfCOL-wt population, which is structured to maximize the production of OBs in each infected host. PMID:24116220

Slow Muscle Precursors Lay Down a Collagen XV Matrix Fingerprint to Guide Motor Axon Navigation.

PubMed

Guillon, Emilie; Bretaud, Sandrine; Ruggiero, Florence

2016-03-02

The extracellular matrix (ECM) provides local positional information to guide motoneuron axons toward their muscle target. Collagen XV is a basement membrane component mainly expressed in skeletal muscle. We have identified two zebrafish paralogs of the human COL15A1 gene, col15a1a and col15a1b, which display distinct expression patterns. Here we show that col15a1b is expressed and deposited in the motor path ECM by slow muscle precursors also called adaxial cells. We further demonstrate that collagen XV-B deposition is both temporally and spatially regulated before motor axon extension from the spinal cord in such a way that it remains in this region after the adaxial cells have migrated toward the periphery of the myotome. Loss- and gain-of-function experiments in zebrafish embryos demonstrate that col15a1b expression and subsequent collagen XV-B deposition and organization in the motor path ECM depend on a previously undescribed two-step mechanism involving Hedgehog/Gli and unplugged/MuSK signaling pathways. In silico analysis predicts a putative Gli binding site in the col15a1b proximal promoter. Using col15a1b promoter-reporter constructs, we demonstrate that col15a1b participates in the slow muscle genetic program as a direct target of Hedgehog/Gli signaling. Loss and gain of col15a1b function provoke pathfinding errors in primary and secondary motoneuron axons both at and beyond the choice point where axon pathway selection takes place. These defects result in muscle atrophy and compromised swimming behavior, a phenotype partially rescued by injection of a smyhc1:col15a1b construct. These reveal an unexpected and novel role for collagen XV in motor axon pathfinding and neuromuscular development. In addition to the archetypal axon guidance cues, the extracellular matrix provides local information that guides motor axons from the spinal cord to their muscle targets. Many of the proteins involved are unknown. Using the zebrafish model, we identified an unexpected role of the extracellular matrix collagen XV in motor axon pathfinding. We show that the synthesis of collagen XV-B by slow muscle precursors and its deposition in the common motor path are dependent on a novel two-step mechanism that determines axon decisions at a choice point during motor axonogenesis. Zebrafish and humans use common molecular cues and regulatory mechanisms for the neuromuscular system development. And as such, our study reveals COL15A1 as a candidate gene for orphan neuromuscular disorders. Copyright © 2016 the authors 0270-6474/16/362663-14$15.00/0.

Ski Inhibits TGF-β/phospho-Smad3 Signaling and Accelerates Hypertrophic Differentiation in Chondrocytes

PubMed Central

Kim, Kyung-Ok; Sampson, Erik R.; Maynard, Robert D; O'Keefe, Regis J.; Chen, Di; Drissi, Hicham; Rosier, Randy N.; Hilton, Matthew J.; Zuscik, Michael J.

2012-01-01

Since TGF-β/Smad signaling inhibits chondrocyte maturation, endogenous negative regulators of TGF-β signaling are likely also important regulators of the chondrocyte differentiation process. One such negative regulator, Ski, is an oncoprotein that is known to inhibit TGF-β/Smad3 signaling via its interaction with phospho-Smad3 and recruitment of histone deacetylases (HDACs) to the DNA binding complex. Based on this, we hypothesized that Ski inhibits TGF-β signaling and accelerates maturation in chondrocytes via recruitment of HDACs to transcriptional complexes containing Smads. We tested this hypothesis in chick upper sternal chondrocytes (USCs), where gain and loss of Ski expression experiments were performed. Over-expression of Ski not only reversed the inhibitory effect of TGF-β on the expression of hypertrophic marker genes such as type × collagen (colX) and osteocalcin, it induced these genes basally as well. Conversely, knockdown of Ski by RNA interference led to a reduction of colX and osteocalcin expression under basal conditions. Furthermore, Ski blocked TGF-β induction of cyclinD1 and caused a basal up-regulation of Runx2, consistent with the observed acceleration of hypertrophy. Regarding mechanism, not only does Ski associate with phospho-Smad2 and 3, but its association with phospho-Smad3 is required for recruitment of HDAC4 and 5. Implicating this recruitment of HDACs in the phenotypic effects of Ski in chondrocytes, the HDAC inhibitor SAHA reversed the up-regulation of colX and osteocalcin in Ski over-expressing cells. These results suggest that inhibition of TGF-β signaling by Ski, which involves its association with phospho-Smad3 and recruitment of HDAC4 and 5, leads to accelerated chondrocyte differentiation. PMID:22461172

Ocular features in Alport syndrome: pathogenesis and clinical significance.

PubMed

Savige, Judy; Sheth, Shivanand; Leys, Anita; Nicholson, Anjali; Mack, Heather G; Colville, Deb

2015-04-07

Alport syndrome is an inherited disease characterized by progressive renal failure, hearing loss, and ocular abnormalities. Mutations in the COL4A5 (X-linked), or COL4A3 and COL4A4 (autosomal recessive) genes result in absence of the collagen IV α3α4α5 network from the basement membranes of the cornea, lens capsule, and retina and are associated with corneal opacities, anterior lenticonus, fleck retinopathy, and temporal retinal thinning. Typically, these features do not affect vision or, in the case of lenticonus, are correctable. In contrast, the rarer ophthalmic complications of posterior polymorphous corneal dystrophy, giant macular hole, and maculopathy all produce visual loss. Many of the ocular features of Alport syndrome are common, easily recognizable, and thus, helpful diagnostically, and in identifying the likelihood of early-onset renal failure. Lenticonus and central fleck retinopathy strongly suggest the diagnosis of Alport syndrome and are associated with renal failure before the age of 30 years, in males with X-linked disease. Sometimes, ophthalmic features suggest the mode of inheritance. A peripheral retinopathy in the mother of a male with hematuria suggests X-linked inheritance, and central retinopathy or lenticonus in a female means that recessive disease is likely. Ocular examination, retinal photography, and optical coherence tomography are widely available, safe, fast, inexpensive, and acceptable to patients. Ocular examination is particularly helpful in the diagnosis of Alport syndrome when genetic testing is not readily available or the results are inconclusive. It also detects complications, such as macular hole, for which new treatments are emerging. Copyright © 2015 by the American Society of Nephrology.

Ocular Features in Alport Syndrome: Pathogenesis and Clinical Significance

PubMed Central

Sheth, Shivanand; Leys, Anita; Nicholson, Anjali; Mack, Heather G.; Colville, Deb

2015-01-01

Alport syndrome is an inherited disease characterized by progressive renal failure, hearing loss, and ocular abnormalities. Mutations in the COL4A5 (X-linked), or COL4A3 and COL4A4 (autosomal recessive) genes result in absence of the collagen IV α3α4α5 network from the basement membranes of the cornea, lens capsule, and retina and are associated with corneal opacities, anterior lenticonus, fleck retinopathy, and temporal retinal thinning. Typically, these features do not affect vision or, in the case of lenticonus, are correctable. In contrast, the rarer ophthalmic complications of posterior polymorphous corneal dystrophy, giant macular hole, and maculopathy all produce visual loss. Many of the ocular features of Alport syndrome are common, easily recognizable, and thus, helpful diagnostically, and in identifying the likelihood of early-onset renal failure. Lenticonus and central fleck retinopathy strongly suggest the diagnosis of Alport syndrome and are associated with renal failure before the age of 30 years, in males with X-linked disease. Sometimes, ophthalmic features suggest the mode of inheritance. A peripheral retinopathy in the mother of a male with hematuria suggests X-linked inheritance, and central retinopathy or lenticonus in a female means that recessive disease is likely. Ocular examination, retinal photography, and optical coherence tomography are widely available, safe, fast, inexpensive, and acceptable to patients. Ocular examination is particularly helpful in the diagnosis of Alport syndrome when genetic testing is not readily available or the results are inconclusive. It also detects complications, such as macular hole, for which new treatments are emerging. PMID:25649157

Osteogenic gene expression of murine osteoblastic (MC3T3-E1) cells under cyclic tension

NASA Astrophysics Data System (ADS)

Kao, C. T.; Chen, C. C.; Cheong, U.-I.; Liu, S. L.; Huang, T. H.

2014-08-01

Low-level laser therapy (LLLT) can promote cell proliferation. The remodeling ability of the tension side of orthodontic teeth affects post-orthodontic stability. The purpose of the present study was to investigate the osteogenic effects of LLLT on osteoblast-like cells treated with a simulated tension system that provides a mechanical tension regimen. Murine osteoblastic (MC3T3-E1) cells were cultured in a Flexcell strain unit with programmed loads of 12% elongation at a frequency of 0.5 Hz for 24 and 48 h. The cultured cells were treated with a low-level diode laser using powers of 5 J and 10 J. The proliferation of MC3T3-E1 cells was determined using the Alamar Blue assay. The expression of osteogenic genes (type I collagen (Col-1), osteopontin (OPN), osteocalcin (OC), osteoprotegerin (OPG), receptor activator of nuclear factor kappa B ligand (RANKL), bone morphologic protein (BMP-2), and bone morphologic protein (BMP-4)) in MC3T3-E1 cells was analyzed using reverse transcription polymerase chain reaction (RT-PCR). The data were analyzed using one-way analysis of variance. The proliferation rate of tension-cultured MC3T3-E1 cells under 5 J and 10 J LLLT increased compared with that of the control group (p < 0.05). Prominent mineralization of the MC3T3-E1 cells was visible using a von Kossa stain in the 5 J LLLT group. Osteogenic genes (Col-1, OC, OPG and BMP-2) were significantly expressed in the MC3T3-E1 cells treated with 5 J and 10 J LLLT (p < 0.05). LLLT in tension-cultured MC3T3-E1 cells showed synergistic osteogenic effects, including increases in cell proliferation and Col-1, OPN, OC, OPG and BMP-2 gene expression. LLLT might be beneficial for bone remodeling on the tension side of orthodontics.

Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

PubMed Central

Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

2012-01-01

Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

Smad4 deficiency impairs chondrocyte hypertrophy via the Runx2 transcription factor in mouse skeletal development.

PubMed

Yan, Jianyun; Li, Jun; Hu, Jun; Zhang, Lu; Wei, Chengguo; Sultana, Nishat; Cai, Xiaoqiang; Zhang, Weijia; Cai, Chen-Leng

2018-06-15

Chondrocyte hypertrophy is the terminal step in chondrocyte differentiation and is crucial for endochondral bone formation. How signaling pathways regulate chondrocyte hypertrophic differentiation remains incompletely understood. In this study, using a Tbx18:Cre ( Tbx18 Cre /+ ) gene-deletion approach, we selectively deleted the gene for the signaling protein SMAD family member 4 ( Smad4 f/f ) in the limbs of mice. We found that the Smad4 -deficient mice develop a prominent shortened limb, with decreased expression of chondrocyte differentiation markers, including Col2a1 and Acan , in the humerus at mid-to-late gestation. The most striking defects in these mice were the absence of stylopod elements and failure of chondrocyte hypertrophy in the humerus. Moreover, expression levels of the chondrocyte hypertrophy-related markers Col10a1 and Panx3 were significantly decreased. Of note, we also observed that the expression of runt-related transcription factor 2 ( Runx2 ), a critical mediator of chondrocyte hypertrophy, was also down-regulated in Smad4 -deficient limbs. To determine how the skeletal defects arose in the mouse mutants, we performed RNA-Seq with ChIP-Seq analyses and found that Smad4 directly binds to regulatory elements in the Runx2 promoter. Our results suggest a new mechanism whereby Smad4 controls chondrocyte hypertrophy by up-regulating Runx2 expression during skeletal development. The regulatory mechanism involving Smad4-mediated Runx2 activation uncovered here provides critical insights into bone development and pathogenesis of chondrodysplasia. © 2018 Yan et al.

Systemic resistance induced in Arabidopsis thaliana by Trichoderma asperellum SKT-1, a microbial pesticide of seedborne diseases of rice.

PubMed

Yoshioka, Yohei; Ichikawa, Haruki; Naznin, Hushna Ara; Kogure, Atsushi; Hyakumachi, Mitsuro

2012-01-01

Trichoderma asperellum SKT-1 is a microbial pesticide of seedborne diseases of rice. To investigate the mechanisms of disease suppression in SKT-1, the ability to induce systemic resistance by SKT-1, or its cell-free culture filtrate (CF), was tested using Arabidopsis thaliana Col-0 plants. Both SKT-1 and its CF elicit an induced systemic resistance against the bacterial leaf speck pathogen Pseudomonas syringae pv. tomato DC3000 in Col-0 plants. Involvement of plant hormones in the induced resistance by SKT-1 and CF was assessed using Arabidopsis genotypes such as the jasmonic acid (JA)-resistant mutant jar1, the ethylene (ET)-resistant mutant etr1, the plant impaired in salicylic acid (SA) signalling transgenic NahG and the mutant npr1 impaired in NPR1 activity. In soil experiments using SKT-1, no significant disease suppression effect was observed in NahG transgenic plants or npr1 mutant plants. Expression levels of SA-inducible genes such as PR-1, PR-2 and PR-5 increased substantially in the leaves of Col-0 plants. Expression levels of JA/ET-induced genes such as PDF1.2a, PR-3, PR-4 and AtVsp1 were also induced, but the levels were not as high as for SA-inducible genes. In a hydroponic experiment using CF from SKT-1, all Arabidopsis genotypes showed an induced systemic resistance by CF and increased expression levels of JA/ET- and SA-inducible genes in leaves of CF-treated plants. The SA signalling pathway is important in inducing systemic resistance to colonisation by SKT-1, and both SA and JA/ET signalling pathways combine in the signalling of induced resistance by CF. These results indicate that the response of A. thaliana is different from that found in root treatments with barley grain inoculum and CF from SKT-1. Copyright © 2011 Society of Chemical Industry.

Transcriptional expression of type-I interferon response genes and stability of housekeeping genes in the human endometrium and endometriosis.

PubMed

Vestergaard, Anna L; Knudsen, Ulla B; Munk, Torben; Rosbach, Hanne; Martensen, Pia M

2011-04-01

Endometriosis is a painful chronic female disease defined by the presence of endometrial tissue implants in ectopic (Ec) locations. The pathogenesis is much debated, and type-I interferons (IFNs) could be involved. The expression of genes of the type-I IFN response were profiled by a specific PCR array of RNA obtained from Ec and eutopic (Eu) endometrium collected from nine endometriosis patients and nine healthy control women. Transcriptional expression levels of selected IFN-regulated and housekeeping genes (HKGs) were investigated by real-time quantitative reverse transcriptase PCR (qRT-PCR). Stably expressed HKGs for valid normalization of transcriptional studies of endometrium and endometriosis have not yet been published. Here, seven HKGs were evaluated for stability using the GeNorm and NormFinder software. A normalization factor based on HMBS, TBP and YWHAZ expression was suitable for normalization of qRT-PCR studies of Eu versus Ec endometrium. In the endometrial cell lines HEC1A, HEC1B, Ishikawa and RL95-2, HMBS and HPRT1 were the most stably expressed. The IFN-specific PCR array indicated significantly different expression of the genes BST2, COL16A1, HOXB2 and ISG20 between the endometrial tissue types. However, by correctly normalized qRT-PCR, levels of BST2, COL16A1 and the highly type-I IFN-stimulated genes ISG12A and 6-16 displayed insignificant variations. Conversely, HOXB2 and ISG20 transcriptions were significantly reduced in endometriosis lesions compared with endometrium from endometriosis patients and healthy controls. In conclusion, appropriate HKGs for normalization of qRT-PCR studies of endometrium and endometriosis have been identified here. Abolished expression of ISG20 and HOX genes could be important in endometriosis.

The Chemical Chaperone, PBA, Reduces ER Stress and Autophagy and Increases Collagen IV α5 Expression in Cultured Fibroblasts From Men With X-Linked Alport Syndrome and Missense Mutations.

PubMed

Wang, Dongmao; Mohammad, Mardhiah; Wang, Yanyan; Tan, Rachel; Murray, Lydia S; Ricardo, Sharon; Dagher, Hayat; van Agtmael, Tom; Savige, Judy

2017-07-01

X-linked Alport syndrome (OMIM 301050) is caused by COL4A5 missense variants in 40% of families. This study examined the effects of chemical chaperone treatment (sodium 4-phenylbutyrate) on fibroblast cell lines derived from men with missense mutations. Dermal fibroblast cultures were established from 2 affected men and 3 normals. Proliferation rates were examined, the collagen IV α5 chain localized with immunostaining, and levels of the intra- and extracellular chains quantitated with an in-house enzyme-linked immunosorbent assay. COL4A5 mRNA was measured using quantitative reverse transcriptase polymerase chain reaction. Endoplasmic reticulum (ER) size was measured on electron micrographs and after HSP47 immunostaining. Markers of ER stress (ATF6, HSPA5, DDIT3), autophagy (ATG5, BECN1, ATG7), and apoptosis (CASP3, BAD, BCL 2 ) were also quantitated by quantitative reverse transcriptase polymerase chain reaction. Measurements were repeated after 48 hours of incubation with 10 mM sodium 4-phenylbutyrate acid. Both COL4A5 missense variants were associated with reduced proliferation rates on day 6 ( P  = 0.01 and P  = 0.03), ER enlargement, and increased mRNA for ER stress and autophagy (all P values < 0.05) when compared with normal. Sodium 4-phenylbutyrate treatment increased COL4A5 transcript levels ( P  < 0.01), and reduced ER size ( P  < 0.01 by EM and P  < 0.001 by immunostaining), ER stress (p HSPA5 and DDIT3, all P values < 0.01) and autophagy (ATG7, P  < 0.01). Extracellular collagen IV α5 chain was increased in the M1 line only ( P  = 0.06). Sodium 4-phenylbutyrate increases collagen IV α5 mRNA levels, reduces ER stress and autophagy, and possibly facilitates collagen IV α5 extracellular transport. Whether these actions delay end-stage renal failure in men with X-linked Alport syndrome and missense mutations will only be determined with clinical trials.

Overexpressing the Multiple-Stress Responsive Gene At1g74450 Reduces Plant Height and Male Fertility in Arabidopsis thaliana

PubMed Central

Visscher, Anne M.; Belfield, Eric J.; Vlad, Daniela; Irani, Niloufer; Moore, Ian; Harberd, Nicholas P.

2015-01-01

A subset of genes in Arabidopsis thaliana is known to be up-regulated in response to a wide range of different environmental stress factors. However, not all of these genes are characterized as yet with respect to their functions. In this study, we used transgenic knockout, overexpression and reporter gene approaches to try to elucidate the biological roles of five unknown multiple-stress responsive genes in Arabidopsis. The selected genes have the following locus identifiers: At1g18740, At1g74450, At4g27652, At4g29780 and At5g12010. Firstly, T-DNA insertion knockout lines were identified for each locus and screened for altered phenotypes. None of the lines were found to be visually different from wildtype Col-0. Secondly, 35S-driven overexpression lines were generated for each open reading frame. Analysis of these transgenic lines showed altered phenotypes for lines overexpressing the At1g74450 ORF. Plants overexpressing the multiple-stress responsive gene At1g74450 are stunted in height and have reduced male fertility. Alexander staining of anthers from flowers at developmental stage 12–13 showed either an absence or a reduction in viable pollen compared to wildtype Col-0 and At1g74450 knockout lines. Interestingly, the effects of stress on crop productivity are most severe at developmental stages such as male gametophyte development. However, the molecular factors and regulatory networks underlying environmental stress-induced male gametophytic alterations are still largely unknown. Our results indicate that the At1g74450 gene provides a potential link between multiple environmental stresses, plant height and pollen development. In addition, ruthenium red staining analysis showed that At1g74450 may affect the composition of the inner seed coat mucilage layer. Finally, C-terminal GFP fusion proteins for At1g74450 were shown to localise to the cytosol. PMID:26485022

Life sciences payload definition and integration study. Volume 1: Executive summary. [carry-on laboratory for Spacelab

NASA Technical Reports Server (NTRS)

1974-01-01

The definition and integration tasks involved in the development of design concepts for a carry-on laboratory (COL), to be compatible with Spacelab operations, were divided into the following study areas: (1) identification of research and equipment requirements of the COL; (2) development of a number of conceptual layouts for COL based on the defined research of final conceptual designs; and (4) development of COL planning information for definition of COL/Spacelab interface data, cost data, and program cost schedules, including design drawings of a selected COL to permit fabrication of a functional breadboard.

Evidence of recent interspecies horizontal gene transfer regarding nucleopolyhedrovirus infection of Spodoptera frugiperda.

PubMed

Barrera, Gloria Patricia; Belaich, Mariano Nicolás; Patarroyo, Manuel Alfonso; Villamizar, Laura Fernanda; Ghiringhelli, Pablo Daniel

2015-11-25

Baculoviruses are insect-associated viruses carrying large, circular double-stranded-DNA genomes with significant biotechnological applications such as biological pest control, recombinant protein production, gene delivery in mammals and as a model of DNA genome evolution. These pathogens infect insects from the orders Lepidoptera, Hymenoptera and Diptera, and have high species diversity which is expressed in their diverse biological properties including morphology, virulence or pathogenicity. Spodoptera frugiperda (Lepidoptera: Noctuidae), the fall armyworm, represents a significant pest for agriculture in America; it is a host for baculoviruses such as the Spodoptera frugiperda multiple nucleopolyhedrovirus (SfMNPV) (Colombia strain, genotype A) having been classified as a Group II alphabaculovirus making it a very attractive target for bioinsecticidal use. Genome analysis by pyrosequencing revealed that SfMNPV ColA has 145 ORFs, 2 of which were not present in the other sequenced genotypes of the virus (SfMNPV-NicB, SfMNPV-NicG, SfMNPV-19 and SfMNPV-3AP2). An in-depth bioinformatics study showed that ORF023 and ORF024 were acquired by a recent homologous recombination process between Spodoptera frugiperda and Spodoptera litura (the Oriental leafworm moth) nucleopolyhedroviruses. Auxiliary genes are numerous in the affected locus which has a homologous region (hr3), a repetitive sequence associated with genome replication which became lost in SfColA along with 1 ORF. Besides, the mRNAs associated with two acquired genes appeared in the virus' life-cycle during the larval stage. Predictive studies concerning the theoretical proteins identified that ORF023 protein would be a phosphatase involved in DNA repair and that the ORF024 protein would be a membrane polypeptide associated with cell transport. The SfColA genome was thus revealed to be a natural recombinant virus showing evidence of recent horizontal gene transfer between different baculovirus species occurring in nature. This feature could be the cause of its high insecticidal power and therefore SfColA becomes a great candidate for bioinsecticide formulations.

Variable Bone Fragility Associated With an Amish COL1A2 Variant and a Knock-in Mouse Model

PubMed Central

Daley, Ethan; Streeten, Elizabeth A; Sorkin, John D; Kuznetsova, Natalia; Shapses, Sue A; Carleton, Stephanie M; Shuldiner, Alan R; Marini, Joan C; Phillips, Charlotte L; Goldstein, Steven A; Leikin, Sergey; McBride, Daniel J

2010-01-01

Osteogenesis imperfecta (OI) is a heritable form of bone fragility typically associated with a dominant COL1A1 or COL1A2 mutation. Variable phenotype for OI patients with identical collagen mutations is well established, but phenotype variability is described using the qualitative Sillence classification. Patterning a new OI mouse model on a specific collagen mutation therefore has been hindered by the absence of an appropriate kindred with extensive quantitative phenotype data. We benefited from the large sibships of the Old Order Amish (OOA) to define a wide range of OI phenotypes in 64 individuals with the identical COL1A2 mutation. Stratification of carrier spine (L1–4) areal bone mineral density (aBMD) Z-scores demonstrated that 73% had moderate to severe disease (less than −2), 23% had mild disease (−1 to −2), and 4% were in the unaffected range (greater than −1). A line of knock-in mice was patterned on the OOA mutation. Bone phenotype was evaluated in four F1 lines of knock-in mice that each shared approximately 50% of their genetic background. Consistent with the human pedigree, these mice had reduced body mass, aBMD, and bone strength. Whole-bone fracture susceptibility was influenced by individual genomic factors that were reflected in size, shape, and possibly bone metabolic regulation. The results indicate that the G610C OI (Amish) knock-in mouse is a novel translational model to identify modifying genes that influence phenotype and for testing potential therapies for OI. © 2010 American Society for Bone and Mineral Research PMID:19594296

Isolation and characterization of two novel groups of Kanamycin-resistance ColE1-like plasmids in Salmonella enterica serotypes from food animals

USDA-ARS?s Scientific Manuscript database

While antimicrobial resistance in Salmonella enterica is largely attributed to large plasmids, small plasmids may also harbor antimicrobial resistance genes. Previously, three major groups of ColE1-like plasmids conferring kanamycin-resistance (KanR) in various S. enterica serotypes from diagnostic...

The expanding spectrum of COL2A1 gene variants IN 136 patients with a skeletal dysplasia phenotype

PubMed Central

Barat-Houari, Mouna; Dumont, Bruno; Fabre, Aurélie; Them, Frédéric TM; Alembik, Yves; Alessandri, Jean-Luc; Amiel, Jeanne; Audebert, Séverine; Baumann-Morel, Clarisse; Blanchet, Patricia; Bieth, Eric; Brechard, Marie; Busa, Tiffany; Calvas, Patrick; Capri, Yline; Cartault, François; Chassaing, Nicolas; Ciorca, Vidrica; Coubes, Christine; David, Albert; Delezoide, Anne-Lise; Dupin-Deguine, Delphine; El Chehadeh, Salima; Faivre, Laurence; Giuliano, Fabienne; Goldenberg, Alice; Isidor, Bertrand; Jacquemont, Marie-Line; Julia, Sophie; Kaplan, Josseline; Lacombe, Didier; Lebrun, Marine; Marlin, Sandrine; Martin-Coignard, Dominique; Martinovic, Jelena; Masurel, Alice; Melki, Judith; Mozelle-Nivoix, Monique; Nguyen, Karine; Odent, Sylvie; Philip, Nicole; Pinson, Lucile; Plessis, Ghislaine; Quélin, Chloé; Shaeffer, Elise; Sigaudy, Sabine; Thauvin, Christel; Till, Marianne; Touraine, Renaud; Vigneron, Jacqueline; Baujat, Geneviève; Cormier-Daire, Valérie; Le Merrer, Martine; Geneviève, David; Touitou, Isabelle

2016-01-01

Heterozygous COL2A1 variants cause a wide spectrum of skeletal dysplasia termed type II collagenopathies. We assessed the impact of this gene in our French series. A decision tree was applied to select 136 probands (71 Stickler cases, 21 Spondyloepiphyseal dysplasia congenita cases, 11 Kniest dysplasia cases, and 34 other dysplasia cases) before molecular diagnosis by Sanger sequencing. We identified 66 different variants among the 71 positive patients. Among those patients, 18 belonged to multiplex families and 53 were sporadic. Most variants (38/44, 86%) were located in the triple helical domain of the collagen chain and glycine substitutions were mainly observed in severe phenotypes, whereas arginine to cysteine changes were more often encountered in moderate phenotypes. This series of skeletal dysplasia is one of the largest reported so far, adding 44 novel variants (15%) to published data. We have confirmed that about half of our Stickler patients (46%) carried a COL2A1 variant, and that the molecular spectrum was different across the phenotypes. To further address the question of genotype–phenotype correlation, we plan to screen our patients for other candidate genes using a targeted next-generation sequencing approach. PMID:26626311

The expanding spectrum of COL2A1 gene variants IN 136 patients with a skeletal dysplasia phenotype.

PubMed

Barat-Houari, Mouna; Dumont, Bruno; Fabre, Aurélie; Them, Frédéric Tm; Alembik, Yves; Alessandri, Jean-Luc; Amiel, Jeanne; Audebert, Séverine; Baumann-Morel, Clarisse; Blanchet, Patricia; Bieth, Eric; Brechard, Marie; Busa, Tiffany; Calvas, Patrick; Capri, Yline; Cartault, François; Chassaing, Nicolas; Ciorca, Vidrica; Coubes, Christine; David, Albert; Delezoide, Anne-Lise; Dupin-Deguine, Delphine; El Chehadeh, Salima; Faivre, Laurence; Giuliano, Fabienne; Goldenberg, Alice; Isidor, Bertrand; Jacquemont, Marie-Line; Julia, Sophie; Kaplan, Josseline; Lacombe, Didier; Lebrun, Marine; Marlin, Sandrine; Martin-Coignard, Dominique; Martinovic, Jelena; Masurel, Alice; Melki, Judith; Mozelle-Nivoix, Monique; Nguyen, Karine; Odent, Sylvie; Philip, Nicole; Pinson, Lucile; Plessis, Ghislaine; Quélin, Chloé; Shaeffer, Elise; Sigaudy, Sabine; Thauvin, Christel; Till, Marianne; Touraine, Renaud; Vigneron, Jacqueline; Baujat, Geneviève; Cormier-Daire, Valérie; Le Merrer, Martine; Geneviève, David; Touitou, Isabelle

2016-07-01

Heterozygous COL2A1 variants cause a wide spectrum of skeletal dysplasia termed type II collagenopathies. We assessed the impact of this gene in our French series. A decision tree was applied to select 136 probands (71 Stickler cases, 21 Spondyloepiphyseal dysplasia congenita cases, 11 Kniest dysplasia cases, and 34 other dysplasia cases) before molecular diagnosis by Sanger sequencing. We identified 66 different variants among the 71 positive patients. Among those patients, 18 belonged to multiplex families and 53 were sporadic. Most variants (38/44, 86%) were located in the triple helical domain of the collagen chain and glycine substitutions were mainly observed in severe phenotypes, whereas arginine to cysteine changes were more often encountered in moderate phenotypes. This series of skeletal dysplasia is one of the largest reported so far, adding 44 novel variants (15%) to published data. We have confirmed that about half of our Stickler patients (46%) carried a COL2A1 variant, and that the molecular spectrum was different across the phenotypes. To further address the question of genotype-phenotype correlation, we plan to screen our patients for other candidate genes using a targeted next-generation sequencing approach.

Support of positive association in family-based genetic analysis between COL27A1 and Tourette syndrome

PubMed Central

Liu, Shiguo; Yu, Xiaoxia; Xu, Quanchen; Cui, Jiajia; Yi, Mingji; Zhang, Xinhua; Ge, Yinlin; Ma, Xu

2015-01-01

Recently, a genome-wide association study has indicated associations between single nucleotide polymorphisms in the Collagen Type XXVII Alpha 1 gene (COL27A1) and Tourette syndrome in several ethnic populations. To clarify the global relevance of the previously identified SNPs in the development of Tourette syndrome, the associations between polymorphisms in COL27A1and Tourette syndrome were assessed in Chinese trios. PCR-directed sequencing was used to evaluate the genetic contributions of three SNPs in COL27A1(rs4979356, rs4979357 and rs7868992) using haplotype relative risk (HRR) and transmission disequilibrium tests (TDT) with a total of 260 Tourette syndrome trios. The family-based association was significant between Tourette syndrome and rs4979356 (TDT: χ2 = 4.804, P = 0.033; HRR = 1.75, P = 0.002; HHRR = 1.32, P = 0.027), and transmission disequilibrium was suspected for rs4979357 (TDT: χ2 = 3.969, P = 0.053; HRR = 1.84, P = 0.001; HHRR = 1.29, P = 0.044). No statistically significant allele transfer was found for rs7868992 (TDT: χ2 = 2.177, P = 0.158). Although the TDT results did not remain significant after applying the conservative Bonferroni correction (p = 0.005), the significant positive HRR analysis confirmed the possibility of showing transmission disequilibrium, which provides evidence for an involvement of COL27A1in the development of TS. However, these results need to be verified with larger datasets from different populations. PMID:26235311

Collagen-alginate as bioink for three-dimensional (3D) cell printing based cartilage tissue engineering.

PubMed

Yang, Xingchen; Lu, Zhenhui; Wu, Huayu; Li, Wei; Zheng, Li; Zhao, Jinmin

2018-02-01

Articular cartilage repair is still a huge challenge for researchers and clinicians. 3D bioprinting could be an innovative technology for cartilage tissue engineering. In this study, we used collagen type I (COL) or agarose (AG) mixed with sodium alginate (SA) to serve as 3D bioprinting bioinks and incorporated chondrocytes to construct in vitro 3D printed cartilage tissue. Swelling ratio, mechanical properties, scanning electron microscopy (SEM), cell viability and cytoskeleton, biochemistry analysis and quantitative real-time polymerase chain reaction (qRT-PCR) were performed to investigate the function of different bioinks in 3D printing cartilage tissue engineering applications. The results showed that the mechanical strength was improved in both SA/COL and SA/AG groups compared to SA alone. Besides, the addition of COL or AG has little impact on gelling behavior, demonstrating the advantage as bioinks for 3D printing. Among the three scaffolds, SA/COL could distinctly facilitated cell adhesion, accelerated cell proliferation and enhanced the expression of cartilage specific genes such as Acan, Col2al and Sox9 than the other two groups. Lower expression of Col1a1, the fibrocartilage marker, was present in SA/COL group than that in both of SA and SA/AG groups. The results indicated that SA/COL effectively suppressed dedifferentiation of chondrocytes and preserved the phenotype. In summary, 3D bioprinted SA/COL with favorable mechanical strength and biological functionality is promising in cartilage tissue engineering. Copyright © 2017. Published by Elsevier B.V.

Genome-wide approach identifies a novel gene-maternal pre-pregnancy BMI interaction on preterm birth

PubMed Central

Hong, Xiumei; Hao, Ke; Ji, Hongkai; Peng, Shouneng; Sherwood, Ben; Di Narzo, Antonio; Tsai, Hui-Ju; Liu, Xin; Burd, Irina; Wang, Guoying; Ji, Yuelong; Caruso, Deanna; Mao, Guangyun; Bartell, Tami R.; Zhang, Zhongyang; Pearson, Colleen; Heffner, Linda; Cerda, Sandra; Beaty, Terri H.; Fallin, M. Daniele; Lee-Parritz, Aviva; Zuckerman, Barry; Weeks, Daniel E.; Wang, Xiaobin

2017-01-01

Preterm birth (PTB) contributes significantly to infant mortality and morbidity with lifelong impact. Few robust genetic factors of PTB have been identified. Such ‘missing heritability' may be partly due to gene × environment interactions (G × E), which is largely unexplored. Here we conduct genome-wide G × E analyses of PTB in 1,733 African-American women (698 mothers of PTB; 1,035 of term birth) from the Boston Birth Cohort. We show that maternal COL24A1 variants have a significant genome-wide interaction with maternal pre-pregnancy overweight/obesity on PTB risk, with rs11161721 (PG × E=1.8 × 10−8; empirical PG × E=1.2 × 10−8) as the top hit. This interaction is replicated in African-American mothers (PG × E=0.01) from an independent cohort and in meta-analysis (PG × E=3.6 × 10−9), but is not replicated in Caucasians. In adipose tissue, rs11161721 is significantly associated with altered COL24A1 expression. Our findings may provide new insight into the aetiology of PTB and improve our ability to predict and prevent PTB. PMID:28598419

The role of miR-370 in fibrosis after myocardial infarction

PubMed Central

Yuan, Hui; Gao, Jie

2017-01-01

In the present study, we investigated the expression of miR-370 in the border area of infarction after myocardial infarction and its role in the process of post-infarction fibrosis. A myocardial infarction model in Sprague-Dawley rats was established. After two weeks, the mRNA levels of transforming growth factor-β1 (TGFβ1), TGFβRII, ColIa1, ColIIIa1 and miR-370 and the expression of TGFβ1, TGFβRII and α-smooth muscle actin (α-SMA) proteins in the border area of infarction were detected by real-time fluorescence quantitative polymerase chain reaction (qRT-PCR) and western blot analysis. Cardiac fibroblasts in neonatal rat were isolated and cultured, and the changes in the above indicators were detected after AngII and miR-370 intervention. Luciferase reporter gene assay was conducted to verify whether TGFβRII was a target gene of miR-370. In the border area after myocardial infarction, the expression of miR-370 decreased, while mRNA levels of TGFβ1, TGFβRII, ColIa1 and ColIIIa1 and levels of TGFβ1, TGFβRII and α-SMA proteins were all increased. Luciferase reporter gene assay confirmed that TGFβRII was the target gene of miR-370. miR-370 reduced the expression of TGFβRII and inhibited the increased expression of TGFβRII and collagen protein caused by AngII. As well, its inhibited the differentiation effect of muscle fibroblasts while it did not inhibit the expression of TGFβ1. miR-370 inhibited the expression of TGFβRII protein by combining with TGFβRII mRNA. miR-370 also partially blocked TGFβ1-TGFβRII and induced the downstream signal transduction pathways, thus exerting anti-fibrotic effects. PMID:28350072

Genetic variants in COL13A1, ADIPOQ and SAMM50, in addition to the PNPLA3 gene, confer susceptibility to elevated transaminase levels in an admixed Mexican population.

PubMed

Larrieta-Carrasco, Elena; Flores, Yvonne N; Macías-Kauffer, Luis R; Ramírez-Palacios, Paula; Quiterio, Manuel; Ramírez-Salazar, Eric G; León-Mimila, Paola; Rivera-Paredez, Berenice; Cabrera-Álvarez, Guillermo; Canizales-Quinteros, Samuel; Zhang, Zuo-Feng; López-Pérez, Tania V; Salmerón, Jorge; Velázquez-Cruz, Rafael

2018-02-01

Non-alcoholic fatty liver disease (NAFLD) is the accumulation of extra fat in liver cells not caused by alcohol. Elevated transaminase levels are common indicators of liver disease, including NAFLD. Previously, we demonstrated that PNPLA3 (rs738409), LYPLAL1 (rs12137855), PPP1R3B (rs4240624), and GCKR (rs780094) are associated with elevated transaminase levels in overweight/obese Mexican adults. We investigated the association between 288 SNPs identified in genome-wide association studies and risk of elevated transaminase levels in an admixed Mexican-Mestizo sample of 178 cases of NAFLD and 454 healthy controls. The rs2896019, rs12483959, and rs3810622 SNPs in PNPLA3 and rs1227756 in COL13A1 were associated with elevated alanine aminotransferase (ALT, ≥40IU/L). A polygenic risk score (PRS) based on six SNPs in the ADIPOQ, COL13A1, PNPLA3, and SAMM50 genes was also associated with elevated ALT. Individuals carrying 9-12 risk alleles had 65.8% and 48.5% higher ALT and aspartate aminotransferase (AST) levels, respectively, than those with 1-4 risk alleles. The PRS showed the greatest risk of elevated ALT levels, with a higher level of significance than the individual variants. Our findings suggest a significant association between variants in COL13A1, ADIPOQ, SAMM50, and PNPLA3, and risk of NAFLD/elevated transaminase levels in Mexican adults with an admixed ancestry. This is the first study to examine high-density single nucleotide screening for genetic variations in a Mexican-Mestizo population. The extent of the effect of these variations on the development and progression of NAFLD in Latino populations requires further analysis. Copyright © 2018 Elsevier Inc. All rights reserved.

An elt-3/elt-5/elt-6 GATA Transcription Circuit Guides Aging in C. elegans

PubMed Central

Budovskaya, Yelena V.; Wu, Kendall; Southworth, Lucinda K.; Jiang, Min; Tedesco, Patricia; Johnson, Thomas E.; Kim, Stuart K.

2016-01-01

SUMMARY To define the C. elegans aging process at the molecular level, we used DNA microarray experiments to identify a set of 1294 age-regulated genes and found that the GATA transcription factors ELT-3, ELT-5, and ELT-6 are responsible for age regulation of a large fraction of these genes. Expression of elt-5 and elt-6 increases during normal aging, and both of these GATA factors repress expression of elt-3, which shows a corresponding decrease in expression in old worms. elt-3 regulates a large number of downstream genes that change expression in old age, including ugt-9, col-144, and sod-3. elt-5(RNAi) and elt-6(RNAi) worms have extended longevity, indicating that elt-3, elt-5, and elt-6 play an important functional role in the aging process. These results identify a transcriptional circuit that guides the rapid aging process in C. elegans and indicate that this circuit is driven by drift of developmental pathways rather than accumulation of damage. PMID:18662544

Nrf2 and Snail-1 in the prevention of experimental liver fibrosis by caffeine

PubMed Central

Gordillo-Bastidas, Daniela; Oceguera-Contreras, Edén; Salazar-Montes, Adriana; González-Cuevas, Jaime; Hernández-Ortega, Luis Daniel; Armendáriz-Borunda, Juan

2013-01-01

AIM: To determine the molecular mechanisms involved in experimental hepatic fibrosis prevention by caffeine (CFA). METHODS: Liver fibrosis was induced in Wistar rats by intraperitoneal thioacetamide or bile duct ligation and they were concomitantly treated with CFA (15 mg/kg per day). Fibrosis and inflammatory cell infiltrate were evaluated and classified by Knodell index. Inflammatory infiltrate was quantified by immunohistochemistry (anti-CD11b). Gene expression was analyzed by quantitative reverse transcription-polymerase chain reaction for collagen I (Col-1), connective tissue growth factor (CTGF), transforming growth factor β1 (TGF-β1), tumor necrosis factor alpha (TNF-α), interleukin-1 (IL-1), IL-6, superoxide dismutase (SOD) and catalase (CAT). Activation of Nrf2 and Snail-1 was analyzed by Western-blot. TNF-α expression was proved by enzyme-linked immunosorbant assay, CAT activity was performed by zymography. RESULTS: CFA treatment diminished fibrosis index in treated animals. The Knodell index showed both lower fibrosis and necroinflammation. Expression of profibrogenic genes CTGF, Col-1 and TGF-β1 and proinflammatory genes TNF-α, IL-6 and IL-1 was substantially diminished with CFA treatment with less CD11b positive areas. Significantly lower values of transcriptional factor Snail-1 were detected in CFA treated rats compared with cirrhotic rats without treatment; in contrast Nrf2 was increased in the presence of CFA. Expression of SOD and CAT was greater in animals treated with CFA showing a strong correlation between mRNA expression and enzyme activity. CONCLUSION: Our results suggest that CFA inhibits the transcriptional factor Snail-1, down-regulating profibrogenic genes, and activates Nrf2 inducing antioxidant enzymes system, preventing inflammation and fibrosis. PMID:24379627

A novel p. Gly630Ser mutation of COL2A1 in a Chinese family with presentations of Legg-Calvé-Perthes disease or avascular necrosis of the femoral head.

PubMed

Li, Na; Yu, Jian; Cao, Xiang; Wu, Qiu-Yue; Li, Wei-Wei; Li, Tian-Fu; Zhang, Cui; Cui, Ying-Xia; Li, Xiao-Jun; Yin, Zhi-Min; Xia, Xin-Yi

2014-01-01

Mutations in the type II collagen gene are associated with certain human disorders, collectively termed type II collagenopathies. They include Legg-Calvé-Perthes disease (LCPD) and avascular necrosis of the femoral head (ANFH). These two diseases are skeletal dysplasias, inherited in an autosomal dominant fashion, characterized by groin pain, dislocation of the hip and diminished joint mobility. Coxa vara and elevation of the greater trochanter of the femur comprise the typical phenotype of LCPD, but do not occur in ANFH. Lack of synthesis of type II collagen and structural defects are responsible for the major clinical outcomes, because collagen is the essential matrix protein of all connective tissues. Type II collagen, encoded by the COL2A1 gene, contains N- and C- terminal regions that are cleaved after secretion into the extracellular matrix, and the core area is composed of a triple helical (Gly-X-Y) domain. If the Gly in this specific region is replaced by other amino acids, the structure of type II collagen will be destroyed. Forty-five members of a four-generation family were recruited and investigated. Diagnosis was made by independent orthopedic surgeons and radiologists. A mutation of the COL2A1 gene was detected. In our research, we identify a heterozygous mutation (c.1888 G>A, p. Gly630Ser) in exon 29 of COL2A1 in the Gly-X-Y domain, in a Chinese family affected by LCPD and ANFH. Our findings provide significant clues to the phenotype-genotype relationships in these syndromes and may be helpful in clinical diagnosis. Furthermore, these results should assist further studies of the mechanisms underlying collagen diseases. Our data add new variants to the repertoire of COL2A1 mutation resulting in related collagenopathies.

Rare variants in axonogenesis genes connect three families with sound-color synesthesia.

PubMed

Tilot, Amanda K; Kucera, Katerina S; Vino, Arianna; Asher, Julian E; Baron-Cohen, Simon; Fisher, Simon E

2018-03-20

Synesthesia is a rare nonpathological phenomenon where stimulation of one sense automatically provokes a secondary perception in another. Hypothesized to result from differences in cortical wiring during development, synesthetes show atypical structural and functional neural connectivity, but the underlying molecular mechanisms are unknown. The trait also appears to be more common among people with autism spectrum disorder and savant abilities. Previous linkage studies searching for shared loci of large effect size across multiple families have had limited success. To address the critical lack of candidate genes, we applied whole-exome sequencing to three families with sound-color (auditory-visual) synesthesia affecting multiple relatives across three or more generations. We identified rare genetic variants that fully cosegregate with synesthesia in each family, uncovering 37 genes of interest. Consistent with reports indicating genetic heterogeneity, no variants were shared across families. Gene ontology analyses highlighted six genes- COL4A1 , ITGA2 , MYO10 , ROBO3 , SLC9A6 , and SLIT2 -associated with axonogenesis and expressed during early childhood when synesthetic associations are formed. These results are consistent with neuroimaging-based hypotheses about the role of hyperconnectivity in the etiology of synesthesia and offer a potential entry point into the neurobiology that organizes our sensory experiences. Copyright © 2018 the Author(s). Published by PNAS.

A Carbon Dioxide Limitation-Inducible Protein, ColA, Supports the Growth of Synechococcus sp. PCC 7002

PubMed Central

Shimakawa, Ginga; Watanabe, Satoru; Miyake, Chikahiro

2017-01-01

A limitation in carbon dioxide (CO2), which occurs as a result of natural environmental variation, suppresses photosynthesis and has the potential to cause photo-oxidative damage to photosynthetic cells. Oxygenic phototrophs have strategies to alleviate photo-oxidative damage to allow life in present atmospheric CO2 conditions. However, the mechanisms for CO2 limitation acclimation are diverse among the various oxygenic phototrophs, and many mechanisms remain to be discovered. In this study, we found that the gene encoding a CO2 limitation-inducible protein, ColA, is required for the cyanobacterium Synechococcus sp. PCC 7002 (S. 7002) to acclimate to limited CO2 conditions. An S. 7002 mutant deficient in ColA (ΔcolA) showed lower chlorophyll content, based on the amount of nitrogen, than that in S. 7002 wild-type (WT) under ambient air but not high CO2 conditions. Both thermoluminescence and protein carbonylation detected in the ambient air grown cells indicated that the lack of ColA promotes oxidative stress in S. 7002. Alterations in the photosynthetic O2 evolution rate and relative electron transport rate in the short-term response, within an hour, to CO2 limitation were the same between the WT and ΔcolA. Conversely, these photosynthetic parameters were mostly lower in the long-term response of a few days in ΔcolA than in the WT. These data suggest that ColA is required to sustain photosynthetic activity for living under ambient air in S. 7002. The unique phylogeny of ColA revealed diverse strategies to acclimate to CO2 limitation among cyanobacteria. PMID:29244744

Enamel Matrix Derivative Promote Primary Human Pulp Cell Differentiation and Mineralization

PubMed Central

Riksen, Elisabeth Aurstad; Landin, Maria A.; Reppe, Sjur; Nakamura, Yukio; Lyngstadaas, Ståle Petter; Reseland, Janne E.

2014-01-01

Enamel matrix derivative (EMD) has been found to induce reactive dentin formation; however the molecular mechanisms involved are unclear. The effect of EMD (5–50 μg/mL) on primary human pulp cells were compared to untreated cells and cells incubated with 10−8 M dexamethasone (DEX) for 1, 2, 3, 7, and 14 days in culture. Expression analysis using Affymetrix microchips demonstrated that 10 μg/mL EMD regulated several hundred genes and stimulated the gene expression of proteins involved in mesenchymal proliferation and differentiation. Both EMD and DEX enhanced the expression of amelogenin (amel), and the dentinogenic markers dentin sialophosphoprotein (DSSP) and dentin matrix acidic phosphoprotein 1 (DMP1), as well as the osteogenic markers osteocalcin (OC, BGLAP) and collagen type 1 (COL1A1). Whereas, only EMD had effect on alkaline phosphatase (ALP) mRNA expression, the stimulatory effect were verified by enhanced secretion of OC and COL1A from EMD treated cells, and increased ALP activity in cell culture medium after EMD treatment. Increased levels of interleukin-6 (IL-6), interleukin-8 (IL-8), and monocyte chemoattractant proteins (MCP-1) in the cell culture medium were also found. Consequently, the suggested effect of EMD is to promote differentiation of pulp cells and increases the potential for pulpal mineralization to favor reactive dentine formation. PMID:24857913

Linkage of the gene that encodes the alpha 1 chain of type V collagen (COL5A1) to type II Ehlers-Danlos syndrome (EDS II).

PubMed

Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B

1995-09-01

Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.

Functional FRIGIDA allele enhances drought tolerance by regulating the P5CS1 pathway in Arabidopsis thaliana.

PubMed

Chen, Qian; Zheng, Yan; Luo, Landi; Yang, Yongping; Hu, Xiangyang; Kong, Xiangxiang

2018-01-01

Flowering at the right time is important for the reproductive success of plants and their response to environmental stress. In Arabidopsis, a major determinant of natural variation in flowering time is FRIGIDA (FRI). In the present study, we show that overexpression of the functional FRIGIDA gene in wild-type Col background (ColFRI) positively enhances the drought tolerance by activating P5CS1 expression and promoting proline accumulation during water stress. Furthermore, no significant changes in FRI gene and protein expression levels were observed with drought treatment, whereas P5CS1 protein expression significantly increased. In contrast, vernalization treatment efficiently reduced P5CS1 expression levels and resulted in a decrease in drought tolerance in the ColFRI plants. The flc mutants with a functional FRI background also relieved FRI-mediated activation of P5CS1 during drought tolerance. Taken together, our findings reveal the novel function of FRI in enhancing drought resistance through its downstream P5CS1 pathway during water-deficit stress, which is dependent on its target, the FLC gene. Copyright © 2017 Elsevier Inc. All rights reserved.

Major antigenic determinants of F and ColB2 pili.

PubMed Central

Finlay, B B; Frost, L S; Paranchych, W; Parker, J M; Hodges, R S

1985-01-01

F-like conjugative pili are expressed by plasmids with closely related transfer systems. They are tubular filaments that are composed of repeating pilin subunits arranged in a helical array. Both F and ColB2 pilin have nearly identical protein sequences, and both contain an acetylated amino-terminal alanine residue. However, they differ by a few amino acid residues at their amino termini. Rabbit antisera raised against purified F and ColB2 pili are immunologically cross-reactive by only 25%, as measured by a competition enzyme-linked immunosorbent assay (ELISA). A tryptic peptide corresponding to the first 15 amino acid residues of ColB2 pilin was isolated and found to remove nearly 80% of ColB2 pilus-directed rabbit antibodies. The corresponding tryptic peptide from F pilin, which reacted with anti-F pilus antibodies to remove 80%, was less than 20% reactive with anti-ColB2 pilus antiserum. Cleavage of these peptides with cyanogen bromide (at a methionine residue approximately in the middle of the peptide) did not affect the antigenicity of these peptides. Synthetic N alpha-acetylated peptides corresponding to the first eight amino acids of F pilin (Ac-Ala-Gly-Ser-Ser-Gly-Gln-Asp-Leu-COOH) and the first six amino acids of ColB2 pilin (Ac-Ala-Gln-Gly-Gln-Asp-Leu-COOH) were prepared and tested by competition ELISA with homologous and heterologous anti-pilus antisera. The F peptide F(1-8) inhibited the interaction of F pili and anti-F pilus antiserum to 80%, while the ColB2 peptide ColB2(1-6) inhibited anti-ColB2 pilus antiserum reacting with ColB2 pili by greater than 60%. The two peptides F(1-8) and ColB2(1-6) were inactive by competition ELISAs with heterologous antisera. These results suggest that the major antigenic determinant of both F and ColB2 pili is at the amino terminus of the pilin subunit and that 80% of antibodies raised against these pili are specific for this region of the pilin molecule. PMID:2409073

HANAC Syndrome Col4a1 Mutation Causes Neonate Glomerular Hyperpermeability and Adult Glomerulocystic Kidney Disease

PubMed Central

Chen, Zhiyong; Migeon, Tiffany; Verpont, Marie-Christine; Zaidan, Mohamad; Sado, Yoshikazu; Kerjaschki, Dontscho; Ronco, Pierre

2016-01-01

Hereditary angiopathy, nephropathy, aneurysms, and muscle cramps (HANAC) syndrome is an autosomal dominant syndrome caused by mutations in COL4A1 that encodes the α1 chain of collagen IV, a major component of basement membranes. Patients present with cerebral small vessel disease, retinal tortuosity, muscle cramps, and kidney disease consisting of multiple renal cysts, chronic kidney failure, and sometimes hematuria. Mutations producing HANAC syndrome localize within the integrin binding site containing CB3[IV] fragment of the COL4A1 protein. To investigate the pathophysiology of HANAC syndrome, we generated mice harboring the Col4a1 p.Gly498Val mutation identified in a family with the syndrome. Col4a1 G498V mutation resulted in delayed glomerulogenesis and podocyte differentiation without reduction of nephron number, causing albuminuria and hematuria in newborns. The glomerular defects resolved within the first month, but glomerular cysts developed in 3-month-old mutant mice. Abnormal structure of Bowman’s capsule was associated with metalloproteinase induction and activation of the glomerular parietal epithelial cells that abnormally expressed CD44, α-SMA, ILK, and DDR1. Inflammatory infiltrates were observed around glomeruli and arterioles. Homozygous Col4a1 G498V mutant mice additionally showed dysmorphic papillae and urinary concentration defects. These results reveal a developmental role for the α1α1α2 collagen IV molecule in the embryonic glomerular basement membrane, affecting podocyte differentiation. The observed association between molecular alteration of the collagenous network in Bowman’s capsule of the mature kidney and activation of parietal epithelial cells, matrix remodeling, and inflammation may account for glomerular cyst development and CKD in patients with COL4A1-related disorders. PMID:26260163

HANAC Syndrome Col4a1 Mutation Causes Neonate Glomerular Hyperpermeability and Adult Glomerulocystic Kidney Disease.

PubMed

Chen, Zhiyong; Migeon, Tiffany; Verpont, Marie-Christine; Zaidan, Mohamad; Sado, Yoshikazu; Kerjaschki, Dontscho; Ronco, Pierre; Plaisier, Emmanuelle

2016-04-01

Hereditary angiopathy, nephropathy, aneurysms, and muscle cramps (HANAC) syndrome is an autosomal dominant syndrome caused by mutations in COL4A1 that encodes the α1 chain of collagen IV, a major component of basement membranes. Patients present with cerebral small vessel disease, retinal tortuosity, muscle cramps, and kidney disease consisting of multiple renal cysts, chronic kidney failure, and sometimes hematuria. Mutations producing HANAC syndrome localize within the integrin binding site containing CB3[IV] fragment of the COL4A1 protein. To investigate the pathophysiology of HANAC syndrome, we generated mice harboring the Col4a1 p.Gly498Val mutation identified in a family with the syndrome. Col4a1 G498V mutation resulted in delayed glomerulogenesis and podocyte differentiation without reduction of nephron number, causing albuminuria and hematuria in newborns. The glomerular defects resolved within the first month, but glomerular cysts developed in 3-month-old mutant mice. Abnormal structure of Bowman's capsule was associated with metalloproteinase induction and activation of the glomerular parietal epithelial cells that abnormally expressed CD44,α-SMA, ILK, and DDR1. Inflammatory infiltrates were observed around glomeruli and arterioles. Homozygous Col4a1 G498V mutant mice additionally showed dysmorphic papillae and urinary concentration defects. These results reveal a developmental role for the α1α1α2 collagen IV molecule in the embryonic glomerular basement membrane, affecting podocyte differentiation. The observed association between molecular alteration of the collagenous network in Bowman's capsule of the mature kidney and activation of parietal epithelial cells, matrix remodeling, and inflammation may account for glomerular cyst development and CKD in patients with COL4A1-related disorders. Copyright © 2016 by the American Society of Nephrology.

TCF and Groucho-related genes influence pituitary growth and development.

PubMed

Brinkmeier, Michelle L; Potok, Mary Anne; Cha, Kelly B; Gridley, Thomas; Stifani, Stefano; Meeldijk, Jan; Clevers, Hans; Camper, Sally A

2003-11-01

Mutations in the prophet of PIT1 gene (PROP1) are the most common cause of multiple pituitary hormone deficiency in humans; however, the mechanism of PROP1 action is not well understood. We report that Prop1 is essential for dorsally restricted expression of a Groucho-related gene, transducin-like enhancer of split 3 (Tle3), which encodes a transcriptional corepressor. Deficiency of a related gene, amino terminal enhancer of split (Aes), causes pituitary anomalies and growth insufficiency. TLE3 and AES have been shown to interact with TCF/LEF (transcripiton factors of the T cell-specific and lymphoid enhancer specific group) family members in cell culture systems. In the absence of TCF4 (Tcf7L2), Prop1 levels are elevated, pituitary hyperplasia ensues and palate closure is abnormal. Thus, we demonstrate that Tcf4 and Aes influence pituitary growth and development, and place Tcf4 and Tle3 in the genetic hierarchy with Prop1.

Allele-specific siRNA knockdown as a personalized treatment strategy for vascular Ehlers-Danlos syndrome in human fibroblasts.

PubMed

Müller, Gerd A; Hansen, Uwe; Xu, Zhi; Griswold, Benjamin; Talan, Mark I; McDonnell, Nazli B; Briest, Wilfried

2012-02-01

The vascular type of the Ehlers-Danlos syndrome (vEDS) is caused by dominant-negative mutations in the procollagen type III (COL3A1) gene. Patients with this autosomal dominant disorder have a shortened life expectancy due to complications from ruptured vessels or hollow organs. We tested the effectiveness of allele-specific RNA interference (RNAi) to reduce the mutated phenotype in fibroblasts. Small-interfering RNAs (siRNAs) discriminating between wild-type and mutant COL3A1 allele were identified by a luciferase reporter gene assay and in primary fibroblasts from a normal donor and a patient with vEDS. The best discriminative siRNA with the mutation at position 10 resulted in >90% silencing of the mutant allele without affecting the wild-type allele. Transmission and immunogold electron microscopy of extracted extracellular matrices from untreated fibroblasts of the patient with vEDS revealed structurally abnormal fibrils. After siRNA treatment, collagen fibrils became similar to fibrils from fibroblasts of normal and COL3A1 haploinsufficient donors. In addition, it was shown that expression of mutated COL3A1 activates the unfolded protein response and that reduction of the amount of mutated protein by siRNA reduces cellular stress. Taken together, the results provide evidence that allele-specific siRNAs are able to reduce negative effects of mutated COL3A1 proteins. Thus, the application of allele-specific RNAi may be a promising direction for future personalized therapies to reduce the severity of vEDS.

Snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs as a model for swine infectious disease research.

PubMed

Huang, Yanyun; Haines, Deborah M; Harding, John C S

2013-04-01

The current study tested the benefit of commercially available spray-dried bovine colostrum (The Saskatoon Colostrum Company, Saskatoon, Saskatchewan) in raising snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs. In experiment 1, 12 SF-pCD pigs received a liquid diet composed mainly of bovine colostrum from birth to day 10; 6 remained on the same liquid diet (COL), and the other 6 were fed a diet composed mainly of milk replacer (RPL) until weaning. In experiment 2, 12 SF-pCD pigs were fed mainly bovine colostrum before weaning; after weaning, 6 were fed a starter diet containing 20% (w/w) bovine colostrum powder (STARTER-COL), and the other 6 were fed a starter diet without any bovine colostrum (STARTER-CTRL) until termination (day 42 or day 49). In experiment 1 the COL pigs had significantly fewer fever-days than did the RPL pigs. In experiment 2 diarrhea, typhlocolitis, and pancreatic degeneration developed in 4 of the STARTER-COL pigs after weaning. In both experiments all the pigs fed mainly bovine colostrum before weaning survived until termination. All pigs tested free of swine influenza virus H1N1 and H3N2, Porcine reproductive and respiratory syndrome virus, and Porcine parvovirus. In experiment 2 all the pigs tested free of Porcine circovirus type 2 (PCV2), but some in both groups tested positive for Torque teno virus genogroups 1 and 2. In conclusion, with the use of snatch-farrowing and bovine colostrum, pigs can be raised in the absence of porcine maternal antibodies with 100% survival and freedom from most porcine pathogens of biologic relevance. This model is potentially suitable for animal disease research.

Snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs as a model for swine infectious disease research

PubMed Central

Huang, Yanyun; Haines, Deborah M.; Harding, John C.S.

2013-01-01

The current study tested the benefit of commercially available spray-dried bovine colostrum (The Saskatoon Colostrum Company, Saskatoon, Saskatchewan) in raising snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs. In experiment 1, 12 SF-pCD pigs received a liquid diet composed mainly of bovine colostrum from birth to day 10; 6 remained on the same liquid diet (COL), and the other 6 were fed a diet composed mainly of milk replacer (RPL) until weaning. In experiment 2, 12 SF-pCD pigs were fed mainly bovine colostrum before weaning; after weaning, 6 were fed a starter diet containing 20% (w/w) bovine colostrum powder (STARTER-COL), and the other 6 were fed a starter diet without any bovine colostrum (STARTER-CTRL) until termination (day 42 or day 49). In experiment 1 the COL pigs had significantly fewer fever-days than did the RPL pigs. In experiment 2 diarrhea, typhlocolitis, and pancreatic degeneration developed in 4 of the STARTER-COL pigs after weaning. In both experiments all the pigs fed mainly bovine colostrum before weaning survived until termination. All pigs tested free of swine influenza virus H1N1 and H3N2, Porcine reproductive and respiratory syndrome virus, and Porcine parvovirus. In experiment 2 all the pigs tested free of Porcine circovirus type 2 (PCV2), but some in both groups tested positive for Torque teno virus genogroups 1 and 2. In conclusion, with the use of snatch-farrowing and bovine colostrum, pigs can be raised in the absence of porcine maternal antibodies with 100% survival and freedom from most porcine pathogens of biologic relevance. This model is potentially suitable for animal disease research. PMID:24082397

Horizontal Gene Transfer of a ColV Plasmid Has Resulted in a Dominant Avian Clonal Type of Salmonella enterica Serovar Kentucky

PubMed Central

Johnson, Timothy J.; Thorsness, Jessica L.; Anderson, Cole P.; Lynne, Aaron M.; Foley, Steven L.; Han, Jing; Fricke, W. Florian; McDermott, Patrick F.; White, David G.; Khatri, Mahesh; Stell, Adam L.; Flores, Cristian; Singer, Randall S.

2010-01-01

Salmonella enterica continues to be a significant cause of foodborne gastrointestinal illness in humans. A wide variety of Salmonella serovars have been isolated from production birds and from retail poultry meat. Recently, though, S. enterica subsp. enterica serovar Kentucky has emerged as one of the prominent Salmonella serovars isolated from broiler chickens. Recent work suggests that its emergence apparently coincides with its acquisition of a ColV virulence plasmid. In the present study, we examined 902 Salmonella isolates belonging to 59 different serovars for the presence of this plasmid. Of the serovars examined, the ColV plasmid was found only among isolates belonging to the serovars Kentucky (72.9%), Typhimurium (15.0%) and Heidelberg (1.7%). We demonstrated that a single PFGE clonal type of S. Kentucky harbors this plasmid, and acquisition of this plasmid by S. Kentucky significantly increased its ability to colonize the chicken cecum and cause extraintestinal disease. Comparison of the completed sequences of three ColV plasmids from S. Kentucky isolated from different geographical locales, timepoints and sources revealed a nearly identical genetic structure with few single nucleotide changes or insertions/deletions. Overall, it appears that the ColV plasmid was recently acquired by a single clonal type S. Kentucky and confers to its host enhanced colonization and fitness capabilities. Thus, the potential for horizontal gene transfer of virulence and fitness factors to Salmonella from other enteric bacteria exists in poultry, representing a potential human health hazard. PMID:21203520

The Effect of Acute and Chronic Social Stress on the Hippocampal Transcriptome in Mice.

PubMed

Stankiewicz, Adrian M; Goscik, Joanna; Majewska, Alicja; Swiergiel, Artur H; Juszczak, Grzegorz R

2015-01-01

Psychogenic stress contributes to the formation of brain pathology. Using gene expression microarrays, we analyzed the hippocampal transcriptome of mice subjected to acute and chronic social stress of different duration. The longest period of social stress altered the expression of the highest number of genes and most of the stress-induced changes in transcription were reversible after 5 days of rest. Chronic stress affected genes involved in the functioning of the vascular system (Alas2, Hbb-b1, Hba-a2, Hba-a1), injury response (Vwf, Mgp, Cfh, Fbln5, Col3a1, Ctgf) and inflammation (S100a8, S100a9, Ctla2a, Ctla2b, Lcn2, Lrg1, Rsad2, Isg20). The results suggest that stress may affect brain functions through the stress-induced dysfunction of the vascular system. An important issue raised in our work is also the risk of the contamination of brain tissue samples with choroid plexus. Such contamination would result in a consistent up- or down-regulation of genes, such as Ttr, Igf2, Igfbp2, Prlr, Enpp2, Sostdc1, 1500015O10RIK (Ecrg4), Kl, Clic6, Kcne2, F5, Slc4a5, and Aqp1. Our study suggests that some of the previously reported, supposedly specific changes in hippocampal gene expression, may be a result of the inclusion of choroid plexus in the hippocampal samples.

A Study of Relationships between Educational Credentials and Military Performance Criteria

DTIC Science & Technology

1982-04-01

LENGTH: 155 x 6200 COL DESCRIPTION COL DESCRIPTION NOTES 1__ 51._: 2. 52. TAFMS 1 3. 53. 4. SSAN 54, DPOC 1 5. Region 55. 6. CENSUS District 56. DOOC 1 7...SCRIPFION NOTESI 27. 77. ELIGIBILITY TO REENLIST 1 78.8. 29. 12 79. M PEBD 31. AREA 81. FILE FLAG 32. SCORES 82. __ 33, 83. TAFMS 34, 84. 2 35, 85. DPOC 36...the third most signi- ficant skill held by the Service member. Refer to DPOC above for coo vq description and comments. 34 57 Hi. test Year of Educa- 1

Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

PubMed Central

Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

2017-01-01

Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

The p65 Subunit of NF-κB Inhibits COL1A1 Gene Transcription in Human Dermal and Scleroderma Fibroblasts through Its Recruitment on Promoter by Protein Interaction with Transcriptional Activators (c-Krox, Sp1, and Sp3)*

PubMed Central

Beauchef, Gallic; Bigot, Nicolas; Kypriotou, Magdalini; Renard, Emmanuelle; Porée, Benoît; Widom, Russell; Dompmartin-Blanchere, Anne; Oddos, Thierry; Maquart, François-Xavier; Demoor, Magali; Boumediene, Karim; Galera, Philippe

2012-01-01

Transcriptional mechanisms regulating type I collagen genes expression in physiopathological situations are not completely known. In this study, we have investigated the role of nuclear factor-κB (NF-κB) transcription factor on type I collagen expression in adult normal human (ANF) and scleroderma (SF) fibroblasts. We demonstrated that NF-κB, a master transcription factor playing a major role in immune response/apoptosis, down-regulates COL1A1 expression by a transcriptional control involving the −112/−61 bp sequence. This 51-bp region mediates the action of two zinc fingers, Sp1 (specific protein-1) and Sp3, acting as trans-activators of type I collagen expression in ANF and SF. Knockdown of each one of these trans factors by siRNA confirmed the trans-activating effect of Sp1/Sp3 and the p65 subunit of NF-κB trans-inhibiting effect on COL1A1 expression. Despite no existing κB consensus sequence in the COL1A1 promoter, we found that Sp1/Sp3/c-Krox and NF-κB bind and/or are recruited on the proximal promoter in chromatin immunoprecipitation (ChIP) assays. Attempts to elucidate whether interactions between Sp1/Sp3/c-Krox and p65 are necessary to mediate the NF-κB inhibitory effect on COL1A1 in ANF and SF were carried out; in this regard, immunoprecipitation assays revealed that they interact, and this was validated by re-ChIP. Finally, the knockdown of Sp1/Sp3/c-Krox prevents the p65 inhibitory effect on COL1A1 transcription in ANF, whereas only the siRNAs targeting Sp3 and c-Krox provoked the same effect in SF, suggesting that particular interactions are characteristic of the scleroderma phenotype. In conclusion, our findings highlight a new mechanism for COL1A1 transcriptional regulation by NF-κB, and these data could allow the development of new antifibrotic strategies. PMID:22139845

Leukocyte-Reduced Platelet-Rich Plasma Normalizes Matrix Metabolism in Torn Human Rotator Cuff Tendons.

PubMed

Cross, Jessica A; Cole, Brian J; Spatny, Kaylan P; Sundman, Emily; Romeo, Anthony A; Nicholson, Greg P; Wagner, Bettina; Fortier, Lisa A

2015-12-01

The optimal platelet-rich plasma (PRP) for treatment of supraspinatus tendinopathy has not been determined. To evaluate the effect of low- versus high-leukocyte concentrated PRP products on catabolic and anabolic mediators of matrix metabolism in diseased rotator cuff tendons. Controlled laboratory study. Diseased supraspinatus tendons were treated with PRP made by use of 2 commercial systems: Arthrex Autologous Conditioned Plasma Double Syringe System (L(lo) PRP) and Biomet GPS III Mini Platelet Concentrate System (L(hi) PRP). Tendon explants were placed in 6-well plates and cultured in L(lo) PRP, L(hi) PRP, or control media (Dulbecco's Modified Eagle Medium + 10% fetal bovine serum) for 96 hours. Tendons were processed for hematoxylin-eosin histologic results and were scored with the modified Bonar scale. Group 1 tendons were defined as moderate tendinopathy (Bonar score <3); group 2 tendons were assessed as severely affected (Bonar score = 3). Transforming growth factor β-1 (TGFβ-1), interleukin-1β (IL-1β), interleukin-1 receptor antagonist (IL-1Ra), interleukin-6 (IL-6), interleukin-8 (IL-8), and matrix metalloproteinase-9 (MMP-9) concentrations in PRP media were measured by use of enzyme-linked immunosorbent assay after 96 hours of culture with diseased tendon. Tendon messenger RNA expression of collagen type I (COL1A1), collagen type III (COL3A1), cartilage oligomeric matrix protein (COMP), MMP-9, MMP-13, and IL-1β was measured with real-time quantitative polymerase chain reaction. Leukocytes and platelets were significantly more concentrated in L(hi) PRP compared with L(lo) PRP. Increased IL-1β was present in L(hi) PRP after culture with group 1 tendons. IL-6 was increased in L(hi) PRP after culture with group 2 tendons. Both TGFβ-1 and MMP-9 were increased in L(hi) PRP after culture with either tendon group. In L(lo) PRP cultures, IL-1Ra:IL-1β in PRP used as media and COL1A1:COL3A1 gene expression were increased for group 1 tendon cultures. Gene expression of MMP-9 and IL-1β was increased in group 2 tendons cultured in L(lo) PRP. There was no significant difference in the expression of MMP-13 or COMP in either group of tendons cultured in L(lo) PRP or L(hi) PRP. L(lo) PRP promotes normal collagen matrix synthesis and decreases cytokines associated with matrix degradation and inflammation to a greater extent than does L(hi) PRP in moderately degenerative tendons. In severely degenerative tendons, neither PRP preparation enhanced matrix synthesis. L(lo) PRP may promote healing in moderately degenerative rotator cuff tendons. © 2015 The Author(s).

MiR-590 Promotes Transdifferentiation of Porcine and Human Fibroblasts Toward a Cardiomyocyte-Like Fate by Directly Repressing Specificity Protein 1.

PubMed

Singh, Vivek P; Mathison, Megumi; Patel, Vivekkumar; Sanagasetti, Deepthi; Gibson, Brian W; Yang, Jianchang; Rosengart, Todd K

2016-11-10

Reprogramming of cardiac fibroblasts into induced cardiomyocyte-like cells represents a promising potential new therapy for treating heart disease, inducing significant improvements in postinfarct ventricular function in rodent models. Because reprogramming factors effective in transdifferentiating rodent cells are not sufficient to reprogram human cells, we sought to identify reprogramming factors potentially applicable to human studies. Lentivirus vectors expressing Gata4, Mef2c, and Tbx5 (GMT); Hand2 (H), Myocardin (My), or microRNA (miR)-590 were administered to rat, porcine, and human cardiac fibroblasts in vitro. induced cardiomyocyte-like cell production was then evaluated by assessing expression of the cardiomyocyte marker, cardiac troponin T (cTnT), whereas signaling pathway studies were performed to identify reprogramming factor targets. GMT administration induced cTnT expression in ≈6% of rat fibroblasts, but failed to induce cTnT expression in porcine or human cardiac fibroblasts. Addition of H/My and/or miR-590 to GMT administration resulted in cTNT expression in ≈5% of porcine and human fibroblasts and also upregulated the expression of the cardiac genes, MYH6 and TNNT2. When cocultured with murine cardiomyocytes, cTnT-expressing porcine cardiac fibroblasts exhibited spontaneous contractions. Administration of GMT plus either H/My or miR-590 alone also downregulated fibroblast genes COL1A1 and COL3A1. miR-590 was shown to directly suppress the zinc finger protein, specificity protein 1 (Sp1), which was able to substitute for miR-590 in inducing cellular reprogramming. These data support porcine studies as a surrogate for testing human cardiac reprogramming, and suggest that miR-590-mediated repression of Sp1 represents an alternative pathway for enhancing human cardiac cellular reprogramming. © 2016 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

The impact of cut-off lows on ozone in the upper troposphere and lower stratosphere over Changchun from ozonesonde observations

NASA Astrophysics Data System (ADS)

Song, Yushan; Lü, Daren; Li, Qian; Bian, Jianchun; Wu, Xue; Li, Dan

2016-02-01

In situ measurements of the vertical structure of ozone were made in Changchun (43.53°N, 125.13°E), China, by the Institute of Atmosphere Physics, in the summers of 2010-13. Analysis of the 89 validated ozone profiles shows the variation of ozone concentration in the upper troposphere and lower stratosphere (UTLS) caused by cut-off lows (COLs) over Changchun. During the COL events, an increase of the ozone concentration and a lower height of the tropopause are observed. Backward simulations with a trajectory model show that the ozone-rich airmass brought by the COL is from Siberia. A case study proves that stratosphere-troposphere exchange (STE) occurs in the COL. The ozone-rich air mass transported from the stratosphere to the troposphere first becomes unstable, then loses its high ozone concentration. This process usually happens during the decay stage of COLs. In order to understand the influence of COLs on the ozone in the UTLS, statistical analysis of the ozone profiles within COLs, and other profiles, are employed. The results indicate that the ozone concentrations of the in-COL profiles are significantly higher than those of the other profiles between ±4 km around the tropopause. The COLs induce an increase in UTLS column ozone by 32% on average. Meanwhile, the COLs depress the lapse-rate tropopause (LRT)/dynamical tropopause height by 1.4/1.7 km and cause the atmosphere above the tropopause to be less stable. The influence of COLs is durable because the increased ozone concentration lasts at least one day after the COL has passed over Changchun. Furthermore, the relative coefficient between LRT height and lower stratosphere (LS) column ozone is -0.62, which implies a positive correlation between COL strength and LS ozone concentration.

Size and Base Composition of RNA in Supercoiled Plasmid DNA

PubMed Central

Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.

1973-01-01

The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488

A conserved virulence plasmidic region contributes to the virulence of the multiresistant Escherichia coli meningitis strain S286 belonging to phylogenetic group C.

PubMed

Lemaître, Chloé; Mahjoub-Messai, Farah; Dupont, Damien; Caro, Valérie; Diancourt, Laure; Bingen, Edouard; Bidet, Philippe; Bonacorsi, Stéphane

2013-01-01

Recent isolation of the non-K1 Escherichia coli neonatal meningitis strain S286, belonging to phylogroup C, which is closely related to major group B1, and producing an extended-spectrum beta-lactamase, encouraged us to seek the genetic determinants responsible for its virulence. We show that S286 belongs to the sequence O type ST23O78 and harbors 4 large plasmids. The largest one, pS286colV (~120 kb), not related to resistance, contains genes characteristic of a Conserved Virulence Plasmidic (CVP) region initially identified in B2 extra-intestinal avian pathogenic E. coli (APEC) strains and in the B2 neonatal meningitis E. coli strain S88. The sequence of this CVP region has a strong homology (98%) with that of the recently sequenced plasmid pChi7122-1 of the O78 APEC strain Chi7122. A CVP plasmid-cured variant of S286 was less virulent than the wild type strain in a neonatal rat sepsis model with a significant lower level of bacteremia at 24 h (4.1 ± 1.41 versus 2.60 ± 0.16 log CFU/ml, p = 0.001) and mortality. However, the mortality in the model of adult mice was comparable between wild type and variant indicating that pS286colV is not sufficient by itself to fully explain the virulence of S286. Gene expression analysis of pS286colV in iron depleted environment was very close to that of pS88, suggesting that genes of CVP region may be expressed similarly in two very different genetic backgrounds (group C versus group B2). Screening a collection of 178 human A/B1 extraintestinal pathogenic E. coli (ExPEC) strains revealed that the CVP region is highly prevalent (23%) and MLST analysis indicated that these CVP positive strains belong to several clusters and mostly to phylogroup C. The virulence of S286 is explained in part by the presence of CVP region and this region has spread in different clusters of human A/B1 ExPEC, especially in group C.

Phototherapy up-regulates dentin matrix proteins expression and synthesis by stem cells from human-exfoliated deciduous teeth.

PubMed

Turrioni, Ana Paula S; Basso, Fernanda G; Montoro, Liege A; Almeida, Leopoldina de Fátima D de; Costa, Carlos A de Souza; Hebling, Josimeri

2014-10-01

The aim of this study was to evaluate the effects of infrared LED (850nm) irradiation on dentin matrix proteins expression and synthesis by cultured stem cells from human exfoliated deciduous teeth (SHED). Near-exfoliation primary teeth were extracted (n=3), and SHED cultures were characterized by immunofluorescence using STRO-1, CD44, CD146, Nanog and OCT3/4 antibodies, before experimental protocol. The SHEDs were seeded (3×10(4) cells/cm(2)) with DMEM containing 10% FBS. After 24-h incubation, the culture medium was replaced by osteogenic differentiation medium, and the cells were irradiated with LED light at energy densities (EDs) of 0 (control), 2, or 4J/cm(2) (n=8). The irradiated SHEDs were then evaluated for alkaline phosphatase (ALP) activity, total protein (TP) production, and collagen synthesis (SIRCOL™ Assay), as well as ALP, collagen type I (Col I), dentin sialophosphoprotein (DSPP), and dentin matrix acidic phosphoprotein (DMP-1) gene expression (qPCR). Data were analyzed by Kruskal-Wallis and Mann-Whitney tests (α=0.05). Increased ALP activity and collagen synthesis, as well as gene expression of DSPP and ALP, were observed for both EDs compared with non-irradiated cells. The ED of 4J/cm(2) also increased gene expression of COL I and DMP-1. In conclusion, infrared LED irradiation was capable of biostimulating SHEDs by increasing the expression and synthesis of proteins related with mineralized tissue formation, with overall better results for the energy dose of 4J/cm(2). Phototherapy is an additional approach for the clinical application of LED in Restorative Dentistry. Infrared LED irradiation of the cavity's floor could biostimulate subjacent pulp cells, improving local tissue healing. Copyright © 2014 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Xuejiao, E-mail: liuxuejiao0615@163.com; Institute for Liver Diseases, Anhui Medical University, Hefei 230032; Wu, Yuting

Background: NLRC5, as the largest member of NLRs family, has recently been identified as a critical regulator of immune responses through negatively regulating NF-κB which is associated with the development of hepatic fibrosis. However, the expression and potential roles of NLRC5 in hepatic fibrosis and its reversal are still to be defined. Methods: C57BL/6 mice were treatment with carbon tetrachloride (CCl{sub 4}) induce hepatic fibrosis and its reversal. In vitro, models of hepatic fibrosis and its reversal are established by the treatment with TGF-β and MDI. The expression of NLRC5 was determined by RT-PCR, Western blot and immunohistochemistry. Consequently, NLRC5more » was overexpressed or knockdown by transfecting PEGFP-C2-NLRC5 or NLRC5-siRNA respectively in the reversal of hepatic fibrosis, and the expression of fibrogenic genes such as α-SMA and Col1α1 was quantified. The NF-κB activity was detected as well. Results: Immunohistochemistry, RT-PCR and Western blot analysis with liver tissues and primary HSCs showed that NLRC5 was highly expressed in hepatic fibrosis and correspondingly decreased in the reversal stage. The differential expression of NLRC5 was confirmed in vitro. Enforced NLRC5 expression increased the expression of α-SMA and Col1α1, and blockade of NLRC5 reduced the fibrotic response. While the opposite expression of phosphorylated NF-kB p65 and phospho-IκBα was found. Conclusion: NLRC5 is differentially expressed in hepatic tissues and hepatic stellate cells during hepatic fibrosis and its reversal. All the data indicated that NLRC5 may play a crucial role in regulating the reversal of hepatic fibrosis through NF-κB signaling pathway. - Highlights: • The activated HSCs can be reverted to quiescent HSCs by MDI treatment. • NLRC5 expressed differentially during different stages of hepatic fibrosis and its reversal. • Enforced NLRC5 in reverted LX-c cells boosted the expression of α-SMA and Col1α1. • Blockade of NLRC5 diminished α-SMA and Col1α1 expression. • NLRC5 might provide a novel therapeutic approach for liver fibrosis.« less

Mechanisms underlying aberrant expression of miR-29c in uterine leiomyoma.

PubMed

Chuang, Tsai-Der; Khorram, Omid

2016-01-01

To determine the expression of miR-29c and its target genes in leiomyoma and the role of NF-κB, specific protein 1 (SP1), and DNA methylation in its regulation. Experimental study. Academic research laboratory. Women undergoing hysterectomy for leiomyoma. Over- and underexpression of miR-29c; blockade of transcription factors. MiR-29c and its target gene levels in leiomyoma and the effects of blockade of transcription factors on miR-29c expression. Leiomyoma as compared with myometrium expressed significantly lower levels of miR-29c, with an inverse relationship with expression of its targets, COL3A1 and DNMT3A. Gain of function of miR-29c inhibited the expression of COL3A1 and DNMT3A at protein and mRNA levels, secreted COL3A1, and rate of cell proliferation. Loss of function of miR-29c had the opposite effect. E2, P, and their combination inhibited miR-29c in leiomyoma smooth muscle cells (LSMC). Phosphorylated NF-κB (p65) and SP1 protein expression were significantly increased in leiomyoma. SiRNA knockdown of SP1 and DNMT3A or their specific inhibitors significantly increased the expression of miR-29c, accompanied by the inhibition of cellular and secreted COL3A1 in siRNA-treated cells. Knockdown of p65 also induced miR-29c expression but had no effect on COL3A1 expression. MiR-29c expression is suppressed in leiomyoma, resulting in an increase in expression of its targets COL3A1 and DNMT3A. The suppression of miR-29c in LSMC is primarily mediated by SP1, NF-κB signaling, and epigenetic modification. Collectively, these results indicate a significant role for miR-29c in leiomyoma pathogenesis. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

The genetics of human running: ACTN3 polymorphism as an evolutionary tool improving the energy economy during locomotion.

PubMed

Pasqua, Leonardo A; Bueno, Salomão; Matsuda, Monique; Marquezini, Mônica V; Lima-Silva, Adriano E; Saldiva, Paulo H N; Bertuzzi, Rômulo

2016-05-01

Covering long distances was an important trait to human evolution and continues to be highlighted for health and athletic status. This ability is benefitted by a low cost of locomotion (CoL), meaning that the individuals who are able to expend less energy would be able to cover longer distances. The CoL has been shown to be influenced by distinct and even 'opposite' factors, such as physiological and muscular characteristics, which are genetically inherited. In this way, DNA alterations could be important determinants of the characteristics associated with the CoL. A polymorphism in the ACTN3 gene (R577X) has been related to physical performance, associating the X allele with endurance and the R allele with strength/power abilities. To investigate the influence of ACTN3 genotypes on the CoL. One hundred and fifty healthy male individuals performed two constant speed tests (at 10 and 12 km/h) to determine the CoL. Interestingly, the results showed that heterozygous individuals (RX genotype) presented significantly lower CoL compared to RR and XX individuals. It is argued that RX genotype might generate an intermediate strength-to-endurance phenotype, leading to a better phenotypic profile for energy economy during running and, consequently, for long-term locomotion.

Tissue-specific mosaicism for a lethal osteogenesis imperfecta COL1A1 mutation causes mild OI/EDS overlap syndrome.

PubMed

Symoens, Sofie; Steyaert, Wouter; Demuynck, Lynn; De Paepe, Anne; Diderich, Karin E M; Malfait, Fransiska; Coucke, Paul J

2017-04-01

Type I collagen is the predominant protein of connective tissues such as skin and bone. Mutations in the type I collagen genes (COL1A1 and COL1A2) mainly cause osteogenesis imperfecta (OI). We describe a patient with clinical signs of Ehlers-Danlos syndrome (EDS), including fragile skin, easy bruising, recurrent luxations, and fractures resembling mild OI. Biochemical collagen analysis of the patients' dermal fibroblasts showed faint overmodification of the type I collagen bands, a finding specific for structural defects in type I collagen. Bidirectional Sanger sequencing detected an in-frame deletion in exon 44 of COL1A1 (c.3150_3158del), resulting in the deletion of three amino acids (p.Ala1053_Gly1055del) in the collagen triple helix. This COL1A1 mutation was hitherto identified in four probands with lethal OI, and never in EDS patients. As the peaks on the electropherogram corresponding to the mutant allele were decreased in intensity, we performed next generation sequencing of COL1A1 to study mosaicism in skin and blood. While approximately 9% of the reads originating from fibroblast gDNA harbored the COL1A1 deletion, the deletion was not detected in gDNA from blood. Most likely, the mild clinical symptoms observed in our patient can be explained by the mosaic state of the mutation. © 2017 Wiley Periodicals, Inc.

Molecular Analysis of Collagen XVIII Reveals Novel Mutations, Presence of a Third Isoform, and Possible Genetic Heterogeneity in Knobloch Syndrome

PubMed Central

Suzuki, O. T.; Sertié, A. L.; Der Kaloustian, V. M.; Kok, F.; Carpenter, M.; Murray, J.; Czeizel, A. E.; Kliemann, S. E.; Rosemberg, S.; Monteiro, M.; Olsen, B. R.; Passos-Bueno, M. R.

2002-01-01

Knobloch syndrome (KS) is a rare disease characterized by severe ocular alterations, including vitreoretinal degeneration associated with retinal detachment and occipital scalp defect. The responsible gene, COL18A1, has been mapped to 21q22.3, and, on the basis of the analysis of one family, we have demonstrated that a mutation affecting only one of the three COL18A1 isoforms causes this phenotype. We report here the results of the screening of both the entire coding region and the exon-intron boundaries of the COL18A1 gene (which includes 43 exons), in eight unrelated patients with KS. Besides 20 polymorphic changes, we identified 6 different pathogenic changes in both alleles of five unrelated patients with KS (three compound heterozygotes and two homozygotes). All are truncating mutations leading to deficiency of one or all collagen XVIII isoforms and endostatin. We have verified that, in exon 41, the deletion c3514-3515delCT, found in three unrelated alleles, is embedded in different haplotypes, suggesting that this mutation has occurred more than once. In addition, our results provide evidence of nonallelic genetic heterogeneity in KS. We also show that the longest human isoform (NC11-728) is expressed in several tissues (including the human eye) and that lack of either the short variant or all of the collagen XVIII isoforms causes similar phenotypes but that those patients who lack all forms present more-severe ocular alterations. Despite the small sample size, we found low endostatin plasma levels in those patients with mutations leading to deficiency of all isoforms; in addition, it seems that absence of all collagen XVIII isoforms causes predisposition to epilepsy. PMID:12415512

The animal sialyltransferases and sialyltransferase-related genes: a phylogenetic approach.

PubMed

Harduin-Lepers, Anne; Mollicone, Rosella; Delannoy, Philippe; Oriol, Rafael

2005-08-01

The animal sialyltransferases are Golgi type II transmembrane glycosyltransferases. Twenty distinct sialyltransferases have been identified in both human and murine genomes. These enzymes catalyze transfer of sialic acid from CMP-Neu5Ac to the glycan moiety of glycoconjugates. Despite low overall identities, they share four conserved peptide motifs [L (large), S (small), motif III, and motif VS (very small)] that are hallmarks for sialyltransferase identification. We have identified 155 new putative genes in 25 animal species, and we have exploited two lines of evidence: (1) sequence comparisons and (2) exon-intron organization of the genes. An ortholog to the ancestor present before the split of ST6Gal I and II subfamilies was detected in arthropods. An ortholog to the ancestor present before the split of ST6GalNAc III, IV, V, and VI subfamilies was detected in sea urchin. An ortholog to the ancestor present before the split of ST3Gal I and II subfamilies was detected in ciona, and an ortholog to the ancestor of all the ST8Sia was detected in amphioxus. Therefore, single examples of the four families (ST3Gal, ST6Gal, ST6GalNAc, and ST8Sia) have appeared in invertebrates, earlier than previously thought, whereas the four families were all detected in bony fishes, amphibians, birds, and mammals. As previously hypothesized, sequence similarities among sialyltransferases suggest a common genetic origin, by successive duplications of an ancestral gene, followed by divergent evolution. Finally, we propose predictions on these invertebrates sialyltransferase-related activities that have not previously been demonstrated and that will ultimately need to be substantiated by protein expression and enzymatic activity assays.

Nonsense variant in COL7A1 causes recessive dystrophic epidermolysis bullosa in Central Asian Shepherd dogs.

PubMed

Niskanen, Julia; Dillard, Kati; Arumilli, Meharji; Salmela, Elina; Anttila, Marjukka; Lohi, Hannes; Hytönen, Marjo K

2017-01-01

A rare hereditary mechanobullous disorder called epidermolysis bullosa (EB) causes blistering in the skin and the mucosal membranes. To date, nineteen EB-related genes have been discovered in human and other species. We describe here a novel EB variant in dogs. Two newborn littermates of Central Asian Shepherd dogs with severe signs of skin blistering were brought to a veterinary clinic and euthanized due to poor prognosis. In post-mortem examination, the puppies were shown to have findings in the skin and the mucosal membranes characteristic of EB. A whole-genome sequencing of one of the affected puppies was performed to identify the genetic cause. The resequencing data were filtered under a recessive model against variants from 31 other dog genomes, revealing a homozygous case-specific nonsense variant in one of the known EB-causing genes, COL7A1 (c.4579C>T, p.R1527*). The variant results in a premature stop codon and likely absence of the functional protein in the basement membrane of the skin in the affected dogs. This was confirmed by immunohistochemistry using a COL7A1 antibody. Additional screening of the variant indicated full penetrance and breed specificity at ~28% carrier frequency. In summary, this study reveals a novel COL7A1 variant causing recessive dystrophic EB and provides a genetic test for the eradication of the disease from the breed.

Chronic miR-29 antagonism promotes favorable plaque remodeling in atherosclerotic mice.

PubMed

Ulrich, Victoria; Rotllan, Noemi; Araldi, Elisa; Luciano, Amelia; Skroblin, Philipp; Abonnenc, Mélanie; Perrotta, Paola; Yin, Xiaoke; Bauer, Ashley; Leslie, Kristen L; Zhang, Pei; Aryal, Binod; Montgomery, Rusty L; Thum, Thomas; Martin, Kathleen; Suarez, Yajaira; Mayr, Manuel; Fernandez-Hernando, Carlos; Sessa, William C

2016-06-01

Abnormal remodeling of atherosclerotic plaques can lead to rupture, acute myocardial infarction, and death. Enhancement of plaque extracellular matrix (ECM) may improve plaque morphology and stabilize lesions. Here, we demonstrate that chronic administration of LNA-miR-29 into an atherosclerotic mouse model improves indices of plaque morphology. This occurs due to upregulation of miR-29 target genes of the ECM (col1A and col3A) resulting in reduced lesion size, enhanced fibrous cap thickness, and reduced necrotic zones. Sustained LNA-miR-29 treatment did not affect circulating lipids, blood chemistry, or ECM of solid organs including liver, lung, kidney, spleen, or heart. Collectively, these data support the idea that antagonizing miR-29 may promote beneficial plaque remodeling as an independent approach to stabilize vulnerable atherosclerotic lesions. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

STAT3 inhibition attenuates the progressive phenotypes of Alport syndrome mouse model.

PubMed

Yokota, Tsubasa; Omachi, Kohei; Suico, Mary Ann; Kamura, Misato; Kojima, Haruka; Fukuda, Ryosuke; Motomura, Keishi; Teramoto, Keisuke; Kaseda, Shota; Kuwazuru, Jun; Takeo, Toru; Nakagata, Naomi; Shuto, Tsuyoshi; Kai, Hirofumi

2018-02-01

Alport syndrome (AS) is a hereditary, progressive nephritis caused by mutation of type IV collagen. Previous studies have shown that activation of signal transducer and activator of transcription 3 (STAT3) exacerbates other renal diseases, but whether STAT3 activation exacerbates AS pathology is still unknown. Here we aim to investigate the involvement of STAT3 in the progression of AS. Phosphorylated STAT3 expression was assessed by immunoblotting analysis of kidneys and glomeruli of an AS mouse model (Col4a5 G5X mutant). To determine the effect of blocking STAT3 signaling, we treated AS mice with the STAT3 inhibitor stattic (10 mg/kg i.p., three times per week for 10 weeks; n = 10). We assessed the renal function [proteinuria, blood urea nitrogen (BUN), serum creatinine] and analyzed the glomerular injury score, fibrosis and inflammatory cell invasion by histological staining. Moreover, we analyzed the gene expression of nephritis-associated molecules. Phosphorylated STAT3 was upregulated in AS kidneys and glomeruli. Treatment with stattic ameliorated the progressive renal dysfunction, such as increased levels of proteinuria, BUN and serum creatinine. Stattic also significantly suppressed the gene expression levels of renal injury markers (Lcn2, Kim-1), pro-inflammatory cytokines (Il-6, KC), pro-fibrotic genes (Tgf-β, Col1a1, α-Sma) and Mmp9. Stattic treatment decreased the renal fibrosis congruently with the decrease of transforming growth factor beta (TGF-β) protein and increase of antifibrosis-associated markers p-Smad1, 5 and 8, which are negative regulators of TGF-β signaling. STAT3 inhibition significantly ameliorated the renal dysfunction in AS mice. Our finding identifies STAT3 as an important regulator in AS progression and provides a promising therapeutic target for AS. © The Author 2017. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

Transcription factor EGR1 directs tendon differentiation and promotes tendon repair

PubMed Central

Guerquin, Marie-Justine; Charvet, Benjamin; Nourissat, Geoffroy; Havis, Emmanuelle; Ronsin, Olivier; Bonnin, Marie-Ange; Ruggiu, Mathilde; Olivera-Martinez, Isabel; Robert, Nicolas; Lu, Yinhui; Kadler, Karl E.; Baumberger, Tristan; Doursounian, Levon; Berenbaum, Francis; Duprez, Delphine

2013-01-01

Tendon formation and repair rely on specific combinations of transcription factors, growth factors, and mechanical parameters that regulate the production and spatial organization of type I collagen. Here, we investigated the function of the zinc finger transcription factor EGR1 in tendon formation, healing, and repair using rodent animal models and mesenchymal stem cells (MSCs). Adult tendons of Egr1–/– mice displayed a deficiency in the expression of tendon genes, including Scx, Col1a1, and Col1a2, and were mechanically weaker compared with their WT littermates. EGR1 was recruited to the Col1a1 and Col2a1 promoters in postnatal mouse tendons in vivo. Egr1 was required for the normal gene response following tendon injury in a mouse model of Achilles tendon healing. Forced Egr1 expression programmed MSCs toward the tendon lineage and promoted the formation of in vitro–engineered tendons from MSCs. The application of EGR1-producing MSCs increased the formation of tendon-like tissues in a rat model of Achilles tendon injury. We provide evidence that the ability of EGR1 to promote tendon differentiation is partially mediated by TGF-β2. This study demonstrates EGR1 involvement in adult tendon formation, healing, and repair and identifies Egr1 as a putative target in tendon repair strategies. PMID:23863709

Analysis of the functional consequences of targeted exon deletion in COL7A1 reveals prospects for dystrophic epidermolysis bullosa therapy

PubMed Central

Bornert, Olivier; Kühl, Tobias; Bremer, Jeroen; van den Akker, Peter C; Pasmooij, Anna MG; Nyström, Alexander

2016-01-01

Genetically evoked deficiency of collagen VII causes dystrophic epidermolysis bullosa (DEB)—a debilitating disease characterized by chronic skin fragility and progressive fibrosis. Removal of exons carrying frame-disrupting mutations can reinstate protein expression in genetic diseases. The therapeutic potential of this approach is critically dependent on gene, protein, and disease intrinsic factors. Naturally occurring exon skipping in COL7A1, translating collagen VII, suggests that skipping of exons containing disease-causing mutations may be feasible for the treatment of DEB. However, despite a primarily in-frame arrangement of exons in the COL7A1 gene, no general conclusion of the aptitude of exon skipping for DEB can be drawn, since regulation of collagen VII functionality is complex involving folding, intra- and intermolecular interactions. To directly address this, we deleted two conceptually important exons located at both ends of COL7A1, exon 13, containing recurrent mutations, and exon 105, predicted to impact folding. The resulting recombinantly expressed proteins showed conserved functionality in biochemical and in vitro assays. Injected into DEB mice, the proteins promoted skin stability. By demonstrating functionality of internally deleted collagen VII variants, our study provides support of targeted exon deletion or skipping as a potential therapy to treat a large number of individuals with DEB. PMID:27157667

[Effects of Jianpi Qinghua Decoctions on immune inflammatory injury in adriamycin-induced nephropathic rats MA].

PubMed

Ma, Xiao-Hong; He, Li-Qun

2014-01-01

To investigate the effects of Jianpi Qinghua Decoctions on the inflammation injury mediated by the cellular immunity in the focal segmental glomurular Sclerosis (FSGS) nephropathy rats. The FSGS nephropathy rat model was established by the method of intravenous injection of Adriamycin after the removal of one kidney. After the treatment of Jianpi Qinghua Decoctions, the blood, spleen and kidney samples of each rat were collected for the detection of splenocytes CD4+/CD8+ ratio, renal tubulointerstitial fibronectin (FN) mRNA, Col III mRNA, and the expression levels of TNF-alpha and IL6. The treatment of Jianpi Qinghua Decoctions decreased the levels of CD4+/CD8+, tubulointerstitial FN mRNA, Col III mRNA, TNF-alpha and IL6 significantly in FSGS nephropathy rats. Jianpi Qinghua Decoctions could improve renal FSGS damage in adriamycin-induced nephropathy rats.

Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

PubMed

Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

2007-01-01

Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

Whole-genome sequencing of Atacama skeleton shows novel mutations linked with dysplasia

PubMed Central

Bhattacharya, Sanchita; Li, Jian; Sockell, Alexandra; Kan, Matthew J.; Bava, Felice A.; Chen, Shann-Ching; Ávila-Arcos, María C.; Ji, Xuhuai; Smith, Emery; Asadi, Narges B.; Lachman, Ralph S.; Lam, Hugo Y.K.; Bustamante, Carlos D.; Butte, Atul J.; Nolan, Garry P.

2018-01-01

Over a decade ago, the Atacama humanoid skeleton (Ata) was discovered in the Atacama region of Chile. The Ata specimen carried a strange phenotype—6-in stature, fewer than expected ribs, elongated cranium, and accelerated bone age—leading to speculation that this was a preserved nonhuman primate, human fetus harboring genetic mutations, or even an extraterrestrial. We previously reported that it was human by DNA analysis with an estimated bone age of about 6–8 yr at the time of demise. To determine the possible genetic drivers of the observed morphology, DNA from the specimen was subjected to whole-genome sequencing using the Illumina HiSeq platform with an average 11.5× coverage of 101-bp, paired-end reads. In total, 3,356,569 single nucleotide variations (SNVs) were found as compared to the human reference genome, 518,365 insertions and deletions (indels), and 1047 structural variations (SVs) were detected. Here, we present the detailed whole-genome analysis showing that Ata is a female of human origin, likely of Chilean descent, and its genome harbors mutations in genes (COL1A1, COL2A1, KMT2D, FLNB, ATR, TRIP11, PCNT) previously linked with diseases of small stature, rib anomalies, cranial malformations, premature joint fusion, and osteochondrodysplasia (also known as skeletal dysplasia). Together, these findings provide a molecular characterization of Ata's peculiar phenotype, which likely results from multiple known and novel putative gene mutations affecting bone development and ossification. PMID:29567674

Identification of a TAAT-containing motif required for high level expression of the COL1A1 promoter in differentiated osteoblasts of transgenic mice

NASA Technical Reports Server (NTRS)

Dodig, M.; Kronenberg, M. S.; Bedalov, A.; Kream, B. E.; Gronowicz, G.; Clark, S. H.; Mack, K.; Liu, Y. H.; Maxon, R.; Pan, Z. Z.;