Taxonomic history and current status of Stachybotrys chartarum and related species.
Li, D-W; Yang, C S
2005-01-01
The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. It is a cellulolytic saprophyte with a worldwide distribution and is frequently recovered in water-damaged buildings. Three isolates of S. chartarum were studied morphologically from single-spore isolations. Significant differences were found with the sizes, lengths, width, and L/W ratio of conidia and phialides among the isolates. QPCR analysis on S. chartarum, S. yunnanensis, S. chlorohalonata, S. elegans, S. microspora, and S. nephrospora showed that the primers and probe for detecting S. chartarum used by commercial laboratories were not able to differentiate S. chartarum from S. chlorohalonata and S. yunnanensis. Results suggested that S. chartarum may not be well delineated even after S. chlorohalonata was recently segregated from the species complex. Further study on the taxonomic status of the epithet S. chartarum is necessary. Six species of Stachybotrys are present indoors. Differentiation of Stachybotrys chartarum from S. chlorohalonata, and S. yunnanensis can be challenging using either morphological or QPCR methods. Caution should be taken to identify S. chartarum and closely related species and to explain their health effects implication for indoor air quality investigations.
Genome sequence of Stachybotrys chartarum Strain 51-11
Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...
PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF STACHYBOTRYS CHARTARUM
PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF Stachybotrys chartarum. M E Viana1, MJ Selgrade2, and M D Ward2. 1NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.
Exposure to Stachybotrys chartarum has been associated with the development of serious health ...
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Vojdani, Aristo
2005-05-01
IgG and IgE antibodies against Stachybotrys extract have been reported in allergic patients and residents of water-damaged buildings. Detection of these antibodies in blood was partially attributed to cross-reacting proteins from other fungi. There is a need for a specific method to detect antibodies against characteristic components of S. chartarum. We measured IgG and IgE antibodies against Stachybotrys hemolysin and proteinase-Stachyrase-A by ELISA and ELISA-inhibition techniques. Of 50 reference sera with IgE greater than 500 IU ml and positive against different mold extracts used in this study, significant elevation in IgG or IgE antibodies against S. chartarum extract was present in 25 and 21 specimens. Of these specimens 20 (80%) and 10 (40%) were positive for IgG anti-Stachybotrys hemolysin and anti-Stachyrase-A, while 8 out of 21 sera (38%) and 17 out of 21 (81%) specimens were positive for IgE anti-Stachybotrys hemolysin and anti-Stachyrase-A respectively. Inhibition studies using Stachybotrys hemolysin and Stachyrase-A at a concentration of 50 microg/ml prevented binding of anti-Stachybotrys to S. chartarum extract. Detection of IgG as well as IgE antibodies against Stachybotrys hemolysin and Stachyrase-A and inhibition of anti-Stachybotrys binding to Stachybotrys antigens indicate that Stachybotrys hemolysin and Stachyrase-A are two major antigenic components of S. chartarum extract, which can be used in antibody assays. Measurement of antibodies against these characteristic components of S. chartarum may be considered for demonstration of exposure and possibly allergy to the fungus.
Indoor mold, toxigenic fungi, and Stachybotrys chartarum: infectious disease perspective.
Kuhn, D M; Ghannoum, M A
2003-01-01
Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors.
Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective
Kuhn, D. M.; Ghannoum, M. A.
2003-01-01
Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430
GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS
The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...
GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS
The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...
Genome Sequence of Stachybotrys chartarum Strain 51-11
Kim, Jean; Levy, Josh
2015-01-01
The Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina HiSeq 2000 and PacBio technologies. Since S. chartarum has been implicated as having health impacts within water-damaged buildings, any information extracted from the genomic sequence data relating to toxins or the metabolism of the fungus might be useful. PMID:26430036
A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the ...
Genome Sequence of Stachybotrys chartarum Strain 51-11.
Betancourt, Doris A; Dean, Timothy R; Kim, Jean; Levy, Josh
2015-10-01
The Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina HiSeq 2000 and PacBio technologies. Since S. chartarum has been implicated as having health impacts within water-damaged buildings, any information extracted from the genomic sequence data relating to toxins or the metabolism of the fungus might be useful. Copyright © 2015 Betancourt et al.
CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM
Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
Da as determ...
CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM
Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...
CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM
Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...
Andersen, Birgitte; Nielsen, Kristian F; Jarvis, Bruce B
2002-01-01
Stachybotrys was found to be associated with idiopathic pulmonary hemorrhage in infants in Cleveland, Ohio. Since that time, considerable effort has been put into finding the toxic components responsible for the disease. The name Stachybotrys chartarum has been applied to most of these isolates, but inconsistent toxicity results and taxonomic confusion prompted the present study. In this study, 122 Stachybotrys isolates, mainly from water-damaged buildings, were characterized and identified by combining three different approaches: morphology, colony characteristics, and metabolite production. Two different Stachybotrys taxa, S. chartarum and one undescribed species, were found in water-damaged buildings regardless of whether the buildings were in Denmark, Finland, or the USA. Furthermore, two chemotypes could be distinguished in S. chartarum. One chemotype produced atranones, whereas the other was a macrocyclic trichothecene-producer. The second undescribed taxon produced atranones and could be differentiated from S. chartarum by its growth characteristics and pigment production. Our results correlate with different inflammatory and toxicological properties reported for these same isolates and show that the three taxa/chemotypes should be treated separately. The co-occurrence of these three taxa/chemotypes in water-damaged buildings explains the inconsistent results in the literature concerning toxicity of Stachybotrys isolated from that environment.
STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES
Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...
The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...
CHARACTERISTIC GROWTH REQUIREMENTS OF THE TOXIC MOLD STACHYBOTRYS CHARTARAM
The paper discusses the results of a study of the environmental factors leading to the growth of the mold Stachybotrys chartarum. S. chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants, and its toxin production and occurrence in water damaged...
A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...
Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...
The occurence of Stachybotrys chartarum in indoor environments has been associated with a number of human health concerns, including fatal pulmonary haemosiderosis in infants. Currently used culture-based and microscopic methods of fungal species identification are poorly suited ...
Andersen, Birgitte; Nielsen, Kristian F; Thrane, Ulf; Szaro, Tim; Taylor, John W; Jarvis, Bruce B
2003-01-01
Twenty-five Stachybotrys isolates from two previous studies have been examined and compared, using morphological, chemical and phylogenetic methods. The results show that S. chartarum sensu lato can be segregated into two chemotypes and one new species. The new species, S. chlorohalonata, differs morphologically from S. chartarum by having smooth conidia, being more restricted in growth and producing a green extracellular pigment on the medium CYA. S. chlorohalonata and S. chartarum also have different tri5, chs1 and tub1 gene fragment sequences. The two chemotypes of S. chartarum, chemotype S and chemotype A, have similar morphology but differ in production of metabolites. Chemotype S produces macrocyclic trichothecenes, satratoxins and roridins, while chemotype A produces atranones and dolabellanes. There is no difference between the two chemotypes in the tub1 gene fragment, but there is a one nucleotide difference in each of the tri5 and the chs1 gene fragments.
Vesper, Stephen J.; Dearborn, Dorr G.; Elidemir, Okan; Haugland, Richard A.
2000-01-01
A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the Houston strain and 10 strains of S. chartarum isolated from case (n = 5) or control (n = 5) homes in Cleveland were analyzed for hemolytic activity, siderophore production, and relatedness as measured by random amplified polymorphic DNA analysis. PMID:10831457
Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...
It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...
The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...
Occurrence of Stachybotrys chartarum chemotype S in dried culinary herbs.
Biermaier, Barbara; Gottschalk, Christoph; Schwaiger, Karin; Gareis, Manfred
2015-02-01
Stachybotrys (S.) chartarum is an omnipresent cellulolytic mould which produces secondary metabolites, such as the highly toxic macrocyclic trichothecenes. While it is known to occur in animal feed like hay and straw as well as in water-damaged indoor environments, there is little knowledge about the occurrence of S. chartarum and its secondary metabolites in food. The objective of the present study was to examine selected dried culinary herbs for the presence of S. chartarum chemotype S, to assess the potential risk of a contamination of foods with macrocyclic trichothecenes. In total, 50 Stachybotrys isolates from different types of culinary herbs (n=100) such as marjoram (Origanum majorana Linné (L.)), oregano (Origanum vulgare L.), thyme (Thymus vulgaris L.), and savory (Satureja hortensis L.) were examined by MTT-cell culture test (effect-based bioassay), ELISA, and by liquid chromatography tandem mass spectrometry (LC-MS/MS). Selected toxic and non-toxic isolates (n=15) were genetically characterized by PCR and sequencing. Five isolates (10%) were highly toxic in the MTT-cell culture test, and the production of macrocyclic trichothecenes was proven by ELISA and LC-MS/MS. These five isolates were genetically confirmed as S. chartarum chemotype S. To the best of our knowledge, this is the first report about a contamination of dried culinary herbs with toxigenic S. chartarum.
RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF Stachybotrys chartarum IN BALB/C MICE. ME Viana1, N Haykal-Coates2, S H Gavett2, MJ Selgrade2, and M D W Ward2. 1APR/CVM, NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.
Rationale: assess the ab...
Attributes of Stachybotrys chartarum and its association with human disease.
Hossain, Mohammad Ashraf; Ahmed, Mohamed Sotohy; Ghannoum, Mahmoud Afif
2004-02-01
Mold contamination and toxicities are not limited to crops and animals; they are also a concern in human health. Molds occur in outdoor and indoor environments, and water-damaged buildings harbor and provide substrate for several mold species. Of these, Stachybotrys chartarum poses a particular threat to occupants. Patients with building-related symptoms and infant idiopathic pulmonary hemorrhage often have histories of living in moldy, water-damaged buildings. Although a causal connection is far from being unequivocally proven, S. chartarum has been associated with such clinical conditions. These illnesses could be attributed in part to mycotoxins released by S. chartarum. Recently, a hemolysin released by this mold was found to be hemolytic in vitro and in vivo. In addition, allergenic proteins have been characterized from S. chartarum. The exact mechanism of S. chartarum pathogenesis has not yet been defined. Moreover, a causality-effect relation is not yet established. This review summarizes available information on the pathogenic attributes of S. chartarum and calls for well-controlled objective studies.
Sanitation of wallboard colonized with Stachybotrys chartarum.
Price, D L; Ahearn, D G
1999-07-01
Sections (8 cm2) of unused, nonsterile gypsum wallboard (dry wall) were inoculated with varying densities (10(4) to approximately 10(8)/ml) of conidia from 14- to 21-day cultures of Stachybotrys chartarum grown on cellulose agar. The sections were permitted to air dry and were placed into vessels with 86% or 92% RH and incubated at 22-25 degrees C for up to 12 weeks. The moisture content of the dryboard increased from near 10% to over 35%. Selected sections with confluent surface growth, mainly of S. chartarum, were obtained within 3 weeks. Sections were cleaned with a quaternary or quaternary and chlorine dioxide or a concentrated oxygen-saline solution and treated, in some cases, with a preservative system and returned to humidity vessels. Reemergence of S. chartarum from inoculated and treated surfaces occurred within 5 weeks only with sections treated with the quaternary alone. Other fungi, mostly species of Aspergillus, Chaetomium and Penicillium, slowly colonized (between 9-12 weeks) at least some areas of most treated surfaces and most uninoculated control surfaces. Stachybotrys chartarum was also found on several sections of uninoculated controls. Sections treated with a quaternary/acrylic and placed in a dynamic challenging chamber remained visually free of colonized fungi for over 90 days. These studies indicate that control samples of uninstalled wallboard, available from local distributors, can contain a baseline bioburden, including S. chartarum, that will colonize surfaces under high humidity conditions. Sanitation and preservation treatment of the wallboard can markedly delay regrowth of these fungi, particularly of S. chartarum.
Stachybotrys is a hydrophilic fungal genus that is well known for its ability to colonize water-damaged building materials in indoor environments. Personal exposure to Stachybotrys chartarum allergens, mycotoxins, cytolytic peptides, and other immunostimulatory macromolecules has...
Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...
FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES
The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...
Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.
Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...
2013-01-01
Background Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Results Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. Conclusions MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold. PMID:24308451
Betancourt, Doris A; Krebs, Ken; Moore, Scott A; Martin, Shayna M
2013-12-05
Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold.
Biomechanics of conidial dispersal in the toxic mold Stachybotrys chartarum
Tucker, Kathryn; Stolze, Jessica L.; Kennedy, Aaron H.; Money, Nicholas P.
2007-01-01
Conidial dispersal in Stachybotrys chartarum in response to low-velocity airflow was studied using a microflow apparatus. The maximum rate of spore release occurred during the first 5 min of airflow, followed by a dramatic reduction in dispersal that left more than 99% of the conidia attached to their conidiophores. Micromanipulation of undisturbed colonies showed that micronewton (μN) forces were needed to dislodge spore clusters from their supporting conidiophores. Calculations show that airspeeds that normally prevail in the indoor environment disturb colonies with forces that are 1,000-fold lower, in the nanonewton (nN) range. Low-velocity airflow does not, therefore, cause sufficient disturbance to disperse a large proportion of the conidia of S. chartarum. PMID:17267247
The paper describes results of experiments assessing the efficacy of treating mold-contaminated gypsum wallboard with cleaners and/or disinfectants. Although the accepted recommendations for handling Stachybotrys chartarum contaminated gypsum wallboard are removal and replacement...
Brasel, T L; Martin, J M; Carriker, C G; Wilson, S C; Straus, D C
2005-11-01
The existence of airborne mycotoxins in mold-contaminated buildings has long been hypothesized to be a potential occupant health risk. However, little work has been done to demonstrate the presence of these compounds in such environments. The presence of airborne macrocyclic trichothecene mycotoxins in indoor environments with known Stachybotrys chartarum contamination was therefore investigated. In seven buildings, air was collected using a high-volume liquid impaction bioaerosol sampler (SpinCon PAS 450-10) under static or disturbed conditions. An additional building was sampled using an Andersen GPS-1 PUF sampler modified to separate and collect particulates smaller than conidia. Four control buildings (i.e., no detectable S. chartarum growth or history of water damage) and outdoor air were also tested. Samples were analyzed using a macrocyclic trichothecene-specific enzyme-linked immunosorbent assay (ELISA). ELISA specificity was tested using phosphate-buffered saline extracts of the fungal genera Aspergillus, Chaetomium, Cladosporium, Fusarium, Memnoniella, Penicillium, Rhizopus, and Trichoderma, five Stachybotrys strains, and the indoor air allergens Can f 1, Der p 1, and Fel d 1. For test buildings, the results showed that detectable toxin concentrations increased with the sampling time and short periods of air disturbance. Trichothecene values ranged from <10 to >1,300 pg/m3 of sampled air. The control environments demonstrated statistically significantly (P < 0.001) lower levels of airborne trichothecenes. ELISA specificity experiments demonstrated a high specificity for the trichothecene-producing strain of S. chartarum. Our data indicate that airborne macrocyclic trichothecenes can exist in Stachybotrys-contaminated buildings, and this should be taken into consideration in future indoor air quality investigations.
Sick building syndrome. III. Stachybotrys chartarum.
Mahmoudi, M; Gershwin, M E
2000-04-01
Increasingly, physicians are being asked to evaluate patients with putative environmentally associated illnesses. These can include a variety of problems, including infectious illnesses (Legionnaire's disease), chemical exposure in the workplace, and sick building syndromes. The latter has been an issue particularly in asthma because of the association of mold and increased bronchial responsiveness. Recently, attention has been focused on the mold Stachybotrys in human disease. Stachybotrys was first identified more than 60 years ago following an epidemic of stomatitis, rhinitis, conjunctivitis, pancytopenia, neurologic disorders, and death in horses. Since then, Stachybotrys has been identified in several outbreaks of disease in animals. It has also attracted attention as a possible agent in idiopathic pulmonary hemorrhage in infants. Stachybotrys is a relatively uncommon fungus but has been isolated from a variety of sources, including contaminated grains, tobacco, indoor air, insulator foams, and water-damaged buildings with high humidity. This fungus is particularly important because it is one of a series of fungi that produces trichothecenes mycotoxins; these mycotoxins are biologically active and can produce a variety of physiological and pathologic changes in humans and animals, including modulation of inflammation and altered alveolar surfactant phospholipid concentrations. The presence of Stachybotrys in a building does not necessarily imply a cause-and-effect relationship with illness, but should alert physicians and healthcare professionals to do more vigorous environmental testing. Guidelines are presented herein for intervention measures in the maintenance of heating, ventilation, and air-conditioning systems.
Pre-contamination of new gypsum wallboard with potentially harmful fungal species.
Andersen, B; Dosen, I; Lewinska, A M; Nielsen, K F
2017-01-01
Gypsum wallboard is a popular building material, but is also very frequently overgrown by Stachybotrys chartarum after severe and/or undetected water damage. The purpose of this study was to determine whether Stachybotrys and other fungi frequently isolated from wet gypsum wallboard are already present in the panels directly from the factory. Surface-disinfected gypsum disks were wetted with sterile water, sealed, and incubated for 70 days. The results showed that Neosartorya hiratsukae (≡ Aspergillus hiratsukae) was the most dominant fungus on the gypsum wallboard followed by Chaetomium globosum and Stachybotrys chartarum. Our results suggest that these three fungal species are already embedded in the materials, presumably in the paper/carton layer surrounding the gypsum core, before the panels reach the retailers/building site. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Damp building-related illnesses (DBRI) include a myriad of respiratory, immunologic, and neurologic symptoms that are sometimes etiologically linked to aberrant indoor growth of the toxic black mold, Stachybotrys chartarum. Although supportive evidence for such linkages is limite...
Stachybotrys: An unusual mold associated with water-damaged buildings.
Jarvis, B; Hinkley, S; Nielsen, K
2000-03-01
Chemical analyses of extracts of cultures ofS. chartarum show that this fungus has two chemotypes: producers of the potent cytotoxic macrocyclic trichothecenes (e. g. satratoxins) and those that produce the diterpenoid atranones and the simple trichothecenes, trichodermol and trichodermin. All isolates ofS. chartarum produce the immunosuppressant spirocyclic drimanes.
This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...
Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...
Hastings, C; Rand, T; Bergen, H T; Thliveris, J A; Shaw, A R; Lombaert, G A; Mantsch, H H; Giles, B L; Dakshinamurti, S; Scott, J E
2005-03-01
Stachybotry chartarum, a fungal contaminant of water-damaged buildings commonly grows on damp cellulose-containing materials. It produces a complex array of mycotoxins. Their mechanisms of action on the pulmonary system are not entirely clear. Previous studies suggest spore products may depress formation of disaturated phosphatidylcholine (DSPC), the major surface-active component of pulmonary surfactant (PS). If S. chartarum can indeed affect formation of this phospholipid, then mold exposure may be a significant issue for pulmonary function in both mature lung and developing fetal lung. To address this possibility, fetal rat type II cells, the principal source of DSPC, were used to assess effects of S. chartarum extract on formation of DSPC. Isolated fetal rat lung type II cells prelabeled with 3H-choline and incubated with spore extract showed decreased incorporation of 3H-choline into DSPC. The activity of CTP:cholinephosphate cytidylyltransferase (CPCT), the rate-limiting enzyme in phosphatidylcholine synthesis was reduced by approximately 50% by a 1:10 dilution of spore extract. Two different S. chartarum extracts (isolates from S. chartarum (Cleveland) and S. chartarum (Hawaiian)) were used to compare activity of CPCT in the presence of phosphatidylglycerol (PG), a known activator. PG produced an approximate two-fold increase in CPCT activity. The spore isolate from Hawaii did not alter enzyme activity. S. chartarum (Cleveland) eliminated the PG-induced activation of CPCT. These results support previous observations that mold products alter PS metabolism and may pose a risk in developing lung, inhibiting surfactant synthesis. Different isolates of the same species of fungus are not equivalent in terms of potential exposure risks.
Gao, Pengfei; Martin, Jennifer
2002-06-01
Stachybotrys chartarum (atra) is a toxigenic fungus frequently found in water-damaged buildings. Although microbial volatile organic compounds (MVOCs) produced by Aspergillus, Penicillium, and other fungi have been investigated extensively, little information exists on what MVOCs can be produced by S. chartarum. In this study, three strains of S. chartarum isolated from water-damaged residential homes in Cleveland, Ohio, were cultivated on rice and gypsum board. Air samples were collected after one, two, three, four, and six weeks of cultivation using Tenax TA tubes. Unique MVOCs were determined and other alcohols, ketones, and terpenes were also investigated using gas chromatography/mass spectrometry after thermal desorption from the sampling tube. Four unique MVOCs, 1-butanol, 3-methyl-1-butanol, 3-methyl-2-butanol, and thujopsene, were detected on rice cultures, and only one of them (1-butanol) was detected on gypsum board cultures. For a given strain, volatiles were considerably different with different cultivation media. Concentration profiles of the volatile compounds varied among compounds; however, each compound exhibited corresponding concentration trends between the strains. In comparison with our previous studies of five Aspergillus species on gypsum board under the same experimental conditions, fewer unique MVOCs were produced by S. chartarum, and they were quite different. It thus may be possible to use marker-unique MVOCs as a fingerprint to distinguish fungi in indoor environments once enough information becomes available. Our findings also indicate that volatiles produced by S. chartarum may represent a relatively small fraction of the total volatiles present in problem buildings where Aspergillus spp., Penicillium spp., and other fungi usually coexist.
Van Emon, Jeanette M; Reed, Allan W; Yike, Iwona; Vesper, Stephen J
2003-06-01
The goal of this research was to develop a measurable indicator of human exposure to Stachyborys chartarum. Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay methods for the analysis of stachylysin in human and rat sera and environmental samples. Stachylysin was measured in rat pups that received nasal instillations of S. chartarum conidia but not in control rat serum. Stachylysin in the serum of five human adults exposed to S. chartarum in water-damaged environments was 371 ng/mL but none was detected in the control serum. Stachylysin was also quantified in spore, wallboard, mycelial, and dust samples. The measurement of stachylysin may be a useful indicator in assessing human exposure to S. chartarum and in determining the presence of this indoor mold.
Testing antimicrobial paint efficacy on gypsum wallboard contaminated with Stachybotrys chartarum.
Menetrez, M Y; Foarde, K K; Webber, T D; Dean, T R; Betancourt, D A
2008-02-01
The goal of this research was to reduce occupant exposure to indoor mold through the efficacy testing of antimicrobial paints. An accepted method for handling Stachybotrys chartarum-contaminated gypsum wallboard (GWB) is removal and replacement. This practice is also recommended for water-damaged or mold-contaminated GWB but is not always followed completely. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can be tested easily on nonporous surfaces. The testing of antimicrobial efficacy on porous surfaces found in the indoor environment, such as gypsum wallboard, can be more complicated and prone to incorrect conclusions regarding residual organisms. The mold S. chartarum has been studied for toxin production and its occurrence in water-damaged buildings. Research to control its growth using seven different antimicrobial paints and two commonly used paints on contaminated, common gypsum wallboard was performed in laboratory testing at high relative humidity. The results indicate differences in antimicrobial efficacy for the period of testing, and that proper cleaning and resurfacing of GWB with an antimicrobial paint can be an option in those unique circumstances when removal may not be possible.
Facts about Stachybotrys chartarum and Other Molds
... buildings and homes? As part of routine building maintenance, buildings should be inspected for evidence of water ... Privacy FOIA No Fear Act OIG 1600 Clifton Road Atlanta , GA 30329-4027 USA 800-CDC-INFO ( ...
Murtoniemi, Timo; Nevalainen, Aino; Hirvonen, Maija-Riitta
2003-01-01
The effects of plasterboard composition on the growth and sporulation of Stachybotrys chartarum as well as on the inflammatory potential of the spores were studied. S. chartarum was grown on 13 modified plasterboards under saturated humidity conditions. The biomass was estimated by measuring the ergosterol content of the S. chartarum culture while the spore-induced cytotoxicity and production of nitric oxide (NO), tumor necrosis factor alpha (TNF-α), and interleukin-6 in mouse macrophages was used to illustrate the bioactivity of spores. The ergosterol content of S. chartarum correlated with the number of spores collected from plasterboards. The growth and sporulation decreased compared to that of the reference board in those cases where (i) the liner was treated with biocide, (ii) starch was removed from the plasterboard, or (iii) desulfurization gypsum was used in the core. Spores collected from all the plasterboards were toxic to the macrophages. The biocide added to the core did not reduce the growth; in fact, the spores collected from that board evoked the highest cytotoxicity. The conventional additives used in the core had inhibitory effects on growth. Recycled plasterboards used in the core and the board lacking the starch triggered spore-induced TNF-α production in macrophages. In summary, this study shows that the growth of a strain of S. chartarum on plasterboard and the subsequent bioactivity of spores were affected by minor changes to the composition of the core or liners, but it could not be totally prevented without resorting to the use of biocides. However, incomplete prevention of microbial growth by biocides even increased the cytotoxic potential of the spores. PMID:12839740
ELISA MEASUREMENT FOR STACHYLYSIN
The consumption of food commodities contaminated with the mold, Stachybotrys charatrum, has a long history of causing severe illness, and even death, in humans and animals. More recently, negative health effects have been linked to indoor inhalation exposures to S. chartarum. F...
EVALUATION OF ANTIMICROBIAL EFFICACY FOR CONTROL OF STACHYBOTRYS CHARTARUM
Biological contaminants in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants, Sick buildings are evidence of extremely problematic indoor air quality (lAO) often resulting from unacceptable concentration...
Vesper, S; Dearborn, D G; Yike, I; Allan, T; Sobolewski, J; Hinkley, S F; Jarvis, B B; Haugland, R A
2000-03-01
Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage cases in the Cleveland, Ohio, area. This study applied two new quantitative measurements to air samples from a home in which an infant developed PH. Quantitative polymerase chain reaction and a protein synthesis inhibition assay were used to determine the level of S. chartarum spores and their toxicity in air samples taken before, during, and after a remediation program was implemented to remove the fungus. Initial spore concentrations were between 0.1 and 9.3 spores/m3 of air, and the toxicity of air particulates was correspondingly low. However, the dust in the house contained between 0.4 and 2.1 x 10(3) spores/mg (as determined by hemocytometer counts). The remediation program removed all contaminated wallboard, paneling, and carpeting in the water-damaged areas of the home. In addition, a sodium hypochlorite solution was used to spray all surfaces during remediation. Although spore counts and toxicity were high during remediation, air samples taken postremediation showed no detectable levels of S. chartarum or related toxicity. Nine isolates of S. chartarum obtained from the home were analyzed for spore toxicity, hemolytic activity, and random amplified polymorphic DNA banding patterns. None of the isolates produced highly toxic spores (>90 microg T2 toxin equivalents per gram wet weight spores) after growth for 10 and 30 days on wet wallboard, but three isolates were hemolytic consistently. DNA banding patterns suggested that at least one of these isolates was related to isolates from homes of infants with previously investigated cases.
Brasel, T L; Douglas, D R; Wilson, S C; Straus, D C
2005-01-01
Highly respirable particles (diameter, <1 microm) constitute the majority of particulate matter found in indoor air. It is hypothesized that these particles serve as carriers for toxic compounds, specifically the compounds produced by molds in water-damaged buildings. The presence of airborne Stachybotrys chartarum trichothecene mycotoxins on particles smaller than conidia (e.g., fungal fragments) was therefore investigated. Cellulose ceiling tiles with confluent Stachybotrys growth were placed in gas-drying containers through which filtered air was passed. Exiting particulates were collected by using a series of polycarbonate membrane filters with decreasing pore sizes. Scanning electron microscopy was employed to determine the presence of conidia on the filters. A competitive enzyme-linked immunosorbent assay (ELISA) specific for macrocyclic trichothecenes was used to analyze filter extracts. Cross-reactivity to various mycotoxins was examined to confirm the specificity. Statistically significant (P < 0.05) ELISA binding was observed primarily for macrocyclic trichothecenes at concentrations of 50 and 5 ng/ml and 500 pg/ml (58.4 to 83.5% inhibition). Of the remaining toxins tested, only verrucarol and diacetylverrucarol (nonmacrocyclic trichothecenes) demonstrated significant binding (18.2 and 51.7% inhibition, respectively) and then only at high concentrations. The results showed that extracts from conidium-free filters demonstrated statistically significant (P < 0.05) antibody binding that increased with sampling time (38.4 to 71.9% inhibition, representing a range of 0.5 to 4.0 ng/ml). High-performance liquid chromatography analysis suggested the presence of satratoxin H in conidium-free filter extracts. These data show that S. chartarum trichothecene mycotoxins can become airborne in association with intact conidia or smaller particles. These findings may have important implications for indoor air quality assessment.
Johanning, E; Biagini, R; Hull, D; Morey, P; Jarvis, B; Landsbergis, P
1996-01-01
There is growing concern about adverse health effects of fungal bio-aerosols on occupants of water-damaged buildings. Accidental, occupational exposure in a nonagricultural setting has not been investigated using modern immunological laboratory tests. The objective of this study was to evaluate the health status of office workers after exposure to fungal bio-aerosols, especially Stachybotrys chartarum (atra) (S. chartarum) and its toxigenic metabolites (satratoxins), and to study laboratory parameters or biomarkers related to allergic or toxic human health effects. Exposure characterization and quantification were performed using microscopic, culture, and chemical techniques. The study population (n = 53) consisted of 39 female and 14 male employees (mean age 34.8 years) who had worked for a mean of 3.1 years at a problem office site; a control group comprised 21 persons (mean age 37.5 years) without contact with the problem office site. Health complaints were surveyed with a 187-item standardized questionnaire. A comprehensive test battery was used to study the red and white blood cell system, serum chemistry, immunology/antibodies, lymphocyte enumeration and function. Widespread fungal contamination of water-damaged, primarily cellulose material with S. chartarum was found. S. chartarum produced a macrocyclic trichothecene, satratoxin H, and spirocyclic lactones. Strong associations with exposure indicators and significant differences between employees (n = 53) and controls (n = 21) were found for lower respiratory system symptoms, dermatological symptoms, eye symptoms, constitutional symptoms, chronic fatigue symptoms and several enumeration and function laboratory tests, mainly of the white blood cell system. The proportion of mature T-lymphocyte cells (CD3%) was lower in employees than in controls, and regression analyses showed significantly lower CD3% among those reporting a history of upper respiratory infections. Specific S. chartarum antibody tests (IgE and IgG) showed small differences (NS). It is concluded that prolonged and intense exposure to toxigenic S. chartarum and other atypical fungi was associated with reported disorders of the respiratory and central nervous systems, reported disorders of the mucous membranes and a few parameters pertaining to the cellular and humoral immune system, suggesting a possible immune competency dysfunction.
TESTING ANTIMICROBIAL CLEANER EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM
Reducing occupant exposure to indoor mold growth is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the prob...
EMISSION EXPOSURE MODEL FOR TRANSPORT OF TOXIC MOLD
The paper presents the results of a study of the release of Stachybotrys chartarum spores from contaminated gypsum wallboard and of tests on the effects of environmental conditions on the release of viable and non-viable spores and fragments. Biocontaminants such as mold spores a...
The role of fungal proteinases in pathophysiology of Stachybotrys chartarum.
Yike, Iwona; Rand, Thomas; Dearborn, Dorr G
2007-10-01
The adverse health effects of Stachybotrys chartarum have often been linked to exposure to the trichothecene mycotoxins. Recent studies have shown that in addition to mycotoxins this fungus is capable of producing and secreting in vivo proteins such as hemolysins and proteinases. Spore extracts obtained from a high trichothecene producing isolate JS 58-17 exhibited a significantly lower proteolytic activity compared to the low trichothecene producer, JS 58-06. Growing isolates on rice or potato dextrose agar results in higher proteolytic activity of the spores compared to those grown on drywall. Proteinases in the spore extracts can hydrolyze gelatin and collagen I and IV. Analysis of zymograms shows the presence of several proteins with proteolytic activity in the spores of S. chartarum. Human tracheal epithelial cells exposed to spore extracts produced significantly higher levels of IL-6, IL-8, and TNF-alpha than control cells. This stimulation of cytokine production was completely abolished by Pefabloc, a serine protease inhibitor. Neutrophil numbers and proinflammatory cytokine (IL1-beta and TNF-alpha) concentrations were highly elevated in the lungs of 7 day old rat pups exposed intratracheally to 4 x 10(4) spores/gm body weight compared to control. No significant differences in those inflammatory indices in vivo were noted between the treatments with the high trichothecene producer, isolate JS 58-17 and JS 58-06, which does not produce macrocyclic trichothecenes. Immunohistochemistry revealed reduced collagen IV labeling in spore-induced lung granulomas in rat pups exposed to both isolates. These results suggest that proteinases from S. chartarum spores significantly contribute to lung inflammation and injury.
The purpose of this project was to determine the efficacy ofCl02 fumigation to inactivate viable mold, mycotoxins, and allergens on building materials. Alternaria alternata, Aspergillus versicolor, Aspergillus Jumigatus, Chaetomium globosum, and Stachybotrys chartarum were indivi...
TESTING ANTIMICROBIAL PAINT EFFICACY ON GYPSUM WALLBOARD CONTAMINATED WITH STACHYBOTRYS CHARTARUM
Often mold contaminated building materials are not properly removed, some surface cleaning is performed and paint is applied in an attempt to alleviate the problem. The efficacy of antimicrobial paints to eliminate or control mold regrowth on surfaces can easily be tested on non-...
Analyses of fungal spores or conidia in indoor dust samples can be useful for determining the contamination status of building interiors and in signaling instances where potentially harmful exposures of building occupants to these organisms may exist. A recently developed method ...
This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...
Vesper, Stephen J.; Dearborn, Dorr G.; Yike, Iwona; Sorenson, W. G.; Haugland, Richard A.
1999-01-01
Stachybotrys chartarum is an indoor air, toxigenic fungus that has been associated with a number of human and veterinary health problems. Most notable among these has been a cluster of idiopathic pulmonary hemorrhage cases that were observed in the Cleveland, Ohio, area. In this study, 16 strains of S. chartarum isolated from case (n = 8) or control (n = 8) homes in Cleveland and 12 non-Cleveland strains from diverse geographic locations were analyzed for hemolytic activity, conidial toxicity, and randomly amplified polymorphic DNA banding patterns. In tests for hemolytic activity, strains were grown at 23°C on wet wallboard pieces for an 8-week test period. Conidia from these wallboard pieces were subcultured on sheep’s blood agar once a week over this period and examined for growth and clearing of the medium at 37 or 23°C. Five of the Cleveland strains (all from case homes) showed hemolytic activity at 37°C throughout the 8-week test compared to 3 of the non-Cleveland strains. Five of the Cleveland strains, compared to two of the non-Cleveland strains, produced highly toxic conidia (>90 μg of T2 toxin equivalents per g [wet weight] of conidia) after 10 and 30 days of growth on wet wallboard. Only 3 of the 28 strains examined both were consistently hemolytic and produced highly toxic conidia. Each of these strains was isolated from a house in Cleveland where an infant had idiopathic pulmonary hemorrhage. PMID:10388719
Vesper, S J; Dearborn, D G; Yike, I; Sorenson, W G; Haugland, R A
1999-07-01
Stachybotrys chartarum is an indoor air, toxigenic fungus that has been associated with a number of human and veterinary health problems. Most notable among these has been a cluster of idiopathic pulmonary hemorrhage cases that were observed in the Cleveland, Ohio, area. In this study, 16 strains of S. chartarum isolated from case (n = 8) or control (n = 8) homes in Cleveland and 12 non-Cleveland strains from diverse geographic locations were analyzed for hemolytic activity, conidial toxicity, and randomly amplified polymorphic DNA banding patterns. In tests for hemolytic activity, strains were grown at 23 degrees C on wet wallboard pieces for an 8-week test period. Conidia from these wallboard pieces were subcultured on sheep's blood agar once a week over this period and examined for growth and clearing of the medium at 37 or 23 degrees C. Five of the Cleveland strains (all from case homes) showed hemolytic activity at 37 degrees C throughout the 8-week test compared to 3 of the non-Cleveland strains. Five of the Cleveland strains, compared to two of the non-Cleveland strains, produced highly toxic conidia (>90 microgram of T2 toxin equivalents per g [wet weight] of conidia) after 10 and 30 days of growth on wet wallboard. Only 3 of the 28 strains examined both were consistently hemolytic and produced highly toxic conidia. Each of these strains was isolated from a house in Cleveland where an infant had idiopathic pulmonary hemorrhage.
New technologies are creating the potential for using nucleic acid sequence detection to perform routine microbiological analyses of environmental samples. Our laboratory has recently reported on the development of a method for the quantitative detection of Stachybotrys chartarum...
The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...
Data points used to generate figures 2 through 6 in manuscript submission.
Excel files containing raw data used to generate figures throughout manuscript.This dataset is associated with the following publication:Dean , T., D. Betancourt , J. Kim, L. Harvey, A. Evans, and B. Grace. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types. INHALATION TOXICOLOGY. Taylor & Francis, Inc., Philadelphia, PA, USA, 28(7): 303-307, (2016).
Carey, Stephan A; Plopper, Charles G; Hyde, Dallas M; Islam, Zahidul; Pestka, James J; Harkema, Jack R
2012-08-01
Satratoxin-G (SG) is a trichothecene mycotoxin of Stachybotrys chartarum, the black mold suggested to contribute etiologically to illnesses associated with water-damaged buildings. We have reported that intranasal exposure to SG evokes apoptosis of olfactory sensory neurons (OSNs) and acute inflammation in the nose and brain of laboratory mice. To further assess the potential human risk of nasal airway injury and neurotoxicity, we developed a model of SG exposure in monkeys, whose nasal airways more closely resemble those of humans. Adult, male rhesus macaques received a single intranasal instillation of 20 µg SG (high dose, n = 3), or 5 µg SG daily for four days (repeated low dose, n = 3) in one nasal passage, and saline vehicle in the contralateral nasal passage. Nasal tissues were examined using light and electron microscopy and morphometric analysis. SG induced acute rhinitis, atrophy of the olfactory epithelium (OE), and apoptosis of OSNs in both groups. High-dose and repeated low-dose SG elicited a 13% and 66% reduction in OSN volume density, and a 14-fold and 24-fold increase in apoptotic cells of the OE, respectively. This model provides new insight into the potential risk of nasal airway injury and neurotoxicity caused by exposure to water-damaged buildings.
Mader, Douglas R; Yike, Iwona; Distler, Anne M; Dearborn, Dorr G
2007-09-01
Acute pulmonary hemorrhage developed during isoflurane anesthesia in 2 Himalayan cats undergoing routine dental cleaning and prophylaxis. The cats were siblings and lived together. In both cats, results of pre-operative physical examinations and laboratory testing were unremarkable. Blood pressure and oxygen saturation were within reference ranges throughout the dental procedure. Approximately 15 to 20 minutes after administration of isoflurane was begun, frothy blood was noticed within the endotracheal tube. Blood was suctioned from the endotracheal tube, and the cats were allowed to recover from anesthesia. 1 cat initially responded to supportive care but developed a second episode of spontaneous pulmonary hemorrhage approximately 30 hours later and died. The other cat responded to supportive care and was discharged after 4 days, but its condition deteriorated, and the cat died 10 days later. Subsequently, it was discovered that the home was severely contaminated with mold as a result of storm damage that had occurred approximately 7 months previously. Retrospective analysis of banked serum from the cats revealed satratoxin G, a biomarker for Stachybotrys chartarum, commonly referred to as "toxic black mold." Findings highlight the potential risk of acute pulmonary hemorrhage in animals living in an environment contaminated with mold following flood damage.
Lewinska, Anna M; Hoof, Jakob B; Peuhkuri, Ruut H; Rode, Carsten; Lilje, Osu; Foley, Matthew; Trimby, Patrick; Andersen, Birgitte
2016-10-01
Fungal growth in indoor environments is associated with many negative health effects. Many studies focus on brown- and white-rot fungi and their effect on wood, but there is none that reveals the influence of soft-rot fungi, such as Stachybotrys spp. and Chaetomium spp., on the structure of building materials such as plywood and gypsum wallboard. This study focuses on using micro-computed tomography (microCT) to investigate changes of the structure of plywood and gypsum wallboard during fungal degradation by S. chartarum and C. globosum. Changes in the materials as a result of dampness and fungal growth were determined by measuring porosity and pore shape via microCT. The results show that the composition of the building material influenced the level of penetration by fungi as shown by scanning electron microscopy (SEM). Plywood appeared to be the most affected, with the penetration of moisture and fungi throughout the whole thickness of the sample. Conversely, fungi grew only on the top cardboard in the gypsum wallboard and they did not have significant influence on the gypsum wallboard structure. The majority of the observed changes in gypsum wallboard occurred due to moisture. This paper suggests that the mycelium distribution within building materials and the structural changes, caused by dampness and fungal growth, depend on the type of the material. Copyright © 2016 Elsevier B.V. All rights reserved.
Testing antimicrobial cleaner efficacy on gypsum wallboard contaminated with Stachybotrys chartarum.
Menetrez, Marc Y; Foarde, Karin K; Webber, Tricia D; Dean, Timothy R; Betancourt, Doris A
2007-11-01
Reducing occupant exposure to indoor mold is the goal of this research, through the efficacy testing of antimicrobial cleaners. Often mold contaminated building materials are not properly removed, but instead surface cleaners are applied in an attempt to alleviate the problem. The efficacy of antimicrobial cleaners to remove, eliminate or control mold growth on surfaces can easily be tested on non-porous surfaces. However, the testing of antimicrobial cleaner efficacy on porous surfaces, such as those found in the indoor environment such as gypsum board can be more complicated and prone to incorrect conclusions regarding residual organisms. The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as gypsum wallboard has been frequently documented. Research to control S. chartarum growth using 13 separate antimicrobial cleaners on contaminated gypsum wallboard has been performed in laboratory testing. Popular brands of cleaning products were tested by following directions printed on the product packaging. A variety of gypsum wallboard surfaces were used to test these cleaning products at high relative humidity. The results indicate differences in antimicrobial efficacy for the six month period of testing. Results for the six types of GWB surfaces varied extensively. However, three cleaning products exhibited significantly better results than others. Lysol All-Purpose Cleaner-Orange Breeze (full strength) demonstrated results which ranked among the best in five of the six surfaces tested. Both Borax and Orange Glo Multipurpose Degreaser demonstrated results which ranked among the best in four of the six surfaces tested. The best antimicrobial cleaner to choose is often dependent on the type of surface to be cleaned of S. chartarum contamination. For Plain GWB, no paint, the best cleaners were Borax, Lysol All-Purpose Cleaner-Orange Breeze (full strength), Orange Glo Multipurpose Degreaser, and Fantastik Orange Action. These results are not meant to endorse the incomplete removal of mold contaminated building materials. However, it is recognized that complete removal may not always be possible and solutions to control mold regrowth may contribute to reduced occupant exposure. Current recommendations of removal and replacement of porous building materials should be followed. It is not the intension of this discussion to endorse any product. Reporting on the performance of these products under the stated conditions was and remains the only purpose.
Culturability and toxicity of sick building syndrome-related fungi over time.
Wilson, Stephen C; Carriker, Curtis G; Brasel, Trevor L; Karunasena, Enusha; Douglas, David R; Wu, Chunfa; Andriychuk, Larysa A; Fogle, Matthew R; Martin, Jared M; Straus, David C
2004-08-01
Two experiments were conducted regarding the culturability and toxicity of fungi located on building materials over time and the efficacy of seven laboratory techniques in recovering culturable fungi from sample swabs. In the first experiment, eight sections of drywall were inoculated with Stachybotrys chartarum and stored at 25 +/- 5 degrees Celsius and 20-60% relative humidity (RH) for up to two years. Another eight sections of ceiling tile were stored at 100% RH for 1 year. Six sections of ceiling tile and 15 swabs were also inoculated with Penicillium chrysogenum and S. chartarum respectively and stored under the same conditions for 8 months and 3.3 years. All materials were tested for culturability at the end of the storage period. S. chartarum-inoculated samples were also tested for toxicity. In the second experiment (replicated twice), S. chartarum and Chaetomium globosum were inoculated onto 84 swabs each. Storage was up to 266 days at 25 +/- 5 degrees Celsius and 20-60% RH. Seven techniques were compared regarding the recovery of culturable fungi from the swabs over different time points. Results for Experiment 1 showed that all samples were culturable after the storage period and that the S. chartarum-inoculated drywall samples were toxic. In Experiment 2, all techniques showed high rates of recovery. These data show that despite being without a water source, these organisms can be culturable and toxic after long periods of time under conditions similar to human-occupied dwellings and that a number of preparation techniques are suitable for the recovery of these fungi from inoculated swabs.
Islam, Zahidul; Harkema, Jack R.; Pestka, James J.
2006-01-01
Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the “black mold” suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose–response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 μg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 μg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 μg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-α, interleukin-6 (IL-6), and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings. PMID:16835065
Islam, Zahidul; Harkema, Jack R; Pestka, James J
2006-07-01
Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the "black mold" suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose-response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 microg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 microg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 microg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-alpha, interleukin-6 (IL-6) , and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings.
Epidemics of mold poisoning past and present.
Meggs, William J
2009-01-01
Molds are ubiquitous throughout the biosphere of planet earth and cause infectious, allergic, and toxic diseases. Toxic diseases arise from exposure to mycotoxins produced by molds. Throughout history, there have been a number of toxic epidemics associated with exposure to mycotoxins. Acute epidemics of ergotism are caused by consumption of grain infested by fungi of the genus Claviceps, which produce the bioactive amine ergotamine that mimics the neurotransmitters norepinephrine, serotonin, and dopamine. Acute aflatoxin outbreaks have occurred from ingestion of corn stored in damp conditions that potentiate growth of the molds of the species Aspergillus. Contemporary construction methods that use cellulose substrates such as fiber board and indoor moisture have caused an outbreak of contaminated buildings with Stachybotrys chartarum, with the extent of health effects still a subject of debate and ongoing research. This article reviews several of the more prominent epidemics and discusses the nature of the toxins. Two diseases that were leading causes of childhood mortality in England in the 1970s and vanished with changing dietary habits, putrid malignant fever, and slow nervous fever were most likely toxic mold epidemics.
McCrae, K C; Rand, T; Shaw, R A; Mason, C; Oulton, M R; Hastings, C; Cherlet, T; Thliveris, J A; Mantsch, H H; MacDonald, J; Scott, J E
2001-03-01
Lung cells are among the first tissues of the body to be exposed to air-borne environmental contaminants. Consequently the function of these cells may be altered before other cells are affected. As gas exchange takes place in the lungs, changes in cellular function may have serious implications for the processes of oxygen uptake and carbon dioxide elimination. In order for these processes to occur, the lung must maintain a high degree of expandability. This latter function is accomplished in part by the pulmonary surfactant which is synthesized and released by alveolar type II cells. Earlier studies have shown that exposure to gas phase materials such as smoke or organic solvents can alter the composition and function of the surfactant. The present study examines the ability of highly toxigenic mold spores to alter surfactant composition. Stachybotrys chartarum spores suspended in saline were instilled into mouse trachea as described earlier. After 24 h, the lungs were lavaged and the different processing stages of surfactant isolated by repeated centrifugation. Intracellular surfactant was isolated from the homogenized lung tissue by centrifugation on a discontinuous sucrose gradient. Samples were extracted into chloroform-methanol, dried and analyzed by Fourier-Transform infrared spectroscopy (FTIR). Exposure to S. chartarum induced an overall reduction of phospholipid among the three surfactant subfractions. The intermediate and spent surfactant fractions in particular were reduced to about half of the values observed in the saline-treated group. The relative distribution of phospholipid was also altered by spore exposure. Within the intracellular surfactant pool, higher levels of phospholipid were detected after spore exposure. In addition, changes were observed in the nature of the phospholipids. In particular strong intramolecular hydrogen bonding, together with other changes, suggested that spore exposure was associated with absence of an acyl chain esterified on the glycerol backbone, resulting in elevated levels of lysophospholipid in the samples. This study shows that mold spores and their products induce changes in regulation of both secretion and synthesis of surfactant, as well as alterations in the pattern of phospholipid targeting to the pulmonary surfactant pools.
Black, J A; Foarde, K K; Menetrez, M Y
2006-08-01
It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, the method of recovering native mycotoxin has been without consensus. Inconsistencies occur in the methods of isolation, suspension, preparation, and quantitation of the mycotoxin from the spores. The purpose of this study was to provide quantitatively comparative data on three concurrent preparations of 10(6)S. chartarum spores. The experiments were designed to specifically evaluate a novel method of mycotoxin extraction, solubilization, and the subsequent inhibitory effect in an established in vitro luminescence protein translation assay from 30 day-old spores. The mycotoxin-containing spores swabbed from wallboard cultures were milled with and without glass beads in 100% methanol, 95% ethanol, or water. Milled spore lysates were cleared of cell debris by filter centrifugation followed by a second centrifugation through a 5000 MWCO filter to remove interfering proteins and RNases. Cleared lysate was concentrated by centrivap and suspended in either alcohol or water as described. The suspensions were used immediately in the in vitro luminescence protein translation assay with the trichothecene, T-2 toxin, as a control. Although, mycotoxin is reported to be alcohol soluble, the level of translation inhibition was not reliably satisfactory for either the methanol or ethanol preparations. In fact, the methanol and ethanol control reactions were not significantly different than the alcohol prepared spore samples. In addition, we observed that increasing amounts of either alcohol inhibited the reaction in a dose dependent manner. This suggests that although alcohol isolation of mycotoxin is desirable in terms of time and labor, the presence of alcohol in the luminescence protein translation reaction was not acceptable. Conversely, water extraction of mycotoxin demonstrated a dose dependent response, and there was significant difference between the water controls and the water extracted mycotoxin reactions. In our hands, water was the best extraction agent for mycotoxin when using this specific luminescence protein translation assay kit.
Kim, J H; Harvey, L A; Evans, A L; Byfield, G E; Betancourt, D A; Dean, T R
2016-06-01
The many benefits of building "green" have motivated the use of sustainable products in the design and execution of the built environment. However, the use of these natural or recycled materials, some of which have been treated with antimicrobials, provides a growth opportunity for microorganisms with the potential to elicit adverse health effects especially in the presence of an antimicrobial. The focus of this research was to determine the effects of Stachybotrys chartarum (strains Houston and 51-11) grown under different conditions on a macrophage cell line (Raw 264.7) using endpoints, including cytotoxicity, and those associated with immunity specifically inflammation and MHC class II expression. The fungi were grown on four different gypsum products, and macrophages were exposed to whole spores of both strains and fragmented spores of strain 51-11. Whole spores of the Houston strain elicited no cytotoxicity with some level of inflammation, while exposure to whole spores of 51-11 caused variable responses depending on the wallboard type supporting the fungal growth. High concentrations of fragmented 51-11 spores primarily resulted in the apoptosis of macrophage with no inflammation. None of the fungal strains caused elevated levels of major histocompatibility complex (MHC) class II expression on the surface of Raw cells. Mycotoxin levels of 51-11 spores from all of the wallboard types measured >250 ng/μL of T2 equivalent toxin based on activity. Collectively, the data demonstrated that all of the wallboard types supported growth of fungi with the ability to elicit harmful biological responses with the potential to negatively impact human health.
Norbäck, Dan; Cai, Gui-Hong
2011-10-01
There is little information on the indoor environment in hotels. Analysis of fungal DNA by quantitative PCR (qPCR) is a new method which can detect general and specific sequences. Dust was collected through swab sampling of door frames in 69 hotel rooms in 20 countries in Europe and Asia (2007-2009). Five sequences were detected by qPCR: total fungal DNA, Aspergillus and Penicillium DNA (Asp/Pen DNA), Aspergillus versicolor (A. versicolor DNA), Stachybotrys chartarum (S. chartarum DNA) and Streptomyces spp. (Streptomyces DNA). Associations were analysed by multiple linear regression. Total fungal DNA (GM = 1.08 × 10(8) cell equivalents m(-2); GSD = 6.36) and Asp/Pen DNA (GM = 1.79 × 10(7) cell equivalents m(-2); GSD = 10.12) were detected in all rooms. A. versicolor DNA, S. chartarum DNA and Streptomyces DNA were detected in 84%, 28% and 47% of the samples. In total, 20% of the rooms had observed dampness/mould, and 30% had odour. Low latitude (range 1.5-64.2 degrees) was a predictor of Asp/Pen DNA. Seaside location, lack of mechanical ventilation, and dampness or mould were other predictors of total fungal DNA and Asp/Pen DNA. Hotel ranking (Trip Advisor) or self-rated quality of the interior of the hotel room was a predictor of total fungal DNA, A. versicolor DNA and Streptomyces DNA. Odour was a predictor of S. chartarum DNA. In conclusion, fungal DNA in swab samples from hotel rooms was related to latitude, seaside location, ventilation, visible dampness and indoor mould growth. Hotels in tropical areas may have 10-100 times higher levels of common moulds such as Aspergillus and Penicillium species, as compared to a temperate climate zone.
Microfungi in cultivated fields in Eskişehir provience (Turkey).
Demirel, Rasime; Ilhan, Semra; Asan, Ahmet; Kinaci, Engin; Oner, Setenay
2005-01-01
The soil microfungi flora was investigated in four locations of Eskişehir (Turkey). 56 soil samples were seasonaly collected from 14 stations in the areas of Karacahöyük, Bahçecik, OGU I, and OGU II. A total of 110 species belonging to 32 genera were encountered including Absidia, Acremonium, Alternaria, Aspergillus, Beauveria, Botryoderma, Chaetomium, Chrysosporium, Cladosporium, Eupenicillium, Eurotium, Fusarium, Geotrichum, Gliocladium, Gonytrichum, Metarrhizium, Mucor, Myrothecium, Paecilomyces, Penicillium, Phoma, Plectosphaerella, Rhizoctania, Rhizopus, Scopulariopsis, Septonema, Stachybotrys, Trichocladium, Trichoderma, Ulocladium, Verticillium, and Wardomyces. Twenty five species were more frequent (all locations) while twenty seven species were rare (only one sample). Mainly, Acremonium kiliense, Aspergillus ochraceus, A. terricola var. americanus, A. versicolor, Cladosporium cladosporioides, Fusarium oxysporum, F. solani, Gliocladium roseum, Penicillium chrysogenum, P. corylophum, P. expansum, P. griseofulvum, P. implicatum, P. restrictum, and Stachybotrys chartarum were the most common and abundant microfungi in all locations. Five species Aspergillus subsessilis, A. terreus var. africanus, Eupenicillium egyptiacum, Paecilomyces ramosus, and Penicillium novae-zeelandiae are likely to be newly recorded for Turkey. The microfungi number in Eskişehir soils was between 25,000-234,000 CFU/g (mean value at 126,375 CFU/g). Copyright (c) 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mycotoxins from mould infested building materials.
Nielsen, K F
2000-03-01
Only limited documentation of non-allergenic, especially toxic reactions after inhalation of microfungal spores in water damaged buildings exists. Recently attention has been drawn to the mycotoxins as causal compounds, as some the dominating genera found in buildings are well known mycotoxin producers.Penicillium chrysogenum and A. ustus do not seem to produce any known mycotoxins when growing on building materials, whereasP. brevicompactum produces mycophenolic acid, someP. polonicum produces verrucosidin and verrucofortine,A. versicolor produces sterigmatocystins,A. niger produces nigragillin, orlandin, naphtho-γ-pyrones and tetracyclic compounds, someA. ochraceus produces ochratoxin A,Alternaria spp. produce alternariol and alternariol monomethyl ether,Chaetomium globosum produce chaetoglobosins, and finally 30-40% ofStachybotrys chartarum isolates from buildings produce macrocyclic trichothecenes and a number of other biologically active compounds.
Murtoniemi, T; Hirvonen, M-R; Nevalainen, A; Suutari, M
2003-03-01
Microbial growth on water-damaged building materials is commonly associated with adverse health effects in the occupants. We examined the growth of Stachybotrys chartarum, Aspergillus versicolor, Penicillium spinulosum, and Streptomyces californicus, isolated from water-damaged buildings, on six different brands of plasterboards. The microbial growth was compared with the biological activity of the spores, that is the potential to induce cytotoxicity and proinflammatory mediators in RAW264.7 macrophages. These results showed that the microbial growth on plasterboard depended on both the microbial strain and the brand of plasterboard used. The biological activity of spores appeared to be regulated by different growth conditions on plasterboards so that good microbial growth was associated with a low bioactivity of the spores, whereas the spores collected from plasterboard supporting only weak growth usually were biologically active. Cytotoxicity of either S. chartarum or A. versicolor did not correlate with any particular growth conditions or induced inflammatory responses. Instead, there were positive correlations between cytotoxicity and levels of induced proinflammatory cytokines for P. spinulosum and S. californicus. These data suggest that both the microbial growth on plasterboard and the resulting bioactivity of spores vary and might be affected by changing the growth conditions provided by the plasterboards.
Aerosolization of Particulate (1→3)-β-d-Glucan from Moldy Materials▿
Seo, Sung-Chul; Reponen, Tiina; Levin, Linda; Borchelt, Tiffany; Grinshpun, Sergey A.
2008-01-01
Mold-damaged building materials may contain biologically active agents, such as (1→3)-β-d-glucan, allergens, and mycotoxins, which have been associated with adverse health effects. The release of these components from contaminated surfaces into the air is not well understood. The purpose of this study was to characterize the release of particulate (1→3)-β-d-glucan from the surface of artificially mold-contaminated materials. Aspergillus versicolor and Stachybotrys chartarum were grown on malt extract agar (MEA), white ceiling tiles, and a wall-papered gypsum board for 1 and 6 months. The (1→3)-β-d-glucan on the surfaces of moldy materials and in air samples collected from these materials was analyzed by the Limulus amebocyte lysate assay. The aerosolization ratio was defined as the amount of (1→3)-β-d-glucan in the air divided by the amount on the surface. The results showed that the aerosolization of particulate (1→3)-β-d-glucan was influenced mainly by the type of material and the fungal species. For A. versicolor, the aerosolization ratios of particulate (1→3)-β-d-glucan released from the three types of material were not significantly different. However, the ratios for S. chartarum released from ceiling tiles and gypsum board were significantly higher than the ratios for this organism released from MEA (P < 0.001) and were comparable to those for A. versicolor. These findings indicate that the use of MEA in aerosolization experiments is likely to underestimate the release of S. chartarum particles from building materials. These results provide important background information for design of future laboratory or animal experiments, as well as for interpretation of field measurement data. PMID:18065630
Differentiation of Toxic Molds via Headspace SPME-GC/MS and Canine Detection
Griffith, Robert T.; Jayachandran, Krishnaswamy; Shetty, Kateel G.; Whitstine, William; Furton, Kenneth G.
2007-01-01
Indoor mold growth has recently become a concern in the legal world in regards to insurance litigation. Hazardous mold exposure to humans has been linked to many acute and chronic adverse health effects including death. As it grows, mold produces several types of primary and secondary metabolites, including microbial volatile organic compounds (MVOCs). Microbial volatile organic compound emission may be used as a preliminary indication of a mold infestation that is invisible to the unaided eye. The objective of the study is to identify the unique odor signatures of three species of molds, Aspergillus versicolor, Penicillium chrysogenum, and Stachybotrys chartarum by SPME-GC/MS analysis. Determining the compounds that are emitted by the selected species has made it possible to conduct validation studies of canine detection of these mold species through a series of field tests.
Occurrence of itraconazole-tolerant micromycetes in the soil and food products.
Piecková, E; Jesenská, Z
1999-01-01
Unexpected pathogens from the environment represent considerable risk for humans with impaired health. We examined the occurrence of itraconazole tolerant micromycetes in soil and in maize products. Five concentrations of itraconazole (2.5-12.5 micrograms/mL) selected according to known treatment schedules for human patients were incorporated into Sabouraud agar with chloramphenicol and Rose Bengal and diluted samples were inoculated onto the agar surface. After 7-d growth at 22 degrees C colonies of Alternaria sp., Aspergillus clavatus, A. glaucus group, A. flavus, A. fumigatus, A. niger group, A. ochraceus group, A. ochraceus, Chaetomium sp., Cladosporium cladosporioides, Cylindrocarpon sp., Doratomyces sp., Fusarium sp., F. moniliforme, F. oxysporum, F. solani, F. subglutinans, Marianaea elegans, Mortierella sp., Mucor sp., Myrothecium sp., Penicillium sp., Rhizopus sp., Scopulariopsis brevicaulis, Sepedonium sp., Stachybotrys chartarum, Stemphylium sp., Torula humicola and Trichoderma viride were isolated.
Ijaz, M Khalid; Zargar, Bahram; Wright, Kathryn E; Rubino, Joseph R; Sattar, Syed A
2016-09-02
Indoor air can be an important vehicle for a variety of human pathogens. This review provides examples of airborne transmission of infectious agents from experimental and field studies and discusses how airborne pathogens can contaminate other parts of the environment to give rise to secondary vehicles leading air-surface-air nexus with possible transmission to susceptible hosts. The following groups of human pathogens are covered because of their known or potential airborne spread: vegetative bacteria (staphylococci and legionellae), fungi (Aspergillus, Penicillium, and Cladosporium spp and Stachybotrys chartarum), enteric viruses (noro- and rotaviruses), respiratory viruses (influenza and coronaviruses), mycobacteria (tuberculous and nontuberculous), and bacterial spore formers (Clostridium difficile and Bacillus anthracis). An overview of methods for experimentally generating and recovering airborne human pathogens is included, along with a discussion of factors that influence microbial survival in indoor air. Available guidelines from the U.S. Environmental Protection Agency and other global regulatory bodies for the study of airborne pathogens are critically reviewed with particular reference to microbial surrogates that are recommended. Recent developments in experimental facilities to contaminate indoor air with microbial aerosols are presented, along with emerging technologies to decontaminate indoor air under field-relevant conditions. Furthermore, the role that air decontamination may play in reducing the contamination of environmental surfaces and its combined impact on interrupting the risk of pathogen spread in both domestic and institutional settings is discussed. Copyright © 2016. Published by Elsevier Inc.
Huttunen, Kati; Hyvärinen, Anne; Nevalainen, Aino; Komulainen, Hannu; Hirvonen, Maija-Riitta
2003-01-01
We compared the inflammatory and cytotoxic responses caused by household mold and bacteria in human and mouse cell lines. We studied the fungi Aspergillus versicolor, Penicillium spinulosum, and Stachybotrys chartarum and the bacteria Bacillus cereus, Pseudomonas fluorescens, and Streptomyces californicus for their cytotoxicity and ability to stimulate the production of inflammatory mediators in mouse RAW264.7 and human 28SC macrophage cell lines and in the human A549 lung epithelial cell line in 24-hr exposure to 10(5), 10(6), and 10(7) microbes/mL. We studied time dependency by terminating the exposure to 10(6) microbes/mL after 3, 6, 12, 24, and 48 hr. We analyzed production of the cytokines tumor necrosis factor-alpha and interleukins 6 and 1ss (TNF-alpha, IL-6, IL-1ss, respectively) and measured nitric oxide production using the Griess method, expression of inducible NO-synthase with Western Blot analysis, and cytotoxicity with the MTT-test. All bacteria strongly induced the production of TNF-alpha, IL-6 and, to a lesser extent, the formation of IL-1ss in mouse macrophages. Only the spores of Str. californicus induced the production of NO and IL-6 in both human and mouse cells. In contrast, exposure to fungal strains did not markedly increase the production of NO or any cytokine in the studied cell lines except for Sta. chartarum, which increased IL-6 production somewhat in human lung epithelial cells. These microbes were less cytotoxic to human cells than to mouse cells. On the basis of equivalent numbers of bacteria and spores of fungi added to cell cultures, the overall potency to stimulate the production of proinflammatory mediators decreased in the order Ps. fluorescens > Str. californicus > B. cereus > Sta. chartarum > A. versicolor > P. spinulosum. These data suggest that bacteria in water-damaged buildings should also be considered as causative agents of adverse inflammatory effects.
Huttunen, Kati; Hyvärinen, Anne; Nevalainen, Aino; Komulainen, Hannu; Hirvonen, Maija-Riitta
2003-01-01
We compared the inflammatory and cytotoxic responses caused by household mold and bacteria in human and mouse cell lines. We studied the fungi Aspergillus versicolor, Penicillium spinulosum, and Stachybotrys chartarum and the bacteria Bacillus cereus, Pseudomonas fluorescens, and Streptomyces californicus for their cytotoxicity and ability to stimulate the production of inflammatory mediators in mouse RAW264.7 and human 28SC macrophage cell lines and in the human A549 lung epithelial cell line in 24-hr exposure to 10(5), 10(6), and 10(7) microbes/mL. We studied time dependency by terminating the exposure to 10(6) microbes/mL after 3, 6, 12, 24, and 48 hr. We analyzed production of the cytokines tumor necrosis factor-alpha and interleukins 6 and 1ss (TNF-alpha, IL-6, IL-1ss, respectively) and measured nitric oxide production using the Griess method, expression of inducible NO-synthase with Western Blot analysis, and cytotoxicity with the MTT-test. All bacteria strongly induced the production of TNF-alpha, IL-6 and, to a lesser extent, the formation of IL-1ss in mouse macrophages. Only the spores of Str. californicus induced the production of NO and IL-6 in both human and mouse cells. In contrast, exposure to fungal strains did not markedly increase the production of NO or any cytokine in the studied cell lines except for Sta. chartarum, which increased IL-6 production somewhat in human lung epithelial cells. These microbes were less cytotoxic to human cells than to mouse cells. On the basis of equivalent numbers of bacteria and spores of fungi added to cell cultures, the overall potency to stimulate the production of proinflammatory mediators decreased in the order Ps. fluorescens > Str. californicus > B. cereus > Sta. chartarum > A. versicolor > P. spinulosum. These data suggest that bacteria in water-damaged buildings should also be considered as causative agents of adverse inflammatory effects. PMID:12515684
Mold growth on gypsum wallboard--a summary of three techniques.
Menetrez, M Y; Foarde, K K; Webber, T D; Dean, T R; Betancourt, D A
2009-01-01
Reducing occupant exposure to mold growing on damp gypsum wallboard and controlling mold contamination in the indoor environment was studied through 1) delineation of environmental conditions required to promote and avoid mold growth and 2) efficacy testing of antimicrobial products, specifically cleaners and paints, on gypsum wallboard (GWB) surfaces. The effects of moisture and relative humidity (RH) on mold growth and transport are important in avoiding and eliminating problems. These effects have been demonstrated on GWB and are discussed in this article for use as control guidance. The authors discuss the efficacy of antimicrobial cleaners and paints to remove, eliminate, or control mold growth on GWB. Research to control Stachybotrys chartarum growth using 13 separate antimicrobial cleaners and nine varieties of antimicrobial paint on contaminated GWB was performed in laboratory testing. GWB surfaces were subjected to high RH. GWB control measures are summarized and combined, and the antimicrobial product results are explained.
A method for detecting fungal contaminants in wall cavities.
Spurgeon, Joe C
2003-01-01
This article describes a practical method for detecting the presence of both fungal spores and culturable fungi in wall cavities. Culturable fungi were collected in 25 mm cassettes containing 0.8 microm mixed cellulose ester filters using aggressive sampling conditions. Both culturable fungi and fungal spores were collected in modified slotted-disk cassettes. The sample volume was 4 L. The filters were examined microscopically and dilution plated onto multiple culture media. Collecting airborne samples in filter cassettes was an effective method for assessing wall cavities for fungal contaminants, especially because this method allowed the sample to be analyzed by both microscopy and culture media. Assessment criteria were developed that allowed the sample results to be used to classify wall cavities as either uncontaminated or contaminated. As a criterion, wall cavities with concentrations of culturable fungi below the limit of detection (LOD) were classified as uncontaminated, whereas those cavities with detectable concentrations of culturable fungi were classified as contaminated. A total of 150 wall cavities was sampled as part of a field project. The concentrations of culturable fungi were below the LOD in 34% of the samples, whereas Aspergillus and/or Penicillium were the only fungal genera detected in 69% of the samples in which culturable fungi were detected. Spore counting resulted in the detection of Stachybotrys-like spores in 25% of the samples that were analyzed, whereas Stachybotrys chartarum colonies were only detected on 2% of malt extract agar plates and on 6% of corn meal agar plates.
Antifungal properties of silver nanoparticles against indoor mould growth.
Ogar, Anna; Tylko, Grzegorz; Turnau, Katarzyna
2015-07-15
The presence of moulds in indoor environments causes serious diseases and acute or chronic toxicological syndromes. In order to inhibit or prevent the growth of microorganisms on building materials, the disruption of their vital processes or the reduction of reproduction is required. The development of novel techniques that impair the growth of microorganisms on building materials is usually based on silver nanoparticles (AgNPs). It makes them an alternative to other biocides. AgNPs have proven antibacterial activity and became promising in relation to fungi. The aim of the study was to assess growth and morphology of mycelia of typical indoor fungal species: Penicillium brevicompactum, Aspergillus fumigatus, Cladosporium cladosporoides, Chaetomium globosum and Stachybotrys chartarum as well as Mortierella alpina, cultured on agar media. The antifungal activity of AgNPs was also tested in relation to C. globosum and S. chartarum grown on the surface of gypsum drywall. It was found that the presence of AgNPs in concentrations of 30-200mg/l significantly decreased the growth of fungi. However, in the case of M. alpina, AgNPs stimulated its growth. Moreover, strong changes in moulds morphology and colour were observed after administration of AgNPs. Parameters of conidiophores/sporangiophores varied depending on mould region and changed significantly after treatment with AgNPs. The experiments have shown antifungal properties of AgNPs against common indoor mould species. Their application to building materials could effectively protect indoor environments from mould development. However, consideration must be given to the fact that the growth of some fungal strains might be stimulated by AgNPs. Copyright © 2015 Elsevier B.V. All rights reserved.
Mycoflora and mycotoxin-producing fungi of air-dust particles from Egypt.
Abdel-Hafez, S I; Shoreit, A A; Abdel-Hafez, A I; el Maghraby, O M
1986-01-01
Using the dilution-plate method, 27 genera and 64 species were collected from 20 air-dust samples on glucose - (24 genera and 57 species) and cellulose - (21 genera and 45 species) Czapek's agar at 28 degrees C. There are basic similarities between the mycoflora of air-dust on the two media and the most prevalent species were Aspergillus niger, A. flavus, A. ochraceus, A. terreus, A. versicolor, Penicillium chrysogenum, P. funiculosum, Alternaria alternata, Cladosporium herbarum, Fusarium oxysporum, Rhizopus stolonifer and Trichoderma viride. Chaetomium globosum, Stachybotrys chartarum, Humicola grisea and Arthrobotrys oligospora were common only on cellulose agar plates. Extracts of mycelium from 25 isolates were tested with brine schrimp (Artemia salina); of these 23 displayed varying degrees of toxicity. Thin layer chromatographic analysis of 12 isolates of Aspergillus flavus revealed that 4 strains were producing detectable aflatoxin. Zearalenone production was noted for 3 out of 5 strains of Fusarium oxysporum and 2 out of 5 strains of F. solani.
Potential of the volatile-producing fungus Muscodor albus for control of building molds.
Mercier, Julien; Jiménez, Jorge I
2007-03-01
The possibility of using the volatile-producing fungus Muscodor albus for biofumigation against building molds was investigated. Several species of Aspergillus and Penicillium as well as fungi belonging to nine other genera were inhibited or killed in vitro by volatiles produced by potato dextrose agar or rye grain cultures of M. albus. Trichoderma viride was the only fungus that was not inhibited by M. albus volatiles. To test biofumigation as a preventative treatment against fungal colonization of building material, dry pieces of gypsum drywall were fumigated with grain cultures of M. albus in closed boxes. After a simulated water damage and incubation under saturated humidity for 2 weeks, untreated drywall developed natural fungal populations of about 10(5)-10(6) cfu/cm2, while drywall fumigated with M. albus culture (20 g/11 L) had nondetectable fungal populations. To test for curative ability, moist pieces of drywall heavily colonized with Cladosporium cladosporioides, Aspergillus niger, or Stachybotrys chartarum were fumigated for 48 h with grain cultures of M. albus. Cladosporium cladosporioides was eliminated within 48 h, while A. niger and S. chartarum were usually more resistant. However, a longer curative fumigation of 96 h was effective in reducing A. niger or naturally occurring mold populations by about 5 log values. The production of volatile organic compounds from 20 g of rye grain culture in 11 L containers was monitored by solid-phase micro extraction and gas chromatography. Concentrations of isobutyric acid, the most abundant volatile, increased gradually in the headspace until it reached 25 microg/L (m/v) within 96 h. The second and third most abundant compounds, 2-methyl-1-butanol and isobutanol, peaked at about 10 and 5 microg/L (m/v), respectively, within the first 24 h and declined gradually afterwards.
Chemistry and toxicology of molds isolated from water-damaged buildings.
Jarvis, Bruce B
2002-01-01
There is increasing evidence of health risks associated with damp buildings and homes in which high levels of microbes are found. Although concerns have traditionally centered on microbial pathogens and allergenic effects, recent work has suggested that fungi pose the more serious risk. Evidence is accumulating that certain toxigenic molds are particularly a risk for human health through exposure, via inhalation, of fungal spores. Many of these fungi produce toxins (mycotoxins) some of which have been shown to cause animal and human intoxications, usually in an agricultural setting. The fungus, Stachybotrys chartarum (S. atra) is considered to be one of the more serious threats to people living and working in water-damaged buildings. This mold has a long history of being responsible for animal toxicoses, and in recent years, being associated with infant pulmonary hemosiderosis (bleeding in the lungs) of infants exposed to spores of this fungus in their homes. S. atra produces a variety of potent toxins and immunosuppressant agents, including a novel class of diterpenes (atranones) of unusual structure. More research is needed to determine the impact to health resulting from inhalation of toxigenic mold spores.
Reeslev, M.; Miller, M.; Nielsen, K. F.
2003-01-01
Two mold species, Stachybotrys chartarum and Aspergillus versicolor, were inoculated onto agar overlaid with cellophane, allowing determination of a direct measurement of biomass density by weighing. Biomass density, ergosterol content, and beta-N-acetylhexosaminidase (3.2.1.52) activity were monitored from inoculation to stationary phase. Regression analysis showed a good linear correlation to biomass density for both ergosterol content and beta-N-acetylhexosaminidase activity. The same two mold species were inoculated onto wallpapered gypsum board, from which a direct biomass measurement was not possible. Growth was measured as an increase in ergosterol content and beta-N-acetylhexosaminidase activity. A good linear correlation was seen between ergosterol content and beta-N-acetylhexosaminidase activity. From the experiments performed on agar medium, conversion factors (CFs) for estimating biomass density from ergosterol content and beta-N-acetylhexosaminidase activity were determined. The CFs were used to estimate the biomass density of the molds grown on gypsum board. The biomass densities estimated from ergosterol content and beta-N-acetylhexosaminidase activity data gave similar results, showing significantly slower growth and lower stationary-phase biomass density on gypsum board than on agar. PMID:12839773
Grantina-Ievina, Lelde; Andersone, Una; Berkolde-Pīre, Dace; Nikolajeva, Vizma; Ievinsh, Gederts
2013-12-01
The aim of the present paper was to show that differences in biological activity among commercially produced vermicompost samples can be found by using a relatively simple test system consisting of microorganism tests on six microbiological media and soilless seedling growth tests with four vegetable crop species. Significant differences in biological properties among analyzed samples were evident both at the level of microbial load as well as plant growth-affecting activity. These differences were mostly manufacturer- and feedstock-associated, but also resulted from storage conditions of vermicompost samples. A mature vermicompost sample that was produced from sewage sludge still contained considerable number of Escherichia coli. Samples from all producers contained several potentially pathogenic fungal species such as Aspergillus fumigatus, Pseudallescheria boidii, Pseudallescheria fimeti, Pseudallescheria minutispora, Scedosporium apiospermum, Scedosporium prolificans, Scopulariopsis brevicaulis, Stachybotrys chartarum, Geotrichum spp., Aphanoascus terreus, and Doratomyces columnaris. In addition, samples from all producers contained plant growth-promoting fungi from the genera Trichoderma and Mortierella. The described system can be useful both for functional studies aiming at understanding of factors affecting quality characteristics of vermicompost preparations and for routine testing of microbiological quality and biological activity of organic waste-derived composts and vermicomposts.
Stachybotrys, a mycotoxin-producing fungus of increasing toxicologic importance.
Fung, F; Clark, R; Williams, S
1998-01-01
Stachybotrys as a fungus has been implicated as a source of mycotoxins. While the toxicity of several well-known mycotoxins (aflatoxins) is well documented, recent studies on Stachybotrys have raised the question that mycotoxins produced by this fungus may be responsible for the health effects of occupants in water-damaged buildings. Published articles regarding Stachybotrys-related mycotoxins were reviewed with particular focus on human toxicity. A critical review of papers, reports, and studies on Stachybotrys mycotoxins revealed only descriptive reports of suspected animal and human poisoning secondary to consumption of mold-contaminated food products. No studies of good toxicologic and epidemiologic designs answer whether airborne mycotoxins produced by Stachybotrys could produce specific human toxicity. Current data on the toxicology of mycotoxins produced by Stachybotrys demonstrate that this group of mycotoxins is capable of producing immunosuppression and inflammatory insults to gastrointestinal and pulmonary systems. Case control study and case reports have suggested a possible association with environmental exposure to Stachybotrys mycotoxins, although a firm causal relationship has not been firmly established. Additional studies are needed to document that humans with sufficient exposure to these mycotoxins develop compatible clinical and pathologic pictures as demonstrated in animal models.
Stachybotrys: relevance to human disease.
Terr, A I
2001-12-01
Recent public concern about the danger of environmental fungi has focused attention on one particular mold, Stachybotrys. The purpose of this review is to examine and critique the published literature on Stachybotrys for objective scientific and clinical evidence of disease caused by the presence of this fungal organism in the environment. Data were obtained from all published research and reviews of Stachybotrys indexed in MEDLINE since 1966. The publications used for this review were those that contained information about human health effects of this microorganism. The critique of these publications is the author's. Stachybotrys is a minor component of the indoor mycoflora, found on certain building material surfaces in water-damaged buildings, but airborne spores are present in very low concentrations. Published reports fail to establish inhalation of Stachybotrys spores as a cause of human disease even in water-damaged buildings. A possible exception may be mycotoxin-caused pulmonary hemorrhage/hemosiderosis in infants, although scientific evidence to date is suggestive but not conclusive. Based on old reports ingestion of food prepared from Stachybotrys-contaminated grains may cause a toxic gastroenteropathy. No convincing cases of human allergic disease or infection from this mold have been published. The current public concern for adverse health effects from inhalation of Stachybotrys spores in water-damaged buildings is not supported by published reports in the medical literature.
JAAKKOLA, M S; LAITINEN, S; PIIPARI, R; UITTI, J; NORDMAN, H; HAAPALA, A-M; JAAKKOLA, J J K
2002-01-01
Immunoglobulin G (IgG) antibodies against microbes related to indoor dampness problems have been used as potential biomarkers of fungal exposure in clinical investigations. There is limited information on their relation to asthma. We conducted a population-based incident case–control study to assess the risk of asthma in relation to specific IgG antibodies to eight dampness-related microbes: Aspergillus fumigatus, A. versicolor, Cladosporium cladosporioides, Fusarium oxysporum, Sporobolomyces salmonicolor, Stachybotrys chartarum, Streptomyces albus and Trichoderma citrinoviride. We recruited systematically all new cases of asthma during a 2·5-year study period and randomly selected controls from a source population of adults 21–63 years of age living in the Pirkanmaa Hospital District, South Finland. The clinically diagnosed case series consisted of 521 adults with newly diagnosed asthma and the control series of 932 controls selected randomly from the source population. IgG antibodies were analysed with ELISA. An increased risk of developing asthma in adulthood was significantly related to IgG antibodies to T. citrinoviride, but not to the other moulds. There was no evidence of a dose–response relation between the IgG antibody level and the risk of asthma. T. citrinoviride may play a role in the aetiology of adult-onset asthma or serve as an indicator of other causal factors. PMID:12100029
Schöniger, S; Roschanski, N; Rösler, U; Vidovic, A; Nowak, M; Dietz, O; Wittenbrink, M M; Schoon, H-A
2016-01-01
Pyogranulomatous rhinitis associated with an algal infection was diagnosed in a 25-year-old gelding and a 23-year-old mare had necrotizing sinusitis with intralesional algae and pigmented fungi. Algae were identified immunohistochemically in both cases as Prototheca spp. In the gelding, further characterization by polymerase chain reaction and sequencing revealed that the organism was Prototheca zopfii genotype 2. Fungi from the mare were identified as Pithomyces chartarum by molecular analysis. Prototheca species are achlorophyllous algae and P. chartarum represents a dematiaceous fungus; they are saprophytes and facultative pathogens. Prototheca spp. and P. chartarum should be considered as rare respiratory pathogens of horses. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle
2013-01-01
The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980
Wu, Qiong; Li, Yaqian; Li, Yingying; Gao, Shigang; Wang, Meng; Zhang, Tailong; Chen, Jie
2013-01-01
Xylanolytic enzymes are widely used in processing industries, e.g., pulp and paper, food, livestock feeds, and textile. Furthermore, certain xylanotic enzymes have demonstrated the capability to improve the resistance and immunity of plants. Screening of high-yield microbial xylanolytic enzyme producers is significant for improving large-scale cost-effective xylanolytic enzyme production. This study provided new evidence of high-level xylanolytic enzyme production by a novel fungus, designated Leptosphaerulina chartarum SJTU59. Under laboratory conditions, L. chartarum SJTU59 produced xylanolytic enzymes of up to 17.566 U/mL (i.e., 878.307 U/g substrate). The enzyme solution was relatively stable over a wide range of pH (pH 3.0 to pH 9.0) and temperature (40°C to 65°C) while showing high resistance to the majority of metal ions tested. Composition analysis of the hydrolytic products of xylan showed sufficient degradation by xylanolytic enzymes from L. chartarum SJTU59, mainly the monosaccharide xylose, and a small amount of xylobiose were enzymatically produced; whereas in the presence of sufficient xylan substrates, mainly xylooligosaccharides, an emerging prebiotic used in food industry, were produced. In addition, the xylanolytic enzyme preparation from L. chartarum SJTU59 could initiate tissue necrosis and oxidative burst in tobacco leaves, which may be related to enhanced plant defense to adversity and disease. L. chartarum SJTU59 possessed a complex xylanolytic enzyme system, from which two novel endo-β-1,4-xylanases of the glycoside hydrolase (GH) family 10, one novel endo-β-1,4-xylanase of the GH family 11, and one novel β-xylosidase of the GH family 43 were obtained via rapid amplification of complementary DNA ends. Given the high yield and stable properties of xylanolytic enzymes produced by L. chartarum SJTU59, future studies will be conducted to characterize the properties of individual xylanolytic enzymes from L. chartarum SJTU59. xylanolytic enzymes-encoding gene(s) of potential use for industrial and agricultural applications will be screened to construct genetically engineered strains.
Use of Laccase as a Novel, Versatile Reporter System in Filamentous Fungi
Mander, Gerd J.; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C.; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G.; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nüsslein, Bernhard; Fischer, Reinhard
2006-01-01
Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2′-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km = 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain. PMID:16820501
Abdeen, Nishard; Cross, Albert; Cron, Gregory; White, Steven; Rand, Thomas; Miller, David; Santyr, Giles
2006-08-01
We used the dual capability of hyperpolarized 129Xe for spectroscopy and imaging to develop new measures of xenon diffusing capacity in the rat lung that (analogously to the diffusing capacity of carbon monoxide or DLCO) are calculated as a product of total lung volume and gas transfer rate constants divided by the pressure gradient. Under conditions of known constant pressure breath-hold, the volume is measured by hyperpolarized 129Xe MRI, and the transfer rate is measured by dynamic spectroscopy. The new quantities (xenon diffusing capacity in lung parenchyma (DLXeLP)), xenon diffusing capacity in RBCs (DLXeRBC), and total lung xenon diffusing capacity (DLXe)) were measured in six normal rats and six rats with lung inflammation induced by instillation of fungal spores of Stachybotrys chartarum. DLXeLP, DLXeRBC, and DLXe were 56 +/- 10 ml/min/mmHg, 64 +/- 35 ml/min/mmHg, and 29 +/- 9 ml/min/mmHg, respectively, for normal rats, and 27 +/- 9 ml/min/mmHg, 42 +/- 27 ml/min/mmHg, and 16 +/- 7 ml/min/mmHg, respectively, for diseased rats. Lung volumes and gas transfer times for LP (TtrLP) were 16 +/- 2 ml and 22 +/- 3 ms, respectively, for normal rats and 12 +/- 2 ml and 35 +/- 8 ms, respectively, for diseased rats. Xenon diffusing capacities may be useful for measuring changes in gas exchange associated with inflammation and other lung diseases. Copyright 2006 Wiley-Liss, Inc.
Use of laccase as a novel, versatile reporter system in filamentous fungi.
Mander, Gerd J; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nüsslein, Bernhard; Fischer, Reinhard
2006-07-01
Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2'-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km = 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain.
Lai, K M
2006-03-01
An extensive growth of Stachybotrys in water-damaged buildings is of great public health concern. It is inconclusive whether Stachybotrys is responsible for the reported health effects on the occupants in these contaminated environments. However, based on the veterinary, occupational and laboratory toxicity studies, it is reasonable to project that Stachybotrys can cause adverse health responses once the toxic level of the corresponding agents reached the target systems. In order to assess the risk to occupants in contaminated buildings, it is essential to outline and collect information for risk assessment. This review paper presents the current information in the format of hazard identification, dose-response and environmental characteristics and aims to discuss existing information with researchers and risk assessors and help to conduct risk characterization under different indoor conditions.
Prevalence of culturable airborne spores of selected allergenic and pathogenic fungi in outdoor air
NASA Astrophysics Data System (ADS)
O'Gorman, Céline M.; Fuller, Hubert T.
2008-06-01
Temporal and spatial variations in airborne spore concentrations of selected allergenic and pathogenic fungi were examined in Dublin, Ireland, in 2005. Air samples were taken at four outdoor locations in the city every 2 weeks, coupled with measurements of meteorological conditions. Total culturable airborne fungal spore concentrations in Dublin ranged from 30-6800 colony forming units per cubic metre of air (CFU m-3) over the 12-month period. Cladosporium, Penicillium, Aspergillus and Alternaria spores were constantly present in the Dublin atmosphere, representing >20% of the total culturable spore count. Concentrations of Cladosporium increased significantly in summer and reached allergenic threshold levels, peaking at over 3200 CFU m-3 in August. Penicillium spore concentrations never reached allergenic threshold levels, with average concentrations of <150 CFU m-3. Alternaria conidia formed only 0.3% of the total culturable fungal spore count and concentrations never exceeded 50 CFU m-3, attributable to the coastal position of Dublin and its low levels of arable production. The opportunistic human pathogen Aspergillus fumigatus was present throughout the year in nominal concentrations (<10 CFU m-3), but sporadic high counts were also recorded (300-400 CFU m-3), the potential health implications of which give cause for concern. Spores of neither Cryptococcus neoformans nor Stachybotrys chartarum were detected, but airborne basidiospores of Schizophyllum commune were evidenced by the dikaryotization of monokaryon tester strains following exposure to the air. The relationships between airborne fungal spore concentrations and meteorological factors were analysed by redundancy analysis and revealed positive correlations between temperature and Cladosporium and relative humidity and Penicillium and Aspergillus.
Occupational exposure to fungi and particles in animal feed industry.
Viegas, Carla; Faria, Tiago; Carolino, Elisabete; Sabino, Raquel; Gomes, Anita Quintal; Viegas, Susana
Very few studies regarding fungal and particulate matter (PM) exposure in feed industry have been reported, although such contaminants are likely to be a significant contributing factor to several symptoms reported among workers. The purpose of this study has been to characterize fungal and dust exposure in one Portuguese feed industry. Air and surface samples were collected and subject to further macro- and microscopic observations. In addition we collected other air samples in order to perform real-time quantitative polymerase chain reaction (PCR) amplification of genes from Aspergillus fumigatus and Aspergillus flavus complexes as well as Stachybotrys chartarum. Additionally, two exposure metrics were considered - particle mass concentration (PMC), measured in 5 different sizes (PM0.5, PM1, PM2.5, PM5, PM10), and particle number concentration (PNC) based on results given in 6 different sizes in terms of diameter (0.3 μm, 0.5 μm, 1 μm, 2.5 μm, 5 μm and 10 μm). Species from the Aspergillus fumigatus complex were the most abundant in air (46.6%) and in surfaces, Penicillium genus was the most frequently found (32%). The only DNA was detected from A. fumigatus complex. The most prevalent in dust samples were smaller particles which may reach deep into the respiratory system and trigger not only local effects but also the systemic ones. Future research work must be developed aiming at assessing the real health effects of these co-exposures. Med Pr 2016;67(2):143-154. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Saito, Rena; Park, Ju-Hyeong; LeBouf, Ryan; Green, Brett J.; Park, Yeonmi
2017-01-01
Gas chromatography-tandem mass spectrometry (GC-MS/MS) was used to detect fungal secondary metabolites. Detection of verrucarol, the hydrolysis product of Stachybotrys chartarum macrocyclic trichothecene (MCT), was confounded by matrix effects associated with heterogeneous indoor environmental samples. In this study, we examined the role of dust matrix effects associated with GC-MS/ MS to better quantify verrucarol in dust as a measure of total MCT. The efficiency of the internal standard (ISTD, 1,12-dodecanediol), and application of a matrix-matched standard correction method in measuring MCT in floor dust of water-damaged buildings was additionally examined. Compared to verrucarol, ISTD had substantially higher matrix effects in the dust extracts. The results of the ISTD evaluation showed that without ISTD adjustment, there was a 280% ion enhancement in the dust extracts compared to neat solvent. The recovery of verrucarol was 94% when the matrix-matched standard curve without the ISTD was used. Using traditional calibration curves with ISTD adjustment, none of the 21 dust samples collected from water damaged buildings were detectable. In contrast, when the matrix-matched calibration curves without ISTD adjustment were used, 38% of samples were detectable. The study results suggest that floor dust of water-damaged buildings may contain MCT. However, the measured levels of MCT in dust using the GC-MS/MS method could be significantly under- or overestimated, depending on the matrix effects, the inappropriate ISTD, or combination of the two. Our study further shows that the routine application of matrix-matched calibration may prove useful in obtaining accurate measurements of MCT in dust derived from damp indoor environments, while no isotopically labeled verrucarol is available. PMID:26853932
Antibodies to molds and satratoxin in individuals exposed in water-damaged buildings.
Vojdani, Aristo; Thrasher, Jack D; Madison, Roberta A; Gray, Michael R; Heuser, Gunnar; Campbell, Andrew W
2003-07-01
Immunoglobulin (Ig)A, IgM, and IgG antibodies against Penicillium notatum, Aspergillus niger, Stachybotrys chartarum, and satratoxin H were determined in the blood of 500 healthy blood donor controls, 500 random patients, and 500 patients with known exposure to molds. The patients were referred to the immunological testing laboratory for health reasons other than mold exposure, or for measurement of mold antibody levels. Levels of IgA, IgM, and IgG antibodies against molds were significantly greater in the patients (p < 0.001 for all measurements) than in the controls. However, in mold-exposed patients, levels of these antibodies against satratoxin differed significantly for IgG only (p < 0.001), but not for IgM or IgA. These differences in the levels of mold antibodies among the 3 groups were confirmed by calculation of z score and by Scheffé's significant difference tests. A general linear model was applied in the majority of cases, and 3 different subsets were formed, meaning that the healthy control groups were different from the random patients and from the mold-exposed patients. These findings indicated that mold exposure was more common in patients who were referred for immunological evaluation than it was in healthy blood donors. The detection of antibodies to molds and satratoxin H likely resulted from antigenic stimulation of the immune system and the reaction of serum with specially prepared mold antigens. These antigens, which had high protein content, were developed in this laboratory and used in the enzyme-linked immunosorbent assay (ELISA) procedure. The authors concluded that the antibodies studied are specific to mold antigens and mycotoxins, and therefore could be useful in epidemiological and other studies of humans exposed to molds and mycotoxins.
Jia, Cuihong; Sangsiri, Sutheera; Belock, Bethany; Iqbal, Tania R.; Pestka, James J.; Hegg, Colleen C.
2011-01-01
Intranasal aspiration of satratoxin G (SG), a mycotoxin produced by the black mold Stachybotrys chartarum, selectively induces apoptosis in olfactory sensory neurons (OSNs) in mouse olfactory epithelium (OE) through unknown mechanisms. Here, we show a dose-dependent induction of apoptosis 24 h post-SG exposure in vitro as measured by increased activated caspases in the OP6 olfactory placodal cell line and increased propidium iodide staining in primary OE cell cultures. Intranasal aspiration of SG increased TUNEL (Terminal dUTP Nick End Labeling) staining in the neuronal layer of the OE and significantly increased the latency to find a buried food pellet, confirming that SG selectively induces neuronal apoptosis and demonstrating that SG impairs the sense of smell. Next, we investigated whether ATP can prevent SG-induced OE toxicity. ATP did not decrease apoptosis under physiological conditions but significantly reduced SG-induced OSN apoptosis in vivo and in vitro. Furthermore, purinergic receptor inhibition significantly increased apoptosis in OE primary cell culture and in vivo. These data indicate that ATP is neuroprotective against SG-induced OE toxicity. The number of cells that incorporated 5′-bromodeoxyuridine, a measure of proliferation, was significantly increased 3 and 6 days post-SG aspiration. Treatment with purinergic receptor antagonists significantly reduced SG-induced cell proliferation, whereas post-treatment with ATP significantly potentiated SG-induced cell proliferation. These data indicate that ATP is released and promotes cell proliferation via activation of purinergic receptors in SG-induced OE injury. Thus, the purinergic system is a therapeutic target to alleviate or restore the loss of OSNs. PMID:21865290
Amuzie, Chidozie J.; Islam, Zahidul; Kim, Jae Kyung; Seo, Ji-Hyun; Pestka, James J.
2010-01-01
Intranasal exposure of mice to satratoxin G (SG), a macrocyclic trichothecene produced by the indoor air mold Stachybotrys chartarum, selectively induces apoptosis in olfactory sensory neurons (OSNs) of the nose and brain. The purpose of this study was to measure the kinetics of distribution and clearance of SG in the mouse. Following intranasal instillation of female C57B16 mice with SG (500 μg/kg bw), the toxin was detectable from 5 to 60 min in blood and plasma, with the highest concentrations, 30 and 19 ng/ml, respectively, being observed at 5 min. SG clearance from plasma was rapid and followed single-compartment kinetics (t1/2 = 20 min) and differed markedly from that of other tissues. SG concentrations were maximal at 15–30 min in nasal turbinates (480 ng/g), kidney (280 ng/g), lung (250 ng/g), spleen (200 ng/g), liver (140 ng/g), thymus (90 ng/g), heart (70 ng/g), olfactory bulb (14 ng/g), and brain (3 ng/g). The half-lives of SG in the nasal turbinate and thymus were 7.6 and 10.1 h, respectively, whereas in other organs, these ranged from 2.3 to 4.4 h. SG was detectable in feces and urine, but cumulative excretion over 5 days via these routes accounted for less than 0.3% of the total dose administered. Taken together, SG was rapidly taken up from the nose, distributed to tissues involved in respiratory, immune, and neuronal function, and subsequently cleared. However, a significant amount of the toxin was retained in the nasal turbinate, which might contribute to SG’s capacity to evoke OSN death. PMID:20466779
Saito, Rena; Park, Ju-Hyeong; LeBouf, Ryan; Green, Brett J; Park, Yeonmi
2016-01-01
Gas chromatography-tandem mass spectrometry (GC-MS/MS) was used to detect fungal secondary metabolites. Detection of verrucarol, the hydrolysis product of Stachybotrys chartarum macrocyclic trichothecene (MCT), was confounded by matrix effects associated with heterogeneous indoor environmental samples. In this study, we examined the role of dust matrix effects associated with GC-MS/MS to better quantify verrucarol in dust as a measure of total MCT. The efficiency of the internal standard (ISTD, 1,12-dodecanediol), and application of a matrix-matched standard correction method in measuring MCT in floor dust of water-damaged buildings was additionally examined. Compared to verrucarol, ISTD had substantially higher matrix effects in the dust extracts. The results of the ISTD evaluation showed that without ISTD adjustment, there was a 280% ion enhancement in the dust extracts compared to neat solvent. The recovery of verrucarol was 94% when the matrix-matched standard curve without the ISTD was used. Using traditional calibration curves with ISTD adjustment, none of the 21 dust samples collected from water damaged buildings were detectable. In contrast, when the matrix-matched calibration curves without ISTD adjustment were used, 38% of samples were detectable. The study results suggest that floor dust of water-damaged buildings may contain MCT. However, the measured levels of MCT in dust using the GC-MS/MS method could be significantly under- or overestimated, depending on the matrix effects, the inappropriate ISTD, or combination of the two. Our study further shows that the routine application of matrix-matched calibration may prove useful in obtaining accurate measurements of MCT in dust derived from damp indoor environments, while no isotopically labeled verrucarol is available.
Norbäck, Dan; Hashim, Jamal Hisham; Cai, Gui-Hong; Hashim, Zailina; Ali, Faridah; Bloom, Erica; Larsson, Lennart
2016-01-01
There are few studies on rhinitis and sick building syndrome (SBS) among students in tropical countries. We studied associations between levels of five fungal DNA sequences, two mycotoxins (sterigmatocystin and verrucarol) and cat allergen (Fel d 1) levels in schools and rhinitis and other weekly SBS symptoms in the students. Fungal DNA was measured by quantitative PCR and cat allergen by ELISA. Pupils (N = 462) from eight randomly selected schools in Johor Bahru, Malaysia participated (96%). Dust samples were collected by cotton swabs and Petri dishes exposed for one week. None of the schools had a mechanical ventilation system, but all classrooms had openable windows that were kept open during lectures and indoor CO2 levels were low (mean 492 ppm; range 380–690 ppm). Weekly nasal symptoms (rhinitis) (18.8%), ocular (11.6%), throat (11.1%), dermal symptoms, headache (20.6%) and tiredness (22.1%) were common. Total fungal DNA in swab samples was associated with rhinitis (p = 0.02), ocular symptoms (p = 0.009) and tiredness (p = 0.001). There were positive associations between Aspergillus versicolor DNA in Petri dish samples, ocular symptoms (p = 0.02) and tiredness (p = 0.001). The level of the mycotoxin verrucarol (produced by Stachybotrys chartarum) in swab samples was positively associated with tiredness (p = 0.04). Streptomyces DNA in swab samples (p = 0.03) and Petri dish samples (p = 0.03) were negatively associated with tiredness. In conclusion, total fungal contamination, measured as total fungal DNA) in the classrooms, Aspergillus versicolor and verrucarol can be risk factors for rhinitis and SBS symptoms among students in the tropical country Malaysia. PMID:26829324
Environmental Mold and Mycotoxin Exposures Elicit Specific Cytokine and Chemokine Responses
Rosenblum Lichtenstein, Jamie H.; Hsu, Yi-Hsiang; Gavin, Igor M.; Donaghey, Thomas C.; Molina, Ramon M.; Thompson, Khristy J.; Chi, Chih-Lin; Gillis, Bruce S.; Brain, Joseph D.
2015-01-01
Background Molds can cause respiratory symptoms and asthma. We sought to use isolated peripheral blood mononuclear cells (PBMCs) to understand changes in cytokine and chemokine levels in response to mold and mycotoxin exposures and to link these levels with respiratory symptoms in humans. We did this by utilizing an ex vivo assay approach to differentiate mold-exposed patients and unexposed controls. While circulating plasma chemokine and cytokine levels from these two groups might be similar, we hypothesized that by challenging their isolated white blood cells with mold or mold extracts, we would see a differential chemokine and cytokine release. Methods and Findings Peripheral blood mononuclear cells (PBMCs) were isolated from blood from 33 patients with a history of mold exposures and from 17 controls. Cultured PBMCs were incubated with the most prominent Stachybotrys chartarum mycotoxin, satratoxin G, or with aqueous mold extract, ionomycin, or media, each with or without PMA. Additional PBMCs were exposed to spores of Aspergillus niger, Cladosporium herbarum and Penicillium chrysogenum. After 18 hours, cytokines and chemokines released into the culture medium were measured by multiplex assay. Clinical histories, physical examinations and pulmonary function tests were also conducted. After ex vivo PBMC exposures to molds or mycotoxins, the chemokine and cytokine profiles from patients with a history of mold exposure were significantly different from those of unexposed controls. In contrast, biomarker profiles from cells exposed to media alone showed no difference between the patients and controls. Conclusions These findings demonstrate that chronic mold exposures induced changes in inflammatory and immune system responses to specific mold and mycotoxin challenges. These responses can differentiate mold-exposed patients from unexposed controls. This strategy may be a powerful approach to document immune system responsiveness to molds and other inflammation-inducing environmental agents. PMID:26010737
Nielsen, Kristian Fog; Huttunen, Kati; Hyvärinen, Anne; Andersen, Birgitte; Jarvis, Bruce B; Hirvonen, Maija-Riitta
2002-01-01
The metabolite profiles of 20 Stachybotrys spp. isolates from Finnish water-damaged buildings were compared with their biological activities. Effects of purified compounds on cytotoxicity and production of inflammatory mediators such as nitric oxide, IL-6 and TNFalpha in murine RAW264.7 macrophage cells were studied. The 11 isolates belonging to the satratoxin-producing chemotype were highly cytotoxic to the macrophages. The isolates inducing inflammatory mediators all belonged to the atranone-producing chemotype, but pure atranones B, and D did not elicit a response in the bioassay. Altogether, cytotoxicity of Stachybotrys sp. isolates appear to be related to satratoxin production whereas the specific component inducing inflammatory responses in atranone-producing isolates remains obscure.
Li, Wei; Yang, Ya-Bin; Yang, Xue-Qiong; Xie, Hui-Ding; Shao, Zhi-Hui; Zhou, Hao; Miao, Cui-Ping; Zhao, Li-Xing; Ding, Zhong-Tao
2017-05-01
The rare anishidiol and five new isochromans, including three novel dimers with unprecedented skeletons, were isolated from Stachybotrys sp. PH30583. Their structures were determined by spectral analyses. The bioactivities of these compounds were also investigated. The dimers ( 6 - 10 ) inhibited acetylcholinesterase at 50 µM, but the monomers did not. To investigate the biogenesis of the novel dimers, a time-course investigation of metabolite production was undertaken. Georg Thieme Verlag KG Stuttgart · New York.
Enhanced Characterization of Microorganisms in the Spacecraft Environment
NASA Technical Reports Server (NTRS)
Cruz, Patricia; Stetzenbach, Linda D.
2004-01-01
Spacecraft such as the International Space Station (ISS) and the space shuttles are enclosed environments where crewmembers may spend long periods of time. Currently, crewmembers spend approximately a period of 6 months in the ISS. It is known that these prolonged stays in space may result in weakening of the immune system. Therefore, exposure to opportunistic pathogens or high concentrations of environmental microorganisms may compromise the health of the crew. The detection of biocontaminants in spacecraft environments utilizes culture-based methodology, omitting greater than 90% of all microorganisms including pathogens such as Legionella and Cryptosporidium. Culturable bacteria and fungi have been the only allergens studied; the more potent allergens, such as those from dust mites, have never been tested for in spacecraft environments. In addition, no attempts have been made to monitor microbial toxins in spacecrafts. The present study utilized quantitative polymerase chain reaction (QPCR) as a novel approach for monitoring microorganisms in the spacecraft environment. QPCR is a molecular biology technique that does not rely on the physiological state of the organisms for identification, thereby enabling detection of both culturable and non-culturable organisms. In this project, specific molecular primers and probes were utilized for the detection and quantitation of two fungi of concern in indoor environments, Aspergillus fumigatus and Stachybotrys chartarum. These organisms were selected because of the availability of PCR primers and probes, and to establish the sample processing and analysis methodology that may be employed with additional organisms. Purification methods and QPCR assays were optimized for the detection of these organisms in air, surface, and water; and sample processing and analysis protocols were developed. Preliminary validation of these protocols was conducted in the laboratory with air, surface, and water samples seeded with known concentrations of the target organisms. Additional studies were conducted with bulk materials (HEPA filter pleats and particulate found on the filter screen) obtained from the ISS.
Gunn, Shelly R.; Gibson Gunn, G.; Mueller, Francis W.
2016-01-01
Patient: Male, 25 Final Diagnosis: Ulcerative colitis and chronic fatigue syndrome Symptoms: Colitis • profound fatigue • multi-joint pain • cognitive impairment • corneal keratitis Medication: — Clinical Procedure: VIP replacement therapy Specialty: Family Medicine Objective: Unusual clinical course Background: Patients with multisymptom chronic conditions, such as refractory ulcerative colitis (RUC) and chronic fatigue syndrome (CFS), present diagnostic and management challenges for clinicians, as well as the opportunity to recognize and treat emerging disease entities. In the current case we report reversal of co-existing RUC and CFS symptoms arising from biotoxin exposures in a genetically susceptible individual. Case Report: A 25-year-old previously healthy male with new-onset refractory ulcerative colitis (RUC) and chronic fatigue syndrome (CFS) tested negative for autoimmune disease biomarkers. However, urine mycotoxin panel testing was positive for trichothecene group and air filter testing from the patient’s water-damaged rental house identified the toxic mold Stachybotrys chartarum. HLA-DR/DQ testing revealed a multisusceptible haplotype for development of chronic inflammation, and serum chronic inflammatory response syndrome (CIRS) biomarker testing was positive for highly elevated TGF-beta and a clinically undetectable level of vasoactive intestinal peptide (VIP). Following elimination of biotoxin exposures, VIP replacement therapy, dental extractions, and implementation of a mind body intervention-relaxation response (MBI-RR) program, the patient’s symptoms resolved. He is off medications, back to work, and resuming normal exercise. Conclusions: This constellation of RUC and CFS symptoms in an HLA-DR/DQ genetically susceptible individual with biotoxin exposures is consistent with the recently described CIRS disease pathophysiology. Chronic immune disturbance (turbatio immuno) can be identified with clinically available CIRS biomarkers and may represent a treatable underlying disease etiology in a subset of genetically susceptible patients with RUC, CFS, and other immune disorders. PMID:27165859
Minagawa, K; Kouzuki, S; Nomura, K; Yamaguchi, T; Kawamura, Y; Matsushima, K; Tani, H; Ishii, K; Tanimoto, T; Kamigauchi, T
2001-11-01
In the course of screening for yeast squalene synthase inhibitors, bisabosqual A was isolated from the culture broth of Stachybotrys sp. RF-7260. The related compounds bisabosquals B, C and D were also isolated from Stachybotrys ruwenzoriensis RF-6853. Bisabosquals inhibited squalene synthases. IC50 values of bisabosqual A against the microsomal squalene synthases from Saccharomyces cerevisiae, Candida albicans, HepG2 cell and rat liver were 0.43, 0.25, 0.95 and 2.5 microg/ml, respectively. Bisabosqual C exhibited inhibitory activities similar to bisabosqual A. Bisabosqual A showed broad spectrum antifungal activity in vitro.
Usleber, E; Dietrich, R; Schneider, E; Märtlbauer, E
2001-06-01
This paper presents a case report of indoor Stachybotrys toxins in Germany. In the summer of 2000, heavy rainfall and a leakage of the gutter system of an appartement house in Munich, Germany, caused a severe water damage in one of the appartments. The appartment was at that time occupied by two of the authors (ES, EU). A wall (covered with wallpaper) in one room in particular was most strongly affected, about 6-8 m(2) of the wallpaper became very wet. Large parts of this wet wallpaper were within days infested by multiple circumscribed round, grey-black colonies (0.5-5 cm in diameter) of presumtiveStachybotrys spp.. At the same time, the air in this room became very damp and oppressive. Several persons reported burning sensations on the mucous membranes of the eye, nose, and larynx, followed by headache symptoms, as soon as a few minutes after they had entered this room. Inadvertent skin contact with one of the fungal colonies by one person resulted in burning sensations immediately, but symptoms disappeared after thorough rinsing of the skin with water. The infested room was evacuated, and samples were taken from the wet wallpaper at areas (1) in the center of the most heavy fungal colony growth, (2) several cm away from colony growth, and (3) from locations which were wet but about 1 m away from visible colony growth. The samples were extracted with methanol, the extract diluted with buffer solution and analysed by competitive enzyme immunoassay (EIA) for roridin A. Due to cross-reactivity, this EIA detects several macrocyclic trichothecenes produced byStachybotrys spp.. Heavily infected pieces of wallpaper were strongly contaminated with toxins, with maximum concentrations of 1.1 microgram per cm(2) (Roridin A equivalents). Wet but visibly not infected samples of wallpaper were negative in the EIA. Considering a EIA cross-reactivity of satratoxin H (the major Stachybotrys-toxin) of 15%, the actual maximum toxin concentration would correspond to 6 microgram of satratoxin H per cm(2). As far as we know, this is the first documented case of indoor Stachybotrys toxins in Germany. The toxin concentration by far exceeds the minimum toxin level required for skin toxicity, and was considered as unhealthy. Health authorities in Munich were informed but were unable to provide assistance, probably because awareness of the importance and the possible health risks caused by indoor mycotoxins is not yet widespread in Germany. Reporting and monitoring programs for mycotoxins in water-damaged buildings seem to be necessary to provide insight into the occurrence of similar cases as the one described here.
Kidane, Yared H; Lawrence, Christopher; Murali, T M
2013-10-07
Fungi are the second most abundant type of human pathogens. Invasive fungal pathogens are leading causes of life-threatening infections in clinical settings. Toxicity to the host and drug-resistance are two major deleterious issues associated with existing antifungal agents. Increasing a host's tolerance and/or immunity to fungal pathogens has potential to alleviate these problems. A host's tolerance may be improved by modulating the immune system such that it responds more rapidly and robustly in all facets, ranging from the recognition of pathogens to their clearance from the host. An understanding of biological processes and genes that are perturbed during attempted fungal exposure, colonization, and/or invasion will help guide the identification of endogenous immunomodulators and/or small molecules that activate host-immune responses such as specialized adjuvants. In this study, we present computational techniques and approaches using publicly available transcriptional data sets, to predict immunomodulators that may act against multiple fungal pathogens. Our study analyzed data sets derived from host cells exposed to five fungal pathogens, namely, Alternaria alternata, Aspergillus fumigatus, Candida albicans, Pneumocystis jirovecii, and Stachybotrys chartarum. We observed statistically significant associations between host responses to A. fumigatus and C. albicans. Our analysis identified biological processes that were consistently perturbed by these two pathogens. These processes contained both immune response-inducing genes such as MALT1, SERPINE1, ICAM1, and IL8, and immune response-repressing genes such as DUSP8, DUSP6, and SPRED2. We hypothesize that these genes belong to a pool of common immunomodulators that can potentially be activated or suppressed (agonized or antagonized) in order to render the host more tolerant to infections caused by A. fumigatus and C. albicans. Our computational approaches and methodologies described here can now be applied to newly generated or expanded data sets for further elucidation of additional drug targets. Moreover, identified immunomodulators may be used to generate experimentally testable hypotheses that could help in the discovery of broad-spectrum immunotherapeutic interventions. All of our results are available at the following supplementary website: http://bioinformatics.cs.vt.edu/~murali/supplements/2013-kidane-bmc.
2013-01-01
Background Fungi are the second most abundant type of human pathogens. Invasive fungal pathogens are leading causes of life-threatening infections in clinical settings. Toxicity to the host and drug-resistance are two major deleterious issues associated with existing antifungal agents. Increasing a host’s tolerance and/or immunity to fungal pathogens has potential to alleviate these problems. A host’s tolerance may be improved by modulating the immune system such that it responds more rapidly and robustly in all facets, ranging from the recognition of pathogens to their clearance from the host. An understanding of biological processes and genes that are perturbed during attempted fungal exposure, colonization, and/or invasion will help guide the identification of endogenous immunomodulators and/or small molecules that activate host-immune responses such as specialized adjuvants. Results In this study, we present computational techniques and approaches using publicly available transcriptional data sets, to predict immunomodulators that may act against multiple fungal pathogens. Our study analyzed data sets derived from host cells exposed to five fungal pathogens, namely, Alternaria alternata, Aspergillus fumigatus, Candida albicans, Pneumocystis jirovecii, and Stachybotrys chartarum. We observed statistically significant associations between host responses to A. fumigatus and C. albicans. Our analysis identified biological processes that were consistently perturbed by these two pathogens. These processes contained both immune response-inducing genes such as MALT1, SERPINE1, ICAM1, and IL8, and immune response-repressing genes such as DUSP8, DUSP6, and SPRED2. We hypothesize that these genes belong to a pool of common immunomodulators that can potentially be activated or suppressed (agonized or antagonized) in order to render the host more tolerant to infections caused by A. fumigatus and C. albicans. Conclusions Our computational approaches and methodologies described here can now be applied to newly generated or expanded data sets for further elucidation of additional drug targets. Moreover, identified immunomodulators may be used to generate experimentally testable hypotheses that could help in the discovery of broad-spectrum immunotherapeutic interventions. All of our results are available at the following supplementary website: http://bioinformatics.cs.vt.edu/~murali/supplements/2013-kidane-bmc PMID:24099000
MicroRNA Regulation of Host Immune Responses following Fungal Exposure.
Croston, Tara L; Lemons, Angela R; Beezhold, Donald H; Green, Brett J
2018-01-01
Fungal bioaerosols are ubiquitous in the environment and human exposure can result in a variety of health effects ranging from systemic, subcutaneous, and cutaneous infections to respiratory morbidity including allergy, asthma, and hypersensitivity pneumonitis. Recent research has focused on the role of microRNAs (miRNAs) following fungal exposure and is overlooked, yet important, group of regulators capable of influencing fungal immune responses through a variety of cellular mechanisms. These small non-coding ribose nucleic acids function to regulate gene expression at the post-transcriptional level and have been shown to participate in multiple disease pathways including cancer, heart disease, apoptosis, as well as immune responses to microbial hazards and occupational allergens. Recent animal model studies have characterized miRNAs following the exposure to inflammatory stimuli. Studies focused on microbial exposure, including bacterial infections, as well as exposure to different allergens have shown miRNAs, such as miR-21, miR-146, miR-132, miR-155, and the let-7 family members, to be involved in immune and inflammatory responses. Interestingly, the few studies have assessed that the miRNA profiles following fungal exposure have identified the same critical miRNAs that have been characterized in other inflammatory-mediated and allergy-induced experimental models. Review of available in vitro , animal and human studies of exposures to Aspergillus fumigatus, Candida albicans, Cryptococcus neoformans, Paracoccidioides brasiliensis , and Stachybotrys chartarum identified several miRNAs that were shared between responses to these species including miR-125 a/b (macrophage polarization/activation), miR-132 [toll-like receptor (TLR)2-mediated signaling], miR-146a (TLR mediated signaling, alternative macrophage activation), and miR-29a/b (natural killer cell function, C-leptin signaling, inhibition of Th1 immune response). Although these datasets provide preliminary insight into the role of miRNAs in fungal exposed models, interpretation of miRNA datasets can be challenging for researchers. To assist in navigating this rapidly evolving field, the aim of this review is to describe miRNAs in the framework of host recognition mechanisms and provide initial insight into the regulatory pathways in response to fungal exposure.
Chamoun, Rony; Aliferis, Konstantinos A.; Jabaji, Suha
2015-01-01
Stachybotrys elegans is able to parasitize the fungal plant pathogen Rhizoctonia solani AG-3 following a complex and intimate interaction, which, among others, includes the production of cell wall-degrading enzymes, intracellular colonization, and expression of pathogenic process encoding genes. However, information on the metabolome level is non-existent during mycoparasitism. Here, we performed a direct-infusion mass spectrometry (DIMS) metabolomics analysis using an LTQ Orbitrap analyzer in order to detect changes in the profiles of induced secondary metabolites of both partners during this mycoparasitic interaction 4 and 5 days following its establishment. The diketopiperazine(s) (DKPs) cyclo(S-Pro-S-Leu)/cyclo(S-Pro-S-Ile), ethyl 2-phenylacetate, and 3-nitro-4-hydroxybenzoic acid were detected as the primary response of Rhizoctonia 4 days following dual-culturing with Stachybotrys, whereas only the latter metabolite was up-regulated 1 day later. On the other hand, trichothecenes and atranones were mycoparasite-derived metabolites identified during mycoparasitism 4 and 5 days following dual-culturing. All the above secondary metabolites are known to exhibit bioactivity, including fungitoxicity, and represent key elements that determine the outcome of the interaction being studied. Results could be further exploited in programs for the evaluation of the bioactivity of these metabolites per se or their chemical analogs, and/or genetic engineering programs to obtain more efficient mycoparasite strains with improved efficacy and toxicological profiles. PMID:25972848
Szathmary, C I; Mirocha, C J; Palyusik, M; Pathre, S V
1976-01-01
Isolates of Fusarium and Stachybotrys spp. and crude extracts from these fungi were obtained from Hungary and the U.S.S.R. and used for the evaluation of the mycotoxins they produced. The cultures were grown on millet and oats and extracted in Budapest, Hungary (Veterinary Medical Research Institute) and chemically analyzed at the University of Minnesota using thin-layer chromatography (TLC), gas-liquid chromatography (GLC), gas chromatograph-mass spectrometry (GC-MS), and the rat skin bioassay. Zearalenone was found in most of the Fusarium cultures, T-2 toxin, neosolaniol, T-2 tetraol, and HT-2 toxin were found in extracts of Fusarium poae and F. sporotrichioies. A special effort was made to isolate the steroid-like toxins reported in the early Russian literature as sporofusarin and poaefusarin. None of the extracts from the Fusarium species yielded poaefusarin or sporofusarin when analyzed by our chemical methods or by those of L.E. Olifson, S.M. Kenina, and V.L. Kartashova, 1972. We therefore accounted for the toxicity of the Fusarium extracts as due to the 12,13,epoxytrichothecenes. One culture of Stachybotrys alternans yielded a macrocyclic ester of 12,13-epoxytrichothecene which, upon hydrolysis, yielded verrucarol; a steroid-like molecule (SB-3) was also isolated. The former had skin-irritant activity but SB-3 did not; the latter exhibited cardiac activity on the heart of the cockroach. PMID:988785
Microbial specialists in below-grade foundation walls in Scandinavia.
Nunez, M; Hammer, H
2014-10-01
Below-grade foundation walls are often exposed to excessive moisture by water infiltration, condensation, leakage, or lack of ventilation. Microbial growth in these structures depends largely on environmental factors, elapsed time, and the type of building materials and construction setup. The ecological preferences of Actinomycetes (Actinobacteria) and the molds Ascotricha chartarum, Myxotrichum chartarum (Ascomycota), Geomyces pannorum, and Monocillium sp. (Hyphomycetes) have been addressed based on analyses of 1764 samples collected in below-grade spaces during the period of 2001-2012. Our results show a significant correlation between these taxa and moist foundation walls as ecological niches. Substrate preference was the strongest predictor of taxa distribution within the wall, but the taxa's physiological needs, together with gradients of abiotic factors within the wall structure, also played a role. Our study describes for the first time how the wall environment affects microbial growth. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Mycotoxin production by indoor molds.
Fog Nielsen, Kristian
2003-07-01
Fungal growth in buildings starts at a water activity (a(w)) near 0.8, but significant quantities of mycotoxins are not produced unless a(w) reaches 0.95. Stachybotrys generates particularly high quantities of many chemically distinct metabolites in water-damaged buildings. These metabolites are carried by spores, and can be detected in air samples at high spore concentrations. Very little attention has been paid to major metabolites of Stachybotrys called spirocyclic drimanes, and the precise structures of the most abundant of these compounds are unknown. Species of Aspergillus and Penicillium prevalent in the indoor environment produce relatively low concentrations of mycotoxins, with the exception of sterigmatocystins that can represent up to 1% of the biomass of A. versicolor at a(w)'s close to 1. The worst-case scenario for homeowners is produced by consecutive episodes of water damage that promote fungal growth and mycotoxin synthesis, followed by drier conditions that facilitate the liberation of spores and hyphal fragments.
A new species, Stachybotrys longistipitata sp. nov is described and illustrated. This fungus was originally isolated from forest soil in Japan and deposited as Memnoniella subsimplex.
Introduction
Four species have been described in the mitosporic genus Memnoniella ...
Fu, Xi; Lindgren, Torsten; Guo, Moran; Cai, Gui-Hong; Lundgren, Håkan; Norbäck, Dan
2013-06-01
There has been concern about the cabin environment in commercial aircraft. We measured cat, dog and horse allergens and fungal DNA in cabin dust and microbial volatile organic compounds (MVOCs) in cabin air. Samples were collected from two European airline companies, one with cabins having textile seats (TSC) and the other with cabins having leather seats (LSC), 9 airplanes from each company. Dust was vacuumed from seats and floors in the flight deck and different parts of the cabin. Cat (Fel d1), dog (Can f1) and horse allergens (Equ cx) were analyzed by ELISA. Five sequences of fungal DNA were analyzed by quantitative PCR. MVOCs were sampled on charcoal tubes in 42 TSC flights, and 17 compounds were analyzed by gas chromatography mass spectrometry (GC-MS) with selective ion monitoring (SIM). MVOC levels were compared with levels in homes from Nordic countries. The weight of dust was 1.8 times larger in TSC cabins as compared to LSC cabins (p < 0.001). In cabins with textile seats, the geometric mean (GM) concentrations of Fel d1, Can f1 and Equ cx were 5359 ng g(-1), 6067 ng g(-1), and 13 703 ng g(-1) (GM) respectively. Levels of Fel d1, Can f1 and Equ cx were 50 times, 27 times and 75 times higher respectively, in TSC cabins as compared to LSC cabins (p < 0.001). GM levels of Aspergillus/Penicillium DNA, Aspergillus versicolor DNA, Stachybotrys chartarum DNA and Streptomyces DNA were all higher in TSC as compared to LSC (p < 0.05). The sum of MVOCs in cabin air (excluding butanols) was 3192 ng m(-3) (GM), 3.7 times higher than in homes (p < 0.001) and 2-methyl-1-butanol and 3-methyl-1-butanol concentrations were 15-17 times higher as compared to homes (p < 0.001). Concentrations of isobutanol, 1-butanol, dimethyldisulfide, 2-hexanone, 2-heptanone, 3-octanone, isobutyl acetate and ethyl-2-methylbutyrate were lower in cabin air as compared to homes (p < 0.05). In conclusion, textile seats are much more contaminated by pet allergens and fungal DNA than leather seats. The use of seats with smooth surfaces should be encouraged. The MVOC levels differed between cabin air and homes.
ASSESSMENT OF ALLERGIC IMMUNE RESPONSES TO INDOOR AIR FUNGAL CONTAMINANTS
We are using a mouse model to assess immune and inflammatory responses as well as changes in respiratory function and pathology characteristic of allergic asthma to fungal extracts M. anisopliae (MACA), S. chartarum (SCE), and P. chrysogenum (PCE). This model will be useful to a...
The influence of lime and nitrogen fertilisers on spore counts of Pithomyces chartarum in pasture.
Cuttance, E L; Laven, R A; Mason, W A; Stevenson, M
2016-11-01
To determine whether the application of lime or nitrogen to pasture affected the spore counts of Pithomyces chartarum. The lime application studies were undertaken on a spring-calving, pasture-based, commercial dairy farm near Te Awamutu, New Zealand. On 6 November 2012, five randomly selected paddocks were split into three equal sections. In two of the sections, lime was applied at either 1.5 or 2.5 t/ha, and the central section was left as an untreated control. Each section was sampled for spore counting weekly from 16 January to 15 May 2013. Starting in January 2013, five other randomly selected paddocks were monitored for spore counts. On 20 March 2013 the average spore counts in three paddocks were >100,000 spores/g of pasture. These paddocks were then divided into three equal sections and lime was applied as described above. Spore counting in each section continued weekly until 15 May 2013. The nitrogen application study was carried out on three commercial dairy farms near Te Awamutu, New Zealand. Two randomly selected paddocks on each farm were divided into three equal sections and, on 20 December 2012, nitrogen in the form of urea was applied at either 50 or 80 kg urea/ha to two of the sections; the central section remained as an untreated control. Each section was sampled for spore counting weekly from 16 January to 15 May 2013. Following pre-summer lime application, treatment at 1.5 or 2.5 t/ha did not affect spore counts over time compared with the control section (p>0.26). Similarly following autumn lime application, treatment at 1.5 or 2.5 t/ha did not affect spore counts over time compared with the control section (p>0.11). Following nitrogen application median spore counts remained <20,000 spores/g pasture throughout the trial period and there was no effect of treatment on spore counts over time (p>0.49). This study found that application of lime before the risk period for facial eczema, in November, application of lime after a spore count rise, in March, or urea application in December did not affect changes in number of spores produced by P. chartarum. This study does not support previous suggestions that fertilising pasture with lime or urea could alter the spore counts of P. chartarum. Fertiliser use does not provide an alternative to, or support, conventional methods of facial eczema control such as zinc prophylaxis or treatment of pasture with fungicides.
USDA-ARS?s Scientific Manuscript database
Brachiaria species are cultivated worldwide in tropical and subtropical climates as the main forage source for ruminants. Numerous tropical and warm-season grasses cause hepatogenous photosensitization, among them several species of Brachiaria. Steroidal saponins present in these plants may be respo...
USDA-ARS?s Scientific Manuscript database
Turnip (Brassica rapa ssp. rapa) and rape (Brassica napus ssp. biennis) and other brassica forage crops are generally regarded as “safe” feed for cattle during late summer and fall in New Zealand. However, when Pithomyces chartarum spore counts are high there are epidemics of sporidesmin toxicity (...
Five different DNA extraction methods were evaluated for their effectiveness in recovering PCR templates from the conidia of a series of fungal species often encountered in indoor air. The test organisms were Aspergillus versicolor, Penicillium chrysogenum, Stachybotrys chartaru...
RELATIVE POTENCY OF FUNGAL EXTRACTS IN INDUCING ALLERGIC ASTHMA-LIKE RESPONSES IN BALB/C MICE
Indoor mold has been associated with the development of allergic asthma. However, relative potency of molds in the induction of allergic asthma is not clear. In this study, we tested the relative potency of fungal extracts (Metarizium anisophilae [MACA], Stachybotrys ...
USDA-ARS?s Scientific Manuscript database
Trichothecenes are sesquiterpene mycotoxins produced by several fungal genera including Fusarium, Trichothecium, Myrothecium, Stachybotrys, and Trichoderma. These toxins have attracted great attention because they are frequent contaminants of food and animal feed, and can be easily absorbed by anim...
Removal of humic substances by biosorption.
Vuković, Marija; Domanovac, Tomislav; Briski, Felicita
2008-01-01
Fungal pellets of Aspergillus niger 405, Aspergillus ustus 326, and Stachybotrys sp. 1103 were used for the removal of humic substances from aqueous solutions. Batchwise biosorption, carried out at pH 6 and 25 degrees C, was monitored spectrophotometrically and the process described with Freundlich's model. Calculated sorption coefficients K(f) and n showed that A. niger exhibited the highest efficiency. A good match between the model and experimental data and a high correlation coefficient (R2) pointed out to judicious choice of the mechanism for removal of humic substances from the reaction medium. The sorption rate constants (k) for A. ustus and Stachybotrys sp. were almost equal, however higher than that for A. niger. Comparison of test results with the simulated ones demonstrated the applicability of the designed kinetic model for removal of humic substances from natural water by biosorption with fungal pellets. Different morphological structure of the examined fungal pellets showed that faster sorption does not imply the most efficient removal of humic substances. Desorption of humic substances from fungal pellets was complete, rapid, and yielded uniform results.
Evaluation of fungal growth on cellulose-containing and inorganic ceiling tile.
Karunasena, E; Markham, N; Brasel, T; Cooley, J D; Straus, D C
2001-01-01
Buildings with poor indoor air quality (IAQ) frequently have many areas with surface fungal contamination. Studies have demonstrated that certain fungal genera (e.g., Cladosporium, Penicillium, and Stachybotrys) are able to grow on building materials such as wallpaper, drywall, and ceiling tiles, particularly after water damage has occurred. Due to the increasing awareness of sick building syndrome (SBS), it has become essential to identify building materials that prevent the interior growth of fungi. The objective of this study was to identify building materials that would not support the growth of certain fungal genera, regardless of whether an external food source was made available. The growth of three fungal genera (Cladosporium, Penicillium, and Stachybotrys) was evaluated on cellulose-containing ceiling tile (CCT) and inorganic ceiling tile (ICT). Both types of ceiling tile were exposed to environmental conditions which can occur inside a building. Our results show that ICT did not support the growth of these three fungal genera while CCT did. Our data demonstrate that ICT could serve as an ideal replacement for CCT.
USDA-ARS?s Scientific Manuscript database
Trichothecenes are secondary metabolites produced by multiple genera in the order Hypocreales, including Fusarium, Myrothecium, Stachybotrys, and Trichoderma. These metabolites are of concern because they are toxic to humans and animals, can contribute to pathogenicity in Fusarium, and are required ...
Toxigenic molds in water-damaged buildings: dechlorogriseofulvins from Memnoniella echinata.
Jarvis, B B; Zhou, Y; Jiang, J; Wang, S; Sorenson, W G; Hintikka, E L; Nikulin, M; Parikka, P; Etzel, R A; Dearborn, D G
1996-06-01
An investigation of a cluster of cases of pulmonary hemosiderosis in infants in Cleveland, OH, led to the isolation of many isolates of Stachybotrys atra and two isolates of a related toxigenic fungus, Memnoniella echinata. M. echinata produces two cytotoxic trichothecene mycotoxins, trichodermol (1a) and trichodermin (1b), as well as several griseofulvins. Dechlorogriseofulvin (2a) and epidechlorogriseofulvin (2b) were the major compounds isolated. This is the first report of a fungus outside the Penicillium genus producing griseofulvins.
Endoglucanase production by paper-degrading mycoflora.
Das, M K; Prasad, J S; Ahmad, S K
1997-11-01
Fourteen fungal species, namely Aspergillus flavus, A. fumigatus, A. niger, A. ustus, Penicillium islandicum, P. wortmannii, Memnoniella echinata, Cladosporium herbarum, Stachybotrys atra, Chaetomium globosum, Fusarium oxysporum, Torula herbarum, Alternaria alternata and Curvularia uncinata were isolated from different grades of paper. They differ in their distribution on various kinds of paper and also in relative occurrence. While seasonal influence on mycoflora was observed, most of the moulds were capable of growing in all three seasons examined (summer, winter, rainy season). The moulds were cellulolytic in nature and endoglucanase activity was greatest in Aspergillus flavus, A. niger, A. fumigatus, P. wortmannii and P. islandicum.
Vélez, Jessica M.; Tschaplinski, Timothy J.; Vilgalys, Rytas; ...
2017-04-07
Here, we examined variation in growth rate, patterns of nitrogen utilization, and competitive interactions of Atractiellarhizophila isolates from the roots of Populus hosts. Atractiella grew significantly faster on media substituted with inorganic nitrogen sources and slower in the presence of another fungal genus. In order to determine plausible causal mechanisms we used metabolomics to explore competitive interactions between Atractiella strains and Fusarium oxysporum or Leptosphaerulina chartarum. Metabolomic screening of potential microbial inhibitors showed increased levels of glycosides produced in vitro by Atractiella when grown with a different fungal genus, relative to when grown alone. Overall, our results suggest Atractiella ismore » a poor competitor with other fungi via direct routes e.g. faster growth rates, but may utilize chemical interactions and possibly nitrogen sources to defend itself, and niche partition its way to abundance in the plant host root and rhizosphere.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vélez, Jessica M.; Tschaplinski, Timothy J.; Vilgalys, Rytas
Here, we examined variation in growth rate, patterns of nitrogen utilization, and competitive interactions of Atractiellarhizophila isolates from the roots of Populus hosts. Atractiella grew significantly faster on media substituted with inorganic nitrogen sources and slower in the presence of another fungal genus. In order to determine plausible causal mechanisms we used metabolomics to explore competitive interactions between Atractiella strains and Fusarium oxysporum or Leptosphaerulina chartarum. Metabolomic screening of potential microbial inhibitors showed increased levels of glycosides produced in vitro by Atractiella when grown with a different fungal genus, relative to when grown alone. Overall, our results suggest Atractiella ismore » a poor competitor with other fungi via direct routes e.g. faster growth rates, but may utilize chemical interactions and possibly nitrogen sources to defend itself, and niche partition its way to abundance in the plant host root and rhizosphere.« less
Fungal burden exposure assessment in podiatry clinics from Ireland.
Viegas, Carla; Coggins, Ann Marie; Faria, Tiago; Caetano, Liliana Aranha; Gomes, Anita Quintal; Sabino, Raquel; Verissimo, Cristina; Roberts, Nigel; Watterson, David; MacGilchrist, Claire; Fleming, Gerard T A
2018-03-26
Fungi are amongst the bioaerosols of most importance, as indicated by the growing interest in this field of research. The aim was to characterize the exposure to fungal burden in podiatry clinics using culture-based and molecular methods. Airborne fungi were collected using an impaction air sampler and surface samples were also performed. Fourteen air samples were collected for direct detection of fungal DNA from filamentous fungi and dermatophytes. Overall, 63.6 % of the evening samples and 46 % of the morning samples surpassed the threshold values (150 CFU/m 3 ). Molecular detection, by real time PCR, of the target fungal species/strains (Aspergillus and Stachybotrys species) was negative for all samples collected. Trichophyton rubrum was detected by PCR analysis in one DNA sample collected on day six. Results suggest the use of both culture-based and molecular methodologies are desirable for a complete evaluation of fungal burden in this particular health care setting.
Cytotoxicity and phytotoxicity of trichothecene mycotoxins produced by Fusarium spp.
Abbas, Hamed K; Yoshizawa, Takumi; Shier, W Thomas
2013-11-01
Trichothecenes, a major class of mycotoxins produced by Fusarium, Myrothecium, and Stachybotrys species, are toxic to both plants and mammals. Simple trichothecenes, including type A (e.g., T-2 toxin) and type B (e.g., deoxynivalenol), are generally less toxic than macrocyclic trichothecenes. We sought to determine if simple trichothecenes are a potential source of candidates for development as bioherbicides, which require high phytotoxicity and low mammalian toxicity. We examined 28 simple trichothecenes in vitro for phytotoxicity using a small aquatic plant, Lemna pausicostata, and for mammalian toxicity using four cultured mammalian cell lines. Several structure-activity relationships were identified, including the following two, which may be relevant to bioherbicide development: peracetylation of type B trichothecenes and de-epoxidation of type A trichothecenes both substantially reduced mammalian toxicity with little effect on phytotoxicity. It was concluded that simple trichothecenes possessing strong phytotoxicity and minimal mammalian toxicity in vitro can be identified. Copyright © 2013 Elsevier Ltd. All rights reserved.
Effect of phenol on the mycelial growth and fructification in some of basidiomycetous fungi.
Upadhyay, R C; Hofrichter, M
1993-01-01
Cometabolic growth studies with phenol were undertaken to screen 32 strains of white and brown rot fungi. All the cultures studied grew well up to 4 mM of phenol on Czapekdox agar except Agaricus bisporus (white button mushroom) and Pleurotus cystidiosus. Most of them could grow even up to 6 mM of phenol. Phenol induced a brown pigmentation of the culture medium. P. flabellatus and P. pulmonarius metabolized 67 and 64 mg/l phenol in 10 days. Studies have indicated that phenol (0.1 to 1.0 mM) incorporated in malt-extract agar has no inhibitory effect on fruitbody formation. Preliminary studies indicate that soaking of wheat straw with phenol solution up to 1600 mg/l give better mycelial growth and fructification of P. cornucopiae, P. ostreatus Z-15 and Calocybe indica than water soaked. Soaking of wheat straw in phenol inhibited the growth of common competitor weed fungi like Stachybotrys sp. and Coprinus sp.
Mold: "tsara'at," Leviticus, and the history of a confusion.
Heller, Richard M; Heller, Toni W; Sasson, Jack M
2003-01-01
The noun tsara'at appears about two dozen times in the Hebrew Bible, almost exclusively in Leviticus, where it is used to describe a state of ritual defilement manifested as a scaly condition of the skin, a condition of cloth, leather, and the walls of houses. In the Septuagint, the Greek translation of the Hebrew Bible, negac tsara'at was translated as aphe lepras; in the Latin Vulgate, this became plega leprae. These words in Greek and Latin implied a condition that spread over the body, not a term of ritual impurity. Tsara'at has continued to be translated as "leprosy," even though this term is not appropriate, as there was no leprosy as we know it in the Middle East during the time period the Hebrew Bible was written. Others have suggested that the proper translation of tsara'at is "mold." The recent identification of a specific mold (Stachybotrys sp.) that contaminates buildings and causes respiratory distress, memory loss, and rash, and the fact that mold has been present for millennia, lend support to the translation of tsara'at as "mold."
Hospital readmissions with acute infectious diseases in New Zealand children < 2 years of age.
Seibt, Silvia; Gilchrist, Catherine A; Reed, Peter W; Best, Emma J; Harnden, Anthony; Camargo, Carlos A; Grant, Cameron C
2018-03-05
Infectious diseases are the leading cause of hospital admissions in young children. Hospitalisation with an infectious disease is a recurrent event for some children. Our objective was to describe risk factors for infectious disease readmission following hospital admission with an infectious disease in the first two years of life. We performed a national cohort study of New Zealand children, born 2005-2009, with an infectious disease admission before age 24 months. Children readmitted with an infectious disease within 12 months of the first infectious disease admission were identified. Every infectious disease admission was categorised as a respiratory, enteric, skin and soft tissue, urinary or other infection. Independent associations of demographic and child health factors with infectious disease readmission were determined using multiple variable logistic regression. From 2005 to 2011, there were 69,902 infectious disease admissions for 46,657 children less than two years old. Of these 46,657 children, 10,205 (22%) had at least one infectious disease readmission within 12 months of their first admission. The first infectious disease admission was respiratory (54%), enteric (15%), skin or soft tissue (7%), urinary (4%) or other (20%). Risk of infectious disease readmission was increased if the first infectious disease admission was respiratory (OR = 1.87, 95% CI 1.78-1.95) but not if it was in any other infectious disease category. Risk factors for respiratory infectious disease readmission were male gender, Pacific or Māori ethnicity, greater household deprivation, presence of a complex chronic condition, or a first respiratory infectious disease admission during autumn or of ≥3 days duration. Fewer factors (younger age, male gender, presence of a complex chronic condition) were associated with enteric infection readmission. The presence of a complex chronic condition was the only factor associated with urinary tract infection readmission and none of the factors were associated with skin or soft tissue infection readmission. In children less than two years old, infectious disease readmission risk is increased if the first infectious disease admission is a respiratory infectious disease but not if it is another infectious disease category. Risk factors for respiratory infectious disease readmission are different from those for other infectious disease readmissions.
Decommissioning of the 247-F Fuel Manufacturing Facility at the Savannah River Site (SRS)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santos, Joseph K.; Chostner, Stephen M.
Building 247-F at SRS was a roughly 110,000 ft{sup 2} two-story facility designed and constructed during the height of the cold war naval buildup to provide additional naval nuclear fuel manufacturing capacity in early 1980's. The manufacturing process employed a wide variety of acids, bases, and other hazardous materials. As the need for naval fuel declined, the facility was shut down and underwent initial deactivation, which was completed in 1990. All process systems were flushed with water and drained using the existing process drain valves. However, since these drains were not always installed at the lowest point in piping andmore » equipment systems, a significant volume of liquid remained after initial deactivation. After initial deactivation, a non-destructive assay of the process area identified approximately 17 ({+-}100%) kg of uranium held up in equipment and piping. The facility was placed in Surveillance and Maintenance mode until 2003, when the decision was made to perform final deactivation, and then decommission the facility. The following lessons were learned as a result of the D and D of building 247-F. Successful D and D of a major radiochemical process building requires significant up-front planning by a team of knowledgeable personnel led by a strong project manager. The level of uncertainty and resultant risk to timely, cost effective project execution was found to be high. Examples of the types of problems encountered which had high potential to adversely impact cost and schedule performance are described below. Low level and sanitary waste acceptance criteria do not allow free liquids in waste containers. These liquids, which are often corrosive, must be safely removed from the equipment before it is loaded to waste containers. Drained liquids must be properly managed, often as hazardous or mixed waste. Tapping and draining of process lines is a dangerous operation, which must be performed carefully. The temptation to become complacent when breaking into lines is great. Incidents of personnel exposure to liquids during draining are likely. Records from the initial 1990 deactivation led early work planners to assume the facility was cold, dark and dry. This turned out to be a poor assumption. Work instructions had to be modified to require that engineers evaluate each of several hundred process lines to identify the low point, where a tap and drain system could be installed to allow positive verification that the line was empty before the line was cut for removal. During the period between facility shut down in 1990 and the start of final deactivation in 2003, roof leaks had developed, allowing rain water to enter building 247-F, which provided an environment for mold growth. Sampling confirmed the presence of Stachybotrys chartarum, a toxic indoor mold that grows on wet cellulosic material, such as drywall paper. D and D workers in areas where this hazard was identified were required to where proper personal protective equipment, which complicated work execution. Discovery of the potential presence of uniquely hazardous chemicals such as shock sensitive compounds and toxic uranium hexafluoride became issues which required investigation and special handling strategies. Team access to subject matter experts, who could quickly provide the required guidance for safe material handling, was critical to keeping the project on schedule. In old legacy facilities, it is possible that the D and D workers will be exposed to undocumented energy sources such as energized electrical conductors and pipes containing hazardous materials that originate outside the boundaries of the facility. Significant effort must be expended on adequate mechanical and electrical isolation. Subdividing the facility into well defined zones for which detailed zone-specific end points could be developed proved to be a highly effective project management strategy. Waste management must be carefully planned. The rate of waste generation as the facility is converted from a structure to waste can frequently exceed the D and D team's resources to characterize, package, store and transport the waste to a disposal facility in a timely manner. This can lead to schedule delays and/or increased project cost.« less
Vergara, Teresa; Véliz, Elena; Fica, Alberto; Leiva, Jordan
2017-08-01
There is no consensus definition to distinguish infectious from non-infectious phlebitis associated to peripheral venous catheter. To evaluate the impact of an intervention program on the rate of infectious (those associated to bacteremia or local purulent discharge) and non-infectious phlebitis (the rest) and identify differential features. Interventional study developed in three stages: basal measurement, intervention, and evaluation. Ten infectious and 186 non-infectious phlebitis were registered. Infectious phlebitis diminished after intervention (0.2 to 0.04 events per 1,000 bed-days; p = 0.02) but not the rest (2.3 per 1,000 bed-days before and after). Five of 10 patients with infectious phlebitis had bacteremia, one with infectious endocarditis and valve replacement, and other with septic shock and a fatal outcome. None of the patients in the non-infectious group presented complications. Infectious phlebitis appeared later (mean 4.1 versus 2.4 days; p = 0.007) and were associated to fever (40% vs 5.9%, p = 0.004). Non-infectious phlebitis was associated to irritating compounds (OR 6.1; IC95 1.3-29, p < 0.05). The intervention program demonstrated a favorable impact only on the rate of infectious phlebitis. Distinction appears to be relevant because those of infectious origin are associated with fever, complications or death, respond to an intervention program, and emerge lately.
[Common pediatric infectious diseases following natural disasters].
Yao, Kai-Hu
2013-06-01
Natural disasters may lead to the outbreaks of infectious diseases because they increase the risk factors for infectious diseases. This paper reviews the risk factors for infectious diseases after natural disasters, especially earthquake, and the infectious diseases following disasters reported in recent years. The infectious diseases after earthquake include diarrhea, cholera, viral hepatitis, upper respiratory tract infection, tuberculosis, measles, leptospirosis, dengue fever, tetanus, and gas gangrene, as well as some rare infections. Children are vulnerable to infectious diseases, so pediatricians should pay more attention to the research on relationship between infectious diseases and natural disasters.
National Infectious Diseases Surveillance data of South Korea.
Park, Sunhee; Cho, Eunhee
2014-01-01
The Korea Centers for Disease Control and Prevention (KCDC) operate infectious disease surveillance systems to monitor national disease incidence. Since 1954, Korea has collected data on various infectious diseases in accordance with the Infectious Disease Control and Prevention Act. All physicians (including those working in Oriental medicine) who diagnose a patient with an infectious disease or conduct a postmortem examination of an infectious disease case are obliged to report the disease to the system. These reported data are incorporated into the database of the National Infectious Disease Surveillance System, which has been providing web-based real-time surveillance data on infectious diseases since 2001. In addition, the KCDC analyzes reported data and publishes the Infectious Disease Surveillance Yearbook annually.
21 CFR 866.5640 - Infectious mononucleosis immunological test system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Infectious mononucleosis immunological test system....5640 Infectious mononucleosis immunological test system. (a) Identification. An infectious... immunochemical techniques heterophile antibodies frequently associated with infectious mononucleosis in serum...
21 CFR 866.5640 - Infectious mononucleosis immunological test system.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Infectious mononucleosis immunological test system....5640 Infectious mononucleosis immunological test system. (a) Identification. An infectious... immunochemical techniques heterophile antibodies frequently associated with infectious mononucleosis in serum...
21 CFR 866.5640 - Infectious mononucleosis immunological test system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Infectious mononucleosis immunological test system....5640 Infectious mononucleosis immunological test system. (a) Identification. An infectious... immunochemical techniques heterophile antibodies frequently associated with infectious mononucleosis in serum...
21 CFR 866.5640 - Infectious mononucleosis immunological test system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Infectious mononucleosis immunological test system....5640 Infectious mononucleosis immunological test system. (a) Identification. An infectious... immunochemical techniques heterophile antibodies frequently associated with infectious mononucleosis in serum...
21 CFR 866.5640 - Infectious mononucleosis immunological test system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Infectious mononucleosis immunological test system....5640 Infectious mononucleosis immunological test system. (a) Identification. An infectious... immunochemical techniques heterophile antibodies frequently associated with infectious mononucleosis in serum...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyazaki, M.; Une, H.
In Japan, the waste management practice is carried out in accordance with the Waste Disposal Law of 1970. The first rule of infectious waste management was regulated in 1992, and infectious wastes are defined as the waste materials generated in medical institutions as a result of medical care or research which contain pathogens that have the potential to transmit infectious diseases. Revised criteria for infectious waste management were promulgated by the Ministry of Environment in 2004. Infectious waste materials are divided into three categories: the form of waste; the place of waste generation; the kind of infectious diseases. A reductionmore » of infectious waste is expected. We introduce a summary of the revised regulation of infectious waste management in this article.« less
Emerging and Neglected Infectious Diseases: Insights, Advances, and Challenges
2017-01-01
Infectious diseases are a significant burden on public health and economic stability of societies all over the world. They have for centuries been among the leading causes of death and disability and presented growing challenges to health security and human progress. The threat posed by infectious diseases is further deepened by the continued emergence of new, unrecognized, and old infectious disease epidemics of global impact. Over the past three and half decades at least 30 new infectious agents affecting humans have emerged, most of which are zoonotic and their origins have been shown to correlate significantly with socioeconomic, environmental, and ecological factors. As these factors continue to increase, putting people in increased contact with the disease causing pathogens, there is concern that infectious diseases may continue to present a formidable challenge. Constant awareness and pursuance of effective strategies for controlling infectious diseases and disease emergence thus remain crucial. This review presents current updates on emerging and neglected infectious diseases and highlights the scope, dynamics, and advances in infectious disease management with particular focus on WHO top priority emerging infectious diseases (EIDs) and neglected tropical infectious diseases. PMID:28286767
Emerging and Neglected Infectious Diseases: Insights, Advances, and Challenges.
Nii-Trebi, Nicholas Israel
2017-01-01
Infectious diseases are a significant burden on public health and economic stability of societies all over the world. They have for centuries been among the leading causes of death and disability and presented growing challenges to health security and human progress. The threat posed by infectious diseases is further deepened by the continued emergence of new, unrecognized, and old infectious disease epidemics of global impact. Over the past three and half decades at least 30 new infectious agents affecting humans have emerged, most of which are zoonotic and their origins have been shown to correlate significantly with socioeconomic, environmental, and ecological factors. As these factors continue to increase, putting people in increased contact with the disease causing pathogens, there is concern that infectious diseases may continue to present a formidable challenge. Constant awareness and pursuance of effective strategies for controlling infectious diseases and disease emergence thus remain crucial. This review presents current updates on emerging and neglected infectious diseases and highlights the scope, dynamics, and advances in infectious disease management with particular focus on WHO top priority emerging infectious diseases (EIDs) and neglected tropical infectious diseases.
28 CFR 549.15 - Infectious disease training and preventive measures.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Infectious disease training and... INSTITUTIONAL MANAGEMENT MEDICAL SERVICES Infectious Disease Management § 549.15 Infectious disease training and..., incorporating a question-and-answer session, about infectious diseases to all newly committed inmates, during...
28 CFR 549.15 - Infectious disease training and preventive measures.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Infectious disease training and... INSTITUTIONAL MANAGEMENT MEDICAL SERVICES Infectious Disease Management § 549.15 Infectious disease training and..., incorporating a question-and-answer session, about infectious diseases to all newly committed inmates, during...
28 CFR 549.15 - Infectious disease training and preventive measures.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Infectious disease training and... INSTITUTIONAL MANAGEMENT MEDICAL SERVICES Infectious Disease Management § 549.15 Infectious disease training and..., incorporating a question-and-answer session, about infectious diseases to all newly committed inmates, during...
28 CFR 549.15 - Infectious disease training and preventive measures.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Infectious disease training and... INSTITUTIONAL MANAGEMENT MEDICAL SERVICES Infectious Disease Management § 549.15 Infectious disease training and..., incorporating a question-and-answer session, about infectious diseases to all newly committed inmates, during...
28 CFR 549.15 - Infectious disease training and preventive measures.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Infectious disease training and... INSTITUTIONAL MANAGEMENT MEDICAL SERVICES Infectious Disease Management § 549.15 Infectious disease training and..., incorporating a question-and-answer session, about infectious diseases to all newly committed inmates, during...
Mycotoxins in Crude Building Materials from Water-Damaged Buildings
Tuomi, Tapani; Reijula, Kari; Johnsson, Tom; Hemminki, Kaisa; Hintikka, Eeva-Liisa; Lindroos, Outi; Kalso, Seija; Koukila-Kähkölä, Pirkko; Mussalo-Rauhamaa, Helena; Haahtela, Tari
2000-01-01
We analyzed 79 bulk samples of moldy interior finishes from Finnish buildings with moisture problems for 17 mycotoxins, as well as for fungi that could be isolated using one medium and one set of growth conditions. We found the aflatoxin precursor, sterigmatocystin, in 24% of the samples and trichothecenes in 19% of the samples. Trichothecenes found included satratoxin G or H in five samples; diacetoxyscirpenol in five samples; and 3-acetyl-deoxynivalenol, deoxynivalenol, verrucarol, or T-2-tetraol in an additional five samples. Citrinine was found in three samples. Aspergillus versicolor was present in most sterigmatocystin-containing samples, and Stachybotrys spp. were present in the samples where satratoxins were found. In many cases, however, the presence of fungi thought to produce the mycotoxins was not correlated with the presence of the expected compounds. However, when mycotoxins were found, some toxigenic fungi usually were present, even if the species originally responsible for producing the mycotoxin was not isolated. We conclude that the identification and enumeration of fungal species present in bulk materials are important to verify the severity of mold damage but that chemical analyses are necessary if the goal is to establish the presence of mycotoxins in moldy materials. PMID:10788357
Mycotoxins in crude building materials from water-damaged buildings.
Tuomi, T; Reijula, K; Johnsson, T; Hemminki, K; Hintikka, E L; Lindroos, O; Kalso, S; Koukila-Kähkölä, P; Mussalo-Rauhamaa, H; Haahtela, T
2000-05-01
We analyzed 79 bulk samples of moldy interior finishes from Finnish buildings with moisture problems for 17 mycotoxins, as well as for fungi that could be isolated using one medium and one set of growth conditions. We found the aflatoxin precursor, sterigmatocystin, in 24% of the samples and trichothecenes in 19% of the samples. Trichothecenes found included satratoxin G or H in five samples; diacetoxyscirpenol in five samples; and 3-acetyl-deoxynivalenol, deoxynivalenol, verrucarol, or T-2-tetraol in an additional five samples. Citrinine was found in three samples. Aspergillus versicolor was present in most sterigmatocystin-containing samples, and Stachybotrys spp. were present in the samples where satratoxins were found. In many cases, however, the presence of fungi thought to produce the mycotoxins was not correlated with the presence of the expected compounds. However, when mycotoxins were found, some toxigenic fungi usually were present, even if the species originally responsible for producing the mycotoxin was not isolated. We conclude that the identification and enumeration of fungal species present in bulk materials are important to verify the severity of mold damage but that chemical analyses are necessary if the goal is to establish the presence of mycotoxins in moldy materials.
D'Annibale, Alessandro; Leonardi, Vanessa; Federici, Ermanno; Baldi, Franco; Zecchini, Fulvio; Petruccioli, Maurizio
2007-04-01
Contaminated soil from a historical industrial site and containing sulfide ore ashes and aromatic hydrocarbons underwent sequential leaching by 0.5 M citrate and microbial treatments. Heavy metals leaching was with the following efficiency scale: Cu (58.7%) > Pb (55.1%) > Zn (44.5%) > Cd (42.9%) > Cr (26.4%) > Ni (17.7%) > Co (14.0%) > As (12.4%) > Fe (5.3%) > Hg (1.1%) and was accompanied by concomitant removal of organic contaminants (about 13%). Leached metals were concentrated into an iron gel, produced during ferric citrate fermentation by the metal-resistant strain BAS-10 of Klebsiella oxytoca. Concomitantly, the acidic leached soil was bioaugmented with Allescheriella sp. DABAC 1, Stachybotrys sp. DABAC 3, Phlebia sp. DABAC 9, Pleurotus pulmonarius CBS 664.97, and Botryosphaeria rhodina DABAC P82. B. rhodina was most effective, leading to a significant depletion of the most abundant contaminants, including 7-H-benz[DE]anthracene-7-one, 9,10-anthracene dione and dichloroaniline isomers, and to a marked detoxification as assessed by the mortality test with the Collembola Folsomia candida Willem. The overall degradation activities of B. rhodina and P. pulmonarius appeared to be significantly enhanced by the preliminary metal removal.
Mold allergy: is it real and what do we do about it?
Rudert, Amanda; Portnoy, Jay
2017-08-01
fungi produce substances that contain pathogen-associated molecular patterns (pamps) and damage-associated molecular patterns (damps) which bind to pattern recognition receptors, stimulating innate immune responses in humans. they also produce allergens that induce production of specific ige. Areas covered: In this review we cover both innate and adaptive immune responses to fungi. Some fungal products can activate both innate and adaptive responses and in doing so, cause an intense and complex health effects. Methods of testing for fungal allergy and evidence for clinical treatment including environmental control are also discussed. In addition, we describe controversial issues including the role of Stachybotrys and mycotoxins in adverse health effects. Expert commentary: Concerns about long-term exposure to fungi have led some patients, attorneys and fungus advocates to promote fears about a condition that has been termed toxic mold syndrome. This syndrome is associated with vague symptoms and is believed to be due to exposure to mycotoxins, though this connection has not been proven. Ultimately, more precise methods are needed to measure both fungal exposure and the resulting health effects. Once that such methods become available, much of the speculation will be replaced by knowledge.
Fungal flora associated with combine harvester wheat and sorghum dusts from Egypt.
Abdel-Hafez, S I; Moubasher, A H; Shoreit, A A; Ismail, M A
1990-01-01
107 species and 8 species varieties belonging to 44 genera were collected from combine harvester wheat and sorghum dusts (35 genera and 91 species + 4 varieties) and from the atmosphere of their hay sites (26 genera and 69 species + 4 varieties) on glucose- and cellulose-Czapek's Dox agar at 28 degrees C and 45 degrees C. The mycoflora of wheat and sorghum dusts were basically similar on the two types of media and the most common fungi were: Alternaria alternata, Aspergillus flavus, A. fumigatus, A. niger, A. ochraceus, A. sydowii, A. terreus, Cochliobolus spicifer, Emericella nidulans, Fusarium moniliforme, Penicillium chrysogenum, P. duclauxii, P. funiculosum and P. oxalicum. Truly thermophilic species were frequently encountered from the two substrates: Chaetomium thermophilum, Humicola grisea var. thermoidae, H. insolens, Malbranchea pulchella var., sulphurea, Rhizomucor pusillus, Sporotrichum thermophilum, Talaromyces thermophilus, Thermoascus thermophilus and Thermomyces lanuginosus. The airborne fungi in the two atmospheres were basically similar and the most prevalent species were members of Alternaria (1 species), Aspergillus (18 species + 2 varieties), Chaetomium (2 species), Cochliobolus(3 species), Emericella (3 species + 2 varieties), Fusarium (3 species), Mucor (1 species), Penicillium (14 species) and Stachybotrys (1 species).
Thermal inactivation of infectious hematopoietic necrosis and infectious pancreatic necrosis virus
Gosting, L.; Gould, R.W.
1981-01-01
A plaque assay was used to follow the inactivation kinetics of infectious hematopoietic necrosis virus and infectious pancreatic necrosis virus in cell culture media at various temperatures. Inactivation of infectious hematopoietic necrosis virus in a visceral organ slurry was compared with that in culture media.
Splenic Infarction: An Under-recognized Complication of Infectious Mononucleosis?
Li, Yan; George, Ann; Arnaout, Sami; Wang, Jennifer P; Abraham, George M
2018-03-01
Splenic infarction is a rare complication of infectious mononucleosis. We describe 3 cases of splenic infarction attributed to infectious mononucleosis that we encountered within a 2-month period. We underscore the awareness of this potential complication of infectious mononucleosis and discuss the differential diagnosis of splenic infarction, including infectious etiologies. While symptomatic management is usually sufficient for infectious mononucleosis-associated splenic infarction, close monitoring for other complications, including splenic rupture, is mandated.
Impact of infectious complications on gastric cancer recurrence.
Hayashi, Tsutomu; Yoshikawa, Takaki; Aoyama, Toru; Hasegawa, Shinichi; Yamada, Takanobu; Tsuchida, Kazuhito; Fujikawa, Hirohito; Sato, Tsutomu; Ogata, Takashi; Cho, Haruhiko; Oshima, Takashi; Rino, Yasushi; Masuda, Munetaka
2015-04-01
Postoperative infectious complications increase disease recurrence in colorectal cancer patients. We herein investigated the impact of infectious complications on gastric cancer recurrence after curative surgery. In total, 502 patients who underwent R0 resection for gastric cancer were reviewed. Patients were classified into those with infectious complications (IC group) and those without infectious complications (NO group). The risk factors for recurrence-free survival (RFS) were identified. Infectious complications, which occurred in 52 patients (10.4%), included pneumonia, ileus with a systemic inflammatory reaction, anastomotic leakage, and intraperitoneal abscess. The overall 5-year RFS rate was 83% in the NO group and 58% in the IC group (p = 0.000). Multivariate analysis demonstrated that age, ASA score, stage, and infectious complications were significant predictors of RFS. Infectious complications were a risk factor for gastric cancer recurrence. To avoid causing infectious complications, the surgical procedure, surgical strategy, and perioperative care should be carefully planned.
Splenic Infarction: An Under-recognized Complication of Infectious Mononucleosis?
Li, Yan; George, Ann; Arnaout, Sami; Wang, Jennifer P; Abraham, George M
2018-01-01
Abstract Splenic infarction is a rare complication of infectious mononucleosis. We describe 3 cases of splenic infarction attributed to infectious mononucleosis that we encountered within a 2-month period. We underscore the awareness of this potential complication of infectious mononucleosis and discuss the differential diagnosis of splenic infarction, including infectious etiologies. While symptomatic management is usually sufficient for infectious mononucleosis-associated splenic infarction, close monitoring for other complications, including splenic rupture, is mandated. PMID:29577060
Liu, Qiyong; Xu, Wenbo; Lu, Shan; Jiang, Jiafu; Zhou, Jieping; Shao, Zhujun; Liu, Xiaobo; Xu, Lei; Xiong, Yanwen; Zheng, Han; Jin, Sun; Jiang, Hai; Cao, Wuchun; Xu, Jianguo
2018-02-01
For the past several decades, the infectious disease profile in China has been shifting with rapid developments in social and economic aspects, environment, quality of food, water, housing, and public health infrastructure. Notably, 5 notifiable infectious diseases have been almost eradicated, and the incidence of 18 additional notifiable infectious diseases has been significantly reduced. Unexpectedly, the incidence of over 10 notifiable infectious diseases, including HIV, brucellosis, syphilis, and dengue fever, has been increasing. Nevertheless, frequent infectious disease outbreaks/events have been reported almost every year, and imported infectious diseases have increased since 2015. New pathogens and over 100 new genotypes or serotypes of known pathogens have been identified. Some infectious diseases seem to be exacerbated by various factors, including rapid urbanization, large numbers of migrant workers, changes in climate, ecology, and policies, such as returning farmland to forests. This review summarizes the current experiences and lessons from China in managing emerging and re-emerging infectious diseases, especially the effects of ecology, climate, and behavior, which should have merits in helping other countries to control and prevent infectious diseases.
Infectious Disease Specialist: What Is an Infectious Disease Specialist?
... More: Facts about ID Infectious Diseases Society of America 1300 Wilson Boulevard Suite 300 Arlington, VA 22209 | ... Us © Copyright IDSA 2018 Infectious Diseases Society of America Full Site Mobile Site
Wang, Manli; Han, Xuemei; Fang, Haiqing; Xu, Chang; Lin, Xiaojun; Xia, Shuxu; Yu, Wenhan; He, Jinlu; Jiang, Shuai; Tao, Hongbing
2018-01-01
Infectious disease knowledge and behaviors are key elements that ensure student health and safety. This study explores the impact of health education on student knowledge and behaviors toward infectious diseases and determines the factors affecting infectious diseases knowledge and behaviors among students in Gansu, China. A cross-sectional study and three sampling methods were used in two counties, 12 schools, and 32 classes in Gansu, China, from 2012 to 2013. Collected data included the following: (1) sociodemographic characteristics of 2002 students (1001 participants in the intervention group and 1001 in the control group); (2) accuracy of student knowledge and behaviors toward infectious diseases based on comparison of intervention and control groups through X 2 test; and (3) mean scores on knowledge and behavior of students with different characteristics toward infectious diseases, as analyzed through analysis of variance (ANOVA). Multiple linear regression was conducted to analyze factors affecting student knowledge and behaviors toward infectious diseases. Statistically significant differences were observed among eight items of infectious disease transmission and treatment knowledge between intervention and control groups ( P < 0.001). Average accuracies of knowledge and behaviors toward infectious diseases reached 72.23% and 60.03%. Significant differences were observed in six items on student behavior in rural and urban areas ( P < 0.001). Health education, household register, and county affected scores of student knowledge and behaviors toward infectious diseases ( P < 0.05). Gender and education level also affected scores of student behaviors toward infectious diseases ( P < 0.001). Health education contributes to student knowledge and behaviors toward infectious diseases. Students in the control group need intensified health education on infectious diseases. Health education needs to pay particular attention to rural students, all male students, and students at senior high school level living on campus.
[Epidemiology of imported infectious diseases in China, 2013-2016].
Wang, Y L; Wang, X; Ren, R Q; Zhou, L; Tu, W W; Ni, D X; Li, Q; Feng, Z J; Zhang, Y P
2017-11-10
Objective: To describe the epidemic of imported infectious diseases in China between 2013 and 2016, including the kinds of infectious diseases, affected provinces, source countries and the epidemiological characteristics, and provide scientific information for the prevention and control of imported infectious diseases. Methods: Data of cases of imported infectious diseases in China from 2013 to 2016 were collected from national information reporting system of infectious diseases, Microsoft Excel 2010 and SPSS 18.0 were used to conduct data cleaning and analysis. Results: From 2013 to 2016, a total of 16 206 imported cases of infectious diseases were reported in China. Of all the cases, 83.12% (13 471 cases) were malaria cases, followed by dengue fever (2 628 cases, 16.22%). The majority of the imported cases were males (14 522 cases, 89.61%). Most cases were aged 20-50 years. Except Zika virus disease and yellow fever, which were mainly reported before and after spring festival, other imported infectious diseases mainly occurred in summer and autumn. The epidemic in affected provinces varied with the types of infectious diseases, and Yunnan reported the largest case number of imported infectious diseases, followed by Jiangsu, Guangxi and Guangdong. The imported cases were mainly from Asian countries, such as Burma, and African countries, such as Angola, Equatorial Guinea and Ghana, which also varied with the types of infectious diseases. Conclusions: We should pay more attention to imported infectious diseases and strengthen the prevention and control measures in our country. In order to reduce the incidence of imported infectious diseases, the health education should be enforced for persons who plan to travel abroad and the active surveillance should be strengthened for returned travelers.
Michael, Benedict D.; Griffiths, Michael J.; Granerod, Julia; Brown, David; Davies, Nicholas W. S.; Borrow, Ray; Solomon, Tom
2016-01-01
Background Encephalitis is parenchymal brain inflammation due to infectious or immune-mediated processes. However, in 15–60% the cause remains unknown. This study aimed to determine if the cytokine/chemokine-mediated host response can distinguish infectious from immune-mediated cases, and whether this may give a clue to aetiology in those of unknown cause. Methods We measured 38 mediators in serum and cerebrospinal fluid (CSF) of patients from the Health Protection Agency Encephalitis Study. Of serum from 78 patients, 38 had infectious, 20 immune-mediated, and 20 unknown aetiology. Of CSF from 37 patients, 20 had infectious, nine immune-mediated and eight unknown aetiology. Results Heat-map analysis of CSF mediator interactions was different for infectious and immune-mediated cases, and that of the unknown aetiology group was similar to the infectious pattern. Higher myeloperoxidase (MPO) concentrations were found in infectious than immune-mediated cases, in serum and CSF (p = 0.01 and p = 0.006). Serum MPO was also higher in unknown than immune-mediated cases (p = 0.03). Multivariate analysis selected serum MPO; classifying 31 (91%) as infectious (p = 0.008) and 17 (85%) as unknown (p = 0.009) as opposed to immune-mediated. CSF data also selected MPO classifying 11 (85%) as infectious as opposed to immune-mediated (p = 0.036). CSF neutrophils were detected in eight (62%) infective and one (14%) immune-mediated cases (p = 0.004); CSF MPO correlated with neutrophils (p<0.0001). Conclusions Mediator profiles of infectious aetiology differed from immune-mediated encephalitis; and those of unknown cause were similar to infectious cases, raising the hypothesis of a possible undiagnosed infectious cause. Particularly, neutrophils and MPO merit further investigation. PMID:26808276
Michael, Benedict D; Griffiths, Michael J; Granerod, Julia; Brown, David; Davies, Nicholas W S; Borrow, Ray; Solomon, Tom
2016-01-01
Encephalitis is parenchymal brain inflammation due to infectious or immune-mediated processes. However, in 15-60% the cause remains unknown. This study aimed to determine if the cytokine/chemokine-mediated host response can distinguish infectious from immune-mediated cases, and whether this may give a clue to aetiology in those of unknown cause. We measured 38 mediators in serum and cerebrospinal fluid (CSF) of patients from the Health Protection Agency Encephalitis Study. Of serum from 78 patients, 38 had infectious, 20 immune-mediated, and 20 unknown aetiology. Of CSF from 37 patients, 20 had infectious, nine immune-mediated and eight unknown aetiology. Heat-map analysis of CSF mediator interactions was different for infectious and immune-mediated cases, and that of the unknown aetiology group was similar to the infectious pattern. Higher myeloperoxidase (MPO) concentrations were found in infectious than immune-mediated cases, in serum and CSF (p = 0.01 and p = 0.006). Serum MPO was also higher in unknown than immune-mediated cases (p = 0.03). Multivariate analysis selected serum MPO; classifying 31 (91%) as infectious (p = 0.008) and 17 (85%) as unknown (p = 0.009) as opposed to immune-mediated. CSF data also selected MPO classifying 11 (85%) as infectious as opposed to immune-mediated (p = 0.036). CSF neutrophils were detected in eight (62%) infective and one (14%) immune-mediated cases (p = 0.004); CSF MPO correlated with neutrophils (p<0.0001). Mediator profiles of infectious aetiology differed from immune-mediated encephalitis; and those of unknown cause were similar to infectious cases, raising the hypothesis of a possible undiagnosed infectious cause. Particularly, neutrophils and MPO merit further investigation.
Infectious Angiogenesis-Different Pathways, the Same Goal.
Urbanowicz, Maria; Kutzner, Heinz; Riveiro-Falkenbach, Erica; Rodriguez-Peralto, Jose L
2016-11-01
Infectious angiogenesis is the biological response of neoangiogenesis induced by infectious organisms. The authors present 3 exemplary entities which show paradigmatic clinico-pathological settings of infectious angiogenesis: Bacillary angiomatosis, Orf (ecthyma contagiosum), and Kaposi sarcoma. The authors review the literature and elucidate etiopathogenetic pathways leading to the phenomenon of neovascularization stimulated by infectious organisms. The authors describe the clinical and histological pictures, interactions between microorganisms and host cells, and changes that occur within cellular structures, as well as angiogenic factors that underpin infectious angiogenesis. The importance of chronic inflammation and tumor angiogenesis is emphasized.
[Surveillance as an effective approach to infectious diseases control and prevention].
Wang, L P; Cao, W C
2017-04-10
Infectious disease surveillance have played an important role in the national diseases prevention and control strategies. In line with the reporting system, infectious disease surveillance has been greatly improved and played pivotal role in preventing epidemics since 1949 in China. To date, surveillance remains an effective approach to infectious disease control and prevention because of the global serious situation. In this column "infectious disease surveillance" , we have involved articles as systematic analysis of surveillance data and solid evidence related to the development of strategies and measures for infectious diseases control and prevention.
NON-INFECTIOUS DISORDERS OF WARMWATER FISHES
Compared with infectious diseases and disorders, few non-infectious diseases and disorders in cultured fish have severe biologic or economic impact. Culture practices, however, often establish environments that promote infectious disease by weakening the immune response or by pro...
Infectious Cryptosporidium parvum oocysts in final reclaimed effluent
Gennaccaro, A.L.; McLaughlin, M.R.; Quintero-Betancourt, W.; Huffman, D.E.; Rose, J.B.
2003-01-01
Water samples collected throughout several reclamation facilities were analyzed for the presence of infectious Cryptosporidium parvum by the focus detection method-most-probable-number cell culture technique. Results revealed the presence of infectious C. parvum oocysts in 40% of the final disinfected effluent samples. Sampled effluent contained on average seven infectious oocysts per 100 liters. Thus, reclaimed water is not pathogen free but contains infectious C. parvum.
Divorce and risk of hospital-diagnosed infectious diseases.
Nielsen, Nete Munk; Davidsen, Rie B; Hviid, Anders; Wohlfahrt, Jan
2014-11-01
Although, divorce is considered to have a negative impact on morbidity, very little is known concerning exposure to divorce and risk of infectious diseases. We aimed to investigate the association between divorce and subsequent hospital contacts with infectious diseases. We performed a nation-wide cohort study, including all Danish men and women (n≈5.6 million) alive on the 1 January 1982 or later, and followed them for infectious disease diagnosed in hospital settings from 1982 to 2010. The association between divorce and risk of infectious diseases was evaluated through rate ratios (RRs) comparing incidence rates of infectious diseases between divorced and married pesons. Compared with married persons, divorced persons were overall at a 1.48 fold (RR=1.48 (95% CI: 1.47-1.50)) increased risk of hospital-diagnosed infectious diseases (RR adjusted for sex, age, period, income and education). The risk of infectious diseases was slightly more pronounced for divorced women (RR=1.54 (1.52-1.56)) than divorced men ((RR=1.42 (1.41-1.44)). The increased risk remained almost unchanged even more than 15 years after the divorce. Young age at divorce, short duration of marriage and number of divorces further increased the risk of infectious diseases, whereas number of children at time of divorce had no impact on risk of hospital-diagnosed infectious diseases following the divorce. Divorce appears to have a moderate but long lasting impact on the risk of infectious diseases the underlying mechanism is unknown but shared risk factors predicting divorce and infectious diseases could contribute to our findings. © 2014 the Nordic Societies of Public Health.
França, R F O; da Silva, C C; De Paula, S O
2013-06-01
In recent years we have observed great advances in our ability to combat infectious diseases. Through the development of novel genetic methodologies, including a better understanding of pathogen biology, pathogenic mechanisms, advances in vaccine development, designing new therapeutic drugs, and optimization of diagnostic tools, significant infectious diseases are now better controlled. Here, we briefly describe recent reports in the literature concentrating on infectious disease control. The focus of this review is to describe the molecular methods widely used in the diagnosis, prevention, and control of infectious diseases with regard to the innovation of molecular techniques. Since the list of pathogenic microorganisms is extensive, we emphasize some of the major human infectious diseases (AIDS, tuberculosis, malaria, rotavirus, herpes virus, viral hepatitis, and dengue fever). As a consequence of these developments, infectious diseases will be more accurately and effectively treated; safe and effective vaccines are being developed and rapid detection of infectious agents now permits countermeasures to avoid potential outbreaks and epidemics. But, despite considerable progress, infectious diseases remain a strong challenge to human survival.
[Infectious diseases research].
Carratalà, Jordi; Alcamí, José; Cordero, Elisa; Miró, José M; Ramos, José Manuel
2008-12-01
There has been a significant increase in research activity into infectious diseases in Spain in the last few years. The Spanish Society of Infectious Diseases and Clinical Microbiology (SEIMC) currently has ten study groups, with the cooperation of infectious diseases specialists and microbiologists from different centres, with significant research activity. The program of Redes Temáticas de Investigación Cooperativa en Salud (Special Topics Cooperative Health Research Networks) is an appropriate framework for the strategic coordination of research groups from the Spanish autonomous communities. The Spanish Network for Research in Infectious Diseases (REIPI) and the Network for Research in AIDS (RIS) integrate investigators in Infectious Diseases from multiple groups, which continuously perform important research projects. Research using different experimental models in infectious diseases, in numerous institutions, is an important activity in our country. The analysis of the recent scientific production in Infectious Diseases shows that Spain has a good position in the context of the European Union. The research activity in Infectious Diseases carried out in our country is a great opportunity for the training of specialists in this area of knowledge.
Medical Statistics in World War II (Medical Department, United States Army)
1975-01-01
G80,850, 860 tious. Hydrocele, 420, 442, 464, 486, 508, 630, Infectious mononucleosis . See Mononucleo. 1186 sis, Infectious . Hydronephrosls, 398, 420...1049, 1071, 1003, 1115, 1137, 1159 Mononucleosis , infectious , 410, 432, 454, Medulloblastoma, 410, 432, 454, 476, 408, 470, 498, 520, 1170 520, 1176...World War II: Vol. 1. Activities of Medical Consultants Vol. II. Infectious Diseases Vol. III, Infectious Dieeases and General Medicine Neuropsychiatry
Recommended Curriculum for Training in Pediatric Transplant Infectious Diseases.
Danziger-Isakov, Lara; Allen, Upton; Englund, Janet; Herold, Betsy; Hoffman, Jill; Green, Michael; Gantt, Soren; Kumar, Deepali; Michaels, Marian G
2015-03-01
A working group representing the American Society of Transplantation, Pediatric Infectious Diseases Society, and International Pediatric Transplant Association has developed a collaborative effort to identify and develop core knowledge in pediatric transplant infectious diseases. Guidance for patient care environments for training and core competencies is included to help facilitate training directed at improving the experience for pediatric infectious diseases trainees and practitioners in the area of pediatric transplant infectious diseases. © The Author 2013. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Calvo-Bado, Leo; Garcez, Lourdes M.; Quinnell, Rupert J.
2014-01-01
Background The relationships between heterogeneities in host infection and infectiousness (transmission to arthropod vectors) can provide important insights for disease management. Here, we quantify heterogeneities in Leishmania infantum parasite numbers in reservoir and non-reservoir host populations, and relate this to their infectiousness during natural infection. Tissue parasite number was evaluated as a potential surrogate marker of host transmission potential. Methods Parasite numbers were measured by qPCR in bone marrow and ear skin biopsies of 82 dogs and 34 crab-eating foxes collected during a longitudinal study in Amazon Brazil, for which previous data was available on infectiousness (by xenodiagnosis) and severity of infection. Results Parasite numbers were highly aggregated both between samples and between individuals. In dogs, total parasite abundance and relative numbers in ear skin compared to bone marrow increased with the duration and severity of infection. Infectiousness to the sandfly vector was associated with high parasite numbers; parasite number in skin was the best predictor of being infectious. Crab-eating foxes, which typically present asymptomatic infection and are non-infectious, had parasite numbers comparable to those of non-infectious dogs. Conclusions Skin parasite number provides an indirect marker of infectiousness, and could allow targeted control particularly of highly infectious dogs. PMID:24416460
Assessment of risk for transplant-transmissible infectious encephalitis among deceased organ donors.
Smalley, Hannah K; Anand, Nishi; Buczek, Dylan; Buczek, Nicholas; Lin, Timothy; Rajore, Tanay; Wacker, Muriel; Basavaraju, Sridhar V; Gurbaxani, Brian M; Hammett, Teresa; Keskinocak, Pinar; Sokol, Joel; Kuehnert, Matthew J
2018-05-29
There were 13 documented clusters of infectious encephalitis transmission via organ transplant from deceased donors to recipients during 2002-2013. Hence, organs from donors diagnosed with encephalitis are often declined due to concerns about the possibility of infection, given that there is no quick and simple test to detect causes of infectious encephalitis. We constructed a database containing cases of infectious and non-infectious encephalitis. Using statistical imputation, cross-validation, and regression techniques, we determined deceased organ donor characteristics, including demographics, signs, symptoms, physical exam, and laboratory findings, predictive of infectious versus non-infectious encephalitis, and developed a calculator which assesses risk of infection. Using up to 12 predictive patient characteristics, (with a minimum of 3, depending on what information is available), the calculator provides the probability that a donor may have infectious versus non-infectious encephalitis, improving the prediction accuracy over current practices. These characteristics include gender, fever, immunocompromised state (other than HIV), cerebrospinal fluid elevation, altered mental status, psychiatric features, cranial nerve abnormality, meningeal signs, focal motor weakness, Babinski's sign, movement disorder, and sensory abnormalities. In the absence of definitive diagnostic testing in a potential organ donor, infectious encephalitis can be predicted with a risk score. The risk calculator presented in this paper represents a prototype, establishing a framework that can be expanded to other infectious diseases transmissible through solid organ transplantation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
The Role of Gender in Uveitis and Ocular Inflammation
Yeung, Ian YL; Popp, Nicholas A; Chan, Chi-Chao
2015-01-01
Uveitides can be due to non-infectious and infectious etiologies. It has been observed that there is a gender difference with a greater preponderance of non-infectious uveitis in women than in men. This review will describe both non-infectious and infectious uveitides and describes some of the current autoimmune mechanisms thought to be underlying the gender difference. It will specifically look at non-infectious uveitides with systemic involvement including juvenile idiopathic arthritis, spondyloarthopathies, sarcoidosis, Behçet’s disease, and Vogt-Koyanagi-Harada disease and at uveitides without systemic involvement including sympathetic ophthalmia, birdshot chorioretinitis, and the white dot syndromes. Infectious uveitides like acute retinal necrosis, progressive outer retinal necrosis, and cytomegalovirus mediated uveitis will be mentioned. Different uveitides with female- or male- predominance are presented and discussed. PMID:26035764
Use of telemedicine technologies in the management of infectious diseases: a review.
Parmar, Parmvir; Mackie, David; Varghese, Sunil; Cooper, Curtis
2015-04-01
Telemedicine technologies are rapidly being integrated into infectious diseases programs with the aim of increasing access to infectious diseases specialty care for isolated populations and reducing costs. We summarize the utility and effectiveness of telemedicine in the evaluation and treatment of infectious diseases patients. The use of telemedicine in the management of acute infectious diseases, chronic hepatitis C, human immunodeficiency virus, and active pulmonary tuberculosis is considered. We recapitulate and evaluate the advantages of telemedicine described in other studies, present challenges to adopting telemedicine, and identify future opportunities for the use of telemedicine within the realm of clinical infectious diseases. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Emerging Trends in International Law Concerning Global Infectious Disease Control1
2003-01-01
International cooperation has become critical in controlling infectious diseases. In this article, I examine emerging trends in international law concerning global infectious disease control. The role of international law in horizontal and vertical governance responses to infectious disease control is conceptualized; the historical development of international law regarding infectious diseases is described; and important shifts in how states, international institutions, and nonstate organizations use international law in the context of infectious disease control today are analyzed. The growing importance of international trade law and the development of global governance mechanisms, most prominently in connection with increasing access to drugs and other medicines in unindustrialized countries, are emphasized. Traditional international legal approaches to infectious disease control—embodied in the International Health Regulations—may be moribund. PMID:12643821
Fragkoudis, Rennos; Dixon-Ballany, Catherine M; Zagrajek, Adrian K; Kedzierski, Lukasz; Fazakerley, John K
2018-05-18
Alphaviruses are mosquito-transmitted RNA viruses which generally cause acute disease including mild febrile illness, rash, arthralgia, myalgia and more severely, encephalitis. In the mouse, peripheral infection with Semliki Forest virus (SFV) results in encephalitis. With non-virulent strains, infectious virus is detectable in the brain, by standard infectivity assays, for around ten days. As we have shown previously, in severe combined immunodeficient (SCID) mice, infectious virus is detectable for months in the brain. Here we show that in MHC-II -/- mice, with no functional CD4 T-cells, infectious virus is also detectable in the brain for long periods. In contrast, in the brains of CD8 -/- mice, virus RNA persists but infectious virus is not detectable. In SCID mice infected with SFV, repeated intraperitoneal administration of anti-SFV immune serum rapidly reduced the titer of infectious virus in the brain to undetectable, however virus RNA persisted. Repeated intraperitoneal passive transfer of immune serum resulted in maintenance of brain virus RNA, with no detectable infectious virus, for several weeks. When passive antibody transfer was stopped, antibody levels declined and infectious virus was again detectable in the brain. In aged immunocompetent mice, previously infected with SFV, immunosuppression of antibody responses many months after initial infection also resulted in renewed ability to detect infectious virus in the brain. In summary, antiviral antibodies control and determine whether infectious virus is detectable in the brain but immune responses cannot clear this infection from the brain. Functional virus RNA capable of generating infectious virus persists and if antibody levels decline, infectious virus is again detectable.
Noppert, Grace A; Kubale, John T; Wilson, Mark L
2017-01-01
Background Infectious disease epidemiologists have long recognised the importance of social variables as drivers of epidemics and disease risk, yet few apply analytic approaches from social epidemiology. We quantified and evaluated the extent to which recent infectious disease research is employing the perspectives and methods of social epidemiology by replicating the methodology used by Cohen et al in a 2007 study. Methods 2 search strategies were used to identify and review articles published from 1 January 2005 to 31 December 2013. First, we performed a keyword search of ‘social epidemiology’ in the title/abstract/text of published studies identified in PubMed, PsychInfo and ISI Web of Science, and classified each study as pertaining to infectious, non-infectious or other outcomes. A second PubMed search identified articles that were cross-referenced under non-infectious or infectious, and search terms relating to social variables. The abstracts of all articles were read, classified and examined to identify patterns over time. Results Findings suggest that infectious disease research publications that explicitly or implicitly incorporate social epidemiological approaches have stagnated in recent years. While the number of publications that were explicitly self-classified as ‘social epidemiology’ has risen, the proportion that investigated infectious disease outcomes has declined. Furthermore, infectious diseases accounted for the smallest proportion of articles that were cross-referenced with Medical Subject Headings (MeSH) terms related to social factors, and most of these involved sexually transmitted diseases. Conclusions The current landscape of infectious disease epidemiology could benefit from new approaches to understanding how the social and biophysical environment sustains transmission and exacerbates disparities. The framework of social epidemiology provides infectious disease researchers with such a perspective and research opportunity. PMID:27799618
1988-03-14
increased incidence of acute, infectious illnesses, such as upper respiratory infections and infectious mononucleosis , as well as outbreaks of herpes... infectious mononucleosis . Psychosomatic Medicine, 41. 445-466. Kemeny, M., Cohen, F., and Zegams, L., (1986). The relationship of coping strategies to...follow-up period in order to identify predictors of infectious illness over time. As in the preliminary work, we are finding that approximately 1/3 of
Hamandi, Bassem; Husain, Shahid; Humar, Atul; Papadimitropoulos, Emmanuel A
2014-10-15
There has been a paucity of data on the healthcare resource utilization of infectious disease-related complications in solid organ transplant recipients. The aims of this study were to report the clinical and economic burden of infectious disease-related complications, along with the impact of infectious disease consultation. This cohort study evaluated patients requiring admission to a tertiary-care center during 2007, 2008, and 2011. Propensity score matching was used to estimate the effects of patient demographics, comorbidities, and transplant- and infection-related factors on 28-day hospital survival, length of stay (LOS), and medical costs. Infectious disease-related complications occurred in 603 of 1414 (43%) admissions in 306 of 531 (58%) patients. Unadjusted 28-day mortality did not differ between those who received infectious disease consultations vs those who did not (2.9% vs 3.6%, P = .820), however, after propensity score matching, infectious disease consultation resulted in significantly greater 28-day survival estimates (hazard ratio = 0.33; log-rank P = .026), and reduced 30-day rehospitalization rates (16.9% vs 23.9%, P = .036). The median LOS and hospitalization costs were significantly increased for patients receiving an infectious disease consultation than in those managed by the attending team alone (7.0 vs 5.0 days, P = .002, and $9652 vs $6192, P = .003). However, the median LOS (5.5 vs 5.1 days, P = .31) and hospitalization costs ($8106 vs $6912, P = .63) did not differ significantly among those receiving an early infectious disease consultation (<48 hours) vs no consultation, respectively. Infectious disease consultation in recipients of solid organ transplant is associated with increased LOS and hospitalization costs but decreased mortality and reduced rehospitalization rates. Early consultation with infectious disease specialists decreases healthcare resource utilization compared with delayed referrals. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Wang, Manli; Han, Xuemei; Fang, Haiqing; Xu, Chang; Lin, Xiaojun; Xia, Shuxu; Yu, Wenhan; He, Jinlu; Jiang, Shuai
2018-01-01
Objectives Infectious disease knowledge and behaviors are key elements that ensure student health and safety. This study explores the impact of health education on student knowledge and behaviors toward infectious diseases and determines the factors affecting infectious diseases knowledge and behaviors among students in Gansu, China. Methods A cross-sectional study and three sampling methods were used in two counties, 12 schools, and 32 classes in Gansu, China, from 2012 to 2013. Collected data included the following: (1) sociodemographic characteristics of 2002 students (1001 participants in the intervention group and 1001 in the control group); (2) accuracy of student knowledge and behaviors toward infectious diseases based on comparison of intervention and control groups through X2 test; and (3) mean scores on knowledge and behavior of students with different characteristics toward infectious diseases, as analyzed through analysis of variance (ANOVA). Multiple linear regression was conducted to analyze factors affecting student knowledge and behaviors toward infectious diseases. Results Statistically significant differences were observed among eight items of infectious disease transmission and treatment knowledge between intervention and control groups (P < 0.001). Average accuracies of knowledge and behaviors toward infectious diseases reached 72.23% and 60.03%. Significant differences were observed in six items on student behavior in rural and urban areas (P < 0.001). Health education, household register, and county affected scores of student knowledge and behaviors toward infectious diseases (P < 0.05). Gender and education level also affected scores of student behaviors toward infectious diseases (P < 0.001). Conclusions Health education contributes to student knowledge and behaviors toward infectious diseases. Students in the control group need intensified health education on infectious diseases. Health education needs to pay particular attention to rural students, all male students, and students at senior high school level living on campus. PMID:29707573
Koluder-Cimic, Nada; Masic, Izet
2012-01-01
SUMMARY CONFLICT OF INTEREST: none declared There is a relatively low amount of historical data about development of infectology in Bosnia and Herzegovina, but that does not mean that these medical disciplines didn’t have important events and actors that are important for the development of this medical discipline in B&H. In this review we intent to show your several characteristic events and important persons, which left a lasting impression in the development of infectology service in BIH and especially in Sarajevo. Development center for this discipline was in Sarajevo. Experts on infectious diseases were sent from Sarajevo to other health centers to organize new ministry there. Infectology as an organized health care dates back to the Austro-Hungarian period, when a part of the State Hospital in Sarajevo formed a separate Department of Infectious Diseases. Thanks to the competent professional and later teaching staff in this discipline and the importance of health care of patients with infectious diseases, in Sarajevo and other cities in Bosnia, infectious diseases care has experienced expansion and increasing importance and quality. Infectious disease specialists were very quick in organizing their professional association and with exchange of knowledge and experience have contributed substantially to the above assertion. The “Association of infectious diseases of Bosnia and Herzegovina” was founded during the aggression on BIH, in 1994 and in 1997 they organized the first scientific congress of the Association of the infectious disease specialist with international participation. Improving the health of the population in the area of infectious diseases was significantly helped by infectious diseases clinics at clinical centers in BIH and departments for infectious diseases within the hospitals in B&H. Association of the infectious disease is a significant coordinator for scientific and professional activities, but also the environment in which infectious disease specialists are able to share their knowledge and experiences. PMID:24493987
[FEATURES OF CLINICAL COURSE OF INFECTIOUS MONONUCLEOSIS IN CHILDREN DEPENDENT ON ETIOLOGY].
Kharchenko, Iu P; Zarets'ka, A V; Slobodnichenko, L M; Iurchenko, I V
2015-01-01
The article highlights the clinical features of infectious mononucleosis in children (based on the analysis of the data for children of different ages treated in Odessa clinical hospital of infectious diseases in connection with infectious mononucleosis) based on etiological factors.
77 FR 28398 - National Institute of Allergy and Infectious Diseases Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-14
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group, Microbiology and Infectious Diseases B Subcommittee. Date: June 7, 2012..., and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National...
78 FR 6126 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-29
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group, Microbiology and Infectious Diseases B Subcommittee. Date: February 20-21..., Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research...
78 FR 58322 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-09-23
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group, Microbiology and Infectious Diseases B Subcommittee, Microbiology..., 301-402-9523, [email protected] . Name of Committee: Microbiology, Infectious Diseases and AIDS...
75 FR 28029 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-19
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology and Infectious Diseases B Subcommittee. Date: June 10, 2010....855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases...
Effect of non-stationary climate on infectious gastroenteritis transmission in Japan.
Onozuka, Daisuke
2014-06-03
Local weather factors are widely considered to influence the transmission of infectious gastroenteritis. Few studies, however, have examined the non-stationary relationships between global climatic factors and transmission of infectious gastroenteritis. We analyzed monthly data for cases of infectious gastroenteritis in Fukuoka, Japan from 2000 to 2012 using cross-wavelet coherency analysis to assess the pattern of associations between indices for the Indian Ocean Dipole (IOD) and El Niño Southern Oscillation (ENSO). Infectious gastroenteritis cases were non-stationary and significantly associated with the IOD and ENSO (Multivariate ENSO Index [MEI], Niño 1 + 2, Niño 3, Niño 4, and Niño 3.4) for a period of approximately 1 to 2 years. This association was non-stationary and appeared to have a major influence on the synchrony of infectious gastroenteritis transmission. Our results suggest that non-stationary patterns of association between global climate factors and incidence of infectious gastroenteritis should be considered when developing early warning systems for epidemics of infectious gastroenteritis.
Capacity building in pediatric transplant infectious diseases: an international perspective.
Danziger-Isakov, Lara; Evans, Helen M; Green, Michael; McCulloch, Mignon; Michaels, Marian G; Posfay-Barbe, Klara M; Verma, Anita; Allen, Upton
2014-12-01
Transplant infectious diseases is a rapidly emerging subspecialty within pediatric infectious diseases reflecting the increasing volumes and complexity of this patient population. Incorporating transplant infectious diseases into the transplant process would provide an opportunity to improve clinical outcome and advocacy as well as expand research. The relationship between transplant physicians and infectious diseases (ID) specialists is one of partnership, collaboration, and mutual continuing professional education. The ID CARE Committee of the International Pediatric Transplant Association (IPTA) views the development and integration of transplant infectious diseases into pediatric transplant care as an international priority. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Global mapping of infectious disease
Hay, Simon I.; Battle, Katherine E.; Pigott, David M.; Smith, David L.; Moyes, Catherine L.; Bhatt, Samir; Brownstein, John S.; Collier, Nigel; Myers, Monica F.; George, Dylan B.; Gething, Peter W.
2013-01-01
The primary aim of this review was to evaluate the state of knowledge of the geographical distribution of all infectious diseases of clinical significance to humans. A systematic review was conducted to enumerate cartographic progress, with respect to the data available for mapping and the methods currently applied. The results helped define the minimum information requirements for mapping infectious disease occurrence, and a quantitative framework for assessing the mapping opportunities for all infectious diseases. This revealed that of 355 infectious diseases identified, 174 (49%) have a strong rationale for mapping and of these only 7 (4%) had been comprehensively mapped. A variety of ambitions, such as the quantification of the global burden of infectious disease, international biosurveillance, assessing the likelihood of infectious disease outbreaks and exploring the propensity for infectious disease evolution and emergence, are limited by these omissions. An overview of the factors hindering progress in disease cartography is provided. It is argued that rapid improvement in the landscape of infectious diseases mapping can be made by embracing non-conventional data sources, automation of geo-positioning and mapping procedures enabled by machine learning and information technology, respectively, in addition to harnessing labour of the volunteer ‘cognitive surplus’ through crowdsourcing. PMID:23382431
76 FR 30373 - National Institute of Allergy and Infectious Diseases; Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-25
... Allergy and Infectious Diseases; Meeting Notice of Closed Meeting Pursuant to section 10(d) of the Federal... Infectious Diseases Special Emphasis Panel; NIAID Investigator Initiated Program Project Applications (P01... Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated...
76 FR 28997 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-19
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group,Microbiology and Infectious Diseases B Subcommittee. Date: June 15, 2011... Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated...
77 FR 2736 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-19
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology and Infectious Diseases B Subcommittee. Date: February 8-9... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
78 FR 3011 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-15
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology and Infectious Diseases Research Committee. Date: February 5-6... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
75 FR 49502 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-13
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology and Infectious Diseases Research Committee. Date: October 14..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: August 9, 2010...
75 FR 81631 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-12-28
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group. Microbiology and Infectious Diseases Research Committee. Date: February 16..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: December 21, 2010...
77 FR 29676 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-18
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology and Infectious Diseases Research Committee. Date: June 12, 2012..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: May 11, 2012...
78 FR 27976 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-05-13
..., 301-496-2550, [email protected] . Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology and Infectious Diseases B Subcommittee. Date: June 10, 2013... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
76 FR 2128 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-12
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group. Microbiology and Infectious Diseases B Subcommittee. Date: February 10-11... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
76 FR 55074 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-06
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group, Microbiology and Infectious Diseases Research Committee. Date: October 4..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: August 30, 2011...
78 FR 41939 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-07-12
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... Infectious Diseases Special Emphasis Panel; NIAID Investigator Initiated Program Project Applications. Date... Allergy and Infectious Diseases Special Emphasis Panel; NIAID Investigator Initiated Program Project...
Ganguly, Bhaskar; Umapathi, Vijaypillai; Rastogi, Sunil Kumar
2018-01-01
Infectious Bursal Disease is a severe viral disease of chicken responsible for serious economic losses to poultry farmers. The causative agent, Infectious Bursal Disease virus, is inhibited by nitric oxide. Root extract of the Indian ginseng, Withania somnifera , inhibits Infectious Bursal Disease virus in vitro. Also, Withania somnifera root extract is known to induce nitric oxide production in vitro. Therefore, the present study was undertaken to determine if the inhibitory activity of Withania somnifera against Infectious Bursal Disease virus was based on the production of nitric oxide. We show that besides other mechanisms, the inhibition of Infectious Bursal Disease virus by Withania somnifera involves the production of nitric oxide. Our results also highlight the paradoxical role of nitric oxide in the pathogenesis of Infectious Bursal Disease.
Liu, Zhidong; Zhang, Feifei; Zhang, Ying; Li, Jing; Liu, Xuena; Ding, Guoyong; Zhang, Caixia; Liu, Qiyong; Jiang, Baofa
2018-06-01
Understanding the potential links between floods and infectious diarrhea is important under the context of climate change. However, little is known about the risk of infectious diarrhea after floods and what factors could modify these effects in China. This study aims to quantitatively examine the relationship between floods and infectious diarrhea and their effect modifiers. Weekly number of infectious diarrhea cases from 2004 to 2011 during flood season in Hunan province were supplied by the National Notifiable Disease Surveillance System. Flood and meteorological data over the same period were obtained. A two-stage model was used to estimate a provincial average association and their effect modifiers between floods and infectious diarrhea, accounting for other confounders. A total of 134,571 cases of infectious diarrhea were notified from 2004 to 2011. After controlling for seasonality, long-term trends, and meteorological factors, floods were significantly associated with infectious diarrhea in the provincial level with a cumulative RR of 1.22 (95% CI: 1.05, 1.43) with a lagged effect of 0-1 week. Geographic locations and economic levels were identified as effect modifiers, with a higher impact of floods on infectious diarrhea in the western and regions with a low economic level of Hunan. Our study provides strong evidence of a positive association between floods and infectious diarrhea in the study area. Local control strategies for public health should be taken in time to prevent and reduce the risk of infectious diarrhea after floods, especially for the vulnerable regions identified. Copyright © 2018 Elsevier B.V. All rights reserved.
Brennan, Meghan B; Allen, Glenn O; Ferguson, Patrick D; McBride, Joseph A; Crnich, Christopher J; Smith, Maureen A
2017-01-01
Avoiding major (above-ankle) amputation in patients with diabetic foot ulcers is best accomplished by multidisciplinary care teams with access to infectious disease specialists. However, access to infectious disease physicians is partially influenced by geography. We assessed the effect of living in a hospital referral region with a high geographic density of infectious disease physicians on major amputation for patients with diabetic foot ulcers. We studied geographic density, rather than infectious disease consultation, to capture both the direct and indirect (eg, informal consultation) effects of access to these providers on major amputation. We used a national retrospective cohort of 56440 Medicare enrollees with incident diabetic foot ulcers. Cox proportional hazard models were used to assess the relationship between infectious disease physician density and major amputation, while controlling for patient demographics, comorbidities, and ulcer severity. Living in hospital referral regions with high geographic density of infectious disease physicians was associated with a reduced risk of major amputation after controlling for demographics, comorbidities, and ulcer severity (hazard ratio, .83; 95% confidence interval, .75-.91; P < .001). The relationship between the geographic density of infectious disease physicians and major amputation was not different based on ulcer severity and was maintained when adjusting for socioeconomic factors and modeling amputation-free survival. Infectious disease physicians may play an important role in limb salvage. Future studies should explore whether improved access to infectious disease physicians results in fewer major amputations. © The Author 2017. Published by Oxford University Press on behalf of Infectious Diseases Society of America.
Kanisek, Sanja; Gmajnić, Rudika; Barać, Ivana
2018-01-01
Abstract Introduction The proper classification of sharp and infectious waste in situ by the healthcare workers is an important measure of prevention of sharps and other exposure incidents in non-healthcare workers, who handle such waste. The aim was to examine the practice of classifying sharp and infectious waste in family and dental practices. Methods An analysis of 50 bags of infectious and 50 bags of municipal waste from five family and five dental practices for five days in October 2016 at the Health centre Osijek. Results Healthcare workers in 70% of the practices deposited sharps in infectious waste. In 56% of infectious waste bags, sharp object were found. More risky bags of infectious waste were produced by family practices (64%), but with no significant differences in relation to dental practices (48%), (P=0.143). Disposing of infectious into municipal waste was the case in 90% of the practitioners, where in 60% of municipal waste bags, infectious waste was disposed. Dental practices produced more risky bags of municipal waste (76%) in relation to family practices (44%), but with no significant difference (P=0.714). Conclusions The results of this research point to importance of performing audits of proper disposal of sharps and infectious waste to reduce the risks of injury to non-healthcare workers who come into contact with the said waste. Given results could be used for framing written protocols of proper disposal of sharps and infectious waste that should be visibly available in family and dental practices and for education of healthcare workers. PMID:29651317
76 FR 6626 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-02-07
... Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(d) of the Federal Advisory... Allergy and Infectious Diseases Council. The meetings will be open to the public as indicated below, with... privacy. Name of Committee: National Advisory Allergy and Infectious Diseases Council; Allergy, Immunology...
76 FR 75552 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-02
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... Institute of Allergy and Infectious Diseases Special Emphasis Panel, NIAID Investigator Initiated Program... Institute of Allergy and Infectious Diseases Special Emphasis Panel, NIAID Investigator Initiated Program...
75 FR 57972 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-23
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... conducted by the National Institute of Allergy and Infectious Diseases, including consideration of personnel..., Division of Intramural Research, National Institute of Allergy and Infectious Diseases, NIH, Building 31...
76 FR 4858 - Submission for OMB Review; Comment Request
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-27
... such as equine infectious anemia, as well as to take action to prevent and to manage exotic diseases... Infectious Anemia Laboratory Test; VS 10- 12, Equine Infectious Anemia Supplemental Investigation; and VS 1... infectious anemia. Regulations also require the use an Agreement for Approved Livestock Facilities, Request...
77 FR 56660 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-13
... constitute a clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology and Infectious Diseases B Subcommittee. MID-B October..., [email protected] . Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group...
78 FR 27409 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-05-10
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... Infectious Diseases Special Emphasis Panel; NIAID Investigator Initiated Program Project Applications (P01... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
78 FR 34110 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-06-06
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... Infectious Diseases Special Emphasis Panel; NIAID Investigator Initiated Program Project Applications (P01... Infectious Diseases Research, National Institutes of Health, HHS) Dated: May 31, 2013. David Clary, Program...
78 FR 314 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-03
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... Infectious Diseases Special Emphasis Panel, ``NIAID Investigator Initiated Program Applications (P01).'' Date... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
78 FR 12769 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-02-25
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... conducted by the National Institute of Allergy and Infectious Diseases, including consideration of personnel..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: February 19, 2013...
78 FR 108 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-02
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... Infectious Diseases Special Emphasis Panel NIAID Science Education Awards (R25). Date: January 22, 2013. Time... Committee: National Institute of Allergy and Infectious Diseases Special Emphasis Panel NIAID Investigator...
Management of Chronic Infectious Diseases in School Children.
ERIC Educational Resources Information Center
Illinois State Board of Education, Springfield.
This document contains guidelines for developing policies and procedures related to chronic infectious diseases, as recommended by the Illinois Task Force on School Management of Infectious Disease. It is designed to help school personnel understand how infectious diseases can be transmitted, and to assist school districts in the development and…
Surveillance and early warning systems of infectious disease in China: From 2012 to 2014.
Zhang, Honglong; Wang, Liping; Lai, Shengjie; Li, Zhongjie; Sun, Qiao; Zhang, Peng
2017-07-01
Appropriate surveillance and early warning of infectious diseases have very useful roles in disease control and prevention. In 2004, China established the National Notifiable Infectious Disease Surveillance System and the Public Health Emergency Event Surveillance System to report disease surveillance and events on the basis of data sources from the National Notifiable Infectious Disease Surveillance System, China Infectious Disease Automated-alert and Response System in this country. This study provided a descriptive summary and a data analysis, from 2012 to 2014, of these 3 key surveillance and early warning systems of infectious disease in China with the intent to provide suggestions for system improvement and perfection. Copyright © 2017 John Wiley & Sons, Ltd.
[Infectious diseases - a specialty of internal medicine].
Fätkenheuer, G; Jung, N; Kern, W V; Fölsch, U R; Salzberger, B
2018-04-01
Infectious diseases have recently gained wide public interest. Emerging infections and rising rates of antibiotic resistance are determining this trend. Both challenges will need to be addressed in international and local collaborations between different specialties in medicine and basic science. Infectious diseases as a clinical specialty in this scenario is directly responsible for the care of patients with infectious diseases. Its involvement in the care of patients with complicated infections has proved to be highly effective. Antibiotic stewardship programmes are effective measures in slowing the development of antibiotic resistance and have been widely implemented. But antibiotic stewardship specialists should not be confused with or taken as an alternative to infectious disease experts. Infectious diseases requires appropriate and specific training. It mainly uses the instrumentarium of internal medicine. With the current challenges in modern medicine, infectious diseases in Germany should thus be upgraded from a subspecialty to a clinical specialty, ideally within Internal Medicine.
Pillai, Satish K; Beekmann, Susan E; Santibanez, Scott; Polgreen, Philip M
2014-04-01
In 1995, the Centers for Disease Control and Prevention granted a Cooperative Agreement Program award to the Infectious Diseases Society of America to develop a provider-based emerging infections sentinel network, the Emerging Infections Network (EIN). Over the past 17 years, the EIN has evolved into a flexible, nationwide network with membership representing a broad cross-section of infectious disease physicians. The EIN has an active electronic mail conference (listserv) that facilitates communication among infectious disease providers and the public health community, and also sends members periodic queries (short surveys on infectious disease topics) that have addressed numerous topics relevant to both clinical infectious diseases and public health practice. The article reviews how the various functions of EIN contribute to clinical care and public health, identifies opportunities to further link clinical medicine and public health, and describes future directions for the EIN.
The role of infectious disease in marine communities: chapter 5
Lafferty, Kevin D.; Harvell, C. Drew
2014-01-01
Marine ecologists recognize that infectious diseases play and important role in ocean ecosystems. This role may have increased in some host taxa over time (Ward and Lafferty 2004). We begin this chapter by introducing infectious agents and their relationships with their hosts in marine systems. We then put infectious disease agents with their hosts in marine systems. We then put infectious disease agents in the perspective of marine biodiversity and discuss the various factors that affect parasites. Specifically, we introduce some basin epidemiological concepts, including the effects of stress and free-living diversity on parasites. Following this, we give brief consideration to communities of parasites within their hosts, particularly as these can lead to general insights into community ecology. We also give examples of how infectious diseases affect host populations, scaling up to marine communities. Finally, we present examples of marine infectious disease that impair conservation and fisheries.
A World Wide Web selected bibliography for pediatric infectious diseases.
Jenson, H B; Baltimore, R S
1999-02-01
A pediatric infectious diseases bibliography of selected medical reference citations has been developed and placed on the World Wide Web (WWW) at http://www.pedid.uthscsa.edu. A regularly updated bibliography of >2,500 selected literature citations representing general reviews and key articles has been organized under a standard outline for individual infectious diseases and related topics that cover the breadth of pediatric infectious diseases. Citations are categorized by infectious disease or clinical syndrome, and access can be achieved by the disease or by syndrome or the name of the pathogen. Abstracts, and in some cases the complete text of articles, may be viewed by use of hypertext links. The bibliography provides medical students, residents, fellows, and clinicians with a constantly available resource of current literature citations in pediatric infectious diseases. The WWW is an emerging educational and clinical resource for the practice of clinical infectious diseases.
Pillai, Satish K.; Beekmann, Susan E.; Santibanez, Scott; Polgreen, Philip M.
2015-01-01
In 1995, the Centers for Disease Control and Prevention granted a Cooperative Agreement Program award to the Infectious Diseases Society of America to develop a provider-based emerging infections sentinel network, the Emerging Infections Network (EIN). Over the past 17 years, the EIN has evolved into a flexible, nationwide network with membership representing a broad cross-section of infectious disease physicians. The EIN has an active electronic mail conference (listserv) that facilitates communication among infectious disease providers and the public health community, and also sends members periodic queries (short surveys on infectious disease topics) that have addressed numerous topics relevant to both clinical infectious diseases and public health practice. The article reviews how the various functions of EIN contribute to clinical care and public health, identifies opportunities to further link clinical medicine and public health, and describes future directions for the EIN. PMID:24403542
50 CFR 16.13 - Importation of live or dead fish, mollusks, and crustaceans, or their eggs.
Code of Federal Regulations, 2011 CFR
2011-10-01
... necrosis, and infectious pancreatic necrosis have not been detected in the fish stocks from which the... hemorrhagic septicemia, infectious hematopoietic necrosis, and infectious pancreatic necrosis have not been... necrosis, and infectious pancreatic necrosis have been killed. (d) Any fish caught in the wild in North...
50 CFR 16.13 - Importation of live or dead fish, mollusks, and crustaceans, or their eggs.
Code of Federal Regulations, 2014 CFR
2014-10-01
... necrosis, and infectious pancreatic necrosis have not been detected in the fish stocks from which the... hemorrhagic septicemia, infectious hematopoietic necrosis, and infectious pancreatic necrosis have not been... necrosis, and infectious pancreatic necrosis have been killed. (d) Any fish caught in the wild in North...
50 CFR 16.13 - Importation of live or dead fish, mollusks, and crustaceans, or their eggs.
Code of Federal Regulations, 2012 CFR
2012-10-01
... necrosis, and infectious pancreatic necrosis have not been detected in the fish stocks from which the... hemorrhagic septicemia, infectious hematopoietic necrosis, and infectious pancreatic necrosis have not been... necrosis, and infectious pancreatic necrosis have been killed. (d) Any fish caught in the wild in North...
50 CFR 16.13 - Importation of live or dead fish, mollusks, and crustaceans, or their eggs.
Code of Federal Regulations, 2013 CFR
2013-10-01
... necrosis, and infectious pancreatic necrosis have not been detected in the fish stocks from which the... hemorrhagic septicemia, infectious hematopoietic necrosis, and infectious pancreatic necrosis have not been... necrosis, and infectious pancreatic necrosis have been killed. (d) Any fish caught in the wild in North...
76 FR 77241 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-12
... Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(d) of the Federal Advisory... Allergy and Infectious Diseases Council. The meetings will be open to the public as indicated below, with... Committee: National Advisory Allergy and Infectious Diseases Council. Date: January 30, 2012. Open: 10:30 a...
77 FR 76296 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2012-12-27
... Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(d) of the Federal Advisory... Allergy and Infectious Diseases Council. The meetings will be open to the public as indicated below, with... Committee: National Advisory Allergy and Infectious Diseases Council. Date: February 4, 2013. Open: 10:30 a...
78 FR 79703 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-31
... Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(d) of the Federal Advisory... Allergy and Infectious Diseases Council. The meetings will be open to the public as indicated below, with... of Committee: National Advisory Allergy and Infectious Diseases Council. Date: January 27, 2014. Open...
78 FR 12767 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-02-25
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... Infectious Diseases Special Emphasis Panel; NIAID Peer Review Meeting. Date: March 14, 2013. Time: 11:00 a.m... Nos. 93.855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious...
Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-07-21
...] Notice of Request for Extension of Approval of an Information Collection; Infectious Salmon Anemia... of indemnity due to infectious salmon anemia. DATES: We will consider all comments that we receive on... the payment of indemnity due to infectious salmon anemia, contact Dr. William G. Smith, Area...
The effect of global warming on infectious diseases.
Kurane, Ichiro
2010-12-01
Global warming has various effects on human health. The main indirect effects are on infectious diseases. Although the effects on infectious diseases will be detected worldwide, the degree and types of the effect are different, depending on the location of the respective countries and socioeconomical situations. Among infectious diseases, water- and foodborne infectious diseases and vector-borne infectious diseases are two main categories that are forecasted to be most affected. The effect on vector-borne infectious diseases such as malaria and dengue fever is mainly because of the expansion of the infested areas of vector mosquitoes and increase in the number and feeding activity of infected mosquitoes. There will be increase in the number of cases with water- and foodborne diarrhoeal diseases. Even with the strongest mitigation procedures, global warming cannot be avoided for decades. Therefore, implementation of adaptation measures to the effect of global warming is the most practical action we can take. It is generally accepted that the impacts of global warming on infectious diseases have not been apparent at this point yet in East Asia. However, these impacts will appear in one form or another if global warming continues to progress in future. Further research on the impacts of global warming on infectious diseases and on future prospects should be conducted.
Isenring, Egon; Fehr, Jan; Gültekin, Nejla; Schlagenhauf, Patricia
2018-04-24
In the past decade, a large influx of migrants presented in Europe. Their country of origin was mainly either Syria or Eritrea. Public health institutions in host countries in Europe are challenged to screen and care for migrant populations with regard to infectious diseases. We performed a systematic literature review (according to PRISMA guidelines) to define the infectious disease profile of migrants originating in Syria and Eritrea. The search resulted in 825 papers of possible relevance for infectious diseases in migrants from Syria, of which, after screening, we included 35 in the systematic review. A further 265 papers of possible relevance for infectious diseases in Eritrean migrants were screened, of which we included 27 in the systematic review. In migrants from Syria, leishmaniasis was the most frequently reported infectious disease. In addition, colonisation with drug resistant, Gram-negativ bacteria was reported. In the Eritrean migrants the infectious disease most described in the selected papers was louse-borne relapsing fever. Other frequently reported infectious diseases were scabies and Plasmodium vivax malaria. Our systematic analysis defines the profiles of infectious diseases for migrants from Syria and Eritrea and serves as an evidence base for public health screening and care of presenting migrants. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Infectious diseases in competitive sports.
Goodman, R A; Thacker, S B; Solomon, S L; Osterholm, M T; Hughes, J M
1994-03-16
Participation in competitive sports is popular and widely encouraged throughout the United States. Reports of infectious disease outbreaks among competitive athletes and recent publicity regarding infectious disease concerns in sports underscore the need to better characterize the occurrence of these problems. To identify reports of infectious diseases in sports, we performed a comprehensive search of the medical literature (MEDLINE) and newspaper databases in two on-line services (NEXIS and DIALOG PAPERS). Articles selected from the literature review included those describing cases or outbreaks of disease in which exposure to an infectious agent was likely to have occurred during training for competitive sports or during actual competition. Articles from the newspaper review included reports of outbreaks, exposures, or preventive measures that directly or indirectly involved teams or spectators. The literature review identified 38 reports of infectious disease outbreaks or other instances of transmission through person-to-person (24 reports), common-source (nine reports), or airborne (five reports) routes; the newspaper search identified 28 reports. Infectious agents included predominantly viruses but also a variety of fungi and gram-positive and gram-negative bacteria. Our findings indicate that strategies to prevent transmission of infectious diseases in sports must recognize risks at three levels: the individual athlete, the team, and spectators or others who may become exposed to infectious diseases as a result of sports-related activities. Team physicians and others who are responsible for the health of athletes should be especially familiar with the features of infectious diseases that occur in sports and measures for the prevention of these problems.
Evidence for the role of infectious disease in species extinction and endangerment
Smith, Katherine F.; Sax, Dov F.; Lafferty, Kevin D.
2006-01-01
Infectious disease is listed among the top five causes of global species extinctions. However, the majority of available data supporting this contention is largely anecdotal. We used the IUCN Red List of Threatened and Endangered Species and literature indexed in the ISI Web of Science to assess the role of infectious disease in global species loss. Infectious disease was listed as a contributing factor in <4% of species extinctions known to have occurred since 1500 (833 plants and animals) and as contributing to a species' status as critically endangered in <8% of cases (2852 critically endangered plants and animals). Although infectious diseases appear to play a minor role in global species loss, our findings underscore two important limitations in the available evidence: uncertainty surrounding the threats to species survival and a temporal bias in the data. Several initiatives could help overcome these obstacles, including rigorous scientific tests to determine which infectious diseases present a significant threat at the species level, recognition of the limitations associated with the lack of baseline data for the role of infectious disease in species extinctions, combining data with theory to discern the circumstances under which infectious disease is most likely to serve as an agent of extinction, and improving surveillance programs for the detection of infectious disease. An evidence-based understanding of the role of infectious disease in species extinction and endangerment will help prioritize conservation initiatives and protect global biodiversity.
Hutchins, Rae G; Breitschwerdt, Edward B; Cullen, John M; Bissett, Sally A; Gookin, Jody L
2012-09-01
Canine granulomatous hepatitis is an uncommon morphologic diagnosis that has been associated with a variety of diseases, including a number of systemic infectious etiologies. Formalin-fixed, paraffin-embedded (FFPE) tissues are typically the only source of liver tissue remaining for additional testing for the presence of infectious disease within granulomas. It is unclear if the more common infectious culprits of granulomatous hepatitis can be identified from such specimens. The aim of the current study was to retrospectively investigate archival FFPE liver tissue from dogs with granulomatous hepatitis for the presence of infectious agents. Semiquantitative analysis of copper accumulation in liver specimens was also performed. Medical records were examined for recorded evidence of systemic infectious disease diagnosis. Formalin-fixed, paraffin-embedded liver was prospectively evaluated for infectious agents via differential staining techniques (n = 13), eubacterial fluorescent in situ hybridization (n = 11), and Bartonella polymerase chain reaction assays (n = 15). An infectious cause of granulomatous hepatitis was not identified within liver tissue from any dog using these diagnostic methodologies. Six out of 25 (24%) dogs were diagnosed with concurrent systemic or localized bacterial infections at the time of presentation. Nine out of 17 (53%) dogs had excessive hepatic copper accumulation when evaluated by a semiquantitative histologic grading scheme or quantitative copper analysis. As definitive infectious causes of granulomatous hepatitis were not identified within archival liver biopsy samples, it was concluded that investigation of infectious etiologies within FFPE liver specimens using these diagnostic approaches may be of low yield.
Enterovirus A71 DNA-Launched Infectious Clone as a Robust Reverse Genetic Tool
Tan, Chee Wah; Tee, Han Kang; Lee, Michelle Hui Pheng; Sam, I-Ching; Chan, Yoke Fun
2016-01-01
Enterovirus A71 (EV-A71) causes major outbreaks of hand, foot and mouth disease, and is occasionally associated with neurological complications and death in children. Reverse genetics is widely used in the field of virology for functional study of viral genes. For EV-A71, such tools are limited to clones that are transcriptionally controlled by T7/SP6 bacteriophage promoter. This is often time-consuming and expensive. Here, we describe the development of infectious plasmid DNA-based EV-A71 clones, for which EV-A71 genome expression is under transcriptional control by the CMV-intermediate early promoter and SV40 transcriptional-termination signal. Transfection of this EV-A71 infectious DNA produces good virus yield similar to in vitro-transcribed EV-A71 infectious RNA, 6.4 and 5.8 log10PFU/ml, respectively. Infectious plasmid with enhanced green fluorescence protein and Nano luciferase reporter genes also produced good virus titers, with 4.3 and 5.0 log10 PFU/ml, respectively. Another infectious plasmid with both CMV and T7 promoters was also developed for easy manipulation of in vitro transcription or direct plasmid transfection. Transfection with either dual-promoter infectious plasmid DNA or infectious RNA derived from this dual-promoter clone produced infectious viral particles. Incorporation of hepatitis delta virus ribozyme, which yields precise 3’ ends of the DNA-launched EV-A71 genomic transcripts, increased infectious viral production. In contrast, the incorporation of hammerhead ribozyme in the DNA-launched EV-A71 resulted in lower virus yield, but improved the virus titers for T7 promoter-derived infectious RNA. This study describes rapid and robust reverse genetic tools for EV-A71. PMID:27617744
Choi, Eun Kyung; Lee, Jong-Koo
2016-12-01
This paper focus upon the changes of global infectious disease governance in 2000s and the transformation of infectious disease control system in South Korea. Traditionally, infectious disease was globally governed by the quarantine regulated by the international conventions. When an infectious disease outbreak occurred in one country, each country prevented transmission of the disease through the standardized quarantine since the installation of international sanitary convention in 1892. Republic of Korea also organized the infectious disease control system with quarantine and disease report procedure after the establishment of government. Additionally, Korea National Health Institute(KNIH) was founded as research and training institute for infectious disease. However, traditional international health regulation system faced a serious challenge by the appearance of emerging and re-emerging infectious disease in 1990s. As a result, global infectious disease governance was rapidly changed under the demand to global disease surveillance and response. Moreover, global health security frame became important after 2001 bioterror and 2003 SARS outbreak. Consequently, international health regulation was fully revised in 2005, which included not only infectious disease but also public health emergency. The new international health regime was differently characterized in several aspects; reinforcement of global cooperation and surveillance, enlargement of the role of supranational and international agencies, and reorganization of national capacity. KNIH was reorganized with epidemic control and research since late 1990s. However, in 2004 Korea Center for Disease Control and Prevention(KCDC) was established as a disease control institution with combining quarantine and other functions after 2003 SARS outbreak. KCDC unified national function against infectious disease including prevention, protection, response and research, as a national representative in disease control. The establishment of KCDC can be understood as the adoption of new international health regulation system based upon SARS experience.
Noppert, Grace A; Kubale, John T; Wilson, Mark L
2017-04-01
Infectious disease epidemiologists have long recognised the importance of social variables as drivers of epidemics and disease risk, yet few apply analytic approaches from social epidemiology. We quantified and evaluated the extent to which recent infectious disease research is employing the perspectives and methods of social epidemiology by replicating the methodology used by Cohen et al in a 2007 study. 2 search strategies were used to identify and review articles published from 1 January 2005 to 31 December 2013. First, we performed a keyword search of 'social epidemiology' in the title/abstract/text of published studies identified in PubMed, PsychInfo and ISI Web of Science, and classified each study as pertaining to infectious, non-infectious or other outcomes. A second PubMed search identified articles that were cross-referenced under non-infectious or infectious, and search terms relating to social variables. The abstracts of all articles were read, classified and examined to identify patterns over time. Findings suggest that infectious disease research publications that explicitly or implicitly incorporate social epidemiological approaches have stagnated in recent years. While the number of publications that were explicitly self-classified as 'social epidemiology' has risen, the proportion that investigated infectious disease outcomes has declined. Furthermore, infectious diseases accounted for the smallest proportion of articles that were cross-referenced with Medical Subject Headings (MeSH) terms related to social factors, and most of these involved sexually transmitted diseases. The current landscape of infectious disease epidemiology could benefit from new approaches to understanding how the social and biophysical environment sustains transmission and exacerbates disparities. The framework of social epidemiology provides infectious disease researchers with such a perspective and research opportunity. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Bladder stones after bladder augmentation are not what they seem.
Szymanski, Konrad M; Misseri, Rosalia; Whittam, Benjamin; Lingeman, James E; Amstutz, Sable; Ring, Joshua D; Kaefer, Martin; Rink, Richard C; Cain, Mark P
2016-04-01
Bladder and renal calculi after bladder augmentation are thought to be primarily infectious, yet few studies have reported stone composition. The primary aim was to assess bladder stone composition after augmentation, and renal stone composition in those with subsequent nephrolithiasis. The exploratory secondary aim was to screen for possible risk factors for developing infectious stones. Patients treated for bladder stones after bladder augmentation at the present institution between 1981 and 2012 were retrospectively reviewed. Data were collected on demographics, surgeries and stone composition. Patients without stone analysis were excluded. Stones containing struvite, carbonate apatite or ammonium acid ureate were classified as infectious. The following variables were analyzed for a possible association with infectious bladder stone composition: gender, history of cloacal exstrophy, ambulatory status, nephrolithiasis, recurrent urea-splitting urinary tract infections, first vs recurrent stones, timing of presentation with a calculus, history of bladder neck procedures, catheterizable channel and vesicoureteral reflux. Fisher's exact test was used for analysis. Of the 107 patients with bladder stones after bladder augmentation, 85 met inclusion criteria. Median age at augmentation was 8.0 years (follow-up 10.8 years). Forty-four patients (51.8%) recurred (14 multiple recurrences, 143 bladder stones). Renal calculi developed in 19 (22.4%) patients with a bladder stone, and 10 (52.6%) recurred (30 renal stones). Overall, 30.8% of bladder stones were non-infectious (Table). Among patients recurring after an infectious bladder stone, 30.4% recurred with a non-infectious one. Among patients recurring after a non-infectious stone, 84.6% recurred with a non-infectious one (P = 0.005). Compared with bladder stones, renal stones were more likely to be non-infectious (60.0%, P = 0.003). Of patients with recurrent renal calculi after an infectious stone, 40.0% recurred with a non-infectious one. No clinical variables were significantly associated with infectious stone composition on univariate (≥0.28) or bivariate analysis (≥0.36). This study had several limitations: it was not possible to accurately assess adherence with bladder irrigations, and routine metabolic evaluations were not performed. The findings may not apply to patients in all clinical settings. While stone analysis was available for 3/4 of the stones, similar rates of incomplete stone analyses have been reported in other series. In patients with bladder augmentation, 1/3 of bladder stones and >1/2 of renal stones were non-infectious. Furthermore, an infectious stone does not imply an infectious recurrent stone and no known clinical variables appear to be associated with stone composition, suggesting that there is a possible metabolic component in stone formation after bladder augmentation. Copyright © 2015 Journal of Pediatric Urology Company. Published by Elsevier Ltd. All rights reserved.
Milićević, Dragan R; Skrinjar, Marija; Baltić, Tatjana
2010-04-01
Mycotoxins are toxic compounds, produced by the secondary metabolism of toxigenic moulds in the Aspergillus, Alternaria, Claviceps, Fusarium, Penicillium and Stachybotrys genera occurring in food and feed commodities both pre- and post-harvest. Adverse human health effects from the consumption of mycotoxins have occurred for many centuries. When ingested, mycotoxins may cause a mycotoxicosis which can result in an acute or chronic disease episode. Chronic conditions have a much greater impact, numerically, on human health in general, and induce diverse and powerful toxic effects in test systems: some are carcinogenic, mutagenic, teratogenic, estrogenic, hemorrhagic, immunotoxic, nephrotoxic, hepatotoxic, dermotoxic and neurotoxic. Although mycotoxin contamination of agricultural products still occurs in the developed world, the application of modern agricultural practices and the presence of a legislatively regulated food processing and marketing system have greatly reduced mycotoxin exposure in these populations. However, in developing countries, where climatic and crop storage conditions are frequently conducive to fungal growth and mycotoxin production, much of the population relies on subsistence farming or on unregulated local markets. Therefore both producers and governmental control authorities are directing their efforts toward the implementation of a correct and reliable evaluation of the real status of contamination of a lot of food commodity and, consequently, of the impact of mycotoxins on human and animal health.
Mycotoxins: toxicity, carcinogenicity, and the influence of various nutritional conditions*
Newberne, Paul M.
1974-01-01
Toxicologic diseases of man and animals, associated with molds growing on foods, have been recognized for centuries. Only in recent years, however, have these mycotoxicoses received the attention of many laboratories and skilled scientists around the world in a broad inter-disciplinary effort. This review covers the literature on mycotoxicoses but centers on those about which most is known, particularly the diseases associated with metabolites elaborated by some strains of Aspergilli, Penicillia, Fusaria, Stachybotrys, and Claviceps. The ubiquitous nature of the aflatoxins, toxic metabolites produced by Aspergillus flavus, make them important to public health, especially since it is now known that certain areas of endemic liver disease coincide with consumption of aflatoxins and, often, malnutrition. The older disease of ergotism, the scourge of Europe for centuries, is considered in detail. Alimentary toxic aleukia, which has caused enormous suffering in Russian human and animal populations, is better understood as a result of relatively recent experimental investigations. Stachybotryotoxicosis, a disease previously considered to be of significance only to man has now been identified in domestic animals. Finally, Japanese studies have clearly revealed the hepatotoxicity of certain metabolites of Penicillium molds. Factors that influence susceptibility to mycotoxins and the hazards they present to man are also reviewed. ImagesFIGURE 2. PMID:4620330
Shaban, G M
1996-01-01
The sugar and osmophilic fungal composition of soils amended with five organic substrates (newspaper, orange peel, bromegrass leaves, wheat straw and wood sawdust) was estimated after 2, 4, 6, 8 and 10 weeks using the dilution plate method on glucose and 50% sucrose Czapek's agar media. Wheat straw was the best substrate for total counts of both sugar and osmophilic fungi followed by newspaper, bromegrass leaves, wood sawdust and orange peel. Wood sawdust supported the highest average counts of total sugar fungi, Fusarium, Mucor, Scopulariopsis, Trichoderma and Trimmatostroma spp.; Newspaper, of Aspergillus (8 spp.), Penicillium (4 spp.) and Chaetomium sp.; bromegrass leaves of Cladosporium sp., Humicola sp. and Sporotrichum sp.; orange peel, of Alternaria sp., Circinella sp. and Stachybotrys sp.; and wheat straw, of Botryotrichum sp. and Myrothecium sp. Bromegrass leaves and orange peel supported the highest average counts of total osmophilic fungi, Aspergillus (10 spp.), Cladosporium sp. Paecillomyces sp. and Rhizopus sp.; and of Stemphylium sp., Trichoderma sp., Humicola sp. and Circinella sp. respectively; wheat straw, of Epicoccum sp., Scopulariopsis sp. and Trichothecium sp.; newspaper, of Penicillium (4 spp.) and Alternaria sp.; and wood sawdust of Curvularia sp. and Fusarium (3 spp.). The best colonizers throughout the experimental periods were Aspergilus and Penicillium spp.
75 FR 76475 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-12-08
... Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(d) of the Federal Advisory... Allergy and Infectious Diseases Council. The meetings will be open to the public as indicated below, with... Infectious Diseases Council. Date: February 7, 2011. Open: 10:30 a.m. to 11:40 a.m. Agenda: Report from the...
75 FR 48978 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-12
... Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(d) of the Federal Advisory... Allergy and Infectious Diseases Council. The meetings will be open to the public as indicated below, with... Infectious Diseases Council. Date: September 20, 2010. Open: 10:30 a.m. to 11:40 a.m. Agenda: Report from the...
75 FR 13561 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-22
... Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(d) of the Federal Advisory... Allergy and Infectious Diseases Council. The meetings will be open to the public as indicated below, with... Infectious Diseases Council. Date: May 24, 2010. Open: 10:30 a.m. to 11:40 a.m. Agenda: Report from the...
The Challenge of Infectious Diseases to the Biomedical Paradigm
ERIC Educational Resources Information Center
Foladori, Guillermo
2005-01-01
The resurgence of infectious diseases and the emergence of infectious diseases raise questions on how to cope with the situation. The germ or clinical approach is the hegemonic biomedical paradigm. In this article, the author argues that the spread of infectious diseases has posted a challenge to the biomedical paradigm and shows how lock-in…
ERIC Educational Resources Information Center
Neulight, Nina; Kafai, Yasmin B.; Kao, Linda; Foley, Brian; Galas, Cathleen
2007-01-01
This study investigated students' understanding of a virtual infectious disease in relation to their understanding of natural infectious diseases. Two sixth-grade classrooms of students between the ages of 10 and 12 (46 students) took part in a participatory simulation of a virtual infectious disease, which was integrated into their science…
78 FR 38998 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-06-28
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... Infectious Diseases Special Emphasis Panel; Immunity in the Elderly (R01). Date: July 16-17, 2013. Time: 8:00... Allergy and Infectious Diseases Special Emphasis Panel; AIDSRRC Independent SEP. Date: July 18, 2013. Time...
Controlling Infectious Diseases in Nurseries
T. H. Filer
1968-01-01
At least 300 publications have been written about non-infectious and infectious diseases of tree seedlings. I will outline some of the progress that is being made in finding ways to control infectious diseases, those caused by pathogens. I will touch upon pre- and post-emergence damping-off, root rots, leaf spots, and fusiform rust, which are the most serious diseases...
Monocyte function in infectious mononucleosis: evidence for a reversible cellular defect.
Britton, S
1976-10-01
Migration of blood monocytes from patients with acute infectious mononucleosis and from normal controls was measured against chemotactic factors in serum. Moncytes from patients with acute infectious mononucleosis showed decreased migration as compared with that of control monocytes. However, serum from patients with infectious mononucleosis contained normal or above normal amounts of chemotaxins for monocytes. The migratory defect of monocytes from patients with infectious mononucleosis was reversible within three months after the onset of diesease. The cause of this monocyte migration defect in infectious mononucleosis is though to be an in vivo blockade of receptors on monocytes for chemotaxins, and it is speculated that this defect can partially explain the explain the ablated delayed-hypersensitivity skin reactions in this disease.
Chronic fatigue syndrome after infectious mononucleosis in adolescents.
Katz, Ben Z; Shiraishi, Yukiko; Mears, Cynthia J; Binns, Helen J; Taylor, Renee
2009-07-01
The goal was to characterize prospectively the course and outcome of chronic fatigue syndrome in adolescents during a 2-year period after infectious mononucleosis. A total of 301 adolescents (12-18 years of age) with infectious mononucleosis were identified and screened for nonrecovery 6 months after infectious mononucleosis by using a telephone screening interview. Nonrecovered adolescents underwent a medical evaluation, with follow-up screening 12 and 24 months after infectious mononucleosis. After blind review, final diagnoses of chronic fatigue syndrome at 6, 12, and 24 months were made by using established pediatric criteria. Six, 12, and 24 months after infectious mononucleosis, 13%, 7%, and 4% of adolescents, respectively, met the criteria for chronic fatigue syndrome. Most individuals recovered with time; only 2 adolescents with chronic fatigue syndrome at 24 months seemed to have recovered or had an explanation for chronic fatigue at 12 months but then were reclassified as having chronic fatigue syndrome at 24 months. All 13 adolescents with chronic fatigue syndrome 24 months after infectious mononucleosis were female and, on average, they reported greater fatigue severity at 12 months. Reported use of steroid therapy during the acute phase of infectious mononucleosis did not increase the risk of developing chronic fatigue syndrome. Infectious mononucleosis may be a risk factor for chronic fatigue syndrome in adolescents. Female gender and greater fatigue severity, but not reported steroid use during the acute illness, were associated with the development of chronic fatigue syndrome in adolescents. Additional research is needed to determine other predictors of persistent fatigue after infectious mononucleosis.
Sibship structure and risk of infectious mononucleosis: a population-based cohort study.
Rostgaard, Klaus; Nielsen, Trine Rasmussen; Wohlfahrt, Jan; Ullum, Henrik; Pedersen, Ole; Erikstrup, Christian; Nielsen, Lars Peter; Hjalgrim, Henrik
2014-10-01
Present understanding of increased risk of Epstein-Barr virus (EBV)-related infectious mononucleosis among children of low birth order or small sibships is mainly based on old and indirect evidence. Societal changes and methodological limitations of previous studies call for new data. We used data from the Danish Civil Registration System and the Danish National Hospital Discharge Register to study incidence rates of inpatient hospitalizations for infectious mononucleosis before the age of 20 years in a cohort of 2,543,225 Danes born between 1971 and 2008, taking individual sibship structure into account. A total of 12,872 cases of infectious mononucleosis were observed during 35.3 million person-years of follow-up. Statistical modelling showed that increasing sibship size was associated with a reduced risk of infectious mononucleosis and that younger siblings conferred more protection from infectious mononucleosis than older siblings. In addition to this general association with younger and older siblings, children aged less than 4 years transiently increased their siblings’ infectious mononucleosis risk. Our results were confirmed in an independent sample of blood donors followed up retrospectively for self-reported infectious mononucleosis. Younger siblings, and to a lesser degree older siblings, seem to be important in the transmission of EBV within families. Apparently the dogma of low birth order in a sibship as being at the highest risk of infectious mononucleosis is no longer valid.
The Infectious Disease Manpower Crisis: Finding the Cure.
Berk, Steven L
2017-02-01
The challenges of infectious diseases, including new pathogens, dangerous outbreaks, antibiotic-resistant bacteria, and the perils of international travel have never been more publically appreciated. These challenges require a well-trained workforce of infectious disease specialists. Just when the need appears to be greatest, however, the interest in infectious diseases among today's young physicians is at its lowest point.
Tulane/Xavier Vaccine Development/Engineering Project
2010-03-01
mortality of some infectious diseases , new ones such as AIDS, Lyme disease , West Nile fever, Hanta virus, SARS, and Avian Influenza virus are constantly...12 4 INTRODUCTION Infectious diseases remain one of the leading causes of death in adults and children world...wide. Each year, infectious diseases kill more than 17 million people, including 9 million children. In addition to suffering and death, infectious
[Spontaneous splenic rupture due to infectious acute mononucleosis: case report].
Greco, L; De Gennaro, E; Degara, A; Papa, U
2003-01-01
Infectious mononucleosis is an acute, viral, illness associated with a high incidence of splenomegaly. Spontaneous splenic rupture is a rare but life-threatening complication of infectious mononucleosis. The authors report the case of a 19-year-old patient with an infectious mononucleosis causing a spontaneous splenic rupture. When rupture occurs the mortality has been significant. The spleen may be vulnerable for the histopathologic changes that occur as a result of this illness. Two thirds of patients with infectious mononucleosis develop an enlarged spleen, but in only 0.5% of all patients will it rupture. Abdominal pain and tachycardia are unusual in uncomplicated infectious mononucleosis and should alert a doctor to the possibility of spontaneous splenic rupture. The diagnosis of splenic rupture may be confirmed in a variety of ways. In this patient ultrasound and Rutkow's criteria may aid in establishing the diagnosis. In patients with infectious mononucleosis suspected of having rupture of the spleen, a rapid but thorough assessment and prompt implementation of appropriate management should minimize the associated morbidity and mortality. On the basis of review of the medical literature and of our own experience, we advocate emergent splenectomy for spontaneous splenic rupture in patients with infectious mononucleosis.
Al-Surimi, Khaled; Khalifa, Mohammed; Bahkali, Salwa; El-Metwally, Ashraf; Househ, Mowafa
2017-01-01
Health threats due to infectious diseases used to be a major public health concerns around the globe till mid of twentieth century when effective public health interventions helped in eradicating a number of infectious diseases around the world. Over the past 15 years, there has been a rise in the number of emerging and reemerging infectious diseases being reported such as the Acute Respiratory Syndrome (SARS) in 2002, HINI in 2009, Middle East Respiratory Syndrome (MERS) in 2012, Ebola in 2014, and Zika in 2016. These emerging viral infectious diseases have led to serious public health concerns leading to death and causing fear and anxiety among the public. More importantly, at the moment, the prevention and control of viral infectious diseases is difficult due to a lack of effective vaccines. Thus having real-time reporting tools are paramount to alert relevant public health surveillance systems and authorities about taking the right and necessary actions to control and minimize the potential harmful effects of viral infectious diseases. Social media and Internet-based data can play a major role in real-time reporting to empower active public health surveillance systems for controlling and fighting infectious diseases.
Ma, Hui; Dong, Ji-Ping; Zhou, Na; Pu, Wei
2016-01-01
In recent years, the incidence of severe infectious diseases has increased, and the number of emerging infectious diseases continues to increase. The Chinese government and military forces have paid a great deal of attention to infectious disease prevention and control, and using military-civilian cooperation, they have successfully prevented numerous severe epidemic situations, such as severe acute respiratory syndrome (SARS), influenza A (H1N1), avian influenza H5N1 and H7N9, and Ebola hemorrhagic fever, while actively maintained public health, economic development, and national construction. This paper focuses on the mechanisms of the military-cooperative emergency response to infectious diseases--the joint working mechanism, the information-sharing mechanism, the research collaboration mechanism, and the joint disposal mechanism--and presents a sorted summary of the practices and experiences of cooperative emergency responses to infectious diseases. In the future, the Chinese military and the civilian sector will further strengthen the cooperative joint command system and emergency rescue force and will reinforce their collaborative information-sharing platform and technical equipment system to further improve military-civilian collaborative emergency infectious diseases disposal, advance the level of infectious disease prevention and control, and maintain public health.
[Severe upper airway obstruction in infectious mononucleosis: a life emergency].
Salazard, B; Paut, O; Nicollas, R; Zandotti, C; Chrestian, M A; Thuret, I; Camboulives, J
2001-09-01
Upper airway obstruction can represent a severe, life-threatening complication of infectious mononucleosis. We report a rare case of airway obstruction in a child with infectious mononucleosis associated with herpes virus infection, and we discuss management strategy that can be proposed in such cases. A 9-year-old girl was hospitalised in intensive care unit for obstructive dyspnea during infectious mononucleosis. Despite five days of corticosteroids and tracheal intubation, persistent pharyngo-tonsillar tumefaction led us to perform a surgical adenotonsillectomy. This latter treatment allowed immediate tracheal extubation and a rapid recovery. Histology showed a herpes virus infection associated with infectious mononucleosis. Maintaining airway opening in infectious mononucleosis needs sometimes to use instrumental interventions: nasal trumpet, endotracheal intubation, even tracheostomy. Early tonsilloadenoidectomy may relieve airway obstruction and allow a rapid recovery in the most severe cases. Airway obstruction in infectious mononucleosis may be aggravated by concomitant herpes virus infection that should be searched for in this situation, in order to adapt the treatment.
Lennon, P; Saunders, J; Fenton, J E
2013-02-01
Anecdotally, infectious mononucleosis is considered a more severe infection than bacterial tonsillitis, requiring a longer hospital stay. However, there is little in the literature comparing the epidemiology of the two conditions. This study aimed to compare the epidemiology of bacterial tonsillitis and infectious mononucleosis, in particular any differences in the length of in-patient stay. The hospital in-patient enquiry system was used to analyse patients admitted with bacterial tonsillitis and infectious mononucleosis between 1990 and 2009 inclusive. There was a total of 3435 cases over the 20 years: 3064 with bacterial tonsillitis and 371 with infectious mononucleosis. The mean length of stay was 3.22 days for bacterial tonsillitis and 4.37 days for infectious mononucleosis. The median length of stay for each condition was compared using the Mann-Whitney U non-parametric test, and a significant difference detected (p < 0.001). Patients with infectious mononucleosis have a significantly longer stay in hospital than those with bacterial tonsillitis.
Identifying climate drivers of infectious disease dynamics: recent advances and challenges ahead
Walter, Katharine S.; Wesolowski, Amy; Buckee, Caroline O.; Shevliakova, Elena; Tatem, Andrew J.; Boos, William R.; Weinberger, Daniel M.; Pitzer, Virginia E.
2017-01-01
Climate change is likely to profoundly modulate the burden of infectious diseases. However, attributing health impacts to a changing climate requires being able to associate changes in infectious disease incidence with the potentially complex influences of climate. This aim is further complicated by nonlinear feedbacks inherent in the dynamics of many infections, driven by the processes of immunity and transmission. Here, we detail the mechanisms by which climate drivers can shape infectious disease incidence, from direct effects on vector life history to indirect effects on human susceptibility, and detail the scope of variation available with which to probe these mechanisms. We review approaches used to evaluate and quantify associations between climate and infectious disease incidence, discuss the array of data available to tackle this question, and detail remaining challenges in understanding the implications of climate change for infectious disease incidence. We point to areas where synthesis between approaches used in climate science and infectious disease biology provide potential for progress. PMID:28814655
Assessment of economic vulnerability to infectious disease crises.
Sands, Peter; El Turabi, Anas; Saynisch, Philip A; Dzau, Victor J
2016-11-12
Infectious disease crises have substantial economic impact. Yet mainstream macroeconomic forecasting rarely takes account of the risk of potential pandemics. This oversight contributes to persistent underestimation of infectious disease risk and consequent underinvestment in preparedness and response to infectious disease crises. One reason why economists fail to include economic vulnerability to infectious disease threats in their assessments is the absence of readily available and digestible input data to inform such analysis. In this Viewpoint we suggest an approach by which the global health community can help to generate such inputs, and a framework to use these inputs to assess the economic vulnerability to infectious disease crises of individual countries and regions. We argue that incorporation of these risks in influential macroeconomic analyses such as the reports from the International Monetary Fund's Article IV consultations, rating agencies and risk consultancies would simultaneously improve the quality of economic risk forecasting and reinforce individual government and donor incentives to mitigate infectious disease risks. Copyright © 2016 Elsevier Ltd. All rights reserved.
Identifying climate drivers of infectious disease dynamics: recent advances and challenges ahead.
Metcalf, C Jessica E; Walter, Katharine S; Wesolowski, Amy; Buckee, Caroline O; Shevliakova, Elena; Tatem, Andrew J; Boos, William R; Weinberger, Daniel M; Pitzer, Virginia E
2017-08-16
Climate change is likely to profoundly modulate the burden of infectious diseases. However, attributing health impacts to a changing climate requires being able to associate changes in infectious disease incidence with the potentially complex influences of climate. This aim is further complicated by nonlinear feedbacks inherent in the dynamics of many infections, driven by the processes of immunity and transmission. Here, we detail the mechanisms by which climate drivers can shape infectious disease incidence, from direct effects on vector life history to indirect effects on human susceptibility, and detail the scope of variation available with which to probe these mechanisms. We review approaches used to evaluate and quantify associations between climate and infectious disease incidence, discuss the array of data available to tackle this question, and detail remaining challenges in understanding the implications of climate change for infectious disease incidence. We point to areas where synthesis between approaches used in climate science and infectious disease biology provide potential for progress. © 2017 The Authors.
Facts about Infectious Diseases (ID)
... of microorganisms will emerge. Infectious Diseases Society of America 1300 Wilson Boulevard Suite 300 Arlington, VA 22209 | ... Us © Copyright IDSA 2018 Infectious Diseases Society of America Full Site Mobile Site
Infectious Disease Transmission during Organ and Tissue Transplantation
Kuehnert, Matthew J.; Fishman, Jay A.
2012-01-01
Infectious disease transmission through organ and tissue transplantation has been associated with severe complications in recipients. Determination of donor-derived infectious risk associated with organ and tissue transplantation is challenging and limited by availability and performance characteristics of current donor epidemiologic screening (e.g., questionnaire) and laboratory testing tools. Common methods and standards for evaluating potential donors of organs and tissues are needed to facilitate effective data collection for assessing the risk for infectious disease transmission. Research programs can use advanced microbiological technologies to define infectious risks posed by pathogens that are known to be transplant transmissible and provide insights into transmission potential of emerging infectious diseases for which transmission characteristics are unknown. Key research needs are explored. Stakeholder collaboration for surveillance and research infrastructure is required to enhance transplant safety. PMID:22840823
Cameron, Andrew; Akilan, Kosalan; Carr, David
2018-03-01
Infectious mononucleosis is typically a self-limited viral infection of adolescence and early adulthood that resolves in a period of weeks, causing no major sequelae. We describe a case of a healthy 18-year-old female diagnosed with infectious mononucleosis who also presented with right upper quadrant abdominal pain, moderate transaminitis, and cholestatic biochemistry. An ultrasound revealed acute acalculous cholecystitis, generally a condition seen in the context of critical illness. Further investigating emergency department patients with infectious mononucleosis is often not indicated, but may be important for those who present atypically.
Bilateral sixth cranial nerve palsy in infectious mononucleosis.
Neuberger, J.; Bone, I.
1979-01-01
A 15-year-old girl who presented with a bilateral sixth nerve palsy caused by infectious mononucleosis is described. The neurological presentation of infectious mononucleosis is discussed. PMID:225738
Infectious mononucleosis #3 (image)
Infectious mononucleosis is caused by the Epstein-Barr virus. It is a viral infection causing high temperature, sore throat, and swollen lymph glands. Infectious mononucleosis can be contagious if the infected person comes ...
75 FR 77650 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-12-13
... Infectious Diseases Special Emphasis Panel; Ancillary Studies in Immunomodulation Clinical Trails. Date..., and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National...
77 FR 13133 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-05
... Infectious Diseases Special Emphasis Panel Integrated Preclinical/Clinical Program for HIV Topical..., and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National...
78 FR 40756 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-07-08
... Infectious Diseases Special Emphasis Panel; Integrated Preclinical/Clinical AIDS Vaccine Development Program..., and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National...
Hogan, William R; Wagner, Michael M; Brochhausen, Mathias; Levander, John; Brown, Shawn T; Millett, Nicholas; DePasse, Jay; Hanna, Josh
2016-08-18
We developed the Apollo Structured Vocabulary (Apollo-SV)-an OWL2 ontology of phenomena in infectious disease epidemiology and population biology-as part of a project whose goal is to increase the use of epidemic simulators in public health practice. Apollo-SV defines a terminology for use in simulator configuration. Apollo-SV is the product of an ontological analysis of the domain of infectious disease epidemiology, with particular attention to the inputs and outputs of nine simulators. Apollo-SV contains 802 classes for representing the inputs and outputs of simulators, of which approximately half are new and half are imported from existing ontologies. The most important Apollo-SV class for users of simulators is infectious disease scenario, which is a representation of an ecosystem at simulator time zero that has at least one infection process (a class) affecting at least one population (also a class). Other important classes represent ecosystem elements (e.g., households), ecosystem processes (e.g., infection acquisition and infectious disease), censuses of ecosystem elements (e.g., censuses of populations), and infectious disease control measures. In the larger project, which created an end-user application that can send the same infectious disease scenario to multiple simulators, Apollo-SV serves as the controlled terminology and strongly influences the design of the message syntax used to represent an infectious disease scenario. As we added simulators for different pathogens (e.g., malaria and dengue), the core classes of Apollo-SV have remained stable, suggesting that our conceptualization of the information required by simulators is sound. Despite adhering to the OBO Foundry principle of orthogonality, we could not reuse Infectious Disease Ontology classes as the basis for infectious disease scenarios. We thus defined new classes in Apollo-SV for host, pathogen, infection, infectious disease, colonization, and infection acquisition. Unlike IDO, our ontological analysis extended to existing mathematical models of key biological phenomena studied by infectious disease epidemiology and population biology. Our ontological analysis as expressed in Apollo-SV was instrumental in developing a simulator-independent representation of infectious disease scenarios that can be run on multiple epidemic simulators. Our experience suggests the importance of extending ontological analysis of a domain to include existing mathematical models of the phenomena studied by the domain. Apollo-SV is freely available at: http://purl.obolibrary.org/obo/apollo_sv.owl .
78 FR 68857 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-11-15
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and..., and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National...
75 FR 8975 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-26
... Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group, Acquired Immunodeficiency...; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) [[Page...
75 FR 15712 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-30
... Infectious Diseases Special Emphasis Panel; Ancillary Studies in Immunomodulation Clinical Trials. Date..., Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National...
Howley, Peter M
2015-01-01
The role of infectious agents in cancer is generally underappreciated. However, approximately 20% of human cancers are caused by infectious agents and as such they rank second only to tobacco as a potentially preventable cause in humans. Specific viruses, parasites, and bacteria have been linked to specific human cancers. The infectious etiology for these specific cancers provides opportunities for prevention and treatment.
Control of Hemotropic Diseases of Dogs.
1979-12-01
In Japan, for many years, the disease was identified as viral infectious mononucleosis . In other southeast Asian Countries, i.e., Malaysia, confirmed...cases of infectious mononucleosis are found only among the European population. The occurrence of signs and symptoms compatible with infectious ...sonnets.: in cell culture system. JaP. J. of Microbiology. 9: ’S-8b. isao, T. and Kobayashi, Y. 1955. Studies on infectious mononucleosis . I
NASA Technical Reports Server (NTRS)
Pierson, Duane L.
1990-01-01
This is a collection of viewgraphs on the Johnson Space Center's work on infectious disease. It addresses their major concern over outbreaks of infectious disease that could jeopardize the health, safety and/or performance of crew members engaged in long duration space missions. The Antarctic environment is seen as an analogous location on Earth and a good place to carry out such infectious disease studies and methods for proposed studies as suggested.
Brazilian infectious diseases specialists: who and where are they?
Cassenote, Alex Jones Flores; Scheffer, Mario César; Segurado, Aluísio Augusto Cotrim
2016-01-01
The infectious diseases specialist is a medical doctor dedicated to the management of infectious diseases in their individual and collective dimensions. The aim of this paper was to evaluate the current profile and distribution of infectious diseases specialists in Brazil. This is a cross-sectional study using secondary data obtained from institutions that register medical specialists in Brazil. Variables of interest included gender, age, type of medical school (public or private) the specialist graduated from, time since finishing residency training in infectious diseases, and the interval between M.D. graduation and residency completion. Maps are used to study the geographical distribution of infectious diseases specialists. A total of 3229 infectious diseases specialist registries were counted, with 94.3% (3045) of individual counts (heads) represented by primary registries. The mean age was 43.3 years (SD 10.5), and a higher proportion of females was observed (57%; 95% CI 55.3-58.8). Most Brazilian infectious diseases specialists (58.5%) practice in the Southeastern region. However, when distribution rates were calculated, several states exhibited high concentration of infectious diseases specialists, when compared to the national rate (16.06). Interestingly, among specialists working in the Northeastern region, those trained locally had completed their residency programs more recently (8.7yrs; 95% CI 7.9-9.5) than physicians trained elsewhere in the country (13.6yrs: 95% CI 11.8-15.5). Our study shows that Brazilian infectious diseases specialists are predominantly young and female doctors. Most have concluded a medical residency training program. The absolute majority practice in the Southeastern region. However, some states from the Northern, Northeastern and Southeastern regions exhibit specialist rates above the national average. In these areas, nonetheless, there is a strong concentration of infectious diseases specialists in state capitals and in metropolitan areas. Copyright © 2016. Published by Elsevier Editora Ltda.
75 FR 6043 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-05
... Infectious Diseases Special Emphasis Panel; Nonhuman Primate Cellular Immunology Core for HIV Vaccine..., Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research...
75 FR 30040 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-28
... Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Acquired Immunodeficiency..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: May 24, 2010...
76 FR 28443 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-17
... . Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group, Microbiology and..., Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National...
77 FR 46099 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-02
... Committee: National Institute of Allergy and Infectious Diseases Special Emphasis Panel; NIAID Clinical..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) [[Page 46100
78 FR 46357 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-07-31
... Infectious Diseases Special Emphasis Panel; NIAID Clinical Trial Implementation Cooperative Agreement (U01....855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases...
77 FR 2736 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-19
... Infectious Diseases Special Emphasis Panel; NIAID Clinical Trial Planning and Implementation. Date: February..., Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research...
77 FR 2736 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-19
... Infectious Diseases Special Emphasis Panel; NIAID Clinical Trial Implementation Cooperative Agreement (U01....855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases...
Alicke, Marie; Boakye-Appiah, Justice K.; Abdul-Jalil, Inusah; Henze, Andrea; van der Giet, Markus; Schulze, Matthias B.; Schweigert, Florian J.; Mockenhaupt, Frank P.; Bedu-Addo, George
2017-01-01
In sub-Saharan Africa, infectious diseases and malnutrition constitute the main health problems in children, while adolescents and adults are increasingly facing cardio-metabolic conditions. Among adolescents as the largest population group in this region, we investigated the co-occurrence of infectious diseases, malnutrition and cardio-metabolic risk factors (CRFs), and evaluated demographic, socio-economic and medical risk factors for these entities. In a cross-sectional study among 188 adolescents in rural Ghana, malarial infection, common infectious diseases and Body Mass Index were assessed. We measured ferritin, C-reactive protein, retinol, fasting glucose and blood pressure. Socio-demographic data were documented. We analyzed the proportions (95% confidence interval, CI) and the co-occurrence of infectious diseases (malaria, other common diseases), malnutrition (underweight, stunting, iron deficiency, vitamin A deficiency [VAD]), and CRFs (overweight, obesity, impaired fasting glucose, hypertension). In logistic regression, odds ratios (OR) and 95% CIs were calculated for the associations with socio-demographic factors. In this Ghanaian population (age range, 14.4–15.5 years; males, 50%), the proportions were for infectious diseases 45% (95% CI: 38–52%), for malnutrition 50% (43–57%) and for CRFs 16% (11–21%). Infectious diseases and malnutrition frequently co-existed (28%; 21–34%). Specifically, VAD increased the odds of non-malarial infectious diseases 3-fold (95% CI: 1.03, 10.19). Overlap of CRFs with infectious diseases (6%; 2–9%) or with malnutrition (7%; 3–11%) was also present. Male gender and low socio-economic status increased the odds of infectious diseases and malnutrition, respectively. Malarial infection, chronic malnutrition and VAD remain the predominant health problems among these Ghanaian adolescents. Investigating the relationships with evolving CRFs is warranted. PMID:28727775
Alicke, Marie; Boakye-Appiah, Justice K; Abdul-Jalil, Inusah; Henze, Andrea; van der Giet, Markus; Schulze, Matthias B; Schweigert, Florian J; Mockenhaupt, Frank P; Bedu-Addo, George; Danquah, Ina
2017-01-01
In sub-Saharan Africa, infectious diseases and malnutrition constitute the main health problems in children, while adolescents and adults are increasingly facing cardio-metabolic conditions. Among adolescents as the largest population group in this region, we investigated the co-occurrence of infectious diseases, malnutrition and cardio-metabolic risk factors (CRFs), and evaluated demographic, socio-economic and medical risk factors for these entities. In a cross-sectional study among 188 adolescents in rural Ghana, malarial infection, common infectious diseases and Body Mass Index were assessed. We measured ferritin, C-reactive protein, retinol, fasting glucose and blood pressure. Socio-demographic data were documented. We analyzed the proportions (95% confidence interval, CI) and the co-occurrence of infectious diseases (malaria, other common diseases), malnutrition (underweight, stunting, iron deficiency, vitamin A deficiency [VAD]), and CRFs (overweight, obesity, impaired fasting glucose, hypertension). In logistic regression, odds ratios (OR) and 95% CIs were calculated for the associations with socio-demographic factors. In this Ghanaian population (age range, 14.4-15.5 years; males, 50%), the proportions were for infectious diseases 45% (95% CI: 38-52%), for malnutrition 50% (43-57%) and for CRFs 16% (11-21%). Infectious diseases and malnutrition frequently co-existed (28%; 21-34%). Specifically, VAD increased the odds of non-malarial infectious diseases 3-fold (95% CI: 1.03, 10.19). Overlap of CRFs with infectious diseases (6%; 2-9%) or with malnutrition (7%; 3-11%) was also present. Male gender and low socio-economic status increased the odds of infectious diseases and malnutrition, respectively. Malarial infection, chronic malnutrition and VAD remain the predominant health problems among these Ghanaian adolescents. Investigating the relationships with evolving CRFs is warranted.
75 FR 11896 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-12
...: National Institute of Allergy and Infectious Diseases Special Emphasis Panel; B cell Immunology Partnership..., Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research...
Spontaneous splenic rupture in infectious mononucleosis.
Rothwell, S; McAuley, D
2001-09-01
Spontaneous splenic rupture is a rare but life-threatening complication of infectious mononucleosis. Abdominal pain and tachycardia are unusual in uncomplicated infectious mononucleosis and should alert a doctor to the possibility of spontaneous splenic rupture.
Spatiotemporal Frameworks for Infectious Disease Diffusion and Epidemiology.
Congdon, Peter
2016-12-20
Emerging infectious diseases, and the resurgence of previously controlled infectious disease (e.g., malaria, tuberculosis), are a major focus for public health concern, as well as providing challenges for establishing aetiology and transmission. [...].
77 FR 64816 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-23
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and... Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated...
78 FR 10623 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-02-14
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: February 7, 2013...
76 FR 65204 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-10-20
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: October 14, 2011...
75 FR 62546 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-12
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
78 FR 28858 - National Institute of Allergy and Infectious Diseases Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-05-16
....gov . Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology... Nos. 93.855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious...
77 FR 6810 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-09
... Institute of Allergy and Infectious Diseases Special Emphasis Panel; Integrated Preclinical/Clinical AIDS... Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated...
76 FR 17928 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-03-31
... Infectious Diseases Special Emphasis Panel; DAIDS Clinical Trial Planning and Implementation Grants. Date... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
77 FR 29678 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-18
... Infectious Diseases Special Emphasis Panel; ``Integrated Preclinical/Clinical Program for HIV Topical..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: May 11, 2012...
78 FR 22274 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-15
... Infectious Diseases Special Emphasis Panel; ``Leadership Group for a Clinical Research Network on... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
76 FR 32980 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-06-07
... Allergy and Infectious Diseases Special Emphasis Panel; Clinical Trial Implementation Grants. Date: June... Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated...
75 FR 21005 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-04-22
... Infectious Diseases Special Emphasis Panel; ``Inner City Asthma Consortium: Statistical and Clinical..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: April 15, 2010...
77 FR 74676 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-12-17
... Allergy and Infectious Diseases Special Emphasis Panel; NIAID Clinical Trial Planning and Implementation... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
What Is a Pediatric Infectious Diseases Specialist?
... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... through the teen years. What Kind of Training Do Pediatric Infectious Diseases Specialists Have? Pediatric infectious diseases ...
A Knowledge-Base for a Personalized Infectious Disease Risk Prediction System.
Vinarti, Retno; Hederman, Lucy
2018-01-01
We present a knowledge-base to represent collated infectious disease risk (IDR) knowledge. The knowledge is about personal and contextual risk of contracting an infectious disease obtained from declarative sources (e.g. Atlas of Human Infectious Diseases). Automated prediction requires encoding this knowledge in a form that can produce risk probabilities (e.g. Bayesian Network - BN). The knowledge-base presented in this paper feeds an algorithm that can auto-generate the BN. The knowledge from 234 infectious diseases was compiled. From this compilation, we designed an ontology and five rule types for modelling IDR knowledge in general. The evaluation aims to assess whether the knowledge-base structure, and its application to three disease-country contexts, meets the needs of personalized IDR prediction system. From the evaluation results, the knowledge-base conforms to the system's purpose: personalization of infectious disease risk.
Stachan, R; Kunstýr, I
1983-12-01
The minimal infectious doses (MID) of Giardia muris cysts, Spironucleus muris cysts and Tritrichomonas muris pseudocysts for athymic mice were determined. A novel micromanipulator-aided technique was developed for selecting small exact numbers of specified fresh or old cysts/pseudocysts from a faecal homogenate. This technique can also be of value in manipulating protozoan parasites of any particular species. Only fresh cysts/pseudocysts, which appeared bright under phase contrast optics, were infectious. Older cysts and pseudocysts which appeared dark in phase contrast were not infectious. The MID for three murine intestinal flagellates addressed above were: 10 (between 5 and 20), 1 and 5 cysts/pseudocysts respectively. Corresponding prepatent periods (PP) were 8, 5 and 10 days. A relation was evident between the infectious dose and the PP: The prepatent period shortened with an increased infectious dose.
Climate change-related migration and infectious disease.
McMichael, Celia
2015-01-01
Anthropogenic climate change will have significant impacts on both human migration and population health, including infectious disease. It will amplify and alter migration pathways, and will contribute to the changing ecology and transmission dynamics of infectious disease. However there has been limited consideration of the intersections between migration and health in the context of a changing climate. This article argues that climate-change related migration - in conjunction with other drivers of migration - will contribute to changing profiles of infectious disease. It considers infectious disease risks for different climate-related migration pathways, including: forced displacement, slow-onset migration particularly to urban-poor areas, planned resettlement, and labor migration associated with climate change adaptation initiatives. Migration can reduce vulnerability to climate change, but it is critical to better understand and respond to health impacts - including infectious diseases - for migrant populations and host communities.
Noble, Geoffrey P.; Wang, Daphne W.; Walsh, Daniel J.; Barone, Justin R.; Miller, Michael B.; Nishina, Koren A.; Li, Sheng; Supattapone, Surachai
2015-01-01
Infectious prions contain a self-propagating, misfolded conformer of the prion protein termed PrPSc. A critical prediction of the protein-only hypothesis is that autocatalytic PrPSc molecules should be infectious. However, some autocatalytic recombinant PrPSc molecules have low or undetectable levels of specific infectivity in bioassays, and the essential determinants of recombinant prion infectivity remain obscure. To identify structural and functional features specifically associated with infectivity, we compared the properties of two autocatalytic recombinant PrP conformers derived from the same original template, which differ by >105-fold in specific infectivity for wild-type mice. Structurally, hydrogen/deuterium exchange mass spectrometry (DXMS) studies revealed that solvent accessibility profiles of infectious and non-infectious autocatalytic recombinant PrP conformers are remarkably similar throughout their protease-resistant cores, except for two domains encompassing residues 91-115 and 144-163. Raman spectroscopy and immunoprecipitation studies confirm that these domains adopt distinct conformations within infectious versus non-infectious autocatalytic recombinant PrP conformers. Functionally, in vitro prion propagation experiments show that the non-infectious conformer is unable to seed mouse PrPC substrates containing a glycosylphosphatidylinositol (GPI) anchor, including native PrPC. Taken together, these results indicate that having a conformation that can be specifically adopted by post-translationally modified PrPC molecules is an essential determinant of biological infectivity for recombinant prions, and suggest that this ability is associated with discrete features of PrPSc structure. PMID:26125623
Rattanaumpawan, Pinyo; Boonyasiri, Adhiratha; Vong, Sirenda; Thamlikitkul, Visanu
2018-02-01
Electronic surveillance of infectious diseases involves rapidly collecting, collating, and analyzing vast amounts of data from interrelated multiple databases. Although many developed countries have invested in electronic surveillance for infectious diseases, the system still presents a challenge for resource-limited health care settings. We conducted a systematic review by performing a comprehensive literature search on MEDLINE (January 2000-December 2015) to identify studies relevant to electronic surveillance of infectious diseases. Study characteristics and results were extracted and systematically reviewed by 3 infectious disease physicians. A total of 110 studies were included. Most surveillance systems were developed and implemented in high-income countries; less than one-quarter were conducted in low-or middle-income countries. Information technologies can be used to facilitate the process of obtaining laboratory, clinical, and pharmacologic data for the surveillance of infectious diseases, including antimicrobial resistance (AMR) infections. These novel systems require greater resources; however, we found that using electronic surveillance systems could result in shorter times to detect targeted infectious diseases and improvement of data collection. This study highlights a lack of resources in areas where an effective, rapid surveillance system is most needed. The availability of information technology for the electronic surveillance of infectious diseases, including AMR infections, will facilitate the prevention and containment of such emerging infectious diseases. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
A Highly Infectious Disease Care Network in the US Healthcare System.
Le, Aurora B; Biddinger, Paul D; Smith, Philip W; Herstein, Jocelyn J; Levy, Deborah A; Gibbs, Shawn G; Lowe, John J
During the 2014-15 Ebola outbreak in West Africa, the United States responded by stratifying hospitals into 1 of 3 Centers for Disease Control and Prevention (CDC)-designated categories-based on the hospital's ability to identify, isolate, assess, and provide care to patients with suspected or confirmed Ebola virus disease (EVD)-in an attempt to position the US healthcare system to safely isolate and care for potential patients. Now, with the Ebola epidemic quelled, it is crucial that we act on the lessons learned from the EVD response to broaden our national perspective on infectious disease mitigation and management, build on our newly enhanced healthcare capabilities to respond to infectious disease threats, develop a more cost-effective and sustainable model of infectious disease prevention, and continue to foster training so that the nation is not in a vulnerable position once more. We propose the formal creation of a US Highly Infectious Disease Care Network (HIDCN) modeled after 2 previous highly infectious disease consensus efforts in the United States and the European Union. A US Highly Infectious Disease Care Network can provide a common platform for the exchange of training, protocols, research, knowledge, and capability sharing among high-level isolation units. Furthermore, we envision the network will cultivate relationships among facilities and serve as a means of establishing national standards for infectious disease response, which will strengthen domestic preparedness and the nation's ability to respond to the next highly infectious disease threat.
Medical Resource Allocation: Injury and Disease Incidence among Marines in Vietnam
1989-09-01
Meningc-encephalitis, uncomplicated 302 Mumps, all cases 303 Infectious mononucleosis , all cases 304 Hepatitis, infectious , viral, all cases 305...MENINGITUS DUE TO ENTOVIRUS 301 04100 MUMPS ALL 302 06300 INFECTIOUS MONONUCLEOSIS ALL 303 06600 HEPATITIS INFECT VIRAL ALL 304 06100 PANCREATITIS ACUTE ALL...from hostile action), geographical area of incidence (denotes region in which injury or infectious disease was incurred), and location code (states the
1989-02-02
knowledge about how infectious diseases develop. Prior to AIDS, we paid little attention to the origin of infectious dis- eases. Advocates of the...One and one-half years ago, an anonymous examination section was set up at the Second Infectious Disease Hospital in Moscow, on Sokolin Hill. That...of the Moscow Clinical Infectious Diseases Hospital No. 2 on August 14, 1982, complaining of having a fever for a long period of time and mucoid
Current diagnosis and management of infectious mononucleosis.
Vouloumanou, Evridiki K; Rafailidis, Petros I; Falagas, Matthew E
2012-01-01
Infectious mononucleosis is a common, usually self-limited disease. However, infectious mononucleosis may present with severe manifestations. Complications may also occur. Consequently, diagnostic and treatment issues regarding infectious mononucleosis are of major importance. In this review, we focus on the evaluation of articles providing diagnosis and treatment data for infectious mononucleosis, published during the past 2 years. Twelve studies, deriving from extended search in PubMed, were included. Nine studies provided diagnosis data. The evaluated diagnostic methods were real-time PCR (RT-PCR), IgM/IgG antibodies measured with different assays [measurement of Epstein-Barr virus viral load (EBV-VL) in peripheral blood, neutrophil/lymphocyte/monocyte counts, C-reactive protein values, and monospot test]. The sensitivities reported for RT-PCR were high. The available treatment data were scarce (three studies). Two of them suggested that antivirals (mainly acyclovir and valacyclovir) may have a role in the treatment of infectious mononucleosis with complications, whereas the remaining study presented novel potential therapeutic patents including 5-substituted uracyle, azacytosine derivatives, and peptides inhibiting EBV-mediated membrane fusion. RT-PCR and measurement of EBV-VL may provide useful tools for the early diagnosis of infectious mononucleosis in cases with inconclusive serological results. Antiviral agents may provide a useful treatment option in patients with severe infectious mononucleosis.
A method for screening climate change-sensitive infectious diseases.
Wang, Yunjing; Rao, Yuhan; Wu, Xiaoxu; Zhao, Hainan; Chen, Jin
2015-01-14
Climate change is a significant and emerging threat to human health, especially where infectious diseases are involved. Because of the complex interactions between climate variables and infectious disease components (i.e., pathogen, host and transmission environment), systematically and quantitatively screening for infectious diseases that are sensitive to climate change is still a challenge. To address this challenge, we propose a new statistical indicator, Relative Sensitivity, to identify the difference between the sensitivity of the infectious disease to climate variables for two different climate statuses (i.e., historical climate and present climate) in non-exposure and exposure groups. The case study in Anhui Province, China has demonstrated the effectiveness of this Relative Sensitivity indicator. The application results indicate significant sensitivity of many epidemic infectious diseases to climate change in the form of changing climatic variables, such as temperature, precipitation and absolute humidity. As novel evidence, this research shows that absolute humidity has a critical influence on many observed infectious diseases in Anhui Province, including dysentery, hand, foot and mouth disease, hepatitis A, hemorrhagic fever, typhoid fever, malaria, meningitis, influenza and schistosomiasis. Moreover, some infectious diseases are more sensitive to climate change in rural areas than in urban areas. This insight provides guidance for future health inputs that consider spatial variability in response to climate change.
Denbæk, Anne Maj; Andersen, Anette; Bast, Lotus Sofie; Bonnesen, Camilla Thørring; Ersbøll, Annette Kjær; Due, Pernille; Johansen, Anette
2018-05-01
There is limited research on the importance of implementation when evaluating the effect of hand hygiene interventions in school settings in developed countries. The aim of this study was to examine the association between an implementation index and the effect of the intervention. The Hi Five Intervention was evaluated in a 3-armed cluster randomized controlled trial involving 43 randomly selected Danish schools. Analyses investigating the association between implementation of the Hi Five Intervention and infectious illness days, infectious illness episodes, illness-related absenteeism, and hand hygiene were carried out in a multilevel model (school, class, and child). The level of implementation was associated with hand hygiene and potentially associated with number of infectious illness days and infectious illness episodes among children. This association was not found for illness-related absenteeism. Classes that succeeded in achieving a high level of implementation of the Hi Five Intervention had a lower number of infectious illness days and infectious illness episodes, suggesting that the Hi Five Intervention, if implemented adequately, may be relevant as a tool to decrease infectious illness in a Danish school setting. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
A Method for Screening Climate Change-Sensitive Infectious Diseases
Wang, Yunjing; Rao, Yuhan; Wu, Xiaoxu; Zhao, Hainan; Chen, Jin
2015-01-01
Climate change is a significant and emerging threat to human health, especially where infectious diseases are involved. Because of the complex interactions between climate variables and infectious disease components (i.e., pathogen, host and transmission environment), systematically and quantitatively screening for infectious diseases that are sensitive to climate change is still a challenge. To address this challenge, we propose a new statistical indicator, Relative Sensitivity, to identify the difference between the sensitivity of the infectious disease to climate variables for two different climate statuses (i.e., historical climate and present climate) in non-exposure and exposure groups. The case study in Anhui Province, China has demonstrated the effectiveness of this Relative Sensitivity indicator. The application results indicate significant sensitivity of many epidemic infectious diseases to climate change in the form of changing climatic variables, such as temperature, precipitation and absolute humidity. As novel evidence, this research shows that absolute humidity has a critical influence on many observed infectious diseases in Anhui Province, including dysentery, hand, foot and mouth disease, hepatitis A, hemorrhagic fever, typhoid fever, malaria, meningitis, influenza and schistosomiasis. Moreover, some infectious diseases are more sensitive to climate change in rural areas than in urban areas. This insight provides guidance for future health inputs that consider spatial variability in response to climate change. PMID:25594780
Laser paper cleaning: the method of cleaning historical books
NASA Astrophysics Data System (ADS)
Zekou, Evangelini; Tsilikas, Ioannis; Chatzitheodoridis, Elias; Serafetinides, Alexander A.
2016-01-01
Conservation of cultural heritage treasures is the most important issue for transferring knowledge to the public through the next generation of students, academics, and researchers. Although this century is authenticating e-books and information by means of electronic text, still historical manuscripts as content as well as objects are the main original recourses of keeping a record of this transformation. The current work focuses on cleaning paper samples by the application of pulsed light, which is interventional. Experiments carried out using paper samples that are artificially colonized with Ulocladium chartarum. Paper is treated by Nd:YAG laser light. The available wavelength is 1064 nm, at various fluences, repetition rates and number of pulses. Two types of paper are stained with fungi colonies, which grow on substrates of clean paper, as well as on paper with ink text. The first type of paper is Whatman No.1056, which is closer to pure cellulose. The second type of paper is a page of a cultural heritage book published in 1926. Cleaning is performed using laser irradiation, thus defining the damage threshold of each sample. The treatment on paper Watman showed a yellowing, especially on areas with high concentration of fungi. The second sample was more durable to the exposure, performing the best results at higher fluences. Eventually, the paper samples are characterized, with optical microscopy and SEM/EDX analyses, prior to and after cleaning.
The population ecology of infectious diseases: pertussis in Thailand as a case study.
Blackwood, J C; Cummings, D A T; Broutin, H; Iamsirithaworn, S; Rohani, P
2012-12-01
Many of the fundamental concepts in studying infectious diseases are rooted in population ecology. We describe the importance of population ecology in exploring central issues in infectious disease research including identifying the drivers and dynamics of host-pathogen interactions and pathogen persistence, and evaluating the success of public health policies. The use of ecological concepts in infectious disease research is demonstrated with simple theoretical examples in addition to an analysis of case notification data of pertussis, a childhood respiratory disease, in Thailand as a case study. We stress that further integration of these fields will have significant impacts in infectious diseases research.
Role for HLA in susceptibility to infectious mononucleosis.
Farrell, Paul J
2007-10-01
Factors involved in determining whether infectious mononucleosis occurs after primary EBV infection may include age, dose of virus received, and various genetic markers. A study by McAulay and colleagues reported in this issue of the JCI shows that the presence of certain HLA class I alleles correlates with the incidence and severity of infectious mononucleosis. These same HLA alleles are also risk factors for EBV-associated Hodgkin lymphoma (HL), supporting recent epidemiology that indicates that a history of infectious mononucleosis predisposes to HL. Recent studies suggest that an EBV vaccine might help to prevent infectious mononucleosis, and further development of this should now be considered.
75 FR 6043 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-05
... Infectious Diseases Special Emphasis Panel RFA-AI-09-040 Protection of Human Health by Immunology and..., Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research...
Hypoglossal nerve palsy complicating a case of infectious mononucleosis
Sibert, J. R.
1972-01-01
A case of infectious mononucleosis complicated by the rare neurological complication of left isolated hypoglossal nerve palsy is described. The literature on cranial nerve palsies in infectious mononucleosis is briefly reviewed. PMID:4650785
Cerebellitis as an uncommon complication of infectious mononucleosis.
de Fraiture, D M; Sie, T H; Boezeman, E H; Haanen, H C
1997-08-01
Cerebellitis is an uncommon complication of infectious mononucleosis. We describe such a patient with infectious mononucleosis and cerebellitis as a major feature of a more global encephalitis. In the discussion the cerebral complications are reviewed.
78 FR 40755 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-07-08
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: July 1, 2013. David...
78 FR 23771 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-22
... Infectious Diseases Special Emphasis Panel; ``Clinical Trails Units for NIAID Network'' (Meeting 1). Date..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: April 16, 2013. David...
77 FR 59937 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-01
... Infectious Diseases Special Emphasis Panel; NIAID Clinical Trial Planning Grants (R34) and Implementation... Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated...
77 FR 70791 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-11-27
... Infectious Diseases Special Emphasis Panel; NIAID Clinical Trial Planning (R34) Grants and Implementation..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: November 20, 2012...
76 FR 72959 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-11-28
... Infectious Diseases Special Emphasis Panel; NIAID Clinical Trial Implementation and Planning (U01, R34). Date..., Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National...
78 FR 25753 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-05-02
... Infectious Diseases Special Emphasis Panel; Leadership Group for a HIV Vaccines Clinical Network. Date: May... Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated...
Developing Research in Infectious and Tropical Diseases in Africa: The Paradigm of Senegal.
Sokhna, Cheikh; Gaye, Oumar; Doumbo, Ogobara
2017-08-15
Infectious diseases represent one of the greatest potential barriers to achievement of the third Sustainable Development Goals in African countries and around the world because they continue to pose major public health challenges. The surveillance of infectious diseases has recently assumed greater importance in most African countries, both because of the emergence of infectious diseases and because strains of pathogens that cause tuberculosis, malaria, cholera, dysentery, and pneumonia have developed resistance to common and inexpensive antimicrobial drugs. However, data on the pathogen-specific causes of infectious diseases are limited. Developing research in infectious and tropical diseases in Africa is urgently needed to better describe the distribution of pathogen-borne diseases and to know which pathogens actually cause fever. This research is critical for guiding treatment and policies in Africa. More effective diagnostics are also needed for these diseases, which often are misdiagnosed or diagnosed too late. A comprehensive review of this type of research is presented here. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Naïve Human Antibody Libraries for Infectious Diseases.
Chan, Soo Khim; Rahumatullah, Anizah; Lai, Jing Yi; Lim, Theam Soon
2017-01-01
Many countries are facing an uphill battle in combating the spread of infectious diseases. The constant evolution of microorganisms magnifies the problem as it facilitates the re-emergence of old infectious diseases as well as promote the introduction of new and more deadly variants. Evidently, infectious diseases have contributed to an alarming rate of mortality worldwide making it a growing concern. Historically, antibodies have been used successfully to prevent and treat infectious diseases since the nineteenth century using antisera collected from immunized animals. The inherent ability of antibodies to trigger effector mechanisms aids the immune system to fight off pathogens that invades the host. Immune libraries have always been an important source of antibodies for infectious diseases due to the skewed repertoire generated post infection. Even so, the role and ability of naïve antibody libraries should not be underestimated. The naïve repertoire has its own unique advantages in generating antibodies against target antigens. This chapter will highlight the concept, advantages and application of human naïve libraries as a source to isolate antibodies against infectious disease target antigens.
Wartenberg, J; Lewandowska, J; Pilarek, M; Piltz, D
The aim of this study was to evaluate an effect of Broncho-Vaxom treatment on T and B lymphocytes and serum alpha 1AT in children treated at "Zuch" sanatorium in Szczawno-spa. The trial involved 46 school aged children suffering from infectious or infectious-atopic asthma. The post-Broncho-Vaxom treatment values for T lymphocytes were significantly higher in infectious, and significantly lower for B lymphocytes in infectious-atopic asthma. Serum alpha 1AT activity in children suffering from infectious asthma decreased significantly after the treatment. A correlation between the efficacy of the treatment and the lymphocyte percentage was observed. In children with very effective clinical results of Broncho-Vaxom treatment, the significant increase in T lymphocyte, and decrease in B lymphocyte populations was observed. Changes in T and B lymphocyte percentage were analysed in respect to alpha 1AT pre-treatment activity. In children with high alpha 1AT value, T lymphocytes after the treatment increased significantly in infectious, and B lymphocytes decreased significantly in infectious-atopic group.
Myeloma Xenograft Destruction by a Nonviral Vector Delivering Oncolytic Infectious Nucleic Acid
Hadac, Elizabeth M; Kelly, Elizabeth J; Russell, Stephen J
2011-01-01
The feasibility of using a nonviral vector formulation to initiate an oncolytic viral infection has not been previously demonstrated. We therefore sought to determine whether infectious nucleic acid (INA) could be used in place of virus particles to initiate an oncolytic picornavirus infection in vivo. Infectious RNA encoding coxsackievirus A21 (CVA21) was transcribed from plasmid DNA using T7 polymerase. Within 48 hours of injecting this RNA into KAS6/1 myeloma xenografts, high titers of infectious CVA21 virions were detected in the bloodstream. Tumors regressed rapidly thereafter and mice developed signs of myositis. At euthanasia, CVA21 was recovered from regressing tumors and from skeletal muscles. Treatment outcomes were comparable following intratumoral injection of naked RNA or fully infectious CVA21 virus. Dose–response studies showed that an effective oncolytic infection could be established by intratumoral injection of 1 µg of infectious RNA. The oncolytic infection could also be initiated by intravenous injection of infectious RNA. Our study demonstrates that INA is a highly promising alternative drug formulation for oncolytic virotherapy. PMID:21505425
Land-Use Change and Emerging Infectious Disease on an Island Continent
McFarlane, Rosemary A.; Sleigh, Adrian C.; McMichael, Anthony J.
2013-01-01
A more rigorous and nuanced understanding of land-use change (LUC) as a driver of emerging infectious disease (EID) is required. Here we examine post hunter-gatherer LUC as a driver of infectious disease in one biogeographical region with a compressed and documented history—continental Australia. We do this by examining land-use and native vegetation change (LUCC) associations with infectious disease emergence identified through a systematic (1973–2010) and historical (1788–1973) review of infectious disease literature of humans and animals. We find that 22% (20) of the systematically reviewed EIDs are associated with LUCC, most frequently where natural landscapes have been removed or replaced with agriculture, plantations, livestock or urban development. Historical clustering of vector-borne, zoonotic and environmental disease emergence also follows major periods of extensive land clearing. These advanced stages of LUCC are accompanied by changes in the distribution and density of hosts and vectors, at varying scales and chronology. This review of infectious disease emergence in one continent provides valuable insight into the association between accelerated global LUC and concurrent accelerated infectious disease emergence. PMID:23812027
Liu, Nan; Zhang, Hongzhe; Zhang, Shanshan
2014-12-01
Emerging infectious disease is one of the most minatory threats in modern society. A perfect medical building network system need to be established to protect and control emerging infectious disease. Although in China a preliminary medical building network is already set up with disease control center, the infectious disease hospital, infectious diseases department in general hospital and basic medical institutions, there are still many defects in this system, such as simple structural model, weak interoperability among subsystems, and poor capability of the medical building to adapt to outbreaks of infectious disease. Based on the characteristics of infectious diseases, the whole process of its prevention and control and the comprehensive influence factors, three-dimensional medical architecture network system is proposed as an inevitable trend. In this conception of medical architecture network structure, the evolutions are mentioned, such as from simple network system to multilayer space network system, from static network to dynamic network, and from mechanical network to sustainable network. Ultimately, a more adaptable and corresponsive medical building network system will be established and argued in this paper.
Infectious disease agents mediate interaction in food webs and ecosystems
Selakovic, Sanja; de Ruiter, Peter C.; Heesterbeek, Hans
2014-01-01
Infectious agents are part of food webs and ecosystems via the relationship with their host species that, in turn, interact with both hosts and non-hosts. Through these interactions, infectious agents influence food webs in terms of structure, functioning and stability. The present literature shows a broad range of impacts of infectious agents on food webs, and by cataloguing that range, we worked towards defining the various mechanisms and their specific effects. To explore the impact, a direct approach is to study changes in food-web properties with infectious agents as separate species in the web, acting as additional nodes, with links to their host species. An indirect approach concentrates not on adding new nodes and links, but on the ways that infectious agents affect the existing links across host and non-host nodes, by influencing the ‘quality’ of consumer–resource interaction as it depends on the epidemiological state host involved. Both approaches are natural from an ecological point of view, but the indirect approach may connect more straightforwardly to commonly used tools in infectious disease dynamics. PMID:24403336
Infectious Agents and Cancer Epidemiology Research Webinar Series
Infectious Agents and Cancer Epidemiology Research Webinar Series highlights emerging and cutting-edge research related to infection-associated cancers, shares scientific knowledge about technologies and methods, and fosters cross-disciplinary discussions on infectious agents and cancer epidemiology.
[Adult respiratory distress syndrome as a complication of infectious mononucleosis].
Storm, W; Jorch, G
1987-09-01
We describe a three-year-old boy with clinical findings of infectious mononucleosis, but no serologic proof in the beginning of his disease. The subsequent course was complicated by fatal pulmonary complications compatible with an adult respiratory distress syndrome (ARDS). Repeat serologic tests for Epstein-Barr virus finally could confirm the diagnosis of infectious mononucleosis. Thus, ARDS has to be added to the possible rare causes of fulminant, fatal cases of infectious mononucleosis.
Multiple Pulmonary Nodules in an Immunocompetent Adolescent with Infectious Mononucleosis.
Bhaskaran, Praveena Nediyara; Puliyel, Mammen; Myers, Melissa; Abughali, Nazha
2018-02-15
Infectious mononucleosis is usually a self-limiting illness, but can be rarely associated with complications. A 17-year-old boy with Epstein-Barr virus related infectious mononucleosis and cold antibody-mediated autoimmune hemolytic anemia with incidentally noted multiple pulmonary nodules. Nodules regressed over the next few weeks without specific therapy. Pediatricians need to be aware of this rare clinical presentation of infectious mononucleosis so that further invasive testing can be avoided.
Merging economics and epidemiology to improve the prediction and management of infectious disease.
Perrings, Charles; Castillo-Chavez, Carlos; Chowell, Gerardo; Daszak, Peter; Fenichel, Eli P; Finnoff, David; Horan, Richard D; Kilpatrick, A Marm; Kinzig, Ann P; Kuminoff, Nicolai V; Levin, Simon; Morin, Benjamin; Smith, Katherine F; Springborn, Michael
2014-12-01
Mathematical epidemiology, one of the oldest and richest areas in mathematical biology, has significantly enhanced our understanding of how pathogens emerge, evolve, and spread. Classical epidemiological models, the standard for predicting and managing the spread of infectious disease, assume that contacts between susceptible and infectious individuals depend on their relative frequency in the population. The behavioral factors that underpin contact rates are not generally addressed. There is, however, an emerging a class of models that addresses the feedbacks between infectious disease dynamics and the behavioral decisions driving host contact. Referred to as "economic epidemiology" or "epidemiological economics," the approach explores the determinants of decisions about the number and type of contacts made by individuals, using insights and methods from economics. We show how the approach has the potential both to improve predictions of the course of infectious disease, and to support development of novel approaches to infectious disease management.
Busch, Daniel; Hilswicht, Sarah; Schöb, Dominik S; von Trotha, Klaus T; Junge, Karsten; Gassler, Nikolaus; Truong, Son; Neumann, Ulf P; Binnebösel, Marcel
2014-02-05
Infectious mononucleosis is a clinical syndrome most commonly associated with primary Epstein-Barr virus infection. The majority of patients with infectious mononucleosis recovers without apparent sequelae. However, infectious mononucleosis may be associated with several acute complications. In this report we present a rare case of esophageal rupture that has never been described in the literature before. We present the case of an 18-year-old Caucasian man affected by severe infectious mononucleosis complicated by fulminant hepatic failure, splenic rupture and esophageal necrosis. Although primary Epstein-Barr virus infection is rarely fatal, fulminant infection may occur - in this case leading to hepatic failure, splenic rupture and esophageal necrosis, subsequently making several surgical interventions necessary. We show here that infectious mononucleosis is not only a strictly medical condition, but can also lead to severe surgical complications.
Harris, Vanessa C; Haak, Bastiaan W; Boele van Hensbroek, Michaël; Wiersinga, Willem J
2017-01-01
The field of infectious disease is undergoing a paradigm shift as the intestinal microbiome is becoming understood. The aim of this review is to inform infectious disease physicians of the potential relevance of the intestinal microbiome to their practice. We searched Medline using both index and text words relating to infectious diseases, microbiome, and probiotics. Relevant articles published up through 2017 were reviewed within Rayyan. The review illustrates pathophysiologic concepts linking the microbiome and infectious diseases; specifically, the intestinal microbiome's relevance to early immune development, the microbiome and enteric infections, the microbiome's relevance in compromised hosts, and antimicrobial resistance. Within each subject, there are specific examples of diseases and at-risk patient populations where a role for the microbiome has been strongly established. This provides an overview of the significance of the intestinal microbiome to microbiology, pediatric and adult infectious diseases with an underpinning of concepts useful for the practicing clinician.
Climate change-related migration and infectious disease
McMichael, Celia
2015-01-01
Anthropogenic climate change will have significant impacts on both human migration and population health, including infectious disease. It will amplify and alter migration pathways, and will contribute to the changing ecology and transmission dynamics of infectious disease. However there has been limited consideration of the intersections between migration and health in the context of a changing climate. This article argues that climate-change related migration - in conjunction with other drivers of migration – will contribute to changing profiles of infectious disease. It considers infectious disease risks for different climate-related migration pathways, including: forced displacement, slow-onset migration particularly to urban-poor areas, planned resettlement, and labor migration associated with climate change adaptation initiatives. Migration can reduce vulnerability to climate change, but it is critical to better understand and respond to health impacts – including infectious diseases - for migrant populations and host communities. PMID:26151221
A complete categorization of multiscale models of infectious disease systems.
Garira, Winston
2017-12-01
Modelling of infectious disease systems has entered a new era in which disease modellers are increasingly turning to multiscale modelling to extend traditional modelling frameworks into new application areas and to achieve higher levels of detail and accuracy in characterizing infectious disease systems. In this paper we present a categorization framework for categorizing multiscale models of infectious disease systems. The categorization framework consists of five integration frameworks and five criteria. We use the categorization framework to give a complete categorization of host-level immuno-epidemiological models (HL-IEMs). This categorization framework is also shown to be applicable in categorizing other types of multiscale models of infectious diseases beyond HL-IEMs through modifying the initial categorization framework presented in this study. Categorization of multiscale models of infectious disease systems in this way is useful in bringing some order to the discussion on the structure of these multiscale models.
Aerobiology and Its Role in the Transmission of Infectious Diseases
Fernstrom, Aaron; Goldblatt, Michael
2013-01-01
Aerobiology plays a fundamental role in the transmission of infectious diseases. As infectious disease and infection control practitioners continue employing contemporary techniques (e.g., computational fluid dynamics to study particle flow, polymerase chain reaction methodologies to quantify particle concentrations in various settings, and epidemiology to track the spread of disease), the central variables affecting the airborne transmission of pathogens are becoming better known. This paper reviews many of these aerobiological variables (e.g., particle size, particle type, the duration that particles can remain airborne, the distance that particles can travel, and meteorological and environmental factors), as well as the common origins of these infectious particles. We then review several real-world settings with known difficulties controlling the airborne transmission of infectious particles (e.g., office buildings, healthcare facilities, and commercial airplanes), while detailing the respective measures each of these industries is undertaking in its effort to ameliorate the transmission of airborne infectious diseases. PMID:23365758
Infectious and non-infectious neurologic complications in heart transplant recipients.
Muñoz, Patricia; Valerio, Maricela; Palomo, Jesús; Fernández-Yáñez, Juan; Fernández-Cruz, Ana; Guinea, Jesús; Bouza, Emilio
2010-05-01
Neurologic complications are important causes of morbidity and mortality in heart transplant (HT) recipients. New immunomodulating agents have improved survival rates, although some have been associated with a high rate of neurologic complications (infectious and non-infectious). We conducted this study to analyze the frequency of these complications, before and after the use of daclizumab induction therapy. We reviewed all neurologic complications in our HT cohort, comparing infectious with non-infectious complications over 2 periods of time in which different induction therapies were used (316 patients with OKT3 or antithymocyte globulin from 1988 to 2002, and 68 patients with daclizumab from 2003 to 2006). Neurologic complications were found in 75/384 patients (19.5%) with a total of 78 episodes. Non-infectious complications accounted for 68% of the 78 episodes of neurologic complications. A total of 51 patients and 53 episodes were detailed as follows: 25 episodes of stroke (25 of 78 total episodes, 32%; 19 ischemic, 6 hemorrhagic); 7 neuropathies; 6 seizures; 4 episodes of transient ischemic attack (TIA); 3 anoxic encephalopathy; 2 each brachial plexus palsy and metabolic encephalopathy; and 1 each myoclonia, central nervous system (CNS) lymphoma, subdural hematoma, and Cotard syndrome. Mean time to presentation of stroke, TIA, and encephalopathy was 1 day (range, 1-19 d) posttransplant. Mortality rate among non-infectious complications was 12/53 (22.6%). Infectious complications accounted for 32% of the 78 total episodes. We found 25 episodes in 24 patients: 17 herpes zoster (median, 268 d after HT), 3 CNS aspergillosis (median, 90 d after HT), 1 CNS toxoplasmosis and tuberculosis (51 d after HT), 1 pneumococcal meningitis (402 d after HT), and 2 Listeria meningitis (median, 108 d after HT). The 3 patients with CNS aspergillosis died. The mortality rate among patients with infectious neurologic complications was 12% (42.8% if the CNS was involved). When we compared the OKT3-ATG and daclizumab groups, we found that the incidence of non-infectious complications was 15.1% vs. 7.3%, respectively, and the incidence of infectious complications was 7.5% vs. 1.4%, respectively. All but 1 opportunistic infection occurred in the OKT3-ATG time period. In conclusion, a wide variety of neurologic complications affected 19.5% of HT recipients. Non-infectious causes clearly predominated, but infections still accounted for 32% of the episodes. New monoclonal induction therapies have contributed to diminished CNS opportunistic infections in our program.
Suhrcke, Marc; Stuckler, David; Suk, Jonathan E.; Desai, Monica; Senek, Michaela; McKee, Martin; Tsolova, Svetla; Basu, Sanjay; Abubakar, Ibrahim; Hunter, Paul; Rechel, Boika; Semenza, Jan C.
2011-01-01
There is concern among public health professionals that the current economic downturn, initiated by the financial crisis that started in 2007, could precipitate the transmission of infectious diseases while also limiting capacity for control. Although studies have reviewed the potential effects of economic downturns on overall health, to our knowledge such an analysis has yet to be done focusing on infectious diseases. We performed a systematic literature review of studies examining changes in infectious disease burden subsequent to periods of crisis. The review identified 230 studies of which 37 met our inclusion criteria. Of these, 30 found evidence of worse infectious disease outcomes during recession, often resulting from higher rates of infectious contact under poorer living circumstances, worsened access to therapy, or poorer retention in treatment. The remaining studies found either reductions in infectious disease or no significant effect. Using the paradigm of the “SIR” (susceptible-infected-recovered) model of infectious disease transmission, we examined the implications of these findings for infectious disease transmission and control. Key susceptible groups include infants and the elderly. We identified certain high-risk groups, including migrants, homeless persons, and prison populations, as particularly vulnerable conduits of epidemics during situations of economic duress. We also observed that the long-term impacts of crises on infectious disease are not inevitable: considerable evidence suggests that the magnitude of effect depends critically on budgetary responses by governments. Like other emergencies and natural disasters, preparedness for financial crises should include consideration of consequences for communicable disease control. PMID:21695209
Enserink, Remko; Noel, Harold; Friesema, Ingrid H M; de Jager, Carolien M; Kooistra-Smid, Anna M D; Kortbeek, Laetitia M; Duizer, Erwin; van der Sande, Marianne A B; Smit, Henriette A; Pelt, Wilfrid van
2012-10-15
Day care-associated infectious diseases are widely recognized as a public health problem but rarely studied. Insights into their dynamics and their association with the day care setting are important for effective decision making in management of infectious disease control. This paper describes the purpose, design and potential of our national multi-center, day care-based sentinel surveillance network for infectious diseases (the KIzSS network). The aim of the KIzSS network is to acquire a long-term insight into the syndromic and microbiological aspects of day care-related infectious diseases and associated disease burden and to model these aspects with day care setting characteristics. The KIzSS network applies a prospective cohort design, following day care centers rather than individual children or staff members over time. Data on infectious disease symptoms and related morbidity (children and staff), medical consumption, absenteeism and circulating enteric pathogens (children) are collected on a daily, weekly or monthly basis. Every two years, a survey is performed to assess the characteristics of participating day care centers. The KIzSS network offers a unique potential to study infectious disease dynamics in the day care setting over a sustained period of time. The created (bio)databases will help us to assess day care-related disease burden of infectious diseases among attending children and staff and their relation with the day care setting. This will support the much needed development of evidence-based and pragmatic guidelines for infectious disease control in day care centers.
2012-01-01
Background Day care-associated infectious diseases are widely recognized as a public health problem but rarely studied. Insights into their dynamics and their association with the day care setting are important for effective decision making in management of infectious disease control. This paper describes the purpose, design and potential of our national multi-center, day care-based sentinel surveillance network for infectious diseases (the KIzSS network). The aim of the KIzSS network is to acquire a long-term insight into the syndromic and microbiological aspects of day care-related infectious diseases and associated disease burden and to model these aspects with day care setting characteristics. Methods/design The KIzSS network applies a prospective cohort design, following day care centers rather than individual children or staff members over time. Data on infectious disease symptoms and related morbidity (children and staff), medical consumption, absenteeism and circulating enteric pathogens (children) are collected on a daily, weekly or monthly basis. Every two years, a survey is performed to assess the characteristics of participating day care centers. Discussion The KIzSS network offers a unique potential to study infectious disease dynamics in the day care setting over a sustained period of time. The created (bio)databases will help us to assess day care-related disease burden of infectious diseases among attending children and staff and their relation with the day care setting. This will support the much needed development of evidence-based and pragmatic guidelines for infectious disease control in day care centers. PMID:23066727
Wang, Ruiping; Jiang, Yonggen; Michael, Engelgau; Zhao, Genming
2017-06-12
China Centre for Diseases Control and Prevention (CDC) developed the China Infectious Disease Automated Alert and Response System (CIDARS) in 2005. The CIDARS was used to strengthen infectious disease surveillance and aid in the early warning of outbreak. The CIDARS has been integrated into the routine outbreak monitoring efforts of the CDC at all levels in China. Early warning threshold is crucial for outbreak detection in the CIDARS, but CDCs at all level are currently using thresholds recommended by the China CDC, and these recommended thresholds have recognized limitations. Our study therefore seeks to explore an operational method to select the proper early warning threshold according to the epidemic features of local infectious diseases. The data used in this study were extracted from the web-based Nationwide Notifiable Infectious Diseases Reporting Information System (NIDRIS), and data for infectious disease cases were organized by calendar week (1-52) and year (2009-2015) in Excel format; Px was calculated using a percentile-based moving window (moving window [5 week*5 year], x), where x represents one of 12 centiles (0.40, 0.45, 0.50….0.95). Outbreak signals for the 12 Px were calculated using the moving percentile method (MPM) based on data from the CIDARS. When the outbreak signals generated by the 'mean + 2SD' gold standard were in line with a Px generated outbreak signal for each week during the year of 2014, this Px was then defined as the proper threshold for the infectious disease. Finally, the performance of new selected thresholds for each infectious disease was evaluated by simulated outbreak signals based on 2015 data. Six infectious diseases were selected in this study (chickenpox, mumps, hand foot and mouth diseases (HFMD), scarlet fever, influenza and rubella). Proper thresholds for chickenpox (P75), mumps (P80), influenza (P75), rubella (P45), HFMD (P75), and scarlet fever (P80) were identified. The selected proper thresholds for these 6 infectious diseases could detect almost all simulated outbreaks within a shorter time period compared to thresholds recommended by the China CDC. It is beneficial to select the proper early warning threshold to detect infectious disease aberrations based on characteristics and epidemic features of local diseases in the CIDARS.
Fink, Ericka L; von Saint Andre-von Arnim, Amelie; Kumar, Rashmi; Wilson, Patrick T; Bacha, Tigist; Aklilu, Abenezer Tirsit; Teklemariam, Tsegazeab Laeke; Hooli, Shubhada; Tuyisenge, Lisine; Otupiri, Easmon; Fabio, Anthony; Gianakas, John; Kochanek, Patrick M; Angus, Derek C; Tasker, Robert C
2018-04-16
To assess the frequency, interventions, and outcomes of children presenting with traumatic brain injury or infectious encephalopathy in low-resource settings. Prospective study. Four hospitals in Sub-Saharan Africa. Children age 1 day to 17 years old evaluated at the hospital with traumatic brain injury or infectious encephalopathy. None. We evaluated the frequency and outcomes of children presenting consecutively over 4 weeks to any hospital department with traumatic brain injury or infectious encephalopathy. Pediatric Cerebral Performance Category score was assessed pre morbidity and at hospital discharge. Overall, 130 children were studied (58 [45%] had traumatic brain injury) from hospitals in Ethiopia (n = 51), Kenya (n = 50), Rwanda (n = 20), and Ghana (n = 7). Forty-six percent had no prehospital care, and 64% required interhospital transport over 18 km (1-521 km). On comparing traumatic brain injury with infectious encephalopathy, there was no difference in presentation with altered mental state (80% vs 82%), but a greater proportion of traumatic brain injury cases had loss of consciousness (80% vs 53%; p = 0.004). Traumatic brain injury patients were older (median [range], 120 mo [6-204 mo] vs 13 mo [0.3-204 mo]), p value of less than 0.001, and more likely male (73% vs 51%), p value of less than 0.01. In 78% of infectious encephalopathy cases, cause was unknown. More infectious encephalopathy cases had a seizure (69% vs 12%; p < 0.001). In regard to outcome, infectious encephalopathy versus traumatic brain injury: hospital lengths of stay were longer for infectious encephalopathy (8 d [2-30 d] vs 4 d [1-36 d]; p = 0.003), discharge rate to home, or for inpatient rehabilitation, or death differed between infectious encephalopathy (85%, 1%, and 13%) and traumatic brain injury (79%, 12%, and 1%), respectively, p value equals to 0.044. There was no difference in the proportion of children surviving with normal or mild disability (73% traumatic brain injury vs 79% infectious encephalopathy; p = 0.526). The epidemiology and outcomes of pediatric traumatic brain injury and infectious encephalopathy varied by center and disease. To improve outcomes of these conditions in low-resource setting, focus should be on neurocritical care protocols for pre-hospital, hospital, and rehabilitative care.
Infectious optic neuropathies: a clinical update
Kahloun, Rim; Abroug, Nesrine; Ksiaa, Imen; Mahmoud, Anis; Zeghidi, Hatem; Zaouali, Sonia; Khairallah, Moncef
2015-01-01
Different forms of optic neuropathy causing visual impairment of varying severity have been reported in association with a wide variety of infectious agents. Proper clinical diagnosis of any of these infectious conditions is based on epidemiological data, history, systemic symptoms and signs, and the pattern of ocular findings. Diagnosis is confirmed by serologic testing and polymerase chain reaction in selected cases. Treatment of infectious optic neuropathies involves the use of specific anti-infectious drugs and corticosteroids to suppress the associated inflammatory reaction. The visual prognosis is generally good, but persistent severe vision loss with optic atrophy can occur. This review presents optic neuropathies caused by specific viral, bacterial, parasitic, and fungal diseases. PMID:28539795
Erard, P; Rüedi, B
1993-11-01
More than 3000 infectious diseases treated in the past 10 years at the Department of Medicine of the Cadolles Hospital in Neuchâtel (Switzerland) have been gathered from a computer data base. The infectious disease specialist is directly involved in the diagnosis and treatment of the most severe or rare affections. However, he influences in a more general fashion the management of anti-infectious treatments by directing the treatment plan and helping to choose the proper antibiotics. He also is responsible for the prevention of nosocomial infections. The role and function of the infectious disease specialist as well as the importance of this specialty in a community hospital are discussed.
Role for HLA in susceptibility to infectious mononucleosis
Farrell, Paul J.
2007-01-01
Factors involved in determining whether infectious mononucleosis occurs after primary EBV infection may include age, dose of virus received, and various genetic markers. A study by McAulay and colleagues reported in this issue of the JCI shows that the presence of certain HLA class I alleles correlates with the incidence and severity of infectious mononucleosis (see the related article beginning on page 3042). These same HLA alleles are also risk factors for EBV-associated Hodgkin lymphoma (HL), supporting recent epidemiology that indicates that a history of infectious mononucleosis predisposes to HL. Recent studies suggest that an EBV vaccine might help to prevent infectious mononucleosis, and further development of this should now be considered. PMID:17909622
1990-12-20
and infectious mononucleosis , as well as outbreaks of herpes simplex (Ishigami, 1919; Hinkle and Plummer, 1952; McClelland, Alexander, and Marks, 1982...Evans, A., and Neiderman, J., (1979). Psychosocial risk factors in the development of infectious mononucleosis . Psychosomatic Medicine, 41, 445-466...34Stress, Coping, and Infectious Illness: Persistently Low Natural Killer Cell Activity as a Host Ri-k Fa.ctor" 2. PERSONAL AUTHOR(S) Sandra M. Lev
[Spot diagnosis of infectious exanthema].
Ishiwada, Naruhiko
2007-03-01
There are lots of infectious diseases accompanied with exanthema. When the physicians see the patients with exanthema, they should carefully examine the form of exanthema and accessory symptoms. The physicians also should inquire of the patients about past history, history of vaccination and situation of current infectious disease epidemic in surrounding area. These clinical approaches lead to specific diagnosis. On this manuscript, I show the photos of several major infectious exanthema caused by viral, bacterial, bacterial toxin and so on.
An evaluation of the Monosticon rapid slide test diagnosis of infectious mononucleosis
Scott, G. L.; Priest, C. J.
1972-01-01
A new rapid slide test for the detection of infectious mononucleosis heterophile antibody has been compared with the Paul-Bunnell absorption test. Out of 200 sera, 46 were seropositive for infectious mononucleosis by the Paul-Bunnell test and 43 of these were detected by the Monosticon test; the three Monosticon-negative sera were of low titre. There was no problem with false positive reactions due to heterophile antibody not specific for infectious mononucleosis. PMID:4678188
Hyams, K C; Riddle, J; Trump, D H; Graham, J T
2001-11-01
Infectious diseases were one of the first health threats confronted by Coalition troops deployed to the Arabian desert in August 1990. On the basis of experiences in World War II, the major endemic infectious disease risks were thought to be sandfly fever, cutaneous leishmaniasis, diarrheal disease, and malaria. Although there was active surveillance, no case of sandfly fever and few other endemic infectious diseases were identified among over 500,000 U.S., British, and Canadian ground troops. In addition, there was no diagnosis of biological warfare (BW) exposure, and BW agents were not detected in clinical, environmental, or veterinary samples. The most common infectious disease problems were those associated with crowding (acute upper respiratory infections) and reduced levels of sanitation (travelers-type diarrhea). Only one endemic infectious disease has been confirmed as causing chronic health problems: visceral Leishmania tropica infection (viscerotropic leishmaniasis). However, this protozoan infection was diagnosed in only 12 U.S. veterans, and no new cases have been identified during the last 8 years. Infectious diseases were not a serious problem for Gulf War troops because of extensive preventive medicine efforts and favorable weather and geographic factors. Moreover, it is unlikely that an endemic infectious disease or a BW agent could cause chronic health problems and remain undetected over a 10-year period.
Le, Aurora B; Witter, Lesley; Herstein, Jocelyn J; Jelden, Katelyn C; Beam, Elizabeth L; Gibbs, Shawn G; Lowe, John J
2017-09-01
A United States industry-specific gap analysis survey of the death care sector-which comprises organizations and businesses affiliated with the funeral industry and the handling of human remains- was developed, the results analyzed, and training and education needs in relation to highly infectious disease mitigation and management were explored in an effort to identify where occupational health and safety can be enhanced in this worker population. Collaborating national death care organizations distributed the 47-question electronic survey. N = 424 surveys were initiated and results recorded. The survey collected death care sector-specific information pertaining to the comfortability and willingness to handle highly infectious remains; perceptions of readiness, current policies and procedures in place to address highly infectious diseases; current highly infectious disease training levels, available resources, and personal protective equipment. One-third of respondents have been trained on how to manage highly infectious remains. There was a discrepancy between Supervisor/Management and Employee/Worker perceptions on employees' willingness and comfortability to manage potentially highly infectious remains. More than 40% of respondents did not know the correct routes of transmission for viral hemorrhagic fevers. Results suggest death care workers could benefit from increasing up-to-date industry-specific training and education on highly infectious disease risk mitigation and management. Professional death care sector organizations are positioned to disseminate information, training, and best practices.
Wang, Liping; Zeng, Lingjia; Ren, Xiang; Geng, Mengjie; Li, Zhongjie; Yu, Hongjie
2015-03-01
To learn the characteristics of morbidity and mortality of notifiable diseases reported in China in 2013. Descriptive analysis method was used to analyze the morbidity and mortality of notifiable diseases in China in 2013, with Microsoft Excel 2010 and ArcGIS 10.0 used to develop statistical charts. In 2013, the morbidity of the nationwide notifiable diseases was 473.87/100 000, a decrease of 3% below the average of the recent 3 years, while the mortality was 1.23/100 000, an increase of 2% over the average of the recent 3 years. The rate of laboratory diagnosis of the reported cases was 38.4%. Top 5 diseases of the reported incidence were hand foot and mouth disease, other infectious diarrhea, hepatitis B, tuberculosis and syphilis. The death cases reported were mainly AIDS, tuberculosis and rabies. As classified by the transmission route analysis, intestinal infectious diseases accounted for 49% of the total incidence reported for the year, followed by the blood and sexually transmitted infectious diseases, respiratory infectious diseases, animal and vector borne infectious diseases. According to the pathogenic analysis, virus infectious diseases accounted for 68% of the total cases, higher than bacterial infectious diseases and animal-borne/vector-borne infectious diseases. In Shanghai, Zhejiang and Jiangsu, human infection with avian influenza A (H7N9) virus was emerging, as epidemic situation of measles, dengue fever and brucellosis were on the rise significantly nationwide, while the morbidity of infectious diseases decreased, namely pulmonary tuberculosis, hepatitis B among others. Morbidity of the top 5 provinces for notifiable infectious diseases were Hainan, Guangxi, Guangdong, Xinjiang and Zhejiang, respectively. The proportion of laboratory confirmed cases among totals was still low in 2013. The morbidity of the infectious diseases was higher in western provinces and parts of south-eastern province, the mortality was higher in western provinces. The emerging human infection with avian influenza A (H7N9) virus, and the high epidemic of measles, dengue fever and brucellosis in some areas had caught the society concerns.
Rutkow, Lainie; Paul, Amy; Taylor, Holly A; Barnett, Daniel J
Local health departments play a key role in emergency preparedness and respond to a wide range of threats including infectious diseases such as seasonal influenza, tuberculosis, H1N1, Ebola virus disease, and Zika virus disease. To successfully respond to an infectious disease outbreak, local health departments depend upon the participation of their workforce; yet, studies indicate that sizable numbers of workers would not participate in such a response. The reasons why local health department workers participate, or fail to participate, in infectious disease responses are not well understood. To understand why local health department workers are willing, or not willing, to report to work during an infectious disease response. From April 2015 to January 2016, we conducted 28 semistructured interviews with local health department directors, preparedness staff, and nonpreparedness staff. Interviews were conducted with individuals throughout the United States. We interviewed 28 individuals across 3 groups: local health department directors (n = 8), preparedness staff (n = 10), and nonpreparedness staff (n = 10). Individuals' descriptions of why local health department workers are willing, or not willing, to report to work during an infectious disease response. Factors that facilitate willingness to respond to an infectious disease emergency included availability of vaccines and personal protective equipment; flexible work schedule and childcare arrangements; information sharing via local health department trainings; and perceived commitments to one's job and community. Factors that hinder willingness to respond to an infectious disease emergency included potential disease exposure for oneself and one's family; logistical considerations for care of children, the elderly, and pets; and perceptions about one's role during an infectious disease response. Our findings highlight opportunities for local health departments to revisit their internal policies and engage in strategies likely to promote willingness to respond among their staff. As LHDs face the persistent threat of infectious diseases, they must account for response willingness when planning for and fielding emergency responses. Our findings highlight opportunities for local health departments to revisit their internal policies and engage in strategies likely to promote response willingness to infectious disease emergencies among their staff.
2014-01-01
Background Transmission models can aid understanding of disease dynamics and are useful in testing the efficiency of control measures. The aim of this study was to formulate an appropriate stochastic Susceptible-Infectious-Resistant/Carrier (SIR) model for Salmonella Typhimurium in pigs and thus estimate the transmission parameters between states. Results The transmission parameters were estimated using data from a longitudinal study of three Danish farrow-to-finish pig herds known to be infected. A Bayesian model framework was proposed, which comprised Binomial components for the transition from susceptible to infectious and from infectious to carrier; and a Poisson component for carrier to infectious. Cohort random effects were incorporated into these models to allow for unobserved cohort-specific variables as well as unobserved sources of transmission, thus enabling a more realistic estimation of the transmission parameters. In the case of the transition from susceptible to infectious, the cohort random effects were also time varying. The number of infectious pigs not detected by the parallel testing was treated as unknown, and the probability of non-detection was estimated using information about the sensitivity and specificity of the bacteriological and serological tests. The estimate of the transmission rate from susceptible to infectious was 0.33 [0.06, 1.52], from infectious to carrier was 0.18 [0.14, 0.23] and from carrier to infectious was 0.01 [0.0001, 0.04]. The estimate for the basic reproduction ration (R 0 ) was 1.91 [0.78, 5.24]. The probability of non-detection was estimated to be 0.18 [0.12, 0.25]. Conclusions The proposed framework for stochastic SIR models was successfully implemented to estimate transmission rate parameters for Salmonella Typhimurium in swine field data. R 0 was 1.91, implying that there was dissemination of the infection within pigs of the same cohort. There was significant temporal-cohort variability, especially at the susceptible to infectious stage. The model adequately fitted the data, allowing for both observed and unobserved sources of uncertainty (cohort effects, diagnostic test sensitivity), so leading to more reliable estimates of transmission parameters. PMID:24774444
Sweileh, Waleed M; Al-Jabi, Samah W; Abuzanat, Alaeddin; Sawalha, Ansam F; AbuTaha, Adham S; Ghanim, Mustafa A; Zyoud, Sa'ed H
2015-01-01
To meet the future challenges of infectious diseases and limit the spread of multidrug resistant microorganisms, a better understanding of published studies in the field of infectious diseases is needed. The objective of this study was to analyze the quantity and quality of research activity in the field of infectious diseases in Arab countries and compare it with that in non-Arab countries. Documents published in Arab countries within the research category of "infectious diseases" were extracted and analyzed using the Web of Science database. The data analyzed represent research productivity during the time interval between 1900 - 2012. Worldwide, the total number of documents published in the field of infectious diseases up to 2012 was 227,188. A total of 2,408 documents in the field of infectious diseases were published in Arab countries, which represents 1.06% of worldwide research output. Research output from Arab countries in the field of infectious diseases was low for decades. However, approximately a five-fold increase was observed in the past decade. Arab countries ranked 56(th) to 218(th) on the standard competition ranking (SCR) in worldwide publications in the field of infectious diseases. Egypt, with a total publication of 464 (19.27%) documents ranked first among Arab countries, while Kuwait University was the most productive institution with a total of 158 (6.56%) documents. Average citation per document published in Arab countries was 13.25 and the h-index was 64. Tuberculosis (230; 9.55%), malaria (223; 9.26%), and hepatitis (189; 7.8%) were the top three infectious diseases studied as according to the retrieved documents. The present data reveals that some Arab countries contribute significantly to the field of infectious diseases. However, Arab countries need to work harder to bridge the gap in this field. Compared with non-Arab countries in the Middle East, research output from Arab countries was high, but more efforts are needed to enhance the quality of this output. Future research in the field should be encouraged and correctly directed.
Infectious mononucleosis presenting as upper airway obstruction.
Jain, Vivek; Singhi, Sunit; Desai, Ravi V
2003-01-01
Upper airway obstruction though a common complication of infectious mononucleosis is rarely considered in differential diagnosis of stridor. We report a three-year-old child who had upper airway obstruction due to infectious mononucleosis, managed conservatively with oxygen, intravenous fluids and steroids.
Hodgkin's disease following infectious mononucleosis
Robinson, T. J.
1976-01-01
A case of Hodgkin's disease occurring 4 years after the onset of infectious mononucleosis is described. Persistence of symptoms, physical signs and Paul Bunnell test are noted and the possible association of persistent infectious mononucleosis and development of Hodgkin's disease is discussed. PMID:1273021
China's capacity of hospitals to deal with infectious diseases in the context of climate change.
Tong, Michael Xiaoliang; Hansen, Alana; Hanson-Easey, Scott; Xiang, Jianjun; Cameron, Scott; Liu, Qiyong; Liu, Xiaobo; Sun, Yehuan; Weinstein, Philip; Han, Gil-Soo; Bi, Peng
2018-06-01
Infectious diseases are a major cause of morbidity and mortality in China. The capacity of hospitals to deal with the challenge from emerging and re-emerging infectious diseases due to climate change is of great importance to population health. This study aimed to explore the capacity of hospitals in China to deal with such challenges. A cross-sectional questionnaire survey was utilized to gauge information regarding capacity of hospitals to deal with infectious diseases in the context of climate change among 611 clinical professionals whose roles pertained to infectious disease diagnosis, treatment and management in Anhui Province of China. Descriptive analysis and logistic regression analysis were performed on the data. More than 90% of participants believed climate change would have an adverse influence on population health and infectious disease control in China. Most indicated that their hospitals were well prepared for emerging infectious diseases at present, and they considered that logistical support in hospitals (e.g. administrative and maintenance services) should be strengthened for future capacity building. The majority of participants suggested that effective prevention and control measures, more interdisciplinary collaborations, more funding in rural areas for health care, and improved access to facilities enabling online reporting of infectious diseases, were extremely important strategies in building capacity to curb the population health impact of emerging and re-emerging infectious diseases due to climate change in China. Clinical professionals recognized that climate change will likely increase the transmission of infectious diseases. Although rural health care and hospitals' logistical support need to be improved, most professionals believed their hospitals to be capable of dealing with emerging diseases. They thought that interdisciplinary and cross-regional collaborations, together with necessary resource support (e.g. improved facilities for rural health care) would be important control strategies. Copyright © 2018 Elsevier Ltd. All rights reserved.
Ding, Guoyong; Zhang, Ying; Gao, Lu; Ma, Wei; Li, Xiujun; Liu, Jing; Liu, Qiyong; Jiang, Baofa
2013-01-01
Persistent and heavy rainfall in the upper and middle Huaihe River of China brought about severe floods during the end of June and July 2007. However, there has been no assessment on the association between the floods and infectious diarrhea. This study aimed to quantify the impact of the floods in 2007 on the burden of disease due to infectious diarrhea in northwest of Anhui Province. A time-stratified case-crossover analysis was firstly conducted to examine the relationship between daily cases of infectious diarrhea and the 2007 floods in Fuyang and Bozhou of Anhui Province. Odds ratios (ORs) of the flood risk were quantified by conditional logistic regression. The years lived with disability (YLDs) of infectious diarrhea attributable to floods were then estimated based on the WHO framework of the calculating potential impact fraction in the Burden of Disease study. A total of 197 infectious diarrheas were notified during the exposure and control periods in the two study areas. The strongest effect was shown with a 2-day lag in Fuyang and a 5-day lag in Bozhou. Multivariable analysis showed that floods were significantly associated with an increased risk of the number cases of infectious diarrhea (OR = 3.175, 95%CI: 1.126-8.954 in Fuyang; OR = 6.754, 95%CI: 1.954-23.344 in Bozhou). Attributable YLD per 1000 of infectious diarrhea resulting from the floods was 0.0081 in Fuyang and 0.0209 in Bozhou. Our findings confirm that floods have significantly increased the risks of infectious diarrhea in the study areas. In addition, prolonged moderate flood may cause more burdens of infectious diarrheas than severe flood with a shorter duration. More attention should be paid to particular vulnerable groups, including younger children and elderly, in developing public health preparation and intervention programs. Findings have significant implications for developing strategies to prevent and reduce health impact of floods.
Jacquot, Cyril; Seo, Andrew; Miller, Peter M; Lezama, Niara; Criss, Valli R; Colvin, Camilla; Luban, Naomi L C; Wong, Edward C C
2017-11-01
Directed donation is associated with a higher prevalence of donations that are positive for infectious disease markers; however, little is known about the positive rates among parental-directed, non-parental-directed, and allogeneic donations. We reviewed blood-collection records from January 1997 through December 2008, including infectious disease results, among parental, non-parental, and community donations. Infectious disease rates were compared by Mann-Whitney U test. In total, 1532 parental, 4910 non-parental, and 17,423 community donations were examined. Among parental donors, the median rate of positive infectious disease testing was 8.66% (interquartile range (IQR), 4.49%) for first-time donors and 1.26% (IQR, 5.86%) for repeat donors; among non-parental donors, the rate was 1.09% (IQR, 0.98%) for first-time donors and 0% (IQR, 0.83%) for repeat donors; and, among community donors, the rate was 2.95% (IQR, 1.50%) for first-time donors and 0.45% (IQR, 0.82%) for repeat donors. The mean rate of positive infectious disease testing for first-time parental donors was significantly higher (7.63%), whereas all repeat donors had similar rates. However, the rate of positive infectious disease testing among first-time non-parental donors was significantly lower than that in the other groups, especially for the period from 2001 through 2008. First-time non-parental and community donors had significantly higher infectious disease risk than the respective repeat donors. First-time parental donors had the highest rates of positive infectious disease testing. We suggest that first-time parental blood donation should be discouraged. Repeat community donors or first-time non-parental donors provide a safer alternative. These findings can foster better patient education, donor selection, and possibly a reduced risk of infectious disease. © 2017 AABB.
Yokoyama, Yukihiro; Mizuno, Takashi; Sugawara, Gen; Asahara, Takashi; Nomoto, Koji; Igami, Tsuyoshi; Ebata, Tomoki; Nagino, Masato
2017-10-01
To investigate the association between preoperative fecal organic acid concentrations and the incidence of postoperative infectious complications in patients undergoing major hepatectomy with extrahepatic bile duct resection for biliary malignancies. The fecal samples of 44 patients were collected before undergoing hepatectomy with bile duct resection for biliary malignancies. The concentrations of fecal organic acids, including acetic acid, butyric acid, and lactic acid, and representative fecal bacteria were measured. The perioperative clinical characteristics and the concentrations of fecal organic acids were compared between patients with and without postoperative infectious complications. Among 44 patients, 13 (30%) developed postoperative infectious complications. Patient age and intraoperative bleeding were significantly greater in patients with postoperative infectious complications compared with those without postoperative infectious complications. The concentrations of fecal acetic acid and butyric acid were significantly less, whereas the concentration of fecal lactic acid tended to be greater in the patients with postoperative infectious complications. The calculated gap between the concentrations of fecal acetic acid plus butyric acid minus lactic acid gap was less in the patients with postoperative infectious complications (median 43.5 vs 76.1 μmol/g of feces, P = .011). Multivariate analysis revealed that an acetic acid plus butyric acid minus lactic acid gap <60 μmol/g was an independent risk factor for postoperative infectious complications with an odds ratio of 15.6; 95% confidence interval 1.8-384.1. The preoperative fecal organic acid profile (especially low acetic acid, low butyric acid, and high lactic acid) had a clinically important impact on the incidence of postoperative infectious complications in patients undergoing major hepatectomy with extrahepatic bile duct resection. Copyright © 2017. Published by Elsevier Inc.
Development of Self-Remediating Packaging for Safe and Secure Transport of Infectious Substances.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guilinger, Terry Rae; Gaudioso, Jennifer M; Aceto, Donato Gonzalo
As George W. Bush recognized in November 2001, "Infectious diseases make no distinctions among people and recognize no borders." By their very nature, infectious diseases of natural or intentional (bioterrorist) origins are capable of threatening regional health systems and economies. The best mechanism for minimizing the spread and impact of infectious disease is rapid disease detection and diagnosis. For rapid diagnosis to occur, infectious substances (IS) must be transported very quickly to appropriate laboratories, sometimes located across the world. Shipment of IS is problematic since many carriers, concerned about leaking packages, refuse to ship this material. The current packaging doesmore » not have any ability to neutralize or kill leaking IS. The technology described here was developed by Sandia National Laboratories to provide a fail-safe packaging system for shipment of IS that will increase the likelihood that critical material can be shipped to appropriate laboratories following a bioterrorism event or the outbreak of an infectious disease. This safe and secure packaging method contains a novel decontaminating material that will kill or neutralize any leaking infectious organisms; this feature will decrease the risk associated with shipping IS, making transport more efficient. 3 DRAFT4« less
[Occult rupture of the spleen in a patient with infectious mononucleosis].
Bonsignore, A; Grillone, G; Soliera, M; Fiumara, F; Pettinato, M; Calarco, G; Angiò, L G; Licursi, M
2010-03-01
Rupture of the spleen can be secondary to abdominal traumas (usually closed trauma) or spontaneous, can interest an organ normal or with morphological alterations secondary to various pathologies. Among the diseases responsible of occult rupture, infectious diseases are the most frequent and, among these, infectious mononucleosis, that is complicated with splenic rupture in 0.5% of the cases, with 30% of mortality. P.M., 16 years old female, admitted with acute abdomen, progressive anaemia and incipient cardiovascular instability, associated with suggestive clinical diagnosis of infectious mononucleosis, confirmed by serological findings and histological examination. Because of the imaging of subcapsular splenic haematoma, probably ruptured and with peritoneal bleeding we opt for emergency laparotomy intraoperative findings allows to splenectomy. Splenic rupture in infectious mononucleosis often presents as left hypochondrial pain, rare in uncomplicated cases; its occurrence in a patient with a recent diagnosis of infectious mononucleosis or with clinical or laboratory features suggestive of acute EBV infection, should always be investigated with an urgent abdominal ultrasound scan or CT. This approach is mandatory when hypochondrial pain is associated with pain referred to the left shoulder (Kehr's sign), peritoneal irritation and haemodynamic instability. Patients with splenic rupture in infectious mononucleosis generally undergo emergency splenectomy.
Infectious disease risks among refugees from North Korea.
Nishiura, Hiroshi; Lee, Hyojung; Yuan, Baoyin; Endo, Akira; Akhmetzhanov, Andrei R; Chowell, Gerardo
2018-01-01
The characteristics of disease in North Korea, including severe malnutrition and infectious disease risks, have not been openly and widely analyzed. This study was performed to estimate the risks of infectious diseases among refugees from North Korea. A literature review of clinical studies among North Korean defectors was conducted to statistically estimate the risks of infectious diseases among North Korean subjects. A total of six groups of data from five publications covering the years 2004 to 2014 were identified. Tuberculosis and viral hepatitis appeared to be the two most common infectious diseases, especially among adult refugees. When comparing the risks of infectious diseases between North Korean and Syrian refugees, it is critical to remember that Plasmodium vivax malaria has been endemic in North Korea, while cutaneous leishmaniasis has frequently been seen among Syrian migrants. Valuable datasets from health surveys of defectors were reviewed. In addition to tuberculosis and viral hepatitis, which were found to be the two most common infectious diseases, a special characteristic of North Korean defectors was Plasmodium vivax malaria. This needs to be added to the list of differential diagnoses for pyretic patients. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Route prediction model of infectious diseases for 2018 Winter Olympics in Korea
NASA Astrophysics Data System (ADS)
Kim, Eungyeong; Lee, Seok; Byun, Young Tae; Kim, Jae Hun; Lee, Hyuk-jae; Lee, Taikjin
2014-03-01
There are many types of respiratory infectious diseases caused by germs, virus, mycetes and parasites. Researchers recently have tried to develop mathematical models to predict the epidemic of infectious diseases. However, with the development of ground transportation system in modern society, the spread of infectious diseases became faster and more complicated in terms of the speed and the pathways. The route of infectious diseases during Vancouver Olympics was predicted based on the Susceptible-Infectious-Recovered (SIR) model. In this model only the air traffic as an essential factor for the intercity migration of infectious diseases was involved. Here, we propose a multi-city transmission model to predict the infection route during 2018 Winter Olympics in Korea based on the pre-existing SIR model. Various types of transportation system such as a train, a car, a bus, and an airplane for the interpersonal contact in both inter- and intra-city are considered. Simulation is performed with assumptions and scenarios based on realistic factors including demographic, transportation and diseases data in Korea. Finally, we analyze an economic profit and loss caused by the variation of the number of tourists during the Olympics.
40 CFR 62.13106 - Identification of plan.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Control of Air Emissions of Designated Pollutants from Existing Hospital, Medical, and Infectious Waste.../Infectious Waste Incinerators. (b) Identification of sources: The plan applies to all applicable existing hospital/medical/infectious waste incinerators for which construction commenced on or before June 20, 1996...
[Asymptomatic subcapsular splenic hematoma in infectious mononucleosis (Pfeiffer disease)].
Stahlknecht, T; Majewski, A
1986-09-01
Splenic rupture in infectious mononucleosis (Pfeiffer disease, or glandular fever) is a rare but life-threatening complication. The exact mechanism of rupture of the spleen is unknown to date. A case of a spontaneous, asymptomatic, subcapsular haematoma of the spleen of an eighteen-year old female with infectious mononucleosis is presented with special reference to the echographic findings. A complete remission without any complication was obtained. The contribution of the sonographic examination and follow-up in the diagnosis of infectious mononucleosis is emphasised.
A Rare Case of Infectious Mononucleosis Complicated by Guillain-Barre Syndrome
Kennedy, Margaret; Apostolova, Mariya
2013-01-01
Infectious mononucleosis is a clinical syndrome characterized by fever, lymphadenopathy and pharyngitis. Neurologic complications of infectious mononucleosis, such as the development of Guillain-Barre syndrome, have been rarely reported and usually present late in the course of the disease. We describe a case of a 29 year old male with no significant past medical history who was diagnosed with Guillain-Barre syndrome following an infection with Epstein-Barr virus associated infectious mononucleosis. Supportive treatment resulted in full recovery. PMID:23888210
NASA Astrophysics Data System (ADS)
Behling, Robert G.; Eifert, Joseph; Erickson, Marilyn C.; Gurtler, Joshua B.; Kornacki, Jeffrey L.; Line, Erick; Radcliff, Roy; Ryser, Elliot T.; Stawick, Bradley; Yan, Zhinong
This chapter, written by several contributing authors, is devoted to discussing selected microbes of contemporary importance. Microbes from three categories are described by the following: (1) infectious invasive agents like Salmonella, Listeria monocytogenes, and Campylobacter; (2) toxigenic pathogens such as Staphylococcus aureus, Bacillus cereus, and Clostridium botulinum; and (3) toxico-infectious agents like enterohemorrhagic Escherichia coli and Clostridium perfringens. In addition, emerging pathogens, like Cronobacter (Enterobacter) sakazakii, Arcobacter spp., and Mycobacterium avium subspecies paratuberculosis are also described.
Ambulatory Care Data Base. Part B.
1984-03-16
Mumps 172 1/ 075- Infectious Mononucleosis 071 8 077- Viral Conjunctivitis 077 19 0781 Warts, All Sites 078.1 20 0799 Viral Infection NOS n/0.9 21 084...Parasitic Diseases 1 003- Proven Infectious Intestine Disease n? 2 009- Presumed Infectious Intestine Uisease qijO 4 Oil- luberculosis 011 6 033- Whooping...053 11 054- Herpes Simplex 054 12 055- Measles 055 13 056- Rubella 0 6 14 057- Other Viral Exanthems (17 15 ()/0- Infectious Hepatitis r) I) 16 o72
Periorbital and eyelid edema: the initial manifestation of acute infectious mononucleosis.
Decker, G R; Berberian, B J; Sulica, V I
1991-05-01
A case of periorbital and eyelid edema in an eighteen-year-old student is presented as the initial manifestation of acute infectious mononucleosis occurring one week before the typical prodrome. Although periorbital and eyelid edema have been reported in about 50 percent of patients with early infectious mononucleosis, its occurrence is much less frequent in clinical practice. Physicians, particularly those specializing in the treatment of cutaneous and ocular diseases, should now include acute infectious mononucleosis in the differential diagnosis of periorbital and eyelid edema.
A rare case of infectious mononucleosis complicated by guillain-barre syndrome.
Kennedy, Margaret; Apostolova, Mariya
2013-06-25
Infectious mononucleosis is a clinical syndrome characterized by fever, lymphadenopathy and pharyngitis. Neurologic complications of infectious mononucleosis, such as the development of Guillain-Barre syndrome, have been rarely reported and usually present late in the course of the disease. We describe a case of a 29 year old male with no significant past medical history who was diagnosed with Guillain-Barre syndrome following an infection with Epstein-Barr virus associated infectious mononucleosis. Supportive treatment resulted in full recovery.
Jaakkimainen, R Liisa; Bondy, Susan J; Parkovnick, Meredith; Barnsley, Jan
2014-10-01
To compare how the infectious disease outbreaks H1N1 and severe acute respiratory syndrome (SARS) affected community-based GPs and FPs. A mailed survey sent after the H1N1 outbreak compared with the results of similar survey completed after the SARS outbreak. Greater Toronto area in Ontario. A total of 183 randomly selected GPs and FPs who provided office-based care. The perceptions of GPs and FPs on how serious infectious disease outbreaks affected their clinical work and personal lives; their preparedness for a serious infectious disease outbreak; and the types of information they want to receive and the sources they wanted to receive information from during a serious infectious disease outbreak. The responses from this survey were compared with the responses of GPs and FPs in the greater Toronto area who completed a similar survey in 2003 after the SARS outbreak. After the H1N1 outbreak, GPs and FPs still had substantial concerns about the effects of serious infectious disease outbreaks on the health of their family members. Physicians made changes to various office practices in order to manage and deal with patients with serious infectious diseases. They expressed concerns about the effects of an infectious disease on the provision of health care services. Also, physicians wanted to quickly receive accurate information from the provincial government and their medical associations. Serious community-based infectious diseases are a personal concern for GPs and FPs, and have considerable effects on their clinical practice. Further work examining the timely flow of relevant information through different health care sectors and government agencies still needs to be undertaken. Copyright© the College of Family Physicians of Canada.
Alotaibi, Badriah M; Yezli, Saber; Bin Saeed, Abdul-Aziz A; Turkestani, Abdulhafeez; Alawam, Amnah H; Bieh, Kingsley L
2017-05-01
Hajj is one of the largest and the most ethnically and culturally diverse mass gatherings worldwide. The use of appropriate surveillance systems ensures timely information management for effective planning and response to infectious diseases threats during the pilgrimage. The literature describes infectious diseases prevention and control strategies for Hajj but with limited information on the operations and characteristics of the existing Hajj infectious diseases surveillance systems. We reviewed documents, including guidelines and reports from the Saudi Ministry of Health's database, to describe the characteristics of the infectious diseases surveillance systems that were operational during the 2015 Hajj, highlighting best practices and gaps and proposing strategies for strengthening and improvement. Using Pubmed and Embase online search engines and a combination of search terms including, 'mass gatherings' 'Olympics' 'surveillance' 'Hajj' 'health security', we explored the existing literature and highlighted some lessons learnt from other international mass gatherings. A regular indicator-based infectious disease surveillance system generates routine reports from health facilities within the Kingdom to the regional and central public health directorates all year round. During Hajj, enhanced indicator-based notifiable diseases surveillance systems complement the existing surveillance tool to ensure timely reporting of event information for appropriate action by public health officials. There is need to integrate the existing Hajj surveillance data management systems and to implement syndromic surveillance as an early warning system for infectious disease control during Hajj. International engagement is important to strengthen Hajj infectious diseases surveillance and to prevent disease transmission and globalization of infectious agents which could undermine global health security. © International Society of Travel Medicine, 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Blatchford, Patrick J.; Forsyth, Simon J.; Stern, Marc F.; Kinner, Stuart A.
2016-01-01
Objectives People in prison may be at high risk for infectious diseases and have an elevated risk of death immediately after release compared with later; their risk of death is elevated for at least a decade after release. We compared rates, characteristics, and prison-related risk factors for infectious disease–related mortality among people released from prisons in Queensland, Australia, and Washington State, United States, regions with analogous available data. Methods We analyzed data from retrospective cohort studies of people released from prison in Queensland (1997–2007, n=37,180) and Washington State (1999–2009, n=76,208) and linked identifiers from each cohort to its respective national death index. We estimated infectious disease–related mortality rates (deaths per person-years in community) and examined associations using Cox proportional hazard models. Results The most frequent infectious disease–related underlying cause of death after release from prison was pneumonia (43%, 23/54 deaths) in the Australian cohort and viral hepatitis (40%, 69/171 deaths) in the U.S. cohort. The infectious disease–related mortality rate was significantly higher in the U.S. cohort than in the Australian cohort (51.2 vs. 26.5 deaths per 100,000 person-years; incidence rate ratio = 1.93, 95% confidence interval 1.42, 2.62). In both cohorts, increasing age was strongly associated with mortality from infectious diseases. Conclusion Differences in the epidemiology of infectious disease–related mortality among people released from prison may reflect differences in patterns of community health service delivery in each region. These findings highlight the importance of preventing and treating hepatitis C and other infectious diseases during the transition from prison to the community. PMID:27453602
Grabovsky, Irina; Hess, Brian J; Haist, Steven A; Lipner, Rebecca S; Hawley, Janine L; Woodward, Stephanie; Engleberg, N Cary
2015-03-01
The Infectious Diseases Society of America In-Training Examination (IDSA ITE) is a feedback tool used to help fellows track their knowledge acquisition during fellowship training. We determined whether the scores on the IDSA ITE and from other major medical knowledge assessments predict performance on the American Board of Internal Medicine (ABIM) Infectious Disease Certification Examination. The sample was 1021 second-year fellows who took the IDSA ITE and ABIM Infectious Disease Certification Examination from 2008 to 2012. Multiple regression analysis was used to determine if ABIM Infectious Disease Certification Examination scores were predicted by IDSA ITE scores, prior United States Medical Licensing Examination (USMLE) scores, ABIM Internal Medicine Certification Examination scores, fellowship director ratings of medical knowledge, and demographic variables. Logistic regression was used to evaluate if these same assessments predicted a passing outcome on the certification examination. IDSA ITE scores were the strongest predictor of ABIM Infectious Disease Certification Examination scores (β = .319), followed by prior ABIM Internal Medicine Certification Examination scores (β = .258), USMLE Step 1 scores (β = .202), USMLE Step 3 scores (β = .130), and fellowship directors' medical knowledge ratings (β = .063). IDSA ITE scores were also a significant predictor of passing the Infectious Disease Certification Examination (odds ratio, 1.017 [95% confidence interval, 1.013-1.021]). The significant relationship between the IDSA ITE score and performance on the ABIM Infectious Disease Certification Examination supports the use of the ITE as a valid feedback tool in fellowship training. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
[Behaviours related to infectious disease and family factors in primary and middle school students].
Feng, Na; Luo, Jiayou; Li, Huixia; Zhu, Na; Feng, Qi; Li, Xiongwei; Zhou, Haixiang
2015-06-01
To explore the behaviors related to infectious disease and family factors in primary and middle school students, and to provide evidence for improving behaviors related to infectious disease. A total of 8465 students were randomly surveyed by a standard questionnaire of behaviors related to infectious disease. Chi-square test was used to analyze the influential factors for behaviors related to infectious disease, and non conditional logistic regression analysis was used to analyze the multiple factors. The total formation rate of behaviors related to infectious disease was 66.4%. The rates for primary and middle school students were 69.4% and 62.8% respectively, with significant difference (P<0.05). There were significant differences in the following behaviors, such as washing hands before eating food, rarely buying snacks on outside stalls, informing teachers when showing infectious disease symptoms (all P<0.05), the degree for such behaviors in primary school students was higher than that in middle school students. There were also significant differences in the following behaviors, such as washing hands after using the toilet, blocking with a handkerchief, wiping while coughing and sneezing (all P<0.05), the degree for such behaviors in middle school students was higher than that in primary school students. Non conditional logistic regression analysis showed that the behaviors related to infectious disease in primary and middle school students were associated with parents' education degree, mother's occupation and living status with parents. Behaviors related to infectious disease in primary and middle school students need to be improved, and the formation of these behaviors may be related to many family factors.
Binswanger, Ingrid A; Blatchford, Patrick J; Forsyth, Simon J; Stern, Marc F; Kinner, Stuart A
2016-01-01
People in prison may be at high risk for infectious diseases and have an elevated risk of death immediately after release compared with later; their risk of death is elevated for at least a decade after release. We compared rates, characteristics, and prison-related risk factors for infectious disease-related mortality among people released from prisons in Queensland, Australia, and Washington State, United States, regions with analogous available data. We analyzed data from retrospective cohort studies of people released from prison in Queensland (1997-2007, n=37,180) and Washington State (1999-2009, n=76,208) and linked identifiers from each cohort to its respective national death index. We estimated infectious disease-related mortality rates (deaths per person-years in community) and examined associations using Cox proportional hazard models. The most frequent infectious disease-related underlying cause of death after release from prison was pneumonia (43%, 23/54 deaths) in the Australian cohort and viral hepatitis (40%, 69/171 deaths) in the U.S. cohort. The infectious disease-related mortality rate was significantly higher in the U.S. cohort than in the Australian cohort (51.2 vs. 26.5 deaths per 100,000 person-years; incidence rate ratio = 1.93, 95% confidence interval 1.42, 2.62). In both cohorts, increasing age was strongly associated with mortality from infectious diseases. Differences in the epidemiology of infectious disease-related mortality among people released from prison may reflect differences in patterns of community health service delivery in each region. These findings highlight the importance of preventing and treating hepatitis C and other infectious diseases during the transition from prison to the community.
A total quality management approach to healthcare waste management in Namazi Hospital, Iran.
Askarian, Mehrdad; Heidarpoor, Peigham; Assadian, Ojan
2010-11-01
Healthcare waste comprises all wastes generated at healthcare facilities, medical research centers and laboratories. Although 75-90% of these wastes are classified as household waste posing no potential risk, 10-25% are deemed to be hazardous, representing a potential threat to healthcare workers, patients, the environment and even the general population, if not disposed of appropriately. If hazardous and non-hazardous waste is mixed and not segregated prior to disposal, costs will increase substantially. Medical waste management is a worldwide issue. In Iran, the majority of problems are associated with an exponential growth in the healthcare sector together with low- or non-compliance with guidelines and recommendations. The aim of this study was to reduce the amounts of infectious waste by clear definition and segregation of waste at the production site in Namazi Hospital in Shiraz, Iran. Namazi Hospital was selected as a study site with an aim to achieving a significant decrease in infectious waste and implementing a total quality management (TQM) method. Infectious and non-infectious waste was weighed at 29 admission wards over a 1-month period. Before the introduction of the new guidelines and the new waste management concept, weight of total waste was 6.67 kg per occupied bed per day (kg/occupied bed/day), of which 73% was infectious and 27% non-infectious waste. After intervention, total waste was reduced to 5.92 kg/occupied bed/day, of which infectious waste represented 61% and non-infectious waste 30%. The implementation of a new waste management concept achieved a 26% reduction in infectious waste. A structured waste management concept together with clear definitions and staff training will result in waste reduction, consequently leading to decreased expenditure in healthcare settings. Copyright © 2010 Elsevier Ltd. All rights reserved.
Bélec, L
1999-01-01
The evaluation of the hypothesis of an infectious etiology to some neurological diseases comprises four different situations. First, numerous neurological diseases have an obvious infectious etiology (encephilitis, meningoencephilitis). Second, some neurological disorders were primarily suspected to be have an infectious etiology, but the causative microorganism was discovered either longtime after the princeps description of the disease (neurologic Whipple disease, due to Tropheryma whippelii), or at the same time (tropical spastic para-paresis secondary to HTLV-I infection). Third, for other neurological diseases, an infectious etiology that was not suspected at time of their anatomoclinic descriptions, was further demonstrated in the context of a generally complex physiopathology (Guillain-Barré syndrome and infection by Campylobacter jejuni). Finally, some idiopathic neurological diseases could be related to well known or yet unknown microorganisms, in association with some environmental factors, and with a particular genetic or acquired susceptibility of the host. The evaluation of an infectious etiology to these idiopathic neurological disorders must be envisioned according to 3 possibilities: 1) generally, the neurological disease is well defined, but its etiology remains unknown and an infectious hypothesis could be relevant (multiple sclerosis, post-polio syndrome, amyotrophic lateral sclerosis); 2) sometimes, a microorganism that is not associated with a known disease, and then qualified as "orphelin", could be associated with neurological disorders (spumaretrovirus); 3) finally, a new neurological disease could be associated with a known or yet unknown microorganism, directly or indirectly. In conclusion, some idiopathic neurological diseases could have an infectious etiology, with physiopathologic, diagnostic, prophylactic (vaccination) and therapeutic (use of anti-infectious drugs) consequences.
Lymph nodes fine needle cytology in the diagnosis of infectious diseases: clinical settings.
Natella, Valentina; Cozzolino, Immacolata; Sosa Fernandez, Laura Virginia; Vigliar, Elena
2012-01-01
Lymph node reactive hyperplasia, caused by specific infectious etiologic factors, represents the most frequent cause of enlarged peripheral lymph nodes. The main infectious agents are viruses, pyogenic bacteria, mycobacteria, fungi and protozoa that may determine unspecific or specific pathological entities, such as cat-scratch disease, toxoplasmosis or infectious mononucleosis. Lymph node fine needle cytology (FNC) is a safe, simple, cost-effective and efficient technique that quickly provides information about the cell population and the nature of the process. FNC can also provide suitable material for ancillary techniques, such as flow cytometry, immunocytochemistry, molecular biology and microbiological examinations. This study focuses on the cytological features of benign lymphadenopathy of infectious origin and their possible contribution to the clinical setting definition of corresponding patients.
Cho, Sung-Yeon; Lee, Hyeon-Jeong; Lee, Dong-Gun
2018-01-01
Hematopoietic stem cell transplantation (HSCT) is a treatment for hematologic malignancies, immune deficiencies, or genetic diseases, ect. Recently, the number of HSCTs performed in Korea has increased and the outcomes have improved. However, infectious complications account for most of the morbidity and mortality after HSCT. Post-HSCT infectious complications are usually classified according to the time after HSCT: pre-engraftment, immediate post-engraftment, and late post-engraftment period. In addition, the types and risk factors of infectious complications differ according to the stem cell source, donor type, conditioning intensity, region, prophylaxis strategy, and comorbidities, such as graft-versushost disease and invasive fungal infection. In this review, we summarize infectious complications after HSCT, focusing on the Korean perspectives. PMID:29506345
New technologies in predicting, preventing and controlling emerging infectious diseases.
Christaki, Eirini
2015-01-01
Surveillance of emerging infectious diseases is vital for the early identification of public health threats. Emergence of novel infections is linked to human factors such as population density, travel and trade and ecological factors like climate change and agricultural practices. A wealth of new technologies is becoming increasingly available for the rapid molecular identification of pathogens but also for the more accurate monitoring of infectious disease activity. Web-based surveillance tools and epidemic intelligence methods, used by all major public health institutions, are intended to facilitate risk assessment and timely outbreak detection. In this review, we present new methods for regional and global infectious disease surveillance and advances in epidemic modeling aimed to predict and prevent future infectious diseases threats.
New technologies in predicting, preventing and controlling emerging infectious diseases
Christaki, Eirini
2015-01-01
Surveillance of emerging infectious diseases is vital for the early identification of public health threats. Emergence of novel infections is linked to human factors such as population density, travel and trade and ecological factors like climate change and agricultural practices. A wealth of new technologies is becoming increasingly available for the rapid molecular identification of pathogens but also for the more accurate monitoring of infectious disease activity. Web-based surveillance tools and epidemic intelligence methods, used by all major public health institutions, are intended to facilitate risk assessment and timely outbreak detection. In this review, we present new methods for regional and global infectious disease surveillance and advances in epidemic modeling aimed to predict and prevent future infectious diseases threats. PMID:26068569
[Stochastic model of infectious diseases transmission].
Ruiz-Ramírez, Juan; Hernández-Rodríguez, Gabriela Eréndira
2009-01-01
Propose a mathematic model that shows how population structure affects the size of infectious disease epidemics. This study was conducted during 2004 at the University of Colima. It used generalized small-world network topology to represent contacts that occurred within and between families. To that end, two programs in MATLAB were conducted to calculate the efficiency of the network. The development of a program in the C programming language was also required, that represents the stochastic susceptible-infectious-removed model, and simultaneous results were obtained for the number of infected people. An increased number of families connected by meeting sites impacted the size of the infectious diseases by roughly 400%. Population structure influences the rapid spread of infectious diseases, reaching epidemic effects.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-05-08
...; Public Health Service Guideline on Infectious Disease Issues on Xenotransplantation AGENCY: Food and Drug... collection of information entitled ``Public Health Service Guideline on Infectious Disease Issues on... information entitled ``Public Health Service Guideline on Infectious Disease Issues on Xenotransplantation...
ERIC Educational Resources Information Center
Erceg, Linda Ebner
1993-01-01
As a result of new federal regulations, camps are revising procedures for waste disposal from their health centers. Discusses the importance of properly handling infectious material and developing written policies; determining how infectious waste can be incorporated safely into the general waste stream; and arranging for disposal. (LP)
Return to play after infectious mononucleosis.
Becker, Jonathan A; Smith, Julie Anne
2014-05-01
Infectious mononucleosis is a disease primarily of adolescence and early adulthood. The risk of splenic injury and chronic fatigue make return-to-play decisions a challenge for the clinician caring for athletes with infectious mononucleosis. Data were obtained from the PubMed and MEDLINE databases through December 2012 by searching for epidemiology, diagnosis, clinical manifestations, management, and the role of the spleen in infectious mononucleosis. Clinical review. Level 4. Infectious mononucleosis is commonly encountered in young athletes. Its disease pattern is variable and can affect multiple organ systems. Supportive care is the cornerstone, with little role for medications such as corticosteroids. Physical examination is unreliable for the spleen, and ultrasound imaging has limitations in its ability to guide return-to-play decisions. Exercise does not appear to place the young athlete at risk for chronic fatigue, but determining who is at risk for persistent symptoms is a challenge. Return-to-play decisions for the athlete with infectious mononucleosis need to be individualized because of the variable disease course and lack of evidence-based guidelines.
Banerjee, Indranil; Mondal, Somnath; Sen, Sukanta; Tripathi, Santanu Kumar; Banerjee, Gautam
2014-08-01
Antibiotic induced skin rash in setting of infectious mononucleosis is often encountered in clinical practice. However, macrolides like azithromycin are considered relatively safe and till date only two cases of azithromycin induced rash in setting of infectious mononucleosis have been reported. The following report illustrates the case of a 23-year-old man suffering from infectious mononucleosis who exhibited a generalized cutaneous rash following treatment with azithromycin. Using the Naranjo ADR probability scale, this case of acute onset rash following azithromycin administration was found to be in 'probable' category. The mechanism of antibiotic-induced rash in patients suffering from infectious mononucleosis is incompletely understood. It has been suggested that the rash could result from virus mediated immunomodulation or due to altered drug metabolism. The report calls for cautious use of antibiotics in the setting of suspected viral infections like infectious mononucleosis as injudicious use might increase the risk of deleterious skin reactions and increase the cost of healthcare.
Immunogenicity of West Nile virus infectious DNA and its noninfectious derivatives
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seregin, Alexey; Nistler, Ryan; Borisevich, Victoria
2006-12-20
The exceptionally high virulence of the West Nile NY99 strain makes its suitability in the development of a live WN vaccine uncertain. The aim of this study is to investigate the immunogenicity of noninfectious virus derivatives carrying pseudolethal mutations, which preclude virion formation without affecting preceding steps of the viral infectious cycle. When administered using DNA immunization, such constructs initiate an infectious cycle but cannot lead to a viremia. While the magnitude of the immune response to a noninfectious replication-competent construct was lower than that of virus or infectious DNA, its overall quality and the protective effect were similar. Inmore » contrast, a nonreplicating construct of similar length induced only a marginally detectable immune response in the dose range used. Thus, replication-competent noninfectious constructs derived from infectious DNA may offer an advantageous combination of the safety of noninfectious formulations with the quality of the immune response characteristic of infectious vaccines.« less
Comparative Analysis of Gut Microbial Communities in Children under 5 Years Old with Diarrhea.
Wen, Hongyu; Yin, Xin; Yuan, Zhenya; Wang, Xiuying; Su, Siting
2018-04-28
Diarrhea is a global disease with a high morbidity and mortality rate in children. In this study, 25 fecal samples were collected from children under 5 years old. Seven samples had been taken from healthy children without diarrhea and marked as the healthy control group; eight samples had been sampled from children with diarrhea caused by dyspepsia and defined as the non-infectious group; and ten samples had been taken from children with diarrhea induced by intestinal infections and identified as the infectious group. We detected the microbial communities of samples by using high-throughput sequencing of 16S rRNA genes. The proportion of aerobic and facultative anaerobic microbes in samples of the infectious group was much higher than in the non-infectious group. In addition, the relative abundance of Enterococcus in the healthy control group was significantly higher than in the non-infectious group and infectious group. This can be used as a potential diagnostic biomarker for diarrhea.
Jack, David
2003-01-01
At the 13th European Congress of Clinical Microbiology and Infectious Diseases, held in Glasgow, Scotland, May 10-13, 2003, the latest developments in clinical microbiology and the treatment of infectious diseases were presented alongside recent progress on molecular aspects of diagnosis and emerging patterns of infection. Around 5,000 delegates from more than 80 countries attended the congress, which saw the presentation of more than 400 oral communications and 1,700 posters. In addition to a historical session looking at Scotland's own contribution to the control of infectious diseases, the meeting involved up to six parallel sessions a day, looking at all the major aspects of infectious diseases, treatment, surveillance, epidemiology and drug pharmacodynamics and pharmacokinetics. The organizers also organized a Late Breaker symposium on severe acute respiratory syndrome. The topics likely to be of most interest to Drug News and Perspectives readers are described here. (c) 2003 Prous Science. All rights reserved.
Infectious diseases affect marine fisheries and aquaculture economics
Lafferty, Kevin D.; Harvell, C. Drew; Conrad, Jonathan M.; Friedman, Carolyn S.; Kent, Michael L.; Kuris, Armand M.; Powell, Eric N.; Rondeau, Daniel; Saksida, Sonja M.
2015-01-01
Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern.
Sumi, Ayako; Kobayashi, Nobumichi
2017-01-01
In this report, we present a short review of applications of time series analysis, which consists of spectral analysis based on the maximum entropy method in the frequency domain and the least squares method in the time domain, to the incidence data of infectious diseases. This report consists of three parts. First, we present our results obtained by collaborative research on infectious disease epidemics with Chinese, Indian, Filipino and North European research organizations. Second, we present the results obtained with the Japanese infectious disease surveillance data and the time series numerically generated from a mathematical model, called the susceptible/exposed/infectious/recovered (SEIR) model. Third, we present an application of the time series analysis to pathologic tissues to examine the usefulness of time series analysis for investigating the spatial pattern of pathologic tissue. It is anticipated that time series analysis will become a useful tool for investigating not only infectious disease surveillance data but also immunological and genetic tests.
Infectious Diseases, Urbanization and Climate Change: Challenges in Future China.
Tong, Michael Xiaoliang; Hansen, Alana; Hanson-Easey, Scott; Cameron, Scott; Xiang, Jianjun; Liu, Qiyong; Sun, Yehuan; Weinstein, Philip; Han, Gil-Soo; Williams, Craig; Bi, Peng
2015-09-07
China is one of the largest countries in the world with nearly 20% of the world's population. There have been significant improvements in economy, education and technology over the last three decades. Due to substantial investments from all levels of government, the public health system in China has been improved since the 2003 severe acute respiratory syndrome (SARS) outbreak. However, infectious diseases still remain a major population health issue and this may be exacerbated by rapid urbanization and unprecedented impacts of climate change. This commentary aims to explore China's current capacity to manage infectious diseases which impair population health. It discusses the existing disease surveillance system and underscores the critical importance of strengthening the system. It also explores how the growing migrant population, dramatic changes in the natural landscape following rapid urbanization, and changing climatic conditions can contribute to the emergence and re-emergence of infectious disease. Continuing research on infectious diseases, urbanization and climate change may inform the country's capacity to deal with emerging and re-emerging infectious diseases in the future.
Huff, Andrew G; Breit, Nathan; Allen, Toph; Whiting, Karissa; Kiley, Christopher
2016-01-01
The Global Rapid Identification of Threats System (GRITS) is a biosurveillance application that enables infectious disease analysts to monitor nontraditional information sources (e.g., social media, online news outlets, ProMED-mail reports, and blogs) for infectious disease threats. GRITS analyzes these textual data sources by identifying, extracting, and succinctly visualizing epidemiologic information and suggests potentially associated infectious diseases. This manuscript evaluates and verifies the diagnoses that GRITS performs and discusses novel aspects of the software package. Via GRITS' web interface, infectious disease analysts can examine dynamic visualizations of GRITS' analyses and explore historical infectious disease emergence events. The GRITS API can be used to continuously analyze information feeds, and the API enables GRITS technology to be easily incorporated into other biosurveillance systems. GRITS is a flexible tool that can be modified to conduct sophisticated medical report triaging, expanded to include customized alert systems, and tailored to address other biosurveillance needs.
Breit, Nathan
2016-01-01
The Global Rapid Identification of Threats System (GRITS) is a biosurveillance application that enables infectious disease analysts to monitor nontraditional information sources (e.g., social media, online news outlets, ProMED-mail reports, and blogs) for infectious disease threats. GRITS analyzes these textual data sources by identifying, extracting, and succinctly visualizing epidemiologic information and suggests potentially associated infectious diseases. This manuscript evaluates and verifies the diagnoses that GRITS performs and discusses novel aspects of the software package. Via GRITS' web interface, infectious disease analysts can examine dynamic visualizations of GRITS' analyses and explore historical infectious disease emergence events. The GRITS API can be used to continuously analyze information feeds, and the API enables GRITS technology to be easily incorporated into other biosurveillance systems. GRITS is a flexible tool that can be modified to conduct sophisticated medical report triaging, expanded to include customized alert systems, and tailored to address other biosurveillance needs. PMID:27698665
The ecology of climate change and infectious diseases
Lafferty, Kevin D.
2009-01-01
The projected global increase in the distribution and prevalence of infectious diseases with climate change suggests a pending societal crisis. The subject is increasingly attracting the attention of health professionals and climate-change scientists, particularly with respect to malaria and other vector-transmitted human diseases. The result has been the emergence of a crisis discipline, reminiscent of the early phases of conservation biology. Latitudinal, altitudinal, seasonal, and interannual associations between climate and disease along with historical and experimental evidence suggest that climate, along with many other factors, can affect infectious diseases in a nonlinear fashion. However, although the globe is significantly warmer than it was a century ago, there is little evidence that climate change has already favored infectious diseases. While initial projections suggested dramatic future increases in the geographic range of infectious diseases, recent models predict range shifts in disease distributions, with little net increase in area. Many factors can affect infectious disease, and some may overshadow the effects of climate.
Clinical laboratory waste management in Shiraz, Iran.
Askarian, Mehrdad; Motazedian, Nasrin; Palenik, Charles John
2012-06-01
Clinical laboratories are significant generators of infectious waste, including microbiological materials, contaminated sharps, and pathologic wastes such as blood specimens and blood products. Most waste produced in laboratories can be disposed of in the general solid waste stream. However, improper management of infectious waste, including mixing general wastes with infectious wastes and improper handling or storage, could lead to disease transmission. The aim of this study was to assess waste management processes used at clinical laboratories in Shiraz, Iran. One hundred and nine clinical laboratories participated In this cross sectional study, Data collection was by questionnaire and direct observation. Of the total amount of waste generated, 52% (by weight) was noninfectious domestic waste, 43% was non-sharps infectious waste and 5% consisted of sharps. There was no significant relationship between laboratory staff or manager education and the score for quality of waste collection and disposal at clinical laboratories. Improvements in infectious waste management processes should involve clearer, more uniformly accepted definitions of infectious waste and increased staff training.
Infectious Diseases Affect Marine Fisheries and Aquaculture Economics
NASA Astrophysics Data System (ADS)
Lafferty, Kevin D.; Harvell, C. Drew; Conrad, Jon M.; Friedman, Carolyn S.; Kent, Michael L.; Kuris, Armand M.; Powell, Eric N.; Rondeau, Daniel; Saksida, Sonja M.
2015-01-01
Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern.
Infectious diseases affect marine fisheries and aquaculture economics.
Lafferty, Kevin D; Harvell, C Drew; Conrad, Jon M; Friedman, Carolyn S; Kent, Michael L; Kuris, Armand M; Powell, Eric N; Rondeau, Daniel; Saksida, Sonja M
2015-01-01
Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern.
Mondal, Somnath; Sen, Sukanta; Tripathi, Santanu Kumar; Banerjee, Gautam
2014-01-01
Antibiotic induced skin rash in setting of infectious mononucleosis is often encountered in clinical practice. However, macrolides like azithromycin are considered relatively safe and till date only two cases of azithromycin induced rash in setting of infectious mononucleosis have been reported. The following report illustrates the case of a 23-year-old man suffering from infectious mononucleosis who exhibited a generalized cutaneous rash following treatment with azithromycin. Using the Naranjo ADR probability scale, this case of acute onset rash following azithromycin administration was found to be in ‘probable’ category. The mechanism of antibiotic-induced rash in patients suffering from infectious mononucleosis is incompletely understood. It has been suggested that the rash could result from virus mediated immunomodulation or due to altered drug metabolism. The report calls for cautious use of antibiotics in the setting of suspected viral infections like infectious mononucleosis as injudicious use might increase the risk of deleterious skin reactions and increase the cost of healthcare. PMID:25302218
Global biogeography of human infectious diseases.
Murray, Kris A; Preston, Nicholas; Allen, Toph; Zambrana-Torrelio, Carlos; Hosseini, Parviez R; Daszak, Peter
2015-10-13
The distributions of most infectious agents causing disease in humans are poorly resolved or unknown. However, poorly known and unknown agents contribute to the global burden of disease and will underlie many future disease risks. Existing patterns of infectious disease co-occurrence could thus play a critical role in resolving or anticipating current and future disease threats. We analyzed the global occurrence patterns of 187 human infectious diseases across 225 countries and seven epidemiological classes (human-specific, zoonotic, vector-borne, non-vector-borne, bacterial, viral, and parasitic) to show that human infectious diseases exhibit distinct spatial grouping patterns at a global scale. We demonstrate, using outbreaks of Ebola virus as a test case, that this spatial structuring provides an untapped source of prior information that could be used to tighten the focus of a range of health-related research and management activities at early stages or in data-poor settings, including disease surveillance, outbreak responses, or optimizing pathogen discovery. In examining the correlates of these spatial patterns, among a range of geographic, epidemiological, environmental, and social factors, mammalian biodiversity was the strongest predictor of infectious disease co-occurrence overall and for six of the seven disease classes examined, giving rise to a striking congruence between global pathogeographic and "Wallacean" zoogeographic patterns. This clear biogeographic signal suggests that infectious disease assemblages remain fundamentally constrained in their distributions by ecological barriers to dispersal or establishment, despite the homogenizing forces of globalization. Pathogeography thus provides an overarching context in which other factors promoting infectious disease emergence and spread are set.
Liu, Shuanghu; Nelson, Cassie A; Xiao, Li; Lu, Ling; Seth, Punit P; Davis, Darrell R; Hagedorn, Curt H
2011-01-01
Major progress has been made in developing infectious HCV cell culture systems and these systems have been useful in identifying novel HCV antivirals. However, more rapid and sensitive assays using infectious cell based HCV systems would facilitate the development of additional antivirals, including small molecules directed at unique targets such as the HCV RNA internal ribosomal entry site (IRES). We have found that the V3 region (28 aa) of NS5A of HCV JFH1 can be deleted from the genome with only modest effects on the titer of infectious virus produced in cell culture. Moreover, the V3 region can be replaced with the Renilla reniformis luciferase (Rluc) gene resulting in an infectious virus that stably expresses an NS5A-Rluc fusion protein. Infected cells cultured in 96-well plates provided a robust luciferase signal that accurately reflected the production of infectious virus. This infectious HCV reporter system was used to test the activity of three benzimidazole compounds that bind the HCV RNA IRES. Compounds in this chemical class of small molecules bind and alter the IRES RNA structure at low to sub-micromolar concentrations and interfere with viral replication. The current study shows that these compounds inhibit HCV replication in an infectious HCV cell culture system, defines their IC(50) in this system, and provides a platform for the rapid testing of next generation inhibitors. Copyright © 2010 Elsevier B.V. All rights reserved.
Liu, Shuanghu; Nelson, Cassie A.; Xiao, Li; Lu, Ling; Seth, Punit P.; Davis, Darrell R.; Hagedorn, Curt H.
2010-01-01
Major progress has been made in developing infectious HCV cell culture systems and these systems have been useful in identifying novel HCV antivirals. However, more rapid and sensitive assays using infectious cell based HCV systems would facilitate the development of additional antivirals, including small molecules directed at unique targets such as the HCV RNA internal ribosomal entry site (IRES). We have found that the V3 region (28 aa) of NS5A of HCV JFH1 can be deleted from the genome with only modest effects on the titer of infectious virus produced in cell culture. Moreover, the V3 region can be replaced with the Renilla reniformis luciferase (Rluc) gene resulting in an infectious virus that stably expresses an NS5A-Rluc fusion protein. Infected cells cultured in 96-well plates provided a robust luciferase signal that accurately reflected the production of infectious virus. This infectious HCV reporter system was used to test the activity of three benzimidazole compounds that bind the HCV RNA IRES. Compounds in this chemical class of small molecules bind and alter the IRES RNA structure at low to sub-micromolar concentrations and interfere with viral replication. The current study shows that these compounds inhibit HCV replication in an infectious HCV cell culture system, defines their IC50 in this system, and provides a platform for the rapid testing of next generation inhibitors. PMID:21075143
On the 2-Row Rule for Infectious Disease Transmission on Aircraft.
Hertzberg, Vicki Stover; Weiss, Howard
With over two billion airline passengers annually, in-flight transmission of infectious diseases is an important global health concern. Many instances of in-flight transmission have been documented, but the relative influence of the many factors (see below) affecting in-flight transmission has not been quantified. Long-standing guidance by public health agencies is that the primary transmission risk associated with air travel for most respiratory infectious diseases is associated with sitting within two rows of an infectious passenger. The effect of proximity may be one of these factors. The aim of this study was to determine the risk of infection within and beyond the 2-row rule given by public health guidance. We searched the literature for reports of in-flight transmission of infection which included seat maps indicating where the infectious and infected passengers were seated. There is a ∼ 6% risk to passengers seated within the 2-rows of infected individual(s) and there is ∼ 2% risk to passengers seated beyond 2-rows from the infectious individual. Contact tracing limited to passengers within 2-rows of the infectious individual(s) could fail to detect other cases of infections. This has important consequences for assessing the spread of infectious diseases. Infection at a distance from the index case indicates other factors, such as airflow, movement of passenger/crew members, fomites and contacts between passengers in the departure gate before boarding, or after deplaning, are involved. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Flannery, J; Rajko-Nenow, P; Winterbourn, J B; Malham, S K; Jones, D L
2014-08-01
The aim of this study was to determine if domestic cooking practices can reduce concentrations of norovirus (NoV) and F-specific RNA (FRNA) bacteriophage in experimentally contaminated mussels. Mussels (n = 600) contaminated with NoV and FRNA bacteriophage underwent four different cooking experiments performed in triplicate at ~70°C and >90°C. Concentrations of infectious FRNA bacteriophage (using a plaque assay) were compared with concentrations of FRNA bacteriophage and NoV determined using a standardised RT-qPCR. Initial concentrations of infectious FRNA bacteriophage (7·05 log10 PFU g(-1) ) in mussels were not significantly reduced in simmering water (~70°C); however, cooking at higher temperatures (>90°C) reduced infectious FRNA bacteriophage to undetected levels within 3 min. Further investigation determined the time required for a 1-log reduction of infectious FRNA bacteriophage at 90°C to be 42 s therefore a >3-log reduction in infectious virus can be obtained by heating mussel digestive tissue to 90°C for 126 s. Domestic cooking practices based on shell opening alone do not inactivate infectious virus in mussels, however, cooking mussels at high temperatures is effective to reduce infectious virus concentrations and the risk of illness in consumers. The data will contribute towards evidence-based cooking recommendations for shellfish to provide a safe product for human consumption. © 2014 The Society for Applied Microbiology.
76 FR 7573 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-02-10
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal..., Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research...
77 FR 25487 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-04-30
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal..., Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research...
77 FR 10540 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-22
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal.... 93.855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious...
75 FR 19408 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-04-14
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal..., Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National...
77 FR 42503 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-07-19
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal....855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases...
75 FR 15712 - National Institute of Allergy and Infectious Diseases; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-30
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meeting Pursuant to section 10(a) of the Federal Advisory....855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases...
77 FR 76058 - National Institute of Allergy and Infectious Diseases; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-12-26
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meeting Pursuant to section 10(a) of the Federal Advisory....855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases...
75 FR 76478 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-12-08
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(a) of the Federal Advisory... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
75 FR 49942 - National Institute of Allergy and Infectious Diseases; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-16
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meeting Pursuant to section 10(a) of the Federal Advisory..., Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research...
78 FR 78982 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-27
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(a) of the Federal Advisory... ransplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
77 FR 19677 - National Institute of Allergy and Infectious Diseases; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-04-02
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meeting Pursuant to section 10(a) of the Federal Advisory... Transplantation Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health...
78 FR 27409 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-05-10
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... Infectious Diseases Special Emphasis Panel; NIAID Centers of Excellence [[Page 27410
Understanding the role of ORF-C gene in the pathogenicity of infectious laryngotracheitis virus
USDA-ARS?s Scientific Manuscript database
Infectious laryngotracheitis (ILT) is a very serious and widespread respiratory disease of chickens caused by infectious laryngotracheitis virus (ILTV). Conventional attenuated ILT vaccines, obtained by continuous passages in chicken embryos and tissue culture, had been the main tools utilized by th...
Wang, Li Jun; Du, Xiao Qin; Nyirimigabo, Eric; Shou, Song Tao
2014-04-01
It is rare to see a concurrent infection with infectious mononucleosis and community-associated methicillin-resistant Staphylococcus aureus in Tianjin, China. Until now, there is still no any single recorded case of concurrent infectious mononucleosis and community-associated methicillin-resistant Staphylococcus aureus bacteremia.
An Interdisciplinary Perspective: Infectious Diseases and History.
ERIC Educational Resources Information Center
Turco, Jenifer; Byrd, Melanie
2001-01-01
Introduces the course "Infectious Diseases and History" which is designed for freshman and sophomore students. Aims to teach about infectious diseases, develop skills of using libraries and computer resources, and develop oral and written communication skills. Focuses on tuberculosis as an example of an instructional approach and…
Perspectives and research challenges in veterinary infectious diseases
USDA-ARS?s Scientific Manuscript database
The Veterinary Infectious Disease specialty section seeks to become an outlet for veterinary research into infectious diseases through the study of the pathogen or its host or the host's environment or by addressing combinations of these aspects of the disease system. We vision research in this are...
75 FR 3472 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-01-21
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology and Infectious Diseases B Subcommittee. Date: February 11-12... Assistance Program Nos. 93.855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and...
75 FR 26760 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-12
... clearly unwarranted invasion of personal privacy. Name of Committee: Microbiology, Infectious Diseases and AIDS Initial Review Group; Microbiology and Infectious Diseases Research Committee. Date: June 17, 2010... Assistance Program Nos. 93.855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and...
Evolutionary Response to Human Infectious Diseases
ERIC Educational Resources Information Center
Armelagos, George J.; Dewey, John R.
1970-01-01
Gives an overview of human history, relating cultural changes with resulting changes in population density and in ecological balance to patterns of infectious diseases in man. Discusses mechanisms of evolution of resistance. Suggests that in populations where infectious diseases can be controlled, attention should shift to degenerative diseases…
28 CFR 549.13 - Programming, duty, and housing restrictions.
Code of Federal Regulations, 2013 CFR
2013-07-01
... INSTITUTIONAL MANAGEMENT MEDICAL SERVICES Infectious Disease Management § 549.13 Programming, duty, and housing restrictions. (a) The CD will assess any inmate with an infectious disease for appropriateness for programming, duty, and housing. Inmates with infectious diseases that are transmitted through casual contact will be...
28 CFR 549.13 - Programming, duty, and housing restrictions.
Code of Federal Regulations, 2012 CFR
2012-07-01
... INSTITUTIONAL MANAGEMENT MEDICAL SERVICES Infectious Disease Management § 549.13 Programming, duty, and housing restrictions. (a) The CD will assess any inmate with an infectious disease for appropriateness for programming, duty, and housing. Inmates with infectious diseases that are transmitted through casual contact will be...
28 CFR 549.13 - Programming, duty, and housing restrictions.
Code of Federal Regulations, 2014 CFR
2014-07-01
... INSTITUTIONAL MANAGEMENT MEDICAL SERVICES Infectious Disease Management § 549.13 Programming, duty, and housing restrictions. (a) The CD will assess any inmate with an infectious disease for appropriateness for programming, duty, and housing. Inmates with infectious diseases that are transmitted through casual contact will be...
42 CFR 482.27 - Condition of participation: Laboratory services.
Code of Federal Regulations, 2012 CFR
2012-10-01
... infectious blood and blood components—(1) Potentially human immunodeficiency virus (HIV) infectious blood and blood components. Potentially HIV infectious blood and blood components are prior collections from a donor— (i) Who tested negative at the time of donation but tests reactive for evidence of HIV infection...
42 CFR 482.27 - Condition of participation: Laboratory services.
Code of Federal Regulations, 2010 CFR
2010-10-01
... infectious blood and blood components—(1) Potentially human immunodeficiency virus (HIV) infectious blood and blood components. Potentially HIV infectious blood and blood components are prior collections from a donor— (i) Who tested negative at the time of donation but tests reactive for evidence of HIV infection...
42 CFR 482.27 - Condition of participation: Laboratory services.
Code of Federal Regulations, 2013 CFR
2013-10-01
... infectious blood and blood components—(1) Potentially human immunodeficiency virus (HIV) infectious blood and blood components. Potentially HIV infectious blood and blood components are prior collections from a donor— (i) Who tested negative at the time of donation but tests reactive for evidence of HIV infection...
42 CFR 482.27 - Condition of participation: Laboratory services.
Code of Federal Regulations, 2014 CFR
2014-10-01
... infectious blood and blood components—(1) Potentially human immunodeficiency virus (HIV) infectious blood and blood components. Potentially HIV infectious blood and blood components are prior collections from a donor— (i) Who tested negative at the time of donation but tests reactive for evidence of HIV infection...
42 CFR 482.27 - Condition of participation: Laboratory services.
Code of Federal Regulations, 2011 CFR
2011-10-01
... infectious blood and blood components—(1) Potentially human immunodeficiency virus (HIV) infectious blood and blood components. Potentially HIV infectious blood and blood components are prior collections from a donor— (i) Who tested negative at the time of donation but tests reactive for evidence of HIV infection...
The use of secondary metabolite profiling in chemotaxonomy of filamentous fungi.
Frisvad, Jens C; Andersen, Birgitte; Thrane, Ulf
2008-02-01
A secondary metabolite is a chemical compound produced by a limited number of fungal species in a genus, an order, or even phylum. A profile of secondary metabolites consists of all the different compounds a fungus can produce on a given substratum and includes toxins, antibiotics and other outward-directed compounds. Chemotaxonomy is traditionally restricted to comprise fatty acids, proteins, carbohydrates, or secondary metabolites, but has sometimes been defined so broadly that it also includes DNA sequences. It is not yet possible to use secondary metabolites in phylogeny, because of the inconsistent distribution throughout the fungal kingdom. However, this is the very quality that makes secondary metabolites so useful in classification and identification. Four groups of organisms are particularly good producers of secondary metabolites: plants, fungi, lichen fungi, and actinomycetes, whereas yeasts, protozoa, and animals are less efficient producers. Therefore, secondary metabolites have mostly been used in plant and fungal taxonomy, whereas chemotaxonomy has been neglected in bacteriology. Lichen chemotaxonomy has been based on few biosynthetic families (chemosyndromes), whereas filamentous fungi have been analysed for a wide array of terpenes, polyketides, non-ribosomal peptides, and combinations of these. Fungal chemotaxonomy based on secondary metabolites has been used successfully in large ascomycete genera such as Alternaria, Aspergillus, Fusarium, Hypoxylon, Penicillium, Stachybotrys, Xylaria and in few basidiomycete genera, but not in Zygomycota and Chytridiomycota.
Milićević, Dragan R.; Škrinjar, Marija; Baltić, Tatjana
2010-01-01
Mycotoxins are toxic compounds, produced by the secondary metabolism of toxigenic moulds in the Aspergillus, Alternaria, Claviceps, Fusarium, Penicillium and Stachybotrys genera occurring in food and feed commodities both pre- and post-harvest. Adverse human health effects from the consumption of mycotoxins have occurred for many centuries. When ingested, mycotoxins may cause a mycotoxicosis which can result in an acute or chronic disease episode. Chronic conditions have a much greater impact, numerically, on human health in general, and induce diverse and powerful toxic effects in test systems: some are carcinogenic, mutagenic, teratogenic, estrogenic, hemorrhagic, immunotoxic, nephrotoxic, hepatotoxic, dermotoxic and neurotoxic. Although mycotoxin contamination of agricultural products still occurs in the developed world, the application of modern agricultural practices and the presence of a legislatively regulated food processing and marketing system have greatly reduced mycotoxin exposure in these populations. However, in developing countries, where climatic and crop storage conditions are frequently conducive to fungal growth and mycotoxin production, much of the population relies on subsistence farming or on unregulated local markets. Therefore both producers and governmental control authorities are directing their efforts toward the implementation of a correct and reliable evaluation of the real status of contamination of a lot of food commodity and, consequently, of the impact of mycotoxins on human and animal health. PMID:22069600
Dalmont, Kelsey; Biles, Charles L; Konsure, Heather; Dahal, Sujita; Rowsey, Tyler; Broge, Matthew; Poudyal, Shubhra; Gurung, Tara; Shrestha, Sabina; Biles, Caleb L; Cluck, Terry; Howard, Alisha
2017-12-01
Indoor mold due to water damage causes serious human respiratory disorders, and the remediation to homes, schools, and businesses is a major expense. Prevention of mold infestation of building materials would reduce health problems and building remediation costs. Nonsteroidal anti-inflammatory drugs (NSAIDs) inhibit yeasts and a limited number of filamentous fungi. The purpose of this research was to determine the possible inhibitory activity of nonsteroidal anti-inflammatory drugs (NSAIDs) on germination, fungal growth, and reproduction of Chaetomium globosum and other important filamentous fungi that occur in water-damaged buildings. Several NSAIDs were found to inhibit C. globosum germination, growth, and reproduction. The most effective NSAIDs inhibiting C. globosum were ibuprofen, diflunisal, and diclofenac. Fusarium oxysporum, Fusarium solani, Aspergillus niger, and Stachybotrys atra were also tested on the various media with similar results obtained. However, F. oxysporum and A. niger exhibited a higher level of resistance to aspirin and NaSAL when compared to the C. globosum isolates. The inhibition exhibited by NSAIDs was variable depending on growth media and stage of fungal development. These compounds have a great potential of inhibiting fungal growth on building materials such as gypsum board. Formulations of sprays or building materials with NSAID-like chemical treatments may hold promise in reducing mold in homes and buildings.
Bioconversion of straw into improved fodder: fungal flora decomposing rice straw.
Helal, G A
2005-09-01
The fungal flora decomposing rice straw were investigated all over the soil of Sharkia Province, east of Nile Delta, Egypt, using the nylon net bag technique. Sixty-four straw-decomposing species belonging to 30 genera were isolated by the dilution plate method in ground rice straw-Czapek's agar medium at pH 6. The plates were incubated separately at 5℃, 25℃ and 45℃, respectively. Twenty nine species belonging to 14 genera were isolated at 5℃. The most frequent genus was Penicillium (seven species), and the next frequent genera were Acremonium (three species), Fusarium (three species), Alternaria, Chaetomium, Cladosporium, Mucor, Stachybotrys (two species) and Rhizopus stolonifer. At 25℃, 47 species belonging to 24 genera were isolated. The most frequent genus was Aspergillus (nine species), and the next frequent genera were ranked by Penicillium (five species), Chaetomium (three species), Fusarium (three species). Each of Alternaria, Cladosporium, Mucor, Myrothecium and Trichoderma was represented by two species. At 45℃, 15 species belonging to seven genera were isolated. These were seven species of Aspergillus, two species of Chaetomium and two species of Emericella, while Humicola, Malbranchea, Rhizomucor and Talaromyces were represented by one species respectively. The total counts of fungi the genera, and species per gram of dry straw were significantly affected by incubation temperature and soil analysis (P < 0.05).
[Fatal course of acute appendicitis associated with infectious mononucleosis].
Spelde, A G; Ruys, G J; Steffelaar, J W; Bakker, N C
1992-07-25
The case history is presented of a 10-year-old boy with a fatal combination of acute appendicitis and infectious mononucleosis, in the literature a particularly rare combination. The boy died of a perforative peritonitis. His appendicitis appeared not to be a complication of the infectious mononucleosis.
Report of the Committee on Infectious Diseases. Twenty-first Edition, 1988.
ERIC Educational Resources Information Center
American Academy of Pediatrics, Elk Grove Village, IL.
This book is a comprehensive textbook of infectious diseases. It is organized in five parts: (1) active and passive immunization; (2) recommendations for care of children in special circumstances; (3) summaries of infectious diseases; (4) antimicrobial prophylaxis; and (5) antimicrobials. There are six appendices: (1) federal vaccine injury…
78 FR 21961 - National Institute of Allergy And Infectious Diseases; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-12
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy And Infectious Diseases; Notice of Meeting Pursuant to section 10(a) of the Federal Advisory... Infectious Diseases Research, National Institutes of Health, HHS) Dated: April 8, 2013. David Clary, Program...
77 FR 74674 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2012-12-17
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(a) of the Federal Advisory..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: December 10, 2012...
76 FR 75888 - National Institute of Allergy and Infectious Diseases; Notice of Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-05
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meetings Pursuant to section 10(a) of the Federal Advisory..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: November 29, 2011...
76 FR 3919 - National Institute of Allergy and Infectious Diseases; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-21
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meeting Pursuant to section 10(a) of the Federal Advisory... Research; 93.856, Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated...
76 FR 75887 - National Institute of Allergy and Infectious Diseases; Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-05
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Notice of Meeting Pursuant to section 10(a) of the Federal Advisory..., Microbiology and Infectious Diseases Research, National Institutes of Health, HHS) Dated: November 29, 2011...
76 FR 81954 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-29
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and... of Committee: National Institute of Allergy and Infectious Diseases Special Emphasis Panel...
78 FR 63998 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-25
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and....855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases...
78 FR 63999 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-25
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and...: National Institute of Allergy and Infectious Diseases Special Emphasis Panel; Mechanisms of Cellular...
76 FR 35224 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-06-16
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and..., [email protected] . Name of Committee: National Institute of Allergy and Infectious Diseases Special...
78 FR 76847 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-19
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and...: National Institute of Allergy and Infectious Diseases Special Emphasis Panel; Limited Competition...
75 FR 7487 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-19
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy [email protected] . Name of Committee: National Institute of Allergy and Infectious Diseases Special...
78 FR 65344 - National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-31
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting Notice is hereby given of a change in the meeting of the National Institute of Allergy and Infectious Diseases Special Emphasis Panel, October 30...
78 FR 26644 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2013-05-07
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and..., [email protected] . Name of Committee: National Institute of Allergy and Infectious Diseases Special...
75 FR 7486 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-19
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... Allergy and Infectious Diseases Special Emphasis Panel, System Biology Approaches to HIV Infection. Date... Federal Domestic Assistance Program Nos. 93.855, Allergy, Immunology, and Transplantation Research; 93.856...
75 FR 7488 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-19
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and...: National Institute of Allergy and Infectious Diseases Special Emphasis Panel, NIAID Product Development...
76 FR 53688 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-29
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and..., [email protected] . Name of Committee: National Institute of Allergy and Infectious Diseases Special...
78 FR 65343 - National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-31
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting Notice is hereby given of a change in the meeting of the National Institute of Allergy and Infectious Diseases Special Emphasis Panel, October 15...
77 FR 298 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-04
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and.... 93.855, Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious...
78 FR 65348 - National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-31
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting Notice is hereby given of a change in the meeting of the National Institute of Allergy and Infectious Diseases Special Emphasis Panel, October 31...
78 FR 64962 - National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-30
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting Notice is hereby given of a change in the meeting of the National Institute of Allergy and Infectious Diseases Special Emphasis Panel, October 21...
76 FR 53691 - National Institute of Allergy and Infectious Diseases Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-29
... Allergy and Infectious Diseases Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and..., [email protected] . Name of Committee: National Institute of Allergy and Infectious Diseases Special...
78 FR 64964 - National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2013-10-30
... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Allergy and Infectious Diseases; Amended Notice of Meeting Notice is hereby given of a change in the meeting of the National Institute of Allergy and Infectious Diseases Special Emphasis Panel, October 23...
77 FR 5035 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-01
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and..., Allergy, Immunology, and Transplantation Research; 93.856, Microbiology and Infectious Diseases Research...
75 FR 156 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-01-04
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and... and funding cycle. Name of Committee: National Institute of Allergy and Infectious Diseases Special...
77 FR 297 - National Institute of Allergy And Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-04
... Allergy And Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and...-7098, [email protected] . Name of Committee: National Institute of Allergy and Infectious Diseases...
77 FR 20645 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2012-04-05
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and...-496-7042, [email protected] . Name of Committee: National Institute of Allergy and Infectious...
Infectious Diseases in Day Care.
ERIC Educational Resources Information Center
Sleator, Esther K.
Discussed in this publication are infectious illnesses for which children attending day care appear to be at special risk. Also covered are the common cold, some infectious disease problems receiving media attention, and some other annoying but not serious diseases, such as head lice, pinworms, and contagious skin conditions. Causes,…
Atypical pyoderma gangrenosum mimicking an infectious process.
To, Derek; Wong, Aaron; Montessori, Valentina
2014-01-01
We present a patient with atypical pyoderma gangrenosum (APG), which involved the patient's arm and hand. Hemorrhagic bullae and progressive ulcerations were initially thought to be secondary to an infectious process, but a biopsy revealed PG. Awareness of APG by infectious disease services may prevent unnecessary use of broad-spectrum antibiotics.
76 FR 13649 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-03-14
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and Infectious Diseases Special Emphasis Panel; Martin Delaney Collaboratory: Towards an HIV-1 Cure. Date: April...
75 FR 4091 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-01-26
... Allergy and Infectious Diseases; Notice of Closed Meeting Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and Infectious Diseases Special Emphasis Panel; Partnerships in Biodefense Food and Waterborne Diseases. Date...
75 FR 993 - National Institute of Allergy and Infectious Diseases; Notice of Closed Meetings
Federal Register 2010, 2011, 2012, 2013, 2014
2010-01-07
... Allergy and Infectious Diseases; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Allergy and Infectious Diseases Special Emphasis Panel, Partnerships in Biodefense Food and Waterborne Diseases. Date...